#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA2	20	ucsc.edu;bcgsc.ca	37	9	139911383	139911383	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:139911383G>A	ENST00000371605.3	-	18	2891	c.2744C>T	c.(2743-2745)gCt>gTt	p.A915V	ABCA2_ENST00000492260.1_5'Flank|ABCA2_ENST00000341511.6_Missense_Mutation_p.A916V|ABCA2_ENST00000265662.5_Missense_Mutation_p.A916V			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	915					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TGGGTGCACAGCCTCAATGTA	0.637																																					p.A946V		.											.	ABCA2	90	0			c.C2837T						.						43.0	46.0	45.0					9																	139911383		2060	4200	6260	SO:0001583	missense	20	exon19			TGCACAGCCTCAA	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.2744C>T	9.37:g.139911383G>A	ENSP00000360666:p.Ala915Val	49.0	0.0		30.0	4.0	NM_212533	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	ENST00000371605.3	37		.	.	.	.	.	.	.	.	.	.	G	16.10	3.027889	0.54790	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	T;T;T	0.77877	-1.13;-1.13;-1.13	3.27	3.27	0.37495	.	0.062472	0.64402	U	0.000005	D	0.86560	0.5962	M	0.81614	2.55	0.58432	D	0.999998	D;D	0.69078	0.996;0.997	P;D	0.65010	0.906;0.931	D	0.88185	0.2873	10	0.51188	T	0.08	.	14.6818	0.69023	0.0:0.0:1.0:0.0	.	915;946	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	V	916;915;946;916	ENSP00000265662:A916V;ENSP00000360666:A915V;ENSP00000344155:A916V	ENSP00000265662:A916V	A	-	2	0	ABCA2	139031204	1.000000	0.71417	0.985000	0.45067	0.189000	0.23516	7.323000	0.79105	1.658000	0.50742	0.313000	0.20887	GCT	.		0.637	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		NM_001606	
ABCA3	21	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2339468	2339468	+	Silent	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:2339468C>T	ENST00000301732.5	-	20	3367	c.2667G>A	c.(2665-2667)gaG>gaA	p.E889E	ABCA3_ENST00000382381.3_Silent_p.E831E	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	889					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	TGCGCTCCTCCTCGATGAGGG	0.677																																					p.E889E		.											.	ABCA3	1015	0			c.G2667A						.						29.0	27.0	28.0					16																	2339468		2195	4298	6493	SO:0001819	synonymous_variant	21	exon20			CTCCTCCTCGATG	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2667G>A	16.37:g.2339468C>T		110.0	0.0		67.0	16.0	NM_001089	B2RU09|Q54A95|Q6P5P9|Q92473	Silent	SNP	ENST00000301732.5	37	CCDS10466.1																																																																																			.		0.677	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	
ABCA9	10350	hgsc.bcm.edu;bcgsc.ca	37	17	67017907	67017907	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:67017907C>T	ENST00000340001.4	-	18	2588	c.2377G>A	c.(2377-2379)Gga>Aga	p.G793R	ABCA9_ENST00000370732.2_Missense_Mutation_p.G793R|ABCA9_ENST00000453985.2_Missense_Mutation_p.G793R	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	793					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					GTTGATTTTCCTTCTAATTTC	0.338																																					p.G793R		.											.	ABCA9	95	0			c.G2377A						.						89.0	88.0	89.0					17																	67017907		2202	4295	6497	SO:0001583	missense	10350	exon18			ATTTTCCTTCTAA	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.2377G>A	17.37:g.67017907C>T	ENSP00000342216:p.Gly793Arg	62.0	0.0		57.0	4.0	NM_080283	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	37	CCDS11681.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.031549	0.75504	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	D;D	0.82619	-1.63;-1.63	5.12	4.15	0.48705	.	0.000000	0.47455	D	0.000223	D	0.89451	0.6719	M	0.70595	2.14	0.40094	D	0.97628	D;D	0.89917	1.0;0.982	D;D	0.87578	0.998;0.942	D	0.90222	0.4272	10	0.59425	D	0.04	.	12.4951	0.55923	0.0:0.9178:0.0:0.0822	.	793;793	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	R	793;776;793;788	ENSP00000342216:G793R;ENSP00000359767:G793R	ENSP00000342216:G793R	G	-	1	0	ABCA9	64529502	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.584000	0.60971	1.300000	0.44818	0.603000	0.83216	GGA	.		0.338	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386	
ABCC2	1244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	101567952	101567952	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr10:101567952G>A	ENST00000370449.4	+	13	1894	c.1781G>A	c.(1780-1782)aGc>aAc	p.S594N		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	594	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	TTTCCCCTGAGCATGCTTCCC	0.473																																					p.S594N		.											.	ABCC2	91	0			c.G1781A						.						241.0	210.0	221.0					10																	101567952		2203	4300	6503	SO:0001583	missense	1244	exon13			CCCTGAGCATGCT	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.1781G>A	10.37:g.101567952G>A	ENSP00000359478:p.Ser594Asn	160.0	0.0		115.0	39.0	NM_000392	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	37	CCDS7484.1	.	.	.	.	.	.	.	.	.	.	G	2.621	-0.288648	0.05605	.	.	ENSG00000023839	ENST00000370449	T	0.29142	1.58	5.63	1.32	0.21799	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	0.767826	0.12970	N	0.424253	T	0.22859	0.0552	N	0.25789	0.76	0.58432	D	0.999999	B	0.30326	0.276	B	0.28709	0.093	T	0.14008	-1.0488	10	0.07813	T	0.8	-12.9795	20.8761	0.99795	0.0:0.8123:0.1877:0.0	.	594	Q92887	MRP2_HUMAN	N	594	ENSP00000359478:S594N	ENSP00000359478:S594N	S	+	2	0	ABCC2	101557942	0.003000	0.15002	0.157000	0.22605	0.964000	0.63967	0.116000	0.15561	0.253000	0.21552	0.491000	0.48974	AGC	.		0.473	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
ABCC9	10060	hgsc.bcm.edu;bcgsc.ca	37	12	21962812	21962812	+	Missense_Mutation	SNP	A	A	G	rs144125604		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:21962812A>G	ENST00000261201.4	-	35	4288	c.4289T>C	c.(4288-4290)aTg>aCg	p.M1430T	ABCC9_ENST00000261200.4_Missense_Mutation_p.M1430T|ABCC9_ENST00000345162.2_Missense_Mutation_p.M1394T	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1430	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	AGATTTGACCATATTCTTCAG	0.333																																					p.M1430T		.											.	ABCC9	96	0			c.T4289C						.	A	THR/MET,THR/MET	0,4406		0,0,2203	97.0	100.0	99.0		4289,4289	5.3	1.0	12	dbSNP_134	99	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense	ABCC9	NM_005691.2,NM_020297.2	81,81	0,1,6501	GG,GA,AA		0.0116,0.0,0.0077	benign,benign	1430/1550,1430/1550	21962812	1,13003	2203	4299	6502	SO:0001583	missense	10060	exon35			TTGACCATATTCT	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.4289T>C	12.37:g.21962812A>G	ENSP00000261201:p.Met1430Thr	60.0	0.0		45.0	4.0	NM_005691	O60707	Missense_Mutation	SNP	ENST00000261201.4	37	CCDS8694.1	.	.	.	.	.	.	.	.	.	.	A	14.78	2.636999	0.47049	0.0	1.16E-4	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62	5.29	5.29	0.74685	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.039691	0.85682	D	0.000000	T	0.80899	0.4712	N	0.05031	-0.125	0.58432	D	0.999998	B;B	0.14012	0.004;0.009	B;B	0.20384	0.029;0.013	T	0.76353	-0.2990	10	0.35671	T	0.21	-18.5984	13.954	0.64135	1.0:0.0:0.0:0.0	.	1430;1430	O60706;O60706-2	ABCC9_HUMAN;.	T	1430;1057;1430;1394	ENSP00000261200:M1430T;ENSP00000440521:M1057T;ENSP00000261201:M1430T;ENSP00000261202:M1394T	ENSP00000261200:M1430T	M	-	2	0	ABCC9	21854079	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.688000	0.91260	2.213000	0.71641	0.528000	0.53228	ATG	A|1.000;G|0.000		0.333	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691	
ADAM2	2515	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	39678655	39678655	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr8:39678655T>C	ENST00000265708.4	-	6	482	c.379A>G	c.(379-381)Ata>Gta	p.I127V	ADAM2_ENST00000521880.1_Missense_Mutation_p.I127V|ADAM2_ENST00000379853.2_Missense_Mutation_p.I127V|ADAM2_ENST00000523181.1_5'UTR|ADAM2_ENST00000347580.4_Missense_Mutation_p.I127V	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	127					adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		AGGGGTTCTATTCCATAACTA	0.318																																					p.I127V		.											.	ADAM2	227	0			c.A379G						.						49.0	49.0	49.0					8																	39678655		2203	4297	6500	SO:0001583	missense	2515	exon6			GTTCTATTCCATA	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.379A>G	8.37:g.39678655T>C	ENSP00000265708:p.Ile127Val	163.0	0.0		99.0	5.0	NM_001464	P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	37	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	T	19.65	3.867809	0.72065	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	T;T;T;T	0.13901	2.55;2.55;2.55;2.55	5.47	5.47	0.80525	Peptidase M12B, propeptide (1);	.	.	.	.	T	0.41419	0.1158	M	0.84585	2.705	0.36139	D	0.846633	D;D;D;D	0.76494	0.999;0.998;0.999;0.999	D;D;D;D	0.85130	0.99;0.995;0.993;0.997	T	0.56565	-0.7958	8	.	.	.	.	13.5152	0.61537	0.0:0.0:0.0:1.0	.	127;127;127;127	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	V	127	ENSP00000343854:I127V;ENSP00000369182:I127V;ENSP00000265708:I127V;ENSP00000429352:I127V	.	I	-	1	0	ADAM2	39797812	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	3.868000	0.56055	2.076000	0.62316	0.533000	0.62120	ATA	.		0.318	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464	
ADAM8	101	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	135087474	135087474	+	Missense_Mutation	SNP	G	G	A	rs375135486		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr10:135087474G>A	ENST00000445355.3	-	4	337	c.287C>T	c.(286-288)aCg>aTg	p.T96M	ADAM8_ENST00000559180.1_5'UTR|ADAM8_ENST00000415217.3_Missense_Mutation_p.T96M|ADAM8_ENST00000485491.2_Silent_p.D61D	NM_001109.4	NP_001100.3	P78325	ADAM8_HUMAN	ADAM metallopeptidase domain 8	96					activation of MAPK activity involved in innate immune response (GO:0035419)|angiogenesis (GO:0001525)|cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|leukocyte migration involved in inflammatory response (GO:0002523)|lymphocyte chemotaxis (GO:0048247)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell adhesion (GO:0045785)|positive regulation of eosinophil migration (GO:2000418)|positive regulation of fibronectin-dependent thymocyte migration (GO:2000415)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of neutrophil extravasation (GO:2000391)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein processing (GO:0010954)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|regulation of cell-cell adhesion (GO:0022407)|single organismal cell-cell adhesion (GO:0016337)	alpha9-beta1 integrin-ADAM8 complex (GO:0071133)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dense core granule membrane (GO:0032127)|integral component of plasma membrane (GO:0005887)|phagolysosome (GO:0032010)|plasma membrane (GO:0005886)|podosome (GO:0002102)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein self-association (GO:0043621)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)	17		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;7.72e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.23e-06)|Epithelial(32;1.02e-05)		AGGCTGCTCCGTCACCTCGGA	0.701																																					p.T96M		.											.	ADAM8	90	0			c.C287T						.		MET/THR,MET/THR,	0,4354		0,0,2177	28.0	29.0	29.0		287,287,183	0.2	0.2	10		29	3,8577		0,3,4287	no	missense,missense,coding-synonymous	ADAM8	NM_001109.4,NM_001164489.1,NM_001164490.1	81,81,	0,3,6464	AA,AG,GG		0.035,0.0,0.0232	probably-damaging,probably-damaging,	96/825,96/743,61/734	135087474	3,12931	2177	4290	6467	SO:0001583	missense	101	exon4			TGCTCCGTCACCT	D26579	CCDS31319.2, CCDS58102.1, CCDS58103.1	10q26.3	2014-03-20	2005-08-18		ENSG00000151651	ENSG00000151651		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	215	protein-coding gene	gene with protein product		602267	"""a disintegrin and metalloproteinase domain 8"""			9126482	Standard	NM_001109		Approved	CD156, MS2, CD156a	uc021qbe.1	P78325	OTTHUMG00000019309	ENST00000445355.3:c.287C>T	10.37:g.135087474G>A	ENSP00000453302:p.Thr96Met	101.0	0.0		62.0	17.0	NM_001164489	B4DVM6|H0YL36|H0YLR0|H0YN39	Missense_Mutation	SNP	ENST00000445355.3	37	CCDS31319.2																																																																																			.		0.701	ADAM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051118.4	NM_001109	
ADCK4	79934	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	41206291	41206291	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:41206291C>A	ENST00000324464.3	-	11	1260	c.959G>T	c.(958-960)cGg>cTg	p.R320L	ADCK4_ENST00000450541.1_Missense_Mutation_p.R279L|ADCK4_ENST00000243583.6_Missense_Mutation_p.R279L	NM_024876.3	NP_079152.3	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4	320	Protein kinase.		R -> W (in NPHS9). {ECO:0000269|PubMed:24270420}.			integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(6)|stomach(2)|urinary_tract(1)	17			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			GCCCAGCACCCGTGTCGTGCA	0.642																																					p.R320L		.											.	ADCK4	319	0			c.G959T						.						39.0	39.0	39.0					19																	41206291		2203	4300	6503	SO:0001583	missense	79934	exon11			AGCACCCGTGTCG	AK022291	CCDS12562.1, CCDS46081.1	19q13.2	2008-02-05				ENSG00000123815			19041	protein-coding gene	gene with protein product		615567					Standard	NM_024876		Approved	FLJ12229, COQ8	uc002oor.2	Q96D53		ENST00000324464.3:c.959G>T	19.37:g.41206291C>A	ENSP00000315118:p.Arg320Leu	109.0	0.0		77.0	29.0	NM_024876	Q8TAJ1|Q9HA52	Missense_Mutation	SNP	ENST00000324464.3	37	CCDS12562.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.664953	0.88251	.	.	ENSG00000123815	ENST00000324464;ENST00000450541;ENST00000243583	T;T;T	0.52295	0.67;0.67;0.67	5.75	5.75	0.90469	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.69869	0.3159	M	0.87547	2.89	0.58432	D	0.999997	D;D	0.63046	0.978;0.992	P;D	0.66196	0.81;0.942	T	0.74312	-0.3706	10	0.66056	D	0.02	-31.0909	12.1003	0.53780	0.0:0.9204:0.0:0.0796	.	320;279	Q96D53;Q96D53-2	ADCK4_HUMAN;.	L	320;279;279	ENSP00000315118:R320L;ENSP00000412839:R279L;ENSP00000243583:R279L	ENSP00000243583:R279L	R	-	2	0	ADCK4	45898131	0.186000	0.23225	0.994000	0.49952	0.747000	0.42532	2.066000	0.41452	2.720000	0.93068	0.563000	0.77884	CGG	.		0.642	ADCK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462731.1	NM_024876	
ADCY10	55811	broad.mit.edu;bcgsc.ca	37	1	167849366	167849366	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:167849366T>C	ENST00000367851.4	-	11	1387	c.1203A>G	c.(1201-1203)agA>agG	p.R401R	ADCY10_ENST00000367848.1_Silent_p.R309R|ADCY10_ENST00000545172.1_Silent_p.R248R	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	401	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						TGTACTCGTGTCTCACAGTGT	0.512																																					p.R401R		.											.	ADCY10	493	0			c.A1203G						.						71.0	63.0	66.0					1																	167849366		2203	4300	6503	SO:0001819	synonymous_variant	55811	exon11			CTCGTGTCTCACA	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.1203A>G	1.37:g.167849366T>C		176.0	1.0		136.0	6.0	NM_018417	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Silent	SNP	ENST00000367851.4	37	CCDS1265.1																																																																																			.		0.512	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417	
AFF3	3899	hgsc.bcm.edu;bcgsc.ca	37	2	100185316	100185316	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:100185316T>C	ENST00000409236.2	-	17	3092	c.2980A>G	c.(2980-2982)Atg>Gtg	p.M994V	AFF3_ENST00000409579.1_Missense_Mutation_p.M1019V|AFF3_ENST00000356421.2_Missense_Mutation_p.M1019V|AFF3_ENST00000317233.4_Missense_Mutation_p.M994V			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	994					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)	p.M1019V(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						GGTCTCACCATTGCATCTGCT	0.383																																					p.M1019V		.											.	AFF3	230	1	Substitution - Missense(1)	breast(1)	c.A3055G						.						208.0	190.0	197.0					2																	100185316		2203	4300	6503	SO:0001583	missense	3899	exon18			TCACCATTGCATC	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.2980A>G	2.37:g.100185316T>C	ENSP00000387207:p.Met994Val	125.0	0.0		121.0	6.0	NM_001025108	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	ENST00000409236.2	37	CCDS42723.1	.	.	.	.	.	.	.	.	.	.	T	18.71	3.681634	0.68042	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000445815	T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.71492	0.3346	M	0.63428	1.95	0.50813	D	0.999892	B;P	0.51147	0.237;0.942	B;P	0.53649	0.387;0.731	T	0.72704	-0.4213	10	0.49607	T	0.09	.	16.383	0.83481	0.0:0.0:0.0:1.0	.	994;1019	P51826;P51826-2	AFF3_HUMAN;.	V	994;1019;1019;994;36	ENSP00000317421:M994V;ENSP00000348793:M1019V;ENSP00000386834:M1019V;ENSP00000387207:M994V;ENSP00000416685:M36V	ENSP00000317421:M994V	M	-	1	0	AFF3	99551748	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.842000	0.62831	2.326000	0.78906	0.533000	0.62120	ATG	.		0.383	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285	
AGXT	189	hgsc.bcm.edu;bcgsc.ca	37	2	241813425	241813425	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:241813425A>G	ENST00000307503.3	+	6	1013	c.626A>G	c.(625-627)aAg>aGg	p.K209R		NM_000030.2	NP_000021.1	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase	209					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process (GO:0042853)|L-cysteine catabolic process (GO:0019448)|oxalic acid secretion (GO:0046724)|pyruvate biosynthetic process (GO:0042866)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alanine-glyoxylate transaminase activity (GO:0008453)|amino acid binding (GO:0016597)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|receptor binding (GO:0005102)|serine-pyruvate transaminase activity (GO:0004760)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)	18		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)	GGCTCCCAGAAGGCCCTGAAC	0.632																																					p.K209R		.											.	AGXT	90	0			c.A626G						.						108.0	95.0	100.0					2																	241813425		2203	4300	6503	SO:0001583	missense	189	exon6			CCCAGAAGGCCCT	D13368	CCDS2543.1	2q37.3	2008-02-05	2007-04-13		ENSG00000172482	ENSG00000172482	2.6.1.44, 2.6.1.51		341	protein-coding gene	gene with protein product	"""oxalosis I"", ""primary hyperoxaluria type 1"", ""L-alanine: glyoxylate aminotransferase 1"", ""serine:pyruvate aminotransferase"", ""glycolicaciduria"""	604285		SPAT		2039493, 2045108	Standard	NM_000030		Approved	AGXT1, PH1, AGT, SPT, AGT1	uc002waa.4	P21549	OTTHUMG00000133354	ENST00000307503.3:c.626A>G	2.37:g.241813425A>G	ENSP00000302620:p.Lys209Arg	74.0	0.0		52.0	4.0	NM_000030	Q53QU6	Missense_Mutation	SNP	ENST00000307503.3	37	CCDS2543.1	.	.	.	.	.	.	.	.	.	.	A	16.52	3.145225	0.57044	.	.	ENSG00000172482	ENST00000307503	D	0.99474	-5.97	4.1	4.1	0.47936	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.095585	0.64402	D	0.000001	D	0.99687	0.9882	H	0.97465	4.01	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97383	0.9984	10	0.87932	D	0	-39.91	13.3954	0.60849	1.0:0.0:0.0:0.0	.	209	P21549	SPYA_HUMAN	R	209	ENSP00000302620:K209R	ENSP00000302620:K209R	K	+	2	0	AGXT	241462098	1.000000	0.71417	1.000000	0.80357	0.036000	0.12997	5.335000	0.65929	1.634000	0.50500	0.472000	0.43445	AAG	.		0.632	AGXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257186.1	NM_000030	
ALDH7A1	501	ucsc.edu;bcgsc.ca	37	5	125887798	125887798	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr5:125887798G>T	ENST00000409134.3	-	14	1451	c.1232C>A	c.(1231-1233)cCg>cAg	p.P411Q	RNU6-963P_ENST00000363477.1_RNA|ALDH7A1_ENST00000553117.1_Missense_Mutation_p.P347Q|ALDH7A1_ENST00000447989.2_Missense_Mutation_p.P374Q	NM_001182.4|NM_001201377.1	NP_001173.2|NP_001188306.1	P49419	AL7A1_HUMAN	aldehyde dehydrogenase 7 family, member A1	411					cellular aldehyde metabolic process (GO:0006081)|cellular nitrogen compound metabolic process (GO:0034641)|glycine betaine biosynthetic process from choline (GO:0019285)|lysine catabolic process (GO:0006554)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|betaine-aldehyde dehydrogenase activity (GO:0008802)|L-aminoadipate-semialdehyde dehydrogenase activity (GO:0004043)			endometrium(1)|kidney(4)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.24)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)		CACAATTGTCGGTTCTACATA	0.403																																					p.P411Q		.											.	ALDH7A1	227	0			c.C1232A						.						77.0	70.0	72.0					5																	125887798		2203	4300	6503	SO:0001583	missense	501	exon14			ATTGTCGGTTCTA	S74728	CCDS4137.2, CCDS56380.1	5q31	2013-06-03			ENSG00000164904	ENSG00000164904	1.2.1.31	"""Aldehyde dehydrogenases"""	877	protein-coding gene	gene with protein product	"""antiquitin 1"", ""26g turgor protein homolog"", ""alpha-aminoadipic semialdehyde dehydrogenase"", ""alpha-AASA dehydrogenase"", ""delta1-piperideine-6-carboxylate dehydrogenease"", ""P6c dehydrogenase"""	107323		ATQ1		9417906	Standard	NM_001182		Approved	EPD, PDE	uc003ktx.3	P49419	OTTHUMG00000128942	ENST00000409134.3:c.1232C>A	5.37:g.125887798G>T	ENSP00000387123:p.Pro411Gln	90.0	1.0		65.0	6.0	NM_001182	B2R669|B4DIC7|B4DMA0|E7EPT3|O14619|Q6IPU8|Q9BUL4	Missense_Mutation	SNP	ENST00000409134.3	37	CCDS4137.2	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054808	0.75960	.	.	ENSG00000164904	ENST00000409134;ENST00000553117;ENST00000447989;ENST00000437170	D;D;D	0.97791	-4.54;-4.54;-4.54	4.88	4.88	0.63580	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.99372	0.9779	H	0.99225	4.475	0.48696	D	0.999696	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98192	1.0463	10	0.87932	D	0	.	18.1741	0.89756	0.0:0.0:1.0:0.0	.	374;411	E7EPT3;P49419	.;AL7A1_HUMAN	Q	411;347;374;219	ENSP00000387123:P411Q;ENSP00000448593:P347Q;ENSP00000414132:P374Q	ENSP00000387123:P411Q	P	-	2	0	ALDH7A1	125915697	1.000000	0.71417	0.982000	0.44146	0.473000	0.32948	9.455000	0.97625	2.688000	0.91661	0.655000	0.94253	CCG	.		0.403	ALDH7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250921.2	NM_001182	
ALG13	79868	hgsc.bcm.edu;bcgsc.ca	37	X	110980011	110980011	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:110980011G>T	ENST00000394780.3	+	23	2611	c.2599G>T	c.(2599-2601)Ggt>Tgt	p.G867C	ALG13_ENST00000251943.4_Missense_Mutation_p.G763C|ALG13_ENST00000470971.1_3'UTR	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit	867					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)			endometrium(2)|lung(10)|skin(1)	13						CTTATCTAACGGTGCAGCGGC	0.453																																					p.G867C		.											.	ALG13	130	0			c.G2599T						.						221.0	188.0	198.0					X																	110980011		1568	3582	5150	SO:0001583	missense	79868	exon23			TCTAACGGTGCAG	AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.2599G>T	X.37:g.110980011G>T	ENSP00000378260:p.Gly867Cys	262.0	0.0		166.0	7.0	NM_001099922	B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	Missense_Mutation	SNP	ENST00000394780.3	37	CCDS55477.1	.	.	.	.	.	.	.	.	.	.	G	1.646	-0.515106	0.04200	.	.	ENSG00000101901	ENST00000251943;ENST00000394780;ENST00000436609	T;T	0.74106	1.59;-0.81	5.49	0.135	0.14775	.	0.517332	0.21477	N	0.073895	T	0.35480	0.0933	N	0.00436	-1.5	0.09310	N	0.999997	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.40327	-0.9569	10	0.39692	T	0.17	-0.0745	6.5785	0.22581	0.2464:0.0:0.2588:0.4948	.	789;867;763	Q9NP73-3;Q9NP73;Q9NP73-4	.;ALG13_HUMAN;.	C	763;867;500	ENSP00000251943:G763C;ENSP00000378260:G867C	ENSP00000251943:G763C	G	+	1	0	ALG13	110866667	0.155000	0.22806	0.087000	0.20705	0.066000	0.16364	0.890000	0.28295	-0.249000	0.09569	-0.328000	0.08392	GGT	.		0.453	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272895.1	NM_018466	
ALPL	249	hgsc.bcm.edu;bcgsc.ca	37	1	21902359	21902359	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:21902359G>T	ENST00000374840.3	+	10	1381	c.1131G>T	c.(1129-1131)gcG>gcT	p.A377A	ALPL_ENST00000425315.2_Silent_p.A377A|ALPL_ENST00000374832.1_Silent_p.A377A|ALPL_ENST00000539907.1_Silent_p.A300A|ALPL_ENST00000540617.1_Silent_p.A322A|ALPL_ENST00000374830.1_Silent_p.A23A|ALPL_ENST00000374829.1_Silent_p.A23A	NM_000478.4	NP_000469.3	P05186	PPBT_HUMAN	alkaline phosphatase, liver/bone/kidney	377					cellular response to organic cyclic compound (GO:0071407)|cementum mineralization (GO:0071529)|developmental process involved in reproduction (GO:0003006)|endochondral ossification (GO:0001958)|osteoblast differentiation (GO:0001649)|response to antibiotic (GO:0046677)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)	anchored component of membrane (GO:0031225)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	26		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)|Fospropofol(DB06716)	TGGTCACTGCGGACCATTCCC	0.607																																					p.A377A		.											.	ALPL	94	0			c.G1131T						.						167.0	158.0	161.0					1																	21902359		2203	4300	6503	SO:0001819	synonymous_variant	249	exon10			CACTGCGGACCAT	BC021289	CCDS217.1, CCDS53274.1, CCDS53275.1	1p36.12	2008-02-05			ENSG00000162551	ENSG00000162551	3.1.3.1		438	protein-coding gene	gene with protein product		171760		HOPS		3532105, 3446011	Standard	NM_001127501		Approved	TNSALP	uc001bet.3	P05186	OTTHUMG00000002949	ENST00000374840.3:c.1131G>T	1.37:g.21902359G>T		129.0	0.0		108.0	5.0	NM_000478	A1A4E7|B2RMP8|B7Z387|B7Z4Y6|O75090|Q2TAI7|Q59EJ7|Q5BKZ5|Q5VTG5|Q6NZI8|Q8WU32|Q9UBK0	Silent	SNP	ENST00000374840.3	37	CCDS217.1																																																																																			.		0.607	ALPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000008202.1	NM_000478	
ANKRD17	26057	hgsc.bcm.edu;bcgsc.ca	37	4	74005966	74005966	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr4:74005966T>C	ENST00000358602.4	-	15	2483	c.2367A>G	c.(2365-2367)ccA>ccG	p.P789P	ANKRD17_ENST00000514252.1_5'UTR|ANKRD17_ENST00000509867.2_Silent_p.P676P|ANKRD17_ENST00000330838.6_Intron	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	789					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GGCTGTTTGCTGGCAAATGGC	0.453																																					p.P789P		.											.	ANKRD17	234	0			c.A2367G						.						65.0	65.0	65.0					4																	74005966		2203	4300	6503	SO:0001819	synonymous_variant	26057	exon15			GTTTGCTGGCAAA	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.2367A>G	4.37:g.74005966T>C		89.0	0.0		84.0	4.0	NM_032217	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Silent	SNP	ENST00000358602.4	37	CCDS34004.1																																																																																			.		0.453	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
ANO10	55129	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	43621859	43621859	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:43621859T>C	ENST00000292246.3	-	5	748	c.578A>G	c.(577-579)aAg>aGg	p.K193R	ANO10_ENST00000350459.4_Missense_Mutation_p.K193R|ANO10_ENST00000414522.2_Missense_Mutation_p.K193R|ANO10_ENST00000451430.2_Missense_Mutation_p.K82R|ANO10_ENST00000396091.3_Missense_Mutation_p.K127R	NM_018075.3	NP_060545.3	Q9NW15	ANO10_HUMAN	anoctamin 10	193					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell death (GO:0008219)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(3)|skin(3)	29						GGGCTGATACTTCAAAGCAAA	0.483																																					p.K193R		.											.	ANO10	92	0			c.A578G						.						213.0	176.0	188.0					3																	43621859		2203	4300	6503	SO:0001583	missense	55129	exon5			TGATACTTCAAAG	AL832508	CCDS2710.2, CCDS56247.1, CCDS56248.1, CCDS56249.1, CCDS56250.1	3p22.1-p21.33	2014-04-09	2008-08-28	2008-08-28	ENSG00000160746	ENSG00000160746		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25519	protein-coding gene	gene with protein product		613726	"""transmembrane protein 16K"""	TMEM16K		12477932, 24692353	Standard	NM_001204831		Approved	FLJ10375, MGC47890, SCAR10	uc003cmv.3	Q9NW15	OTTHUMG00000133044	ENST00000292246.3:c.578A>G	3.37:g.43621859T>C	ENSP00000292246:p.Lys193Arg	38.0	0.0		30.0	4.0	NM_018075	A8K8K3|A8MV74|B3KTZ1|B3KY93|B4DJ83|B4DNK2|B7WP12|C9JHS1|Q8IXX9	Missense_Mutation	SNP	ENST00000292246.3	37	CCDS2710.2	.	.	.	.	.	.	.	.	.	.	T	8.029	0.761378	0.15914	.	.	ENSG00000160746	ENST00000292246;ENST00000350459;ENST00000396091;ENST00000414522;ENST00000451430;ENST00000428472	T;T;T;T;T;T	0.67865	-0.01;-0.09;0.0;0.03;-0.17;-0.29	5.98	4.82	0.62117	.	0.289920	0.39615	N	0.001311	T	0.59459	0.2195	L	0.58101	1.795	0.09310	N	1	B;B;B;B;B	0.21452	0.004;0.001;0.056;0.001;0.0	B;B;B;B;B	0.30251	0.005;0.002;0.113;0.005;0.001	T	0.53056	-0.8492	10	0.35671	T	0.21	.	4.3114	0.10972	0.0:0.1996:0.1707:0.6297	.	82;193;193;127;193	Q9NW15-4;C9JHS1;Q9NW15-2;Q9NW15-3;Q9NW15	.;.;.;.;ANO10_HUMAN	R	193;193;127;193;82;82	ENSP00000292246:K193R;ENSP00000327767:K193R;ENSP00000379398:K127R;ENSP00000396990:K193R;ENSP00000394119:K82R;ENSP00000416266:K82R	ENSP00000292246:K193R	K	-	2	0	ANO10	43596863	0.906000	0.30813	0.099000	0.21106	0.625000	0.37756	2.544000	0.45761	1.091000	0.41335	0.482000	0.46254	AAG	.		0.483	ANO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256649.2	NM_018075	
ANO6	196527	hgsc.bcm.edu;bcgsc.ca	37	12	45742051	45742051	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:45742051A>T	ENST00000320560.8	+	5	788	c.586A>T	c.(586-588)Ata>Tta	p.I196L	ANO6_ENST00000425752.2_Missense_Mutation_p.I196L|ANO6_ENST00000423947.3_Missense_Mutation_p.I217L|ANO6_ENST00000441606.2_Missense_Mutation_p.I178L|ANO6_ENST00000426898.2_3'UTR|ANO6_ENST00000435642.1_Missense_Mutation_p.I196L	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	196					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						TGATTTTTACATAGTTGATAG	0.423																																					p.I217L		.											.	ANO6	516	0			c.A649T						.						115.0	117.0	116.0					12																	45742051		2203	4300	6503	SO:0001583	missense	196527	exon6			TTTTACATAGTTG	AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.586A>T	12.37:g.45742051A>T	ENSP00000320087:p.Ile196Leu	275.0	0.0		213.0	16.0	NM_001204803	A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	ENST00000320560.8	37	CCDS31782.1	.	.	.	.	.	.	.	.	.	.	A	15.30	2.793353	0.50102	.	.	ENSG00000177119	ENST00000425752;ENST00000423947;ENST00000435642;ENST00000320560;ENST00000441606	T;T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47;-0.47	5.3	5.3	0.74995	.	0.109289	0.64402	D	0.000009	T	0.62171	0.2406	L	0.45352	1.415	0.48040	D	0.999571	B;B;B;B	0.33022	0.394;0.013;0.019;0.013	B;B;B;B	0.31245	0.126;0.022;0.017;0.026	T	0.59359	-0.7469	10	0.17832	T	0.49	.	15.9619	0.79936	1.0:0.0:0.0:0.0	.	178;217;196;196	E9PB30;B9EGG0;E9PCT2;Q4KMQ2	.;.;.;ANO6_HUMAN	L	196;217;196;196;178	ENSP00000391417:I196L;ENSP00000409126:I217L;ENSP00000413840:I196L;ENSP00000320087:I196L;ENSP00000413137:I178L	ENSP00000320087:I196L	I	+	1	0	ANO6	44028318	1.000000	0.71417	0.919000	0.36401	0.787000	0.44495	4.247000	0.58750	2.308000	0.77769	0.533000	0.62120	ATA	.		0.423	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404822.1	XM_113743	
ANXA5	308	hgsc.bcm.edu;bcgsc.ca	37	4	122607464	122607464	+	Silent	SNP	G	G	T	rs370872365		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr4:122607464G>T	ENST00000296511.5	-	3	358	c.73C>A	c.(73-75)Cgg>Agg	p.R25R	ANXA5_ENST00000509016.1_5'UTR|ANXA5_ENST00000515017.1_Silent_p.R25R|ANXA5_ENST00000501272.2_Intron	NM_001154.3	NP_001145.1	P08758	ANXA5_HUMAN	annexin A5	25					blood coagulation (GO:0007596)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of coagulation (GO:0050819)|response to organic substance (GO:0010033)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipase inhibitor activity (GO:0004859)|phospholipid binding (GO:0005543)			NS(1)|breast(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)	15						ATAGCCTTCCGAAGAGTTTCT	0.378																																					p.R25R	Pancreas(191;1279 2147 16046 17806 52646)|GBM(88;628 1285 16585 32846 50188)	.											.	ANXA5	91	0			c.C73A						.						95.0	93.0	94.0					4																	122607464		2203	4300	6503	SO:0001819	synonymous_variant	308	exon3			CCTTCCGAAGAGT	U05770	CCDS3720.1	4q27	2008-02-05			ENSG00000164111	ENSG00000164111		"""Annexins"""	543	protein-coding gene	gene with protein product		131230		ENX2, ANX5		2960376	Standard	NM_001154		Approved		uc003idv.4	P08758	OTTHUMG00000133034	ENST00000296511.5:c.73C>A	4.37:g.122607464G>T		124.0	0.0		80.0	4.0	NM_001154	D3DNW7|Q6FHB3|Q6FI16|Q8WV69|Q9UDH9	Silent	SNP	ENST00000296511.5	37	CCDS3720.1																																																																																			.		0.378	ANXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256636.2	NM_001154	
APCS	325	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	159558025	159558025	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:159558025A>T	ENST00000255040.2	+	2	296	c.199A>T	c.(199-201)Agc>Tgc	p.S67C		NM_001639.3	NP_001630.1	P02743	SAMP_HUMAN	amyloid P component, serum	67	Pentaxin.				acute-phase response (GO:0006953)|chaperone-mediated protein complex assembly (GO:0051131)|innate immune response (GO:0045087)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral process (GO:0048525)|negative regulation of wound healing (GO:0061045)|protein folding (GO:0006457)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|unfolded protein binding (GO:0051082)|virion binding (GO:0046790)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_hematologic(112;0.0429)					TCGTGCCTACAGCCTCTTCTC	0.413																																					p.S67C		.											.	APCS	154	0			c.A199T						.						116.0	115.0	115.0					1																	159558025		2203	4300	6503	SO:0001583	missense	325	exon2			GCCTACAGCCTCT		CCDS1186.1	1q21-q23	2012-10-02			ENSG00000132703	ENSG00000132703			584	protein-coding gene	gene with protein product	"""pentaxin-related"", ""9.5S alpha-1-glycoprotein"""	104770				2987268	Standard	NM_001639		Approved	SAP, PTX2, MGC88159	uc001ftv.3	P02743	OTTHUMG00000022741	ENST00000255040.2:c.199A>T	1.37:g.159558025A>T	ENSP00000255040:p.Ser67Cys	90.0	0.0		178.0	13.0	NM_001639		Missense_Mutation	SNP	ENST00000255040.2	37	CCDS1186.1	.	.	.	.	.	.	.	.	.	.	A	13.84	2.358230	0.41801	.	.	ENSG00000132703	ENST00000255040	T	0.09817	2.94	4.45	4.45	0.53987	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.268199	0.41294	D	0.000916	T	0.27384	0.0672	M	0.91300	3.195	0.41910	D	0.990463	D	0.89917	1.0	D	0.91635	0.999	T	0.12941	-1.0528	10	0.87932	D	0	-18.5039	7.5418	0.27742	0.8092:0.0:0.0:0.1908	.	67	P02743	SAMP_HUMAN	C	67	ENSP00000255040:S67C	ENSP00000255040:S67C	S	+	1	0	APCS	157824649	0.957000	0.32711	0.895000	0.35142	0.023000	0.10783	2.214000	0.42853	1.984000	0.57885	0.533000	0.62120	AGC	.		0.413	APCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059024.2	NM_001639	
ARID1B	57492	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	157502170	157502170	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr6:157502170A>G	ENST00000350026.5	+	11	3165	c.3164A>G	c.(3163-3165)gAg>gGg	p.E1055G	ARID1B_ENST00000275248.4_Missense_Mutation_p.E1050G|ARID1B_ENST00000367148.1_Missense_Mutation_p.E1108G|ARID1B_ENST00000346085.5_Missense_Mutation_p.E1068G|ARID1B_ENST00000478761.2_3'UTR	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1055	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		AATGAGCCAGAGAGAAAGCTC	0.577																																					p.E1068G		.											.	ARID1B	154	0			c.A3203G						.						92.0	76.0	82.0					6																	157502170		2203	4296	6499	SO:0001583	missense	57492	exon12			AGCCAGAGAGAAA	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.3164A>G	6.37:g.157502170A>G	ENSP00000055163:p.Glu1055Gly	73.0	0.0		38.0	4.0	NM_020732	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	37	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	A	28.7	4.946609	0.92593	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000354354;ENST00000414678;ENST00000319584;ENST00000400790	T;T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81;0.81	5.76	5.76	0.90799	ARID/BRIGHT DNA-binding domain (5);	0.000000	0.85682	D	0.000000	T	0.61223	0.2330	M	0.68317	2.08	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.91635	0.998;0.999;0.998;0.998	T	0.66432	-0.5925	10	0.87932	D	0	.	16.0796	0.80995	1.0:0.0:0.0:0.0	.	305;1055;1068;1050	Q8NFD5-4;Q8NFD5;Q8NFD5-2;G3XAA0	.;ARI1B_HUMAN;.;.	G	1068;1055;1108;1050;525;577;530;122	ENSP00000344546:E1068G;ENSP00000055163:E1055G;ENSP00000356116:E1108G;ENSP00000275248:E1050G;ENSP00000412835:E577G;ENSP00000313006:E530G;ENSP00000383596:E122G	ENSP00000275248:E1050G	E	+	2	0	ARID1B	157543862	1.000000	0.71417	0.990000	0.47175	0.994000	0.84299	9.339000	0.96797	2.195000	0.70347	0.528000	0.53228	GAG	.		0.577	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
ARL5B	221079	hgsc.bcm.edu;bcgsc.ca	37	10	18963040	18963040	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr10:18963040C>A	ENST00000377275.3	+	5	700	c.467C>A	c.(466-468)tCc>tAc	p.S156Y		NM_178815.3	NP_848930.1	Q96KC2	ARL5B_HUMAN	ADP-ribosylation factor-like 5B	156					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			lung(1)|ovary(1)	2						CACATTCAATCCTGCTGTGCT	0.413																																					p.S156Y		.											.	ARL5B	228	0			c.C467A						.						108.0	94.0	98.0					10																	18963040		2203	4300	6503	SO:0001583	missense	221079	exon5			TTCAATCCTGCTG	AF494061	CCDS7131.1	10p13	2014-05-09	2005-11-03	2005-11-03	ENSG00000165997	ENSG00000165997		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	23052	protein-coding gene	gene with protein product		608909	"""ADP-ribosylation factor-like 8"""	ARL8		12853149	Standard	XM_005252400		Approved		uc001iqd.1	Q96KC2	OTTHUMG00000017765	ENST00000377275.3:c.467C>A	10.37:g.18963040C>A	ENSP00000366487:p.Ser156Tyr	85.0	0.0		64.0	4.0	NM_178815		Missense_Mutation	SNP	ENST00000377275.3	37	CCDS7131.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.739167	0.89573	.	.	ENSG00000165997	ENST00000377275	D	0.82255	-1.59	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.89787	0.6816	M	0.67517	2.055	0.80722	D	1	D	0.63046	0.992	P	0.61722	0.893	D	0.90363	0.4375	10	0.87932	D	0	-3.4532	19.6088	0.95594	0.0:1.0:0.0:0.0	.	156	Q96KC2	ARL5B_HUMAN	Y	156	ENSP00000366487:S156Y	ENSP00000366487:S156Y	S	+	2	0	ARL5B	19003046	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	7.760000	0.85248	2.636000	0.89361	0.467000	0.42956	TCC	.		0.413	ARL5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047078.1	NM_178815	
ATAD5	79915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	29192785	29192785	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:29192785T>C	ENST00000321990.4	+	11	3578	c.3200T>C	c.(3199-3201)aTa>aCa	p.I1067T	RP13-753N3.1_ENST00000584157.1_RNA|CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1067					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AGTGAACTTATAGGAAATGAG	0.303																																					p.I1067T		.											.	ATAD5	93	0			c.T3200C						.						75.0	76.0	76.0					17																	29192785		2203	4292	6495	SO:0001583	missense	79915	exon11			AACTTATAGGAAA		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.3200T>C	17.37:g.29192785T>C	ENSP00000313171:p.Ile1067Thr	279.0	0.0		229.0	68.0	NM_024857	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	T	13.50	2.254797	0.39896	.	.	ENSG00000176208	ENST00000321990	T	0.20463	2.07	5.18	5.18	0.71444	.	0.292105	0.37348	N	0.002125	T	0.29588	0.0738	M	0.75615	2.305	0.40062	D	0.975905	B;B	0.30727	0.292;0.19	B;B	0.32022	0.139;0.035	T	0.17289	-1.0374	10	0.87932	D	0	.	15.1186	0.72423	0.0:0.0:0.0:1.0	.	1067;1067	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	T	1067	ENSP00000313171:I1067T	ENSP00000313171:I1067T	I	+	2	0	ATAD5	26216911	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.186000	0.77722	1.970000	0.57323	0.529000	0.55759	ATA	.		0.303	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
ATP11A	23250	hgsc.bcm.edu;bcgsc.ca	37	13	113512575	113512575	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr13:113512575T>C	ENST00000487903.1	+	22	2726	c.2638T>C	c.(2638-2640)Tct>Cct	p.S880P	ATP11A_ENST00000375645.3_Missense_Mutation_p.S880P|ATP11A_ENST00000375630.2_Missense_Mutation_p.S880P|ATP11A_ENST00000283558.8_Missense_Mutation_p.S880P			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	880					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				CATTAGGATCTCTGAGCTCGT	0.522																																					p.S880P		.											.	ATP11A	138	0			c.T2638C						.						94.0	92.0	93.0					13																	113512575		2203	4300	6503	SO:0001583	missense	23250	exon22			AGGATCTCTGAGC	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.2638T>C	13.37:g.113512575T>C	ENSP00000420387:p.Ser880Pro	168.0	0.0		121.0	5.0	NM_032189	Q5VXT2	Missense_Mutation	SNP	ENST00000487903.1	37	CCDS32011.1	.	.	.	.	.	.	.	.	.	.	T	15.69	2.907221	0.52333	.	.	ENSG00000068650	ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558;ENST00000432166	T;T;T;T	0.60299	0.2;0.2;0.2;0.2	5.62	-2.64	0.06114	.	0.220919	0.47852	D	0.000217	T	0.70413	0.3221	M	0.91090	3.175	0.45390	D	0.998376	P;P;B	0.45715	0.865;0.559;0.18	P;P;P	0.49192	0.544;0.602;0.474	T	0.81446	-0.0929	10	0.66056	D	0.02	.	16.7801	0.85561	0.0:0.0:0.5845:0.4155	.	880;880;880	E9PCW5;E9PEJ6;P98196	.;.;AT11A_HUMAN	P	880;880;880;880;321	ENSP00000420387:S880P;ENSP00000364781:S880P;ENSP00000364796:S880P;ENSP00000283558:S880P	ENSP00000283558:S880P	S	+	1	0	ATP11A	112560576	0.991000	0.36638	0.003000	0.11579	0.294000	0.27393	1.459000	0.35234	-0.241000	0.09681	0.533000	0.62120	TCT	.		0.522	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205	
ATP2B1	490	hgsc.bcm.edu;bcgsc.ca	37	12	90015326	90015326	+	Splice_Site	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:90015326C>A	ENST00000428670.3	-	10	2043	c.1587G>T	c.(1585-1587)ttG>ttT	p.L529F	ATP2B1_ENST00000261173.2_Splice_Site_p.L529F|ATP2B1_ENST00000348959.3_Splice_Site_p.L529F|ATP2B1_ENST00000359142.3_Splice_Site_p.L529F|ATP2B1_ENST00000393164.2_Splice_Site_p.L272F			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	529					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						AAAACCTTACCAATATTTTTG	0.279																																					p.L529F		.											.	ATP2B1	516	0			c.G1587T						.						33.0	33.0	33.0					12																	90015326		2181	4276	6457	SO:0001630	splice_region_variant	490	exon9			CCTTACCAATATT	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.1587+1G>T	12.37:g.90015326C>A		115.0	0.0		81.0	4.0	NM_001001323	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	ENST00000428670.3	37	CCDS9035.1	.	.	.	.	.	.	.	.	.	.	C	18.41	3.618329	0.66787	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670;ENST00000393164	T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49	5.85	4.96	0.65561	.	0.054532	0.64402	D	0.000001	T	0.69387	0.3105	L	0.28054	0.825	0.80722	D	1	P;P;P	0.46512	0.879;0.855;0.486	B;P;B	0.53809	0.408;0.735;0.347	T	0.67715	-0.5599	9	.	.	.	-13.6016	15.0228	0.71643	0.0:0.9319:0.0:0.0681	.	529;529;529	P20020-3;P20020-2;P20020-6	.;.;.	F	529;529;529;529;272	ENSP00000261173:L529F;ENSP00000343599:L529F;ENSP00000352054:L529F;ENSP00000392043:L529F;ENSP00000376869:L272F	.	L	-	3	2	ATP2B1	88539457	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.487000	0.81328	1.487000	0.48415	0.563000	0.77884	TTG	.		0.279	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406653.1	NM_001682	Missense_Mutation
ATP6V1G2	534	hgsc.bcm.edu;bcgsc.ca	37	6	31513188	31513188	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr6:31513188G>T	ENST00000303892.5	-	3	638	c.354C>A	c.(352-354)gcC>gcA	p.A118A	DDX39B_ENST00000417556.2_5'Flank|ATP6V1G2-DDX39B_ENST00000475917.1_Intron|ATP6V1G2_ENST00000483251.1_Silent_p.A77A|DDX39B_ENST00000458640.1_5'Flank|DDX39B-AS1_ENST00000420520.1_RNA|NFKBIL1_ENST00000376145.4_5'Flank|DDX39B-AS1_ENST00000416684.1_RNA|ATP6V1G2-DDX39B_ENST00000376185.1_Intron|DDX39B_ENST00000396172.1_5'Flank|ATP6V1G2_ENST00000376151.4_Silent_p.A78A|ATP6V1G2_ENST00000483170.1_5'UTR|NFKBIL1_ENST00000376148.4_5'Flank	NM_130463.3|NM_138282.2	NP_569730.1|NP_612139.1	O95670	VATG2_HUMAN	ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2	118					cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)			breast(1)|large_intestine(2)|lung(1)|prostate(1)	5						GGTGGCCCTAGGCAGAAATCC	0.567																																					p.A118A		.											.	ATP6V1G2	90	0			c.C354A						.						44.0	39.0	40.0					6																	31513188		2203	4300	6503	SO:0001819	synonymous_variant	534	exon3			GCCCTAGGCAGAA	Y14768	CCDS4698.1, CCDS4699.1, CCDS56413.1	6p21.3	2011-03-29	2006-01-13	2002-05-10	ENSG00000213760	ENSG00000213760		"""ATPases / V-type"""	862	protein-coding gene	gene with protein product		606853	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump)"", ""ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 2"""	ATP6G, ATP6G2		10202016	Standard	NM_138282		Approved	Vma10, NG38, Em:AC004181.3	uc003nua.3	O95670	OTTHUMG00000166618	ENST00000303892.5:c.354C>A	6.37:g.31513188G>T		56.0	0.0		58.0	4.0	NM_130463	B5MEF0|Q2L6F8|Q5HYU8|Q5RJ63	Silent	SNP	ENST00000303892.5	37	CCDS4698.1																																																																																			.		0.567	ATP6V1G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076399.3	NM_130463	
BACE1	23621	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	117161738	117161739	+	Frame_Shift_Ins	INS	-	-	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:117161738_117161739insC	ENST00000313005.6	-	7	1429_1430	c.969_970insG	c.(967-972)tggctafs	p.L324fs	BACE1_ENST00000513780.1_Frame_Shift_Ins_p.L299fs|BACE1_ENST00000428381.2_Frame_Shift_Ins_p.L255fs|BACE1_ENST00000510630.1_Frame_Shift_Ins_p.L199fs|BACE1_ENST00000445823.2_Frame_Shift_Ins_p.L280fs|BACE1_ENST00000514464.1_5'Flank|BACE1_ENST00000392937.6_Frame_Shift_Ins_p.L224fs|BACE1_ENST00000528053.1_Frame_Shift_Ins_p.L290fs	NM_012104.4|NM_138971.3|NM_138972.3|NM_138973.3	NP_036236|NP_620427.1|NP_620428.1|NP_620429.1	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1	324					beta-amyloid metabolic process (GO:0050435)|membrane protein ectodomain proteolysis (GO:0006509)|proteolysis (GO:0006508)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	aspartic-type endopeptidase activity (GO:0004190)|beta-amyloid binding (GO:0001540)|beta-aspartyl-peptidase activity (GO:0008798)|enzyme binding (GO:0019899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)		TGCTCTCCTAGCCAGAAACCAT	0.505																																					p.L324fs		.											.	BACE1	91	0			c.970_971insG						.																																			SO:0001589	frameshift_variant	23621	exon7			CTCCTAGCCAGAA	AF190725	CCDS8383.1, CCDS44739.1, CCDS44740.1, CCDS44741.1, CCDS55787.1, CCDS55786.1	11q23-q24	2011-07-27	2004-04-02	2004-04-02	ENSG00000186318	ENSG00000186318			933	protein-coding gene	gene with protein product		604252	"""beta-site APP-cleaving enzyme"""	BACE		10531052	Standard	NM_012104		Approved		uc001pqz.3	P56817	OTTHUMG00000160636	ENST00000313005.6:c.970dupG	11.37:g.117161740_117161740dupC	ENSP00000318585:p.Leu324fs	148.0	0.0		72.0	21.0	NM_012104	A0M8W7|B0YIU9|E9PE65|H7BXJ9|Q9BYB9|Q9BYC0|Q9BYC1|Q9UJT5|Q9ULS1	Frame_Shift_Ins	INS	ENST00000313005.6	37	CCDS8383.1																																																																																			.		0.505	BACE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361505.1		
BAI1	575	hgsc.bcm.edu;bcgsc.ca	37	8	143603470	143603470	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr8:143603470G>A	ENST00000517894.1	+	21	4063	c.3169G>A	c.(3169-3171)Ggc>Agc	p.G1057S	BAI1_ENST00000323289.5_Missense_Mutation_p.G1057S			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1057					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CCTCTGCCTGGGCTGGGGTGA	0.672																																					p.G1057S		.											.	BAI1	1129	0			c.G3169A						.						32.0	40.0	38.0					8																	143603470		2196	4296	6492	SO:0001583	missense	575	exon20			TGCCTGGGCTGGG	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3169G>A	8.37:g.143603470G>A	ENSP00000430945:p.Gly1057Ser	64.0	0.0		57.0	4.0	NM_001702		Missense_Mutation	SNP	ENST00000517894.1	37		.	.	.	.	.	.	.	.	.	.	G	16.06	3.016528	0.54468	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	D;D	0.84516	-1.86;-1.86	3.78	3.78	0.43462	.	0.151741	0.43260	U	0.000583	D	0.86969	0.6061	M	0.84219	2.685	0.58432	D	0.999999	B	0.24533	0.105	B	0.30401	0.115	D	0.87356	0.2341	10	0.72032	D	0.01	.	14.6053	0.68475	0.0:0.0:1.0:0.0	.	1057	E9PBK0	.	S	1057	ENSP00000430945:G1057S;ENSP00000313046:G1057S	ENSP00000313046:G1057S	G	+	1	0	BAI1	143600472	1.000000	0.71417	1.000000	0.80357	0.388000	0.30384	9.490000	0.97952	1.641000	0.50575	0.305000	0.20034	GGC	.		0.672	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
BBS1	582	hgsc.bcm.edu;bcgsc.ca	37	11	66283057	66283057	+	Splice_Site	SNP	G	G	T	rs376894444		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:66283057G>T	ENST00000318312.7	+	5	530	c.479G>T	c.(478-480)cGg>cTg	p.R160L	BBS1_ENST00000393994.2_Splice_Site_p.R160L|CTD-3074O7.11_ENST00000419755.3_Splice_Site_p.R197L|BBS1_ENST00000455748.2_Intron|BBS1_ENST00000529766.1_3'UTR|BBS1_ENST00000537537.1_Intron	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	160			R -> Q (in BBS1). {ECO:0000269|PubMed:15770229, ECO:0000269|PubMed:21344540}.		cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						GAGAGCATCCGGTGAGAGGCT	0.587									Bardet-Biedl syndrome																												p.R160L	GBM(152;173 2612 9770 10137)	.											.	BBS1	91	0			c.G479T						.						112.0	101.0	105.0					11																	66283057		2200	4295	6495	SO:0001630	splice_region_variant	582	exon5	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	GCATCCGGTGAGA	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.479+1G>T	11.37:g.66283057G>T		132.0	0.0		195.0	8.0	NM_024649	Q32MM9|Q32MN0|Q96SN4	Missense_Mutation	SNP	ENST00000318312.7	37	CCDS8142.1	.	.	.	.	.	.	.	.	.	.	G	32	5.135798	0.94517	.	.	ENSG00000256349;ENSG00000174483;ENSG00000174483;ENSG00000174483;ENSG00000174483	ENST00000419755;ENST00000318312;ENST00000525809;ENST00000393994;ENST00000524705	D;D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87;-2.87	5.25	5.25	0.73442	.	.	.	.	.	D	0.94528	0.8238	M	0.67569	2.06	0.80722	D	1	D;D;D;D	0.76494	0.996;0.992;0.999;0.999	D;D;D;D	0.79108	0.992;0.91;0.977;0.977	D	0.94926	0.8078	9	0.72032	D	0.01	.	16.4108	0.83712	0.0:0.0:1.0:0.0	.	160;48;160;197	Q32MM9;Q4G0L2;Q8NFJ9;Q8NFJ9-2	.;.;BBS1_HUMAN;.	L	197;160;69;160;67	ENSP00000398526:R197L;ENSP00000317469:R160L;ENSP00000431187:R69L;ENSP00000377563:R160L;ENSP00000436927:R67L	ENSP00000317469:R160L	R	+	2	0	BBS1;CTD-3074O7.11	66039633	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	7.932000	0.87634	2.452000	0.82932	0.558000	0.71614	CGG	.		0.587	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393235.2		Missense_Mutation
BIRC6	57448	hgsc.bcm.edu;bcgsc.ca	37	2	32678911	32678911	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:32678911G>T	ENST00000421745.2	+	23	4788	c.4654G>T	c.(4654-4656)Ggt>Tgt	p.G1552C		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1552					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AGCTGCTGAGGGTAGTTTCAC	0.388																																					p.G1552C	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6	233	0			c.G4654T						.						205.0	190.0	195.0					2																	32678911		2203	4300	6503	SO:0001583	missense	57448	exon23			GCTGAGGGTAGTT	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.4654G>T	2.37:g.32678911G>T	ENSP00000393596:p.Gly1552Cys	176.0	0.0		152.0	8.0	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	G	20.8	4.045012	0.75846	.	.	ENSG00000115760	ENST00000421745	T	0.74947	-0.89	5.51	5.51	0.81932	.	0.063521	0.64402	D	0.000009	T	0.80633	0.4660	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.68765	0.96	T	0.80251	-0.1460	10	0.45353	T	0.12	.	19.4105	0.94670	0.0:0.0:1.0:0.0	.	1552	Q9NR09	BIRC6_HUMAN	C	1552	ENSP00000393596:G1552C	ENSP00000393596:G1552C	G	+	1	0	BIRC6	32532415	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.987000	0.88182	2.593000	0.87608	0.585000	0.79938	GGT	.		0.388	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
BMX	660	hgsc.bcm.edu;bcgsc.ca	37	X	15534284	15534284	+	Silent	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:15534284C>T	ENST00000357607.2	+	5	563	c.375C>T	c.(373-375)ttC>ttT	p.F125F	BMX_ENST00000463891.1_3'UTR|BMX_ENST00000342014.6_Silent_p.F125F|BMX_ENST00000348343.6_Silent_p.F125F			P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	125					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)|signal transduction (GO:0007165)	cytosol (GO:0005829)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(14)|ovary(2)|urinary_tract(3)	30	Hepatocellular(33;0.183)					GTGGGTTCTTCGTGGACGGGA	0.512																																					p.F125F		.											.	BMX	541	0			c.C375T						.						169.0	152.0	158.0					X																	15534284		2203	4300	6503	SO:0001819	synonymous_variant	660	exon5			GTTCTTCGTGGAC	AF045459	CCDS14168.1	Xp22.2	2013-05-14			ENSG00000102010	ENSG00000102010		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1079	protein-coding gene	gene with protein product	"""BTK-like on X chromosome"""	300101				7970727	Standard	NM_203281		Approved	ETK, PSCTK3	uc004cwx.4	P51813	OTTHUMG00000021180	ENST00000357607.2:c.375C>T	X.37:g.15534284C>T		177.0	0.0		89.0	4.0	NM_001721	A6NIH9|O60564|Q12871	Silent	SNP	ENST00000357607.2	37	CCDS14168.1																																																																																			.		0.512	BMX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055877.1	NM_001721	
BOC	91653	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	3	112987288	112987288	+	Silent	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:112987288C>T	ENST00000495514.1	+	5	1223	c.519C>T	c.(517-519)tcC>tcT	p.S173S	BOC_ENST00000273395.4_Silent_p.S173S|BOC_ENST00000355385.3_Silent_p.S173S			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	173	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			TGGAGGCCTCCAGAGGTGAGT	0.622																																					p.S173S		.											.	BOC	157	0			c.C519T						.						51.0	47.0	48.0					3																	112987288		2203	4300	6503	SO:0001819	synonymous_variant	91653	exon5			GGCCTCCAGAGGT	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.519C>T	3.37:g.112987288C>T		65.0	0.0		68.0	16.0	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Silent	SNP	ENST00000495514.1	37	CCDS2971.1																																																																																			.		0.622	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
C11orf94	143678	hgsc.bcm.edu;bcgsc.ca	37	11	45928125	45928125	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:45928125G>T	ENST00000449465.1	-	3	328	c.292C>A	c.(292-294)Cta>Ata	p.L98I	RP11-618K13.2_ENST00000533218.1_RNA	NM_001080446.2	NP_001073915.2	C9JXX5	CK094_HUMAN	chromosome 11 open reading frame 94	98						extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|ovary(1)|pancreas(1)|prostate(1)	7						TTGGGTCATAGGTGTGCATCA	0.617																																					p.L98I		.											.	.	.	0			c.C292A						.						94.0	96.0	96.0					11																	45928125		1938	4124	6062	SO:0001583	missense	143678	exon3			GTCATAGGTGTGC		CCDS44577.1	11p11.2	2012-08-10			ENSG00000234776	ENSG00000234776			37213	protein-coding gene	gene with protein product							Standard	NM_001080446		Approved		uc001nbs.4	C9JXX5	OTTHUMG00000167004	ENST00000449465.1:c.292C>A	11.37:g.45928125G>T	ENSP00000401498:p.Leu98Ile	87.0	0.0		82.0	4.0	NM_001080446		Missense_Mutation	SNP	ENST00000449465.1	37	CCDS44577.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.908906	0.52439	.	.	ENSG00000234776	ENST00000449465	T	0.55052	0.54	4.66	0.388	0.16264	.	.	.	.	.	T	0.34803	0.0910	.	.	.	0.09310	N	1	B	0.21821	0.061	B	0.19148	0.024	T	0.34551	-0.9824	8	0.87932	D	0	-1.7759	1.1397	0.01762	0.2163:0.3268:0.2903:0.1666	.	98	C9JXX5	CK094_HUMAN	I	98	ENSP00000401498:L98I	ENSP00000401498:L98I	L	-	1	2	C11orf94	45884701	0.000000	0.05858	0.032000	0.17829	0.020000	0.10135	0.050000	0.14120	-0.075000	0.12798	-0.181000	0.13052	CTA	.		0.617	C11orf94-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392395.1	NM_001080446	
C11orf88	399949	hgsc.bcm.edu;bcgsc.ca	37	11	111385715	111385715	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:111385715C>A	ENST00000375618.4	+	1	206	c.206C>A	c.(205-207)cCc>cAc	p.P69H	C11orf88_ENST00000529167.1_Missense_Mutation_p.P69H|MIR34C_ENST00000384831.1_RNA|RP11-794P6.6_ENST00000530283.1_RNA|C11orf88_ENST00000332814.6_Missense_Mutation_p.P69H|BTG4_ENST00000356018.2_5'Flank|MIR34B_ENST00000385076.1_RNA|BTG4_ENST00000525791.1_5'Flank	NM_001100388.1	NP_001093858.1	Q6PI97	CK088_HUMAN	chromosome 11 open reading frame 88	69										endometrium(1)|large_intestine(3)|lung(2)	6						GTGGCGCGGCCCAGGAGGAGC	0.602											OREG0021329	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P69H		.											.	C11orf88	226	0			c.C206A						.						36.0	42.0	40.0					11																	111385715		2153	4278	6431	SO:0001583	missense	399949	exon1			CGCGGCCCAGGAG	BC039505, AK128145	CCDS41712.1, CCDS41713.1	11q23.1	2012-08-10			ENSG00000183644	ENSG00000183644			25061	protein-coding gene	gene with protein product	"""hypothetical gene supported by BC039505"""					12477932	Standard	NM_001100388		Approved	FLJ46266	uc009yyd.3	Q6PI97	OTTHUMG00000166720	ENST00000375618.4:c.206C>A	11.37:g.111385715C>A	ENSP00000364768:p.Pro69His	74.0	0.0	1434	65.0	5.0	NM_001100388	E9PAN0|Q6ZRL3	Missense_Mutation	SNP	ENST00000375618.4	37	CCDS41713.1	.	.	.	.	.	.	.	.	.	.	C	10.29	1.309148	0.23821	.	.	ENSG00000183644	ENST00000375618;ENST00000529167;ENST00000332814	.	.	.	5.09	-1.95	0.07548	.	1.790330	0.02949	N	0.141429	T	0.36496	0.0969	L	0.43152	1.355	0.09310	N	1	P;B	0.34780	0.468;0.12	B;B	0.32289	0.143;0.087	T	0.36407	-0.9749	9	0.46703	T	0.11	2.5614	10.6724	0.45766	0.2192:0.3744:0.4064:0.0	.	69;69	E9PAN0;Q6PI97	.;CK088_HUMAN	H	69	.	ENSP00000333845:P69H	P	+	2	0	C11orf88	110890925	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.351000	0.20096	-0.880000	0.03997	-2.498000	0.00192	CCC	.		0.602	C11orf88-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391181.1	NM_001100388	
C11orf63	79864	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	122830087	122830087	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:122830087A>G	ENST00000531316.1	+	8	2363	c.2271A>G	c.(2269-2271)atA>atG	p.I757M	C11orf63_ENST00000227349.2_Missense_Mutation_p.I757M			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	757					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)					breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		TGCTGGAAATACTGCAGAACA	0.408																																					p.I757M		.											.	C11orf63	93	0			c.A2271G						.						105.0	98.0	100.0					11																	122830087		2202	4299	6501	SO:0001583	missense	79864	exon9			GGAAATACTGCAG	BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.2271A>G	11.37:g.122830087A>G	ENSP00000431669:p.Ile757Met	231.0	1.0		135.0	11.0	NM_024806	A8K6G0|Q96GB5|Q9H5D6	Missense_Mutation	SNP	ENST00000531316.1	37	CCDS8438.1	.	.	.	.	.	.	.	.	.	.	A	13.28	2.190460	0.38707	.	.	ENSG00000109944	ENST00000227349;ENST00000531316	T;T	0.48522	0.81;0.81	5.87	-7.67	0.01272	.	0.794048	0.11658	N	0.542092	T	0.28433	0.0703	L	0.49640	1.575	0.09310	N	0.999993	B	0.28850	0.225	B	0.23574	0.047	T	0.10917	-1.0609	10	0.31617	T	0.26	-0.7287	3.446	0.07481	0.1739:0.2163:0.4272:0.1827	.	757	Q6NUN7	CK063_HUMAN	M	757	ENSP00000227349:I757M;ENSP00000431669:I757M	ENSP00000227349:I757M	I	+	3	3	C11orf63	122335297	0.015000	0.18098	0.225000	0.23894	0.971000	0.66376	-0.784000	0.04633	-1.275000	0.02417	0.482000	0.46254	ATA	.		0.408	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387511.1	NM_024806	
CFAP61	26074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	20055874	20055874	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr20:20055874T>C	ENST00000245957.5	+	5	489	c.413T>C	c.(412-414)cTc>cCc	p.L138P	C20orf26_ENST00000451767.2_Missense_Mutation_p.L138P|C20orf26_ENST00000377306.1_Missense_Mutation_p.L138P|C20orf26_ENST00000389656.3_5'UTR|C20orf26_ENST00000377309.2_5'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		138										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		TTCATATTTCTCATCGTGCCA	0.522																																					p.L138P		.											.	C20orf26	94	0			c.T413C						.						175.0	149.0	158.0					20																	20055874		2203	4300	6503	SO:0001583	missense	26074	exon5			TATTTCTCATCGT																												ENST00000245957.5:c.413T>C	20.37:g.20055874T>C	ENSP00000245957:p.Leu138Pro	218.0	0.0		140.0	42.0	NM_015585	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	37	CCDS33447.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.265822	0.80358	.	.	ENSG00000089101	ENST00000340348;ENST00000343997;ENST00000389655;ENST00000245957;ENST00000377306;ENST00000377303;ENST00000451767;ENST00000472660	T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.62768	0.2455	M	0.72894	2.215	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;0.999	T	0.66528	-0.5901	10	0.87932	D	0	.	12.3497	0.55141	0.0:0.0:0.0:1.0	.	138;138;92;138	Q8NHU2-3;F8W6K4;F8W6E2;Q8NHU2	.;.;.;CT026_HUMAN	P	92;138;138;138;138;138;138;34	ENSP00000345553:L92P;ENSP00000245957:L138P;ENSP00000366521:L138P;ENSP00000366518:L138P;ENSP00000414537:L138P;ENSP00000420498:L34P	ENSP00000245957:L138P	L	+	2	0	C20orf26	20003874	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	4.704000	0.61831	2.178000	0.69098	0.533000	0.62120	CTC	.		0.522	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3		
C2orf44	80304	hgsc.bcm.edu;bcgsc.ca	37	2	24261602	24261602	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:24261602C>A	ENST00000295148.4	-	2	820	c.763G>T	c.(763-765)Ggt>Tgt	p.G255C	C2orf44_ENST00000406895.3_Missense_Mutation_p.G255C	NM_025203.2	NP_079479.1	Q9H6R7	CB044_HUMAN	chromosome 2 open reading frame 44	255									C2orf44/ALK(2)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGTACTTCACCAATAACTGGT	0.378			T	ALK	NSCLC																																p.G255C		.		Dom	yes		2	2p23.3	80304	chromosome 2 open reading frame 44		E	.	C2orf44	154	0			c.G763T						.						84.0	83.0	84.0					2																	24261602		2203	4300	6503	SO:0001583	missense	80304	exon2			CTTCACCAATAAC	AK025598	CCDS1705.1, CCDS46229.1	2p23.3	2012-07-30			ENSG00000163026	ENSG00000163026			26157	protein-coding gene	gene with protein product						22327622	Standard	NM_025203		Approved	FLJ21945	uc002rep.2	Q9H6R7	OTTHUMG00000125498	ENST00000295148.4:c.763G>T	2.37:g.24261602C>A	ENSP00000295148:p.Gly255Cys	121.0	0.0		112.0	5.0	NM_025203	D6W532|Q8IYK0|Q9HBP5	Missense_Mutation	SNP	ENST00000295148.4	37	CCDS1705.1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.387681	0.25031	.	.	ENSG00000163026	ENST00000295148;ENST00000406895	T;T	0.48201	0.82;0.82	5.51	1.67	0.24075	WD40/YVTN repeat-like-containing domain (1);	0.820821	0.11399	N	0.568010	T	0.38453	0.1041	N	0.08118	0	0.09310	N	1	D;D	0.63046	0.992;0.992	P;P	0.53360	0.724;0.724	T	0.33599	-0.9862	10	0.62326	D	0.03	-0.0589	10.773	0.46334	0.0:0.7279:0.0:0.2721	.	255;255	Q9H6R7-2;Q9H6R7	.;CB044_HUMAN	C	255	ENSP00000295148:G255C;ENSP00000385816:G255C	ENSP00000295148:G255C	G	-	1	0	C2orf44	24115106	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	1.518000	0.35877	0.394000	0.25230	-0.136000	0.14681	GGT	.		0.378	C2orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246825.1	NM_025203	
CATIP	375307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	219222293	219222293	+	Missense_Mutation	SNP	C	C	T	rs369378162		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:219222293C>T	ENST00000289388.3	+	3	184	c.155C>T	c.(154-156)aCg>aTg	p.T52M	AC021016.8_ENST00000411433.1_RNA	NM_198559.1	NP_940961.1	Q7Z7H3	CATIP_HUMAN		52					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTCTCTGAGACGCTGGCCATG	0.577																																					p.T52M		.											.	C2orf62	68	0			c.C155T						.	C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	43.0	40.0	41.0		155	4.3	0.9	2		41	0,8600		0,0,4300	no	missense	C2orf62	NM_198559.1	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	52/388	219222293	1,13005	2203	4300	6503	SO:0001583	missense	375307	exon3			CTGAGACGCTGGC																												ENST00000289388.3:c.155C>T	2.37:g.219222293C>T	ENSP00000289388:p.Thr52Met	111.0	0.0		109.0	13.0	NM_198559		Missense_Mutation	SNP	ENST00000289388.3	37	CCDS2414.1	.	.	.	.	.	.	.	.	.	.	C	13.91	2.378286	0.42207	2.27E-4	0.0	ENSG00000158428	ENST00000289388	.	.	.	4.32	4.32	0.51571	.	0.058136	0.64402	D	0.000001	T	0.68650	0.3024	M	0.67953	2.075	0.33075	D	0.535836	D	0.89917	1.0	D	0.91635	0.999	T	0.77571	-0.2538	9	0.87932	D	0	-18.5541	12.4741	0.55803	0.0:1.0:0.0:0.0	.	52	Q7Z7H3	CB062_HUMAN	M	52	.	ENSP00000289388:T52M	T	+	2	0	C2orf62	218930537	0.953000	0.32496	0.900000	0.35374	0.025000	0.11179	2.350000	0.44063	2.398000	0.81561	0.462000	0.41574	ACG	.		0.577	C2orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256771.1		
C3P1	388503	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10157854	10157854	+	RNA	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:10157854A>G	ENST00000495140.1	+	0	1170							Q6ZMU1	C3P1_HUMAN	complement component 3 precursor pseudogene							extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)			endometrium(4)|large_intestine(2)|lung(6)|urinary_tract(1)	13						ACCACGTGGCAGTTTGTGGTG	0.552																																					.		.											.	C3P1	90	0			.						.						306.0	294.0	298.0					19																	10157854		2086	4208	6294			388503	.			CGTGGCAGTTTGT	AK131489		19p13.2	2009-04-08			ENSG00000167798	ENSG00000167798			34414	pseudogene	pseudogene							Standard	NR_027300		Approved	CPLP	uc010dwx.2	Q6ZMU1	OTTHUMG00000158555		19.37:g.10157854A>G		184.0	0.0		205.0	47.0	.		RNA	SNP	ENST00000495140.1	37																																																																																				.		0.552	C3P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000351284.1	NR_027300	
CADM1	23705	hgsc.bcm.edu;bcgsc.ca	37	11	115109361	115109361	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:115109361T>C	ENST00000452722.3	-	3	303	c.283A>G	c.(283-285)Agc>Ggc	p.S95G	CADM1_ENST00000536727.1_Missense_Mutation_p.S95G|CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000537058.1_Missense_Mutation_p.S95G|CADM1_ENST00000331581.6_Missense_Mutation_p.S95G|CADM1_ENST00000542447.2_Missense_Mutation_p.S95G	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		TGAAACCTGCTGTCCTTCAAA	0.373																																					p.S95G		.											.	CADM1	92	0			c.A283G						.						69.0	69.0	69.0					11																	115109361		2201	4296	6497	SO:0001583	missense	23705	exon3			ACCTGCTGTCCTT	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.283A>G	11.37:g.115109361T>C	ENSP00000395359:p.Ser95Gly	129.0	0.0		86.0	4.0	NM_014333		Missense_Mutation	SNP	ENST00000452722.3	37	CCDS8373.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.01|17.01	3.280362|3.280362	0.59758|0.59758	.|.	.|.	ENSG00000182985|ENSG00000182985	ENST00000545380|ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000404468;ENST00000331581;ENST00000545094	.|T;T;T;T;T;T	.|0.59364	.|0.27;0.27;0.27;0.27;0.27;0.27	5.81|5.81	5.81|5.81	0.92471|0.92471	.|Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.173783	.|0.64402	.|D	.|0.000010	T|T	0.62551|0.62551	0.2437|0.2437	M|M	0.62723|0.62723	1.935|1.935	0.51482|0.51482	D|D	0.99992|0.99992	.|P;D;P;B;P	.|0.52996	.|0.942;0.957;0.866;0.447;0.649	.|P;P;P;B;B	.|0.49276	.|0.543;0.57;0.605;0.439;0.222	T|T	0.60058|0.60058	-0.7337|-0.7337	5|10	.|0.22109	.|T	.|0.4	.|.	16.167|16.167	0.81768|0.81768	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|95;95;96;95;95	.|Q9BY67-2;F5H0J4;A4FVB5;Q9BY67;A0A4Z1	.|.;.;.;CADM1_HUMAN;.	R|G	93|95;95;95;95;54;95;62	.|ENSP00000439176:S95G;ENSP00000395359:S95G;ENSP00000439817:S95G;ENSP00000440322:S95G;ENSP00000329797:S95G;ENSP00000439696:S62G	.|ENSP00000329797:S95G	Q|S	-|-	2|1	0|0	CADM1|CADM1	114614571|114614571	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	2.046000|2.046000	0.41260|0.41260	2.214000|2.214000	0.71695|0.71695	0.528000|0.528000	0.53228|0.53228	CAG|AGC	.		0.373	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
CAMKK2	10645	hgsc.bcm.edu;bcgsc.ca	37	12	121701741	121701741	+	Splice_Site	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:121701741A>G	ENST00000324774.5	-	6	1455	c.627T>C	c.(625-627)cgT>cgC	p.R209R	CAMKK2_ENST00000404169.3_Splice_Site_p.R209R|CAMKK2_ENST00000347034.2_Splice_Site_p.R209R|CAMKK2_ENST00000535524.1_Intron|CAMKK2_ENST00000337174.3_Splice_Site_p.R209R|CAMKK2_ENST00000392474.2_Splice_Site_p.R209R|CAMKK2_ENST00000538733.1_Splice_Site_p.R209R|CAMKK2_ENST00000446440.2_Splice_Site_p.R209R|CAMKK2_ENST00000392473.2_Splice_Site_p.R209R|CAMKK2_ENST00000412367.2_Splice_Site_p.R209R|CAMKK2_ENST00000402834.4_Splice_Site_p.R209R	NM_006549.3	NP_006540.3	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase kinase 2, beta	209	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|RP domain.				calcium-mediated signaling (GO:0019722)|MAPK cascade (GO:0000165)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GTGGAGGGCGACCTGAAGGAA	0.602																																					p.R209R		.											.	CAMKK2	450	0			c.T627C						.						20.0	19.0	19.0					12																	121701741		2203	4297	6500	SO:0001630	splice_region_variant	10645	exon6			AGGGCGACCTGAA	AF101264	CCDS9216.1, CCDS9217.1, CCDS9218.1, CCDS9219.1, CCDS44999.1, CCDS53837.1, CCDS58283.1	12q24.2	2002-08-13				ENSG00000110931			1470	protein-coding gene	gene with protein product		615002				9662074	Standard	NM_172226		Approved	CAMKK, KIAA0787, CAMKKB, MGC15254	uc001tzu.3	Q96RR4		ENST00000324774.5:c.626-1T>C	12.37:g.121701741A>G		62.0	0.0		76.0	4.0	NM_153500	A8K7Q7|O94883|Q8IUG2|Q8IUG3|Q8N3I4|Q8WY03|Q8WY04|Q8WY05|Q8WY06|Q96RP1|Q96RP2|Q96RR3|Q9BWE9|Q9UER3|Q9UES2|Q9Y5N2	Silent	SNP	ENST00000324774.5	37	CCDS9216.1																																																																																			.		0.602	CAMKK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402563.1	NM_172226	Silent
CAMSAP2	23271	hgsc.bcm.edu;bcgsc.ca	37	1	200708967	200708967	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:200708967T>C	ENST00000236925.4	+	1	61	c.12T>C	c.(10-12)gcT>gcC	p.A4A	CAMSAP2_ENST00000358823.2_Silent_p.A4A|CAMSAP2_ENST00000413307.2_Silent_p.A4A			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	4					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										TGGGGGATGCTGCAGACCCCA	0.592																																					p.A4A		.											.	.	.	0			c.T12C						.						91.0	74.0	80.0					1																	200708967		2203	4300	6503	SO:0001819	synonymous_variant	23271	exon1			GGATGCTGCAGAC	AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.12T>C	1.37:g.200708967T>C		175.0	0.0		184.0	8.0	NM_203459	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Silent	SNP	ENST00000236925.4	37																																																																																				.		0.592	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086956.2	NM_203459	
CAPS2	84698	hgsc.bcm.edu;bcgsc.ca	37	12	75683540	75683540	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:75683540T>C	ENST00000409445.3	-	15	1509	c.1313A>G	c.(1312-1314)aAa>aGa	p.K438R	CAPS2_ENST00000409004.1_5'UTR|CAPS2_ENST00000393284.3_Missense_Mutation_p.K206R|CAPS2_ENST00000409799.1_Missense_Mutation_p.K356R|CAPS2_ENST00000442339.2_Missense_Mutation_p.K28R|RP11-560G2.1_ENST00000549953.1_RNA	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	438							calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						TTTATGTAGTTTTTCTTTTAG	0.313																																					p.K438R		.											.	CAPS2	92	0			c.A1313G						.						98.0	99.0	99.0					12																	75683540		2201	4299	6500	SO:0001583	missense	84698	exon15			TGTAGTTTTTCTT	AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.1313A>G	12.37:g.75683540T>C	ENSP00000386959:p.Lys438Arg	107.0	0.0		98.0	4.0	NM_032606	Q6PH84|Q8N242|Q8NAY5	Missense_Mutation	SNP	ENST00000409445.3	37	CCDS9008.2	.	.	.	.	.	.	.	.	.	.	T	12.25	1.880475	0.33255	.	.	ENSG00000180881	ENST00000409799;ENST00000409445;ENST00000378703;ENST00000393284;ENST00000442339	T;T;T;T	0.24908	1.91;1.88;1.88;1.83	5.58	5.58	0.84498	.	0.373187	0.26995	N	0.021444	T	0.16811	0.0404	N	0.15975	0.35	0.24863	N	0.992339	B;B;B;B;B	0.17852	0.002;0.004;0.016;0.008;0.024	B;B;B;B;B	0.29077	0.021;0.025;0.02;0.046;0.098	T	0.24512	-1.0158	10	0.16420	T	0.52	-1.8459	12.507	0.55987	0.0:0.0:0.1486:0.8513	.	28;206;174;438;356	A2RRN2;Q9BXY5-2;Q9BXY5-3;Q9BXY5;B9A061	.;.;.;CAYP2_HUMAN;.	R	356;438;174;206;28	ENSP00000386977:K356R;ENSP00000386959:K438R;ENSP00000376963:K206R;ENSP00000389633:K28R	ENSP00000367975:K174R	K	-	2	0	CAPS2	73969807	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	2.585000	0.46111	2.120000	0.65058	0.533000	0.62120	AAA	.		0.313	CAPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327880.2		
CBS	875	broad.mit.edu;ucsc.edu;mdanderson.org	37	21	44488625	44488625	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr21:44488625C>A	ENST00000398165.3	-	4	569	c.310G>T	c.(310-312)Gag>Tag	p.E104*	CBS_ENST00000352178.5_Nonsense_Mutation_p.E104*|CBS_ENST00000359624.3_Nonsense_Mutation_p.E104*|CBS_ENST00000544202.1_Nonsense_Mutation_p.E16*|CBS_ENST00000398158.1_Nonsense_Mutation_p.E104*|CBS_ENST00000398168.1_Nonsense_Mutation_p.E104*|CBS_ENST00000470912.1_5'UTR	NM_000071.2	NP_000062.1	P35520	CBS_HUMAN	cystathionine-beta-synthase	104					cellular nitrogen compound metabolic process (GO:0034641)|cysteine biosynthetic process from serine (GO:0006535)|cysteine biosynthetic process via cystathionine (GO:0019343)|homocysteine catabolic process (GO:0043418)|homocysteine metabolic process (GO:0050667)|hydrogen sulfide biosynthetic process (GO:0070814)|L-cysteine catabolic process (GO:0019448)|L-serine catabolic process (GO:0006565)|L-serine metabolic process (GO:0006563)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|transsulfuration (GO:0019346)	cytosol (GO:0005829)|nucleus (GO:0005634)	adenyl nucleotide binding (GO:0030554)|cystathionine beta-synthase activity (GO:0004122)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|modified amino acid binding (GO:0072341)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(8)	17					L-Cysteine(DB00151)|L-Serine(DB00133)|S-Adenosylmethionine(DB00118)	TCACAGAGCTCACACTTCAGG	0.547																																					p.E104X		.											.	CBS	90	0			c.G310T						.						93.0	90.0	91.0					21																	44488625		2203	4300	6503	SO:0001587	stop_gained	875	exon4			AGAGCTCACACTT	L14577	CCDS13693.1	21q22.3	2014-09-17			ENSG00000160200	ENSG00000160200	4.2.1.22		1550	protein-coding gene	gene with protein product		613381				9790750	Standard	NM_000071		Approved	HIP4	uc002zcv.2	P35520	OTTHUMG00000086834	ENST00000398165.3:c.310G>T	21.37:g.44488625C>A	ENSP00000381231:p.Glu104*	226.0	1.0		150.0	54.0	NM_000071	B2R993|D3DSK4|Q99425|Q9BWC5	Nonsense_Mutation	SNP	ENST00000398165.3	37	CCDS13693.1	.	.	.	.	.	.	.	.	.	.	C	36	5.828942	0.96996	.	.	ENSG00000160200	ENST00000398158;ENST00000398165;ENST00000359624;ENST00000352178;ENST00000398168;ENST00000539520;ENST00000544202;ENST00000441030	.	.	.	4.81	3.89	0.44902	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-54.274	13.0422	0.58906	0.0:0.8378:0.1622:0.0	.	.	.	.	X	104;104;104;104;104;61;16;104	.	ENSP00000344460:E104X	E	-	1	0	CBS	43361694	1.000000	0.71417	0.959000	0.39883	0.350000	0.29205	6.493000	0.73658	1.087000	0.41251	0.655000	0.94253	GAG	.		0.547	CBS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195525.1	NM_000071	
CBX7	23492	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	39530449	39530449	+	Silent	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr22:39530449C>T	ENST00000216133.5	-	5	760	c.555G>A	c.(553-555)gcG>gcA	p.A185A	CBX7_ENST00000401405.3_Silent_p.A92A|CBX7_ENST00000475962.1_Intron	NM_175709.3	NP_783640.1	O95931	CBX7_HUMAN	chromobox homolog 7	185					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|sebaceous gland development (GO:0048733)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|single-stranded RNA binding (GO:0003727)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7	Melanoma(58;0.04)					ACTCGCCAGCCGCCTGCAGGA	0.687																																					p.A185A	GBM(46;845 904 3560 9866 23971)	.											.	CBX7	227	0			c.G555A						.						13.0	17.0	16.0					22																	39530449		2151	4240	6391	SO:0001819	synonymous_variant	23492	exon5			GCCAGCCGCCTGC		CCDS13986.1	22q13.1	2010-07-06			ENSG00000100307	ENSG00000100307			1557	protein-coding gene	gene with protein product		608457					Standard	NM_175709		Approved		uc003axb.3	O95931	OTTHUMG00000150418	ENST00000216133.5:c.555G>A	22.37:g.39530449C>T		88.0	0.0		56.0	20.0	NM_175709	Q86T17	Silent	SNP	ENST00000216133.5	37	CCDS13986.1																																																																																			.		0.687	CBX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318020.1	NM_175709	
DRC1	92749	hgsc.bcm.edu;bcgsc.ca	37	2	26624926	26624926	+	Silent	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:26624926C>T	ENST00000288710.2	+	1	143	c.69C>T	c.(67-69)ctC>ctT	p.L23L		NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	23					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)											CCCAGATTCTCGCGCCCTCGG	0.697																																					p.L23L		.											.	CCDC164	92	0			c.C69T						.						35.0	31.0	32.0					2																	26624926		2203	4300	6503	SO:0001819	synonymous_variant	92749	exon1			GATTCTCGCGCCC	AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.69C>T	2.37:g.26624926C>T		122.0	0.0		64.0	4.0	NM_145038	A8K1N8|Q53R91|Q53TA3|Q8NDI5	Silent	SNP	ENST00000288710.2	37	CCDS1723.1																																																																																			.		0.697	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246862.1	NM_145038	
CCDC22	28952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	49105132	49105132	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:49105132G>T	ENST00000376227.3	+	12	1538	c.1368G>T	c.(1366-1368)ctG>ctT	p.L456L		NM_014008.3	NP_054727.1	O60826	CCD22_HUMAN	coiled-coil domain containing 22	456										NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	18						TCCAAGAACTGCACCAGAGTG	0.602																																					p.L456L		.											.	CCDC22	130	0			c.G1368T						.						32.0	33.0	33.0					X																	49105132		2197	4296	6493	SO:0001819	synonymous_variant	28952	exon12			AGAACTGCACCAG	BC000972	CCDS14322.1	Xp11.23	2008-02-05	2005-07-24	2005-07-24	ENSG00000101997	ENSG00000101997			28909	protein-coding gene	gene with protein product		300859	"""chromosome X open reading frame 37"""	CXorf37		12477932	Standard	NM_014008		Approved	JM1	uc004dnd.2	O60826	OTTHUMG00000024141	ENST00000376227.3:c.1368G>T	X.37:g.49105132G>T		260.0	0.0		174.0	35.0	NM_014008	A8K7G1	Silent	SNP	ENST00000376227.3	37	CCDS14322.1																																																																																			.		0.602	CCDC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060822.1	NM_014008	
CCDC61	729440	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	46498359	46498359	+	5'Flank	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:46498359C>A	ENST00000595358.1	+	0	0				CCDC61_ENST00000536603.1_5'Flank|CCDC61_ENST00000263284.2_Silent_p.L7L	NM_001267723.1	NP_001254652.1	Q9Y6R9	CCD61_HUMAN	coiled-coil domain containing 61							centrosome (GO:0005813)				endometrium(3)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00221)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.164)		ACACCCGGCTCTCCCTTCCAG	0.617																																					.		.											.	CCDC61	23	0			.						.						18.0	18.0	18.0					19																	46498359		1922	4117	6039	SO:0001631	upstream_gene_variant	729440	.			CCGGCTCTCCCTT		CCDS46120.1, CCDS46120.2	19q13.32	2014-09-04			ENSG00000104983	ENSG00000104983			33629	protein-coding gene	gene with protein product							Standard	NM_001267723		Approved		uc031rlj.1	Q9Y6R9	OTTHUMG00000182488		19.37:g.46498359C>A	Exception_encountered	86.0	0.0		59.0	11.0	.	C8CAP4|Q9HDB6	Silent	SNP	ENST00000595358.1	37	CCDS46120.2																																																																																			.		0.617	CCDC61-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461689.1	NM_001080402	
CCL15	6359	ucsc.edu;bcgsc.ca	37	17	34325404	34325404	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:34325404A>G	ENST00000354059.4	-	3	712	c.160T>C	c.(160-162)Tgc>Cgc	p.C54R	CCL14_ENST00000536149.1_5'UTR|CCL15-CCL14_ENST00000481427.2_Missense_Mutation_p.C54R	NM_032965.4	NP_116741.1	Q16663	CCL15_HUMAN	chemokine (C-C motif) ligand 15	54					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|immune response (GO:0006955)|positive chemotaxis (GO:0050918)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)|receptor binding (GO:0005102)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TAGGAGGTGCAGCAGTCAGCA	0.502																																					p.C54R		.											.	CCL15	91	0			c.T160C						.						71.0	62.0	65.0					17																	34325404		2203	4300	6503	SO:0001583	missense	6359	exon3			AGGTGCAGCAGTC	AF031587	CCDS11304.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000267596	ENSG00000275718		"""Chemokine ligands"", ""Endogenous ligands"""	10613	protein-coding gene	gene with protein product	"""leukotactin 1"", ""CC chemokine 3"", ""macrophage inflammatory protein 5"", ""chemokine CC-2"", ""MIP-1 delta"""	601393	"""small inducible cytokine subfamily A (Cys-Cys), member 15"""	SCYA15		8661057	Standard	NM_032965		Approved	HCC-2, NCC-3, SCYL3, MIP-5, Lkn-1, MIP-1d, HMRP-2B	uc010wcu.2	Q16663	OTTHUMG00000188406	ENST00000354059.4:c.160T>C	17.37:g.34325404A>G	ENSP00000293276:p.Cys54Arg	51.0	0.0		41.0	4.0	NM_032965	B2RU34|E1P651|Q9UM74	Missense_Mutation	SNP	ENST00000354059.4	37	CCDS11304.1	.	.	.	.	.	.	.	.	.	.	A	18.15	3.560308	0.65538	.	.	ENSG00000161574	ENST00000354059	D	0.86097	-2.07	4.55	4.55	0.56014	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.000000	0.85682	D	0.000000	D	0.94301	0.8169	H	0.97131	3.945	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95076	0.8209	10	0.87932	D	0	.	10.4703	0.44633	1.0:0.0:0.0:0.0	.	54	Q16663	CCL15_HUMAN	R	54	ENSP00000293276:C54R	ENSP00000293276:C54R	C	-	1	0	CCL15	31349517	1.000000	0.71417	0.999000	0.59377	0.236000	0.25371	4.465000	0.60141	2.030000	0.59900	0.533000	0.62120	TGC	.		0.502	CCL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256584.2	NM_004167	
CCNB1IP1	57820	ucsc.edu;bcgsc.ca	37	14	20784551	20784551	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr14:20784551T>C	ENST00000398169.3	-	5	748	c.132A>G	c.(130-132)tcA>tcG	p.S44S	CCNB1IP1_ENST00000358932.4_Silent_p.S44S|CCNB1IP1_ENST00000353689.4_Silent_p.S44S|CCNB1IP1_ENST00000437553.2_Silent_p.S44S|CCNB1IP1_ENST00000398160.2_Silent_p.S44S|CCNB1IP1_ENST00000398163.2_Silent_p.S44S			Q9NPC3	CIP1_HUMAN	cyclin B1 interacting protein 1, E3 ubiquitin protein ligase	44					blastocyst formation (GO:0001825)|chiasma assembly (GO:0051026)|protein ubiquitination (GO:0016567)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		HMGA2/CCNB1IP1(2)	breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	9	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;8.86e-07)|all cancers(55;4.98e-06)	GBM - Glioblastoma multiforme(265;0.0164)		AGATAGCTGGTGAGCGACTAA	0.473			T	HMGA2	leiomyoma																																p.S44S		.		Dom	yes		14	14q11.2	57820	"""cyclin B1 interacting protein 1, E3 ubiquitin protein ligase"""		M	.	CCNB1IP1	659	0			c.A132G						.						114.0	101.0	105.0					14																	20784551		2203	4300	6503	SO:0001819	synonymous_variant	57820	exon6			AGCTGGTGAGCGA	AF216381	CCDS9547.1	14q11.2	2014-02-04	2011-01-31	2004-01-14	ENSG00000100814	ENSG00000100814			19437	protein-coding gene	gene with protein product	"""human enhancer of invasion 10"""	608249	"""chromosome 14 open reading frame 18"", ""cyclin B1 interacting protein 1"""	C14orf18		12612082, 21779533	Standard	NM_021178		Approved	HEI10	uc001vwy.4	Q9NPC3	OTTHUMG00000029509	ENST00000398169.3:c.132A>G	14.37:g.20784551T>C		76.0	1.0		43.0	4.0	NM_182852		Silent	SNP	ENST00000398169.3	37	CCDS9547.1																																																																																			.		0.473	CCNB1IP1-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073538.3	NM_021178, NM_182849, NM_182851, NM_182852	
CCPG1	9236	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	55664085	55664085	+	Silent	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr15:55664085C>T	ENST00000310958.6	-	6	910	c.612G>A	c.(610-612)aaG>aaA	p.K204K	DYX1C1-CCPG1_ENST00000565113.1_RNA|MIR628_ENST00000385229.1_RNA|CCPG1_ENST00000442196.3_Silent_p.K204K|CCPG1_ENST00000425574.3_Silent_p.K204K|CCPG1_ENST00000569205.1_Silent_p.K204K	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1	204	Interaction with MCF2L and SRC. {ECO:0000250}.				cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)				autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		TACTCAACTCCTTAGAAGGTT	0.448																																					p.K204K		.											.	CCPG1	91	0			c.G612A						.						114.0	103.0	106.0					15																	55664085		1876	4107	5983	SO:0001819	synonymous_variant	9236	exon6			CAACTCCTTAGAA	AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.612G>A	15.37:g.55664085C>T		271.0	0.0		204.0	34.0	NM_020739	A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Silent	SNP	ENST00000310958.6	37	CCDS42039.1																																																																																			.		0.448	CCPG1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419850.1	NM_004748	
CCR9	10803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	45942794	45942794	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:45942794A>G	ENST00000357632.2	+	3	694	c.514A>G	c.(514-516)Atc>Gtc	p.I172V	CCR9_ENST00000395963.2_Missense_Mutation_p.I160V|LZTFL1_ENST00000536047.1_Intron|LZTFL1_ENST00000539217.1_Intron|CCR9_ENST00000355983.2_Missense_Mutation_p.I160V|CCR9_ENST00000422395.1_3'UTR|Y_RNA_ENST00000364765.1_RNA	NM_001256369.1|NM_031200.2	NP_001243298.1|NP_112477.1	P51686	CCR9_HUMAN	chemokine (C-C motif) receptor 9	172					cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(4)|large_intestine(8)|lung(2)|ovary(2)|prostate(2)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.00118)|KIRC - Kidney renal clear cell carcinoma(197;0.0182)|Kidney(197;0.0214)		TTGCTTTACCATCTGGGTATT	0.488																																					p.I172V		.											.	CCR9	660	0			c.A514G						.						77.0	78.0	78.0					3																	45942794		2203	4300	6503	SO:0001583	missense	10803	exon3			TTTACCATCTGGG	AJ132337	CCDS2732.1, CCDS2733.1	3p21.31	2012-09-20			ENSG00000173585	ENSG00000173585		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1610	protein-coding gene	gene with protein product		604738		GPR28		10229797	Standard	NM_006641		Approved	GPR-9-6, CDw199	uc003coz.2	P51686	OTTHUMG00000133450	ENST00000357632.2:c.514A>G	3.37:g.45942794A>G	ENSP00000350256:p.Ile172Val	106.0	0.0		72.0	20.0	NM_031200	Q4VBM3|Q549E0|Q9UQQ6	Missense_Mutation	SNP	ENST00000357632.2	37	CCDS2732.1	.	.	.	.	.	.	.	.	.	.	A	0.011	-1.737593	0.00681	.	.	ENSG00000173585	ENST00000357632;ENST00000395963;ENST00000355983	T;T;T	0.70282	-0.47;-0.47;-0.47	4.96	-1.93	0.07594	GPCR, rhodopsin-like superfamily (1);	0.392917	0.25860	N	0.027824	T	0.41743	0.1172	N	0.10664	0.02	0.21355	N	0.999711	B	0.02656	0.0	B	0.12156	0.007	T	0.35500	-0.9786	10	0.02654	T	1	.	12.8268	0.57725	0.3575:0.0:0.6425:0.0	.	172	P51686	CCR9_HUMAN	V	172;160;160	ENSP00000350256:I172V;ENSP00000379292:I160V;ENSP00000348260:I160V	ENSP00000348260:I160V	I	+	1	0	CCR9	45917798	0.726000	0.28059	0.013000	0.15412	0.503000	0.33858	1.040000	0.30278	-0.630000	0.05567	-0.376000	0.06991	ATC	.		0.488	CCR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257323.2		
CCT3	7203	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156280946	156280946	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:156280946C>T	ENST00000295688.3	-	12	1476	c.1196G>A	c.(1195-1197)cGc>cAc	p.R399H	CCT3_ENST00000368261.3_Missense_Mutation_p.R354H|CCT3_ENST00000472765.2_Missense_Mutation_p.R354H|CCT3_ENST00000368259.2_Missense_Mutation_p.R361H	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	399					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					GAGAACATTGCGACACACTTG	0.537																																					p.R399H		.											.	CCT3	92	0			c.G1196A						.						76.0	73.0	74.0					1																	156280946		2203	4300	6503	SO:0001583	missense	7203	exon12			ACATTGCGACACA	BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.1196G>A	1.37:g.156280946C>T	ENSP00000295688:p.Arg399His	141.0	0.0		157.0	23.0	NM_005998	A6NE14|Q5SZY1|Q9BR64	Missense_Mutation	SNP	ENST00000295688.3	37	CCDS1140.2	.	.	.	.	.	.	.	.	.	.	C	33	5.252956	0.95336	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765	T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.92740	0.7692	H	0.96805	3.885	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.73708	0.96;0.981;0.972	D	0.94427	0.7646	10	0.72032	D	0.01	-9.7785	17.4945	0.87713	0.0:1.0:0.0:0.0	.	361;398;399	P49368-2;E9PAQ6;P49368	.;.;TCPG_HUMAN	H	399;361;354;354	ENSP00000295688:R399H;ENSP00000357242:R361H;ENSP00000357244:R354H;ENSP00000431543:R354H	ENSP00000295688:R399H	R	-	2	0	CCT3	154547570	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.441000	0.80485	2.726000	0.93360	0.650000	0.86243	CGC	.		0.537	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060602.3	NM_005998	
CD177	57126	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	43858024	43858024	+	RNA	SNP	C	C	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:43858024C>G	ENST00000607517.1	+	0	128				CD177_ENST00000378009.4_RNA|CD177_ENST00000378012.2_RNA			Q8N6Q3	CD177_HUMAN	CD177 molecule						blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5		Prostate(69;0.00682)				CGCTGCTCTGCCAGTTTGGGA	0.617																																					.		.											.	CD177	22	0			.						.						81.0	82.0	81.0					19																	43858024		2094	4223	6317			57126	.			GCTCTGCCAGTTT	AF146747	CCDS62700.1	19q13.31	2013-10-02	2006-03-28		ENSG00000204936	ENSG00000204936		"""CD molecules"""	30072	protein-coding gene	gene with protein product	"""polycythemia rubra vera 1"""	162860	"""CD177 antigen"""			10753836, 5552408	Standard	NM_020406		Approved	PRV1, HNA2A, NB1	uc002owi.3	Q8N6Q3	OTTHUMG00000185320		19.37:g.43858024C>G		146.0	1.0		99.0	28.0	.	Q711Q2|Q8NCV9|Q96QH1|Q9HDA5	RNA	SNP	ENST00000607517.1	37		.	.	.	.	.	.	.	.	.	.	c	12.19	1.865051	0.32977	.	.	ENSG00000204936	ENST00000378009;ENST00000378012;ENST00000457794	T;T;T	0.55413	1.4;0.52;0.52	3.75	-0.086	0.13683	.	.	.	.	.	T	0.70552	0.3237	M	0.86953	2.85	0.19575	N	0.999966	D	0.89917	1.0	D	0.97110	1.0	T	0.57318	-0.7832	9	0.87932	D	0	.	6.1252	0.20176	0.0:0.6186:0.0:0.3814	.	24	Q8N6Q3	CD177_HUMAN	W	24	ENSP00000367248:C24W;ENSP00000367251:C24W;ENSP00000388794:C24W	ENSP00000367248:C24W	C	+	3	2	CD177	48549864	0.008000	0.16893	0.019000	0.16419	0.012000	0.07955	-0.386000	0.07370	0.069000	0.16605	0.655000	0.94253	TGC	.		0.617	CD177-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000470162.1	NM_020406	
CD300LG	146894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	41924620	41924620	+	Silent	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:41924620G>A	ENST00000317310.4	+	1	77	c.36G>A	c.(34-36)ctG>ctA	p.L12L	CD300LG_ENST00000586233.1_Silent_p.L12L|CD300LG_ENST00000588884.1_Silent_p.L12L|CD300LG_ENST00000377203.4_Silent_p.L12L|CD300LG_ENST00000293396.8_Silent_p.L12L|CD300LG_ENST00000539718.1_Silent_p.L12L	NM_145273.3	NP_660316.2	Q6UXG3	CLM9_HUMAN	CD300 molecule-like family member g	12					immune system process (GO:0002376)|immunoglobulin transcytosis in epithelial cells (GO:0002414)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|skin(4)	19		Breast(137;0.0199)		BRCA - Breast invasive adenocarcinoma(366;0.115)		GTTGCCTGCTGCTCCCAGGTG	0.622																																					p.L12L		.											.	CD300LG	90	0			c.G36A						.						90.0	86.0	87.0					17																	41924620		2203	4300	6503	SO:0001819	synonymous_variant	146894	exon1			CCTGCTGCTCCCA	BC025395	CCDS11470.1, CCDS54131.1, CCDS54132.1, CCDS54133.1	17q21.31	2013-01-11	2006-03-29					"""Immunoglobulin superfamily / V-set domain containing"""	30455	protein-coding gene	gene with protein product	"""nepmucin"""	610520	"""CD300 antigen like family member G"""			16876123, 16754720	Standard	NM_001168322		Approved	Trem4, CLM9	uc002iem.3	Q6UXG3		ENST00000317310.4:c.36G>A	17.37:g.41924620G>A		106.0	0.0		94.0	22.0	NM_001168323	B4DNY5|F5H7P9|F8W9M3|Q8IX38|Q8IX39|Q8TA95	Silent	SNP	ENST00000317310.4	37	CCDS11470.1																																																																																			.		0.622	CD300LG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457646.1	NM_145273	
CD300C	10871	hgsc.bcm.edu;bcgsc.ca	37	17	72537867	72537867	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:72537867A>G	ENST00000330793.1	-	4	896	c.536T>C	c.(535-537)tTc>tCc	p.F179S		NM_006678.3	NP_006669.1	Q08708	CLM6_HUMAN	CD300c molecule	179					cellular defense response (GO:0006968)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|skin(2)|upper_aerodigestive_tract(1)	21						GACATTGCTGAACAGGGAGCT	0.627																																					p.F179S	Esophageal Squamous(66;421 1121 20537 25337 27468)	.											.	CD300C	90	0			c.T536C						.						83.0	65.0	71.0					17																	72537867		2203	4300	6503	SO:0001583	missense	10871	exon4			TTGCTGAACAGGG	BC022279	CCDS11701.1	17q25.2	2014-05-15	2006-03-28		ENSG00000167850	ENSG00000167850		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19320	protein-coding gene	gene with protein product		606786	"""CD300c antigen"""			1349532, 10746781	Standard	NM_006678		Approved	CMRF35, LIR, CMRF-35A, CMRF35A, IGSF16	uc002jky.2	Q08708	OTTHUMG00000067608	ENST00000330793.1:c.536T>C	17.37:g.72537867A>G	ENSP00000329507:p.Phe179Ser	76.0	0.0		55.0	4.0	NM_006678		Missense_Mutation	SNP	ENST00000330793.1	37	CCDS11701.1	.	.	.	.	.	.	.	.	.	.	A	6.368	0.436008	0.12104	.	.	ENSG00000167850	ENST00000330793	T	0.03242	4.0	4.74	3.66	0.41972	.	0.567919	0.14416	N	0.320989	T	0.02083	0.0065	N	0.08118	0	0.09310	N	1	B	0.17465	0.022	B	0.15484	0.013	T	0.48592	-0.9022	10	0.19590	T	0.45	.	7.4927	0.27471	0.8983:0.0:0.1017:0.0	.	179	Q08708	CLM6_HUMAN	S	179	ENSP00000329507:F179S	ENSP00000329507:F179S	F	-	2	0	CD300C	70049462	0.003000	0.15002	0.072000	0.20136	0.001000	0.01503	1.620000	0.36976	0.930000	0.37217	0.477000	0.44152	TTC	.		0.627	CD300C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145084.1	NM_006678	
CD48	962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160648872	160648872	+	Silent	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:160648872C>T	ENST00000368046.3	-	4	789	c.702G>A	c.(700-702)gtG>gtA	p.V234V	RP11-404F10.2_ENST00000588034.1_RNA|RP11-404F10.2_ENST00000598917.2_RNA|RP11-404F10.2_ENST00000443928.2_RNA	NM_001778.3	NP_001769.2	P09326	CD48_HUMAN	CD48 molecule	234					blood coagulation (GO:0007596)|defense response (GO:0006952)|leukocyte migration (GO:0050900)|mast cell activation (GO:0045576)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	anchored component of plasma membrane (GO:0046658)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(2)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|stomach(1)	10	all_cancers(52;2.18e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			GAATGGTGGGCACCGTGACCA	0.453																																					p.V234V		.											.	CD48	90	0			c.G702A						.						120.0	112.0	115.0					1																	160648872		2203	4300	6503	SO:0001819	synonymous_variant	962	exon4			GGTGGGCACCGTG	BC016182	CCDS1208.1, CCDS72955.1	1q21.3-q22	2013-01-29	2006-03-31		ENSG00000117091	ENSG00000117091		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1683	protein-coding gene	gene with protein product		109530	"""CD48 antigen (B-cell membrane protein)"", ""CD48 molecule """	BCM1		2828034	Standard	NM_001256030		Approved	BLAST, mCD48, hCD48, SLAMF2	uc001fwo.2	P09326	OTTHUMG00000024009	ENST00000368046.3:c.702G>A	1.37:g.160648872C>T		134.0	0.0		136.0	44.0	NM_001778	Q5U055|Q8MGR0	Silent	SNP	ENST00000368046.3	37	CCDS1208.1																																																																																			.		0.453	CD48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060471.1	NM_001778	
CD97	976	ucsc.edu;bcgsc.ca	37	19	14512305	14512305	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:14512305A>G	ENST00000242786.5	+	10	1085	c.1005A>G	c.(1003-1005)gaA>gaG	p.E335E	CD97_ENST00000358600.3_Silent_p.E242E|CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000357355.3_Silent_p.E286E	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	335					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CAAACCTTGAAGATATCATGA	0.582																																					p.E335E		.											.	CD97	570	0			c.A1005G						.						73.0	74.0	74.0					19																	14512305		2203	4300	6503	SO:0001819	synonymous_variant	976	exon10			CCTTGAAGATATC		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1005A>G	19.37:g.14512305A>G		53.0	0.0		28.0	4.0	NM_078481	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Silent	SNP	ENST00000242786.5	37	CCDS32929.1																																																																																			.		0.582	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481	
CEP128	145508	hgsc.bcm.edu;bcgsc.ca	37	14	80971326	80971326	+	Missense_Mutation	SNP	C	C	A	rs377362585		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr14:80971326C>A	ENST00000555265.1	-	24	3485	c.3110G>T	c.(3109-3111)gGg>gTg	p.G1037V	CEP128_ENST00000281129.3_Missense_Mutation_p.G1037V|CEP128_ENST00000553717.1_5'UTR			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	1037						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						GTGATCTAACCCACGAGTGTG	0.423																																					p.G1037V		.											.	CEP128	91	0			c.G3110T						.	C	VAL/GLY	1,4405	2.1+/-5.4	0,1,2202	68.0	65.0	66.0		3110	3.4	0.0	14		66	0,8600		0,0,4300	no	missense	CEP128	NM_152446.3	109	0,1,6502	AA,AC,CC		0.0,0.0227,0.0077	benign	1037/1095	80971326	1,13005	2203	4300	6503	SO:0001583	missense	145508	exon23			TCTAACCCACGAG	AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.3110G>T	14.37:g.80971326C>A	ENSP00000451162:p.Gly1037Val	78.0	0.0		61.0	4.0	NM_152446	B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	ENST00000555265.1	37	CCDS32130.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.36|11.36	1.615669|1.615669	0.28801|0.28801	2.27E-4|2.27E-4	0.0|0.0	ENSG00000100629|ENSG00000100629	ENST00000281129;ENST00000555265|ENST00000556061	T;T|.	0.33216|.	1.42;1.42|.	5.32|5.32	3.38|3.38	0.38709|0.38709	.|.	0.718872|.	0.12773|.	N|.	0.440346|.	T|T	0.23965|0.23965	0.0580|0.0580	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	0.999999|0.999999	B|.	0.16603|.	0.018|.	B|.	0.19946|.	0.027|.	T|T	0.19386|0.19386	-1.0307|-1.0307	10|5	0.37606|.	T|.	0.19|.	.|.	5.7203|5.7203	0.17982|0.17982	0.187:0.7092:0.0:0.1037|0.187:0.7092:0.0:0.1037	.|.	1037|.	Q6ZU80|.	CE128_HUMAN|.	V|C	1037|102	ENSP00000281129:G1037V;ENSP00000451162:G1037V|.	ENSP00000281129:G1037V|.	G|W	-|-	2|3	0|0	CEP128|CEP128	80041079|80041079	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.167000|0.167000	0.22549|0.22549	0.136000|0.136000	0.15974|0.15974	0.708000|0.708000	0.31955|0.31955	-0.355000|-0.355000	0.07637|0.07637	GGG|TGG	.		0.423	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413415.1	NM_152446	
CEP63	80254	hgsc.bcm.edu;bcgsc.ca	37	3	134264444	134264444	+	Missense_Mutation	SNP	G	G	T	rs529386244		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:134264444G>T	ENST00000337090.3	+	7	745	c.572G>T	c.(571-573)cGg>cTg	p.R191L	CEP63_ENST00000332047.5_Missense_Mutation_p.R191L|CEP63_ENST00000383229.3_Missense_Mutation_p.R191L|CEP63_ENST00000513612.2_Missense_Mutation_p.R191L|CEP63_ENST00000354446.3_Missense_Mutation_p.R191L|CEP63_ENST00000606977.1_Missense_Mutation_p.R191L			Q96MT8	CEP63_HUMAN	centrosomal protein 63kDa	191					centriole replication (GO:0007099)|DNA damage checkpoint (GO:0000077)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|signal transduction in response to DNA damage (GO:0042770)|spindle assembly (GO:0051225)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|spindle pole (GO:0000922)				kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						CTTGTCAATCGGAAACAGAAA	0.353																																					p.R191L		.											.	CEP63	493	0			c.G572T						.						79.0	75.0	76.0					3																	134264444		2203	4300	6503	SO:0001583	missense	80254	exon7			TCAATCGGAAACA	AK056465	CCDS3086.1, CCDS43152.1, CCDS43153.1, CCDS43154.1	3q22.1	2014-02-20			ENSG00000182923	ENSG00000182923			25815	protein-coding gene	gene with protein product		614724				14654843, 24240477	Standard	NM_001042383		Approved	FLJ13386	uc003eqo.1	Q96MT8	OTTHUMG00000159725	ENST00000337090.3:c.572G>T	3.37:g.134264444G>T	ENSP00000336524:p.Arg191Leu	105.0	0.0		78.0	4.0	NM_001042383	D3DND8|D3DND9|D3DNE0|Q96CR0|Q9H8F5|Q9H8N0	Missense_Mutation	SNP	ENST00000337090.3	37	CCDS3086.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.2|27.2	4.811746|4.811746	0.90707|0.90707	.|.	.|.	ENSG00000182923|ENSG00000182923	ENST00000508778|ENST00000332047;ENST00000354446;ENST00000337090;ENST00000383229;ENST00000513612	.|T;T;T;T;T	.|0.36157	.|1.93;1.66;1.92;1.27;1.92	6.1|6.1	6.1|6.1	0.99115|0.99115	.|.	.|0.068772	.|0.64402	.|D	.|0.000016	.|T	.|0.60431	.|0.2268	M|M	0.68952|0.68952	2.095|2.095	0.53688|0.53688	D|D	0.999977|0.999977	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.997	.|D;D;D;P	.|0.91635	.|0.999;0.985;0.985;0.898	.|T	.|0.47275	.|-0.9130	.|10	.|0.23891	.|T	.|0.37	-13.8266|-13.8266	20.7146|20.7146	0.99709|0.99709	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|191;191;191;191	.|Q96MT8;Q96MT8-2;Q96MT8-4;Q96MT8-3	.|CEP63_HUMAN;.;.;.	X|L	97|191	.|ENSP00000328382:R191L;ENSP00000346432:R191L;ENSP00000336524:R191L;ENSP00000372716:R191L;ENSP00000426129:R191L	.|ENSP00000328382:R191L	G|R	+|+	1|2	0|0	CEP63|CEP63	135747134|135747134	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.969000|0.969000	0.65631|0.65631	6.717000|6.717000	0.74707|0.74707	2.902000|2.902000	0.99343|0.99343	0.650000|0.650000	0.86243|0.86243	GGA|CGG	.		0.353	CEP63-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000470139.1	NM_025180	
CHD7	55636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	61765595	61765595	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr8:61765595C>T	ENST00000423902.2	+	31	6790	c.6311C>T	c.(6310-6312)gCt>gTt	p.A2104V	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2104					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CTGGTTGGTGCTGCTAAACAC	0.537																																					p.A2104V		.											.	CHD7	141	0			c.C6311T						.						103.0	114.0	111.0					8																	61765595		2074	4209	6283	SO:0001583	missense	55636	exon31			TTGGTGCTGCTAA	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.6311C>T	8.37:g.61765595C>T	ENSP00000392028:p.Ala2104Val	241.0	1.0		220.0	95.0	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	37	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.153143	0.57259	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	D	0.87966	-2.32	5.41	4.52	0.55395	.	0.063732	0.64402	D	0.000007	D	0.83303	0.5225	L	0.28115	0.83	0.58432	D	0.999999	B	0.25169	0.119	B	0.36885	0.235	T	0.78909	-0.2018	10	0.34782	T	0.22	-14.0265	16.0296	0.80570	0.0:0.8653:0.1347:0.0	.	2104	Q9P2D1	CHD7_HUMAN	V	2104	ENSP00000392028:A2104V	ENSP00000307304:A2104V	A	+	2	0	CHD7	61928149	1.000000	0.71417	0.583000	0.28640	0.991000	0.79684	6.090000	0.71397	1.252000	0.44001	0.655000	0.94253	GCT	.		0.537	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
CHI3L2	1117	hgsc.bcm.edu;bcgsc.ca	37	1	111773369	111773369	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:111773369G>A	ENST00000445067.2	+	5	847	c.76G>A	c.(76-78)Gcc>Acc	p.A26T	CHI3L2_ENST00000524472.1_5'UTR|CHI3L2_ENST00000369744.2_Missense_Mutation_p.A16T|CHI3L2_ENST00000466741.1_5'UTR|CHI3L2_ENST00000369748.4_Missense_Mutation_p.A26T			Q15782	CH3L2_HUMAN	chitinase 3-like 2	26					carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)	extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(1)	19		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)		TCCAGGATCTGCCTACAAACT	0.488																																					p.A26T		.											.	CHI3L2	514	0			c.G76A						.						72.0	68.0	69.0					1																	111773369		2203	4300	6503	SO:0001583	missense	1117	exon3			GGATCTGCCTACA	U49835	CCDS30802.1, CCDS30803.1, CCDS41367.1	1p13.3	2008-02-05			ENSG00000064886	ENSG00000064886			1933	protein-coding gene	gene with protein product		601526				8702629	Standard	NM_001025197		Approved	YKL-39, YKL39	uc001eam.3	Q15782	OTTHUMG00000012174	ENST00000445067.2:c.76G>A	1.37:g.111773369G>A	ENSP00000437082:p.Ala26Thr	77.0	0.0		60.0	4.0	NM_004000	A6NNY3|B4DPR7|Q15749|Q15783|Q5VUV7|Q96F97	Missense_Mutation	SNP	ENST00000445067.2	37	CCDS30802.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.738828	0.49045	.	.	ENSG00000064886	ENST00000445067;ENST00000528451;ENST00000486561;ENST00000369744;ENST00000369748;ENST00000474304	T;T;T;T;T	0.15139	3.3;2.49;2.45;3.3;3.3	4.09	2.22	0.28083	.	0.000000	0.40554	N	0.001067	T	0.07458	0.0188	L	0.43757	1.38	0.21184	N	0.999761	D;D	0.54397	0.966;0.966	P;P	0.48227	0.571;0.571	T	0.18650	-1.0330	10	0.36615	T	0.2	-2.6827	8.0089	0.30342	0.2034:0.0:0.7966:0.0	.	16;26	A6NNY3;Q15782	.;CH3L2_HUMAN	T	26;26;26;16;26;26	ENSP00000437082:A26T;ENSP00000436077:A26T;ENSP00000431968:A26T;ENSP00000358759:A16T;ENSP00000358763:A26T	ENSP00000358759:A16T	A	+	1	0	CHI3L2	111574892	0.931000	0.31567	0.645000	0.29479	0.962000	0.63368	0.718000	0.25866	0.371000	0.24564	0.655000	0.94253	GCC	.		0.488	CHI3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033669.4	NM_004000	
CHST7	56548	hgsc.bcm.edu;bcgsc.ca	37	X	46433646	46433646	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:46433646G>T	ENST00000276055.3	+	1	428	c.280G>T	c.(280-282)Ggg>Tgg	p.G94W		NM_019886.2	NP_063939.2	Q9NS84	CHST7_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7	94					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|N-acetylglucosamine metabolic process (GO:0006044)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)			breast(3)|endometrium(2)|kidney(1)|lung(2)	8						CGGCGCTGTCGGGGAGGCAGT	0.692																																					p.G94W		.											.	CHST7	133	0			c.G280T						.						26.0	21.0	23.0					X																	46433646		2203	4300	6503	SO:0001583	missense	56548	exon1			GCTGTCGGGGAGG	AB040711	CCDS14268.1	Xp11.3	2008-02-05			ENSG00000147119	ENSG00000147119		"""Sulfotransferases, membrane-bound"""	13817	protein-coding gene	gene with protein product		300375				10781596	Standard	NM_019886		Approved	C6ST-2, C6ST2	uc004dgt.3	Q9NS84	OTTHUMG00000021423	ENST00000276055.3:c.280G>T	X.37:g.46433646G>T	ENSP00000276055:p.Gly94Trp	100.0	0.0		62.0	5.0	NM_019886	O75667	Missense_Mutation	SNP	ENST00000276055.3	37	CCDS14268.1	.	.	.	.	.	.	.	.	.	.	g	10.92	1.485710	0.26686	.	.	ENSG00000147119	ENST00000276055	D	0.97688	-4.49	4.3	1.14	0.20703	.	0.483859	0.15100	N	0.280593	D	0.96719	0.8929	N	0.19112	0.55	0.30814	N	0.738525	D	0.71674	0.998	D	0.70487	0.969	D	0.94084	0.7347	10	0.66056	D	0.02	.	12.3937	0.55373	0.0:0.4722:0.5278:0.0	.	94	Q9NS84	CHST7_HUMAN	W	94	ENSP00000276055:G94W	ENSP00000276055:G94W	G	+	1	0	CHST7	46318590	1.000000	0.71417	0.770000	0.31555	0.501000	0.33797	1.088000	0.30877	0.350000	0.24002	0.509000	0.49947	GGG	.		0.692	CHST7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056362.1	NM_019886	
CLSTN2	64084	hgsc.bcm.edu;bcgsc.ca	37	3	140251313	140251313	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:140251313G>T	ENST00000458420.3	+	9	1682	c.1492G>T	c.(1492-1494)Ggc>Tgc	p.G498C		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	498					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						ACTCACAGTCGGCGCTTGTTG	0.443										HNSCC(16;0.037)																											p.G498C	GBM(45;858 913 3709 36904 37282)	.											.	CLSTN2	157	0			c.G1492T						.						136.0	113.0	121.0					3																	140251313		2203	4300	6503	SO:0001583	missense	64084	exon9			ACAGTCGGCGCTT	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.1492G>T	3.37:g.140251313G>T	ENSP00000402460:p.Gly498Cys	122.0	0.0		91.0	5.0	NM_022131	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.499134	0.85069	.	.	ENSG00000158258	ENST00000458420	D	0.89270	-2.49	5.67	5.67	0.87782	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.94974	0.8374	M	0.86097	2.795	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94871	0.8030	9	.	.	.	-12.4934	17.2644	0.87081	0.0:0.0:1.0:0.0	.	498	Q9H4D0	CSTN2_HUMAN	C	498	ENSP00000402460:G498C	.	G	+	1	0	CLSTN2	141734003	1.000000	0.71417	0.971000	0.41717	0.880000	0.50808	9.869000	0.99810	2.697000	0.92050	0.655000	0.94253	GGC	.		0.443	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	
CNST	163882	hgsc.bcm.edu;bcgsc.ca	37	1	246784775	246784775	+	Silent	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:246784775C>T	ENST00000366513.4	+	3	693	c.424C>T	c.(424-426)Cta>Tta	p.L142L	CNST_ENST00000366512.3_Silent_p.L142L|CNST_ENST00000483271.1_3'UTR	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	142					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						AGAAAAAGTACTAAGCGCAGT	0.398																																					p.L142L		.											.	CNST	90	0			c.C424T						.						201.0	207.0	205.0					1																	246784775		2203	4300	6503	SO:0001819	synonymous_variant	163882	exon3			AAAGTACTAAGCG	AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.424C>T	1.37:g.246784775C>T		68.0	0.0		92.0	4.0	NM_152609	Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Silent	SNP	ENST00000366513.4	37	CCDS1628.1																																																																																			.		0.398	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096780.1	NM_152609	
CNTLN	54875	hgsc.bcm.edu;bcgsc.ca	37	9	17332673	17332673	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:17332673A>G	ENST00000380647.3	+	10	1673	c.1589A>G	c.(1588-1590)aAg>aGg	p.K530R	CNTLN_ENST00000425824.1_Missense_Mutation_p.K530R|CNTLN_ENST00000262360.5_Missense_Mutation_p.K530R			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	530					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		GAGCTACAGAAGCTGAGAAAA	0.383																																					p.K530R		.											.	CNTLN	91	0			c.A1589G						.						73.0	69.0	70.0					9																	17332673		1836	4082	5918	SO:0001583	missense	54875	exon10			TACAGAAGCTGAG	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.1589A>G	9.37:g.17332673A>G	ENSP00000370021:p.Lys530Arg	244.0	0.0		137.0	6.0	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	37	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	A	11.40	1.626434	0.28978	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.13307	2.6;2.6;2.6	5.54	5.54	0.83059	.	.	.	.	.	T	0.16557	0.0398	L	0.34521	1.04	0.31547	N	0.659277	P;P;P	0.42692	0.787;0.787;0.787	P;P;P	0.46758	0.526;0.526;0.526	T	0.04635	-1.0937	9	0.20519	T	0.43	.	15.3261	0.74164	1.0:0.0:0.0:0.0	.	530;530;530	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	R	530	ENSP00000370021:K530R;ENSP00000392798:K530R;ENSP00000262360:K530R	ENSP00000262360:K530R	K	+	2	0	CNTLN	17322673	1.000000	0.71417	0.986000	0.45419	0.780000	0.44128	3.434000	0.52841	2.098000	0.63641	0.482000	0.46254	AAG	.		0.383	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
COL24A1	255631	hgsc.bcm.edu;broad.mit.edu	37	1	86340972	86340972	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:86340972T>C	ENST00000370571.2	-	34	3438	c.3072A>G	c.(3070-3072)gaA>gaG	p.E1024E	COL24A1_ENST00000436319.1_Silent_p.E1024E	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	1024	Collagen-like 9.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		TTGCACCTGGTTCACCTTGCA	0.413																																					p.E1024E		.											.	COL24A1	94	0			c.A3072G						.						79.0	77.0	78.0					1																	86340972		1875	4107	5982	SO:0001819	synonymous_variant	255631	exon34			ACCTGGTTCACCT	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.3072A>G	1.37:g.86340972T>C		220.0	0.0		108.0	5.0	NM_152890	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Silent	SNP	ENST00000370571.2	37	CCDS41353.1																																																																																			.		0.413	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890	
COL4A1	1282	hgsc.bcm.edu;bcgsc.ca	37	13	110831299	110831299	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr13:110831299G>T	ENST00000375820.4	-	31	2550	c.2429C>A	c.(2428-2430)cCt>cAt	p.P810H		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	810	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CTGTCCTCCAGGGGGACCCCT	0.572																																					p.P810H		.											.	COL4A1	654	0			c.C2429A						.						15.0	17.0	16.0					13																	110831299		2202	4298	6500	SO:0001583	missense	1282	exon31			CCTCCAGGGGGAC	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.2429C>A	13.37:g.110831299G>T	ENSP00000364979:p.Pro810His	69.0	0.0		52.0	4.0	NM_001845	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.480937	0.84747	.	.	ENSG00000187498	ENST00000375820	D	0.98701	-5.08	4.89	4.89	0.63831	.	0.206902	0.43260	D	0.000594	D	0.99312	0.9759	M	0.92219	3.285	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.98931	1.0787	10	0.54805	T	0.06	.	17.4237	0.87521	0.0:0.0:1.0:0.0	.	810	P02462	CO4A1_HUMAN	H	810	ENSP00000364979:P810H	ENSP00000364979:P810H	P	-	2	0	COL4A1	109629300	1.000000	0.71417	0.999000	0.59377	0.928000	0.56348	5.705000	0.68355	2.431000	0.82371	0.655000	0.94253	CCT	.		0.572	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
COL4A2	1284	hgsc.bcm.edu;bcgsc.ca	37	13	111144454	111144454	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr13:111144454A>G	ENST00000360467.5	+	38	3798	c.3492A>G	c.(3490-3492)ggA>ggG	p.G1164G		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	1164	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GGTCGCAGGGAGAGCTGGGGC	0.612																																					p.G1164G		.											.	COL4A2	95	0			c.A3492G						.						28.0	38.0	34.0					13																	111144454		1946	4068	6014	SO:0001819	synonymous_variant	1284	exon38			GCAGGGAGAGCTG	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.3492A>G	13.37:g.111144454A>G		84.0	0.0		57.0	4.0	NM_001846	Q14052|Q548C3|Q5VZA9|Q66K23	Silent	SNP	ENST00000360467.5	37	CCDS41907.1																																																																																			.		0.612	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846	
CPSF4L	642843	hgsc.bcm.edu;bcgsc.ca	37	17	71257927	71257927	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:71257927A>G	ENST00000344935.4	-	1	92	c.31T>C	c.(31-33)Ttc>Ctc	p.F11L	CPSF4L_ENST00000397671.1_Intron	NM_001129885.1	NP_001123357.1	A6NMK7	CPS4L_HUMAN	cleavage and polyadenylation specific factor 4-like	11							metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|prostate(1)	2						GCAAAGGTGAACCGCTCTAGC	0.597																																					p.F11L		.											.	CPSF4L	68	0			c.T31C						.						178.0	159.0	164.0					17																	71257927		692	1591	2283	SO:0001583	missense	642843	exon1			AGGTGAACCGCTC		CCDS45768.1	17q25.1	2010-07-06			ENSG00000187959	ENSG00000187959			33632	protein-coding gene	gene with protein product							Standard	NM_001129885		Approved		uc010dfk.1	A6NMK7	OTTHUMG00000132640	ENST00000344935.4:c.31T>C	17.37:g.71257927A>G	ENSP00000343900:p.Phe11Leu	95.0	0.0		62.0	4.0	NM_001129885	A8MU95|B2RXI9	Missense_Mutation	SNP	ENST00000344935.4	37	CCDS45768.1	.	.	.	.	.	.	.	.	.	.	A	3.867	-0.028595	0.07589	.	.	ENSG00000187959	ENST00000344935	T	0.20738	2.05	5.11	-0.029	0.13920	.	.	.	.	.	T	0.11196	0.0273	L	0.33485	1.01	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21895	-1.0232	9	0.13108	T	0.6	.	3.8229	0.08843	0.5:0.0:0.1782:0.3218	.	11	A6NMK7	CPS4L_HUMAN	L	11	ENSP00000343900:F11L	ENSP00000343900:F11L	F	-	1	0	CPSF4L	68769522	0.000000	0.05858	0.154000	0.22540	0.070000	0.16714	-0.555000	0.05999	0.006000	0.14734	0.459000	0.35465	TTC	.		0.597	CPSF4L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441896.1	NM_001129885	
CREBBP	1387	hgsc.bcm.edu;bcgsc.ca	37	16	3778391	3778391	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:3778391G>T	ENST00000262367.5	-	31	7466	c.6657C>A	c.(6655-6657)gcC>gcA	p.A2219A	CREBBP_ENST00000382070.3_Silent_p.A2181A	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	2219					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CAGCCATGCCGGCACTCCCTt	0.642			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.A2219A		.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	1807	0			c.C6657A						.						33.0	30.0	31.0					16																	3778391		2196	4300	6496	SO:0001819	synonymous_variant	1387	exon31			CATGCCGGCACTC	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.6657C>A	16.37:g.3778391G>T		82.0	0.0		76.0	5.0	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	ENST00000262367.5	37	CCDS10509.1																																																																																			.		0.642	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
CRYBA1	1411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27580737	27580737	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:27580737C>T	ENST00000225387.3	+	5	438	c.437C>T	c.(436-438)cCc>cTc	p.P146L		NM_005208.4	NP_005199.2	P05813	CRBA1_HUMAN	crystallin, beta A1	146	Beta/gamma crystallin 'Greek key' 3. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens development in camera-type eye (GO:0002088)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			breast(1)|large_intestine(2)|lung(1)|prostate(1)	5			BRCA - Breast invasive adenocarcinoma(11;3.3e-05)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			GACGACTACCCCTCCTTGCAA	0.428																																					p.P146L		.											.	CRYBA1	90	0			c.C437T						.						84.0	83.0	84.0					17																	27580737		2203	4300	6503	SO:0001583	missense	1411	exon5			ACTACCCCTCCTT		CCDS11249.1	17q11.2-q12	2008-07-18			ENSG00000108255	ENSG00000108255			2394	protein-coding gene	gene with protein product	"""eye lens structural protein"""	123610		CRYB1		3745196, 3770741	Standard	NM_005208		Approved		uc002hdw.3	P05813	OTTHUMG00000132729	ENST00000225387.3:c.437C>T	17.37:g.27580737C>T	ENSP00000225387:p.Pro146Leu	123.0	0.0		162.0	27.0	NM_005208	Q13633|Q14CM9	Missense_Mutation	SNP	ENST00000225387.3	37	CCDS11249.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.815854	0.90790	.	.	ENSG00000108255	ENST00000225387	T	0.78126	-1.15	5.43	4.45	0.53987	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.000000	0.85682	D	0.000000	D	0.88415	0.6430	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89672	0.3884	10	0.62326	D	0.03	.	14.2229	0.65839	0.0:0.9255:0.0:0.0745	.	146	P05813	CRBA1_HUMAN	L	146	ENSP00000225387:P146L	ENSP00000225387:P146L	P	+	2	0	CRYBA1	24604863	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.686000	0.68211	2.538000	0.85594	0.491000	0.48974	CCC	.		0.428	CRYBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256071.2	NM_005208	
CSMD1	64478	hgsc.bcm.edu;bcgsc.ca	37	8	2967694	2967694	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr8:2967694A>G	ENST00000520002.1	-	44	7152	c.6597T>C	c.(6595-6597)gaT>gaC	p.D2199D	CSMD1_ENST00000602557.1_Silent_p.D2199D|CSMD1_ENST00000537824.1_Silent_p.D2198D|CSMD1_ENST00000602723.1_Silent_p.D2199D|CSMD1_ENST00000400186.3_Silent_p.D2199D|CSMD1_ENST00000542608.1_Silent_p.D2198D			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2199	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CAGCAATGTAATCGTTGACAG	0.433																																					p.D2198D		.											.	CSMD1	86	0			c.T6594C						.						89.0	87.0	88.0					8																	2967694		1947	4132	6079	SO:0001819	synonymous_variant	64478	exon43			AATGTAATCGTTG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6597T>C	8.37:g.2967694A>G		72.0	0.0		52.0	4.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37																																																																																				.		0.433	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CSRNP1	64651	hgsc.bcm.edu;bcgsc.ca	37	3	39184971	39184971	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:39184971A>G	ENST00000273153.5	-	5	1522	c.1345T>C	c.(1345-1347)Ttc>Ctc	p.F449L	CSRNP1_ENST00000514182.1_Missense_Mutation_p.F449L	NM_033027.3	NP_149016.2	Q96S65	CSRN1_HUMAN	cysteine-serine-rich nuclear protein 1	449					apoptotic process (GO:0006915)|face morphogenesis (GO:0060325)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|skin(3)	24						CCTGATGTGAAGCTACAGCCA	0.567																																					p.F449L		.											.	CSRNP1	230	0			c.T1345C						.						64.0	62.0	63.0					3																	39184971		2203	4300	6503	SO:0001583	missense	64651	exon5			ATGTGAAGCTACA	AB053121	CCDS2682.1	3p22	2009-04-17	2009-04-17	2009-04-17	ENSG00000144655	ENSG00000144655			14300	protein-coding gene	gene with protein product		606458	"""AXIN1 up-regulated 1"""	AXUD1		11526492, 17726538	Standard	NM_033027		Approved	URAX1, DKFZp566F164, FAM130B, TAIP-3	uc003cjg.3	Q96S65	OTTHUMG00000131293	ENST00000273153.5:c.1345T>C	3.37:g.39184971A>G	ENSP00000273153:p.Phe449Leu	124.0	0.0		88.0	5.0	NM_033027	Q69YY5	Missense_Mutation	SNP	ENST00000273153.5	37	CCDS2682.1	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.793807	0.00623	.	.	ENSG00000144655	ENST00000273153;ENST00000514182;ENST00000318290	T;T	0.39406	1.08;1.08	4.52	-0.818	0.10833	.	1.069230	0.07196	N	0.856677	T	0.10594	0.0259	N	0.00347	-1.61	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29518	-1.0009	10	0.10636	T	0.68	-16.6951	6.468	0.21993	0.3045:0.1212:0.5743:0.0	.	449	Q96S65	CSRN1_HUMAN	L	449;449;107	ENSP00000273153:F449L;ENSP00000422532:F449L	ENSP00000273153:F449L	F	-	1	0	CSRNP1	39159975	0.989000	0.36119	0.014000	0.15608	0.327000	0.28475	0.309000	0.19332	0.001000	0.14605	-0.242000	0.12053	TTC	.		0.567	CSRNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254061.1	NM_033027	
CSRNP1	64651	hgsc.bcm.edu;bcgsc.ca	37	3	39185786	39185786	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:39185786G>T	ENST00000273153.5	-	4	799	c.622C>A	c.(622-624)Cga>Aga	p.R208R	CSRNP1_ENST00000514182.1_Silent_p.R208R	NM_033027.3	NP_149016.2	Q96S65	CSRN1_HUMAN	cysteine-serine-rich nuclear protein 1	208					apoptotic process (GO:0006915)|face morphogenesis (GO:0060325)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|skin(3)	24						AGCAGAGCTCGACGTCGCCGG	0.627																																					p.R208R		.											.	CSRNP1	230	0			c.C622A						.						76.0	72.0	73.0					3																	39185786		2203	4300	6503	SO:0001819	synonymous_variant	64651	exon4			GAGCTCGACGTCG	AB053121	CCDS2682.1	3p22	2009-04-17	2009-04-17	2009-04-17	ENSG00000144655	ENSG00000144655			14300	protein-coding gene	gene with protein product		606458	"""AXIN1 up-regulated 1"""	AXUD1		11526492, 17726538	Standard	NM_033027		Approved	URAX1, DKFZp566F164, FAM130B, TAIP-3	uc003cjg.3	Q96S65	OTTHUMG00000131293	ENST00000273153.5:c.622C>A	3.37:g.39185786G>T		146.0	0.0		90.0	6.0	NM_033027	Q69YY5	Silent	SNP	ENST00000273153.5	37	CCDS2682.1																																																																																			.		0.627	CSRNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254061.1	NM_033027	
CTNNB1	1499	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266882	41266882	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:41266882A>G	ENST00000349496.5	+	5	833	c.553A>G	c.(553-555)Aga>Gga	p.R185G	CTNNB1_ENST00000405570.1_Missense_Mutation_p.R185G|CTNNB1_ENST00000453024.1_Missense_Mutation_p.R178G|CTNNB1_ENST00000396183.3_Missense_Mutation_p.R185G|CTNNB1_ENST00000396185.3_Missense_Mutation_p.R185G	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	185					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GGAAGCTTCCAGACACGCTAT	0.428		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.R185G	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1	24361	0			c.A553G						.						73.0	73.0	73.0					3																	41266882		2203	4300	6503	SO:0001583	missense	1499	exon5	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTTCCAGACACG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.553A>G	3.37:g.41266882A>G	ENSP00000344456:p.Arg185Gly	212.0	1.0		148.0	45.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	18.91	3.724634	0.68959	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31	5.7	5.7	0.88788	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.74152	0.3679	M	0.66439	2.03	0.80722	D	1	P;D	0.61697	0.858;0.99	P;P	0.55615	0.682;0.78	T	0.76214	-0.3041	10	0.52906	T	0.07	-4.0335	11.4724	0.50278	0.729:0.271:0.0:0.0	.	113;185	B4DSW9;P35222	.;CTNB1_HUMAN	G	185;185;185;178;185	ENSP00000385604:R185G;ENSP00000379486:R185G;ENSP00000344456:R185G;ENSP00000411226:R178G;ENSP00000379488:R185G	ENSP00000344456:R185G	R	+	1	2	CTNNB1	41241886	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.651000	0.74372	2.175000	0.68902	0.533000	0.62120	AGA	.		0.428	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTNNB1	1499	hgsc.bcm.edu;bcgsc.ca	37	3	41275034	41275034	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:41275034T>C	ENST00000349496.5	+	9	1480	c.1200T>C	c.(1198-1200)ggT>ggC	p.G400G	CTNNB1_ENST00000405570.1_Silent_p.G400G|CTNNB1_ENST00000453024.1_Silent_p.G393G|CTNNB1_ENST00000396183.3_Silent_p.G400G|CTNNB1_ENST00000396185.3_Silent_p.G400G	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	400					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GGATGGAAGGTCTCCTTGGGA	0.413		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.G400G	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1	24361	0			c.T1200C						.						142.0	135.0	137.0					3																	41275034		2203	4300	6503	SO:0001819	synonymous_variant	1499	exon9	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GGAAGGTCTCCTT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1200T>C	3.37:g.41275034T>C		107.0	0.0		97.0	5.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Silent	SNP	ENST00000349496.5	37	CCDS2694.1																																																																																			.		0.413	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CXorf22	170063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	35989740	35989740	+	Missense_Mutation	SNP	T	T	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:35989740T>G	ENST00000297866.5	+	12	2074	c.2008T>G	c.(2008-2010)Tta>Gta	p.L670V		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	670										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						AGACATAGGCTTAGAGCCAGG	0.373																																					p.L670V		.											.	CXorf22	131	0			c.T2008G						.						23.0	19.0	20.0					X																	35989740		2202	4295	6497	SO:0001583	missense	170063	exon12			ATAGGCTTAGAGC	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.2008T>G	X.37:g.35989740T>G	ENSP00000297866:p.Leu670Val	130.0	0.0		78.0	25.0	NM_152632	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	T	15.97	2.990875	0.54041	.	.	ENSG00000165164	ENST00000297866	T	0.16597	2.33	5.72	-5.22	0.02806	.	0.529703	0.17944	N	0.156732	T	0.12518	0.0304	M	0.65975	2.015	0.09310	N	1	P	0.43287	0.802	B	0.40677	0.337	T	0.25467	-1.0131	10	0.17369	T	0.5	-3.1402	4.9309	0.13917	0.5443:0.1892:0.0:0.2665	.	670	Q6ZTR5	CX022_HUMAN	V	670	ENSP00000297866:L670V	ENSP00000297866:L670V	L	+	1	2	CXorf22	35899661	0.009000	0.17119	0.000000	0.03702	0.118000	0.20060	-0.271000	0.08572	-0.719000	0.04942	0.486000	0.48141	TTA	.		0.373	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	
CYP4B1	1580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	47264911	47264911	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:47264911G>A	ENST00000271153.4	+	1	194	c.158G>A	c.(157-159)tGg>tAg	p.W53*	CYP4B1_ENST00000371923.4_Nonsense_Mutation_p.W53*|CYP4B1_ENST00000371919.4_Nonsense_Mutation_p.W53*|CYP4B1_ENST00000546128.1_Intron			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	53					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.W53*(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	CCCACCCACTGGCTTTTTGGA	0.557																																					p.W53X		.											.	CYP4B1	92	1	Substitution - Nonsense(1)	skin(1)	c.G158A						.						35.0	31.0	33.0					1																	47264911		2203	4300	6503	SO:0001587	stop_gained	1580	exon1			CCCACTGGCTTTT	BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.158G>A	1.37:g.47264911G>A	ENSP00000271153:p.Trp53*	137.0	0.0		70.0	25.0	NM_000779	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Nonsense_Mutation	SNP	ENST00000271153.4	37	CCDS542.1	.	.	.	.	.	.	.	.	.	.	G	18.83	3.707124	0.68615	.	.	ENSG00000142973	ENST00000371923;ENST00000271153;ENST00000371919	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.5952	0.76574	0.0:0.0:1.0:0.0	.	.	.	.	X	53	.	ENSP00000271153:W53X	W	+	2	0	CYP4B1	47037498	1.000000	0.71417	1.000000	0.80357	0.067000	0.16453	4.702000	0.61817	2.753000	0.94483	0.467000	0.42956	TGG	.		0.557	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779	
DAGLB	221955	hgsc.bcm.edu;bcgsc.ca	37	7	6474496	6474496	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr7:6474496A>G	ENST00000297056.6	-	4	744	c.575T>C	c.(574-576)gTg>gCg	p.V192A	DAGLB_ENST00000428902.2_Missense_Mutation_p.V65A|DAGLB_ENST00000421761.2_Intron|DAGLB_ENST00000436575.1_Missense_Mutation_p.V151A|DAGLB_ENST00000479922.2_5'Flank|DAGLB_ENST00000425398.2_Intron	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta	192					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		GGTTTCCCACACGCTTGTAGC	0.502																																					p.V192A		.											.	DAGLB	70	0			c.T575C						.						165.0	159.0	161.0					7																	6474496		2203	4300	6503	SO:0001583	missense	221955	exon4			TCCCACACGCTTG	AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.575T>C	7.37:g.6474496A>G	ENSP00000297056:p.Val192Ala	190.0	0.0		114.0	6.0	NM_139179	A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	Missense_Mutation	SNP	ENST00000297056.6	37	CCDS5350.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.361846	0.82353	.	.	ENSG00000164535	ENST00000297056;ENST00000436575;ENST00000471132;ENST00000428902	T;T	0.44083	0.94;0.93	5.37	5.37	0.77165	.	0.068629	0.64402	D	0.000019	T	0.49372	0.1553	M	0.78637	2.42	0.80722	D	1	D	0.53745	0.962	P	0.46389	0.515	T	0.51371	-0.8714	10	0.16420	T	0.52	.	15.3683	0.74541	1.0:0.0:0.0:0.0	.	192	Q8NCG7	DGLB_HUMAN	A	192;151;192;65	ENSP00000297056:V192A;ENSP00000404785:V151A	ENSP00000297056:V192A	V	-	2	0	DAGLB	6441021	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.834000	0.92094	2.024000	0.59613	0.482000	0.46254	GTG	.		0.502	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246840.2	NM_139179	
DGCR14	8220	hgsc.bcm.edu;bcgsc.ca	37	22	19126802	19126802	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr22:19126802A>G	ENST00000252137.6	-	6	735	c.692T>C	c.(691-693)gTc>gCc	p.V231A		NM_022719.2	NP_073210.1	Q96DF8	DGC14_HUMAN	DiGeorge syndrome critical region gene 14	231					mRNA splicing, via spliceosome (GO:0000398)|nervous system development (GO:0007399)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)	16	Colorectal(54;0.0993)					CTCGTCAGGGACACCTGGCAG	0.587																																					p.V231A		.											.	DGCR14	116	0			c.T692C						.						33.0	33.0	33.0					22																	19126802		2203	4300	6503	SO:0001583	missense	8220	exon6			TCAGGGACACCTG	L77566	CCDS13756.1	22q11.21	2007-02-20			ENSG00000100056	ENSG00000100056			16817	protein-coding gene	gene with protein product		601755	"""DiGeorge syndrome critical region gene 13"""	DGCR13		8776594, 9063747	Standard	NM_022719		Approved	DGSI, Es2el, ES2, DGS-H	uc002zou.3	Q96DF8	OTTHUMG00000150119	ENST00000252137.6:c.692T>C	22.37:g.19126802A>G	ENSP00000252137:p.Val231Ala	61.0	0.0		78.0	4.0	NM_022719	Q49AH7|Q9BTZ4	Missense_Mutation	SNP	ENST00000252137.6	37	CCDS13756.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.518884	0.64634	.	.	ENSG00000100056	ENST00000252137	T	0.46819	0.86	5.03	5.03	0.67393	.	0.062809	0.64402	D	0.000006	T	0.54159	0.1841	L	0.52206	1.635	0.58432	D	0.999998	D	0.55605	0.972	P	0.56563	0.801	T	0.48410	-0.9038	10	0.15066	T	0.55	-33.843	14.4069	0.67088	1.0:0.0:0.0:0.0	.	231	Q96DF8	DGC14_HUMAN	A	231	ENSP00000252137:V231A	ENSP00000252137:V231A	V	-	2	0	DGCR14	17506802	1.000000	0.71417	1.000000	0.80357	0.568000	0.35870	6.453000	0.73488	1.887000	0.54652	0.460000	0.39030	GTC	.		0.587	DGCR14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316432.2		
DDX17	10521	hgsc.bcm.edu;broad.mit.edu	37	22	38897259	38897259	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr22:38897259A>G	ENST00000396821.3	-	2	413	c.314T>C	c.(313-315)cTt>cCt	p.L105P	DDX17_ENST00000432525.1_5'UTR|DDX17_ENST00000381633.3_Missense_Mutation_p.L26P	NM_001098504.1|NM_006386.4	NP_001091974|NP_006377.2	Q92841	DDX17_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 17	105					ATP catabolic process (GO:0006200)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of skeletal muscle cell differentiation (GO:2001014)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA helicase activity (GO:0003724)|RNA-dependent ATPase activity (GO:0008186)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	25	Melanoma(58;0.0286)					CTTCGGGGGAAGGCCACCACC	0.388																																					p.L105P	Ovarian(55;1085 1454 6392 21425)	.											.	DDX17	229	0			c.T314C						.						72.0	73.0	72.0					22																	38897259		2203	4300	6503	SO:0001583	missense	10521	exon2			GGGGGAAGGCCAC	U59321	CCDS33646.1, CCDS46706.1	22q13.1	2012-02-23	2012-02-23		ENSG00000100201	ENSG00000100201		"""DEAD-boxes"""	2740	protein-coding gene	gene with protein product		608469	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17 (72kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 17"""			8871553, 17226766	Standard	NM_006386		Approved	P72	uc003avy.4	Q92841	OTTHUMG00000151136	ENST00000396821.3:c.314T>C	22.37:g.38897259A>G	ENSP00000380033:p.Leu105Pro	63.0	0.0		73.0	4.0	NM_006386	B1AHM0|Q69YT1|Q6ICD6	Missense_Mutation	SNP	ENST00000396821.3	37	CCDS46706.1	.	.	.	.	.	.	.	.	.	.	A	14.16	2.453211	0.43531	.	.	ENSG00000100201	ENST00000396821;ENST00000381633;ENST00000403230;ENST00000404499	T;T;T	0.30182	1.54;1.54;1.54	5.58	5.58	0.84498	.	9.185410	0.00166	N	0.000000	T	0.23451	0.0567	N	0.04508	-0.205	0.80722	D	1	B;B;B	0.20988	0.001;0.05;0.008	B;B;B	0.20184	0.001;0.028;0.023	T	0.02533	-1.1145	10	0.33141	T	0.24	-14.9317	15.756	0.78025	1.0:0.0:0.0:0.0	.	26;107;105	Q92841;Q59F66;Q92841-4	DDX17_HUMAN;.;.	P	105;26;105;107	ENSP00000380033:L105P;ENSP00000371046:L26P;ENSP00000385536:L105P	ENSP00000371046:L26P	L	-	2	0	DDX17	37227205	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.645000	0.74343	2.122000	0.65172	0.482000	0.46254	CTT	.		0.388	DDX17-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321476.2	NM_030881	
DIRAS3	9077	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	68512864	68512864	+	Silent	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:68512864G>A	ENST00000370981.1	-	4	753	c.117C>T	c.(115-117)cgC>cgT	p.R39R	GNG12-AS1_ENST00000413628.1_RNA|GNG12-AS1_ENST00000420587.1_RNA|DIRAS3_ENST00000395201.1_Silent_p.R39R			O95661	DIRA3_HUMAN	DIRAS family, GTP-binding RAS-like 3	39					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of gene expression by genetic imprinting (GO:0006349)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						CTACCACGACGCGGTAATCTC	0.582																																					p.R39R		.											.	DIRAS3	848	0			c.C117T						.						68.0	72.0	71.0					1																	68512864		2203	4300	6503	SO:0001819	synonymous_variant	9077	exon2			CACGACGCGGTAA	U96750	CCDS641.1	1p31	2014-05-09		2005-01-27	ENSG00000162595	ENSG00000162595			687	protein-coding gene	gene with protein product		605193	"""ras homolog gene family, member I"""	ARHI		9874798	Standard	XM_006711027		Approved	NOEY2	uc001ded.3	O95661	OTTHUMG00000009544	ENST00000370981.1:c.117C>T	1.37:g.68512864G>A		147.0	0.0		106.0	30.0	NM_004675	B3KMP3	Silent	SNP	ENST00000370981.1	37	CCDS641.1																																																																																			.		0.582	DIRAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026354.2	NM_004675	
DKK3	27122	hgsc.bcm.edu;bcgsc.ca	37	11	11988502	11988502	+	Splice_Site	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:11988502T>C	ENST00000396505.2	-	6	910	c.672A>G	c.(670-672)agA>agG	p.R224R	DKK3_ENST00000326932.4_Splice_Site_p.R224R|DKK3_ENST00000527132.1_Intron|DKK3_ENST00000525493.1_Splice_Site_p.R224R|DKK3_ENST00000450094.2_Splice_Site_p.R196R	NM_015881.5	NP_056965.3	Q9UBP4	DKK3_HUMAN	dickkopf WNT signaling pathway inhibitor 3	224	DKK-type Cys-2.				adrenal gland development (GO:0030325)|anatomical structure morphogenesis (GO:0009653)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of transcription, DNA-templated (GO:0045892)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|pancreas(1)	8				Epithelial(150;0.000502)		GCCACTCACCTCTCTGGAAGG	0.607											OREG0020766	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R224R		.											.	DKK3	721	0			c.A672G						.						77.0	75.0	76.0					11																	11988502		2201	4294	6495	SO:0001630	splice_region_variant	27122	exon6			CTCACCTCTCTGG	AF177396	CCDS7808.1	11p15.3	2013-05-15	2013-05-15		ENSG00000050165	ENSG00000050165			2893	protein-coding gene	gene with protein product	"""regulated in glioma"""	605416	"""dickkopf (Xenopus laevis) homolog 3"", ""dickkopf 3 homolog (Xenopus laevis)"""			10570958	Standard	XM_006718177		Approved	REIC, RIG	uc001mjv.3	Q9UBP4	OTTHUMG00000165709	ENST00000396505.2:c.673+1A>G	11.37:g.11988502T>C		232.0	0.0	676	129.0	6.0	NM_015881	A8K1I2|D3DQW1|Q9ULB7	Silent	SNP	ENST00000396505.2	37	CCDS7808.1																																																																																			.		0.607	DKK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385863.1	NM_013253	Silent
DMD	1756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	32490308	32490308	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:32490308G>T	ENST00000357033.4	-	22	3128	c.2922C>A	c.(2920-2922)atC>atA	p.I974I	DMD_ENST00000378677.2_Silent_p.I970I	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	974					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCTGCTCCATGATTTCATAGT	0.423																																					p.I974I		.											.	DMD	265	0			c.C2922A						.						171.0	148.0	156.0					X																	32490308		2202	4300	6502	SO:0001819	synonymous_variant	1756	exon22			CTCCATGATTTCA	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.2922C>A	X.37:g.32490308G>T		216.0	0.0		156.0	45.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	CCDS14233.1																																																																																			.		0.423	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
DNAH14	127602	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	225440023	225440023	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:225440023G>A	ENST00000445597.2	+	31	5488	c.5488G>A	c.(5488-5490)Gaa>Aaa	p.E1830K	DNAH14_ENST00000430092.1_Missense_Mutation_p.E2251K|DNAH14_ENST00000439375.2_Missense_Mutation_p.E2251K			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	1830					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						ACCAACTGGTGAATGTTCCAT	0.353																																					p.E2251K		.											.	DNAH14	23	0			c.G6751A						.						281.0	234.0	248.0					1																	225440023		692	1591	2283	SO:0001583	missense	127602	exon44			ACTGGTGAATGTT	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.5488G>A	1.37:g.225440023G>A	ENSP00000409472:p.Glu1830Lys	485.0	2.0		460.0	209.0	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	37		.	.	.	.	.	.	.	.	.	.	g	15.12	2.738464	0.49045	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.29397	2.54;1.57;1.57	4.74	1.29	0.21616	.	.	.	.	.	T	0.14570	0.0352	N	0.14661	0.345	0.31076	N	0.712465	B	0.15930	0.015	B	0.16722	0.016	T	0.38023	-0.9680	9	0.06625	T	0.88	.	8.8703	0.35311	0.2323:0.0:0.7677:0.0	.	2251	Q0VDD8-4	.	K	1830;2251;2251	ENSP00000409472:E1830K;ENSP00000414402:E2251K;ENSP00000392061:E2251K	ENSP00000414402:E2251K	E	+	1	0	DNAH14	223506646	0.189000	0.23263	0.029000	0.17559	0.282000	0.26991	0.072000	0.14617	0.030000	0.15379	0.598000	0.82781	GAA	.		0.353	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
DNAH6	1768	hgsc.bcm.edu;bcgsc.ca	37	2	84955003	84955003	+	Silent	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:84955003C>A	ENST00000237449.6	+	60	10191	c.10183C>A	c.(10183-10185)Cga>Aga	p.R3395R	DNAH6_ENST00000389394.3_Silent_p.R3395R			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	3395					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TTTCTTTCTCCGAGGTTCTGC	0.413																																					p.R3395R		.											.	DNAH6	69	0			c.C10183A						.						102.0	83.0	89.0					2																	84955003		692	1591	2283	SO:0001819	synonymous_variant	1768	exon61			TTTCTCCGAGGTT	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.10183C>A	2.37:g.84955003C>A		103.0	0.0		91.0	4.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	37	CCDS46348.1																																																																																			.		0.413	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DOC2A	8448	hgsc.bcm.edu;bcgsc.ca	37	16	30020840	30020840	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:30020840G>T	ENST00000350119.4	-	3	491	c.301C>A	c.(301-303)Cgg>Agg	p.R101R	DOC2A_ENST00000564944.1_Silent_p.R101R|DOC2A_ENST00000564979.1_Silent_p.R101R|DOC2A_ENST00000567824.1_5'Flank	NM_001282062.1|NM_001282063.1|NM_001282068.1|NM_003586.2	NP_001268991.1|NP_001268992.1|NP_001268997.1|NP_003577.2	Q14183	DOC2A_HUMAN	double C2-like domains, alpha	101	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				nervous system development (GO:0007399)|regulation of calcium ion-dependent exocytosis (GO:0017158)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|lysosome (GO:0005764)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)	9						CAGGAGGCCCGGTCGTAGAGA	0.657																																					p.R101R		.											.	DOC2A	92	0			c.C301A						.						47.0	40.0	42.0					16																	30020840		1910	3689	5599	SO:0001819	synonymous_variant	8448	exon3			AGGCCCGGTCGTA	D31897	CCDS10666.1	16p11.2	2014-07-02			ENSG00000149927	ENSG00000149927		"""Synaptotagmins"""	2985	protein-coding gene	gene with protein product		604567				7826360, 9736751	Standard	NM_003586		Approved		uc002dvn.3	Q14183	OTTHUMG00000132109	ENST00000350119.4:c.301C>A	16.37:g.30020840G>T		58.0	0.0		57.0	4.0	NM_003586	B4DEJ2|H3BNH6|Q6P4G4|Q7Z5G0|Q8IVX0	Silent	SNP	ENST00000350119.4	37	CCDS10666.1																																																																																			.		0.657	DOC2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255148.2	NM_003586	
DSCAML1	57453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	117374691	117374691	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:117374691C>T	ENST00000321322.6	-	11	2409	c.2408G>A	c.(2407-2409)cGc>cAc	p.R803H	DSCAML1_ENST00000527706.1_Missense_Mutation_p.R533H	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	743	Ig-like C2-type 9.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GATCTGGATGCGGCCAGTGAG	0.632																																					p.R803H		.											.	DSCAML1	159	0			c.G2408A						.						104.0	94.0	97.0					11																	117374691		2201	4296	6497	SO:0001583	missense	57453	exon11			TGGATGCGGCCAG		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2408G>A	11.37:g.117374691C>T	ENSP00000315465:p.Arg803His	194.0	0.0		134.0	40.0	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.619302	0.87460	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	D;D	0.84800	-1.9;-1.9	4.29	4.29	0.51040	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.88280	0.6394	L	0.35854	1.095	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.87355	0.2340	9	0.34782	T	0.22	.	16.9369	0.86205	0.0:1.0:0.0:0.0	.	743	Q8TD84	DSCL1_HUMAN	H	533;803;510	ENSP00000434335:R533H;ENSP00000315465:R803H	ENSP00000315465:R803H	R	-	2	0	DSCAML1	116879901	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.605000	0.82844	2.237000	0.73441	0.462000	0.41574	CGC	.		0.632	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
DST	667	hgsc.bcm.edu;bcgsc.ca	37	6	56350122	56350122	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr6:56350122G>T	ENST00000361203.3	-	83	20242	c.20235C>A	c.(20233-20235)atC>atA	p.I6745I	DST_ENST00000312431.6_3'UTR|DST_ENST00000370754.5_Silent_p.I7034I|DST_ENST00000370788.2_Silent_p.I4659I|DST_ENST00000421834.2_Silent_p.I4768I|DST_ENST00000370769.4_Silent_p.I6856I|DST_ENST00000244364.6_Silent_p.I4442I|DST_ENST00000446842.2_Silent_p.I6530I			Q03001	DYST_HUMAN	dystonin	6744					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.I6856I(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGTGATTATCGATCAGATTCA	0.363																																					p.I4442I		.											.	DST	523	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.C13326A						.						128.0	122.0	124.0					6																	56350122		1841	4084	5925	SO:0001819	synonymous_variant	667	exon69			ATTATCGATCAGA	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.20235C>A	6.37:g.56350122G>T		150.0	0.0		106.0	5.0	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	37																																																																																				.		0.363	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
DST	667	hgsc.bcm.edu;bcgsc.ca	37	6	56365936	56365936	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr6:56365936T>C	ENST00000361203.3	-	75	18885	c.18878A>G	c.(18877-18879)gAg>gGg	p.E6293G	DST_ENST00000312431.6_3'UTR|DST_ENST00000370754.5_Missense_Mutation_p.E6582G|DST_ENST00000370788.2_Missense_Mutation_p.E4207G|DST_ENST00000421834.2_Missense_Mutation_p.E4316G|DST_ENST00000370769.4_Missense_Mutation_p.E6404G|DST_ENST00000244364.6_Missense_Mutation_p.E3990G|DST_ENST00000446842.2_Missense_Mutation_p.E6078G|DST_ENST00000340834.4_5'UTR			Q03001	DYST_HUMAN	dystonin	6292					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGGTTTCTGCTCACTTAGCAA	0.478																																					p.E3990G		.											.	DST	523	0			c.A11969G						.						99.0	96.0	97.0					6																	56365936		1947	4142	6089	SO:0001583	missense	667	exon61			TTCTGCTCACTTA	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.18878A>G	6.37:g.56365936T>C	ENSP00000354508:p.Glu6293Gly	103.0	0.0		77.0	5.0	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	T	17.02	3.283157	0.59867	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63	5.88	5.88	0.94601	.	0.000000	0.53938	D	0.000042	T	0.57755	0.2075	M	0.62154	1.92	0.33747	D	0.620107	D;D;D;P;B	0.69078	0.96;0.997;0.993;0.896;0.093	P;D;D;P;B	0.73380	0.859;0.98;0.926;0.562;0.059	T	0.57837	-0.7742	9	0.39692	T	0.17	.	16.2744	0.82636	0.0:0.0:0.0:1.0	.	4316;6404;6582;6402;3990	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	G	3990;6582;6404;4316;6078;4207;6293	ENSP00000244364:E3990G;ENSP00000359790:E6582G;ENSP00000359805:E6404G;ENSP00000400883:E4316G;ENSP00000393645:E6078G;ENSP00000359824:E4207G;ENSP00000354508:E6293G	ENSP00000244364:E3990G	E	-	2	0	DST	56473895	1.000000	0.71417	0.957000	0.39632	0.686000	0.39977	5.093000	0.64517	2.237000	0.73441	0.482000	0.46254	GAG	.		0.478	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
DVL2	1856	hgsc.bcm.edu;bcgsc.ca	37	17	7132581	7132581	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:7132581A>G	ENST00000005340.5	-	8	1112	c.830T>C	c.(829-831)tTc>tCc	p.F277S	DVL2_ENST00000574642.1_5'UTR|DVL2_ENST00000575458.1_Missense_Mutation_p.F271S	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	277	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						GATACCCAGGAAGTTGTACTT	0.622																																					p.F277S		.											.	DVL2	659	0			c.T830C						.						81.0	85.0	84.0					17																	7132581		2203	4300	6503	SO:0001583	missense	1856	exon8			CCCAGGAAGTTGT	BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.830T>C	17.37:g.7132581A>G	ENSP00000005340:p.Phe277Ser	115.0	0.0		79.0	4.0	NM_004422	D3DTN3|Q53XM0	Missense_Mutation	SNP	ENST00000005340.5	37	CCDS11091.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.060179	0.76074	.	.	ENSG00000004975	ENST00000005340	T	0.14640	2.49	5.11	5.11	0.69529	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.21921	0.0528	N	0.16233	0.39	0.80722	D	1	P;D	0.89917	0.946;1.0	P;D	0.87578	0.869;0.998	T	0.05920	-1.0856	10	0.87932	D	0	-17.7532	12.856	0.57886	1.0:0.0:0.0:0.0	.	271;277	B4DLQ0;O14641	.;DVL2_HUMAN	S	277	ENSP00000005340:F277S	ENSP00000005340:F277S	F	-	2	0	DVL2	7073305	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	9.307000	0.96226	1.938000	0.56188	0.459000	0.35465	TTC	.		0.622	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219999.2	NM_004422	
DVL2	1856	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	7133190	7133190	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:7133190A>G	ENST00000005340.5	-	5	875	c.593T>C	c.(592-594)cTc>cCc	p.L198P	DVL2_ENST00000574642.1_5'UTR|DVL2_ENST00000575458.1_Missense_Mutation_p.L192P	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	198					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						GCTGGTCATGAGGGTAGAGGA	0.647																																					p.L198P		.											.	DVL2	659	0			c.T593C						.						69.0	72.0	71.0					17																	7133190		2203	4300	6503	SO:0001583	missense	1856	exon5			GTCATGAGGGTAG	BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.593T>C	17.37:g.7133190A>G	ENSP00000005340:p.Leu198Pro	93.0	0.0		50.0	4.0	NM_004422	D3DTN3|Q53XM0	Missense_Mutation	SNP	ENST00000005340.5	37	CCDS11091.1	.	.	.	.	.	.	.	.	.	.	A	19.64	3.864584	0.71949	.	.	ENSG00000004975	ENST00000005340	T	0.04917	3.53	5.18	5.18	0.71444	Dishevelled protein domain (1);	0.137790	0.49305	D	0.000146	T	0.23410	0.0566	M	0.74881	2.28	0.80722	D	1	D;D;D	0.76494	0.999;0.994;0.994	D;D;D	0.71184	0.972;0.961;0.961	T	0.00557	-1.1672	10	0.72032	D	0.01	-21.0209	12.972	0.58517	1.0:0.0:0.0:0.0	.	105;192;198	B4DM44;B4DLQ0;O14641	.;.;DVL2_HUMAN	P	198	ENSP00000005340:L198P	ENSP00000005340:L198P	L	-	2	0	DVL2	7073914	1.000000	0.71417	0.998000	0.56505	0.807000	0.45602	8.930000	0.92872	1.961000	0.56991	0.418000	0.28097	CTC	.		0.647	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219999.2	NM_004422	
DYNC1H1	1778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	102494143	102494143	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr14:102494143C>A	ENST00000360184.4	+	47	9400	c.9236C>A	c.(9235-9237)gCa>gAa	p.A3079E		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3079	AAA 4. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						AAGGACCGGGCAGCTACATCA	0.562																																					p.A3079E		.											.	DYNC1H1	98	0			c.C9236A						.						130.0	124.0	126.0					14																	102494143		2203	4300	6503	SO:0001583	missense	1778	exon47			ACCGGGCAGCTAC	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.9236C>A	14.37:g.102494143C>A	ENSP00000348965:p.Ala3079Glu	88.0	0.0		59.0	14.0	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.721168	0.89205	.	.	ENSG00000197102	ENST00000360184	T	0.49139	0.79	5.78	5.78	0.91487	Dynein heavy chain, P-loop containing D4 domain (1);ATPase, AAA+ type, core (1);	0.112123	0.64402	D	0.000011	T	0.79100	0.4389	H	0.96943	3.91	0.80722	D	1	D	0.63046	0.992	P	0.61275	0.886	D	0.85690	0.1306	10	0.72032	D	0.01	.	20.0203	0.97492	0.0:1.0:0.0:0.0	.	3079	Q14204	DYHC1_HUMAN	E	3079	ENSP00000348965:A3079E	ENSP00000348965:A3079E	A	+	2	0	DYNC1H1	101563896	1.000000	0.71417	0.944000	0.38274	0.889000	0.51656	7.554000	0.82212	2.730000	0.93505	0.655000	0.94253	GCA	.		0.562	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
EFTUD2	9343	hgsc.bcm.edu;bcgsc.ca	37	17	42937415	42937415	+	Splice_Site	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:42937415T>C	ENST00000426333.2	-	18	2017		c.e18-2		EFTUD2_ENST00000591382.1_Splice_Site|EFTUD2_ENST00000592576.1_Splice_Site|EFTUD2_ENST00000402521.3_Splice_Site	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2						gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				AATCTGAGCCTGAGATCCAAA	0.493																																					.	Ovarian(10;65 485 10258 29980 30707)	.											.	EFTUD2	91	0			c.1720-2A>G						.						94.0	88.0	90.0					17																	42937415		2203	4300	6503	SO:0001630	splice_region_variant	9343	exon19			TGAGCCTGAGATC	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.1720-2A>G	17.37:g.42937415T>C		145.0	0.0		116.0	5.0	NM_004247	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Splice_Site	SNP	ENST00000426333.2	37	CCDS11489.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.450043	0.84101	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0055	0.71510	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	EFTUD2	40292941	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.850000	0.86915	2.135000	0.66039	0.454000	0.30748	.	.		0.493	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	NM_004247	Intron
EGLN2	112398	hgsc.bcm.edu;bcgsc.ca	37	19	41306565	41306565	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:41306565G>A	ENST00000593726.1	+	1	1116	c.88G>A	c.(88-90)Ggc>Agc	p.G30S	EGLN2_ENST00000303961.4_Missense_Mutation_p.G30S|CTC-490E21.12_ENST00000601627.1_5'Flank|EGLN2_ENST00000594140.1_5'Flank|RAB4B-EGLN2_ENST00000594136.1_3'UTR|EGLN2_ENST00000406058.2_Missense_Mutation_p.G30S			Q96KS0	EGLN2_HUMAN	egl-9 family hypoxia-inducible factor 2	30					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|intracellular estrogen receptor signaling pathway (GO:0030520)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|positive regulation of protein catabolic process (GO:0045732)|regulation of cell growth (GO:0001558)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-proline 4-dioxygenase activity (GO:0031545)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	GCCTGAGCCTGGCCGGGCCAG	0.652																																					p.G30S		.											.	EGLN2	228	0			c.G88A						.						45.0	39.0	41.0					19																	41306565		2203	4300	6503	SO:0001583	missense	112398	exon2			GAGCCTGGCCGGG	AJ310544	CCDS12567.1	19q13.2	2013-08-21	2013-08-21		ENSG00000269858	ENSG00000269858			14660	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 1"""	606424	"""EGL nine (C.elegans) homolog 2"", ""egl nine homolog 2 (C. elegans)"""				Standard	NM_080732		Approved	PHD1, HIFPH1	uc002oph.3	Q96KS0		ENST00000593726.1:c.88G>A	19.37:g.41306565G>A	ENSP00000469686:p.Gly30Ser	108.0	0.0		96.0	4.0	NM_053046	A8K5S0|Q8WWY4|Q9BV14	Missense_Mutation	SNP	ENST00000593726.1	37	CCDS12567.1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.536840	0.27475	.	.	ENSG00000171570	ENST00000303961;ENST00000406058	T;T	0.30448	1.53;1.53	4.04	0.449	0.16619	.	0.434068	0.21393	N	0.075276	T	0.08980	0.0222	N	0.02539	-0.55	0.28523	N	0.912943	B	0.02656	0.0	B	0.04013	0.001	T	0.34850	-0.9812	10	0.08837	T	0.75	-6.1654	6.3273	0.21251	0.6573:0.0:0.3427:0.0	.	30	Q96KS0	EGLN2_HUMAN	S	30	ENSP00000307080:G30S;ENSP00000385253:G30S	ENSP00000307080:G30S	G	+	1	0	EGLN2	45998405	0.123000	0.22298	1.000000	0.80357	0.994000	0.84299	0.411000	0.21115	0.301000	0.22738	0.491000	0.48974	GGC	.		0.652	EGLN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463218.1		
EHBP1	23301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	62998523	62998523	+	Missense_Mutation	SNP	A	A	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:62998523A>C	ENST00000263991.5	+	5	790	c.308A>C	c.(307-309)gAa>gCa	p.E103A	EHBP1_ENST00000405015.3_Missense_Mutation_p.E103A|EHBP1_ENST00000405289.1_Missense_Mutation_p.E103A|EHBP1_ENST00000431489.1_Missense_Mutation_p.E103A|EHBP1_ENST00000354487.3_Missense_Mutation_p.E103A	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	103						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			TTTGTCATAGAAAATGTAAGC	0.333																																					p.E103A		.											.	EHBP1	154	0			c.A308C						.						114.0	113.0	113.0					2																	62998523		2203	4296	6499	SO:0001583	missense	23301	exon5			TCATAGAAAATGT	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.308A>C	2.37:g.62998523A>C	ENSP00000263991:p.Glu103Ala	152.0	0.0		145.0	26.0	NM_001142616	O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	ENST00000263991.5	37	CCDS1872.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.618486	0.87359	.	.	ENSG00000115504	ENST00000405015;ENST00000413434;ENST00000405482;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289	T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.06	5.06	0.68205	.	0.122342	0.56097	D	0.000023	T	0.68513	0.3009	M	0.87180	2.865	0.80722	D	1	P;D;D;P	0.71674	0.726;0.979;0.998;0.689	P;D;D;P	0.81914	0.525;0.973;0.995;0.73	T	0.75539	-0.3282	10	0.87932	D	0	.	14.5025	0.67732	1.0:0.0:0.0:0.0	.	103;103;103;103	Q8NDI1-2;A8K930;Q8NDI1-3;Q8NDI1	.;.;.;EHBP1_HUMAN	A	103;71;103;103;103;103;103	ENSP00000384143:E103A;ENSP00000392192:E71A;ENSP00000384829:E103A;ENSP00000403783:E103A;ENSP00000263991:E103A;ENSP00000346482:E103A;ENSP00000385524:E103A	ENSP00000263991:E103A	E	+	2	0	EHBP1	62852027	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.964000	0.93389	1.909000	0.55274	0.528000	0.53228	GAA	.		0.333	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251616.1	NM_015252	
EIF2A	83939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	150285799	150285799	+	Silent	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:150285799G>A	ENST00000460851.1	+	8	769	c.660G>A	c.(658-660)aaG>aaA	p.K220K	SERP1_ENST00000479209.1_Intron|EIF2A_ENST00000487799.1_Silent_p.K195K|EIF2A_ENST00000383043.3_Splice_Site|SERP1_ENST00000490945.1_Intron|EIF2A_ENST00000406576.3_Silent_p.K159K|EIF2A_ENST00000273435.5_Silent_p.K215K			Q9BY44	EIF2A_HUMAN	eukaryotic translation initiation factor 2A, 65kDa	220					positive regulation of signal transduction (GO:0009967)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|ribosome assembly (GO:0042255)|SREBP signaling pathway (GO:0032933)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|eukaryotic translation initiation factor 2 complex (GO:0005850)|extracellular space (GO:0005615)	ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)|tRNA binding (GO:0000049)			cervix(1)|endometrium(2)|kidney(1)|lung(3)	7		Melanoma(1037;0.0575)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GTTTCTTTAAGGCAGATAAAG	0.338																																					p.K220K		.											.	EIF2A	22	0			c.G660A						.						65.0	61.0	62.0					3																	150285799		1824	4087	5911	SO:0001819	synonymous_variant	83939	exon8			CTTTAAGGCAGAT	AF212241	CCDS46935.1	3q25.1	2011-01-19	2006-01-24		ENSG00000144895	ENSG00000144895			3254	protein-coding gene	gene with protein product		609234				12133843, 1620067	Standard	NM_032025		Approved	EIF-2A	uc003eya.3	Q9BY44	OTTHUMG00000159775	ENST00000460851.1:c.660G>A	3.37:g.150285799G>A		60.0	0.0		61.0	19.0	NM_032025	A8MPS6|B4DF96|B4DQ14|D3DNI9|Q5QTR2|Q7Z4E9|Q8NFM1|Q96EW9|Q96K81	Silent	SNP	ENST00000460851.1	37	CCDS46935.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.822993	0.50739	.	.	ENSG00000144895	ENST00000383043	.	.	.	6.07	3.18	0.36537	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.1513	0.20313	0.5938:0.0:0.4062:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EIF2A	151768489	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.664000	0.46783	0.796000	0.33947	0.655000	0.94253	.	.		0.338	EIF2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357259.2	NM_032025	
EIF4A3	9775	hgsc.bcm.edu;bcgsc.ca	37	17	78109863	78109863	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:78109863G>T	ENST00000269349.3	-	11	1380	c.1159C>A	c.(1159-1161)Cgc>Agc	p.R387S		NM_014740.3	NP_055555.1	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A3	387	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cytokine-mediated signaling pathway (GO:0019221)|embryonic cranial skeleton morphogenesis (GO:0048701)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|mRNA binding (GO:0003729)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			CTGAGGATGCGGATGTCGTCA	0.428																																					p.R387S		.											.	EIF4A3	227	0			c.C1159A						.						128.0	120.0	123.0					17																	78109863		2203	4300	6503	SO:0001583	missense	9775	exon11			GGATGCGGATGTC	BC004386	CCDS11767.1	17q25.3	2010-02-10	2010-02-10	2006-11-27		ENSG00000141543		"""DEAD-boxes"""	18683	protein-coding gene	gene with protein product		608546	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 48"", ""eukaryotic translation initiation factor 4A, isoform 3"""	DDX48		10623621, 14730019	Standard	NM_014740		Approved	KIAA0111, EIF4AIII	uc002jxs.3	P38919		ENST00000269349.3:c.1159C>A	17.37:g.78109863G>T	ENSP00000269349:p.Arg387Ser	81.0	0.0		58.0	4.0	NM_014740	Q15033|Q6IBQ2|Q96A18	Missense_Mutation	SNP	ENST00000269349.3	37	CCDS11767.1	.	.	.	.	.	.	.	.	.	.	G	9.791	1.178053	0.21787	.	.	ENSG00000141543	ENST00000269349	T	0.04551	3.6	4.18	2.12	0.27331	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.03348	0.0097	N	0.20845	0.615	0.80722	D	1	B	0.10296	0.003	B	0.12837	0.008	T	0.44605	-0.9317	10	0.72032	D	0.01	-18.3621	6.2572	0.20879	0.1016:0.0:0.7137:0.1847	.	387	P38919	IF4A3_HUMAN	S	387	ENSP00000269349:R387S	ENSP00000269349:R387S	R	-	1	0	EIF4A3	75724458	1.000000	0.71417	0.809000	0.32408	0.155000	0.21991	5.903000	0.69877	0.397000	0.25310	0.555000	0.69702	CGC	.		0.428	EIF4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437446.1	NM_014740	
ELOVL6	79071	hgsc.bcm.edu;bcgsc.ca	37	4	111119423	111119423	+	Silent	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr4:111119423G>A	ENST00000394607.3	-	2	232	c.69C>T	c.(67-69)atC>atT	p.I23I	ELOVL6_ENST00000302274.3_Silent_p.I23I|ELOVL6_ENST00000506461.1_5'UTR			Q9H5J4	ELOV6_HUMAN	ELOVL fatty acid elongase 6	23					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty acid biosynthetic process (GO:0042759)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	8				OV - Ovarian serous cystadenocarcinoma(123;0.00462)		GCATCCATTGGATGGCTTCAT	0.493																																					p.I23I		.											.	ELOVL6	91	0			c.C69T						.						236.0	200.0	213.0					4																	111119423		2203	4300	6503	SO:0001819	synonymous_variant	79071	exon2			CCATTGGATGGCT	AK027031	CCDS3690.1	4q25	2011-05-25	2011-05-25		ENSG00000170522	ENSG00000170522			15829	protein-coding gene	gene with protein product		611546	"""ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"""			11567032	Standard	NM_024090		Approved	FLJ23378, MGC5487, LCE	uc003hzz.3	Q9H5J4	OTTHUMG00000132547	ENST00000394607.3:c.69C>T	4.37:g.111119423G>A		140.0	0.0		78.0	5.0	NM_001130721	Q4W5L0|Q8NCD1	Silent	SNP	ENST00000394607.3	37	CCDS3690.1																																																																																			.		0.493	ELOVL6-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255748.1	NM_024090	
EMILIN2	84034	hgsc.bcm.edu;bcgsc.ca	37	18	2891118	2891118	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr18:2891118G>T	ENST00000254528.3	+	4	1152	c.993G>T	c.(991-993)gaG>gaT	p.E331D		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	331					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		AGCTCATGGAGGGCATGGACA	0.552																																					p.E331D		.											.	EMILIN2	93	0			c.G993T						.						113.0	116.0	115.0					18																	2891118		2203	4300	6503	SO:0001583	missense	84034	exon4			CATGGAGGGCATG	AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.993G>T	18.37:g.2891118G>T	ENSP00000254528:p.Glu331Asp	88.0	0.0		78.0	5.0	NM_032048	B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	ENST00000254528.3	37	CCDS11828.1	.	.	.	.	.	.	.	.	.	.	G	12.36	1.915026	0.33815	.	.	ENSG00000132205	ENST00000254528	T	0.32753	1.44	5.09	0.0109	0.14085	.	0.078107	0.52532	D	0.000066	T	0.24275	0.0588	M	0.61703	1.905	0.29809	N	0.831758	B	0.27882	0.192	B	0.29176	0.099	T	0.16453	-1.0402	10	0.21540	T	0.41	-40.7192	5.6585	0.17656	0.4833:0.0:0.3862:0.1306	.	331	Q9BXX0	EMIL2_HUMAN	D	331	ENSP00000254528:E331D	ENSP00000254528:E331D	E	+	3	2	EMILIN2	2881118	0.734000	0.28142	0.987000	0.45799	0.989000	0.77384	-0.068000	0.11561	0.002000	0.14630	0.557000	0.71058	GAG	.		0.552	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048	
ENPP3	5169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	132068028	132068028	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr6:132068028A>G	ENST00000414305.1	+	26	2888	c.2560A>G	c.(2560-2562)Aaa>Gaa	p.K854E	ENPP3_ENST00000358229.5_3'UTR|ENPP3_ENST00000357639.3_Missense_Mutation_p.K854E			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	854	Nuclease.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		CTATCAGGATAAAGTGCAGCC	0.363																																					p.K854E		.											.	ENPP3	95	0			c.A2560G						.						67.0	70.0	69.0					6																	132068028		2203	4300	6503	SO:0001583	missense	5169	exon25			CAGGATAAAGTGC	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.2560A>G	6.37:g.132068028A>G	ENSP00000406261:p.Lys854Glu	217.0	0.0		151.0	37.0	NM_005021	Q5JTL3	Missense_Mutation	SNP	ENST00000414305.1	37	CCDS5148.1	.	.	.	.	.	.	.	.	.	.	A	8.833	0.940494	0.18281	.	.	ENSG00000154269	ENST00000414305;ENST00000357639	T;T	0.73258	-0.73;-0.73	5.45	5.45	0.79879	DNA/RNA non-specific endonuclease (1);Extracellular Endonuclease, subunit A (1);	0.249386	0.35378	N	0.003250	T	0.59702	0.2213	M	0.68317	2.08	0.30983	N	0.722258	B	0.32467	0.372	B	0.39771	0.309	T	0.61382	-0.7074	10	0.37606	T	0.19	-20.724	11.7667	0.51935	0.8531:0.1469:0.0:0.0	.	854	O14638	ENPP3_HUMAN	E	854	ENSP00000406261:K854E;ENSP00000350265:K854E	ENSP00000350265:K854E	K	+	1	0	ENPP3	132109721	0.430000	0.25538	0.028000	0.17463	0.009000	0.06853	3.820000	0.55693	2.190000	0.69967	0.482000	0.46254	AAA	.		0.363	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2		
EP300	2033	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	41573037	41573037	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr22:41573037A>T	ENST00000263253.7	+	31	6541	c.5322A>T	c.(5320-5322)aaA>aaT	p.K1774N	RP1-85F18.5_ENST00000420537.1_RNA|RP1-85F18.6_ENST00000415054.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1774	Binding region for E1A adenovirus.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						GCAAACGGAAAACCAATGGCG	0.562			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.K1774N		.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	2011	0			c.A5322T						.						76.0	67.0	70.0					22																	41573037		2203	4300	6503	SO:0001583	missense	2033	exon31	Familial Cancer Database	Broad Thumb-Hallux syndrome	ACGGAAAACCAAT	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.5322A>T	22.37:g.41573037A>T	ENSP00000263253:p.Lys1774Asn	78.0	0.0		85.0	6.0	NM_001429	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	37	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	A	14.61	2.586477	0.46110	.	.	ENSG00000100393	ENST00000263253	D	0.83250	-1.7	5.76	0.909	0.19332	Zinc finger, TAZ-type (5);	0.000000	0.51477	D	0.000098	D	0.90748	0.7096	M	0.88570	2.965	0.38829	D	0.955817	D	0.89917	1.0	D	0.87578	0.998	D	0.90571	0.4522	10	0.72032	D	0.01	-8.7941	10.9976	0.47585	0.6018:0.0:0.3982:0.0	.	1774	Q09472	EP300_HUMAN	N	1774	ENSP00000263253:K1774N	ENSP00000263253:K1774N	K	+	3	2	EP300	39902983	0.991000	0.36638	1.000000	0.80357	0.992000	0.81027	0.310000	0.19356	0.124000	0.18369	0.533000	0.62120	AAA	.		0.562	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
ETF1	2107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	137844000	137844000	+	Silent	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr5:137844000G>A	ENST00000360541.5	-	11	1529	c.1308C>T	c.(1306-1308)gaC>gaT	p.D436D	ETF1_ENST00000499810.2_Silent_p.D403D|ETF1_ENST00000503014.1_Silent_p.D422D	NM_004730.3	NP_004721.1	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	436					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)|translation termination factor activity (GO:0008079)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CTACCTAGTAGTCATCAAGGT	0.488																																					p.D436D		.											.	ETF1	229	0			c.C1308T						.						56.0	47.0	50.0					5																	137844000		2203	4300	6503	SO:0001819	synonymous_variant	2107	exon11			CTAGTAGTCATCA	AF095901	CCDS4207.1, CCDS75313.1, CCDS75314.1	5q31.2	2008-02-05			ENSG00000120705	ENSG00000120705			3477	protein-coding gene	gene with protein product	"""sup45 (yeast omnipotent suppressor 45) homolog-like 1"", ""polypeptide chain release factor 1"""	600285		SUP45L1, ERF1, ERF		1546371, 7990965	Standard	NM_004730		Approved	eRF1, TB3-1, RF1	uc003ldc.5	P62495	OTTHUMG00000129199	ENST00000360541.5:c.1308C>T	5.37:g.137844000G>A		96.0	0.0		124.0	19.0	NM_004730	B2R6B4|D3DQC1|P46055|Q5M7Z7|Q96CG1	Silent	SNP	ENST00000360541.5	37	CCDS4207.1																																																																																			.		0.488	ETF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251276.2	NM_004730	
EVX2	344191	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	176948256	176948256	+	Silent	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:176948256G>A	ENST00000308618.4	-	1	385	c.249C>T	c.(247-249)ggC>ggT	p.G83G		NM_001080458.1	NP_001073927.1	Q03828	EVX2_HUMAN	even-skipped homeobox 2	83					limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(3)	16			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)		TGCTTTCGCTGCCCGTGTGCT	0.642																																					p.G83G		.											.	EVX2	70	0			c.C249T						.						62.0	70.0	67.0					2																	176948256		2203	4300	6503	SO:0001819	synonymous_variant	344191	exon1			TTCGCTGCCCGTG		CCDS33333.1	2q31.1	2012-03-09	2007-02-15		ENSG00000174279	ENSG00000174279		"""Homeoboxes / ANTP class : HOXL subclass"""	3507	protein-coding gene	gene with protein product		142991	"""eve, even-skipped homeobox homolog 2 (Drosophila)"""			1675198	Standard	NM_001080458		Approved		uc010zeu.2	Q03828	OTTHUMG00000154173	ENST00000308618.4:c.249C>T	2.37:g.176948256G>A		226.0	1.0		259.0	52.0	NM_001080458		Silent	SNP	ENST00000308618.4	37	CCDS33333.1																																																																																			.		0.642	EVX2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359252.1		
FAM129B	64855	hgsc.bcm.edu;bcgsc.ca	37	9	130272586	130272586	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:130272586A>G	ENST00000373312.3	-	9	1213	c.1000T>C	c.(1000-1002)Tgc>Cgc	p.C334R	FAM129B_ENST00000468379.1_Intron|FAM129B_ENST00000373314.3_Missense_Mutation_p.C321R	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	334					negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						TTCCGCACGCACACCTCTGCC	0.642																																					p.C334R		.											.	FAM129B	68	0			c.T1000C						.						106.0	102.0	103.0					9																	130272586		2203	4300	6503	SO:0001583	missense	64855	exon9			GCACGCACACCTC	AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.1000T>C	9.37:g.130272586A>G	ENSP00000362409:p.Cys334Arg	108.0	0.0		66.0	4.0	NM_022833	Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Missense_Mutation	SNP	ENST00000373312.3	37	CCDS35145.1	.	.	.	.	.	.	.	.	.	.	A	8.958	0.969866	0.18659	.	.	ENSG00000136830	ENST00000373314;ENST00000373312	T;T	0.26067	1.77;1.76	6.04	6.04	0.98038	.	0.174286	0.51477	D	0.000096	T	0.23210	0.0561	L	0.40543	1.245	0.80722	D	1	P;P	0.39094	0.659;0.659	B;B	0.37943	0.261;0.261	T	0.02625	-1.1132	10	0.26408	T	0.33	-23.0447	14.5284	0.67905	1.0:0.0:0.0:0.0	.	321;334	Q96TA1-2;Q96TA1	.;NIBL1_HUMAN	R	321;334	ENSP00000362411:C321R;ENSP00000362409:C334R	ENSP00000362409:C334R	C	-	1	0	FAM129B	129312407	1.000000	0.71417	1.000000	0.80357	0.049000	0.14656	3.207000	0.51106	2.317000	0.78254	0.459000	0.35465	TGC	.		0.642	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054196.1	NM_022833	
FAM155B	27112	hgsc.bcm.edu;bcgsc.ca	37	X	68725240	68725240	+	Silent	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:68725240C>A	ENST00000252338.4	+	1	157	c.115C>A	c.(115-117)Cgg>Agg	p.R39R	AL158069.1_ENST00000579664.1_RNA	NM_015686.2	NP_056501.2	O75949	F155B_HUMAN	family with sequence similarity 155, member B	39						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)	16						CGACTCCGAGCGGGCGCAGCG	0.701																																					p.R39R		.											.	FAM155B	131	0			c.C115A						.						11.0	6.0	8.0					X																	68725240		1882	3579	5461	SO:0001819	synonymous_variant	27112	exon1			TCCGAGCGGGCGC	AF087142	CCDS35317.1	Xq13.1	2008-04-15	2008-04-15	2008-04-15	ENSG00000130054	ENSG00000130054			30701	protein-coding gene	gene with protein product			"""transmembrane protein 28"", ""chromosome X open reading frame 63"""	TMEM28, CXorf63			Standard	NM_015686		Approved	TED	uc004dxk.3	O75949	OTTHUMG00000021756	ENST00000252338.4:c.115C>A	X.37:g.68725240C>A		54.0	0.0		55.0	4.0	NM_015686	B1ALV6|B9EGK1|D3DVU1	Silent	SNP	ENST00000252338.4	37	CCDS35317.1																																																																																			.		0.701	FAM155B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057037.1	NM_015686	
FAM161A	84140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	62067708	62067708	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:62067708G>A	ENST00000405894.3	-	3	532	c.431C>T	c.(430-432)tCa>tTa	p.S144L	FAM161A_ENST00000404929.1_Missense_Mutation_p.S144L	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	144					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GTTCTTTTCTGATACAGATCT	0.343																																					p.S144L		.											.	FAM161A	136	0			c.C431T						.						67.0	59.0	61.0					2																	62067708		1833	4086	5919	SO:0001583	missense	84140	exon3			TTTTCTGATACAG		CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.431C>T	2.37:g.62067708G>A	ENSP00000385893:p.Ser144Leu	200.0	0.0		159.0	76.0	NM_032180	B4DJV7|Q9H8R2	Missense_Mutation	SNP	ENST00000405894.3	37	CCDS42687.2	.	.	.	.	.	.	.	.	.	.	G	13.01	2.110039	0.37242	.	.	ENSG00000170264	ENST00000404929;ENST00000405894	T;T	0.25250	2.62;1.81	4.66	1.63	0.23807	.	0.372310	0.26453	N	0.024295	T	0.21921	0.0528	L	0.56769	1.78	0.09310	N	1	P;B	0.50156	0.932;0.274	B;B	0.44278	0.445;0.084	T	0.13019	-1.0525	9	.	.	.	-9.5961	2.1742	0.03858	0.1828:0.2952:0.3944:0.1276	.	144;144	Q3B820;Q3B820-3	F161A_HUMAN;.	L	144	ENSP00000385158:S144L;ENSP00000385893:S144L	.	S	-	2	0	FAM161A	61921212	0.997000	0.39634	0.163000	0.22734	0.918000	0.54935	1.814000	0.38972	0.513000	0.28278	0.563000	0.77884	TCA	.		0.343	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325537.2	NM_032180	
FANCM	57697	hgsc.bcm.edu;bcgsc.ca	37	14	45633698	45633698	+	Missense_Mutation	SNP	G	G	T	rs550238354		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr14:45633698G>T	ENST00000267430.5	+	10	1803	c.1718G>T	c.(1717-1719)cGa>cTa	p.R573L	FANCM_ENST00000542564.2_Missense_Mutation_p.R547L|FANCM_ENST00000556036.1_Missense_Mutation_p.R573L	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	573	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						CTTGTACAACGAATGGGTAGA	0.423								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.R573L		.											.	FANCM	569	0			c.G1718T						.						76.0	74.0	74.0					14																	45633698		2203	4300	6503	SO:0001583	missense	57697	exon10	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TACAACGAATGGG	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.1718G>T	14.37:g.45633698G>T	ENSP00000267430:p.Arg573Leu	128.0	0.0		80.0	4.0	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	37	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	G	34	5.394071	0.96009	.	.	ENSG00000187790	ENST00000556036;ENST00000267430;ENST00000542564	D;D;D	0.81908	-1.55;-1.55;-1.55	6.07	6.07	0.98685	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.95677	0.8594	H	0.99325	4.515	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96905	0.9663	10	0.87932	D	0	.	20.2544	0.98414	0.0:0.0:1.0:0.0	.	547;573;573	B2RTQ9;Q8IYD8;Q8IYD8-2	.;FANCM_HUMAN;.	L	573;573;547	ENSP00000450596:R573L;ENSP00000267430:R573L;ENSP00000442493:R547L	ENSP00000267430:R573L	R	+	2	0	FANCM	44703448	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.432000	0.97498	2.885000	0.99019	0.655000	0.94253	CGA	.		0.423	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
FAT3	120114	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	92533159	92533159	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:92533159T>C	ENST00000298047.6	+	9	6997	c.6980T>C	c.(6979-6981)gTc>gCc	p.V2327A	FAT3_ENST00000525166.1_Missense_Mutation_p.V2177A|FAT3_ENST00000409404.2_Missense_Mutation_p.V2327A			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2327	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TATCAGATTGTCCAGGATACC	0.388										TCGA Ovarian(4;0.039)																											p.V2327A		.											.	FAT3	73	0			c.T6980C						.						87.0	78.0	81.0					11																	92533159		1904	4124	6028	SO:0001583	missense	120114	exon9			AGATTGTCCAGGA	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.6980T>C	11.37:g.92533159T>C	ENSP00000298047:p.Val2327Ala	78.0	1.0		56.0	23.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	T	17.07	3.296390	0.60086	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.51574	0.7;0.7;0.7	5.94	5.94	0.96194	.	.	.	.	.	T	0.50326	0.1609	L	0.48174	1.505	0.80722	D	1	P	0.44044	0.825	P	0.46026	0.501	T	0.49399	-0.8944	9	0.48119	T	0.1	.	16.4075	0.83691	0.0:0.0:0.0:1.0	.	2327	Q8TDW7-3	.	A	2327;2327;2177	ENSP00000298047:V2327A;ENSP00000387040:V2327A;ENSP00000432586:V2177A	ENSP00000298047:V2327A	V	+	2	0	FAT3	92172807	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.240000	0.72363	2.275000	0.75901	0.528000	0.53228	GTC	.		0.388	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FAT3	120114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	92616016	92616016	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:92616016T>C	ENST00000298047.6	+	23	12411	c.12394T>C	c.(12394-12396)Tac>Cac	p.Y4132H	FAT3_ENST00000525166.1_Missense_Mutation_p.Y3982H|FAT3_ENST00000409404.2_Missense_Mutation_p.Y4132H|FAT3_ENST00000533797.1_Missense_Mutation_p.Y467H			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4132	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CGTGGGCCAGTACTGCGGGCT	0.622										TCGA Ovarian(4;0.039)																											p.Y4132H		.											.	FAT3	73	0			c.T12394C						.						61.0	79.0	73.0					11																	92616016		2093	4213	6306	SO:0001583	missense	120114	exon23			GGCCAGTACTGCG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.12394T>C	11.37:g.92616016T>C	ENSP00000298047:p.Tyr4132His	130.0	0.0		76.0	22.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	T	0.836	-0.743501	0.03088	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	D;D;D;D	0.91577	-2.24;-2.24;-2.24;-2.87	5.55	-1.56	0.08532	EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.75642	0.3877	N	0.10837	0.055	0.80722	D	1	B;B	0.09022	0.002;0.0	B;B	0.09377	0.002;0.004	T	0.62267	-0.6890	9	0.02654	T	1	.	11.637	0.51209	0.0:0.4332:0.0:0.5668	.	4132;4132	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	H	4132;4132;3982;467	ENSP00000298047:Y4132H;ENSP00000387040:Y4132H;ENSP00000432586:Y3982H;ENSP00000436399:Y467H	ENSP00000298047:Y4132H	Y	+	1	0	FAT3	92255664	0.940000	0.31905	0.676000	0.29932	0.598000	0.36846	0.132000	0.15891	-0.451000	0.07097	-0.250000	0.11733	TAC	.		0.622	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FBXL22	283807	hgsc.bcm.edu;bcgsc.ca	37	15	63889776	63889776	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr15:63889776A>G	ENST00000360587.2	+	1	225	c.185A>G	c.(184-186)aAg>aGg	p.K62R	USP3-AS1_ENST00000559861.1_RNA|FBXL22_ENST00000539570.3_Missense_Mutation_p.K56R|USP3-AS1_ENST00000561256.1_RNA|FBXL22_ENST00000534939.1_Missense_Mutation_p.K62R|USP3-AS1_ENST00000560962.1_RNA|USP3-AS1_ENST00000560622.1_RNA|USP3-AS1_ENST00000558831.1_RNA|USP3-AS1_ENST00000559737.1_RNA|USP3-AS1_ENST00000561191.1_RNA	NM_203373.2	NP_976307.2	Q6P050	FXL22_HUMAN	F-box and leucine-rich repeat protein 22	62					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(4)	4						GAACTCCAGAAGGACAACTTC	0.627																																					p.K62R		.											.	FBXL22	90	0			c.A185G						.						62.0	50.0	54.0					15																	63889776		2203	4300	6503	SO:0001583	missense	283807	exon1			TCCAGAAGGACAA	BC065833	CCDS10187.1, CCDS10187.2	15q22.1	2012-04-05			ENSG00000197361	ENSG00000197361		"""F-boxes / Leucine-rich repeats"""	27537	protein-coding gene	gene with protein product		609088				12477932	Standard	NM_203373		Approved	Fbl22, FLJ39626	uc002amn.4	Q6P050	OTTHUMG00000132905	ENST00000360587.2:c.185A>G	15.37:g.63889776A>G	ENSP00000353794:p.Lys62Arg	80.0	0.0		83.0	4.0	NM_203373		Missense_Mutation	SNP	ENST00000360587.2	37	CCDS10187.2	.	.	.	.	.	.	.	.	.	.	A	21.4	4.138354	0.77775	.	.	ENSG00000197361	ENST00000360587;ENST00000539570	T;T	0.39056	1.1;1.1	5.49	5.49	0.81192	.	0.158011	0.56097	D	0.000032	T	0.29684	0.0741	L	0.41824	1.3	0.33837	D	0.630966	P	0.43750	0.816	B	0.32762	0.152	T	0.52290	-0.8595	10	0.52906	T	0.07	-11.311	10.7624	0.46272	0.9261:0.0:0.0739:0.0	.	56	Q6P050	FXL22_HUMAN	R	62;56	ENSP00000353794:K62R;ENSP00000442112:K56R	ENSP00000353794:K62R	K	+	2	0	FBXL22	61676829	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.369000	0.44231	2.090000	0.63153	0.460000	0.39030	AAG	.		0.627	FBXL22-001	KNOWN	downstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256412.4	NM_203373	
FBXW2	26190	hgsc.bcm.edu;bcgsc.ca	37	9	123526947	123526947	+	Missense_Mutation	SNP	C	C	T	rs374464211		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:123526947C>T	ENST00000608872.1	-	8	1442	c.1255G>A	c.(1255-1257)Gaa>Aaa	p.E419K	FBXW2_ENST00000340778.5_Missense_Mutation_p.E354K|FBXW2_ENST00000493559.1_Intron	NM_012164.3	NP_036296.2	Q9UKT8	FBXW2_HUMAN	F-box and WD repeat domain containing 2	419					cellular protein modification process (GO:0006464)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)			ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	4						CAGGATGCTTCGCCTGCCAGG	0.542																																					p.E419K		.											.	FBXW2	227	0			c.G1255A						.	C	LYS/GLU	1,4167		0,1,2083	127.0	137.0	134.0		1255	4.9	1.0	9		134	0,8458		0,0,4229	no	missense	FBXW2	NM_012164.3	56	0,1,6312	TT,TC,CC		0.0,0.024,0.0079	benign	419/455	123526947	1,12625	2084	4229	6313	SO:0001583	missense	26190	exon8			ATGCTTCGCCTGC	AF129531	CCDS43872.1	9q34	2013-01-09	2007-02-08		ENSG00000119402	ENSG00000119402		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13608	protein-coding gene	gene with protein product		609071	"""F-box and WD-40 domain protein 2"""			10531035, 10828603	Standard	NM_012164		Approved	FBW2, Md6, Fwd2	uc004bkm.1	Q9UKT8	OTTHUMG00000020576	ENST00000608872.1:c.1255G>A	9.37:g.123526947C>T	ENSP00000476369:p.Glu419Lys	115.0	0.0		95.0	5.0	NM_012164	B3KRL8|Q4VXH2|Q7Z4V6|Q8WV51|Q9HA09|Q9UKA3	Missense_Mutation	SNP	ENST00000608872.1	37	CCDS43872.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000785	0.74818	2.4E-4	0.0	ENSG00000119402	ENST00000373926;ENST00000340778;ENST00000444833	T;T	0.80480	0.29;-1.38	4.95	4.95	0.65309	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.106728	0.64402	D	0.000005	T	0.66386	0.2784	N	0.22421	0.69	0.53688	D	0.999978	P;P;B	0.43352	0.774;0.804;0.428	B;B;B	0.29716	0.106;0.039;0.027	T	0.74426	-0.3669	10	0.72032	D	0.01	-8.1105	16.037	0.80638	0.0:1.0:0.0:0.0	.	354;419;419	Q9UKT8-2;B2RAW3;Q9UKT8	.;.;FBXW2_HUMAN	K	419;354;419	ENSP00000363036:E419K;ENSP00000341161:E354K	ENSP00000341161:E354K	E	-	1	0	FBXW2	122566768	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.978000	0.70501	2.447000	0.82792	0.563000	0.77884	GAA	.		0.542	FBXW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053834.2		
FDPS	2224	hgsc.bcm.edu;bcgsc.ca	37	1	155289468	155289468	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:155289468T>C	ENST00000356657.6	+	9	1075	c.913T>C	c.(913-915)Ttt>Ctt	p.F305L	RUSC1_ENST00000368352.5_5'Flank|FDPS_ENST00000447866.1_Missense_Mutation_p.F239L|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1-AS1_ENST00000450199.1_RNA|FDPS_ENST00000368356.4_Missense_Mutation_p.F305L|RUSC1-AS1_ENST00000446880.1_RNA|RUSC1_ENST00000368354.3_5'Flank|RUSC1-AS1_ENST00000543656.1_RNA	NM_001135821.1	NP_001129293.1	P14324	FPPS_HUMAN	farnesyl diphosphate synthase	305					cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dimethylallyltranstransferase activity (GO:0004161)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	GGGGGAGTTCTTTCAGATTCA	0.547																																					p.F305L		.											.	FDPS	90	0			c.T913C						.						79.0	80.0	80.0					1																	155289468		2203	4300	6503	SO:0001583	missense	2224	exon9			GAGTTCTTTCAGA	J05262	CCDS1110.1, CCDS44241.1, CCDS72940.1	1q22	2012-07-13	2010-06-24		ENSG00000160752	ENSG00000160752	2.5.1.1, 2.5.1.10		3631	protein-coding gene	gene with protein product	"""farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase"""	134629				1968462	Standard	NM_002004		Approved		uc001fkc.2	P14324	OTTHUMG00000013909	ENST00000356657.6:c.913T>C	1.37:g.155289468T>C	ENSP00000349078:p.Phe305Leu	118.0	0.0		88.0	4.0	NM_001135821	D3DV91|E9PCI9|Q96G29	Missense_Mutation	SNP	ENST00000356657.6	37	CCDS1110.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.876048	0.91664	.	.	ENSG00000160752	ENST00000447866;ENST00000368356;ENST00000356657	D;D;D	0.82526	-1.62;-1.62;-1.62	4.06	4.06	0.47325	Terpenoid synthase (2);	0.000000	0.45126	D	0.000394	D	0.91188	0.7224	M	0.93594	3.435	0.80722	D	1	D	0.61080	0.989	D	0.66979	0.948	D	0.93060	0.6473	10	0.87932	D	0	-16.4506	12.9405	0.58340	0.0:0.0:0.0:1.0	.	305	P14324	FPPS_HUMAN	L	239;305;305	ENSP00000391755:F239L;ENSP00000357340:F305L;ENSP00000349078:F305L	ENSP00000349078:F305L	F	+	1	0	FDPS	153556092	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.711000	0.84669	2.066000	0.61787	0.459000	0.35465	TTT	.		0.547	FDPS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039053.1	NM_002004	
FEM1A	55527	hgsc.bcm.edu;bcgsc.ca	37	19	4792961	4792961	+	Silent	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:4792961C>A	ENST00000269856.3	+	1	1234	c.1095C>A	c.(1093-1095)acC>acA	p.T365T	AC005523.3_ENST00000598782.1_lincRNA|AC005523.2_ENST00000596170.1_RNA|AC005523.2_ENST00000601192.1_RNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)	365					negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		CGCTGATCACCGACCCGGATG	0.637																																					p.T365T		.											.	FEM1A	90	0			c.C1095A						.						48.0	50.0	50.0					19																	4792961		2203	4300	6503	SO:0001819	synonymous_variant	55527	exon1			GATCACCGACCCG	BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.1095C>A	19.37:g.4792961C>A		37.0	0.0		53.0	5.0	NM_018708	B2RDI3|Q711P8|Q9NPN7|Q9NPW8	Silent	SNP	ENST00000269856.3	37	CCDS12135.1																																																																																			.		0.637	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459000.1		
FGL2	10875	hgsc.bcm.edu;bcgsc.ca	37	7	76828978	76828978	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr7:76828978T>C	ENST00000248598.5	-	1	165	c.133A>G	c.(133-135)Agc>Ggc	p.S45G	CCDC146_ENST00000431197.1_Intron|CCDC146_ENST00000285871.4_Intron|RP11-467H10.2_ENST00000459742.1_RNA	NM_006682.2	NP_006673.1	Q14314	FGL2_HUMAN	fibrinogen-like 2	45						extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)				breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	13						TTCCCTCTGCTTTCTAGTCTC	0.498																																					p.S45G		.											.	FGL2	92	0			c.A133G						.						120.0	116.0	118.0					7																	76828978		2203	4300	6503	SO:0001583	missense	10875	exon1			CTCTGCTTTCTAG	Z36531	CCDS5591.1	7q11.23	2013-02-06			ENSG00000127951	ENSG00000127951		"""Fibrinogen C domain containing"""	3696	protein-coding gene	gene with protein product		605351				7642106	Standard	NM_006682		Approved	pT49, T49	uc003ugb.3	Q14314	OTTHUMG00000130681	ENST00000248598.5:c.133A>G	7.37:g.76828978T>C	ENSP00000248598:p.Ser45Gly	112.0	0.0		89.0	4.0	NM_006682		Missense_Mutation	SNP	ENST00000248598.5	37	CCDS5591.1	.	.	.	.	.	.	.	.	.	.	T	2.182	-0.387245	0.04932	.	.	ENSG00000127951	ENST00000248598	T	0.58210	0.35	5.38	0.0476	0.14281	.	0.335611	0.39274	N	0.001418	T	0.25121	0.0610	N	0.11560	0.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11767	-1.0574	10	0.21014	T	0.42	.	5.6955	0.17853	0.0:0.2206:0.1313:0.6481	.	45	Q14314	FGL2_HUMAN	G	45	ENSP00000248598:S45G	ENSP00000248598:S45G	S	-	1	0	FGL2	76666914	0.206000	0.23470	0.051000	0.19133	0.454000	0.32378	-0.074000	0.11450	0.114000	0.18032	-1.054000	0.02325	AGC	.		0.498	FGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253176.1	NM_006682	
FKBP5	2289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	35604882	35604882	+	Silent	SNP	A	A	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr6:35604882A>C	ENST00000539068.1	-	3	361	c.159T>G	c.(157-159)gtT>gtG	p.V53V	FKBP5_ENST00000357266.4_Silent_p.V53V|FKBP5_ENST00000540787.1_Intron|FKBP5_ENST00000536438.1_Silent_p.V53V|FKBP5_ENST00000542713.1_Silent_p.V53V	NM_001145776.1	NP_001139248.1	Q13451	FKBP5_HUMAN	FK506 binding protein 5	53	PPIase FKBP-type 1. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	FK506 binding (GO:0005528)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(3)|urinary_tract(2)	17						AATGGACATAAACTTTGTCTC	0.363																																					p.V53V		.											.	FKBP5	227	0			c.T159G						.						112.0	102.0	105.0					6																	35604882		2203	4300	6503	SO:0001819	synonymous_variant	2289	exon4			GACATAAACTTTG	U42031	CCDS4808.1, CCDS54996.1	6p21.31	2013-01-10	2001-11-28		ENSG00000096060	ENSG00000096060		"""Tetratricopeptide (TTC) repeat domain containing"""	3721	protein-coding gene	gene with protein product		602623	"""FK506-binding protein 5"""			9001212	Standard	NM_004117		Approved	FKBP51, FKBP54, PPIase, P54, Ptg-10	uc003okx.2	Q13451	OTTHUMG00000014576	ENST00000539068.1:c.159T>G	6.37:g.35604882A>C		204.0	0.0		117.0	40.0	NM_001145775	F5H7R1|Q59EB8|Q5TGM6	Silent	SNP	ENST00000539068.1	37	CCDS4808.1																																																																																			.		0.363	FKBP5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040309.2		
MACROD1	28992	hgsc.bcm.edu;bcgsc.ca	37	11	63884020	63884020	+	Intron	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:63884020A>G	ENST00000255681.6	-	3	584				RP11-21A7A.3_ENST00000543817.1_RNA|FLRT1_ENST00000246841.3_Missense_Mutation_p.N94S	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1						cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						AACCAGATCAACAACGCCGGC	0.562																																					p.N94S		.											.	FLRT1	90	0			c.A281G						.						91.0	70.0	77.0					11																	63884020		2201	4297	6498	SO:0001627	intron_variant	23769	exon2			AGATCAACAACGC	AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.517+34690T>C	11.37:g.63884020A>G		65.0	0.0		61.0	5.0	NM_013280	Q9UH96	Missense_Mutation	SNP	ENST00000255681.6	37	CCDS8056.1	.	.	.	.	.	.	.	.	.	.	A	10.49	1.365961	0.24684	.	.	ENSG00000126500	ENST00000246841	T	0.02032	4.49	5.57	0.773	0.18516	.	0.315459	0.31660	N	0.007277	T	0.01730	0.0055	L	0.34521	1.04	0.38044	D	0.935546	B	0.21606	0.058	B	0.15052	0.012	T	0.53885	-0.8375	10	0.23891	T	0.37	-34.1717	5.8822	0.18862	0.6576:0.1347:0.2077:0.0	.	66	Q9NZU1	FLRT1_HUMAN	S	94	ENSP00000246841:N94S	ENSP00000246841:N94S	N	+	2	0	FLRT1	63640596	0.999000	0.42202	1.000000	0.80357	0.941000	0.58515	1.347000	0.33975	0.394000	0.25230	0.459000	0.35465	AAC	.		0.562	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396570.1	NM_014067	
FMO3	2328	hgsc.bcm.edu;bcgsc.ca	37	1	171076816	171076816	+	Splice_Site	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:171076816A>G	ENST00000367755.4	+	4	433	c.322A>G	c.(322-324)Aca>Gca	p.T108A	FMO3_ENST00000542847.1_Splice_Site_p.T88A|FMO3_ENST00000538429.1_Splice_Site_p.T45A|FMO3_ENST00000392085.2_Splice_Site_p.T108A	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	108					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)			endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	TTTCTCTTAGACATTTGTATC	0.348																																					p.T108A		.											.	FMO3	187	0			c.A322G						.						78.0	78.0	78.0					1																	171076816		2203	4300	6503	SO:0001630	splice_region_variant	2328	exon4			TCTTAGACATTTG	BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.322-1A>G	1.37:g.171076816A>G		156.0	0.0		143.0	6.0	NM_006894	B2R816|Q14854|Q8N5N5	Missense_Mutation	SNP	ENST00000367755.4	37	CCDS1292.1	.	.	.	.	.	.	.	.	.	.	A	19.75	3.885920	0.72410	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000542847;ENST00000538429	T;T;T;T	0.61392	0.11;0.11;0.11;0.11	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.71945	0.3400	M	0.88640	2.97	0.58432	D	0.999994	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.985;0.996	T	0.77539	-0.2550	9	.	.	.	-13.2412	10.0866	0.42421	0.8497:0.0:0.0:0.1503	.	45;88;108	F5H261;F5GZZ8;P31513	.;.;FMO3_HUMAN	A	108;108;88;45	ENSP00000356729:T108A;ENSP00000375935:T108A;ENSP00000444073:T88A;ENSP00000439500:T45A	.	T	+	1	0	FMO3	169343440	1.000000	0.71417	0.998000	0.56505	0.895000	0.52256	7.079000	0.76829	1.787000	0.52448	0.482000	0.46254	ACA	.		0.348	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086219.1	NM_006894	Missense_Mutation
FOCAD	54914	hgsc.bcm.edu;bcgsc.ca	37	9	20907148	20907148	+	Splice_Site	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:20907148G>T	ENST00000380249.1	+	24	2989		c.e24-1		FOCAD_ENST00000605086.1_Splice_Site|FOCAD_ENST00000338382.6_Splice_Site	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin							focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											ttttcccataggttcatatcc	0.363																																					.		.											.	.	.	0			c.2626-1G>T						.						116.0	107.0	110.0					9																	20907148		2203	4300	6503	SO:0001630	splice_region_variant	54914	exon24			CCCATAGGTTCAT	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.2626-1G>T	9.37:g.20907148G>T		80.0	0.0		64.0	4.0	NM_017794	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Splice_Site	SNP	ENST00000380249.1	37	CCDS34993.1																																																																																			.		0.363	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794	Intron
FOXL1	2300	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	86612739	86612739	+	Missense_Mutation	SNP	A	A	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:86612739A>C	ENST00000320241.3	+	1	625	c.410A>C	c.(409-411)aAc>aCc	p.N137T		NM_005250.2	NP_005241.1	Q12952	FOXL1_HUMAN	forkhead box L1	137					heart development (GO:0007507)|multicellular organismal development (GO:0007275)|organ morphogenesis (GO:0009887)|Peyer's patch morphogenesis (GO:0061146)|proteoglycan biosynthetic process (GO:0030166)|regulation of Wnt signaling pathway (GO:0030111)|transcription, DNA-templated (GO:0006351)|visceral mesoderm-endoderm interaction involved in midgut development (GO:0007495)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(2)|prostate(3)|skin(1)|urinary_tract(1)	15						GAGAACGGCAACTACCGGCGC	0.721																																					p.N137T	NSCLC(163;308 2020 10889 11476 18208)	.											.	FOXL1	227	0			c.A410C						.						20.0	24.0	23.0					16																	86612739		2196	4298	6494	SO:0001583	missense	2300	exon1			ACGGCAACTACCG	AF315075	CCDS10959.1	16q24	2014-07-15			ENSG00000176678	ENSG00000176678		"""Forkhead boxes"""	3817	protein-coding gene	gene with protein product		603252		FKHL11		7957066	Standard	NM_005250		Approved	FREAC7, FKH6	uc002fjr.3	Q12952	OTTHUMG00000137653	ENST00000320241.3:c.410A>C	16.37:g.86612739A>C	ENSP00000326272:p.Asn137Thr	63.0	1.0		93.0	12.0	NM_005250	Q17RR1|Q9H242	Missense_Mutation	SNP	ENST00000320241.3	37	CCDS10959.1	.	.	.	.	.	.	.	.	.	.	A	17.73	3.460994	0.63513	.	.	ENSG00000176678	ENST00000320241	D	0.95272	-3.66	3.93	3.93	0.45458	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	D	0.000000	D	0.94991	0.8379	L	0.51914	1.62	0.46725	D	0.999171	P	0.50617	0.937	P	0.62089	0.898	D	0.93421	0.6777	10	0.30854	T	0.27	.	12.0777	0.53653	1.0:0.0:0.0:0.0	.	137	Q12952	FOXL1_HUMAN	T	137	ENSP00000326272:N137T	ENSP00000326272:N137T	N	+	2	0	FOXL1	85170240	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.880000	0.39628	1.635000	0.50512	0.402000	0.26972	AAC	.		0.721	FOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269105.2	NM_005250	
FOXL1	2300	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	86612753	86612753	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:86612753A>G	ENST00000320241.3	+	1	639	c.424A>G	c.(424-426)Aag>Gag	p.K142E		NM_005250.2	NP_005241.1	Q12952	FOXL1_HUMAN	forkhead box L1	142					heart development (GO:0007507)|multicellular organismal development (GO:0007275)|organ morphogenesis (GO:0009887)|Peyer's patch morphogenesis (GO:0061146)|proteoglycan biosynthetic process (GO:0030166)|regulation of Wnt signaling pathway (GO:0030111)|transcription, DNA-templated (GO:0006351)|visceral mesoderm-endoderm interaction involved in midgut development (GO:0007495)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(2)|prostate(3)|skin(1)|urinary_tract(1)	15						CCGGCGCCGGAAGAGGAAGCC	0.746																																					p.K142E	NSCLC(163;308 2020 10889 11476 18208)	.											.	FOXL1	227	0			c.A424G						.						12.0	16.0	15.0					16																	86612753		2179	4272	6451	SO:0001583	missense	2300	exon1			CGCCGGAAGAGGA	AF315075	CCDS10959.1	16q24	2014-07-15			ENSG00000176678	ENSG00000176678		"""Forkhead boxes"""	3817	protein-coding gene	gene with protein product		603252		FKHL11		7957066	Standard	NM_005250		Approved	FREAC7, FKH6	uc002fjr.3	Q12952	OTTHUMG00000137653	ENST00000320241.3:c.424A>G	16.37:g.86612753A>G	ENSP00000326272:p.Lys142Glu	52.0	1.0		67.0	11.0	NM_005250	Q17RR1|Q9H242	Missense_Mutation	SNP	ENST00000320241.3	37	CCDS10959.1	.	.	.	.	.	.	.	.	.	.	A	19.32	3.804707	0.70682	.	.	ENSG00000176678	ENST00000320241	D	0.95171	-3.63	3.93	3.93	0.45458	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (2);	0.217771	0.37669	N	0.001993	D	0.96191	0.8758	M	0.77616	2.38	0.39245	D	0.963931	D	0.57257	0.979	P	0.60949	0.881	D	0.96810	0.9596	10	0.62326	D	0.03	.	12.0777	0.53653	1.0:0.0:0.0:0.0	.	142	Q12952	FOXL1_HUMAN	E	142	ENSP00000326272:K142E	ENSP00000326272:K142E	K	+	1	0	FOXL1	85170254	1.000000	0.71417	0.951000	0.38953	0.913000	0.54294	3.610000	0.54125	1.635000	0.50512	0.402000	0.26972	AAG	.		0.746	FOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269105.2	NM_005250	
FOXR1	283150	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	118842683	118842683	+	Silent	SNP	C	C	A	rs145283417	byFrequency	TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:118842683C>A	ENST00000317011.3	+	1	267	c.42C>A	c.(40-42)ctC>ctA	p.L14L	Y_RNA_ENST00000410597.1_RNA	NM_181721.2	NP_859072.1	Q6PIV2	FOXR1_HUMAN	forkhead box R1	14					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		CATCTCACCTCCCCTTAGCGG	0.682																																					p.L14L		.											.	FOXR1	228	0			c.C42A						.	C		0,4290		0,0,2145	51.0	34.0	39.0		42	-2.9	0.0	11	dbSNP_134	39	2,8404		0,2,4201	no	coding-synonymous	FOXR1	NM_181721.2		0,2,6346	AA,AC,CC		0.0238,0.0,0.0158		14/293	118842683	2,12694	2145	4203	6348	SO:0001819	synonymous_variant	283150	exon1			TCACCTCCCCTTA	AB094092	CCDS31688.1	11q23.3	2008-02-05			ENSG00000176302	ENSG00000176302		"""Forkhead boxes"""	29980	protein-coding gene	gene with protein product		615755				15067358	Standard	XM_005271514		Approved	DLNB13, FOXN5	uc001pui.3	Q6PIV2	OTTHUMG00000166347	ENST00000317011.3:c.42C>A	11.37:g.118842683C>A		73.0	0.0		25.0	13.0	NM_181721	B0YJ15|Q08AS8|Q86UT9|Q8IXX2	Silent	SNP	ENST00000317011.3	37	CCDS31688.1																																																																																			C|0.999;A|0.001		0.682	FOXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389312.1	NM_181721	
FOXR2	139628	hgsc.bcm.edu;bcgsc.ca	37	X	55650629	55650629	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:55650629C>A	ENST00000339140.3	+	1	797	c.485C>A	c.(484-486)cCa>cAa	p.P162Q		NM_198451.3	NP_940853.1	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	162					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	19						GCTGAGGAACCAGACGACAAC	0.517																																					p.P162Q		.											.	FOXR2	227	0			c.C485A						.						69.0	59.0	62.0					X																	55650629		2203	4300	6503	SO:0001583	missense	139628	exon1			AGGAACCAGACGA	BC012934	CCDS35308.1	Xp11	2006-12-15			ENSG00000189299	ENSG00000189299		"""Forkhead boxes"""	30469	protein-coding gene	gene with protein product						15202009, 15202027	Standard	NM_198451		Approved	MGC21658, FOXN6	uc004duo.3	Q6PJQ5	OTTHUMG00000021661	ENST00000339140.3:c.485C>A	X.37:g.55650629C>A	ENSP00000427329:p.Pro162Gln	154.0	0.0		86.0	5.0	NM_198451		Missense_Mutation	SNP	ENST00000339140.3	37	CCDS35308.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.940364	0.00479	.	.	ENSG00000189299	ENST00000339140	D	0.93763	-3.28	3.19	0.654	0.17833	.	1.825580	0.03342	N	0.194900	T	0.68897	0.3051	N	0.00170	-1.935	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.72676	-0.4221	10	0.02654	T	1	.	0.4452	0.00492	0.4251:0.2217:0.1345:0.2187	.	162	Q6PJQ5	FOXR2_HUMAN	Q	162	ENSP00000427329:P162Q	ENSP00000427329:P162Q	P	+	2	0	FOXR2	55667354	0.017000	0.18338	0.000000	0.03702	0.007000	0.05969	0.063000	0.14410	-0.255000	0.09486	-0.314000	0.08810	CCA	.		0.517	FOXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056877.2	NM_198451	
FUCA1	2517	hgsc.bcm.edu;bcgsc.ca	37	1	24186295	24186295	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:24186295G>T	ENST00000374479.3	-	4	768	c.761C>A	c.(760-762)cCt>cAt	p.P254H		NM_000147.4	NP_000138.2	P04066	FUCO_HUMAN	fucosidase, alpha-L- 1, tissue	254					fucose metabolic process (GO:0006004)|glycosaminoglycan catabolic process (GO:0006027)|glycoside catabolic process (GO:0016139)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		TACCTTGACAGGGCTGTCATT	0.418																																					p.P254H		.											.	FUCA1	153	0			c.C761A						.						93.0	87.0	89.0					1																	24186295		2203	4300	6503	SO:0001583	missense	2517	exon4			TTGACAGGGCTGT	BC017338	CCDS244.2	1p34	2012-10-02			ENSG00000179163	ENSG00000179163	3.2.1.51		4006	protein-coding gene	gene with protein product		612280				2803312	Standard	NM_000147		Approved		uc001bie.3	P04066	OTTHUMG00000002965	ENST00000374479.3:c.761C>A	1.37:g.24186295G>T	ENSP00000363603:p.Pro254His	90.0	0.0		73.0	4.0	NM_000147	B2RBG3|Q14334|Q14335|Q3LID0|Q8NAC2	Missense_Mutation	SNP	ENST00000374479.3	37	CCDS244.2	.	.	.	.	.	.	.	.	.	.	G	17.63	3.437118	0.62955	.	.	ENSG00000179163	ENST00000374479;ENST00000374475	T	0.66638	-0.22	6.16	6.16	0.99307	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.88081	0.6341	H	0.94542	3.55	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89805	0.3978	10	0.87932	D	0	-15.2455	20.8598	0.99761	0.0:0.0:1.0:0.0	.	254	P04066	FUCO_HUMAN	H	254;43	ENSP00000363603:P254H	ENSP00000363599:P43H	P	-	2	0	FUCA1	24058882	1.000000	0.71417	0.954000	0.39281	0.054000	0.15201	9.283000	0.95860	2.937000	0.99478	0.650000	0.86243	CCT	.		0.418	FUCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008259.2	NM_000147	
G3BP2	9908	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	76573877	76573877	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr4:76573877G>A	ENST00000359707.4	-	9	1659	c.874C>T	c.(874-876)Cgt>Tgt	p.R292C	G3BP2_ENST00000395719.3_Missense_Mutation_p.R292C|G3BP2_ENST00000357854.3_Missense_Mutation_p.R259C	NM_203505.2	NP_987101.1	Q9UN86	G3BP2_HUMAN	GTPase activating protein (SH3 domain) binding protein 2	292					cytoplasmic sequestering of NF-kappaB (GO:0007253)|mRNA transport (GO:0051028)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|receptor signaling complex scaffold activity (GO:0030159)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	27			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			CGTTGTTCACGCACACGAGGT	0.408																																					p.R292C		.											.	G3BP2	153	0			c.C874T						.						102.0	92.0	96.0					4																	76573877		2203	4300	6503	SO:0001583	missense	9908	exon9			GTTCACGCACACG	AB014560	CCDS3571.1, CCDS3572.1	4q21.1	2013-02-12	2006-11-01		ENSG00000138757	ENSG00000138757		"""RNA binding motif (RRM) containing"""	30291	protein-coding gene	gene with protein product	"""Ras-GTPase activating protein SH3 domain-binding protein 2"""					9734811, 9575347	Standard	NM_203504		Approved	KIAA0660	uc003his.3	Q9UN86	OTTHUMG00000130097	ENST00000359707.4:c.874C>T	4.37:g.76573877G>A	ENSP00000352738:p.Arg292Cys	34.0	0.0		35.0	4.0	NM_012297	A8K6X1|O60606|O75149|Q9UPA1	Missense_Mutation	SNP	ENST00000359707.4	37	CCDS3571.1	.	.	.	.	.	.	.	.	.	.	G	16.28	3.077733	0.55753	.	.	ENSG00000138757	ENST00000395719;ENST00000359707;ENST00000357854	T;T;T	0.78707	-1.19;-1.19;-1.2	5.96	5.96	0.96718	.	0.050014	0.85682	D	0.000000	D	0.86053	0.5841	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	0.993;1.0	P;D	0.74023	0.489;0.982	D	0.86364	0.1719	10	0.66056	D	0.02	.	15.1472	0.72667	0.0:0.0:0.8588:0.1412	.	259;292	Q9UN86-2;Q9UN86	.;G3BP2_HUMAN	C	292;292;259	ENSP00000379069:R292C;ENSP00000352738:R292C;ENSP00000350518:R259C	ENSP00000350518:R259C	R	-	1	0	G3BP2	76792901	1.000000	0.71417	1.000000	0.80357	0.126000	0.20510	4.978000	0.63799	2.813000	0.96785	0.655000	0.94253	CGT	.		0.408	G3BP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252399.2	NM_012297	
GAB1	2549	hgsc.bcm.edu;bcgsc.ca	37	4	144378898	144378898	+	Intron	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr4:144378898G>T	ENST00000262994.4	+	7	1887				GAB1_ENST00000262995.4_Missense_Mutation_p.G551C|GAB1_ENST00000505913.1_Intron	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1						activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					ACAAACCATAGGTGACTTTGC	0.338																																					p.G551C		.											.	GAB1	1146	0			c.G1651T						.						58.0	53.0	55.0					4																	144378898		2203	4298	6501	SO:0001627	intron_variant	2549	exon7			ACCATAGGTGACT	U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.1586-1640G>T	4.37:g.144378898G>T		112.0	0.0		87.0	4.0	NM_207123	A8K152|Q4W5G2|Q6P1W2	Missense_Mutation	SNP	ENST00000262994.4	37	CCDS3759.1	.	.	.	.	.	.	.	.	.	.	G	19.86	3.906295	0.72868	.	.	ENSG00000109458	ENST00000262995	T	0.15603	2.41	5.18	4.33	0.51752	.	0.075533	0.50627	D	0.000105	T	0.27419	0.0673	N	0.22421	0.69	0.80722	D	1	D	0.69078	0.997	D	0.65874	0.939	T	0.07635	-1.0762	10	0.87932	D	0	-5.757	15.6984	0.77517	0.0:0.1372:0.8628:0.0	.	551	Q13480-2	.	C	551	ENSP00000262995:G551C	ENSP00000262995:G551C	G	+	1	0	GAB1	144598348	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.356000	0.79445	1.162000	0.42619	0.655000	0.94253	GGT	.		0.338	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364998.1	NM_002039	
GABRA1	2554	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	161300201	161300201	+	Silent	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr5:161300201C>A	ENST00000428797.2	+	6	689	c.334C>A	c.(334-336)Cgg>Agg	p.R112R	GABRA1_ENST00000023897.6_Silent_p.R112R|GABRA1_ENST00000393943.4_Silent_p.R112R|GABRA1_ENST00000420560.1_Silent_p.R112R|GABRA1_ENST00000437025.2_Silent_p.R112R|GABRA1_ENST00000444819.1_Silent_p.R112R	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	112			R -> Q (in EIEE19). {ECO:0000269|PubMed:24623842}.		gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	GACAGTCCTCCGGTTAAATAA	0.388																																					p.R112R		.											.	GABRA1	93	0			c.C334A						.						80.0	82.0	81.0					5																	161300201		2203	4300	6503	SO:0001819	synonymous_variant	2554	exon6			GTCCTCCGGTTAA		CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.334C>A	5.37:g.161300201C>A		167.0	0.0		133.0	42.0	NM_001127643	D3DQK6|Q8N629	Silent	SNP	ENST00000428797.2	37	CCDS4357.1																																																																																			.		0.388	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252702.2	NM_000806.5	
GABRB3	2562	hgsc.bcm.edu;bcgsc.ca	37	15	26812847	26812847	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr15:26812847A>G	ENST00000311550.5	-	7	827	c.716T>C	c.(715-717)tTg>tCg	p.L239S	GABRB3_ENST00000299267.4_Missense_Mutation_p.L239S|GABRB3_ENST00000400188.3_Missense_Mutation_p.L168S|GABRB3_ENST00000541819.2_Missense_Mutation_p.L295S|GABRB3_ENST00000545868.1_Missense_Mutation_p.L154S	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	239					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTTCCTCTTCAACCGAAAGCT	0.423																																					p.L239S		.											.	GABRB3	518	0			c.T716C						.						127.0	108.0	115.0					15																	26812847		2203	4300	6503	SO:0001583	missense	2562	exon7			CTCTTCAACCGAA		CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.716T>C	15.37:g.26812847A>G	ENSP00000308725:p.Leu239Ser	103.0	0.0		80.0	4.0	NM_021912	B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Missense_Mutation	SNP	ENST00000311550.5	37	CCDS10019.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.677285	0.88445	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868	D;D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78;-1.78	6.06	6.06	0.98353	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.94218	0.8144	H	0.96833	3.89	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.81914	0.988;0.991;0.995	D	0.95891	0.8907	10	0.87932	D	0	.	15.7938	0.78394	1.0:0.0:0.0:0.0	.	295;239;239	F5H7N0;P28472-2;P28472	.;.;GBRB3_HUMAN	S	239;295;239;168;154	ENSP00000308725:L239S;ENSP00000442408:L295S;ENSP00000299267:L239S;ENSP00000383049:L168S;ENSP00000439169:L154S	ENSP00000299267:L239S	L	-	2	0	GABRB3	24363940	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.204000	0.95041	2.322000	0.78497	0.528000	0.53228	TTG	.		0.423	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251352.2		
RASL10A	10633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	29706428	29706429	+	IGR	DNP	GG	GG	TT			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown|.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr22:29706428_29706429GG>TT	ENST00000216101.6	-	0	1490				GAS2L1_ENST00000403764.1_Splice_Site_p.V212L|GAS2L1_ENST00000406549.3_Splice_Site_p.V212L|GAS2L1_ENST00000471961.1_Splice_Site_p.V212L|GAS2L1_ENST00000407854.1_Splice_Site_p.V212L|GAS2L1_ENST00000341313.6_Splice_Site_p.V212L|GAS2L1_ENST00000407647.2_Splice_Site_p.V212L|GAS2L1_ENST00000360113.2_Splice_Site_p.V212L	NM_006477.4	NP_006468.1	Q92737	RSLAA_HUMAN	RAS-like, family 10, member A						small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)	1						TCTGGCCTCAGGTGAGGGAGAT	0.589																																					.|p.V212L		.											.	GAS2L1	90	0			c.634-1G>T|c.G634T						.																																			SO:0001628	intergenic_variant	10634	exon3			GCCTCAGGTGAGG|CCTCAGGTGAGGG	Y07847	CCDS13854.1	22q12.2	2014-05-09			ENSG00000100276	ENSG00000100276			16954	protein-coding gene	gene with protein product		602220				8975699, 15731001	Standard	NM_006477		Approved	RRP22	uc031rxl.1	Q92737	OTTHUMG00000151106	ENST00000216101.6:c.610_610delinsTT	22.37:g.29706428_29706429delinsTT		129.0|130.0	0.0|1.0		173.0|174.0	72.0|73.0	NM_152237	Q49AU5|Q6PI03	Splice_Site|Missense_Mutation	SNP	ENST00000216101.6	37	CCDS13854.1																																																																																			.		0.589	RASL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321342.1		
GDPD3	79153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30124047	30124047	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:30124047C>T	ENST00000406256.3	-	3	627	c.250G>A	c.(250-252)Gtg>Atg	p.V84M	MAPK3_ENST00000494643.1_5'Flank|RP11-455F5.4_ENST00000566190.1_RNA	NM_024307.2	NP_077283.2	Q7L5L3	GDPD3_HUMAN	glycerophosphodiester phosphodiesterase domain containing 3	84	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(6)	11						TCATGTGACACCACCACCACT	0.667											OREG0023731	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V84M		.											.	GDPD3	90	0			c.G250A						.						69.0	61.0	64.0					16																	30124047		2197	4300	6497	SO:0001583	missense	79153	exon3			GTGACACCACCAC	AK026256	CCDS10671.2	16p11.2	2008-02-05			ENSG00000102886	ENSG00000102886			28638	protein-coding gene	gene with protein product							Standard	NM_024307		Approved	MGC4171	uc002dwp.3	Q7L5L3	OTTHUMG00000132106	ENST00000406256.3:c.250G>A	16.37:g.30124047C>T	ENSP00000384363:p.Val84Met	52.0	0.0	814	40.0	13.0	NM_024307	Q9H652	Missense_Mutation	SNP	ENST00000406256.3	37	CCDS10671.2	.	.	.	.	.	.	.	.	.	.	C	18.59	3.655806	0.67586	.	.	ENSG00000102886	ENST00000406256;ENST00000360688	T	0.19532	2.14	5.57	4.61	0.57282	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.059458	0.64402	D	0.000003	T	0.51702	0.1690	M	0.91196	3.185	0.48571	D	0.999676	D	0.76494	0.999	D	0.66602	0.945	T	0.62765	-0.6785	10	0.87932	D	0	.	12.4157	0.55492	0.0:0.8309:0.1691:0.0	.	84	Q7L5L3	GDPD3_HUMAN	M	84;22	ENSP00000384363:V84M	ENSP00000353909:V22M	V	-	1	0	GDPD3	30031548	0.999000	0.42202	0.998000	0.56505	0.529000	0.34654	4.175000	0.58263	1.318000	0.45170	0.563000	0.77884	GTG	.		0.667	GDPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255144.1	NM_024307	
GFM2	84340	hgsc.bcm.edu;bcgsc.ca	37	5	74028915	74028915	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr5:74028915G>T	ENST00000296805.3	-	16	1976	c.1519C>A	c.(1519-1521)Cat>Aat	p.H507N	GFM2_ENST00000515125.1_5'UTR|GFM2_ENST00000345239.2_Missense_Mutation_p.H460N|GFM2_ENST00000509430.1_Missense_Mutation_p.H507N	NM_032380.3	NP_115756.2			G elongation factor, mitochondrial 2											breast(2)|endometrium(2)|large_intestine(4)|lung(5)|prostate(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		TTCAACGCATGTTCCAAATCT	0.343																																					p.H507N		.											.	GFM2	90	0			c.C1519A						.						117.0	110.0	112.0					5																	74028915		2203	4300	6503	SO:0001583	missense	84340	exon16			ACGCATGTTCCAA	AF111808	CCDS4023.1, CCDS4024.1, CCDS47232.1	5q13	2008-02-05			ENSG00000164347	ENSG00000164347			29682	protein-coding gene	gene with protein product		606544				11735030	Standard	NM_001281302		Approved	EFG2, FLJ21661	uc003kdh.1	Q969S9	OTTHUMG00000102058	ENST00000296805.3:c.1519C>A	5.37:g.74028915G>T	ENSP00000296805:p.His507Asn	108.0	0.0		84.0	4.0	NM_032380		Missense_Mutation	SNP	ENST00000296805.3	37	CCDS4023.1	.	.	.	.	.	.	.	.	.	.	G	6.267	0.417379	0.11870	.	.	ENSG00000164347	ENST00000296805;ENST00000345239;ENST00000546082;ENST00000509430	T;T;T	0.70749	-0.51;-0.51;-0.51	5.07	4.17	0.49024	Elongation factor G/III/V (1);	0.246709	0.38663	N	0.001603	T	0.47040	0.1424	N	0.10874	0.06	0.80722	D	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.31971	-0.9924	10	0.31617	T	0.26	-8.6912	6.5471	0.22412	0.0955:0.0:0.6032:0.3013	.	507;460;507	Q969S9-3;Q969S9-2;Q969S9	.;.;RRF2M_HUMAN	N	507;460;507;507	ENSP00000296805:H507N;ENSP00000296804:H460N;ENSP00000427004:H507N	ENSP00000296805:H507N	H	-	1	0	GFM2	74064671	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.058000	0.49939	1.067000	0.40740	0.557000	0.71058	CAT	.		0.343	GFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219860.2	NM_032380	
GIPC1	10755	hgsc.bcm.edu;bcgsc.ca	37	19	14589371	14589371	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:14589371T>C	ENST00000393033.4	-	9	1128	c.859A>G	c.(859-861)Atg>Gtg	p.M287V	GIPC1_ENST00000393028.1_Missense_Mutation_p.M190V|GIPC1_ENST00000393029.3_Missense_Mutation_p.M190V|GIPC1_ENST00000345425.2_Missense_Mutation_p.M287V|GIPC1_ENST00000591349.1_Missense_Mutation_p.M190V|GIPC1_ENST00000586027.1_Missense_Mutation_p.M287V	NM_005716.3	NP_005707.1	O14908	GIPC1_HUMAN	GIPC PDZ domain containing family, member 1	287					endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|glutamate secretion (GO:0014047)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of cytokinesis (GO:0032467)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein targeting (GO:0006605)|regulation of protein stability (GO:0031647)|regulation of synaptic plasticity (GO:0048167)|synaptic transmission (GO:0007268)	brush border (GO:0005903)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|myosin binding (GO:0017022)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(1)|lung(4)|upper_aerodigestive_tract(1)	6						AGCTCCACCATGGTGGCCGCT	0.617																																					p.M287V	Pancreas(33;78 923 2910 41023 52850)	.											.	GIPC1	226	0			c.A859G						.						43.0	47.0	46.0					19																	14589371		2203	4300	6503	SO:0001583	missense	10755	exon8			CCACCATGGTGGC	AF089816	CCDS12310.1, CCDS12311.1	19p13.1	2009-09-22	2005-06-28	2005-06-28					1226	protein-coding gene	gene with protein product		605072	"""chromosome 19 open reading frame 3"", ""regulator of G-protein signalling 19 interacting protein 1"""	C19orf3, RGS19IP1		9770488, 9482110	Standard	NM_005716		Approved	TIP-2, Hs.6454, GIPC, SEMCAP, GLUT1CBP, SYNECTIN, NIP	uc002myx.4	O14908		ENST00000393033.4:c.859A>G	19.37:g.14589371T>C	ENSP00000376753:p.Met287Val	149.0	0.0		107.0	6.0	NM_202468	A8K4I3|A8MZG3|Q9BTC9	Missense_Mutation	SNP	ENST00000393033.4	37	CCDS12310.1	.	.	.	.	.	.	.	.	.	.	t	15.53	2.861072	0.51482	.	.	ENSG00000123159	ENST00000393033;ENST00000345425;ENST00000393029;ENST00000393028;ENST00000351277	T;T;D;D	0.84944	-1.41;-1.41;-1.92;-1.92	4.28	4.28	0.50868	.	0.089037	0.85682	D	0.000000	D	0.83303	0.5225	M	0.72576	2.205	0.53005	D	0.999964	B	0.09022	0.002	B	0.14578	0.011	T	0.81254	-0.1016	10	0.54805	T	0.06	-19.0869	11.3771	0.49735	0.0:0.0:0.0:1.0	.	287	O14908	GIPC1_HUMAN	V	287;287;190;190;287	ENSP00000376753:M287V;ENSP00000340698:M287V;ENSP00000376749:M190V;ENSP00000376748:M190V	ENSP00000340698:M287V	M	-	1	0	GIPC1	14450371	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.690000	0.68241	1.586000	0.49944	0.454000	0.30748	ATG	.		0.617	GIPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460239.2		
GLUD2	2747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	120181981	120181981	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:120181981G>A	ENST00000328078.1	+	1	520	c.443G>A	c.(442-444)gGa>gAa	p.G148E		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	148					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						CCCTGCAAGGGAGGTATCCGT	0.577																																					p.G148E		.											.	GLUD2	131	0			c.G443A						.						94.0	67.0	76.0					X																	120181981		2203	4300	6503	SO:0001583	missense	2747	exon1			GCAAGGGAGGTAT	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.443G>A	X.37:g.120181981G>A	ENSP00000327589:p.Gly148Glu	246.0	0.0		147.0	38.0	NM_012084	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	G	17.89	3.498790	0.64298	.	.	ENSG00000182890	ENST00000328078	D	0.99685	-6.4	1.8	1.8	0.24995	Glutamate/phenylalanine/leucine/valine dehydrogenase, dimerisation domain (1);	0.124053	0.53938	N	0.000048	D	0.99832	0.9924	H	0.99697	4.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97061	0.9771	10	0.87932	D	0	.	9.1461	0.36933	0.0:0.0:1.0:0.0	.	148	P49448	DHE4_HUMAN	E	148	ENSP00000327589:G148E	ENSP00000327589:G148E	G	+	2	0	GLUD2	120009662	1.000000	0.71417	0.835000	0.33067	0.842000	0.47809	6.236000	0.72339	1.228000	0.43614	0.472000	0.43445	GGA	.		0.577	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
GNLY	10578	hgsc.bcm.edu;bcgsc.ca	37	2	85922521	85922521	+	Missense_Mutation	SNP	C	C	T	rs573832985		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:85922521C>T	ENST00000263863.4	+	2	259	c.131C>T	c.(130-132)cCg>cTg	p.P44L	GNLY_ENST00000409696.3_Missense_Mutation_p.P29L|GNLY_ENST00000533041.1_3'UTR|GNLY_ENST00000524600.1_Missense_Mutation_p.P71L	NM_006433.3	NP_006424.2	P22749	GNLY_HUMAN	granulysin	44					cellular defense response (GO:0006968)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|killing of cells of other organism (GO:0031640)	extracellular space (GO:0005615)				endometrium(4)|kidney(10)|large_intestine(1)|lung(1)|skin(2)|upper_aerodigestive_tract(1)	19						AAATCCTGCCCGTGCCTGGCC	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18397	0.0		0.0	False		,,,				2504	0.0				p.P44L		.											.	GNLY	90	0			c.C131T						.						77.0	64.0	69.0					2																	85922521		2203	4300	6503	SO:0001583	missense	10578	exon2			CCTGCCCGTGCCT	X54101	CCDS1984.1, CCDS46354.1	2p12-q11	2008-02-05			ENSG00000115523	ENSG00000115523			4414	protein-coding gene	gene with protein product	"""T-lymphocyte activation gene 519"""	188855		LAG2		2212946, 2434598	Standard	NM_012483		Approved	NKG5, LAG-2, D2S69E, TLA519	uc002sql.4	P22749	OTTHUMG00000130179	ENST00000263863.4:c.131C>T	2.37:g.85922521C>T	ENSP00000263863:p.Pro44Leu	78.0	0.0		84.0	4.0	NM_006433	P09325|Q6GU08	Missense_Mutation	SNP	ENST00000263863.4	37	CCDS1984.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.649|8.649	0.897716|0.897716	0.17686|0.17686	.|.	.|.	ENSG00000115523|ENSG00000115523	ENST00000263863;ENST00000524600;ENST00000409696|ENST00000526018	T;T;T|.	0.48201|.	0.87;0.82;0.87|.	1.64|1.64	-3.28|-3.28	0.05033|0.05033	.|.	2.881540|.	0.01470|.	U|.	0.016250|.	T|T	0.17280|0.17280	0.0415|0.0415	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	P;P|.	0.46512|.	0.879;0.879|.	B;B|.	0.26517|.	0.07;0.07|.	T|T	0.23226|0.23226	-1.0194|-1.0194	10|5	0.33141|.	T|.	0.24|.	.|.	5.7405|5.7405	0.18092|0.18092	0.2475:0.5939:0.1586:0.0|0.2475:0.5939:0.1586:0.0	.|.	71;44|.	B4E3H9;P22749|.	.;GNLY_HUMAN|.	L|C	44;71;29|11	ENSP00000263863:P44L;ENSP00000436423:P71L;ENSP00000387116:P29L|.	ENSP00000263863:P44L|.	P|R	+|+	2|1	0|0	GNLY|GNLY	85776032|85776032	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.125000|0.125000	0.20455|0.20455	-0.562000|-0.562000	0.05950|0.05950	-1.619000|-1.619000	0.01566|0.01566	0.306000|0.306000	0.20318|0.20318	CCG|CGT	.		0.622	GNLY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252497.1	NM_006433	
GPBAR1	151306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	219127770	219127770	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:219127770G>T	ENST00000522678.1	+	2	1191	c.323G>T	c.(322-324)gGg>gTg	p.G108V	GPBAR1_ENST00000521462.1_Missense_Mutation_p.G108V|GPBAR1_ENST00000519574.1_Missense_Mutation_p.G108V|GPBAR1_ENST00000479077.1_Missense_Mutation_p.G108V	NM_001077191.1	NP_001070659.1	Q8TDU6	GPBAR_HUMAN	G protein-coupled bile acid receptor 1	108					cell surface bile acid receptor signaling pathway (GO:0038184)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid receptor activity (GO:0038181)|G-protein coupled bile acid receptor activity (GO:0038182)			cervix(1)|kidney(1)|large_intestine(1)|ovary(1)	4		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGGTGCACGGGGAGCGCTAC	0.637																																					p.G108V		.											.	GPBAR1	23	0			c.G323T						.						60.0	65.0	63.0					2																	219127770		2146	4247	6393	SO:0001583	missense	151306	exon2			TGCACGGGGAGCG	AB086170	CCDS46515.1	2q35	2012-08-08			ENSG00000179921	ENSG00000179921			19680	protein-coding gene	gene with protein product		610147				12419312	Standard	NM_170699		Approved	BG37, GPCR, TGR5, M-BAR, GPCR19, GPR131, MGC40597	uc010zjw.1	Q8TDU6	OTTHUMG00000155203	ENST00000522678.1:c.323G>T	2.37:g.219127770G>T	ENSP00000430886:p.Gly108Val	109.0	0.0		122.0	21.0	NM_170699	B3KV35	Missense_Mutation	SNP	ENST00000522678.1	37	CCDS46515.1	.	.	.	.	.	.	.	.	.	.	G	9.043	0.990248	0.18966	.	.	ENSG00000179921	ENST00000479077;ENST00000522678;ENST00000519574;ENST00000521462	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.15	4.24	0.50183	GPCR, rhodopsin-like superfamily (1);	0.301296	0.27549	U	0.018864	T	0.14700	0.0355	N	0.11064	0.09	0.53005	D	0.99996	B	0.31611	0.331	B	0.39503	0.301	T	0.18304	-1.0341	10	0.02654	T	1	-4.988	5.0789	0.14646	0.1654:0.1846:0.65:0.0	.	108	Q8TDU6	GPBAR_HUMAN	V	108	ENSP00000430698:G108V;ENSP00000430886:G108V;ENSP00000430202:G108V;ENSP00000428824:G108V	ENSP00000430698:G108V	G	+	2	0	GPBAR1	218836014	1.000000	0.71417	0.873000	0.34254	0.503000	0.33858	3.713000	0.54882	1.348000	0.45733	0.561000	0.74099	GGG	.		0.637	GPBAR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338767.3	NM_001077191	
GMPPA	29926	hgsc.bcm.edu;bcgsc.ca	37	2	220366718	220366718	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:220366718C>T	ENST00000358215.3	+	5	757	c.388C>T	c.(388-390)Cac>Tac	p.H130Y	GMPPA_ENST00000373917.3_Missense_Mutation_p.H130Y|GMPPA_ENST00000341142.3_Missense_Mutation_p.H130Y|AC053503.11_ENST00000429882.1_RNA|GMPPA_ENST00000313597.5_Missense_Mutation_p.H130Y|GMPPA_ENST00000373908.1_Missense_Mutation_p.H130Y	NM_205847.2	NP_995319.1	Q96IJ6	GMPPA_HUMAN	GDP-mannose pyrophosphorylase A	130					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotidyltransferase activity (GO:0016779)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20		Renal(207;0.0183)		Epithelial(149;3.82e-10)|all cancers(144;6.25e-08)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00807)|READ - Rectum adenocarcinoma(5;0.148)		GTTGGAAGCCCACCGACGCCA	0.587																																					p.H130Y		.											.	GMPPA	90	0			c.C388T						.						185.0	168.0	174.0					2																	220366718		2203	4300	6503	SO:0001583	missense	29926	exon5			GAAGCCCACCGAC	AF135422	CCDS2441.1	2q36.1	2008-02-05			ENSG00000144591	ENSG00000144591			22923	protein-coding gene	gene with protein product		615495					Standard	NM_205847		Approved		uc002vlr.3	Q96IJ6	OTTHUMG00000058922	ENST00000358215.3:c.388C>T	2.37:g.220366718C>T	ENSP00000350949:p.His130Tyr	115.0	0.0		65.0	6.0	NM_205847	A6NJ74|A8K3Q6|B3KMT4|Q53GI0|Q9NWC3|Q9Y5P5	Missense_Mutation	SNP	ENST00000358215.3	37	CCDS2441.1	.	.	.	.	.	.	.	.	.	.	C	15.87	2.961313	0.53400	.	.	ENSG00000144591	ENST00000313597;ENST00000373917;ENST00000358215;ENST00000373908;ENST00000455657;ENST00000435316;ENST00000341142;ENST00000373924	D;D;D;D;T;T;D	0.94862	-3.54;-3.54;-3.54;-3.54;-0.93;-0.93;-3.54	4.89	3.98	0.46160	Nucleotidyl transferase (1);	0.119716	0.56097	N	0.000021	D	0.94145	0.8122	M	0.71036	2.16	0.42599	D	0.993274	B;B	0.31227	0.011;0.314	B;B	0.39935	0.029;0.314	D	0.92724	0.6194	10	0.51188	T	0.08	-24.9987	12.0301	0.53394	0.0:0.9114:0.0:0.0886	.	130;130	Q96IJ6-2;Q96IJ6	.;GMPPA_HUMAN	Y	130;130;130;130;130;95;130;60	ENSP00000315925:H130Y;ENSP00000363027:H130Y;ENSP00000350949:H130Y;ENSP00000363016:H130Y;ENSP00000392465:H130Y;ENSP00000411060:H95Y;ENSP00000340760:H130Y	ENSP00000315925:H130Y	H	+	1	0	GMPPA	220074962	0.999000	0.42202	0.996000	0.52242	0.809000	0.45718	2.616000	0.46376	0.999000	0.39023	0.561000	0.74099	CAC	.		0.587	GMPPA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130230.1	NM_013335	
GPR123	84435	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	134910585	134910585	+	Silent	SNP	C	C	T	rs62624493	byFrequency	TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr10:134910585C>T	ENST00000392607.3	+	3	547	c.111C>T	c.(109-111)gtC>gtT	p.V37V	GPR123_ENST00000607359.1_Silent_p.V757V	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	37					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		CCTCCTTCGTCACCTACATCG	0.627																																					p.V37V		.											.	GPR123	90	0			c.C111T						.						124.0	101.0	109.0					10																	134910585		2203	4300	6503	SO:0001819	synonymous_variant	84435	exon3			CTTCGTCACCTAC	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.111C>T	10.37:g.134910585C>T		35.0	0.0		36.0	8.0	NM_001083909	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Silent	SNP	ENST00000392607.3	37	CCDS41580.1																																																																																			C|0.725;G|0.275		0.627	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2		
GPR1	2825	hgsc.bcm.edu;bcgsc.ca	37	2	207041152	207041152	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:207041152G>T	ENST00000407325.2	-	3	1182	c.820C>A	c.(820-822)Cac>Aac	p.H274N	GPR1_ENST00000437420.1_Missense_Mutation_p.H274N	NM_001098199.1|NM_001261452.1|NM_001261453.1|NM_001261454.1|NM_001261455.1|NM_005279.3	NP_001091669.1|NP_001248381.1|NP_001248382.1|NP_001248383.1|NP_001248384.1|NP_005270.2	P46091	GPR1_HUMAN	G protein-coupled receptor 1	274					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	18		Lung NSC(271;7.93e-06)|Renal(323;0.000147)|Hepatocellular(293;0.000888)		UCEC - Uterine corpus endometrioid carcinoma (47;0.000241)|Epithelial(149;1.91e-37)|STAD - Stomach adenocarcinoma(1183;0.00178)|Lung(261;0.111)|LUSC - Lung squamous cell carcinoma(261;0.184)		TAGCTATTGTGGTGAATGGTG	0.478																																					p.H274N		.											.	GPR1	90	0			c.C820A						.						107.0	101.0	103.0					2																	207041152		2203	4300	6503	SO:0001583	missense	2825	exon3			TATTGTGGTGAAT		CCDS2368.1	2q33.3	2014-01-30			ENSG00000183671	ENSG00000183671		"""GPCR / Class A : Orphans"""	4463	protein-coding gene	gene with protein product		600239				7851889	Standard	NM_005279		Approved		uc031rqv.1	P46091	OTTHUMG00000132894	ENST00000407325.2:c.820C>A	2.37:g.207041152G>T	ENSP00000384345:p.His274Asn	127.0	0.0		83.0	4.0	NM_001098199	A5JUU6|A8K4L1|Q53TR9|Q6NVX4	Missense_Mutation	SNP	ENST00000407325.2	37	CCDS2368.1	.	.	.	.	.	.	.	.	.	.	G	16.33	3.091780	0.55968	.	.	ENSG00000183671	ENST00000407325;ENST00000437420	T;T	0.71341	-0.56;-0.56	5.7	4.82	0.62117	GPCR, rhodopsin-like superfamily (1);	0.118678	0.56097	D	0.000023	T	0.72463	0.3463	L	0.31526	0.94	0.47094	D	0.999318	D	0.57257	0.979	P	0.57846	0.828	T	0.74763	-0.3555	10	0.52906	T	0.07	.	14.7805	0.69764	0.0693:0.0:0.9307:0.0	.	274	P46091	GPR1_HUMAN	N	274	ENSP00000384345:H274N;ENSP00000397535:H274N	ENSP00000384345:H274N	H	-	1	0	GPR1	206749397	1.000000	0.71417	0.997000	0.53966	0.652000	0.38707	3.569000	0.53827	1.415000	0.47037	0.655000	0.94253	CAC	.		0.478	GPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256394.2	NM_001098199	
GPR68	8111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	91700499	91700499	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr14:91700499C>T	ENST00000531499.2	-	2	1235	c.896G>A	c.(895-897)cGc>cAc	p.R299H	GPR68_ENST00000529300.1_5'Flank|GPR68_ENST00000535815.1_Missense_Mutation_p.R299H|GPR68_ENST00000238699.3_Missense_Mutation_p.R309H			Q15743	OGR1_HUMAN	G protein-coupled receptor 68	299					cellular response to pH (GO:0071467)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of osteoclast development (GO:2001206)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(2)|endometrium(1)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	8		all_cancers(154;0.0555)		COAD - Colon adenocarcinoma(157;0.21)		CCCGCGGAGGCGGGCCAGGTC	0.711																																					p.R299H		.											.	GPR68	91	0			c.G896A						.						8.0	12.0	11.0					14																	91700499		2110	4150	6260	SO:0001583	missense	8111	exon2			CGGAGGCGGGCCA	U48405	CCDS9894.1, CCDS9894.2	14q31	2012-08-21				ENSG00000119714		"""GPCR / Class A : Orphans"""	4519	protein-coding gene	gene with protein product		601404				8661159	Standard	NM_001177676		Approved	OGR1	uc001xzg.3	Q15743		ENST00000531499.2:c.896G>A	14.37:g.91700499C>T	ENSP00000434045:p.Arg299His	40.0	0.0		32.0	11.0	NM_001177676	Q13334|Q4VBB4|Q6IX34	Missense_Mutation	SNP	ENST00000531499.2	37	CCDS9894.2	.	.	.	.	.	.	.	.	.	.	C	18.93	3.728328	0.69074	.	.	ENSG00000119714	ENST00000531499;ENST00000238699;ENST00000535815;ENST00000529102	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.26	5.26	0.73747	.	0.226361	0.35739	N	0.003009	T	0.45915	0.1366	L	0.27053	0.805	0.30915	N	0.728668	D;D	0.89917	1.0;1.0	D;D	0.65443	0.935;0.935	T	0.51474	-0.8701	10	0.66056	D	0.02	.	8.091	0.30801	0.0:0.8617:0.0:0.1383	.	299;299	Q6NWR5;Q15743	.;OGR1_HUMAN	H	299;309;299;299	ENSP00000434045:R299H;ENSP00000238699:R309H;ENSP00000440797:R299H;ENSP00000432740:R299H	ENSP00000238699:R309H	R	-	2	0	GPR68	90770252	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.952000	0.63618	2.457000	0.83068	0.555000	0.69702	CGC	.		0.711	GPR68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395245.2		
GPSM1	26086	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	139250846	139250846	+	Silent	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:139250846C>T	ENST00000440944.1	+	13	1885	c.1665C>T	c.(1663-1665)atC>atT	p.I555I	GPSM1_ENST00000392944.1_Silent_p.I46I|GPSM1_ENST00000429455.1_Silent_p.I46I	NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1	555	GoLoco 2. {ECO:0000255|PROSITE- ProRule:PRU00097}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)			biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		TCGACCTCATCGCCAGCTCCC	0.711																																					p.I555I		.											.	GPSM1	90	0			c.C1665T						.						16.0	20.0	19.0					9																	139250846		2195	4291	6486	SO:0001819	synonymous_variant	26086	exon13			CCTCATCGCCAGC	AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.1665C>T	9.37:g.139250846C>T		76.0	0.0		65.0	19.0	NM_001145638	A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Silent	SNP	ENST00000440944.1	37	CCDS48055.1																																																																																			.		0.711	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015597	
GREB1L	80000	hgsc.bcm.edu;bcgsc.ca	37	18	19079688	19079688	+	Splice_Site	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr18:19079688A>G	ENST00000580732.2	+	22	3772		c.e22-1		GREB1L_ENST00000400483.4_Splice_Site|GREB1L_ENST00000269218.6_Splice_Site|GREB1L_ENST00000424526.1_Splice_Site			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like							integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						GTTCTCTCACAGGTTCCATCA	0.567																																					.		.											.	.	.	0			c.3392-2A>G						.						50.0	46.0	47.0					18																	19079688		692	1591	2283	SO:0001630	splice_region_variant	80000	exon22			TCTCACAGGTTCC	AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.3392-1A>G	18.37:g.19079688A>G		77.0	0.0		67.0	4.0	NM_001142966	A4QN17|Q9H8F1	Splice_Site	SNP	ENST00000580732.2	37	CCDS45836.1	.	.	.	.	.	.	.	.	.	.	A	18.06	3.540024	0.65085	.	.	ENSG00000141449	ENST00000424526;ENST00000269218	.	.	.	4.61	4.61	0.57282	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1663	0.65477	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GREB1L	17333686	1.000000	0.71417	0.998000	0.56505	0.785000	0.44390	8.285000	0.89914	1.937000	0.56155	0.459000	0.35465	.	.		0.567	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443782.2	NM_024935	Intron
GRID2IP	392862	hgsc.bcm.edu;bcgsc.ca	37	7	6561059	6561059	+	Splice_Site	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr7:6561059C>T	ENST00000457091.2	-	6	1084		c.e6+1		GRID2IP_ENST00000435185.1_Splice_Site|GRID2IP_ENST00000452113.1_Splice_Site	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein						long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						GGGGGTCTCACCACTGGCAAA	0.617																																					.		.											.	.	.	0			c.1084+1G>A						.						48.0	52.0	51.0					7																	6561059		692	1591	2283	SO:0001630	splice_region_variant	392862	exon7			GTCTCACCACTGG		CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.1084+1G>A	7.37:g.6561059C>T		144.0	0.0		97.0	5.0	NM_001145118		Splice_Site	SNP	ENST00000457091.2	37	CCDS47537.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.343749	0.61073	.	.	ENSG00000215045	ENST00000452113;ENST00000435185;ENST00000457091	.	.	.	4.96	4.08	0.47627	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.6134	0.39676	0.0:0.9019:0.0:0.0981	.	.	.	.	.	-1	.	.	.	-	.	.	GRID2IP	6527584	1.000000	0.71417	0.989000	0.46669	0.797000	0.45037	3.008000	0.49544	1.227000	0.43598	0.561000	0.74099	.	.		0.617	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340534.1	XM_294249	Intron
GRIK1	2897	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	21	30971254	30971254	+	Silent	SNP	G	G	T	rs113829116		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr21:30971254G>T	ENST00000399907.1	-	8	1513	c.1102C>A	c.(1102-1104)Cgg>Agg	p.R368R	GRIK1_ENST00000399914.1_Silent_p.R368R|BACH1_ENST00000462262.1_Intron|GRIK1_ENST00000309434.7_Silent_p.R370R|GRIK1_ENST00000399913.1_Silent_p.R368R|GRIK1_ENST00000389124.2_Silent_p.R368R|GRIK1_ENST00000389125.3_Silent_p.R368R|GRIK1_ENST00000472429.1_5'UTR|GRIK1_ENST00000327783.4_Silent_p.R368R|GRIK1_ENST00000399909.1_Silent_p.R368R|GRIK1-AS2_ENST00000333765.4_Intron|GRIK1_ENST00000535441.1_Silent_p.R370R	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	368					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	CCATCCCACCGGGCCTGTGGA	0.383																																					p.R368R		.											.	GRIK1	137	0			c.C1102A						.						78.0	77.0	77.0					21																	30971254		2203	4300	6503	SO:0001819	synonymous_variant	2897	exon8			CCCACCGGGCCTG		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.1102C>A	21.37:g.30971254G>T		48.0	0.0		45.0	4.0	NM_175611	Q13001|Q86SU9	Silent	SNP	ENST00000399907.1	37	CCDS42913.1																																																																																			T|0.000;C|0.999		0.383	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1		
GRIN1	2902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	140036523	140036523	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:140036523C>T	ENST00000371561.3	+	2	1414	c.317C>T	c.(316-318)cCt>cTt	p.P106L	GRIN1_ENST00000371553.3_Missense_Mutation_p.P106L|GRIN1_ENST00000315048.3_Missense_Mutation_p.P106L|GRIN1_ENST00000371559.4_Missense_Mutation_p.P106L|GRIN1_ENST00000471122.1_3'UTR|GRIN1_ENST00000371560.3_Missense_Mutation_p.P106L|GRIN1_ENST00000371546.4_Missense_Mutation_p.P106L|GRIN1_ENST00000350902.5_Missense_Mutation_p.P106L|GRIN1_ENST00000371550.4_Missense_Mutation_p.P106L|GRIN1_ENST00000371555.4_Missense_Mutation_p.P106L	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	106					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ACTCCCACCCCTGTCTCCTAC	0.592																																					p.P106L	NSCLC(113;717 1653 2089 20474 37618)	.											.	GRIN1	187	0			c.C317T						.						380.0	298.0	326.0					9																	140036523		2203	4300	6503	SO:0001583	missense	2902	exon2			CCACCCCTGTCTC		CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.317C>T	9.37:g.140036523C>T	ENSP00000360616:p.Pro106Leu	287.0	0.0		191.0	32.0	NM_000832	A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Missense_Mutation	SNP	ENST00000371561.3	37	CCDS7031.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457243	0.84317	.	.	ENSG00000176884	ENST00000371561;ENST00000315048;ENST00000350902;ENST00000371550;ENST00000371546;ENST00000371555;ENST00000371553;ENST00000371559;ENST00000371560	D;D;D;D;D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76	3.37	3.37	0.38596	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.84826	0.5558	L	0.29908	0.895	0.80722	D	1	D;B;D;D;D;D	0.89917	0.999;0.144;1.0;1.0;1.0;0.995	D;B;D;D;D;D	0.85130	0.984;0.27;0.995;0.995;0.997;0.956	D	0.84739	0.0750	10	0.41790	T	0.15	.	13.8091	0.63252	0.0:1.0:0.0:0.0	.	106;106;106;106;106;106	Q5VSF4;Q5VSF5;Q05586-2;Q05586-3;Q05586;A2AVK2	.;.;.;.;NMDZ1_HUMAN;.	L	106	ENSP00000360616:P106L;ENSP00000316696:P106L;ENSP00000316915:P106L;ENSP00000360605:P106L;ENSP00000360601:P106L;ENSP00000360610:P106L;ENSP00000360608:P106L;ENSP00000360614:P106L;ENSP00000360615:P106L	ENSP00000316696:P106L	P	+	2	0	GRIN1	139156344	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	7.016000	0.76393	1.887000	0.54652	0.462000	0.41574	CCT	.		0.592	GRIN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055267.3	NM_007327	
GRIP2	80852	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	14548375	14548375	+	RNA	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:14548375G>A	ENST00000273083.3	-	0	2396							Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				endometrium(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	25						TCCACACTGGGCACAGCCGGC	0.647																																					.		.											.	GRIP2	69	0			.						.						18.0	23.0	21.0					3																	14548375		2025	4164	6189			80852	.			CACTGGGCACAGC	AB051506		3p24-p23	2012-02-08			ENSG00000144596	ENSG00000144596			23841	protein-coding gene	gene with protein product							Standard	NM_001080423		Approved	KIAA1719	uc021wtn.1	Q9C0E4	OTTHUMG00000155544		3.37:g.14548375G>A		124.0	1.0		77.0	28.0	.	Q8TEH9|Q9H7H3	RNA	SNP	ENST00000273083.3	37																																																																																				.		0.647	GRIP2-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000340582.2	NM_001080423	
GRIPAP1	56850	hgsc.bcm.edu;bcgsc.ca	37	X	48855662	48855662	+	Silent	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:48855662G>A	ENST00000376441.1	-	3	193	c.159C>T	c.(157-159)agC>agT	p.S53S	GRIPAP1_ENST00000376423.4_Silent_p.S53S|GRIPAP1_ENST00000376444.3_Silent_p.S53S|GRIPAP1_ENST00000376425.3_Silent_p.S53S	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	53						blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						TCTGAGCTTTGCTGAACTCCT	0.537																																					p.S53S		.											.	GRIPAP1	227	0			c.C159T						.						135.0	94.0	108.0					X																	48855662		2203	4300	6503	SO:0001819	synonymous_variant	56850	exon3			AGCTTTGCTGAAC	AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.159C>T	X.37:g.48855662G>A		175.0	0.0		137.0	6.0	NM_020137	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Silent	SNP	ENST00000376441.1	37	CCDS35248.1																																																																																			.		0.537	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080970.2	NM_207672	
GTSE1	51512	hgsc.bcm.edu;bcgsc.ca	37	22	46704834	46704834	+	Silent	SNP	G	G	T	rs200502529		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr22:46704834G>T	ENST00000454366.1	+	4	968	c.756G>T	c.(754-756)gcG>gcT	p.A252A		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	233					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		CTGGGGCTGCGGAGAAGGTAA	0.622																																					p.A252A	GBM(153;542 1915 12487 29016 50495)	.											.	GTSE1	187	0			c.G756T						.						33.0	38.0	36.0					22																	46704834		2195	4286	6481	SO:0001819	synonymous_variant	51512	exon4			GGCTGCGGAGAAG	AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.756G>T	22.37:g.46704834G>T		112.0	0.0		64.0	4.0	NM_016426	B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Silent	SNP	ENST00000454366.1	37	CCDS14074.2																																																																																			G|0.999;A|0.001		0.622	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318360.2	NM_016426	
GUSB	2990	hgsc.bcm.edu;bcgsc.ca	37	7	65435344	65435344	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr7:65435344G>T	ENST00000304895.4	-	9	1531	c.1401C>A	c.(1399-1401)atC>atA	p.I467I	GUSB_ENST00000345660.6_Silent_p.I416I|GUSB_ENST00000421103.1_Silent_p.I321I	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	467					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)			breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						TGGTGTGAGCGATCACCATCC	0.577																																					p.I467I		.											.	GUSB	90	0			c.C1401A						.						85.0	82.0	83.0					7																	65435344		2203	4300	6503	SO:0001819	synonymous_variant	2990	exon9			GTGAGCGATCACC	M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.1401C>A	7.37:g.65435344G>T		82.0	0.0		89.0	5.0	NM_000181	B4E1F6|E9PCV0|Q549U0|Q96CL9	Silent	SNP	ENST00000304895.4	37	CCDS5530.1																																																																																			.		0.577	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251637.3	NM_000181	
GZF1	64412	hgsc.bcm.edu;bcgsc.ca	37	20	23345335	23345335	+	Silent	SNP	G	G	T	rs376361468		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr20:23345335G>T	ENST00000338121.5	+	2	392	c.315G>T	c.(313-315)cgG>cgT	p.R105R	GZF1_ENST00000377051.2_Silent_p.R105R|GZF1_ENST00000544236.1_Intron|GZF1_ENST00000542987.1_Intron			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	105					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					AAGAAGATCGGGTGCAGCGAA	0.393																																					p.R105R		.											.	GZF1	91	0			c.G315T						.						83.0	86.0	85.0					20																	23345335		2203	4300	6503	SO:0001819	synonymous_variant	64412	exon1			AGATCGGGTGCAG	AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.315G>T	20.37:g.23345335G>T		123.0	0.0		93.0	4.0	NM_022482	A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Silent	SNP	ENST00000338121.5	37	CCDS13151.1																																																																																			.		0.393	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078333.1	NM_022482	
HGFAC	3083	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	4	3443800	3443800	+	Silent	SNP	G	G	C	rs372137428		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr4:3443800G>C	ENST00000382774.3	+	1	187	c.72G>C	c.(70-72)ctG>ctC	p.L24L	HGFAC_ENST00000511533.1_Silent_p.L24L	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	24					proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		TCCTCCTCCTGCTGCTGCTGC	0.716													G|||	1	0.000199681	0.0008	0.0	5008	,	,		13355	0.0		0.0	False		,,,				2504	0.0				p.L24L		.											.	HGFAC	514	0			c.G72C						.	G		5,3433		0,5,1714	13.0	16.0	15.0		72	0.1	1.0	4		15	0,7164		0,0,3582	no	coding-synonymous	HGFAC	NM_001528.2		0,5,5296	CC,CG,GG		0.0,0.1454,0.0472		24/656	3443800	5,10597	1719	3582	5301	SO:0001819	synonymous_variant	3083	exon1			CCTCCTGCTGCTG	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.72G>C	4.37:g.3443800G>C		27.0	0.0		22.0	4.0	NM_001528	Q14726|Q2M1W7|Q53X47	Silent	SNP	ENST00000382774.3	37	CCDS3369.1																																																																																			.		0.716	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3		
HIPK1	204851	hgsc.bcm.edu;bcgsc.ca	37	1	114499248	114499248	+	Splice_Site	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:114499248G>T	ENST00000369558.1	+	6	1639		c.e6-1		HIPK1_ENST00000406344.1_Splice_Site|HIPK1_ENST00000369555.2_Splice_Site|HIPK1_ENST00000369553.1_Splice_Site|HIPK1_ENST00000369554.2_Splice_Site|HIPK1_ENST00000369559.4_Splice_Site|HIPK1_ENST00000340480.4_Splice_Site|HIPK1_ENST00000369561.4_Splice_Site|HIPK1_ENST00000426820.2_Splice_Site			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1						anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCTTTGGAAGGTGAATATGT	0.388																																					.		.											.	HIPK1	361	0			c.1408-1G>T						.						66.0	63.0	64.0					1																	114499248		2203	4300	6503	SO:0001630	splice_region_variant	204851	exon6			TTGGAAGGTGAAT	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.1408-1G>T	1.37:g.114499248G>T		95.0	0.0		60.0	4.0	NM_152696	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Splice_Site	SNP	ENST00000369558.1	37	CCDS867.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.967471	0.74131	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000340480;ENST00000369553;ENST00000406344	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6579	0.91460	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HIPK1	114300771	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	9.657000	0.98554	2.646000	0.89796	0.650000	0.86243	.	.		0.388	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	Intron
HNRNPL	3191	hgsc.bcm.edu;bcgsc.ca	37	19	39336338	39336338	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:39336338A>G	ENST00000221419.5	-	4	1028	c.662T>C	c.(661-663)gTc>gCc	p.V221A	AC008982.2_ENST00000600473.1_RNA|HNRNPL_ENST00000600873.1_Missense_Mutation_p.V88A	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	221	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			AATTCTCTGGACAGGGCCACA	0.498																																					p.V221A		.											.	HNRNPL	22	0			c.T662C						.						85.0	80.0	82.0					19																	39336338		2203	4300	6503	SO:0001583	missense	3191	exon4			CTCTGGACAGGGC	X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.662T>C	19.37:g.39336338A>G	ENSP00000221419:p.Val221Ala	79.0	0.0		66.0	4.0	NM_001533	A6ND69|A6NIT8|Q9H3P3	Missense_Mutation	SNP	ENST00000221419.5	37	CCDS33015.1	.	.	.	.	.	.	.	.	.	.	A	31	5.072243	0.93950	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750;ENST00000423415;ENST00000536292	.	.	.	5.51	5.51	0.81932	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.86045	0.5839	H	0.95780	3.72	0.80722	D	1	P	0.42993	0.797	P	0.59487	0.858	D	0.89543	0.3794	9	0.87932	D	0	.	14.6052	0.68472	1.0:0.0:0.0:0.0	.	221	P14866	HNRPL_HUMAN	A	221;88;88;88;149	.	ENSP00000221419:V221A	V	-	2	0	HNRNPL	44028178	1.000000	0.71417	0.995000	0.50966	0.971000	0.66376	9.161000	0.94739	2.105000	0.64084	0.455000	0.32223	GTC	.		0.498	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1		
HSD3B7	80270	hgsc.bcm.edu;bcgsc.ca	37	16	30997766	30997766	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:30997766T>C	ENST00000297679.5	+	4	438	c.345T>C	c.(343-345)gcT>gcC	p.A115A	HSD3B7_ENST00000262520.6_Silent_p.A115A|HSD3B7_ENST00000353250.5_Silent_p.A115A|AC135048.1_ENST00000602217.1_5'Flank	NM_025193.3	NP_079469.2	Q9H2F3	3BHS7_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7	115					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|cholest-5-ene-3-beta,7-alpha-diol 3-beta-dehydrogenase activity (GO:0047016)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						TGATCGAGGCTTGTGTGCAGA	0.597																																					p.A115A		.											.	HSD3B7	90	0			c.T345C						.						96.0	81.0	86.0					16																	30997766		2197	4300	6497	SO:0001819	synonymous_variant	80270	exon4			CGAGGCTTGTGTG	AF277719	CCDS10698.1, CCDS45466.1	16p11.2	2011-09-14			ENSG00000099377	ENSG00000099377	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	18324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 3"""	607764				11067870, 19027726	Standard	NM_001142777		Approved	C(27)-3BETA-HSD, SDR11E3	uc002eaf.2	Q9H2F3	OTTHUMG00000132417	ENST00000297679.5:c.345T>C	16.37:g.30997766T>C		96.0	0.0		123.0	6.0	NM_025193	Q96M28|Q9BSN9	Silent	SNP	ENST00000297679.5	37	CCDS10698.1																																																																																			.		0.597	HSD3B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255554.2		
HSPA8	3312	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	122930222	122930222	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:122930222T>C	ENST00000532636.1	-	5	1198	c.1079A>G	c.(1078-1080)aAt>aGt	p.N360S	HSPA8_ENST00000526110.1_Missense_Mutation_p.N341S|SNORD14C_ENST00000365382.1_RNA|HSPA8_ENST00000227378.3_Missense_Mutation_p.N360S|HSPA8_ENST00000533540.1_Missense_Mutation_p.N214S|SNORD14E_ENST00000364009.1_RNA|HSPA8_ENST00000534624.1_Missense_Mutation_p.N360S|HSPA8_ENST00000453788.2_Missense_Mutation_p.N360S|HSPA8_ENST00000534319.1_Missense_Mutation_p.N124S|SNORD14D_ENST00000384390.1_RNA|HSPA8_ENST00000526862.1_5'UTR			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	360	Interaction with BAG1.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GATGCTCTTATTCAGTTCTTT	0.448																																					p.N360S	Colon(21;486 594 5900 6733 14272)	.											.	HSPA8	654	0			c.A1079G						.						113.0	108.0	110.0					11																	122930222		2202	4299	6501	SO:0001583	missense	3312	exon5			CTCTTATTCAGTT	Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.1079A>G	11.37:g.122930222T>C	ENSP00000437125:p.Asn360Ser	146.0	0.0		122.0	12.0	NM_006597	Q9H3R6	Missense_Mutation	SNP	ENST00000532636.1	37	CCDS8440.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.539880	0.85917	.	.	ENSG00000109971	ENST00000532636;ENST00000533540;ENST00000534624;ENST00000453788;ENST00000227378;ENST00000534319;ENST00000526110;ENST00000528292	T;T;T;T;T;T;T;T	0.00912	5.55;5.55;5.55;5.55;5.55;5.55;5.55;5.55	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.03053	0.0090	L	0.41236	1.265	0.80722	D	1	D;D;D;D	0.58970	0.984;0.966;0.958;0.984	P;D;P;P	0.65684	0.896;0.937;0.896;0.896	T	0.59473	-0.7448	10	0.87932	D	0	-19.7226	14.4185	0.67168	0.0:0.0:0.0:1.0	.	360;360;360;360	Q53GZ6;E7ET08;P11142-2;P11142	.;.;.;HSP7C_HUMAN	S	360;214;360;360;360;124;341;300	ENSP00000437125:N360S;ENSP00000437189:N214S;ENSP00000432083:N360S;ENSP00000404372:N360S;ENSP00000227378:N360S;ENSP00000433316:N124S;ENSP00000433584:N341S;ENSP00000432884:N300S	ENSP00000227378:N360S	N	-	2	0	HSPA8	122435432	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.064000	0.71169	1.871000	0.54225	0.454000	0.30748	AAT	.		0.448	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387515.1		
HTT	3064	hgsc.bcm.edu;bcgsc.ca	37	4	3131704	3131704	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr4:3131704G>T	ENST00000355072.5	+	13	1942	c.1797G>T	c.(1795-1797)caG>caT	p.Q599H		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	599					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GACAGCCCCAGGATGAAGATG	0.507																																					p.Q599H		.											.	HTT	281	0			c.G1797T						.						89.0	88.0	88.0					4																	3131704		1897	4136	6033	SO:0001583	missense	3064	exon13			GCCCCAGGATGAA	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.1797G>T	4.37:g.3131704G>T	ENSP00000347184:p.Gln599His	100.0	0.0		99.0	6.0	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.194400	0.38806	.	.	ENSG00000197386	ENST00000355072	T	0.06371	3.31	4.5	3.64	0.41730	Armadillo-type fold (1);	0.244527	0.42964	D	0.000623	T	0.06325	0.0163	L	0.38175	1.15	0.52099	D	0.999946	P	0.39326	0.668	B	0.41088	0.347	T	0.31280	-0.9949	10	0.66056	D	0.02	.	5.4243	0.16417	0.1627:0.0:0.672:0.1652	.	599	P42858	HD_HUMAN	H	599	ENSP00000347184:Q599H	ENSP00000347184:Q599H	Q	+	3	2	HTT	3101502	1.000000	0.71417	0.702000	0.30337	0.041000	0.13682	1.226000	0.32563	1.003000	0.39130	-0.314000	0.08810	CAG	.		0.507	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
HTT	3064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	3225849	3225849	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr4:3225849G>T	ENST00000355072.5	+	56	7901	c.7756G>T	c.(7756-7758)Gct>Tct	p.A2586S		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2586					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TCTGTCTCCGGCTACTACAGG	0.507																																					p.A2586S		.											.	HTT	281	0			c.G7756T						.						130.0	144.0	139.0					4																	3225849		2141	4261	6402	SO:0001583	missense	3064	exon56			TCTCCGGCTACTA	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.7756G>T	4.37:g.3225849G>T	ENSP00000347184:p.Ala2586Ser	98.0	0.0		98.0	35.0	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	G	6.407	0.443274	0.12164	.	.	ENSG00000197386	ENST00000355072	T	0.05447	3.44	5.53	4.64	0.57946	.	0.202412	0.43747	D	0.000527	T	0.05227	0.0139	L	0.29908	0.895	0.31287	N	0.689856	B	0.19331	0.035	B	0.14023	0.01	T	0.07616	-1.0763	10	0.28530	T	0.3	.	9.8937	0.41304	0.0:0.1293:0.6232:0.2475	.	2586	P42858	HD_HUMAN	S	2586	ENSP00000347184:A2586S	ENSP00000347184:A2586S	A	+	1	0	HTT	3195647	1.000000	0.71417	0.429000	0.26710	0.156000	0.22039	3.703000	0.54808	2.611000	0.88343	0.650000	0.86243	GCT	.		0.507	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
ICMT	23463	broad.mit.edu;ucsc.edu	37	1	6292060	6292060	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:6292060C>A	ENST00000343813.5	-	4	602	c.574G>T	c.(574-576)Gaa>Taa	p.E192*		NM_012405.3	NP_036537.1	O60725	ICMT_HUMAN	isoprenylcysteine carboxyl methyltransferase	192					C-terminal protein methylation (GO:0006481)|cellular protein modification process (GO:0006464)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|multicellular organism growth (GO:0035264)|positive regulation of cell proliferation (GO:0008284)|protein targeting to membrane (GO:0006612)|regulation of Ras protein signal transduction (GO:0046578)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cAMP response element binding protein binding (GO:0008140)|protein C-terminal carboxyl O-methyltransferase activity (GO:0003880)|protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase activity (GO:0004671)			NS(1)|endometrium(2)	3	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;2.4e-22)|all_lung(118;2.65e-08)|Lung NSC(185;6.45e-07)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000688)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;5.52e-38)|GBM - Glioblastoma multiforme(13;6.51e-32)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;7.08e-08)|COAD - Colon adenocarcinoma(227;8.35e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		TCTGATTTTTCATTCTGTACC	0.498																																					p.E192X		.											.	ICMT	650	0			c.G574T						.						128.0	111.0	117.0					1																	6292060		2203	4300	6503	SO:0001587	stop_gained	23463	exon4			ATTTTTCATTCTG	AF064084	CCDS61.1	1p36	2010-04-29			ENSG00000116237	ENSG00000116237	2.1.1.100		5350	protein-coding gene	gene with protein product	"""protein-S-isoprenylcysteine O-methyltransferase"""	605851				9614111, 10441503	Standard	XM_005263437		Approved	PCCMT, HSTE14, PPMT	uc001amk.3	O60725	OTTHUMG00000001254	ENST00000343813.5:c.574G>T	1.37:g.6292060C>A	ENSP00000343552:p.Glu192*	157.0	2.0		182.0	44.0	NM_012405	Q6FHT0	Nonsense_Mutation	SNP	ENST00000343813.5	37	CCDS61.1	.	.	.	.	.	.	.	.	.	.	C	38	6.760029	0.97817	.	.	ENSG00000116237	ENST00000343813;ENST00000535068	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	19.6321	0.95713	0.0:1.0:0.0:0.0	.	.	.	.	X	192;96	.	ENSP00000343552:E192X	E	-	1	0	ICMT	6214647	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.223000	0.78033	2.884000	0.98904	0.655000	0.94253	GAA	.		0.498	ICMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003681.1	NM_012405	
IFIT2	3433	hgsc.bcm.edu;bcgsc.ca	37	10	91066851	91066851	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr10:91066851T>C	ENST00000371826.3	+	2	1307	c.1138T>C	c.(1138-1140)Ttt>Ctt	p.F380L	LIPA_ENST00000371837.1_Intron|LIPA_ENST00000487618.1_Intron	NM_001547.4	NP_001538.4	P09913	IFIT2_HUMAN	interferon-induced protein with tetratricopeptide repeats 2	380					apoptotic mitochondrial changes (GO:0008637)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of protein binding (GO:0032091)|positive regulation of apoptotic process (GO:0043065)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	12		Colorectal(252;0.0161)				GTATGGCAACTTTCAGCTGTA	0.408																																					p.F380L		.											.	IFIT2	92	0			c.T1138C						.						93.0	87.0	89.0					10																	91066851		1914	4128	6042	SO:0001583	missense	3433	exon2			GGCAACTTTCAGC	M14660	CCDS41548.1	10q23.31	2013-01-11			ENSG00000119922	ENSG00000119922		"""Tetratricopeptide (TTC) repeat domain containing"""	5409	protein-coding gene	gene with protein product		147040		IFI54, G10P2		3175763, 3360121	Standard	NM_001547		Approved	IFI-54, ISG-54K, cig42, GARG-39	uc009xts.3	P09913	OTTHUMG00000018707	ENST00000371826.3:c.1138T>C	10.37:g.91066851T>C	ENSP00000360891:p.Phe380Leu	96.0	0.0		91.0	4.0	NM_001547	Q5T767	Missense_Mutation	SNP	ENST00000371826.3	37	CCDS41548.1	.	.	.	.	.	.	.	.	.	.	T	19.00	3.741715	0.69304	.	.	ENSG00000119922	ENST00000371826	T	0.20463	2.07	4.58	2.12	0.27331	Tetratricopeptide-like helical (1);	0.078649	0.52532	U	0.000072	T	0.24236	0.0587	L	0.58969	1.84	0.41503	D	0.988297	D	0.54397	0.966	P	0.48598	0.583	T	0.02031	-1.1226	10	0.42905	T	0.14	-8.7326	7.5678	0.27890	0.1403:0.0:0.1468:0.7129	.	380	P09913	IFIT2_HUMAN	L	380	ENSP00000360891:F380L	ENSP00000360891:F380L	F	+	1	0	IFIT2	91056831	0.976000	0.34144	0.994000	0.49952	0.994000	0.84299	2.922000	0.48860	0.449000	0.26747	0.533000	0.62120	TTT	.		0.408	IFIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049293.1	NM_001547	
IFT122	55764	hgsc.bcm.edu;bcgsc.ca	37	3	129238004	129238004	+	Missense_Mutation	SNP	C	C	A	rs373326394		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:129238004C>A	ENST00000348417.2	+	28	3523	c.3446C>A	c.(3445-3447)cCg>cAg	p.P1149Q	IFT122_ENST00000431818.2_Missense_Mutation_p.P999Q|IFT122_ENST00000347300.2_Missense_Mutation_p.P1090Q|IFT122_ENST00000296266.3_Missense_Mutation_p.P1200Q|IFT122_ENST00000504021.1_Missense_Mutation_p.P1026Q|IFT122_ENST00000349441.2_Missense_Mutation_p.P1039Q|IFT122_ENST00000507564.1_Missense_Mutation_p.P1142Q|IFT122_ENST00000440957.2_Missense_Mutation_p.P940Q	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	1149					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)		p.P1200Q(1)		breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						GATGAGGACCCGTTCACAGCT	0.587																																					p.P1200Q		.											.	IFT122	92	1	Substitution - Missense(1)	lung(1)	c.C3599A						.						120.0	111.0	114.0					3																	129238004		2203	4300	6503	SO:0001583	missense	55764	exon29			AGGACCCGTTCAC	AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.3446C>A	3.37:g.129238004C>A	ENSP00000324005:p.Pro1149Gln	145.0	0.0		93.0	5.0	NM_052985	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Missense_Mutation	SNP	ENST00000348417.2	37	CCDS3061.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998072	0.74818	.	.	ENSG00000163913	ENST00000347300;ENST00000296266;ENST00000507564;ENST00000431818;ENST00000504021;ENST00000349441;ENST00000348417;ENST00000446384;ENST00000440957	T;T;T;T;T;T;T;T	0.62498	0.66;0.02;0.14;0.19;0.81;0.8;0.64;0.22	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.72898	0.3518	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.988;1.0;1.0;0.997;1.0;1.0	D;D;D;D;P;D;D;D;D;D	0.91635	0.999;0.999;0.997;0.996;0.708;0.995;0.991;0.932;0.999;0.999	T	0.72690	-0.4217	10	0.52906	T	0.07	-15.0043	20.1054	0.97890	0.0:1.0:0.0:0.0	.	940;475;1142;537;1026;991;1039;1090;1149;1200	E9PDG2;B3KUD1;E7EQF4;B3KT43;B4DEY9;B4DPW7;Q9BTY4;Q9HBG6-3;Q9HBG6;G3XAB1	.;.;.;.;.;.;.;.;IF122_HUMAN;.	Q	1090;1200;1142;999;1026;1039;1149;991;940	ENSP00000323973:P1090Q;ENSP00000296266:P1200Q;ENSP00000425536:P1142Q;ENSP00000410946:P999Q;ENSP00000422179:P1026Q;ENSP00000324165:P1039Q;ENSP00000324005:P1149Q;ENSP00000401569:P940Q	ENSP00000296266:P1200Q	P	+	2	0	IFT122	130720694	1.000000	0.71417	0.965000	0.40720	0.359000	0.29487	7.025000	0.76449	2.757000	0.94681	0.655000	0.94253	CCG	.		0.587	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355852.1	NM_018262	
IGDCC3	9543	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	65621487	65621487	+	Splice_Site	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr15:65621487C>A	ENST00000327987.4	-	14	2457		c.e14-1		IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3						neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CAGGATCCTGCTGGGGAAAGA	0.667																																					.		.											.	IGDCC3	93	0			c.2206-1G>T						.						14.0	17.0	16.0					15																	65621487		2201	4297	6498	SO:0001630	splice_region_variant	9543	exon15			ATCCTGCTGGGGA	AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.2206-1G>T	15.37:g.65621487C>A		51.0	0.0		46.0	16.0	NM_004884	O95215	Splice_Site	SNP	ENST00000327987.4	37	CCDS10205.1	.	.	.	.	.	.	.	.	.	.	C	11.79	1.743246	0.30865	.	.	ENSG00000174498	ENST00000327987	.	.	.	5.45	2.48	0.30137	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.3969	0.16275	0.1661:0.6644:0.0:0.1695	.	.	.	.	.	-1	.	.	.	-	.	.	IGDCC3	63408540	0.073000	0.21202	0.343000	0.25615	0.045000	0.14185	0.301000	0.19174	0.242000	0.21303	0.555000	0.69702	.	.		0.667	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1	NM_004884	Intron
IGF2R	3482	hgsc.bcm.edu;bcgsc.ca	37	6	160450671	160450671	+	Missense_Mutation	SNP	C	C	A	rs373279911		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr6:160450671C>A	ENST00000356956.1	+	7	1014	c.866C>A	c.(865-867)cCg>cAg	p.P289Q		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	289					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TTTGTTTGCCCGTCGGAGCGG	0.562																																					p.P289Q		.											.	IGF2R	118	0			c.C866A						.						115.0	94.0	101.0					6																	160450671		2203	4300	6503	SO:0001583	missense	3482	exon7			TTTGCCCGTCGGA	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.866C>A	6.37:g.160450671C>A	ENSP00000349437:p.Pro289Gln	168.0	0.0		125.0	5.0	NM_000876	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	C	17.53	3.411954	0.62511	.	.	ENSG00000197081	ENST00000356956	T	0.13657	2.57	4.91	4.91	0.64330	Mannose-6-phosphate receptor, binding (1);	0.000000	0.85682	D	0.000000	T	0.36744	0.0978	M	0.87827	2.91	0.48830	D	0.999717	D	0.89917	1.0	D	0.97110	1.0	T	0.40997	-0.9533	10	0.66056	D	0.02	-32.3188	17.4451	0.87575	0.0:1.0:0.0:0.0	.	289	P11717	MPRI_HUMAN	Q	289	ENSP00000349437:P289Q	ENSP00000349437:P289Q	P	+	2	0	IGF2R	160370661	1.000000	0.71417	0.042000	0.18584	0.322000	0.28314	5.926000	0.70070	2.433000	0.82419	0.655000	0.94253	CCG	.		0.562	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
IKBKAP	8518	hgsc.bcm.edu;bcgsc.ca	37	9	111665171	111665171	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:111665171A>G	ENST00000374647.5	-	16	2109	c.1802T>C	c.(1801-1803)gTt>gCt	p.V601A	IKBKAP_ENST00000537196.1_Missense_Mutation_p.V252A	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	601					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						AGGAAACCGAACAGGAAATCC	0.453																																					p.V601A		.											.	IKBKAP	318	0			c.T1802C						.						115.0	114.0	114.0					9																	111665171		2203	4300	6503	SO:0001583	missense	8518	exon16			AACCGAACAGGAA	AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.1802T>C	9.37:g.111665171A>G	ENSP00000363779:p.Val601Ala	175.0	0.0		120.0	6.0	NM_003640	Q5JSV2|Q9H327|Q9UG87	Missense_Mutation	SNP	ENST00000374647.5	37	CCDS6773.1	.	.	.	.	.	.	.	.	.	.	A	19.33	3.807873	0.70797	.	.	ENSG00000070061	ENST00000374647;ENST00000537196	T;T	0.26957	1.7;1.7	5.52	5.52	0.82312	.	0.267708	0.35970	N	0.002871	T	0.31199	0.0789	L	0.60904	1.88	0.23528	N	0.99749	P	0.45283	0.855	P	0.44447	0.45	T	0.22941	-1.0202	10	0.41790	T	0.15	-7.0671	13.5958	0.61988	1.0:0.0:0.0:0.0	.	601	O95163	ELP1_HUMAN	A	601;252	ENSP00000363779:V601A;ENSP00000439367:V252A	ENSP00000363779:V601A	V	-	2	0	IKBKAP	110704992	0.994000	0.37717	0.074000	0.20217	0.751000	0.42716	7.128000	0.77217	2.096000	0.63516	0.454000	0.30748	GTT	.		0.453	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053574.1		
IKZF3	22806	bcgsc.ca;mdanderson.org	37	17	37922726	37922726	+	Missense_Mutation	SNP	C	C	A	rs34974269		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:37922726C>A	ENST00000346872.3	-	8	908	c.847G>T	c.(847-849)Gat>Tat	p.D283Y	IKZF3_ENST00000439167.2_Missense_Mutation_p.D210Y|IKZF3_ENST00000351680.3_Missense_Mutation_p.D244Y|IKZF3_ENST00000583368.1_Missense_Mutation_p.D36Y|IKZF3_ENST00000439016.2_Missense_Mutation_p.D188Y|IKZF3_ENST00000467757.1_Missense_Mutation_p.D227Y|IKZF3_ENST00000346243.3_Missense_Mutation_p.D205Y|RP11-94L15.2_ENST00000488188.2_lincRNA|IKZF3_ENST00000394189.2_Missense_Mutation_p.D101Y|IKZF3_ENST00000350532.3_Missense_Mutation_p.D244Y|IKZF3_ENST00000377958.2_Missense_Mutation_p.D196Y|IKZF3_ENST00000377945.3_Missense_Mutation_p.D149Y|IKZF3_ENST00000535189.1_Missense_Mutation_p.D249Y|IKZF3_ENST00000377944.3_Missense_Mutation_p.D140Y|IKZF3_ENST00000377952.2_Missense_Mutation_p.D62Y	NM_012481.4	NP_036613.2	Q9UKT9	IKZF3_HUMAN	IKAROS family zinc finger 3 (Aiolos)	283					B cell activation (GO:0042113)|mesoderm development (GO:0007498)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of B cell proliferation (GO:0030888)|regulation of lymphocyte differentiation (GO:0045619)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(6)|large_intestine(4)|liver(1)|lung(13)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			TAGTTGACATCAAAGCAGTGG	0.433																																					p.D283Y		.											.	IKZF3	971	0			c.G847T						.						66.0	68.0	67.0					17																	37922726		2203	4300	6503	SO:0001583	missense	22806	exon8			TGACATCAAAGCA	AF129512	CCDS11346.1, CCDS11347.1, CCDS11348.1, CCDS11349.1, CCDS11350.1, CCDS11351.1, CCDS58539.1, CCDS58540.1, CCDS58541.1, CCDS58542.1, CCDS58543.1, CCDS58544.1, CCDS58545.1, CCDS74055.1	17q11.2	2013-01-08	2006-08-25	2006-08-25	ENSG00000161405	ENSG00000161405		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13178	protein-coding gene	gene with protein product		606221	"""zinc finger protein, subfamily 1A, 3 (Aiolos)"""	ZNFN1A3		9155026, 10552935	Standard	NM_012481		Approved	Aiolos	uc002hsu.4	Q9UKT9	OTTHUMG00000133250	ENST00000346872.3:c.847G>T	17.37:g.37922726C>A	ENSP00000344544:p.Asp283Tyr	29.0	0.0		19.0	3.0	NM_012481	B4DVV5|Q69BL6|Q69BL7|Q69BL8|Q69BL9|Q69BM0|Q69BM1|Q69BM2|Q69BM3|Q69BM5|Q8N574|Q8WWQ9|Q8WWR0|Q8WWR1|Q8WWR2|Q8WWR3	Missense_Mutation	SNP	ENST00000346872.3	37	CCDS11346.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.4|24.4	4.525318|4.525318	0.85600|0.85600	.|.	.|.	ENSG00000161405|ENSG00000161405	ENST00000488188;ENST00000346872;ENST00000377945;ENST00000394189;ENST00000377944;ENST00000377958;ENST00000377952;ENST00000535189;ENST00000351680;ENST00000346243;ENST00000350532;ENST00000467757|ENST00000439167;ENST00000439016	T;T;T;T;T;T;T;T;T;T|.	0.16597|.	2.33;3.22;3.01;2.82;3.44;3.09;3.16;3.23;3.09;4.08|.	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	0.098183|.	0.44285|.	D|.	0.000463|.	D|D	0.82770|0.82770	0.5109|0.5109	M|M	0.82823|0.82823	2.61|2.61	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;D;D;P;D;D;B;P;D;D;P|.	0.76494|.	0.999;0.998;0.998;0.998;0.999;0.702;0.998;0.997;0.36;0.823;0.999;0.986;0.949|.	D;D;D;D;D;P;D;D;B;P;D;P;P|.	0.70935|.	0.957;0.912;0.912;0.912;0.971;0.694;0.957;0.912;0.135;0.664;0.957;0.898;0.707|.	T|T	0.82827|0.82827	-0.0265|-0.0265	10|5	0.87932|.	D|.	0|.	-27.0776|-27.0776	20.0852|20.0852	0.97797|0.97797	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	196;62;101;149;140;249;205;188;244;227;244;210;283|.	Q9UKT9-9;Q9UKT9-12;Q9UKT9-11;Q9UKT9-13;Q9UKT9-10;Q9UKT9-7;Q9UKT9-6;Q9UKT9-5;Q9UKT9-4;Q9UKT9-2;Q9UKT9-3;Q9UKT9-8;Q9UKT9|.	.;.;.;.;.;.;.;.;.;.;.;.;IKZF3_HUMAN|.	Y|F	283;188;149;101;140;196;62;249;244;205;244;227|197;236	ENSP00000367180:D149Y;ENSP00000377741:D101Y;ENSP00000367179:D140Y;ENSP00000367194:D196Y;ENSP00000367188:D62Y;ENSP00000438972:D249Y;ENSP00000345622:D244Y;ENSP00000341977:D205Y;ENSP00000344471:D244Y;ENSP00000420463:D227Y|.	ENSP00000341977:D205Y|.	D|L	-|-	1|3	0|2	IKZF3|IKZF3	35176252|35176252	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.990000|0.990000	0.78478|0.78478	4.543000|4.543000	0.60684|0.60684	2.752000|2.752000	0.94435|0.94435	0.655000|0.655000	0.94253|0.94253	GAT|TTG	.		0.433	IKZF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257004.2	NM_012481	
IL1R1	3554	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	102791944	102791944	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:102791944A>G	ENST00000410023.1	+	11	1460	c.1142A>G	c.(1141-1143)gAt>gGt	p.D381G	IL1R1_ENST00000409288.1_Missense_Mutation_p.D381G|IL1R1_ENST00000233946.3_Missense_Mutation_p.D381G|IL1R1_ENST00000409589.1_Intron|AC007271.3_ENST00000428188.1_RNA|IL1R1_ENST00000409929.1_Intron|IL1R1_ENST00000409329.1_Missense_Mutation_p.D381G|IL1R1_ENST00000424272.1_Missense_Mutation_p.D381G			P14778	IL1R1_HUMAN	interleukin 1 receptor, type I	381					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|interleukin-1-mediated signaling pathway (GO:0070498)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)|platelet-derived growth factor receptor binding (GO:0005161)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|prostate(2)|skin(3)	19					Anakinra(DB00026)	TTAGCTTCAGATGGAAAGACC	0.348																																					p.D381G		.											.	IL1R1	523	0			c.A1142G						.						228.0	214.0	219.0					2																	102791944		2203	4300	6503	SO:0001583	missense	3554	exon10			CTTCAGATGGAAA	M27492	CCDS2055.1, CCDS74547.1	2q12	2013-01-29			ENSG00000115594	ENSG00000115594		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5993	protein-coding gene	gene with protein product		147810		IL1R, IL1RA		1833184, 10191101	Standard	XM_005263929		Approved	D2S1473, CD121A	uc002tbr.3	P14778	OTTHUMG00000130783	ENST00000410023.1:c.1142A>G	2.37:g.102791944A>G	ENSP00000386380:p.Asp381Gly	555.0	0.0		557.0	109.0	NM_000877	Q587I7	Missense_Mutation	SNP	ENST00000410023.1	37	CCDS2055.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.079933	0.76528	.	.	ENSG00000115594	ENST00000424272;ENST00000409329;ENST00000428279;ENST00000409288;ENST00000410023;ENST00000233946	T;T;T;T;T;T	0.02606	4.23;4.23;4.23;4.23;4.23;4.23	5.23	5.23	0.72850	Toll/interleukin-1 receptor homology (TIR) domain (1);	0.155915	0.56097	D	0.000030	T	0.19406	0.0466	M	0.88450	2.955	0.53005	D	0.999968	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.01245	-1.1407	10	0.87932	D	0	.	15.4254	0.75045	1.0:0.0:0.0:0.0	.	381;381	P14778;B8ZZ73	IL1R1_HUMAN;.	G	381;381;237;381;381;381	ENSP00000415366:D381G;ENSP00000387131:D381G;ENSP00000410461:D237G;ENSP00000386478:D381G;ENSP00000386380:D381G;ENSP00000233946:D381G	ENSP00000233946:D381G	D	+	2	0	IL1R1	102158376	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.777000	0.62361	2.104000	0.64026	0.456000	0.33151	GAT	.		0.348	IL1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253299.1		
IRF6	3664	hgsc.bcm.edu;bcgsc.ca	37	1	209974642	209974642	+	Silent	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:209974642G>A	ENST00000367021.3	-	3	289	c.117C>T	c.(115-117)ccC>ccT	p.P39P	IRF6_ENST00000542854.1_Intron	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	39			P -> A (in VWS1). {ECO:0000269|PubMed:12219090}.		cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		CATGTTTCCAGGGAATCTGGA	0.502										HNSCC(57;0.16)																											p.P39P		.											.	IRF6	92	0			c.C117T						.						88.0	94.0	92.0					1																	209974642		2203	4300	6503	SO:0001819	synonymous_variant	3664	exon3			TTTCCAGGGAATC	AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.117C>T	1.37:g.209974642G>A		101.0	0.0		79.0	4.0	NM_006147	B4DLE2|D3DT90|F5GWX8|G0ZTL0	Silent	SNP	ENST00000367021.3	37	CCDS1492.1																																																																																			.		0.502	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088827.1	NM_006147	
KAT2B	8850	hgsc.bcm.edu;bcgsc.ca	37	3	20153102	20153102	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:20153102G>A	ENST00000263754.4	+	6	1321	c.866G>A	c.(865-867)tGc>tAc	p.C289Y		NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	289					cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						CTGTGTTACTGCAACGTGCCA	0.458																																					p.C289Y		.											.	KAT2B	228	0			c.G866A						.						137.0	118.0	125.0					3																	20153102		2203	4300	6503	SO:0001583	missense	8850	exon6			GTTACTGCAACGT	U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.866G>A	3.37:g.20153102G>A	ENSP00000263754:p.Cys289Tyr	86.0	0.0		73.0	4.0	NM_003884	Q6NSK1	Missense_Mutation	SNP	ENST00000263754.4	37	CCDS2634.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.856854	0.91433	.	.	ENSG00000114166	ENST00000263754	T	0.39787	1.06	5.7	5.7	0.88788	PCAF, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.69993	0.3173	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73544	-0.3949	10	0.87932	D	0	-18.9628	19.8232	0.96605	0.0:0.0:1.0:0.0	.	289	Q92831	KAT2B_HUMAN	Y	289	ENSP00000263754:C289Y	ENSP00000263754:C289Y	C	+	2	0	KAT2B	20128106	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.734000	0.98822	2.684000	0.91462	0.650000	0.86243	TGC	.		0.458	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252880.1	NM_003884	
KBTBD3	143879	hgsc.bcm.edu;bcgsc.ca	37	11	105924774	105924774	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:105924774C>T	ENST00000526793.1	-	3	801	c.642G>A	c.(640-642)atG>atA	p.M214I	KBTBD3_ENST00000534815.1_Missense_Mutation_p.M135I|KBTBD3_ENST00000531837.1_Missense_Mutation_p.M214I	NM_152433.3	NP_689646.2	Q8NAB2	KBTB3_HUMAN	kelch repeat and BTB (POZ) domain containing 3	210	BACK.									NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	25		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		CTTTCAGTACCATTTCTTCTT	0.313																																					p.M214I		.											.	KBTBD3	91	0			c.G642A						.						63.0	67.0	66.0					11																	105924774		2201	4298	6499	SO:0001583	missense	143879	exon3			CAGTACCATTTCT	AK055247	CCDS8334.1	11q22.3	2013-01-08	2003-12-12	2003-12-17		ENSG00000182359		"""BTB/POZ domain containing"""	22934	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 3"""	BKLHD3			Standard	NM_198439		Approved		uc001pjb.3	Q8NAB2		ENST00000526793.1:c.642G>A	11.37:g.105924774C>T	ENSP00000436262:p.Met214Ile	88.0	0.0		92.0	4.0	NM_152433	Q6N066|Q86X38|Q96NK5	Missense_Mutation	SNP	ENST00000526793.1	37	CCDS8334.1	.	.	.	.	.	.	.	.	.	.	C	10.10	1.256678	0.22965	.	.	ENSG00000182359	ENST00000534815;ENST00000526793;ENST00000531837	T;T;T	0.68181	-0.31;-0.31;-0.31	5.71	-7.6	0.01303	BTB/Kelch-associated (2);	0.506452	0.24258	N	0.040120	T	0.31009	0.0783	N	0.08118	0	0.26322	N	0.977669	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.04693	-1.0933	10	0.45353	T	0.12	.	1.2847	0.02048	0.2642:0.2301:0.3144:0.1913	.	214;210	A8K1K0;Q8NAB2	.;KBTB3_HUMAN	I	135;214;214	ENSP00000431910:M135I;ENSP00000436262:M214I;ENSP00000432163:M214I	ENSP00000436262:M214I	M	-	3	0	KBTBD3	105429984	0.001000	0.12720	0.536000	0.28039	0.963000	0.63663	-1.398000	0.02509	-1.616000	0.01572	-0.312000	0.09012	ATG	.		0.313	KBTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388705.2	NM_152433	
KCNA10	3744	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	111061042	111061042	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:111061042T>C	ENST00000369771.2	-	1	755	c.368A>G	c.(367-369)gAc>gGc	p.D123G		NM_005549.2	NP_005540.1	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 10	123					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|intracellular cyclic nucleotide activated cation channel activity (GO:0005221)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(3)|skin(1)|urinary_tract(1)	35		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Dalfampridine(DB06637)	TCTCATGGAGTCAAAGAACTG	0.468																																					p.D123G		.											.	KCNA10	156	0			c.A368G						.						68.0	72.0	70.0					1																	111061042		2203	4300	6503	SO:0001583	missense	3744	exon1			ATGGAGTCAAAGA	U96110	CCDS826.1	1p13.1	2012-07-05			ENSG00000143105	ENSG00000143105		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6219	protein-coding gene	gene with protein product		602420				16382104	Standard	NM_005549		Approved	Kv1.8	uc001dzt.1	Q16322	OTTHUMG00000022785	ENST00000369771.2:c.368A>G	1.37:g.111061042T>C	ENSP00000358786:p.Asp123Gly	42.0	0.0		29.0	5.0	NM_005549		Missense_Mutation	SNP	ENST00000369771.2	37	CCDS826.1	.	.	.	.	.	.	.	.	.	.	T	19.01	3.743242	0.69418	.	.	ENSG00000143105	ENST00000369771	T	0.78126	-1.15	5.72	5.72	0.89469	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.92198	0.7526	H	0.98883	4.36	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.95141	0.8264	10	0.87932	D	0	.	14.8223	0.70082	0.0:0.0:0.0:1.0	.	123	Q16322	KCA10_HUMAN	G	123	ENSP00000358786:D123G	ENSP00000358786:D123G	D	-	2	0	KCNA10	110862565	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.171000	0.68590	0.533000	0.62120	GAC	.		0.468	KCNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059081.1	NM_005549	
KCNA5	3741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	5153812	5153812	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:5153812C>T	ENST00000252321.3	+	1	728	c.499C>T	c.(499-501)Cgc>Tgc	p.R167C		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	167					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	CTTCTTCGACCGCAACCGGCC	0.662																																					p.R167C		.											.	KCNA5	715	0			c.C499T						.						38.0	41.0	40.0					12																	5153812		2203	4300	6503	SO:0001583	missense	3741	exon1			TTCGACCGCAACC	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.499C>T	12.37:g.5153812C>T	ENSP00000252321:p.Arg167Cys	98.0	0.0		63.0	26.0	NM_002234	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	ENST00000252321.3	37	CCDS8536.1	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912344	0.72983	.	.	ENSG00000130037	ENST00000252321	D	0.90324	-2.65	4.7	4.7	0.59300	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.64402	U	0.000001	D	0.97729	0.9255	H	0.99650	4.68	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99564	1.0969	10	0.87932	D	0	.	16.8208	0.85745	0.0:1.0:0.0:0.0	.	167	P22460	KCNA5_HUMAN	C	167	ENSP00000252321:R167C	ENSP00000252321:R167C	R	+	1	0	KCNA5	5024073	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	1.820000	0.39032	2.443000	0.82685	0.511000	0.50034	CGC	.		0.662	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234	
KCNAB1	7881	hgsc.bcm.edu;bcgsc.ca	37	3	155838515	155838515	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:155838515T>C	ENST00000490337.1	+	1	179	c.115T>C	c.(115-117)Tca>Cca	p.S39P	KCNAB1_ENST00000389636.5_Missense_Mutation_p.S39P	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	39					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			CAAGAAAGCCTCAGAAAACGC	0.542																																					p.S39P		.											.	KCNAB1	94	0			c.T115C						.						76.0	80.0	79.0					3																	155838515		2203	4300	6503	SO:0001583	missense	7881	exon1			AAAGCCTCAGAAA	U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.115T>C	3.37:g.155838515T>C	ENSP00000419952:p.Ser39Pro	197.0	0.0		137.0	6.0	NM_172160	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	ENST00000490337.1	37	CCDS3174.1	.	.	.	.	.	.	.	.	.	.	T	12.88	2.070024	0.36566	.	.	ENSG00000169282	ENST00000490337;ENST00000389636	T;T	0.11821	3.16;2.74	5.47	-3.34	0.04943	.	.	.	.	.	T	0.04815	0.0130	N	0.08118	0	0.41283	D	0.986929	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.33266	-0.9875	9	0.35671	T	0.21	-7.1239	2.5176	0.04672	0.1268:0.3006:0.3317:0.241	.	39;39	B7Z8E5;Q14722	.;KCAB1_HUMAN	P	39	ENSP00000419952:S39P;ENSP00000374287:S39P	ENSP00000374287:S39P	S	+	1	0	KCNAB1	157321209	0.000000	0.05858	0.656000	0.29637	0.979000	0.70002	-1.078000	0.03413	-0.474000	0.06862	0.455000	0.32223	TCA	.		0.542	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1	NM_003471	
KCNH4	23415	hgsc.bcm.edu;bcgsc.ca	37	17	40321671	40321671	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:40321671C>T	ENST00000264661.3	-	9	1746	c.1414G>A	c.(1414-1416)Ggg>Agg	p.G472R	KCNH4_ENST00000607371.1_Missense_Mutation_p.G472R	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	472					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GTCACGTTCCCGAACACCACA	0.662																																					p.G472R	NSCLC(117;707 1703 2300 21308 31858)	.											.	KCNH4	153	0			c.G1414A						.						78.0	62.0	68.0					17																	40321671		2203	4300	6503	SO:0001583	missense	23415	exon9			CGTTCCCGAACAC	AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.1414G>A	17.37:g.40321671C>T	ENSP00000264661:p.Gly472Arg	73.0	0.0		66.0	4.0	NM_012285		Missense_Mutation	SNP	ENST00000264661.3	37	CCDS11420.1	.	.	.	.	.	.	.	.	.	.	C	32	5.186962	0.94923	.	.	ENSG00000089558	ENST00000264661	D	0.99060	-5.38	4.36	4.36	0.52297	Ion transport (1);	0.000000	0.37219	N	0.002199	D	0.99477	0.9814	H	0.96833	3.89	0.80722	D	1	D	0.55800	0.973	P	0.60789	0.879	D	0.98087	1.0407	10	0.87932	D	0	.	17.084	0.86605	0.0:1.0:0.0:0.0	.	472	Q9UQ05	KCNH4_HUMAN	R	472	ENSP00000264661:G472R	ENSP00000264661:G472R	G	-	1	0	KCNH4	37575197	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.616000	0.83018	2.255000	0.74692	0.462000	0.41574	GGG	.		0.662	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449791.2	NM_012285	
KCNQ3	3786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	133153569	133153569	+	Silent	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr8:133153569C>T	ENST00000388996.4	-	10	1692	c.1272G>A	c.(1270-1272)ctG>ctA	p.L424L	KCNQ3_ENST00000521134.1_Silent_p.L304L|KCNQ3_ENST00000519445.1_Silent_p.L424L	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	424					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CCAAGAGACCCAGCTTTTGGC	0.423																																					p.L424L		.											.	KCNQ3	138	0			c.G1272A						.						66.0	69.0	68.0					8																	133153569		2203	4300	6503	SO:0001819	synonymous_variant	3786	exon10			GAGACCCAGCTTT	AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1272G>A	8.37:g.133153569C>T		85.0	0.0		105.0	50.0	NM_004519	A2VCT8|B4DJY4|E7EQ89	Silent	SNP	ENST00000388996.4	37	CCDS34943.1																																																																																			.		0.423	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
KDM6B	23135	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	7749921	7749921	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:7749921C>T	ENST00000448097.2	+	8	905	c.574C>T	c.(574-576)Cgg>Tgg	p.R192W	KDM6B_ENST00000254846.5_Missense_Mutation_p.R192W			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	192					cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						TGGAGCCAAGCGGGGAGGTCC	0.627																																					p.R192W		.											.	KDM6B	205	0			c.C574T						.						67.0	78.0	74.0					17																	7749921		2203	4297	6500	SO:0001583	missense	23135	exon8			GCCAAGCGGGGAG	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.574C>T	17.37:g.7749921C>T	ENSP00000412513:p.Arg192Trp	73.0	0.0		63.0	26.0	NM_001080424	C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	37		.	.	.	.	.	.	.	.	.	.	C	17.36	3.370768	0.61624	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.08458	3.09;3.09	5.17	5.17	0.71159	.	0.255620	0.32055	N	0.006647	T	0.15565	0.0375	N	0.14661	0.345	0.45806	D	0.998682	D	0.89917	1.0	D	0.72338	0.977	T	0.10019	-1.0648	10	0.72032	D	0.01	-12.7822	16.5365	0.84373	0.0:1.0:0.0:0.0	.	192	O15054-1	.	W	192	ENSP00000254846:R192W;ENSP00000412513:R192W	ENSP00000254846:R192W	R	+	1	2	KDM6B	7690646	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.104000	0.41815	2.579000	0.87056	0.650000	0.86243	CGG	.		0.627	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
KDSR	2531	hgsc.bcm.edu;bcgsc.ca	37	18	61034244	61034244	+	Splice_Site	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr18:61034244C>T	ENST00000406396.3	-	1	499	c.108G>A	c.(106-108)gtG>gtA	p.V36V	KDSR_ENST00000326575.5_Splice_Site_p.V36V|RP11-635N19.1_ENST00000589905.1_RNA	NM_002035.2	NP_002026.1	Q06136	KDSR_HUMAN	3-ketodihydrosphingosine reductase	36					3-keto-sphinganine metabolic process (GO:0006666)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-dehydrosphinganine reductase activity (GO:0047560)			endometrium(2)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	9						GGCCACTCACCACCACATGCG	0.701																																					p.V36V		.											.	KDSR	227	0			c.G108A						.						17.0	21.0	20.0					18																	61034244		2191	4287	6478	SO:0001630	splice_region_variant	2531	exon1			ACTCACCACCACA		CCDS11982.1	18q21	2011-09-20	2008-02-20	2008-02-20	ENSG00000119537	ENSG00000119537	1.1.1.102	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	4021	protein-coding gene	gene with protein product	"""3-dehydrosphinganine reductase"", ""short chain dehydrogenase/reductase family 35C, member 1"""	136440	"""follicular lymphoma variant translocation 1"""	FVT1		8417785, 15328338, 17420465, 19027726	Standard	NM_002035		Approved	DHSR, SDR35C1	uc010dpw.3	Q06136	OTTHUMG00000132792	ENST00000406396.3:c.108+1G>A	18.37:g.61034244C>T		226.0	0.0		134.0	6.0	NM_002035	B2R5Y1|B4DMX0	Silent	SNP	ENST00000406396.3	37	CCDS11982.1																																																																																			.		0.701	KDSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256200.2		Silent
KIAA1033	23325	hgsc.bcm.edu;bcgsc.ca	37	12	105534742	105534742	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:105534742G>T	ENST00000332180.5	+	17	1713	c.1626G>T	c.(1624-1626)ttG>ttT	p.L542F		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						CTCTAGTTTTGGCTGAAAACA	0.373																																					p.L542F		.											.	KIAA1033	91	0			c.G1626T						.						167.0	157.0	160.0					12																	105534742		1889	4129	6018	SO:0001583	missense	23325	exon17			AGTTTTGGCTGAA	AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.1626G>T	12.37:g.105534742G>T	ENSP00000328062:p.Leu542Phe	162.0	0.0		103.0	5.0	NM_015275		Missense_Mutation	SNP	ENST00000332180.5	37	CCDS41826.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.145255	0.77888	.	.	ENSG00000136051	ENST00000332180	T	0.51325	0.71	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.68677	0.3027	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72982	0.979;0.979	T	0.70597	-0.4828	10	0.72032	D	0.01	.	19.5261	0.95208	0.0:0.0:1.0:0.0	.	543;542	B7ZKT9;Q2M389	.;WASH7_HUMAN	F	542	ENSP00000328062:L542F	ENSP00000328062:L542F	L	+	3	2	KIAA1033	104058872	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.275000	0.51639	2.668000	0.90789	0.650000	0.86243	TTG	.		0.373	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4	NM_015275	
KIAA1429	25962	hgsc.bcm.edu;bcgsc.ca	37	8	95531221	95531221	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr8:95531221T>C	ENST00000297591.5	-	9	2580	c.2505A>G	c.(2503-2505)gaA>gaG	p.E835E	KIAA1429_ENST00000421249.2_Silent_p.E835E|KIAA1429_ENST00000437199.1_Silent_p.E835E	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	835					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			ACCCCAAGGCTTCTTTGGAAT	0.333																																					p.E835E		.											.	KIAA1429	92	0			c.A2505G						.						50.0	56.0	54.0					8																	95531221		2191	4299	6490	SO:0001819	synonymous_variant	25962	exon9			CAAGGCTTCTTTG	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.2505A>G	8.37:g.95531221T>C		64.0	0.0		68.0	4.0	NM_015496	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Silent	SNP	ENST00000297591.5	37	CCDS34923.1																																																																																			.		0.333	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496	
KIAA1549	57670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	138554406	138554406	+	Silent	SNP	G	G	A	rs575482000		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr7:138554406G>A	ENST00000422774.1	-	14	4701	c.4653C>T	c.(4651-4653)gaC>gaT	p.D1551D	KIAA1549_ENST00000440172.1_Silent_p.D1551D|KIAA1549_ENST00000242365.4_Silent_p.D1501D			Q9HCM3	K1549_HUMAN	KIAA1549	1551						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						AGGACAGGTCGTCTACCACCG	0.652			O	BRAF	pilocytic astrocytoma								g|||	1	0.000199681	0.0	0.0	5008	,	,		15717	0.0		0.0	False		,,,				2504	0.001				p.D1551D	NSCLC(119;1534 1718 44213 46230 50068)	.		Dom	yes		7	7q34	57670	KIAA1549		O	.	KIAA1549	369	0			c.C4653T						.						39.0	48.0	45.0					7																	138554406		2066	4198	6264	SO:0001819	synonymous_variant	57670	exon14			CAGGTCGTCTACC		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.4653C>T	7.37:g.138554406G>A		161.0	0.0		194.0	31.0	NM_020910	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Silent	SNP	ENST00000422774.1	37	CCDS56513.1																																																																																			.		0.652	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
KIF18B	146909	hgsc.bcm.edu;bcgsc.ca	37	17	43012257	43012257	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:43012257A>G	ENST00000593135.1	-	4	615	c.518T>C	c.(517-519)cTt>cCt	p.L173P	KIF18B_ENST00000590129.1_Missense_Mutation_p.L182P|KIF18B_ENST00000438933.2_Missense_Mutation_p.L173P|KIF18B_ENST00000587309.1_Missense_Mutation_p.L173P|KIF18B_ENST00000339151.4_Missense_Mutation_p.L173P	NM_001265577.1	NP_001252506.1	Q86Y91	KI18B_HUMAN	kinesin family member 18B	182	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|regulation of cell division (GO:0051302)	astral microtubule (GO:0000235)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule plus-end (GO:0035371)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	21		Prostate(33;0.155)				GCGGATGGCAAGGGGCCCCTT	0.592																																					p.L173P		.											.	KIF18B	70	0			c.T518C						.						11.0	13.0	13.0					17																	43012257		1821	3991	5812	SO:0001583	missense	146909	exon4			ATGGCAAGGGGCC		CCDS45709.1, CCDS58555.1, CCDS45709.2	17q21.31	2014-09-04			ENSG00000186185			"""Kinesins"""	27102	protein-coding gene	gene with protein product		614570				16084724	Standard	NM_001264573		Approved		uc010wjh.3	Q86Y91	OTTHUMG00000179867	ENST00000593135.1:c.518T>C	17.37:g.43012257A>G	ENSP00000465992:p.Leu173Pro	57.0	0.0		56.0	5.0	NM_001264573	A6NJI2|B7ZM49|B9EGM8|D5L6I1	Missense_Mutation	SNP	ENST00000593135.1	37	CCDS45709.2	.	.	.	.	.	.	.	.	.	.	A	25.2	4.615706	0.87359	.	.	ENSG00000186185	ENST00000438933;ENST00000339151;ENST00000376982	T;T	0.80033	-1.33;-1.33	5.7	5.7	0.88788	Kinesin, motor domain (4);	0.000000	0.34200	N	0.004163	D	0.92502	0.7619	H	0.94222	3.51	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.94443	0.7660	10	0.87932	D	0	.	15.6259	0.76855	1.0:0.0:0.0:0.0	.	182;182;182	Q86Y91;Q86Y91-3;Q86Y91-2	KI18B_HUMAN;.;.	P	173	ENSP00000412798:L173P;ENSP00000341466:L173P	ENSP00000341466:L173P	L	-	2	0	KIF18B	40367783	1.000000	0.71417	0.953000	0.39169	0.995000	0.86356	9.182000	0.94881	2.175000	0.68902	0.454000	0.30748	CTT	.		0.592	KIF18B-001	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000448724.1	NM_001080443	
KIF19	124602	hgsc.bcm.edu;bcgsc.ca	37	17	72324604	72324604	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:72324604A>G	ENST00000389916.4	+	2	218	c.80A>G	c.(79-81)gAg>gGg	p.E27G		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	27	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						GCAGAGCTGGAGGAAGGAGCT	0.617																																					p.E27G		.											.	KIF19	90	0			c.A80G						.						49.0	44.0	46.0					17																	72324604		2203	4299	6502	SO:0001583	missense	124602	exon2			AGCTGGAGGAAGG	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.80A>G	17.37:g.72324604A>G	ENSP00000374566:p.Glu27Gly	78.0	0.0		49.0	4.0	NM_153209	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	A	16.96	3.265121	0.59431	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.76060	-0.67;-0.99	4.96	4.96	0.65561	Kinesin, motor domain (4);	0.707634	0.11041	U	0.606080	T	0.67002	0.2847	L	0.33189	0.99	0.41417	D	0.987773	B;B;B;B	0.22604	0.056;0.072;0.016;0.016	B;B;B;B	0.27608	0.081;0.066;0.019;0.019	T	0.60234	-0.7303	10	0.38643	T	0.18	.	12.2462	0.54572	1.0:0.0:0.0:0.0	.	27;27;27;27	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	G	27	ENSP00000449134:E27G;ENSP00000374566:E27G	ENSP00000374566:E27G	E	+	2	0	KIF19	69836199	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.295000	0.72744	1.878000	0.54408	0.529000	0.55759	GAG	.		0.617	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209	
KLC2	64837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66031564	66031564	+	Silent	SNP	G	G	T	rs556408432		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:66031564G>T	ENST00000417856.1	+	8	1233	c.990G>T	c.(988-990)ctG>ctT	p.L330L	KLC2_ENST00000394066.2_Silent_p.L253L|KLC2_ENST00000394078.1_Intron|KLC2_ENST00000421552.1_Silent_p.L253L|RP11-755F10.3_ENST00000533576.1_RNA|RP11-867G23.1_ENST00000530805.1_RNA|KLC2_ENST00000316924.5_Silent_p.L330L|KLC2_ENST00000394065.2_Silent_p.L191L|KLC2_ENST00000394067.2_Silent_p.L330L	NM_001134775.1	NP_001128247.1	Q9H0B6	KLC2_HUMAN	kinesin light chain 2	330					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon cargo transport (GO:0008088)|blood coagulation (GO:0007596)|microtubule-based movement (GO:0007018)	ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinesin I complex (GO:0016938)|membrane (GO:0016020)|microtubule (GO:0005874)|neuron projection (GO:0043005)|protein complex (GO:0043234)	kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						TCAGCAACCTGGCCCTGCTGT	0.637																																					p.L330L		.											.	KLC2	90	0			c.G990T						.						27.0	26.0	26.0					11																	66031564		2200	4294	6494	SO:0001819	synonymous_variant	64837	exon8			CAACCTGGCCCTG	AK022449	CCDS8130.1, CCDS44653.1	11q13.1	2013-01-10			ENSG00000174996	ENSG00000174996		"""Tetratricopeptide (TTC) repeat domain containing"""	20716	protein-coding gene	gene with protein product		611729				9624122	Standard	NM_022822		Approved	FLJ12387	uc001ohb.2	Q9H0B6	OTTHUMG00000133757	ENST00000417856.1:c.990G>T	11.37:g.66031564G>T		118.0	0.0		142.0	18.0	NM_022822	A8MXL7|B2RDY4|Q9H9C8|Q9HA20	Silent	SNP	ENST00000417856.1	37	CCDS8130.1																																																																																			.		0.637	KLC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258200.1	NM_022822	
KLF12	11278	hgsc.bcm.edu;bcgsc.ca	37	13	74420058	74420058	+	Silent	SNP	C	C	A	rs200955639		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr13:74420058C>A	ENST00000377669.2	-	3	602	c.576G>T	c.(574-576)tcG>tcT	p.S192S	KLF12_ENST00000377666.4_Silent_p.S192S|KLF12_ENST00000472022.1_5'UTR	NM_007249.4	NP_009180.3	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12	192					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.S192S(1)		central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	16		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		CAACAGGCACCGACTGTACCA	0.488																																					p.S192S		.											.	KLF12	91	1	Substitution - coding silent(1)	lung(1)	c.G576T						.						122.0	101.0	108.0					13																	74420058		2203	4300	6503	SO:0001819	synonymous_variant	11278	exon4			AGGCACCGACTGT	AJ243274	CCDS9449.1	13q22	2013-01-08			ENSG00000118922	ENSG00000118922		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6346	protein-coding gene	gene with protein product	"""KLF12 zinc finger transcriptional repressor"", ""AP-2rep transcription factor"", ""AP-2 repressor"""	607531				10704285	Standard	NM_007249		Approved	AP-2rep, HSPC122, AP2REP	uc001vjf.3	Q9Y4X4	OTTHUMG00000017078	ENST00000377669.2:c.576G>T	13.37:g.74420058C>A		166.0	0.0		137.0	7.0	NM_007249	A8K5T2|L0R3J4|Q5VZM7|Q9UHZ0	Silent	SNP	ENST00000377669.2	37	CCDS9449.1																																																																																			C|0.999;T|0.000		0.488	KLF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045271.2	NM_007249	
KRT16	3868	hgsc.bcm.edu;bcgsc.ca	37	17	39766790	39766790	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:39766790T>C	ENST00000301653.4	-	6	1137	c.1073A>G	c.(1072-1074)gAg>gGg	p.E358G		NM_005557.3	NP_005548.2	P08779	K1C16_HUMAN	keratin 16	358	Coil 2.|Rod.				aging (GO:0007568)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|epidermis development (GO:0008544)|hair cycle (GO:0042633)|intermediate filament cytoskeleton organization (GO:0045104)|negative regulation of cell migration (GO:0030336)	cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		Breast(137;0.000307)				CAGGCTGTTCTCCAGGGATGC	0.557																																					p.E358G		.											.	KRT16	91	0			c.A1073G						.						40.0	40.0	40.0					17																	39766790		2203	4300	6503	SO:0001583	missense	3868	exon6			CTGTTCTCCAGGG	S79867	CCDS11401.1	17q21.2	2013-01-16	2008-08-01		ENSG00000186832	ENSG00000186832		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6423	protein-coding gene	gene with protein product	"""focal non-epidermolytic palmoplantar keratoderma"""	148067				2451124, 16831889	Standard	NM_005557		Approved	NEPPK	uc002hxg.4	P08779	OTTHUMG00000133495	ENST00000301653.4:c.1073A>G	17.37:g.39766790T>C	ENSP00000301653:p.Glu358Gly	98.0	0.0		83.0	4.0	NM_005557	A8K488|P30654|Q16402|Q9UBG8	Missense_Mutation	SNP	ENST00000301653.4	37	CCDS11401.1	.	.	.	.	.	.	.	.	.	.	T	19.95	3.922437	0.73213	.	.	ENSG00000186832	ENST00000301653	D	0.91407	-2.84	4.28	4.28	0.50868	Filament (1);	0.000000	0.51477	D	0.000085	D	0.96658	0.8909	H	0.96111	3.77	0.49051	D	0.999749	D	0.89917	1.0	D	0.97110	1.0	D	0.97760	1.0220	10	0.87932	D	0	.	13.864	0.63576	0.0:0.0:0.0:1.0	.	358	P08779	K1C16_HUMAN	G	358	ENSP00000301653:E358G	ENSP00000301653:E358G	E	-	2	0	KRT16	37020316	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	7.549000	0.82163	1.929000	0.55896	0.379000	0.24179	GAG	.		0.557	KRT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257408.1	NM_005557	
KRTAP10-7	386675	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	46020985	46020985	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr21:46020985C>A	ENST00000380102.2	+	1	489	c.464C>A	c.(463-465)cCc>cAc	p.P155H	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	155	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						ACCTCCTCCCCCTGCCAGCAG	0.592																																					p.P150H		.											.	.	.	0			c.C449A						.						62.0	66.0	65.0					21																	46020985		2196	4293	6489	SO:0001583	missense	386675	exon2			CCTCCCCCTGCCA	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.464C>A	21.37:g.46020985C>A	ENSP00000369445:p.Pro155His	630.0	0.0		437.0	120.0	NM_198689	Q0VDJ8|Q70LJ2	Missense_Mutation	SNP	ENST00000380102.2	37		.	.	.	.	.	.	.	.	.	.	N	0.395	-0.921520	0.02396	.	.	ENSG00000205441	ENST00000380102	T	0.01397	4.94	3.06	-0.735	0.11137	.	.	.	.	.	T	0.04272	0.0118	M	0.90759	3.145	0.09310	N	1	D	0.55605	0.972	P	0.45449	0.481	T	0.28554	-1.0040	9	0.34782	T	0.22	.	11.7141	0.51641	0.0:0.5698:0.4302:0.0	.	150	P60409-2	.	H	155	ENSP00000369445:P155H	ENSP00000369445:P155H	P	+	2	0	KRTAP10-7	44845413	0.000000	0.05858	0.000000	0.03702	0.103000	0.19146	-0.543000	0.06084	-0.048000	0.13401	0.460000	0.39030	CCC	.		0.592	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
LAMB4	22798	hgsc.bcm.edu;bcgsc.ca	37	7	107720067	107720067	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr7:107720067A>G	ENST00000388781.3	-	15	1949	c.1866T>C	c.(1864-1866)atT>atC	p.I622I	LAMB4_ENST00000205386.4_Silent_p.I622I|LAMB4_ENST00000388780.3_Silent_p.I622I|LAMB4_ENST00000418464.1_Silent_p.I622I|LAMB4_ENST00000414450.2_Silent_p.I622I	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	622	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						AGTGAATGGCAATGGTGAAGT	0.463																																					p.I622I		.											.	LAMB4	140	0			c.T1866C						.						93.0	86.0	89.0					7																	107720067		2203	4300	6503	SO:0001819	synonymous_variant	22798	exon15			AATGGCAATGGTG	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.1866T>C	7.37:g.107720067A>G		74.0	0.0		49.0	4.0	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Silent	SNP	ENST00000388781.3	37	CCDS34732.1																																																																																			.		0.463	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
LPAR3	23566	hgsc.bcm.edu;bcgsc.ca	37	1	85331068	85331068	+	Splice_Site	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:85331068C>A	ENST00000440886.1	-	1	774	c.736G>T	c.(736-738)Ggg>Tgg	p.G246W	LPAR3_ENST00000370611.3_Splice_Site_p.G246W|LPAR3_ENST00000491034.1_5'UTR			Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	246					activation of MAPK activity (GO:0000187)|bleb assembly (GO:0032060)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|synaptic transmission (GO:0007268)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|urinary_tract(1)	24						TCTTACCTACCTAAGACAGTC	0.498																																					p.G246W		.											.	LPAR3	502	0			c.G736T						.						54.0	41.0	46.0					1																	85331068		2203	4300	6503	SO:0001630	splice_region_variant	23566	exon2			ACCTACCTAAGAC	AF127138	CCDS700.1	1p22.3	2012-08-08	2008-04-11	2008-04-11	ENSG00000171517	ENSG00000171517		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	14298	protein-coding gene	gene with protein product		605106	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7"""	EDG7		10488122	Standard	NM_012152		Approved	LP-A3, Edg-7, RP4-678I3, HOFNH30, LPA3	uc009wcj.1	Q9UBY5	OTTHUMG00000009925	ENST00000440886.1:c.736+1G>T	1.37:g.85331068C>A		118.0	0.0		71.0	4.0	NM_012152	A0AVA3	Missense_Mutation	SNP	ENST00000440886.1	37	CCDS700.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.142484	0.77888	.	.	ENSG00000171517	ENST00000440886;ENST00000370611	T;T	0.38560	1.13;1.13	5.2	5.2	0.72013	GPCR, rhodopsin-like superfamily (1);	0.110306	0.64402	D	0.000008	T	0.73651	0.3614	H	0.97077	3.935	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	D	0.83863	0.0269	9	.	.	.	.	18.7607	0.91849	0.0:1.0:0.0:0.0	.	246	Q9UBY5	LPAR3_HUMAN	W	246	ENSP00000395389:G246W;ENSP00000359643:G246W	.	G	-	1	0	LPAR3	85103656	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	7.792000	0.85828	2.437000	0.82529	0.650000	0.86243	GGG	.		0.498	LPAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027467.1	NM_012152	Missense_Mutation
LPIN3	64900	hgsc.bcm.edu;bcgsc.ca	37	20	39986061	39986061	+	Silent	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr20:39986061C>A	ENST00000373257.3	+	16	2104	c.2013C>A	c.(2011-2013)atC>atA	p.I671I		NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	671	C-LIP.				fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				ACCAGGGCATCACCAGTCTCT	0.592																																					p.I671I		.											.	LPIN3	93	0			c.C2013A						.						78.0	68.0	71.0					20																	39986061		2203	4300	6503	SO:0001819	synonymous_variant	64900	exon16			GGGCATCACCAGT	AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.2013C>A	20.37:g.39986061C>A		66.0	0.0		65.0	5.0	NM_022896	B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Silent	SNP	ENST00000373257.3	37	CCDS33469.1	.	.	.	.	.	.	.	.	.	.	C	9.152	1.016607	0.19355	.	.	ENSG00000132793	ENST00000445975	.	.	.	5.2	4.24	0.50183	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-12.5033	5.3388	0.15973	0.1626:0.6535:0.0:0.1839	.	.	.	.	X	161	.	.	S	+	2	0	LPIN3	39419475	0.996000	0.38824	1.000000	0.80357	0.893000	0.52053	0.453000	0.21811	1.155000	0.42497	0.563000	0.77884	TCA	.		0.592	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080393.1	NM_022896	
LPO	4025	hgsc.bcm.edu;bcgsc.ca	37	17	56344752	56344752	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:56344752A>G	ENST00000262290.4	+	12	2052	c.1736A>G	c.(1735-1737)cAg>cGg	p.Q579R	LPO_ENST00000543544.1_Missense_Mutation_p.Q520R|LPO_ENST00000421678.2_Missense_Mutation_p.Q496R|LPO_ENST00000582328.1_Missense_Mutation_p.Q496R	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	579					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						TCACAGCCGCAGACACTAGAG	0.547																																					p.Q579R		.											.	LPO	91	0			c.A1736G						.						70.0	64.0	66.0					17																	56344752		2203	4300	6503	SO:0001583	missense	4025	exon12			AGCCGCAGACACT	M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.1736A>G	17.37:g.56344752A>G	ENSP00000262290:p.Gln579Arg	88.0	0.0		62.0	4.0	NM_006151	A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Missense_Mutation	SNP	ENST00000262290.4	37	CCDS32689.1	.	.	.	.	.	.	.	.	.	.	A	0.009	-1.809130	0.00606	.	.	ENSG00000167419	ENST00000262290;ENST00000421678;ENST00000543544;ENST00000389576	T;T;T	0.68903	-0.36;-0.36;-0.36	5.11	4.01	0.46588	.	0.748721	0.13539	N	0.380388	T	0.44008	0.1273	N	0.20610	0.595	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.11329	0.001;0.006	T	0.34576	-0.9823	10	0.02654	T	1	.	6.804	0.23766	0.8069:0.0:0.1931:0.0	.	496;579	E7EMJ3;P22079	.;PERL_HUMAN	R	579;496;520;324	ENSP00000262290:Q579R;ENSP00000400245:Q496R;ENSP00000445344:Q520R	ENSP00000262290:Q579R	Q	+	2	0	LPO	53699751	0.022000	0.18835	0.073000	0.20177	0.076000	0.17211	1.540000	0.36115	0.779000	0.33543	0.455000	0.32223	CAG	.		0.547	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443961.1		
LPP	4026	hgsc.bcm.edu;bcgsc.ca	37	3	188592145	188592145	+	Missense_Mutation	SNP	G	G	T	rs9830664	byFrequency	TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:188592145G>T	ENST00000312675.4	+	11	1963	c.1717G>T	c.(1717-1719)Ggt>Tgt	p.G573C	LPP_ENST00000543006.1_Missense_Mutation_p.G573C	NM_001167672.1|NM_005578.3	NP_001161144.1|NP_005569.1	Q93052	LPP_HUMAN	LIM domain containing preferred translocation partner in lipoma	573	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)		HMGA2/LPP(161)	NS(1)|breast(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		CTAGGATTGCGGTGGTCTCCT	0.488			T	"""HMGA2, MLL, C12orf9"""	"""lipoma, leukemia"""																																p.G573C		.		Dom	yes		3	3q28	4026	LIM domain containing preferred translocation partner in lipoma		"""L, M"""	.	LPP	659	0			c.G1717T						.						187.0	165.0	172.0					3																	188592145		2203	4300	6503	SO:0001583	missense	4026	exon11			GATTGCGGTGGTC	AL833171	CCDS3291.1	3q27-q28	2004-03-02	2002-01-14		ENSG00000145012	ENSG00000145012			6679	protein-coding gene	gene with protein product		600700	"""LIM domain-containing preferred translocation partner in lipoma"""			8812423	Standard	XM_005247453		Approved		uc003frs.2	Q93052	OTTHUMG00000156387	ENST00000312675.4:c.1717G>T	3.37:g.188592145G>T	ENSP00000318089:p.Gly573Cys	67.0	0.0		79.0	4.0	NM_005578	A1L4L6|D3DNV6|Q8NFX5	Missense_Mutation	SNP	ENST00000312675.4	37	CCDS3291.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.149572	0.78001	.	.	ENSG00000145012	ENST00000312675;ENST00000543006	D;D	0.88354	-2.37;-2.37	5.79	5.79	0.91817	Zinc finger, LIM-type (4);	0.045098	0.85682	D	0.000000	D	0.96185	0.8756	M	0.93283	3.4	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.987;0.999	D	0.96557	0.9412	10	0.66056	D	0.02	.	19.0299	0.92952	0.0:0.0:1.0:0.0	.	426;573	B7Z8W0;Q93052	.;LPP_HUMAN	C	573	ENSP00000318089:G573C;ENSP00000438891:G573C	ENSP00000318089:G573C	G	+	1	0	LPP	190074839	1.000000	0.71417	0.996000	0.52242	0.611000	0.37282	9.750000	0.98875	2.736000	0.93811	0.655000	0.94253	GGT	G|0.998;A|0.002		0.488	LPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344030.1	NM_005578	
LRP1	4035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57573622	57573622	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:57573622C>G	ENST00000243077.3	+	30	5490	c.5024C>G	c.(5023-5025)aCa>aGa	p.T1675R		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1675					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CTGTTCTGGACAAGCTATGAC	0.587																																					p.T1675R		.											.	LRP1	596	0			c.C5024G						.						127.0	128.0	127.0					12																	57573622		2203	4300	6503	SO:0001583	missense	4035	exon30			TCTGGACAAGCTA	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.5024C>G	12.37:g.57573622C>G	ENSP00000243077:p.Thr1675Arg	89.0	0.0		72.0	16.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	C	16.08	3.020624	0.54576	.	.	ENSG00000123384	ENST00000243077	D	0.92446	-3.04	4.57	4.57	0.56435	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000002	D	0.96867	0.8977	M	0.93106	3.38	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	D	0.97868	1.0284	10	0.87932	D	0	.	16.2887	0.82737	0.0:1.0:0.0:0.0	.	1675	Q07954	LRP1_HUMAN	R	1675	ENSP00000243077:T1675R	ENSP00000243077:T1675R	T	+	2	0	LRP1	55859889	0.998000	0.40836	0.941000	0.38009	0.983000	0.72400	3.928000	0.56506	2.383000	0.81215	0.655000	0.94253	ACA	.		0.587	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	141773444	141773444	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:141773444C>A	ENST00000389484.3	-	13	2982	c.2011G>T	c.(2011-2013)Gac>Tac	p.D671Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	671					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCCACGCTGTCATCTATTTCA	0.408										TSP Lung(27;0.18)																											p.D671Y	Colon(99;50 2074 2507 20106)	.											.	LRP1B	311	0			c.G2011T						.						156.0	152.0	154.0					2																	141773444		2203	4300	6503	SO:0001583	missense	53353	exon13			CGCTGTCATCTAT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2011G>T	2.37:g.141773444C>A	ENSP00000374135:p.Asp671Tyr	322.0	0.0		238.0	72.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.031998	0.75504	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.90197	-2.63	5.75	5.75	0.90469	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	U	0.000000	D	0.93148	0.7818	L	0.50333	1.59	0.52099	D	0.999946	P	0.50066	0.931	P	0.57152	0.814	D	0.92568	0.6064	10	0.54805	T	0.06	.	20.312	0.98644	0.0:1.0:0.0:0.0	.	671	Q9NZR2	LRP1B_HUMAN	Y	671;609	ENSP00000374135:D671Y	ENSP00000374135:D671Y	D	-	1	0	LRP1B	141489914	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.951000	0.56684	2.866000	0.98385	0.650000	0.86243	GAC	.		0.408	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
LRP1B	53353	hgsc.bcm.edu;bcgsc.ca	37	2	141777526	141777526	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:141777526A>G	ENST00000389484.3	-	12	2906	c.1935T>C	c.(1933-1935)tcT>tcC	p.S645S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	645					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTCTGGGATGAGACATTTCAC	0.373										TSP Lung(27;0.18)																											p.S645S	Colon(99;50 2074 2507 20106)	.											.	LRP1B	311	0			c.T1935C						.						92.0	93.0	93.0					2																	141777526		2203	4300	6503	SO:0001819	synonymous_variant	53353	exon12			GGGATGAGACATT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1935T>C	2.37:g.141777526A>G		100.0	0.0		84.0	5.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	CCDS2182.1																																																																																			.		0.373	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
LRP2	4036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	170044602	170044602	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:170044602T>A	ENST00000263816.3	-	49	9491	c.9206A>T	c.(9205-9207)cAc>cTc	p.H3069L		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3069	LDL-receptor class A 24. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TTCTGGGGTGTGGCACAGGTG	0.512																																					p.H3069L		.											.	LRP2	175	0			c.A9206T						.						162.0	136.0	145.0					2																	170044602		2203	4300	6503	SO:0001583	missense	4036	exon49			GGGGTGTGGCACA		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.9206A>T	2.37:g.170044602T>A	ENSP00000263816:p.His3069Leu	318.0	0.0		196.0	49.0	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	T	3.858	-0.030439	0.07543	.	.	ENSG00000081479	ENST00000263816	D	0.90444	-2.67	5.68	0.456	0.16655	.	0.717713	0.14809	N	0.297148	T	0.80665	0.4666	L	0.37630	1.12	0.09310	N	1	B	0.28552	0.215	B	0.25614	0.062	T	0.65705	-0.6103	10	0.27785	T	0.31	.	1.9714	0.03406	0.1242:0.3487:0.254:0.2731	.	3069	P98164	LRP2_HUMAN	L	3069	ENSP00000263816:H3069L	ENSP00000263816:H3069L	H	-	2	0	LRP2	169752848	0.000000	0.05858	0.143000	0.22291	0.045000	0.14185	-0.678000	0.05209	0.408000	0.25621	0.528000	0.53228	CAC	.		0.512	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
LRP4	4038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	46896443	46896443	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:46896443G>T	ENST00000378623.1	-	28	4379	c.4137C>A	c.(4135-4137)gtC>gtA	p.V1379V	LRP4-AS1_ENST00000531719.1_RNA|LRP4-AS1_ENST00000502049.2_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1379					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		CAGGAACAGGGACATGCACAT	0.527																																					p.V1379V		.											.	LRP4	94	0			c.C4137A						.						163.0	132.0	142.0					11																	46896443		2201	4299	6500	SO:0001819	synonymous_variant	4038	exon28			AACAGGGACATGC	AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.4137C>A	11.37:g.46896443G>T		134.0	0.0		114.0	31.0	NM_002334	B2RN39|Q4AC85|Q5KTZ5	Silent	SNP	ENST00000378623.1	37	CCDS31478.1																																																																																			.		0.527	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334	
LRRC43	254050	hgsc.bcm.edu;bcgsc.ca	37	12	122669301	122669301	+	Missense_Mutation	SNP	G	G	T	rs372181783		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:122669301G>T	ENST00000339777.4	+	2	414	c.386G>T	c.(385-387)cGg>cTg	p.R129L	LRRC43_ENST00000425921.1_5'UTR	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	129										NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		TCCTACTTCCGGTCCCTGCGG	0.562																																					p.R129L		.											.	LRRC43	135	0			c.G386T						.	G	LEU/ARG,	0,3986		0,0,1993	25.0	26.0	26.0		386,	1.3	1.0	12		26	1,8349		0,1,4174	no	missense,utr-5	LRRC43	NM_001098519.1,NM_152759.4	102,	0,1,6167	TT,TG,GG		0.012,0.0,0.0081	possibly-damaging,	129/657,	122669301	1,12335	1993	4175	6168	SO:0001583	missense	254050	exon2			ACTTCCGGTCCCT	AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.386G>T	12.37:g.122669301G>T	ENSP00000344233:p.Arg129Leu	192.0	0.0		144.0	6.0	NM_001098519	Q6ZVT9	Missense_Mutation	SNP	ENST00000339777.4	37	CCDS45001.1	.	.	.	.	.	.	.	.	.	.	G	19.79	3.892321	0.72524	0.0	1.2E-4	ENSG00000158113	ENST00000339777	T	0.58358	0.34	4.9	1.34	0.21922	.	.	.	.	.	T	0.60209	0.2251	M	0.62723	1.935	0.39919	D	0.974138	D	0.65815	0.995	P	0.60682	0.878	T	0.62779	-0.6782	9	0.66056	D	0.02	-19.8237	6.3874	0.21568	0.2552:0.1498:0.595:0.0	.	129	Q8N309	LRC43_HUMAN	L	129	ENSP00000344233:R129L	ENSP00000344233:R129L	R	+	2	0	LRRC43	121235254	0.937000	0.31787	0.983000	0.44433	0.867000	0.49689	0.382000	0.20635	1.069000	0.40788	0.462000	0.41574	CGG	.		0.562	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401589.1	NM_152759	
LSS	4047	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	21	47616149	47616149	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr21:47616149C>A	ENST00000397728.3	-	18	1781	c.1703G>T	c.(1702-1704)cGg>cTg	p.R568L	LSS_ENST00000457828.2_Missense_Mutation_p.R488L|AP001468.1_ENST00000594486.1_5'Flank|LSS_ENST00000356396.4_Missense_Mutation_p.R568L|LSS_ENST00000522411.1_Missense_Mutation_p.R557L	NM_001145436.1|NM_002340.5	NP_001138908.1|NP_002331.3	P48449	ERG7_HUMAN	lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)	568					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|lipid particle (GO:0005811)|membrane (GO:0016020)	lanosterol synthase activity (GO:0000250)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	21	Breast(49;0.214)					CTGCTGCCGCCGACAGAACTC	0.557																																					p.R568L	Pancreas(114;955 2313 34923 50507)	.											.	LSS	90	0			c.G1703T						.						70.0	67.0	68.0					21																	47616149		2203	4300	6503	SO:0001583	missense	4047	exon18			TGCCGCCGACAGA	U22526	CCDS13733.1, CCDS46654.1, CCDS54489.1	21q22.3	1998-05-07			ENSG00000160285	ENSG00000160285	5.4.99.7		6708	protein-coding gene	gene with protein product		600909				7639730, 8655142	Standard	NM_001001438		Approved	OSC	uc002zij.3	P48449	OTTHUMG00000090633	ENST00000397728.3:c.1703G>T	21.37:g.47616149C>A	ENSP00000380837:p.Arg568Leu	72.0	0.0		41.0	4.0	NM_001001438	B4DJZ9|D3DSN0|E9PEI9|G5E9Q9|Q8IYL6|Q9UEZ1	Missense_Mutation	SNP	ENST00000397728.3	37	CCDS13733.1	.	.	.	.	.	.	.	.	.	.	C	14.06	2.422737	0.43020	.	.	ENSG00000160285	ENST00000356396;ENST00000457828;ENST00000397728;ENST00000522411	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	5.4	3.52	0.40303	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.246093	0.39407	N	0.001376	T	0.12008	0.0292	N	0.26092	0.79	0.53688	D	0.999974	B;B	0.14438	0.008;0.01	B;B	0.14578	0.004;0.011	T	0.07328	-1.0778	10	0.44086	T	0.13	.	10.0437	0.42173	0.1371:0.7901:0.0:0.0728	.	557;568	E9PEI9;P48449	.;ERG7_HUMAN	L	568;488;568;557	ENSP00000348762:R568L;ENSP00000409191:R488L;ENSP00000380837:R568L;ENSP00000429133:R557L	ENSP00000348762:R568L	R	-	2	0	LSS	46440577	0.662000	0.27439	0.705000	0.30386	0.276000	0.26787	1.324000	0.33712	1.284000	0.44531	0.462000	0.41574	CGG	.		0.557	LSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207274.2		
LUZP2	338645	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	24759781	24759781	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:24759781C>G	ENST00000336930.6	+	4	332	c.266C>G	c.(265-267)tCt>tGt	p.S89C	LUZP2_ENST00000531187.1_3'UTR|LUZP2_ENST00000533227.1_Missense_Mutation_p.S3C			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	89						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						GAAATGAAGTCTCTTCAGGAG	0.358																																					p.S89C		.											.	LUZP2	92	0			c.C266G						.						66.0	69.0	68.0					11																	24759781		2203	4300	6503	SO:0001583	missense	338645	exon4			TGAAGTCTCTTCA	AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.266C>G	11.37:g.24759781C>G	ENSP00000336817:p.Ser89Cys	251.0	1.0		183.0	55.0	NM_001252010	A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Missense_Mutation	SNP	ENST00000336930.6	37	CCDS31446.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072033	0.76415	.	.	ENSG00000187398	ENST00000336930;ENST00000529015;ENST00000533227	T;T;T	0.25749	1.78;1.78;1.78	5.76	5.76	0.90799	.	0.200304	0.43416	D	0.000574	T	0.47710	0.1460	L	0.60455	1.87	0.41438	D	0.987905	D;D	0.89917	1.0;0.999	D;D	0.66351	0.943;0.943	T	0.41034	-0.9531	10	0.72032	D	0.01	-6.6251	17.4398	0.87562	0.0:1.0:0.0:0.0	.	3;89	E9PN53;Q86TE4	.;LUZP2_HUMAN	C	89;89;3	ENSP00000336817:S89C;ENSP00000437032:S89C;ENSP00000432952:S3C	ENSP00000336817:S89C	S	+	2	0	LUZP2	24716357	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.098000	0.71458	2.721000	0.93114	0.650000	0.86243	TCT	.		0.358	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387861.1	NM_001009909	
LYG2	254773	hgsc.bcm.edu;bcgsc.ca	37	2	99870712	99870712	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:99870712G>T	ENST00000409238.1	-	1	32	c.12C>A	c.(10-12)tcC>tcA	p.S4S	LYG2_ENST00000409679.1_Silent_p.S4S|LYG2_ENST00000333017.2_Silent_p.S4S|LYG2_ENST00000423800.1_Silent_p.S4S			Q86SG7	LYG2_HUMAN	lysozyme G-like 2	4					cell wall macromolecule catabolic process (GO:0016998)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)|stomach(1)	12						AAAACACCACGGAGGATAACA	0.398																																					p.S4S		.											.	LYG2	91	0			c.C12A						.						119.0	109.0	112.0					2																	99870712		2203	4300	6503	SO:0001819	synonymous_variant	254773	exon2			CACCACGGAGGAT	AF323919	CCDS2042.1	2q11.2	2008-02-05			ENSG00000185674	ENSG00000185674			29615	protein-coding gene	gene with protein product						8889548, 12574869	Standard	NM_175735		Approved	LYGH	uc002szw.1	Q86SG7	OTTHUMG00000130643	ENST00000409238.1:c.12C>A	2.37:g.99870712G>T		73.0	0.0		57.0	5.0	NM_175735	Q496G2|Q53RW0	Silent	SNP	ENST00000409238.1	37	CCDS2042.1																																																																																			.		0.398	LYG2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330307.1	NM_175735	
MAT1A	4143	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	82039957	82039957	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr10:82039957G>T	ENST00000372213.3	-	5	781	c.521C>A	c.(520-522)cCc>cAc	p.P174H		NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	174					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	CCGCAGCCAGGGGAGGAGGCC	0.567																																					p.P174H		.											.	MAT1A	90	0			c.C521A						.						67.0	76.0	73.0					10																	82039957		2203	4300	6503	SO:0001583	missense	4143	exon5			AGCCAGGGGAGGA		CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.521C>A	10.37:g.82039957G>T	ENSP00000361287:p.Pro174His	100.0	0.0		70.0	19.0	NM_000429	D3DWD5|Q5QP09	Missense_Mutation	SNP	ENST00000372213.3	37	CCDS7365.1	.	.	.	.	.	.	.	.	.	.	G	18.96	3.732975	0.69189	.	.	ENSG00000151224	ENST00000372213;ENST00000372206;ENST00000455001	D;D	0.83250	-1.7;-1.7	4.91	4.91	0.64330	S-adenosylmethionine synthetase, central domain (1);S-adenosylmethionine synthetase superfamily (1);	0.000000	0.85682	D	0.000000	D	0.89866	0.6839	M	0.88512	2.96	0.80722	D	1	P	0.52692	0.955	P	0.52909	0.713	D	0.92061	0.5656	10	0.87932	D	0	-27.5525	15.935	0.79694	0.0:0.0:1.0:0.0	.	174	Q00266	METK1_HUMAN	H	174;174;111	ENSP00000361287:P174H;ENSP00000414961:P111H	ENSP00000361280:P174H	P	-	2	0	MAT1A	82029937	1.000000	0.71417	0.997000	0.53966	0.655000	0.38815	7.528000	0.81941	2.442000	0.82660	0.655000	0.94253	CCC	.		0.567	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049070.1	NM_000429	
MBD1	4152	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	47803368	47803368	+	Splice_Site	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr18:47803368C>A	ENST00000591416.1	-	4	657	c.226G>T	c.(226-228)Gcc>Tcc	p.A76S	MBD1_ENST00000585595.1_Splice_Site_p.A76S|MBD1_ENST00000457839.2_Splice_Site_p.A76S|MBD1_ENST00000591535.1_Splice_Site_p.A76S|MBD1_ENST00000349085.2_Splice_Site_p.A76S|MBD1_ENST00000347968.3_Splice_Site_p.A76S|MBD1_ENST00000269471.5_Splice_Site_p.A76S|MBD1_ENST00000424334.2_Splice_Site_p.A102S|MBD1_ENST00000398488.1_Splice_Site_p.A76S|MBD1_ENST00000585672.1_Splice_Site_p.A76S|MBD1_ENST00000398495.2_Splice_Site_p.A76S|MBD1_ENST00000590208.1_Splice_Site_p.A76S|MBD1_ENST00000353909.3_Splice_Site_p.A76S|MBD1_ENST00000269468.5_Splice_Site_p.A76S|MBD1_ENST00000436910.1_Splice_Site_p.A76S|MBD1_ENST00000588937.1_Splice_Site_p.A76S|MBD1_ENST00000398493.1_Splice_Site_p.A76S|MBD1_ENST00000382948.5_Splice_Site_p.A76S|MBD1_ENST00000587605.1_Splice_Site_p.A76S|MBD1_ENST00000339998.6_Splice_Site_p.A76S			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	76					negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						ACGGGATGGGCCTGGAAAGTA	0.562																																					p.A76S		.											.	MBD1	228	0			c.G226T						.						72.0	70.0	71.0					18																	47803368		2203	4300	6503	SO:0001630	splice_region_variant	4152	exon4			GATGGGCCTGGAA	Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.226-1G>T	18.37:g.47803368C>A		166.0	0.0		131.0	28.0	NM_001204137	A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Missense_Mutation	SNP	ENST00000591416.1	37	CCDS11943.1	.	.	.	.	.	.	.	.	.	.	C	4.883	0.164057	0.09287	.	.	ENSG00000141644	ENST00000382948;ENST00000353909;ENST00000349085;ENST00000269468;ENST00000347968;ENST00000436910;ENST00000269471;ENST00000424334;ENST00000339998;ENST00000398495;ENST00000457839;ENST00000398493;ENST00000398488	D;D;D;D;D;D;D;D;D;D;D;D;D	0.95342	-3.67;-3.68;-3.66;-3.67;-3.66;-3.65;-3.66;-3.67;-3.67;-3.65;-3.66;-3.66;-3.66	5.07	1.25	0.21368	Methyl-CpG DNA binding (2);DNA-binding, integrase-type (1);	0.428457	0.21979	N	0.066329	D	0.89856	0.6836	L	0.50333	1.59	0.20196	N	0.999929	P;B;B;B;B;P;B;B;B;B;B	0.41475	0.751;0.44;0.348;0.036;0.123;0.459;0.147;0.037;0.036;0.056;0.036	B;B;B;B;B;B;B;B;B;B;B	0.40982	0.345;0.243;0.157;0.174;0.167;0.178;0.108;0.028;0.174;0.029;0.174	T	0.80251	-0.1460	10	0.16420	T	0.52	-1.0173	7.155	0.25632	0.0:0.6111:0.0:0.3889	.	76;102;76;76;76;76;76;76;76;76;76	B4DUR3;B4DI41;Q9UIS9-8;A8K654;Q9UIS9-6;Q9UIS9-2;Q9UIS9-5;Q9UIS9-4;Q9UIS9;Q9UIS9-7;B4DXJ5	.;.;.;.;.;.;.;.;MBD1_HUMAN;.;.	S	76;76;76;76;76;76;76;102;76;76;76;76;76	ENSP00000372407:A76S;ENSP00000269469:A76S;ENSP00000342531:A76S;ENSP00000269468:A76S;ENSP00000285102:A76S;ENSP00000409561:A76S;ENSP00000269471:A76S;ENSP00000408846:A102S;ENSP00000339546:A76S;ENSP00000381508:A76S;ENSP00000405268:A76S;ENSP00000381506:A76S;ENSP00000381502:A76S	ENSP00000269468:A76S	A	-	1	0	MBD1	46057366	0.744000	0.28250	0.253000	0.24343	0.049000	0.14656	-0.182000	0.09726	0.094000	0.17404	-0.140000	0.14226	GCC	.		0.562	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255926.3	NM_015846	Missense_Mutation
MCM3AP	8888	hgsc.bcm.edu;bcgsc.ca	37	21	47680812	47680812	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr21:47680812T>C	ENST00000397708.1	-	16	3730	c.3476A>G	c.(3475-3477)cAa>cGa	p.Q1159R	MCM3AP_ENST00000291688.1_Missense_Mutation_p.Q1159R|MCM3AP_ENST00000467026.1_5'Flank|MCM3AP-AS1_ENST00000590829.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1159					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					CTCTCTCTCTTGTTTCAACCT	0.483																																					p.Q1159R		.											.	MCM3AP	291	0			c.A3476G						.						94.0	88.0	90.0					21																	47680812		2203	4300	6503	SO:0001583	missense	8888	exon15			CTCTCTTGTTTCA	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.3476A>G	21.37:g.47680812T>C	ENSP00000380820:p.Gln1159Arg	122.0	0.0		54.0	4.0	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	T	6.224	0.409415	0.11812	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	D;D	0.84660	-1.88;-1.88	5.35	1.36	0.22044	.	0.058491	0.64402	D	0.000001	T	0.71341	0.3328	L	0.29908	0.895	0.33099	D	0.538958	B	0.06786	0.001	B	0.04013	0.001	T	0.64415	-0.6413	10	0.26408	T	0.33	-12.0821	5.4631	0.16627	0.1285:0.1491:0.0:0.7224	.	1159	O60318	MCM3A_HUMAN	R	1159	ENSP00000380820:Q1159R;ENSP00000291688:Q1159R	ENSP00000291688:Q1159R	Q	-	2	0	MCM3AP	46505240	0.659000	0.27411	0.998000	0.56505	0.212000	0.24457	0.104000	0.15313	0.869000	0.35703	-0.376000	0.06991	CAA	.		0.483	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
MCM8	84515	broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	5974231	5974231	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr20:5974231T>C	ENST00000378896.3	+	18	2697	c.2320T>C	c.(2320-2322)Tca>Cca	p.S774P	MCM8_ENST00000265187.4_Missense_Mutation_p.S758P|MCM8_ENST00000378886.2_Missense_Mutation_p.S814P|MCM8_ENST00000378883.1_Missense_Mutation_p.S727P	NM_001281520.1|NM_032485.4|NM_182802.1	NP_001268449.1|NP_115874.3|NP_877954.1	Q9UJA3	MCM8_HUMAN	minichromosome maintenance complex component 8	774					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)|G1/S transition of mitotic cell cycle (GO:0000082)|male gamete generation (GO:0048232)|mitotic cell cycle (GO:0000278)	MCM8-MCM9 complex (GO:0097362)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	23						GAGCAACAGGTCAACAGCGAA	0.368																																					p.S774P		.											.	MCM8	227	0			c.T2320C						.						72.0	76.0	75.0					20																	5974231		2203	4300	6503	SO:0001583	missense	84515	exon18			AACAGGTCAACAG	AJ439063	CCDS13094.1, CCDS13095.1, CCDS63226.1, CCDS63227.1	20p12.3	2007-04-04	2007-04-04	2003-07-09	ENSG00000125885	ENSG00000125885			16147	protein-coding gene	gene with protein product	"""REC homolog (Drosophila)"""	608187	"""chromosome 20 open reading frame 154"""	C20orf154		12527764	Standard	NM_032485		Approved	MGC4816, MGC12866, MGC119522, MGC119523, dJ967N21.5, REC	uc002wmi.3	Q9UJA3	OTTHUMG00000031822	ENST00000378896.3:c.2320T>C	20.37:g.5974231T>C	ENSP00000368174:p.Ser774Pro	111.0	1.0		88.0	8.0	NM_032485	B2RBG7|D3DW08|E7EQU7|Q495R4|Q495R6|Q495R7|Q86US4|Q969I5	Missense_Mutation	SNP	ENST00000378896.3	37	CCDS13094.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.027165	0.75390	.	.	ENSG00000125885	ENST00000378896;ENST00000378883;ENST00000378886;ENST00000265187	T;T;T;T	0.03152	4.09;4.03;4.12;4.1	5.82	5.82	0.92795	.	0.133108	0.53938	D	0.000053	T	0.16896	0.0406	M	0.72894	2.215	0.58432	D	0.999997	D;D;D;D	0.71674	0.998;0.994;0.993;0.994	D;D;D;P	0.69479	0.964;0.921;0.964;0.885	T	0.00145	-1.1993	10	0.49607	T	0.09	-14.4236	16.1917	0.81992	0.0:0.0:0.0:1.0	.	727;814;758;774	Q9UJA3-2;E7EQU7;Q9UJA3-3;Q9UJA3	.;.;.;MCM8_HUMAN	P	774;727;814;758	ENSP00000368174:S774P;ENSP00000368161:S727P;ENSP00000368164:S814P;ENSP00000265187:S758P	ENSP00000265187:S758P	S	+	1	0	MCM8	5922231	1.000000	0.71417	0.997000	0.53966	0.913000	0.54294	5.851000	0.69481	2.216000	0.71823	0.533000	0.62120	TCA	.		0.368	MCM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077900.1	NM_032485	
MGAT1	4245	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	180219412	180219412	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr5:180219412C>A	ENST00000446023.2	-	3	1310	c.560G>T	c.(559-561)cGc>cTc	p.R187L	MGAT1_ENST00000427865.2_Missense_Mutation_p.R187L|MGAT1_ENST00000333055.3_Missense_Mutation_p.R187L|MGAT1_ENST00000307826.4_Missense_Mutation_p.R187L|MGAT1_ENST00000393340.3_Missense_Mutation_p.R187L	NM_001114617.1|NM_001114618.1	NP_001108089.1|NP_001108090.1	P26572	MGAT1_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase	187					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine catabolic process (GO:0006049)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	acetylglucosaminyltransferase activity (GO:0008375)|alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity (GO:0003827)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	13	all_cancers(89;1.11e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00356)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCGGTAGTGGCGCGCGATCTT	0.682																																					p.R187L		.											MGAT1,NS,carcinoma,-1	MGAT1	91	0			c.G560T						.						39.0	46.0	44.0					5																	180219412		2201	4296	6497	SO:0001583	missense	4245	exon3			TAGTGGCGCGCGA	M61829	CCDS4458.1	5q35.3	2013-02-25			ENSG00000131446	ENSG00000131446	2.4.1.101	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7044	protein-coding gene	gene with protein product		160995		MGAT, GLYT1		1827260	Standard	NM_002406		Approved	GNT-1, GLCNAC-TI	uc003mmg.4	P26572	OTTHUMG00000130937	ENST00000446023.2:c.560G>T	5.37:g.180219412C>A	ENSP00000404718:p.Arg187Leu	110.0	0.0		91.0	30.0	NM_001114617	A8K404|B3KRU8|D3DWR1|Q6IBE3	Missense_Mutation	SNP	ENST00000446023.2	37	CCDS4458.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.640519	0.87859	.	.	ENSG00000131446	ENST00000333055;ENST00000307826;ENST00000446023;ENST00000393340;ENST00000427865;ENST00000504671	D;D;D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4;-2.4;-2.4	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	D	0.94182	0.8133	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.94464	0.7679	10	0.87932	D	0	-28.1319	16.3966	0.83607	0.0:1.0:0.0:0.0	.	187	P26572	MGAT1_HUMAN	L	187	ENSP00000332073:R187L;ENSP00000311888:R187L;ENSP00000404718:R187L;ENSP00000377010:R187L;ENSP00000402838:R187L;ENSP00000424891:R187L	ENSP00000311888:R187L	R	-	2	0	MGAT1	180152018	0.815000	0.29118	0.614000	0.29051	0.849000	0.48306	6.801000	0.75170	2.811000	0.96726	0.655000	0.94253	CGC	.		0.682	MGAT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368189.1	NM_001114618	
KMT2A	4297	hgsc.bcm.edu;bcgsc.ca	37	11	118377325	118377325	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:118377325C>T	ENST00000389506.5	+	27	10709	c.10709C>T	c.(10708-10710)cCa>cTa	p.P3570L	KMT2A_ENST00000354520.4_Missense_Mutation_p.P3532L|KMT2A_ENST00000534358.1_Missense_Mutation_p.P3573L			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3570					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										GCACACATTCCAGACCAAGAA	0.473																																					p.P3573L		.											.	MLL	1255	0			c.C10718T						.						96.0	93.0	94.0					11																	118377325		2200	4295	6495	SO:0001583	missense	4297	exon27			ACATTCCAGACCA	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.10709C>T	11.37:g.118377325C>T	ENSP00000374157:p.Pro3570Leu	104.0	0.0		51.0	4.0	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	C	16.02	3.004395	0.54254	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.82167	-1.58;-1.58;-1.54	5.85	5.85	0.93711	.	0.117165	0.64402	D	0.000011	D	0.84777	0.5547	L	0.36672	1.1	0.54753	D	0.999987	D;D	0.63880	0.993;0.993	P;P	0.53954	0.738;0.738	D	0.83952	0.0317	10	0.44086	T	0.13	.	20.1663	0.98152	0.0:1.0:0.0:0.0	.	3573;3570	E9PQG7;Q03164	.;MLL1_HUMAN	L	3573;3570;3532;2480	ENSP00000436786:P3573L;ENSP00000374157:P3570L;ENSP00000346516:P3532L	ENSP00000346516:P3532L	P	+	2	0	MLL	117882535	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.231000	0.51294	2.773000	0.95371	0.585000	0.79938	CCA	.		0.473	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
MLLT1	4298	hgsc.bcm.edu;bcgsc.ca	37	19	6222582	6222582	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:6222582A>G	ENST00000252674.7	-	6	823	c.660T>C	c.(658-660)cgT>cgC	p.R220R		NM_005934.3	NP_005925.2	Q03111	ENL_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1	220					negative regulation of protein kinase activity (GO:0006469)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)			endometrium(3)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|skin(2)	17						TGGCCTGCTCACGCTCCAGCT	0.647			T	MLL	AL																																p.R220R		.		Dom	yes		19	19p13.3	4298	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 (ENL)"""		L	.	MLLT1	658	0			c.T660C						.						42.0	39.0	40.0					19																	6222582		2203	4300	6503	SO:0001819	synonymous_variant	4298	exon6			CTGCTCACGCTCC		CCDS12160.1	19p13.3	2012-10-04	2001-11-28		ENSG00000130382	ENSG00000130382			7134	protein-coding gene	gene with protein product		159556	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 1"""				Standard	XM_005259561		Approved	ENL, LTG19, YEATS1	uc002mek.3	Q03111	OTTHUMG00000180757	ENST00000252674.7:c.660T>C	19.37:g.6222582A>G		58.0	0.0		71.0	5.0	NM_005934	Q14768	Silent	SNP	ENST00000252674.7	37	CCDS12160.1																																																																																			.		0.647	MLLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452909.1	NM_005934	
KMT2B	9757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36229093	36229093	+	Splice_Site	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:36229093G>T	ENST00000222270.7	+	36	7872		c.e36+1		IGFLR1_ENST00000587101.1_5'Flank|KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Splice_Site	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B						chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CGATGGGAAGGTGGGCTCCCA	0.607																																					.		.											.	MLL4	697	0			c.7872+1G>T						.						55.0	61.0	59.0					19																	36229093		2090	4240	6330	SO:0001630	splice_region_variant	8085	exon36			GGGAAGGTGGGCT	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.7872+1G>T	19.37:g.36229093G>T		123.0	0.0		46.0	16.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Splice_Site	SNP	ENST00000222270.7	37	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812288	0.70912	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6212	0.84931	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AD000671.1	40920933	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.210000	0.65214	2.467000	0.83353	0.462000	0.41574	.	.		0.607	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	Intron
MOCOS	55034	hgsc.bcm.edu;bcgsc.ca	37	18	33775243	33775243	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr18:33775243G>T	ENST00000261326.5	+	2	187	c.166G>T	c.(166-168)Ggt>Tgt	p.G56C		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TGACCATGCAGGTGCCACCTT	0.388																																					p.G56C		.											.	MOCOS	91	0			c.G166T						.						149.0	152.0	151.0					18																	33775243		2203	4300	6503	SO:0001583	missense	55034	exon2			CATGCAGGTGCCA	AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.166G>T	18.37:g.33775243G>T	ENSP00000261326:p.Gly56Cys	92.0	0.0		99.0	4.0	NM_017947		Missense_Mutation	SNP	ENST00000261326.5	37	CCDS11919.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.457306	0.84317	.	.	ENSG00000075643	ENST00000261326	D	0.88818	-2.43	5.41	5.41	0.78517	Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.068985	0.64402	D	0.000014	D	0.96071	0.8720	H	0.95079	3.62	0.52501	D	0.999959	D	0.89917	1.0	D	0.97110	1.0	D	0.97014	0.9738	10	0.87932	D	0	-12.8987	14.718	0.69284	0.0:0.0:1.0:0.0	.	56	Q96EN8	MOCOS_HUMAN	C	56	ENSP00000261326:G56C	ENSP00000261326:G56C	G	+	1	0	MOCOS	32029241	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.116000	0.77119	2.538000	0.85594	0.563000	0.77884	GGT	.		0.388	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1		
MRPS5	64969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	95756225	95756225	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:95756225C>T	ENST00000272418.2	-	11	1182	c.974G>A	c.(973-975)cGg>cAg	p.R325Q		NM_031902.3	NP_114108.1	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	325					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						GCCAATGAGCCGGCAGATGGT	0.572																																					p.R325Q		.											.	MRPS5	92	0			c.G974A						.						99.0	100.0	100.0					2																	95756225		2203	4300	6503	SO:0001583	missense	64969	exon11			ATGAGCCGGCAGA	AB049940	CCDS2010.1	2p11.2-q11.2	2012-09-13			ENSG00000144029	ENSG00000144029		"""Mitochondrial ribosomal proteins / small subunits"""	14498	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S5"""	611972					Standard	NM_031902		Approved	MRP-S5, S5mt	uc002sub.3	P82675	OTTHUMG00000130394	ENST00000272418.2:c.974G>A	2.37:g.95756225C>T	ENSP00000272418:p.Arg325Gln	122.0	0.0		87.0	24.0	NM_031902	Q4ZFY5|Q96LJ6|Q9BWI4|Q9BYC4	Missense_Mutation	SNP	ENST00000272418.2	37	CCDS2010.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.652325	0.47362	.	.	ENSG00000144029	ENST00000272418	.	.	.	5.09	4.0	0.46444	Ribosomal protein S5 domain 2-type fold (1);Ribosomal protein S5, C-terminal (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.122060	0.51477	D	0.000094	T	0.26521	0.0648	N	0.25144	0.715	0.26531	N	0.974258	B	0.20261	0.043	B	0.15484	0.013	T	0.11203	-1.0597	9	0.52906	T	0.07	-10.0992	7.817	0.29265	0.0:0.8007:0.0:0.1993	.	325	P82675	RT05_HUMAN	Q	325	.	ENSP00000272418:R325Q	R	-	2	0	MRPS5	95119952	0.993000	0.37304	1.000000	0.80357	0.998000	0.95712	2.213000	0.42844	2.360000	0.80028	0.591000	0.81541	CGG	.		0.572	MRPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252772.1	NM_031902	
MRVI1	10335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	10603489	10603489	+	Missense_Mutation	SNP	G	G	A	rs199557491	byFrequency	TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:10603489G>A	ENST00000436272.1	-	18	2282	c.2204C>T	c.(2203-2205)gCg>gTg	p.A735V	LYVE1_ENST00000531706.1_Intron|MRVI1_ENST00000552103.1_Missense_Mutation_p.A671V|MRVI1_ENST00000423302.2_Missense_Mutation_p.A762V|MRVI1_ENST00000527509.2_Missense_Mutation_p.A671V|MRVI1_ENST00000547195.1_Missense_Mutation_p.A671V|MRVI1_ENST00000545852.1_Missense_Mutation_p.A447V|MRVI1_ENST00000531107.1_Missense_Mutation_p.A754V|MRVI1_ENST00000558540.1_Missense_Mutation_p.A447V|MRVI1-AS1_ENST00000529829.1_RNA|MRVI1_ENST00000424001.1_Missense_Mutation_p.A447V|MRVI1-AS1_ENST00000529979.1_RNA|MRVI1_ENST00000534266.2_Missense_Mutation_p.A447V|MRVI1_ENST00000541483.1_Missense_Mutation_p.A556V|MRVI1_ENST00000421747.1_Missense_Mutation_p.A753V			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	735					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		CAGGGTCAGCGCAGGAGCAGA	0.542													G|||	2	0.000399361	0.0	0.0	5008	,	,		17914	0.0		0.002	False		,,,				2504	0.0				p.A762V		.											.	MRVI1	25	0			c.C2285T						.	G	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	1,4069		0,1,2034	101.0	106.0	104.0		2261,2012,1340,1667,1340,2285	-7.9	0.0	11		104	11,8395		0,11,4192	yes	missense,missense,missense,missense,missense,missense	MRVI1	NM_001098579.2,NM_001100163.2,NM_001100167.2,NM_001206880.1,NM_001206881.1,NM_130385.3	64,64,64,64,64,64	0,12,6226	AA,AG,GG		0.1309,0.0246,0.0962	benign,benign,benign,benign,benign,benign	754/905,671/822,447/598,556/707,447/598,762/913	10603489	12,12464	2035	4203	6238	SO:0001583	missense	10335	exon19			GTCAGCGCAGGAG	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.2204C>T	11.37:g.10603489G>A	ENSP00000412229:p.Ala735Val	126.0	0.0		76.0	33.0	NM_130385	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	ENST00000436272.1	37		2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	g	0.009	-1.836952	0.00579	2.46E-4	0.001309	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000545852;ENST00000424001;ENST00000423302;ENST00000541483;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T;T;T;T	0.11930	2.73;2.73;2.73;2.73;2.73;2.73;2.73;2.73;2.73;2.73	5.24	-7.9	0.01169	.	2.385750	0.01550	N	0.019622	T	0.04770	0.0129	N	0.04508	-0.205	0.09310	N	1	B;B;B;B	0.10296	0.003;0.001;0.001;0.0	B;B;B;B	0.06405	0.002;0.001;0.001;0.001	T	0.40194	-0.9576	10	0.02654	T	1	5.8926	9.0746	0.36513	0.4392:0.1759:0.3849:0.0	.	556;735;754;753	F5H6A1;Q9Y6F6;E9PQY6;Q9Y6F6-4	.;MRVI1_HUMAN;.;.	V	753;736;735;671;671;447;447;762;556;754;671	ENSP00000414598:A753V;ENSP00000412229:A735V;ENSP00000448278:A671V;ENSP00000446764:A671V;ENSP00000441971:A447V;ENSP00000401205:A447V;ENSP00000412130:A762V;ENSP00000437784:A556V;ENSP00000432436:A754V;ENSP00000432067:A671V	ENSP00000307885:A736V	A	-	2	0	MRVI1	10560065	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.273000	0.08548	-1.440000	0.01960	-1.824000	0.00597	GCG	G|0.999;A|0.001		0.542	MRVI1-203	KNOWN	basic	protein_coding	protein_coding		NM_001098579	
MS4A13	503497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	60292725	60292725	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:60292725A>T	ENST00000378186.2	+	5	555	c.232A>T	c.(232-234)Att>Ttt	p.I78F	MS4A13_ENST00000437058.2_Intron|MS4A13_ENST00000378185.2_Intron|MS4A13_ENST00000527948.1_Intron	NM_001012417.2	NP_001012417.2	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 13	122						integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(1)|lung(2)|skin(2)	8						AATTACTACAATTACTGCAGT	0.303																																					p.I78F		.											.	MS4A13	90	0			c.A232T						.						41.0	43.0	42.0					11																	60292725		2197	4274	6471	SO:0001583	missense	503497	exon5			ACTACAATTACTG	AY324188	CCDS31571.1, CCDS41653.1, CCDS60801.1	11q12.2	2005-12-05	2005-12-05		ENSG00000204979	ENSG00000204979			16674	protein-coding gene	gene with protein product							Standard	NM_001012417		Approved		uc001nps.3	Q5J8X5	OTTHUMG00000167615	ENST00000378186.2:c.232A>T	11.37:g.60292725A>T	ENSP00000367428:p.Ile78Phe	408.0	0.0		373.0	126.0	NM_001012417	E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	ENST00000378186.2	37	CCDS31571.1	.	.	.	.	.	.	.	.	.	.	A	14.62	2.588705	0.46110	.	.	ENSG00000204979	ENST00000378186	T	0.02525	4.26	4.55	-5.16	0.02857	.	0.554719	0.14962	N	0.288332	T	0.02083	0.0065	L	0.43757	1.38	0.09310	N	1	B	0.18863	0.031	B	0.20767	0.031	T	0.41858	-0.9485	10	0.27785	T	0.31	-10.0673	3.3356	0.07100	0.2504:0.1477:0.4578:0.1441	.	78	Q5J8X5	M4A13_HUMAN	F	78	ENSP00000367428:I78F	ENSP00000367428:I78F	I	+	1	0	MS4A13	60049301	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.314000	0.01125	-0.906000	0.03866	0.477000	0.44152	ATT	.		0.303	MS4A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395408.1	NM_001012417	
MYH14	79784	hgsc.bcm.edu;bcgsc.ca	37	19	50792838	50792838	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:50792838A>G	ENST00000596571.1	+	32	4775	c.4775A>G	c.(4774-4776)cAg>cGg	p.Q1592R	MYH14_ENST00000440075.2_Missense_Mutation_p.Q1633R|MYH14_ENST00000262269.8_Missense_Mutation_p.Q1633R|MYH14_ENST00000425460.1_Missense_Mutation_p.Q1600R|MYH14_ENST00000376970.2_Missense_Mutation_p.Q1625R|MYH14_ENST00000601313.1_Missense_Mutation_p.Q1633R|MYH14_ENST00000598205.1_Missense_Mutation_p.Q1600R			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1592					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		CTCAAGACTCAGCATGAGCGT	0.597																																					p.Q1633R		.											.	MYH14	23	0			c.A4898G						.						49.0	60.0	56.0					19																	50792838		2194	4294	6488	SO:0001583	missense	79784	exon35			AGACTCAGCATGA	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.4775A>G	19.37:g.50792838A>G	ENSP00000472819:p.Gln1592Arg	82.0	0.0		70.0	4.0	NM_001145809	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.070818	0.76301	.	.	ENSG00000105357	ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18	3.95	3.95	0.45737	Myosin tail (1);	.	.	.	.	D	0.85217	0.5646	M	0.67625	2.065	0.47374	D	0.999401	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.86385	0.1732	9	0.87932	D	0	.	11.0935	0.48130	1.0:0.0:0.0:0.0	.	1633;1592;1600	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	R	1633;1625;1600;1376;1633	ENSP00000406273:Q1633R;ENSP00000366169:Q1625R;ENSP00000407879:Q1600R;ENSP00000262269:Q1633R	ENSP00000262269:Q1633R	Q	+	2	0	MYH14	55484650	1.000000	0.71417	0.763000	0.31416	0.971000	0.66376	8.881000	0.92415	1.800000	0.52685	0.402000	0.26972	CAG	.		0.597	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
MYO6	4646	hgsc.bcm.edu;bcgsc.ca	37	6	76542624	76542624	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr6:76542624T>A	ENST00000369977.3	+	6	596	c.457T>A	c.(457-459)Tca>Aca	p.S153T	MYO6_ENST00000369985.4_Missense_Mutation_p.S153T|MYO6_ENST00000369981.3_Missense_Mutation_p.S153T|MYO6_ENST00000369975.1_Missense_Mutation_p.S153T	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	153	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		ATCTGGAGAATCAGGAGCCGG	0.373																																					p.S153T		.											.	MYO6	92	0			c.T457A						.						83.0	89.0	87.0					6																	76542624		2203	4300	6503	SO:0001583	missense	4646	exon6			GGAGAATCAGGAG	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.457T>A	6.37:g.76542624T>A	ENSP00000358994:p.Ser153Thr	109.0	0.0		84.0	4.0	NM_004999	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	ENST00000369977.3	37	CCDS34487.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.852950	0.91355	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	D;D;D;D	0.96136	-3.92;-3.92;-3.92;-3.92	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.98614	0.9536	H	0.97896	4.1	0.80722	D	1	D;D	0.71674	0.998;0.96	D;D	0.79108	0.992;0.923	D	0.99802	1.1036	10	0.87932	D	0	.	15.8146	0.78589	0.0:0.0:0.0:1.0	.	153;153	Q9UM54-2;Q9UM54-1	.;.	T	153	ENSP00000358998:S153T;ENSP00000359002:S153T;ENSP00000358994:S153T;ENSP00000358992:S153T	ENSP00000358992:S153T	S	+	1	0	MYO6	76599344	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.630000	0.83225	2.193000	0.70182	0.528000	0.53228	TCA	.		0.373	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999	
NBEA	26960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	36239245	36239245	+	Missense_Mutation	SNP	G	G	A	rs368581341		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr13:36239245G>A	ENST00000400445.3	+	55	8857	c.8323G>A	c.(8323-8325)Gtc>Atc	p.V2775I	NBEA_ENST00000310336.4_Missense_Mutation_p.V2775I|NBEA_ENST00000379939.2_Missense_Mutation_p.V2772I|NBEA_ENST00000379922.3_Missense_Mutation_p.V353I|NBEA_ENST00000537702.1_Missense_Mutation_p.V568I|NBEA_ENST00000540320.1_Missense_Mutation_p.V2775I	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2775					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		ACCAAGAGCCGTCCTCACAGG	0.483																																					p.V2775I		.											.	NBEA	144	0			c.G8323A						.	G	ILE/VAL,ILE/VAL	0,4088		0,0,2044	83.0	83.0	83.0		1702,8323	4.7	1.0	13		83	1,8379		0,1,4189	no	missense,missense	NBEA	NM_001204197.1,NM_015678.4	29,29	0,1,6233	AA,AG,GG		0.0119,0.0,0.0080	benign,benign	568/740,2775/2947	36239245	1,12467	2044	4190	6234	SO:0001583	missense	26960	exon55			AGAGCCGTCCTCA	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.8323G>A	13.37:g.36239245G>A	ENSP00000383295:p.Val2775Ile	282.0	0.0		177.0	53.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	G	6.332	0.429400	0.11987	0.0	1.19E-4	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518;ENST00000402346;ENST00000537702;ENST00000379922	T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56	5.52	4.66	0.58398	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.08044	0.0201	N	0.00427	-1.505	0.54753	D	0.999987	B;B;B	0.21905	0.062;0.006;0.038	B;B;B	0.16289	0.015;0.004;0.005	T	0.33137	-0.9880	10	0.02654	T	1	.	14.7267	0.69349	0.0709:0.0:0.9291:0.0	.	2775;353;2772	Q8NFP9;Q8NFP9-2;Q5T321	NBEA_HUMAN;.;.	I	2775;2775;2772;2775;1404;353;568;353	ENSP00000440951:V2775I;ENSP00000383295:V2775I;ENSP00000369271:V2772I;ENSP00000308534:V2775I;ENSP00000440233:V568I;ENSP00000369254:V353I	ENSP00000308534:V2775I	V	+	1	0	NBEA	35137245	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	7.210000	0.77924	2.582000	0.87167	0.655000	0.94253	GTC	.		0.483	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
NBEAL2	23218	hgsc.bcm.edu;bcgsc.ca	37	3	47046023	47046023	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:47046023G>T	ENST00000450053.3	+	38	6416	c.6237G>T	c.(6235-6237)ttG>ttT	p.L2079F	NBEAL2_ENST00000292309.5_Missense_Mutation_p.L1895F|NBEAL2_ENST00000383740.2_Missense_Mutation_p.L358F	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	2079	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		TCGAGTACTTGATGCAACTCA	0.582																																					p.L2079F		.											.	NBEAL2	69	0			c.G6237T						.						100.0	111.0	107.0					3																	47046023		2099	4220	6319	SO:0001583	missense	23218	exon38			GTACTTGATGCAA	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.6237G>T	3.37:g.47046023G>T	ENSP00000415034:p.Leu2079Phe	139.0	0.0		74.0	4.0	NM_015175	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	37	CCDS46817.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	19.40|19.40|19.40	3.820435|3.820435|3.820435	0.71028|0.71028|0.71028	.|.|.	.|.|.	ENSG00000160796|ENSG00000160796|ENSG00000160796	ENST00000443829|ENST00000292309;ENST00000383740;ENST00000450053;ENST00000445550|ENST00000416683	.|D;D;D|.	.|0.88201|.	.|-2.35;-2.35;-2.35|.	4.96|4.96|4.96	4.08|4.08|4.08	0.47627|0.47627|0.47627	.|BEACH domain (4);|.	.|0.147291|.	.|0.45606|.	.|D|.	.|0.000344|.	D|D|.	0.88991|0.88991|.	0.6588|0.6588|.	H|H|H	0.99286|0.99286|0.99286	4.5|4.5|4.5	0.58432|0.58432|0.58432	D|D|D	0.999996|0.999996|0.999996	.|D;D|.	.|0.89917|.	.|1.0;1.0|.	.|D;D|.	.|0.97110|.	.|0.999;1.0|.	D|D|.	0.92912|0.92912|.	0.6348|0.6348|.	5|10|.	.|0.87932|.	.|D|.	.|0|.	.|.|.	13.6862|13.6862|13.6862	0.62517|0.62517|0.62517	0.0:0.2934:0.7065:0.0|0.0:0.2934:0.7065:0.0|0.0:0.2934:0.7065:0.0	.|.|.	.|1895;2079|.	.|Q6ZNJ1-2;Q6ZNJ1|.	.|.;NBEL2_HUMAN|.	Y|F|L	448|1895;358;2079;22|1367	.|ENSP00000292309:L1895F;ENSP00000373246:L358F;ENSP00000415034:L2079F|.	.|ENSP00000292309:L1895F|.	D|L|X	+|+|+	1|3|2	0|2|2	NBEAL2|NBEAL2|NBEAL2	47021027|47021027|47021027	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	2.988000|2.988000|2.988000	0.49386|0.49386|0.49386	1.296000|1.296000|1.296000	0.44742|0.44742|0.44742	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GAT|TTG|TGA	.		0.582	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
NCOA3	8202	broad.mit.edu;bcgsc.ca	37	20	46265318	46265320	+	In_Frame_Del	DEL	AAG	AAG	-	rs149716562		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	AAG	AAG	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr20:46265318_46265320delAAG	ENST00000371998.3	+	12	2379_2381	c.2188_2190delAAG	c.(2188-2190)aagdel	p.K732del	NCOA3_ENST00000372004.3_In_Frame_Del_p.K732del|NCOA3_ENST00000341724.6_In_Frame_Del_p.K742del|NCOA3_ENST00000371997.3_In_Frame_Del_p.K742del			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	732					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GCTAAGTCCTAAGAAGAAGGAGA	0.468																																					p.740_740del		.											.	NCOA3	229	0			c.2218_2220del						.																																			SO:0001651	inframe_deletion	8202	exon12			AGTCCTAAGAAGA	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.2188_2190delAAG	20.37:g.46265324_46265326delAAG	ENSP00000361066:p.Lys732del	197.0	0.0		205.0	28.0	NM_001174088	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	In_Frame_Del	DEL	ENST00000371998.3	37	CCDS13407.1																																																																																			.		0.468	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
NCOA3	8202	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	46264392	46264392	+	Missense_Mutation	SNP	T	T	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr20:46264392T>G	ENST00000371998.3	+	11	1630	c.1439T>G	c.(1438-1440)aTc>aGc	p.I480S	NCOA3_ENST00000372004.3_Missense_Mutation_p.I480S|NCOA3_ENST00000341724.6_Missense_Mutation_p.I490S|NCOA3_ENST00000371997.3_Missense_Mutation_p.I490S			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	480					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						CAGCAGAATATCATGATTTCT	0.448																																					p.I490S		.											.	NCOA3	229	0			c.T1469G						.						79.0	74.0	76.0					20																	46264392		2203	4300	6503	SO:0001583	missense	8202	exon11			AGAATATCATGAT	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.1439T>G	20.37:g.46264392T>G	ENSP00000361066:p.Ile480Ser	143.0	0.0		143.0	37.0	NM_001174088	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	ENST00000371998.3	37	CCDS13407.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.967330	0.74131	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997;ENST00000542882	T;T;T;T	0.16457	2.34;2.34;2.34;2.34	5.28	5.28	0.74379	.	0.167032	0.41605	D	0.000853	T	0.19167	0.0460	N	0.20401	0.57	0.43977	D	0.996668	B;P;B;B;B;B	0.48503	0.007;0.911;0.021;0.021;0.003;0.007	B;P;B;B;B;B	0.49999	0.012;0.628;0.012;0.012;0.017;0.012	T	0.02070	-1.1219	10	0.56958	D	0.05	-20.1411	15.2029	0.73153	0.0:0.0:0.0:1.0	.	480;490;484;480;480;480	A8K0W8;Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;.;NCOA3_HUMAN	S	480;490;480;480;490;246	ENSP00000342123:I490S;ENSP00000361073:I480S;ENSP00000361066:I480S;ENSP00000361065:I490S	ENSP00000345671:I480S	I	+	2	0	NCOA3	45697799	1.000000	0.71417	0.979000	0.43373	0.983000	0.72400	7.499000	0.81566	1.990000	0.58119	0.460000	0.39030	ATC	.		0.448	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
NDEL1	81565	hgsc.bcm.edu;bcgsc.ca	37	17	8347657	8347657	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:8347657C>A	ENST00000334527.7	+	2	265	c.68C>A	c.(67-69)tCc>tAc	p.S23Y	NDEL1_ENST00000380025.4_Missense_Mutation_p.S23Y|NDEL1_ENST00000583066.1_3'UTR|NDEL1_ENST00000402554.3_Missense_Mutation_p.S23Y|NDEL1_ENST00000299734.7_Missense_Mutation_p.S23Y|NDEL1_ENST00000585098.1_Missense_Mutation_p.S23Y	NM_030808.4	NP_110435.1	Q9GZM8	NDEL1_HUMAN	nudE neurodevelopment protein 1-like 1	23					activation of Cdc42 GTPase activity (GO:0032864)|central nervous system neuron axonogenesis (GO:0021955)|centrosome localization (GO:0051642)|cerebral cortex radially oriented cell migration (GO:0021799)|chromosome segregation (GO:0007059)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|neurofilament cytoskeleton organization (GO:0060052)|neuron migration (GO:0001764)|neuron projection extension (GO:1990138)|nuclear envelope disassembly (GO:0051081)|positive regulation of axon extension (GO:0045773)|positive regulation of axon regeneration (GO:0048680)|retrograde axon cargo transport (GO:0008090)|vesicle transport along microtubule (GO:0047496)	axon hillock (GO:0043203)|cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|neurofilament cytoskeleton (GO:0060053)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)	oligopeptidase activity (GO:0070012)			large_intestine(6)|lung(4)|skin(3)	13						AAGGAACTTTCCTTGAAGTAT	0.353																																					p.S23Y		.											.	NDEL1	90	0			c.C68A						.						88.0	87.0	87.0					17																	8347657		2203	4300	6503	SO:0001583	missense	81565	exon2			AACTTTCCTTGAA	AF182078	CCDS11143.1, CCDS32564.1	17p13.1	2013-08-06	2013-08-06	2003-04-16	ENSG00000166579	ENSG00000166579			17620	protein-coding gene	gene with protein product		607538	"""nudE nuclear distribution gene E homolog (A. nidulans)-like 1"", ""nudE nuclear distribution E homolog (A. nidulans)-like 1"""			11163260, 11163259	Standard	NM_001025579		Approved	NUDEL, MITAP1, NDE1L1, NDE2	uc002glj.4	Q9GZM8	OTTHUMG00000108193	ENST00000334527.7:c.68C>A	17.37:g.8347657C>A	ENSP00000333982:p.Ser23Tyr	120.0	0.0		88.0	4.0	NM_001025579	B3KP93|D3DTS0|J3QT32|Q86T80|Q8TAR7|Q9UH50	Missense_Mutation	SNP	ENST00000334527.7	37	CCDS11143.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169783	0.78452	.	.	ENSG00000166579	ENST00000299734;ENST00000380025;ENST00000402554;ENST00000334527	.	.	.	4.18	4.18	0.49190	.	0.126774	0.56097	D	0.000036	T	0.59810	0.2221	L	0.34521	1.04	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.59487	0.858;0.726	T	0.53450	-0.8437	9	0.11485	T	0.65	-1.654	16.7216	0.85411	0.0:1.0:0.0:0.0	.	23;23	Q9GZM8;A6NIZ0	NDEL1_HUMAN;.	Y	23;23;78;23	.	ENSP00000299734:S23Y	S	+	2	0	NDEL1	8288382	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.405000	0.80007	2.152000	0.67230	0.650000	0.86243	TCC	.		0.353	NDEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226999.2	NM_030808	
NDUFAF1	51103	hgsc.bcm.edu;bcgsc.ca	37	15	41687071	41687071	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr15:41687071A>G	ENST00000260361.4	-	3	1126	c.745T>C	c.(745-747)Tgg>Cgg	p.W249R		NM_016013.3	NP_057097.2	Q9Y375	CIA30_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 1	249					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|mitochondrial respiratory chain complex I (GO:0005747)	unfolded protein binding (GO:0051082)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	12		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;8e-17)|GBM - Glioblastoma multiforme(113;1.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.114)		ACCTCCTGCCAGTAGGGTCCC	0.478																																					p.W249R		.											.	NDUFAF1	91	0			c.T745C						.						76.0	73.0	74.0					15																	41687071		2203	4300	6503	SO:0001583	missense	51103	exon3			CCTGCCAGTAGGG	AF151823	CCDS10075.1	15q11.2-q21.3	2012-10-12	2012-05-08		ENSG00000137806	ENSG00000137806		"""Mitochondrial respiratory chain complex assembly factors"""	18828	protein-coding gene	gene with protein product		606934				11935339, 10810093	Standard	NM_016013		Approved	CIA30, CGI-65	uc001znx.3	Q9Y375	OTTHUMG00000130340	ENST00000260361.4:c.745T>C	15.37:g.41687071A>G	ENSP00000260361:p.Trp249Arg	95.0	0.0		71.0	4.0	NM_016013	Q9BVZ5	Missense_Mutation	SNP	ENST00000260361.4	37	CCDS10075.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.522096	0.85600	.	.	ENSG00000137806	ENST00000260361	D	0.82619	-1.63	5.52	5.52	0.82312	NADH:ubiquinone oxidoreductase intermediate-associated protein 30 (1);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.93344	0.7878	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94959	0.8106	10	0.87932	D	0	-20.7997	15.9772	0.80079	1.0:0.0:0.0:0.0	.	249	Q9Y375	CIA30_HUMAN	R	249	ENSP00000260361:W249R	ENSP00000260361:W249R	W	-	1	0	NDUFAF1	39474363	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.047000	0.93823	2.235000	0.73313	0.451000	0.29950	TGG	.		0.478	NDUFAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252692.2	NM_016013	
NEDD4L	23327	hgsc.bcm.edu;bcgsc.ca	37	18	56002763	56002763	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr18:56002763A>G	ENST00000400345.3	+	13	1402	c.1119A>G	c.(1117-1119)gaA>gaG	p.E373E	NEDD4L_ENST00000456986.1_Silent_p.E252E|NEDD4L_ENST00000256832.7_Intron|NEDD4L_ENST00000256830.9_Intron|NEDD4L_ENST00000586263.1_Intron|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000431212.2_Silent_p.E252E|NEDD4L_ENST00000356462.6_Intron|NEDD4L_ENST00000435432.2_Intron|NEDD4L_ENST00000357895.5_Silent_p.E365E|NEDD4L_ENST00000456173.2_Intron|NEDD4L_ENST00000382850.4_Intron	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	373					cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						GTGGTGAGGAACCAACGGTAA	0.448																																					p.E373E		.											.	NEDD4L	658	0			c.A1119G						.						121.0	110.0	113.0					18																	56002763		1568	3582	5150	SO:0001819	synonymous_variant	23327	exon13			TGAGGAACCAACG	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.1119A>G	18.37:g.56002763A>G		110.0	0.0		115.0	5.0	NM_001144967	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Silent	SNP	ENST00000400345.3	37	CCDS45872.1																																																																																			.		0.448	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
NEIL1	79661	hgsc.bcm.edu;bcgsc.ca	37	15	75647049	75647049	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr15:75647049T>C	ENST00000564784.1	+	10	1621	c.992T>C	c.(991-993)cTt>cCt	p.L331P	NEIL1_ENST00000569035.1_Missense_Mutation_p.L331P|RP11-817O13.6_ENST00000563660.1_lincRNA|NEIL1_ENST00000355059.4_Missense_Mutation_p.L331P|MIR631_ENST00000384904.1_RNA			Q96FI4	NEIL1_HUMAN	nei endonuclease VIII-like 1 (E. coli)	331					base-excision repair (GO:0006284)|negative regulation of nuclease activity (GO:0032074)|nucleotide-excision repair (GO:0006289)|response to oxidative stress (GO:0006979)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)	13						AAGAGAGACCTTCCTAAGAGG	0.622								Base excision repair (BER), DNA glycosylases																													p.L417P		.											.	NEIL1	659	0			c.T1250C						.						50.0	55.0	53.0					15																	75647049		2197	4294	6491	SO:0001583	missense	79661	exon9			GAGACCTTCCTAA	AK026055	CCDS10278.1	15q33.33	2008-07-18			ENSG00000140398	ENSG00000140398			18448	protein-coding gene	gene with protein product		608844				11904416	Standard	NM_024608		Approved	FLJ22402, hFPG1, NEI1, FPG1	uc002bae.4	Q96FI4	OTTHUMG00000142821	ENST00000564784.1:c.992T>C	15.37:g.75647049T>C	ENSP00000457352:p.Leu331Pro	82.0	0.0		66.0	4.0	NM_001256552	D3DW75|Q6ZRA7|Q86XW7|Q9H6C3	Missense_Mutation	SNP	ENST00000564784.1	37	CCDS10278.1	.	.	.	.	.	.	.	.	.	.	T	6.154	0.396553	0.11638	.	.	ENSG00000140398	ENST00000355059	T	0.12672	2.66	3.65	-0.0446	0.13855	.	1.484880	0.03689	N	0.246787	T	0.09949	0.0244	N	0.25647	0.755	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32981	-0.9886	10	0.44086	T	0.13	-2.4153	3.3161	0.07034	0.0:0.2306:0.2096:0.5598	.	331	Q96FI4	NEIL1_HUMAN	P	331	ENSP00000347170:L331P	ENSP00000347170:L331P	L	+	2	0	NEIL1	73434102	0.000000	0.05858	0.001000	0.08648	0.098000	0.18820	-0.118000	0.10692	-0.015000	0.14150	0.454000	0.30748	CTT	.		0.622	NEIL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419885.1	NM_024608	
NOL4	8715	hgsc.bcm.edu;bcgsc.ca	37	18	31523052	31523052	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr18:31523052T>C	ENST00000261592.5	-	9	1816	c.1519A>G	c.(1519-1521)Agg>Ggg	p.R507G	NOL4_ENST00000269185.4_Intron|NOL4_ENST00000589544.1_Intron|NOL4_ENST00000535384.1_Missense_Mutation_p.R222G|NOL4_ENST00000538587.1_Missense_Mutation_p.R433G|NOL4_ENST00000535475.1_Missense_Mutation_p.R288G	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	507						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						AGACGCATCCTCTTGGCGGCA	0.433																																					p.R507G		.											.	NOL4	93	0			c.A1519G						.						105.0	95.0	98.0					18																	31523052		2203	4299	6502	SO:0001583	missense	8715	exon9			GCATCCTCTTGGC	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1519A>G	18.37:g.31523052T>C	ENSP00000261592:p.Arg507Gly	89.0	0.0		65.0	4.0	NM_003787	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	37	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	T	18.13	3.554596	0.65425	.	.	ENSG00000101746	ENST00000261592;ENST00000399171;ENST00000535384;ENST00000535475;ENST00000538587	.	.	.	5.87	3.36	0.38483	.	0.000000	0.85682	D	0.000000	T	0.76471	0.3992	M	0.71206	2.165	0.42947	D	0.994361	D;D;D;D;D;P	0.89917	0.989;1.0;1.0;0.997;1.0;0.51	D;D;D;D;D;B	0.87578	0.985;0.998;0.998;0.971;0.998;0.419	T	0.79070	-0.1954	9	0.62326	D	0.03	-18.6544	13.3487	0.60589	0.0:0.0:0.3698:0.6302	.	192;222;433;507;222;288	F8W825;B7Z3Z7;B4DSQ0;O94818;F5H1E3;B3KRF4	.;.;.;NOL4_HUMAN;.;.	G	507;192;222;288;433	.	ENSP00000261592:R507G	R	-	1	2	NOL4	29777050	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.415000	0.52700	1.025000	0.39708	0.528000	0.53228	AGG	.		0.433	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787	
NSD1	64324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176722236	176722236	+	Missense_Mutation	SNP	A	A	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr5:176722236A>C	ENST00000439151.2	+	23	7912	c.7867A>C	c.(7867-7869)Agt>Cgt	p.S2623R	NSD1_ENST00000354179.4_Missense_Mutation_p.S2354R|NSD1_ENST00000361032.4_Missense_Mutation_p.S2520R|NSD1_ENST00000347982.4_Missense_Mutation_p.S2354R	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2623					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CACAGAGCAAAGTCCCTGGGC	0.587			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.S2623R		.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1	188	0			c.A7867C						.						67.0	70.0	69.0					5																	176722236		2203	4300	6503	SO:0001583	missense	64324	exon23	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	GAGCAAAGTCCCT	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.7867A>C	5.37:g.176722236A>C	ENSP00000395929:p.Ser2623Arg	151.0	0.0		110.0	39.0	NM_022455	Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	A	11.83	1.756162	0.31137	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.93604	-3.15;-3.15;-3.15;-3.25	4.71	3.54	0.40534	.	0.227351	0.31636	N	0.007312	D	0.86936	0.6053	N	0.19112	0.55	0.27574	N	0.949798	B;B	0.21905	0.062;0.037	B;B	0.26969	0.075;0.048	T	0.79820	-0.1642	10	0.42905	T	0.14	.	11.1301	0.48341	0.835:0.165:0.0:0.0	.	2354;2623	Q96L73-2;Q96L73	.;NSD1_HUMAN	R	2354;2623;2354;2520	ENSP00000346111:S2354R;ENSP00000395929:S2623R;ENSP00000343209:S2354R;ENSP00000354310:S2520R	ENSP00000343209:S2354R	S	+	1	0	NSD1	176654842	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	2.691000	0.47010	1.980000	0.57719	0.379000	0.24179	AGT	.		0.587	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
NSD1	64324	hgsc.bcm.edu;bcgsc.ca	37	5	176722361	176722361	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr5:176722361T>C	ENST00000439151.2	+	23	8037	c.7992T>C	c.(7990-7992)tcT>tcC	p.S2664S	NSD1_ENST00000354179.4_Silent_p.S2395S|NSD1_ENST00000361032.4_Silent_p.S2561S|NSD1_ENST00000347982.4_Silent_p.S2395S	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2664					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CTTGCTGGTCTCTTGGAAGAG	0.537			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.S2664S		.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1	188	0			c.T7992C						.						67.0	71.0	70.0					5																	176722361		2203	4300	6503	SO:0001819	synonymous_variant	64324	exon23	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	CTGGTCTCTTGGA	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.7992T>C	5.37:g.176722361T>C		139.0	0.0		96.0	5.0	NM_022455	Q96PD8|Q96RN7	Silent	SNP	ENST00000439151.2	37	CCDS4412.1																																																																																			.		0.537	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
NTRK2	4915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	87339221	87339221	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:87339221C>T	ENST00000323115.4	+	7	1156	c.803C>T	c.(802-804)gCg>gTg	p.A268V	NTRK2_ENST00000395866.2_Missense_Mutation_p.A112V|NTRK2_ENST00000376213.1_Missense_Mutation_p.A268V|NTRK2_ENST00000304053.6_Missense_Mutation_p.A268V|NTRK2_ENST00000359847.3_Missense_Mutation_p.A268V|NTRK2_ENST00000395882.1_Missense_Mutation_p.A268V|NTRK2_ENST00000376214.1_Missense_Mutation_p.A268V|NTRK2_ENST00000376208.1_Missense_Mutation_p.A268V|NTRK2_ENST00000277120.3_Missense_Mutation_p.A268V			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	268	Ig-like C2-type 1.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	TCTTGTGTGGCGGAAAATCTT	0.408										TSP Lung(25;0.17)																											p.A268V		.											.	NTRK2	1404	0			c.C803T						.						215.0	204.0	208.0					9																	87339221		2203	4300	6503	SO:0001583	missense	4915	exon8			GTGTGGCGGAAAA	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.803C>T	9.37:g.87339221C>T	ENSP00000314586:p.Ala268Val	188.0	0.0		140.0	35.0	NM_001018065	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	ENST00000323115.4	37	CCDS35050.1	.	.	.	.	.	.	.	.	.	.	C	31	5.067874	0.93950	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000395882;ENST00000376208;ENST00000304053;ENST00000277120;ENST00000323115;ENST00000359847;ENST00000395866	T;T;T;T;T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66;-0.66;-0.66;-0.66;-0.66	5.27	5.27	0.74061	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.054584	0.64402	D	0.000001	D	0.84566	0.5500	M	0.83692	2.655	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.999;0.995;0.995;0.997;0.987;0.977;0.999;0.995	T	0.80966	-0.1146	10	0.15952	T	0.53	.	19.2585	0.93957	0.0:1.0:0.0:0.0	.	112;268;268;268;268;268;314;268	B4DFV9;Q16620-3;Q16620-5;Q5VWE5;Q16620;Q16620-4;Q59GJ1;Q16620-2	.;.;.;.;NTRK2_HUMAN;.;.;.	V	268;268;268;268;268;268;268;268;112	ENSP00000365387:A268V;ENSP00000365386:A268V;ENSP00000379221:A268V;ENSP00000365381:A268V;ENSP00000306167:A268V;ENSP00000277120:A268V;ENSP00000314586:A268V;ENSP00000352906:A268V;ENSP00000379207:A112V	ENSP00000277120:A268V	A	+	2	0	NTRK2	86529041	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.453000	0.73488	2.627000	0.88993	0.460000	0.39030	GCG	.		0.408	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052882.1		
NTRK3	4916	hgsc.bcm.edu;bcgsc.ca	37	15	88679734	88679734	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr15:88679734C>G	ENST00000360948.2	-	7	890	c.729G>C	c.(727-729)tgG>tgC	p.W243C	NTRK3_ENST00000394480.2_Missense_Mutation_p.W243C|NTRK3_ENST00000540489.2_Missense_Mutation_p.W243C|NTRK3_ENST00000355254.2_Missense_Mutation_p.W243C|NTRK3_ENST00000317501.3_Missense_Mutation_p.W243C|NTRK3_ENST00000558676.1_Missense_Mutation_p.W243C|NTRK3_ENST00000557856.1_Missense_Mutation_p.W243C|NTRK3_ENST00000542733.2_Missense_Mutation_p.W145C|NTRK3_ENST00000357724.2_Missense_Mutation_p.W243C	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	243	Ig-like C2-type 1.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.W243C(3)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			CAGTGACTATCCAGTCCACAT	0.547			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.W243C		.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3	3538	3	Substitution - Missense(3)	lung(3)	c.G729C						.						151.0	97.0	115.0					15																	88679734		2201	4299	6500	SO:0001583	missense	4916	exon8			GACTATCCAGTCC	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.729G>C	15.37:g.88679734C>G	ENSP00000354207:p.Trp243Cys	134.0	0.0		75.0	4.0	NM_001243101	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.440008	0.83993	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	D;D;D;D;D;D;D	0.96300	-3.97;-3.97;-3.97;-3.97;-3.97;-3.97;-3.97	5.64	5.64	0.86602	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.98566	0.9521	M	0.91354	3.2	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;0.996;1.0	D	0.99461	1.0943	10	0.87932	D	0	.	18.6884	0.91574	0.0:1.0:0.0:0.0	.	145;243;243;243;243;243	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	C	243;243;243;243;145;243;243	ENSP00000377990:W243C;ENSP00000354207:W243C;ENSP00000350356:W243C;ENSP00000347397:W243C;ENSP00000437773:W145C;ENSP00000444673:W243C;ENSP00000318328:W243C	ENSP00000318328:W243C	W	-	3	0	NTRK3	86480738	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.359000	0.79477	2.657000	0.90304	0.655000	0.94253	TGG	.		0.547	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
NUDT5	11164	hgsc.bcm.edu;bcgsc.ca	37	10	12219892	12219892	+	Silent	SNP	C	C	A	rs371734243		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr10:12219892C>A	ENST00000491614.1	-	5	584	c.189G>T	c.(187-189)gcG>gcT	p.A63A	NUDT5_ENST00000537776.1_Silent_p.A63A|NUDT5_ENST00000378940.3_Silent_p.A63A|NUDT5_ENST00000378927.3_Silent_p.A63A|NUDT5_ENST00000378937.3_Silent_p.A76A|NUDT5_ENST00000378952.3_5'UTR			Q9UKK9	NUDT5_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 5	63	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				D-ribose catabolic process (GO:0019303)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|ribonucleoside diphosphate catabolic process (GO:0009191)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)|magnesium ion binding (GO:0000287)|nucleoside-diphosphatase activity (GO:0017110)|snoRNA binding (GO:0030515)			breast(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)	8		Renal(717;0.228)				CGGGGATGACCGCGACACCTG	0.502																																					p.A63A		.											NUDT5,NS,NS,-1	NUDT5	92	0			c.G189T						.						84.0	65.0	72.0					10																	12219892		2203	4300	6503	SO:0001819	synonymous_variant	11164	exon5			GATGACCGCGACA	AF155832	CCDS7089.1	10p14	2008-05-14			ENSG00000165609	ENSG00000165609		"""Nudix motif containing"""	8052	protein-coding gene	gene with protein product		609230				10373642	Standard	NM_014142		Approved	hYSAH1, YSA1H	uc001ilj.3	Q9UKK9	OTTHUMG00000017682	ENST00000491614.1:c.189G>T	10.37:g.12219892C>A		57.0	0.0		48.0	4.0	NM_014142	A8K516|Q6IAG0|Q9UH49	Silent	SNP	ENST00000491614.1	37	CCDS7089.1																																																																																			.		0.502	NUDT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046811.1		
NUP188	23511	hgsc.bcm.edu;bcgsc.ca	37	9	131765691	131765691	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:131765691G>T	ENST00000372577.2	+	38	4413	c.4392G>T	c.(4390-4392)aaG>aaT	p.K1464N	RP11-167N5.5_ENST00000594418.1_lincRNA	NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1464					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						ACTTCATGAAGGAGTGGCACT	0.582																																					p.K1464N		.											.	NUP188	207	0			c.G4392T						.						118.0	110.0	113.0					9																	131765691		2203	4300	6503	SO:0001583	missense	23511	exon38			CATGAAGGAGTGG	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.4392G>T	9.37:g.131765691G>T	ENSP00000361658:p.Lys1464Asn	67.0	0.0		46.0	4.0	NM_015354	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803502	0.70682	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.33438	1.41	5.8	3.93	0.45458	.	0.000000	0.85682	D	0.000000	T	0.46073	0.1374	L	0.53249	1.67	0.80722	D	1	P;D	0.76494	0.784;0.999	B;D	0.78314	0.312;0.991	T	0.32428	-0.9907	10	0.39692	T	0.17	-8.8756	9.7807	0.40647	0.2141:0.0:0.7859:0.0	.	797;1464	E9PET9;Q5SRE5	.;NU188_HUMAN	N	1353;1464	ENSP00000361658:K1464N	ENSP00000349125:K1353N	K	+	3	2	NUP188	130805512	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.477000	0.45180	1.455000	0.47813	0.561000	0.74099	AAG	.		0.582	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		
NYAP2	57624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	226378371	226378371	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:226378371C>T	ENST00000272907.6	+	3	919	c.506C>T	c.(505-507)aCc>aTc	p.T169I	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	169					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												AGCGGGAAAACCCCTGAGAGG	0.542																																					p.T169I		.											.	.	.	0			c.C506T						.						60.0	73.0	69.0					2																	226378371		2051	4207	6258	SO:0001583	missense	57624	exon3			GGAAAACCCCTGA	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.506C>T	2.37:g.226378371C>T	ENSP00000272907:p.Thr169Ile	86.0	0.0		67.0	14.0	NM_020864	A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	C	15.32	2.799329	0.50208	.	.	ENSG00000144460	ENST00000272907	T	0.42900	0.96	5.46	-3.88	0.04205	.	1.155810	0.06302	N	0.701107	T	0.25865	0.0630	N	0.22421	0.69	0.09310	N	0.999998	B	0.06786	0.001	B	0.04013	0.001	T	0.25745	-1.0123	10	0.34782	T	0.22	0.1231	7.788	0.29103	0.0:0.128:0.5199:0.3521	.	169	Q9P242	K1486_HUMAN	I	169	ENSP00000272907:T169I	ENSP00000272907:T169I	T	+	2	0	KIAA1486	226086615	0.000000	0.05858	0.000000	0.03702	0.969000	0.65631	0.510000	0.22723	-0.592000	0.05851	0.563000	0.77884	ACC	.		0.542	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864	
NYAP2	57624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	226447056	226447056	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:226447056A>G	ENST00000272907.6	+	4	1336	c.923A>G	c.(922-924)aAg>aGg	p.K308R	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	308					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GACTTCGCCAAGGCCTCAGTG	0.597																																					p.K308R		.											.	.	.	0			c.A923G						.						64.0	67.0	66.0					2																	226447056		2069	4190	6259	SO:0001583	missense	57624	exon4			TCGCCAAGGCCTC	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.923A>G	2.37:g.226447056A>G	ENSP00000272907:p.Lys308Arg	114.0	0.0		117.0	27.0	NM_020864	A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	A	11.36	1.615003	0.28712	.	.	ENSG00000144460	ENST00000272907	T	0.44482	0.92	5.84	3.49	0.39957	.	0.212320	0.41294	N	0.000920	T	0.31606	0.0802	L	0.45137	1.4	0.80722	D	1	B	0.15930	0.015	B	0.15870	0.014	T	0.06917	-1.0800	10	0.15499	T	0.54	-20.2547	10.2151	0.43164	0.8774:0.0:0.1226:0.0	.	308	Q9P242	K1486_HUMAN	R	308	ENSP00000272907:K308R	ENSP00000272907:K308R	K	+	2	0	KIAA1486	226155300	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.141000	0.42168	0.487000	0.27698	0.528000	0.53228	AAG	.		0.597	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864	
OAS1	4938	hgsc.bcm.edu;bcgsc.ca	37	12	113357204	113357204	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:113357204A>G	ENST00000202917.5	+	6	1312	c.1049A>G	c.(1048-1050)aAc>aGc	p.N350S	OAS1_ENST00000445409.2_Intron|RP1-71H24.1_ENST00000552784.1_RNA|OAS1_ENST00000551241.1_Intron	NM_016816.2	NP_058132.2	P00973	OAS1_HUMAN	2'-5'-oligoadenylate synthetase 1, 40/46kDa	350					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|protein oligomerization (GO:0051259)|purine nucleotide biosynthetic process (GO:0006164)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)|skin(1)	16						GCTGAAAGCAACAGTGCAGAC	0.483																																					p.N350S		.											.	OAS1	70	0			c.A1049G						.						83.0	82.0	83.0					12																	113357204		2203	4300	6503	SO:0001583	missense	4938	exon6			AAAGCAACAGTGC	X04371	CCDS31905.1, CCDS41838.1, CCDS44980.1	12q24.2	2014-05-21	2011-07-21				2.7.7.-		8086	protein-coding gene	gene with protein product		164350	"""2',5'-oligoadenylate synthetase 1 (40-46 kD)"""	OIAS		9344649, 9325053	Standard	XM_006719434		Approved	OIASI, IFI-4	uc001tud.3	P00973		ENST00000202917.5:c.1049A>G	12.37:g.113357204A>G	ENSP00000202917:p.Asn350Ser	93.0	0.0		92.0	5.0	NM_016816	A8K4N8|P04820|P29080|P29081|P78485|P78486|Q16700|Q16701|Q1PG42|Q3ZM01|Q53GC5|Q53YA4|Q6A1Z3|Q6IPC6|Q6P7N9|Q96J61	Missense_Mutation	SNP	ENST00000202917.5	37	CCDS41838.1	.	.	.	.	.	.	.	.	.	.	A	2.929	-0.221556	0.06061	.	.	ENSG00000089127	ENST00000202917	T	0.04502	3.61	1.9	1.9	0.25705	.	.	.	.	.	T	0.02193	0.0068	N	0.08118	0	0.09310	N	0.999991	B	0.02656	0.0	B	0.04013	0.001	T	0.48031	-0.9070	9	0.09590	T	0.72	.	5.8476	0.18675	1.0:0.0:0.0:0.0	.	350	P00973	OAS1_HUMAN	S	350	ENSP00000202917:N350S	ENSP00000202917:N350S	N	+	2	0	OAS1	111841587	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.024000	0.12435	1.136000	0.42199	0.455000	0.32223	AAC	.		0.483	OAS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405896.2		
OGDHL	55753	hgsc.bcm.edu;bcgsc.ca	37	10	50948862	50948862	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr10:50948862A>G	ENST00000374103.4	-	16	2119	c.2034T>C	c.(2032-2034)caT>caC	p.H678H	OGDHL_ENST00000490844.1_5'Flank|OGDHL_ENST00000432695.1_Silent_p.H469H|OGDHL_ENST00000419399.1_Silent_p.H621H	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	678					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						CCTCCTGGTCATGGAGAACAT	0.632																																					p.H678H		.											.	OGDHL	69	0			c.T2034C						.						126.0	95.0	105.0					10																	50948862		2203	4300	6503	SO:0001819	synonymous_variant	55753	exon16			CTGGTCATGGAGA	AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.2034T>C	10.37:g.50948862A>G		67.0	0.0		47.0	4.0	NM_018245	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Silent	SNP	ENST00000374103.4	37	CCDS7234.1																																																																																			.		0.632	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245	
OR10A3	26496	hgsc.bcm.edu;bcgsc.ca	37	11	7960614	7960614	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:7960614C>A	ENST00000360759.3	-	1	527	c.454G>T	c.(454-456)Ggg>Tgg	p.G152W		NM_001003745.1	NP_001003745.1	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A, member 3	152					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)	21				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ACCATGATCCCTGAGATCCAT	0.428																																					p.G152W		.											.	OR10A3	69	0			c.G454T						.						54.0	52.0	53.0					11																	7960614		2201	4296	6497	SO:0001583	missense	26496	exon1			TGATCCCTGAGAT	BK004404	CCDS31421.1	11p15.4	2012-08-09			ENSG00000170683	ENSG00000170683		"""GPCR / Class A : Olfactory receptors"""	8162	protein-coding gene	gene with protein product						1370859	Standard	NM_001003745		Approved	HTPCRX12, HSHTPCRX12	uc010rbi.2	P58181	OTTHUMG00000165672	ENST00000360759.3:c.454G>T	11.37:g.7960614C>A	ENSP00000353988:p.Gly152Trp	117.0	0.0		129.0	6.0	NM_001003745	B9EH39|Q6IF58|Q96R11	Missense_Mutation	SNP	ENST00000360759.3	37	CCDS31421.1	.	.	.	.	.	.	.	.	.	.	C	4.878	0.163194	0.09287	.	.	ENSG00000170683	ENST00000360759	T	0.40756	1.02	4.95	1.97	0.26223	GPCR, rhodopsin-like superfamily (1);	0.376015	0.18862	N	0.129105	T	0.59224	0.2178	H	0.97732	4.065	0.09310	N	1	B	0.25007	0.116	B	0.35278	0.199	T	0.60316	-0.7287	10	0.72032	D	0.01	.	6.3974	0.21620	0.1471:0.6892:0.0:0.1637	.	152	P58181	O10A3_HUMAN	W	152	ENSP00000353988:G152W	ENSP00000353988:G152W	G	-	1	0	OR10A3	7917190	0.000000	0.05858	0.069000	0.20011	0.056000	0.15407	0.321000	0.19558	0.344000	0.23847	0.650000	0.86243	GGG	.		0.428	OR10A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385704.1	NM_001003745	
OR2AG2	338755	broad.mit.edu;bcgsc.ca	37	11	6789972	6789972	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:6789972A>G	ENST00000338569.2	-	1	314	c.217T>C	c.(217-219)Ttc>Ctc	p.F73L		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	73						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		ACAGATGTGAACAGGAGGTCC	0.557																																					p.F73L		.											.	OR2AG2	71	0			c.T217C						.						139.0	127.0	131.0					11																	6789972		2201	4293	6494	SO:0001583	missense	338755	exon1			ATGTGAACAGGAG	AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.217T>C	11.37:g.6789972A>G	ENSP00000342697:p.Phe73Leu	183.0	1.0		119.0	6.0	NM_001004490		Missense_Mutation	SNP	ENST00000338569.2	37	CCDS31413.1	.	.	.	.	.	.	.	.	.	.	A	6.014	0.370903	0.11409	.	.	ENSG00000188124	ENST00000338569	T	0.14022	2.54	4.15	1.83	0.25207	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000087	T	0.07413	0.0187	L	0.31420	0.93	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.42258	-0.9462	10	0.06625	T	0.88	.	7.0855	0.25255	0.8036:0.0:0.1964:0.0	.	73	A6NM03	O2AG2_HUMAN	L	73	ENSP00000342697:F73L	ENSP00000342697:F73L	F	-	1	0	OR2AG2	6746548	0.117000	0.22190	0.399000	0.26333	0.994000	0.84299	4.445000	0.60007	0.400000	0.25396	0.459000	0.35465	TTC	.		0.557	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386775.1	NM_001004490	
OR10G8	219869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	123901212	123901212	+	Nonsense_Mutation	SNP	A	A	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:123901212A>T	ENST00000431524.1	+	1	916	c.883A>T	c.(883-885)Aag>Tag	p.K295*		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	295						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CAAGGAGGTGAAGAAAGCTCT	0.468																																					p.K295X		.											.	OR10G8	92	0			c.A883T						.						102.0	96.0	98.0					11																	123901212		2201	4299	6500	SO:0001587	stop_gained	219869	exon1			GAGGTGAAGAAAG	AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.883A>T	11.37:g.123901212A>T	ENSP00000389072:p.Lys295*	284.0	0.0		201.0	63.0	NM_001004464	B2RNJ3|Q6IEV2	Nonsense_Mutation	SNP	ENST00000431524.1	37	CCDS31704.1	.	.	.	.	.	.	.	.	.	.	A	11.97	1.797584	0.31777	.	.	ENSG00000234560	ENST00000431524	.	.	.	2.91	0.326	0.15908	.	0.161493	0.28927	N	0.013682	.	.	.	.	.	.	0.36812	D	0.885947	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.3731	0.16150	0.7224:0.1757:0.1019:0.0	.	.	.	.	X	295	.	ENSP00000389072:K295X	K	+	1	0	OR10G8	123406422	0.044000	0.20184	0.982000	0.44146	0.346000	0.29079	1.529000	0.35996	-0.064000	0.13043	-0.385000	0.06624	AAG	.		0.468	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464	
OR4K14	122740	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20483233	20483233	+	Silent	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr14:20483233C>A	ENST00000305045.2	-	1	119	c.120G>T	c.(118-120)ctG>ctT	p.L40L		NM_001004712.1	NP_001004712.1	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K, member 14	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(20)|skin(6)	37	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GAAGGTTACCCAGCATAATGG	0.448																																					p.L40L		.											.	OR4K14	115	0			c.G120T						.						73.0	68.0	70.0					14																	20483233		2203	4300	6503	SO:0001819	synonymous_variant	122740	exon1			GTTACCCAGCATA		CCDS32027.1	14q11.2	2013-09-23			ENSG00000169484	ENSG00000169484		"""GPCR / Class A : Olfactory receptors"""	15352	protein-coding gene	gene with protein product							Standard	NM_001004712		Approved		uc010tky.2	Q8NGD5	OTTHUMG00000170780	ENST00000305045.2:c.120G>T	14.37:g.20483233C>A		296.0	0.0		224.0	78.0	NM_001004712	Q6IEU1|Q96R71	Silent	SNP	ENST00000305045.2	37	CCDS32027.1																																																																																			.		0.448	OR4K14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410343.1		
OR8G5	219865	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	11	124134976	124134976	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:124134976G>A	ENST00000524943.2	+	1	254	c.254G>A	c.(253-255)gGg>gAg	p.G85E	OR8G1_ENST00000341493.2_RNA	NM_001005198.1	NP_001005198.1	Q8NG78	OR8G5_HUMAN	olfactory receptor, family 8, subfamily G, member 5	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)						Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0523)		ACACTGATTGGGCTCAGTTCT	0.507																																					p.G85E	Ovarian(169;523 1969 8640 31295 51256)	.											.	.	.	0			c.G254A						.						122.0	114.0	117.0					11																	124134976		2174	4282	6456	SO:0001583	missense	219865	exon1			TGATTGGGCTCAG	BK004516	CCDS66256.1	11q24.1	2014-04-17		2004-03-10	ENSG00000255298	ENSG00000255298		"""GPCR / Class A : Olfactory receptors"""	19622	protein-coding gene	gene with protein product				OR8G5P, OR8G6			Standard	NM_001005198		Approved			Q8NG78	OTTHUMG00000186059	ENST00000524943.2:c.254G>A	11.37:g.124134976G>A	ENSP00000477014:p.Gly85Glu	137.0	0.0		123.0	34.0	NM_001005198	B2RND3|Q6IEU6	Missense_Mutation	SNP	ENST00000524943.2	37																																																																																				.		0.507	OR8G5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000387283.2	NM_001005198	
OXA1L	5018	hgsc.bcm.edu;bcgsc.ca	37	14	23237290	23237290	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr14:23237290G>T	ENST00000604262.1	+	3	372	c.349G>T	c.(349-351)Ggg>Tgg	p.G117W	CTD-2555K7.2_ENST00000554857.1_RNA|CTD-2555K7.2_ENST00000554730.1_RNA|OXA1L_ENST00000412791.1_Missense_Mutation_p.G117W|OXA1L_ENST00000285848.5_Missense_Mutation_p.G177W|OXA1L_ENST00000358043.5_Missense_Mutation_p.G101W|CTD-2555K7.2_ENST00000553792.1_RNA			Q15070	OXA1L_HUMAN	oxidase (cytochrome c) assembly 1-like	117					aerobic respiration (GO:0009060)|mitochondrial proton-transporting ATP synthase complex assembly (GO:0033615)|mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex I biogenesis (GO:0097031)|negative regulation of ATPase activity (GO:0032780)|negative regulation of oxidoreductase activity (GO:0051354)|oxidation-reduction process (GO:0055114)|protein complex assembly (GO:0006461)|protein insertion into membrane (GO:0051205)|protein tetramerization (GO:0051262)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	mitochondrial ribosome binding (GO:0097177)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(5)|skin(2)	19	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.0096)		ACTGGGGCTGGGGTCATACAC	0.542																																					p.G177W		.											.	OXA1L	204	0			c.G529T						.						56.0	53.0	54.0					14																	23237290		2203	4300	6503	SO:0001583	missense	5018	exon3			GGGCTGGGGTCAT		CCDS9573.1	14q11.2	2009-05-26			ENSG00000155463	ENSG00000155463			8526	protein-coding gene	gene with protein product		601066				8586451, 19349278	Standard	NM_005015		Approved	MGC133129, OXA1	uc001wgn.2	Q15070	OTTHUMG00000028691	ENST00000604262.1:c.349G>T	14.37:g.23237290G>T	ENSP00000474623:p.Gly117Trp	113.0	0.0		68.0	4.0	NM_005015	B4DPA2	Missense_Mutation	SNP	ENST00000604262.1	37		.	.	.	.	.	.	.	.	.	.	G	18.53	3.644409	0.67244	.	.	ENSG00000155463	ENST00000285848;ENST00000412791;ENST00000358043	T;T;T	0.35048	1.33;1.38;1.36	5.76	4.87	0.63330	.	0.208448	0.49305	D	0.000155	T	0.62563	0.2438	M	0.83953	2.67	0.50313	D	0.999866	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.999;0.998	T	0.68025	-0.5518	10	0.62326	D	0.03	-11.0391	13.612	0.62086	0.0757:0.0:0.9243:0.0	.	117;117;117;177	B4DGZ2;E7EVY0;Q15070;Q2M1J6	.;.;OXA1L_HUMAN;.	W	177;117;101	ENSP00000285848:G177W;ENSP00000387601:G117W;ENSP00000350740:G101W	ENSP00000285848:G177W	G	+	1	0	OXA1L	22307130	1.000000	0.71417	0.815000	0.32552	0.641000	0.38312	6.169000	0.71913	1.432000	0.47375	0.655000	0.94253	GGG	.		0.542	OXA1L-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468876.1	NM_005015	
P2RX3	5024	hgsc.bcm.edu;bcgsc.ca	37	11	57115686	57115686	+	Missense_Mutation	SNP	G	G	T	rs115850675	byFrequency	TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:57115686G>T	ENST00000263314.2	+	5	468	c.434G>T	c.(433-435)cGg>cTg	p.R145L		NM_002559.3	NP_002550.2	P56373	P2RX3_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 3	145					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of synaptic plasticity (GO:0048167)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to cold (GO:0009409)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)|transport (GO:0006810)|urinary bladder smooth muscle contraction (GO:0014832)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)			endometrium(4)|kidney(2)|large_intestine(4)|lung(15)|prostate(1)	26						TCTGTGCTCCGGACCTGTGAG	0.627																																					p.R145L		.											.	P2RX3	68	0			c.G434T						.						39.0	32.0	34.0					11																	57115686		2200	4296	6496	SO:0001583	missense	5024	exon5			TGCTCCGGACCTG	Y07683	CCDS7953.1	11q12	2012-01-17			ENSG00000109991	ENSG00000109991		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8534	protein-coding gene	gene with protein product		600843				9221902	Standard	NM_002559		Approved	P2X3	uc001nju.3	P56373	OTTHUMG00000167025	ENST00000263314.2:c.434G>T	11.37:g.57115686G>T	ENSP00000263314:p.Arg145Leu	57.0	0.0		68.0	5.0	NM_002559	Q6DK37|Q9UQB6	Missense_Mutation	SNP	ENST00000263314.2	37	CCDS7953.1	.	.	.	.	.	.	.	.	.	.	G	11.37	1.620038	0.28801	.	.	ENSG00000109991	ENST00000439993;ENST00000263314	T	0.04603	3.59	4.79	0.744	0.18353	.	0.837269	0.10699	N	0.644320	T	0.05227	0.0139	L	0.41492	1.28	0.09310	N	1	B	0.31256	0.316	B	0.31946	0.138	T	0.38045	-0.9679	10	0.72032	D	0.01	-3.417	8.0811	0.30746	0.3492:0.0:0.6508:0.0	.	145	P56373	P2RX3_HUMAN	L	145	ENSP00000263314:R145L	ENSP00000263314:R145L	R	+	2	0	P2RX3	56872262	0.002000	0.14202	0.466000	0.27168	0.373000	0.29922	0.350000	0.20079	0.444000	0.26612	-0.258000	0.10820	CGG	G|0.996;A|0.004		0.627	P2RX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392465.1	NM_002559	
P4HB	5034	hgsc.bcm.edu;bcgsc.ca	37	17	79817083	79817083	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:79817083T>C	ENST00000331483.4	-	2	548	c.326A>G	c.(325-327)gAc>gGc	p.D109G	P4HB_ENST00000576390.1_Intron|P4HB_ENST00000472244.1_5'Flank|P4HB_ENST00000439918.2_Missense_Mutation_p.D109G	NM_000918.3	NP_000909.2	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta polypeptide	109	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|protein folding (GO:0006457)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|procollagen-proline 4-dioxygenase complex (GO:0016222)	poly(A) RNA binding (GO:0044822)|procollagen-proline 4-dioxygenase activity (GO:0004656)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|large_intestine(2)|lung(17)|urinary_tract(1)	22	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			GGAAGCCGTGTCTCCATTCCT	0.602																																					p.D109G	Colon(49;444 983 1296 7887 42561)	.											.	P4HB	46	0			c.A326G						.						152.0	143.0	146.0					17																	79817083		2203	4298	6501	SO:0001583	missense	5034	exon2			GCCGTGTCTCCAT	J02783	CCDS11787.1	17q25	2011-10-19	2008-12-09		ENSG00000185624	ENSG00000185624	1.14.11.2, 5.3.4.1	"""Protein disulfide isomerases"""	8548	protein-coding gene	gene with protein product	"""protein disulfide isomerase-associated 1"", ""protein disulfide isomerase family A, member 1"", ""collagen prolyl 4-hydroxylase beta"""	176790	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase; thyroid hormone binding protein p55)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase-associated 1)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide"""	PO4DB, ERBA2L		8111381	Standard	NM_000918		Approved	PDIA1, PROHB, DSI, GIT, PDI, PO4HB, P4Hbeta	uc002kbn.1	P07237	OTTHUMG00000150269	ENST00000331483.4:c.326A>G	17.37:g.79817083T>C	ENSP00000327801:p.Asp109Gly	116.0	0.0		82.0	6.0	NM_000918	B2RDQ2|P30037|P32079|Q15205|Q6LDE5	Missense_Mutation	SNP	ENST00000331483.4	37	CCDS11787.1	.	.	.	.	.	.	.	.	.	.	T	14.79	2.639882	0.47153	.	.	ENSG00000185624	ENST00000331483;ENST00000537205;ENST00000436463	T	0.03242	4.0	4.59	3.49	0.39957	Thioredoxin domain (1);Thioredoxin-like fold (3);Disulphide isomerase (1);	0.173592	0.49305	D	0.000154	T	0.02455	0.0075	N	0.02120	-0.675	0.38770	D	0.954535	P	0.39964	0.697	P	0.44732	0.459	T	0.61623	-0.7025	10	0.59425	D	0.04	.	10.9514	0.47332	0.0:0.0:0.1576:0.8424	.	109	P07237	PDIA1_HUMAN	G	109;109;93	ENSP00000327801:D109G	ENSP00000327801:D109G	D	-	2	0	P4HB	77410372	1.000000	0.71417	0.864000	0.33941	0.022000	0.10575	7.768000	0.85345	0.605000	0.29947	-0.460000	0.05396	GAC	.		0.602	P4HB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317250.3	NM_000918	
PADI4	23569	hgsc.bcm.edu;bcgsc.ca	37	1	17674451	17674451	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:17674451G>T	ENST00000375448.4	+	10	1089	c.1063G>T	c.(1063-1065)Ggc>Tgc	p.G355C	PADI4_ENST00000487048.1_3'UTR|AC004824.2_ENST00000602074.1_Intron	NM_012387.2	NP_036519.2	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	355					cellular protein modification process (GO:0006464)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|histone citrullination (GO:0036414)|histone H3-R26 citrullination (GO:0036413)|innate immune response (GO:0045087)|nucleosome assembly (GO:0006334)|protein citrullination (GO:0018101)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginine deiminase activity (GO:0016990)|calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(2)|urinary_tract(3)	26		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	AATGGAGATCGGCTACATCCA	0.587																																					p.G355C		.											.	PADI4	70	0			c.G1063T						.						108.0	91.0	97.0					1																	17674451		2203	4300	6503	SO:0001583	missense	23569	exon10			GAGATCGGCTACA	AB017919	CCDS180.1	1p36.13	2014-06-06	2003-02-12		ENSG00000159339	ENSG00000159339	3.5.3.15	"""Peptidyl arginine deiminases"""	18368	protein-coding gene	gene with protein product		605347	"""peptidyl arginine deiminase, type V"""	PADI5		10488123	Standard	NM_012387		Approved	PAD, PDI5, PDI4	uc001baj.2	Q9UM07	OTTHUMG00000002371	ENST00000375448.4:c.1063G>T	1.37:g.17674451G>T	ENSP00000364597:p.Gly355Cys	119.0	0.0		65.0	4.0	NM_012387	A8K392|B2RBW0|Q5VTZ8|Q70SX4	Missense_Mutation	SNP	ENST00000375448.4	37	CCDS180.1	.	.	.	.	.	.	.	.	.	.	-	20.7	4.033983	0.75504	.	.	ENSG00000159339	ENST00000375448	T	0.39787	1.06	5.47	5.47	0.80525	Protein-arginine deiminase, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.67163	0.2864	M	0.83692	2.655	0.44539	D	0.997494	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.67647	-0.5617	10	0.39692	T	0.17	-37.6537	16.1026	0.81194	0.0:0.0:1.0:0.0	.	355;355	A8K392;Q9UM07	.;PADI4_HUMAN	C	355	ENSP00000364597:G355C	ENSP00000364597:G355C	G	+	1	0	PADI4	17547038	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	8.773000	0.91762	2.582000	0.87167	0.518000	0.50308	GGC	.		0.587	PADI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006799.1	NM_012387	
AKAP2	11217	hgsc.bcm.edu;bcgsc.ca	37	9	112899145	112899145	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:112899145A>G	ENST00000259318.7	+	2	835	c.628A>G	c.(628-630)Agg>Ggg	p.R210G	AKAP2_ENST00000374525.1_Missense_Mutation_p.R299G|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.R441G|AKAP2_ENST00000434623.2_Missense_Mutation_p.R299G|AKAP2_ENST00000555236.1_Missense_Mutation_p.R441G|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.R441G|AKAP2_ENST00000510514.5_Missense_Mutation_p.R441G	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	210										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						TAGAAAAGTGAGGCCTTCAGA	0.512																																					p.R441G		.											.	PALM2-AKAP2	475	0			c.A1321G						.						66.0	68.0	67.0					9																	112899145		2203	4300	6503	SO:0001583	missense	445815	exon8			AAAGTGAGGCCTT	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.628A>G	9.37:g.112899145A>G	ENSP00000259318:p.Arg210Gly	130.0	0.0		93.0	4.0	NM_007203	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	ENST00000259318.7	37	CCDS48003.1	.	.	.	.	.	.	.	.	.	.	A	11.08	1.533409	0.27387	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71;0.71;0.71;0.71	6.16	3.81	0.43845	.	0.044099	0.85682	D	0.000000	T	0.66157	0.2761	M	0.70275	2.135	0.49798	D	0.999821	D;D;D;D;D;D;D;D	0.89917	0.999;1.0;0.993;1.0;0.999;0.996;0.996;0.993	D;D;P;D;D;P;P;P	0.85130	0.996;0.997;0.782;0.997;0.994;0.892;0.892;0.782	T	0.67484	-0.5659	10	0.72032	D	0.01	-29.5922	12.6715	0.56870	0.7178:0.2822:0.0:0.0	.	210;299;293;299;300;441;441;259	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	G	441;441;441;441;299;299;259;210	ENSP00000363654:R441G;ENSP00000305861:R441G;ENSP00000451476:R441G;ENSP00000421522:R441G;ENSP00000404782:R299G;ENSP00000363649:R299G;ENSP00000419268:R259G;ENSP00000259318:R210G	ENSP00000259318:R210G	R	+	1	2	PALM2-AKAP2;AKAP2	111938966	1.000000	0.71417	1.000000	0.80357	0.032000	0.12392	3.660000	0.54496	0.544000	0.28883	-0.319000	0.08680	AGG	.		0.512	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346067.3	NM_001004065	
PARP14	54625	hgsc.bcm.edu;bcgsc.ca	37	3	122419215	122419215	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:122419215A>G	ENST00000474629.2	+	6	2080	c.1814A>G	c.(1813-1815)aAc>aGc	p.N605S		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	605					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		GAAGTTGAGAACAAAGAAGTT	0.388																																					p.N605S		.											.	PARP14	525	0			c.A1814G						.						37.0	36.0	36.0					3																	122419215		1869	4091	5960	SO:0001583	missense	54625	exon6			TTGAGAACAAAGA	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.1814A>G	3.37:g.122419215A>G	ENSP00000418194:p.Asn605Ser	92.0	0.0		79.0	4.0	NM_017554	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	ENST00000474629.2	37	CCDS46894.1	.	.	.	.	.	.	.	.	.	.	A	13.35	2.209543	0.39003	.	.	ENSG00000173193	ENST00000474629;ENST00000398162	T	0.08370	3.1	5.22	2.88	0.33553	.	0.342378	0.27056	N	0.021143	T	0.05547	0.0146	N	0.22421	0.69	0.25439	N	0.98811	B;B	0.29716	0.005;0.255	B;B	0.22152	0.004;0.038	T	0.30937	-0.9961	10	0.72032	D	0.01	.	8.4903	0.33095	0.8411:0.0:0.1589:0.0	.	605;605	Q460N5-4;Q460N5	.;PAR14_HUMAN	S	605;524	ENSP00000418194:N605S	ENSP00000381228:N524S	N	+	2	0	PARP14	123901905	1.000000	0.71417	0.122000	0.21767	0.004000	0.04260	5.648000	0.67930	0.465000	0.27167	-0.376000	0.06991	AAC	.		0.388	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554	
PAWR	5074	hgsc.bcm.edu;bcgsc.ca	37	12	80007382	80007382	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:80007382G>T	ENST00000328827.4	-	4	1028	c.656C>A	c.(655-657)cCt>cAt	p.P219H		NM_002583.2	NP_002574.2	Q96IZ0	PAWR_HUMAN	PRKC, apoptosis, WT1, regulator	219					actin filament bundle assembly (GO:0051017)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|interleukin-2 biosynthetic process (GO:0042094)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|positive regulation of apoptotic process (GO:0043065)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|enzyme binding (GO:0019899)|leucine zipper domain binding (GO:0043522)|transcription corepressor activity (GO:0003714)			NS(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						AACTGTTCTAGGTGGCTCCTG	0.289																																					p.P219H		.											.	PAWR	90	0			c.C656A						.						113.0	116.0	115.0					12																	80007382		2203	4299	6502	SO:0001583	missense	5074	exon4			GTTCTAGGTGGCT	U63809	CCDS31863.1	12q21.2	2013-03-07			ENSG00000177425	ENSG00000177425			8614	protein-coding gene	gene with protein product	"""prostate apoptosis response-4"""	601936				8943350, 9790775	Standard	NM_002583		Approved	par-4, PAR4	uc001syx.3	Q96IZ0	OTTHUMG00000170080	ENST00000328827.4:c.656C>A	12.37:g.80007382G>T	ENSP00000328088:p.Pro219His	137.0	0.0		98.0	6.0	NM_002583	O75796|Q6FHY9|Q8N700	Missense_Mutation	SNP	ENST00000328827.4	37	CCDS31863.1	.	.	.	.	.	.	.	.	.	.	G	9.493	1.101312	0.20632	.	.	ENSG00000177425	ENST00000328827	T	0.18016	2.24	4.68	4.68	0.58851	.	1.160130	0.06516	N	0.738775	T	0.15565	0.0375	N	0.14661	0.345	0.25000	N	0.991474	P	0.36249	0.545	B	0.41236	0.351	T	0.23261	-1.0193	9	.	.	.	0.4321	13.2844	0.60235	0.0:0.0:1.0:0.0	.	219	Q96IZ0	PAWR_HUMAN	H	219	ENSP00000328088:P219H	.	P	-	2	0	PAWR	78531513	1.000000	0.71417	1.000000	0.80357	0.336000	0.28762	4.020000	0.57189	2.587000	0.87381	0.655000	0.94253	CCT	.		0.289	PAWR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407175.1	NM_002583	
PAXIP1	22976	hgsc.bcm.edu;bcgsc.ca	37	7	154738503	154738503	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr7:154738503T>C	ENST00000404141.1	-	18	3097	c.2943A>G	c.(2941-2943)acA>acG	p.T981T	PAXIP1_ENST00000397192.1_Silent_p.T981T|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	981	BRCT 6. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Interaction with TP53BP1.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		AGATTCCAGGTGTGATGTAAA	0.363																																					p.T981T		.											.	PAXIP1	228	0			c.A2943G						.						50.0	45.0	46.0					7																	154738503		1845	4112	5957	SO:0001819	synonymous_variant	22976	exon18			TCCAGGTGTGATG	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.2943A>G	7.37:g.154738503T>C		44.0	0.0		49.0	4.0	NM_007349	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Silent	SNP	ENST00000404141.1	37	CCDS47753.1																																																																																			.		0.363	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349	
PCDHAC2	56134	hgsc.bcm.edu;bcgsc.ca	37	5	140347691	140347691	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr5:140347691C>A	ENST00000289269.5	+	1	1872	c.1340C>A	c.(1339-1341)cCg>cAg	p.P447Q	PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	447	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGGGAATACCGCAGCTCACA	0.537																																					p.P447Q	Melanoma(190;638 2083 3390 11909 52360)	.											.	PCDHAC2	26	0			c.C1340A						.						110.0	113.0	112.0					5																	140347691		2203	4300	6503	SO:0001583	missense	56134	exon1			GAATACCGCAGCT	AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1340C>A	5.37:g.140347691C>A	ENSP00000289269:p.Pro447Gln	151.0	0.0		87.0	5.0	NM_031883	Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	ENST00000289269.5	37	CCDS4242.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.977428	0.74360	.	.	ENSG00000243232	ENST00000289269	T	0.55588	0.51	5.92	5.92	0.95590	Cadherin (4);Cadherin-like (1);	0.000000	0.41712	D	0.000834	D	0.82838	0.5124	H	0.96460	3.825	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87312	0.2312	10	0.87932	D	0	.	20.3248	0.98698	0.0:1.0:0.0:0.0	.	447;447	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	Q	447	ENSP00000289269:P447Q	ENSP00000289269:P447Q	P	+	2	0	PCDHAC2	140327875	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.818000	0.86416	2.818000	0.97014	0.655000	0.94253	CCG	.		0.537	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251802.2	NM_018899	
PCDHGA6	56109	hgsc.bcm.edu;bcgsc.ca	37	5	140754660	140754660	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr5:140754660T>C	ENST00000517434.1	+	1	1010	c.1010T>C	c.(1009-1011)aTc>aCc	p.I337T	PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	337	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTAATAACTATCTTGGATGTC	0.443																																					p.I337T		.											.	PCDHGA6	67	0			c.T1010C						.						149.0	156.0	154.0					5																	140754660		1912	4114	6026	SO:0001583	missense	56109	exon1			TAACTATCTTGGA	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1010T>C	5.37:g.140754660T>C	ENSP00000429601:p.Ile337Thr	151.0	0.0		98.0	6.0	NM_018919	A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	ENST00000517434.1	37	CCDS54926.1	.	.	.	.	.	.	.	.	.	.	.	18.57	3.651515	0.67472	.	.	ENSG00000253731	ENST00000517434	T	0.58940	0.3	5.25	5.25	0.73442	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	0.677552	0.11059	U	0.604160	T	0.74741	0.3756	M	0.81942	2.565	0.09310	N	1	P;P	0.45634	0.731;0.863	P;P	0.54590	0.462;0.756	T	0.67221	-0.5725	10	0.87932	D	0	.	15.6084	0.76692	0.0:0.0:0.0:1.0	.	337;337	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	T	337	ENSP00000429601:I337T	ENSP00000429601:I337T	I	+	2	0	PCDHGA6	140734844	0.237000	0.23815	0.984000	0.44739	0.976000	0.68499	3.360000	0.52299	2.326000	0.78906	0.533000	0.62120	ATC	.		0.443	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919	
PCDHGC5	56097	ucsc.edu;bcgsc.ca	37	5	140871104	140871104	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr5:140871104C>A	ENST00000252087.1	+	1	2297	c.2297C>A	c.(2296-2298)cCc>cAc	p.P766H	PCDHGA12_ENST00000252085.3_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	766					homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGCTGCGGCCCACAGACTCG	0.612																																					p.P766H		.											.	PCDHGC5	25	0			c.C2297A						.						44.0	43.0	43.0					5																	140871104		2203	4300	6503	SO:0001583	missense	56097	exon1			TGCGGCCCACAGA	AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.2297C>A	5.37:g.140871104C>A	ENSP00000252087:p.Pro766His	99.0	0.0		42.0	4.0	NM_018929	Q9Y5C2	Missense_Mutation	SNP	ENST00000252087.1	37	CCDS4263.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.939441	0.73557	.	.	ENSG00000240764	ENST00000252087	T	0.47528	0.84	5.16	4.29	0.51040	.	0.000000	0.49916	D	0.000139	T	0.43411	0.1246	N	0.08118	0	0.40726	D	0.982707	D;D	0.71674	0.998;0.994	D;P	0.63192	0.912;0.733	T	0.49597	-0.8923	10	0.48119	T	0.1	.	10.8141	0.46564	0.0:0.8345:0.0:0.1655	.	766;766	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	H	766	ENSP00000252087:P766H	ENSP00000252087:P766H	P	+	2	0	PCDHGC5	140851288	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.134000	0.50538	1.402000	0.46780	0.555000	0.69702	CCC	.		0.612	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	NM_018929	
PDE6A	5145	hgsc.bcm.edu;bcgsc.ca	37	5	149278051	149278051	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr5:149278051C>A	ENST00000255266.5	-	10	1401	c.1282G>T	c.(1282-1284)Ggc>Tgc	p.G428C		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	428	GAF 2.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	ACAGACCAGCCCAGAAATTGA	0.358																																					p.G428C		.											.	PDE6A	92	0			c.G1282T						.						65.0	64.0	65.0					5																	149278051		2203	4300	6503	SO:0001583	missense	5145	exon10			ACCAGCCCAGAAA		CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.1282G>T	5.37:g.149278051C>A	ENSP00000255266:p.Gly428Cys	52.0	0.0		57.0	4.0	NM_000440	Q0P638	Missense_Mutation	SNP	ENST00000255266.5	37	CCDS4299.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.205999	0.79127	.	.	ENSG00000132915	ENST00000255266	T	0.70399	-0.48	5.74	4.87	0.63330	GAF (2);	0.000000	0.85682	D	0.000000	D	0.86867	0.6036	M	0.92268	3.29	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89634	0.3857	10	0.87932	D	0	.	12.7212	0.57144	0.0:0.9205:0.0:0.0795	.	428	P16499	PDE6A_HUMAN	C	428	ENSP00000255266:G428C	ENSP00000255266:G428C	G	-	1	0	PDE6A	149258244	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.427000	0.80284	1.574000	0.49760	0.561000	0.74099	GGC	.		0.358	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252326.2		
PDXDC1	23042	hgsc.bcm.edu;bcgsc.ca	37	16	15127208	15127208	+	Silent	SNP	C	C	A	rs151129728	byFrequency	TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:15127208C>A	ENST00000396410.4	+	19	1861	c.1764C>A	c.(1762-1764)ctC>ctA	p.L588L	PDXDC1_ENST00000450288.2_Silent_p.L560L|PDXDC1_ENST00000535621.2_Intron|PDXDC1_ENST00000569715.1_Silent_p.L561L|PDXDC1_ENST00000563679.1_Silent_p.L606L|PDXDC1_ENST00000447912.2_Silent_p.L497L|PDXDC1_ENST00000325823.7_Silent_p.L573L	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	588					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CTGCTGAGCTCGTGGAGACCA	0.537																																					p.L588L		.											.	PDXDC1	91	0			c.C1764A						.						145.0	130.0	135.0					16																	15127208		2197	4300	6497	SO:0001819	synonymous_variant	23042	exon19			TGAGCTCGTGGAG	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.1764C>A	16.37:g.15127208C>A		86.0	0.0		72.0	4.0	NM_015027	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Silent	SNP	ENST00000396410.4	37	CCDS32393.1																																																																																			C|1.000;T|0.000		0.537	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389065.2	NM_015027	
PGD	5226	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	10471547	10471547	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:10471547A>T	ENST00000270776.8	+	7	630	c.592A>T	c.(592-594)Atc>Ttc	p.I198F	PGD_ENST00000538557.1_Missense_Mutation_p.I185F|PGD_ENST00000541529.1_Missense_Mutation_p.I176F	NM_002631.2	NP_002622.2	P52209	6PGD_HUMAN	phosphogluconate dehydrogenase	198					carbohydrate metabolic process (GO:0005975)|D-gluconate metabolic process (GO:0019521)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	NADP binding (GO:0050661)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	14	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)	Dacarbazine(DB00851)|Furosemide(DB00695)|Gadopentetate dimeglumine(DB00789)|Ketotifen(DB00920)|Meloxicam(DB00814)|Methotrexate(DB00563)|Ritodrine(DB00867)	CATGCAGCTGATCTGTGAGGC	0.597																																					p.I198F		.											.	PGD	91	0			c.A592T						.						140.0	108.0	119.0					1																	10471547		2203	4300	6503	SO:0001583	missense	5226	exon7			CAGCTGATCTGTG	BC000368	CCDS113.1	1p36.22	2012-10-02			ENSG00000142657	ENSG00000142657	1.1.1.43		8891	protein-coding gene	gene with protein product		172200					Standard	NM_002631		Approved		uc001arc.3	P52209	OTTHUMG00000001905	ENST00000270776.8:c.592A>T	1.37:g.10471547A>T	ENSP00000270776:p.Ile198Phe	175.0	0.0		134.0	48.0	NM_002631	A8K2Y9|B4DQJ8|Q9BWD8	Missense_Mutation	SNP	ENST00000270776.8	37	CCDS113.1	.	.	.	.	.	.	.	.	.	.	a	29.5	5.009941	0.93346	.	.	ENSG00000142657	ENST00000541529;ENST00000543846;ENST00000270776;ENST00000538557	T;T;T	0.56103	0.48;0.48;0.48	4.61	4.61	0.57282	6-phosphogluconate dehydrogenase, C-terminal (1);Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.000000	0.85682	D	0.000000	T	0.72137	0.3423	M	0.77486	2.375	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.79108	0.921;0.992;0.992	T	0.77019	-0.2743	10	0.87932	D	0	-27.8081	14.3408	0.66624	1.0:0.0:0.0:0.0	.	176;198;198	F5H7U0;A8K2Y9;P52209	.;.;6PGD_HUMAN	F	176;144;198;185	ENSP00000442285:I176F;ENSP00000270776:I198F;ENSP00000437822:I185F	ENSP00000270776:I198F	I	+	1	0	PGD	10394134	1.000000	0.71417	0.982000	0.44146	0.943000	0.58893	9.127000	0.94417	1.854000	0.53819	0.468000	0.43344	ATC	.		0.597	PGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005398.1	NM_002631	
PGM5	5239	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	71144546	71144546	+	Missense_Mutation	SNP	C	C	G	rs190312271	byFrequency	TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:71144546C>G	ENST00000396396.1	+	11	1907	c.1678C>G	c.(1678-1680)Cgg>Ggg	p.R560G		NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	560					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						GAGAACTGGCCGGAGGGGACC	0.507																																					p.R560G		.											.	PGM5	92	0			c.C1678G						.						55.0	48.0	50.0					9																	71144546		2203	4299	6502	SO:0001583	missense	5239	exon11			ACTGGCCGGAGGG	L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.1678C>G	9.37:g.71144546C>G	ENSP00000379678:p.Arg560Gly	140.0	1.0		104.0	34.0	NM_021965	B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	ENST00000396396.1	37	CCDS6622.2	.	.	.	.	.	.	.	.	.	.	C	18.49	3.635751	0.67130	.	.	ENSG00000154330	ENST00000396396	T	0.49432	0.78	5.66	3.8	0.43715	.	0.113102	0.64402	D	0.000012	T	0.51024	0.1650	M	0.90309	3.105	0.80722	D	1	B	0.33694	0.421	B	0.25614	0.062	T	0.56414	-0.7983	10	0.87932	D	0	.	9.8591	0.41103	0.1396:0.7868:0.0:0.0736	.	560	Q15124	PGM5_HUMAN	G	560	ENSP00000379678:R560G	ENSP00000379678:R560G	R	+	1	2	PGM5	70334366	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.045000	0.64220	0.739000	0.32628	-0.140000	0.14226	CGG	C|0.999;T|0.001		0.507	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052548.2	NM_021965	
PHF19	26147	hgsc.bcm.edu;bcgsc.ca	37	9	123636996	123636996	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:123636996T>C	ENST00000373896.3	-	2	276	c.24A>G	c.(22-24)ccA>ccG	p.P8P	PHF19_ENST00000312189.6_Silent_p.P8P	NM_015651.1	NP_056466.1	Q5T6S3	PHF19_HUMAN	PHD finger protein 19	8					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CCCGAGTCCCTGGATCCAGAG	0.552																																					p.P8P		.											.	PHF19	136	0			c.A24G						.						77.0	78.0	78.0					9																	123636996		2203	4300	6503	SO:0001819	synonymous_variant	26147	exon2			AGTCCCTGGATCC	BX640713	CCDS35116.1, CCDS35117.1, CCDS69648.1, CCDS75889.1	9q34.11	2013-01-28			ENSG00000119403	ENSG00000119403		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24566	protein-coding gene	gene with protein product	"""polycomb-like 3"", ""tudor domain containing 19B"""	609740				15563832	Standard	XM_005251906		Approved	DKFZP727G051, PCL3, MTF2L1, TDRD19B	uc004bks.1	Q5T6S3	OTTHUMG00000020577	ENST00000373896.3:c.24A>G	9.37:g.123636996T>C		58.0	0.0		63.0	4.0	NM_015651	Q32NF2|Q5T6S4|Q6N038|Q8TBL6|Q9UFS9	Silent	SNP	ENST00000373896.3	37	CCDS35116.1																																																																																			.		0.552	PHF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053838.3	XM_045308	
PHKA1	5255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	71915637	71915637	+	Silent	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:71915637C>T	ENST00000373542.4	-	4	534	c.375G>A	c.(373-375)gtG>gtA	p.V125V	PHKA1_ENST00000373545.3_Silent_p.V125V|PHKA1_ENST00000373539.3_Silent_p.V125V|PHKA1_ENST00000541944.1_Silent_p.V125V|PHKA1_ENST00000339490.3_Silent_p.V125V|PHKA1-AS1_ENST00000420998.1_RNA	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	125					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GATCATCACCCACTACAGTGG	0.458																																					p.V125V		.											.	PHKA1	134	0			c.G375A						.						157.0	133.0	141.0					X																	71915637		2202	4280	6482	SO:0001819	synonymous_variant	5255	exon4			ATCACCCACTACA		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.375G>A	X.37:g.71915637C>T		1273.0	1.0		886.0	223.0	NM_001172436	B7ZL05|B7ZL07|Q2M3D7	Silent	SNP	ENST00000373542.4	37	CCDS14421.1																																																																																			.		0.458	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
PHLDB2	90102	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	111604197	111604197	+	Silent	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:111604197C>T	ENST00000431670.2	+	2	1684	c.1273C>T	c.(1273-1275)Ctg>Ttg	p.L425L	PHLDB2_ENST00000478922.1_Silent_p.L425L|PHLDB2_ENST00000393923.3_Silent_p.L452L|PHLDB2_ENST00000412622.1_Silent_p.L425L|PHLDB2_ENST00000477695.1_Silent_p.L425L|PHLDB2_ENST00000481953.1_Silent_p.L425L|PHLDB2_ENST00000393925.3_Silent_p.L425L	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	425						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						ACGTGATGACCTGATGGATTA	0.522																																					p.L452L		.											.	PHLDB2	96	0			c.C1354T						.						74.0	78.0	77.0					3																	111604197		2203	4300	6503	SO:0001819	synonymous_variant	90102	exon3			GATGACCTGATGG		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.1273C>T	3.37:g.111604197C>T		73.0	1.0		66.0	18.0	NM_001134437	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Silent	SNP	ENST00000431670.2	37	CCDS46886.1																																																																																			.		0.522	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753	
PKD1L1	168507	hgsc.bcm.edu;bcgsc.ca	37	7	47898327	47898327	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr7:47898327T>C	ENST00000289672.2	-	27	4356	c.4306A>G	c.(4306-4308)Aag>Gag	p.K1436E		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1436	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						ACTTCCTCCTTCGAGTTTTCT	0.428																																					p.K1436E		.											.	PKD1L1	145	0			c.A4306G						.						176.0	174.0	175.0					7																	47898327		2203	4300	6503	SO:0001583	missense	168507	exon27			CCTCCTTCGAGTT	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.4306A>G	7.37:g.47898327T>C	ENSP00000289672:p.Lys1436Glu	80.0	0.0		77.0	4.0	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	T	10.93	1.489285	0.26686	.	.	ENSG00000158683	ENST00000289672	T	0.19250	2.16	5.03	-0.218	0.13142	Egg jelly receptor, REJ-like (1);	1.115740	0.06704	N	0.771982	T	0.11495	0.0280	L	0.34521	1.04	0.09310	N	1	B	0.28082	0.2	B	0.23716	0.048	T	0.26883	-1.0090	10	0.05436	T	0.98	-8.1515	4.2509	0.10695	0.0:0.1874:0.3461:0.4665	.	1436	Q8TDX9	PK1L1_HUMAN	E	1436	ENSP00000289672:K1436E	ENSP00000289672:K1436E	K	-	1	0	PKD1L1	47864852	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.309000	0.19332	0.020000	0.15106	-0.321000	0.08615	AAG	.		0.428	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
PKD1L1	168507	hgsc.bcm.edu;bcgsc.ca	37	7	47947753	47947753	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr7:47947753G>T	ENST00000289672.2	-	9	1373	c.1323C>A	c.(1321-1323)gcC>gcA	p.A441A		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	441					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						ACGCAGACACGGCCTCATGGC	0.458																																					p.A441A		.											.	PKD1L1	145	0			c.C1323A						.						118.0	102.0	107.0					7																	47947753		2203	4300	6503	SO:0001819	synonymous_variant	168507	exon9			AGACACGGCCTCA	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.1323C>A	7.37:g.47947753G>T		75.0	0.0		75.0	4.0	NM_138295	Q6UWK1	Silent	SNP	ENST00000289672.2	37	CCDS34633.1																																																																																			.		0.458	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
PLEK	5341	hgsc.bcm.edu;bcgsc.ca	37	2	68607861	68607861	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:68607861T>C	ENST00000234313.7	+	3	384	c.205T>C	c.(205-207)Ttt>Ctt	p.F69L		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	69	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		TCAGTTTGTGTTTAAGATCAC	0.478																																					p.F69L		.											.	PLEK	91	0			c.T205C						.						116.0	115.0	115.0					2																	68607861		2203	4300	6503	SO:0001583	missense	5341	exon3			TTTGTGTTTAAGA	X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.205T>C	2.37:g.68607861T>C	ENSP00000234313:p.Phe69Leu	111.0	0.0		95.0	5.0	NM_002664	B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Missense_Mutation	SNP	ENST00000234313.7	37	CCDS1887.1	.	.	.	.	.	.	.	.	.	.	T	17.66	3.445498	0.63178	.	.	ENSG00000115956	ENST00000234313	T	0.35236	1.32	5.79	5.79	0.91817	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.042653	0.85682	N	0.000000	T	0.42988	0.1227	M	0.74258	2.255	0.80722	D	1	B;B	0.13145	0.007;0.004	B;B	0.17433	0.018;0.015	T	0.30679	-0.9970	10	0.46703	T	0.11	.	16.1338	0.81465	0.0:0.0:0.0:1.0	.	87;69	Q59GZ2;P08567	.;PLEK_HUMAN	L	69	ENSP00000234313:F69L	ENSP00000234313:F69L	F	+	1	0	PLEK	68461365	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.676000	0.84012	2.216000	0.71823	0.528000	0.53228	TTT	.		0.478	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251755.1	NM_002664	
PLEKHG1	57480	hgsc.bcm.edu;bcgsc.ca	37	6	151152098	151152098	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr6:151152098A>G	ENST00000358517.2	+	15	2062	c.1851A>G	c.(1849-1851)acA>acG	p.T617T	PLEKHG1_ENST00000367328.1_Silent_p.T617T			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	617							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		AGAGCAACACATGCCCTCCTG	0.557																																					p.T617T		.											.	PLEKHG1	92	0			c.A1851G						.						60.0	55.0	57.0					6																	151152098		2203	4300	6503	SO:0001819	synonymous_variant	57480	exon16			CAACACATGCCCT	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.1851A>G	6.37:g.151152098A>G		114.0	0.0		62.0	4.0	NM_001029884	Q5T1F2	Silent	SNP	ENST00000358517.2	37	CCDS34552.1																																																																																			.		0.557	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
PLXNB2	23654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50720691	50720691	+	Silent	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr22:50720691C>T	ENST00000449103.1	-	19	3179	c.3039G>A	c.(3037-3039)agG>agA	p.R1013R	PLXNB2_ENST00000496720.1_5'Flank|PLXNB2_ENST00000359337.4_Silent_p.R1013R			O15031	PLXB2_HUMAN	plexin B2	1013	IPT/TIG 3.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCATGGCAAACCTCTGGATCA	0.682																																					p.R1013R		.											.	PLXNB2	211	0			c.G3039A						.						46.0	50.0	49.0					22																	50720691		2087	4191	6278	SO:0001819	synonymous_variant	23654	exon19			GGCAAACCTCTGG		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.3039G>A	22.37:g.50720691C>T		122.0	0.0		90.0	20.0	NM_012401	A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	ENST00000449103.1	37	CCDS43035.1																																																																																			.		0.682	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
PLXNB3	5365	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	153032892	153032892	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:153032892G>T	ENST00000361971.5	+	3	724	c.610G>T	c.(610-612)Gcc>Tcc	p.A204S	PLXNB3_ENST00000538966.1_Missense_Mutation_p.A227S|U52111.14_ENST00000416854.1_RNA|PLXNB3_ENST00000538543.1_Intron|PLXNB3_ENST00000538282.1_Intron|PLXNB3_ENST00000538776.1_Intron|U52111.14_ENST00000434284.1_RNA	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	204	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GCCACCCCTGGCCATCCGCCA	0.711																																					p.A227S		.											.	PLXNB3	130	0			c.G679T						.						10.0	10.0	10.0					X																	153032892		2165	4249	6414	SO:0001583	missense	5365	exon4			CCCCTGGCCATCC	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.610G>T	X.37:g.153032892G>T	ENSP00000355378:p.Ala204Ser	50.0	0.0		66.0	10.0	NM_001163257	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	G	6.317	0.426546	0.11987	.	.	ENSG00000198753	ENST00000538966;ENST00000361971	T;T	0.10668	2.85;2.85	4.79	0.894	0.19242	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	3.310250	0.01446	N	0.015302	T	0.04363	0.0120	N	0.02315	-0.6	0.19300	N	0.999976	B;B	0.14012	0.009;0.002	B;B	0.15052	0.012;0.007	T	0.37267	-0.9713	10	0.02654	T	1	.	7.8823	0.29629	0.7283:0.0:0.2717:0.0	.	227;204	F5H773;Q9ULL4	.;PLXB3_HUMAN	S	227;204	ENSP00000442736:A227S;ENSP00000355378:A204S	ENSP00000355378:A204S	A	+	1	0	PLXNB3	152686086	0.375000	0.25089	0.193000	0.23327	0.788000	0.44548	1.395000	0.34520	-0.197000	0.10350	-0.374000	0.07098	GCC	.		0.711	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
POLR2I	5438	hgsc.bcm.edu;bcgsc.ca	37	19	36605106	36605106	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:36605106G>T	ENST00000221859.4	-	4	725	c.236C>A	c.(235-237)cCg>cAg	p.P79Q	TBCB_ENST00000586868.1_5'Flank|TBCB_ENST00000589996.1_5'Flank|TBCB_ENST00000585746.1_5'Flank|TBCB_ENST00000221855.3_5'Flank	NM_006233.4	NP_006224.1	P36954	RPB9_HUMAN	polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa	79					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|maintenance of transcriptional fidelity during DNA-templated transcription elongation from RNA polymerase II promoter (GO:0001193)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|ovary(1)	3	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CTCGGTCCGCGGCAACGTGGG	0.627											OREG0025437	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P79Q		.											.	POLR2I	90	0			c.C236A						.						58.0	57.0	57.0					19																	36605106		2203	4300	6503	SO:0001583	missense	5438	exon4			GTCCGCGGCAACG		CCDS12487.1	19q13.12	2013-10-17	2002-08-29		ENSG00000105258	ENSG00000105258	2.7.7.6	"""RNA polymerase subunits"""	9196	protein-coding gene	gene with protein product		180662	"""polymerase (RNA) II (DNA directed) polypeptide I (14.5kD)"""			8034326	Standard	NM_006233		Approved	RPB9, hRPB14.5	uc002ode.3	P36954	OTTHUMG00000181749	ENST00000221859.4:c.236C>A	19.37:g.36605106G>T	ENSP00000221859:p.Pro79Gln	129.0	0.0	864	123.0	7.0	NM_006233	B2R5J2|Q6NW05	Missense_Mutation	SNP	ENST00000221859.4	37	CCDS12487.1	.	.	.	.	.	.	.	.	.	.	G	31	5.066869	0.93898	.	.	ENSG00000105258	ENST00000221859	T	0.46063	0.88	5.55	4.49	0.54785	.	0.000000	0.85682	D	0.000000	T	0.60971	0.2310	M	0.80847	2.515	0.80722	D	1	D	0.67145	0.996	P	0.61132	0.884	T	0.63928	-0.6526	10	0.59425	D	0.04	-33.6734	12.6656	0.56840	0.0816:0.0:0.9184:0.0	.	79	P36954	RPB9_HUMAN	Q	79	ENSP00000221859:P79Q	ENSP00000221859:P79Q	P	-	2	0	POLR2I	41296946	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	8.708000	0.91372	2.894000	0.99253	0.655000	0.94253	CCG	.		0.627	POLR2I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457442.1	NM_006233	
POPDC2	64091	hgsc.bcm.edu;bcgsc.ca	37	3	119378819	119378819	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:119378819T>C	ENST00000264231.3	-	1	618	c.452A>G	c.(451-453)gAg>gGg	p.E151G	POPDC2_ENST00000468801.1_Missense_Mutation_p.E151G|POPDC2_ENST00000493094.1_Missense_Mutation_p.E151G|POPDC2_ENST00000474523.1_5'UTR|POPDC2_ENST00000538678.1_Missense_Mutation_p.E151G	NM_022135.2	NP_071418.2	Q9HBU9	POPD2_HUMAN	popeye domain containing 2	151					regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sinoatrial node cell development (GO:0060931)	integral component of membrane (GO:0016021)	cAMP binding (GO:0030552)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.242)		GATGGGTGTCTCACCCTCCAC	0.542																																					p.E151G		.											.	POPDC2	90	0			c.A452G						.						134.0	132.0	133.0					3																	119378819		2203	4300	6503	SO:0001583	missense	64091	exon1			GGTGTCTCACCCT	AF204173	CCDS2992.1	3q13.33	2004-01-15			ENSG00000121577	ENSG00000121577			17648	protein-coding gene	gene with protein product		605823				10882522	Standard	NM_022135		Approved	POP2	uc031sbc.1	Q9HBU9	OTTHUMG00000159438	ENST00000264231.3:c.452A>G	3.37:g.119378819T>C	ENSP00000264231:p.Glu151Gly	96.0	0.0		76.0	5.0	NM_022135	Q86UE7	Missense_Mutation	SNP	ENST00000264231.3	37	CCDS2992.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.903812	0.92035	.	.	ENSG00000121577	ENST00000264231;ENST00000493094;ENST00000468801;ENST00000538678	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.69	5.69	0.88448	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.046397	0.85682	D	0.000000	T	0.42314	0.1197	L	0.34521	1.04	0.80722	D	1	D;D	0.67145	0.996;0.986	P;P	0.62813	0.857;0.907	T	0.15607	-1.0431	10	0.35671	T	0.21	.	15.9315	0.79663	0.0:0.0:0.0:1.0	.	151;151	Q9HBU9-2;Q9HBU9	.;POPD2_HUMAN	G	151	ENSP00000264231:E151G;ENSP00000417250:E151G;ENSP00000420715:E151G;ENSP00000438271:E151G	ENSP00000264231:E151G	E	-	2	0	POPDC2	120861509	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.136000	0.71703	2.162000	0.67917	0.533000	0.62120	GAG	.		0.542	POPDC2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000355378.1	NM_022135	
PPFIA3	8541	broad.mit.edu;bcgsc.ca	37	19	49636569	49636569	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:49636569G>A	ENST00000334186.4	+	9	1451	c.1102G>A	c.(1102-1104)Gcg>Acg	p.A368T	PPFIA3_ENST00000602351.1_Missense_Mutation_p.A368T	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	368					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		GCTGCAGAAAGCGGAGACCTT	0.677																																					p.A368T		.											.	PPFIA3	226	0			c.G1102A						.						29.0	31.0	30.0					19																	49636569		2196	4289	6485	SO:0001583	missense	8541	exon9			CAGAAAGCGGAGA	AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.1102G>A	19.37:g.49636569G>A	ENSP00000335614:p.Ala368Thr	155.0	1.0		163.0	27.0	NM_003660	A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Missense_Mutation	SNP	ENST00000334186.4	37	CCDS12758.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.387125	0.82902	.	.	ENSG00000177380	ENST00000334186;ENST00000421230	T	0.38887	1.11	3.91	3.91	0.45181	.	0.655851	0.12427	N	0.469889	T	0.64068	0.2565	M	0.86028	2.79	0.58432	D	0.999995	P;P;B	0.44521	0.837;0.754;0.093	P;P;B	0.54238	0.628;0.746;0.151	T	0.69412	-0.5152	10	0.72032	D	0.01	-1.4624	15.2619	0.73631	0.0:0.0:1.0:0.0	.	292;368;368	B4DEU8;O75145-2;O75145	.;.;LIPA3_HUMAN	T	368;292	ENSP00000335614:A368T	ENSP00000335614:A368T	A	+	1	0	PPFIA3	54328381	1.000000	0.71417	0.983000	0.44433	0.842000	0.47809	7.742000	0.85008	2.213000	0.71641	0.555000	0.69702	GCG	.		0.677	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465688.1	NM_003660	
PPP4R1	9989	hgsc.bcm.edu;bcgsc.ca	37	18	9557375	9557375	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr18:9557375T>C	ENST00000400556.3	-	15	2107	c.2034A>G	c.(2032-2034)aaA>aaG	p.K678K	PPP4R1_ENST00000400555.3_Silent_p.K661K	NM_001042388.2	NP_001035847.1	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	678					dephosphorylation (GO:0016311)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase 4 complex (GO:0030289)	protein phosphatase type 4 regulator activity (GO:0030362)			large_intestine(1)|skin(2)	3						TTCGTCGAACTTTCCACTGCA	0.358																																					p.K678K	Melanoma(188;1232 2082 5061 11948 35994)	.											.	PPP4R1	227	0			c.A2034G						.						109.0	103.0	105.0					18																	9557375		1860	4103	5963	SO:0001819	synonymous_variant	9989	exon15			TCGAACTTTCCAC	AF111106	CCDS42412.1, CCDS42413.1	18p11.22	2010-06-18			ENSG00000154845	ENSG00000154845		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	9320	protein-coding gene	gene with protein product		604908				10026142	Standard	NM_001042388		Approved	PP4R1	uc002koe.2	Q8TF05	OTTHUMG00000137466	ENST00000400556.3:c.2034A>G	18.37:g.9557375T>C		94.0	0.0		78.0	4.0	NM_001042388	Q99774|Q9UNQ7	Silent	SNP	ENST00000400556.3	37	CCDS42412.1																																																																																			.		0.358	PPP4R1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268571.1	NM_005134	
PRAMEF18	391003	broad.mit.edu;bcgsc.ca	37	1	13475005	13475005	+	Missense_Mutation	SNP	C	C	T	rs376569101		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:13475005C>T	ENST00000376126.2	-	3	1123	c.1124G>A	c.(1123-1125)cGc>cAc	p.R375H		NM_001099850.1	NP_001093320.1	Q5VWM3	PRA18_HUMAN	PRAME family member 18	375					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					lung(2)|ovary(1)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GTTGGAGCAGCGGCTCAGGGC	0.562																																					p.R375H		.											.	.	.	0			c.G1124A						.	C	HIS/ARG	1,4401	2.1+/-5.4	0,1,2200	108.0	119.0	115.0		1124	-0.5	0.4	1		115	0,8594		0,0,4297	no	missense	PRAMEF18	NM_001099850.1	29	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	benign	375/480	13475005	1,12995	2201	4297	6498	SO:0001583	missense	645414	exon3			GAGCAGCGGCTCA			1p36.21	2013-01-17			ENSG00000204491			"""-"""	30693	protein-coding gene	gene with protein product							Standard			Approved	OTTHUMG00000002932		Q5VWM3	OTTHUMG00000002932	ENST00000376126.2:c.1124G>A	1.37:g.13475005C>T	ENSP00000365294:p.Arg375His	1324.0	1.0		909.0	227.0	NM_001099790		Missense_Mutation	SNP	ENST00000376126.2	37	CCDS41258.1	.	.	.	.	.	.	.	.	.	.	C	6.449	0.451064	0.12223	2.27E-4	0.0	ENSG00000204491	ENST00000376126	T	0.09538	2.97	1.66	-0.474	0.12108	.	1.164400	0.06173	N	0.678136	T	0.05777	0.0151	N	0.12961	0.28	0.09310	N	0.999992	B	0.14805	0.011	B	0.10450	0.005	T	0.43766	-0.9371	10	0.21014	T	0.42	.	3.9834	0.09504	0.0:0.519:0.0:0.481	.	375	Q5VWM3	PRA18_HUMAN	H	375	ENSP00000365294:R375H	ENSP00000365294:R375H	R	-	2	0	PRAMEF18	13347592	0.883000	0.30277	0.394000	0.26270	0.351000	0.29236	-0.704000	0.05058	-0.140000	0.11394	0.195000	0.17529	CGC	.		0.562	PRAMEF18-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008177.2	NM_001099850	
PREX2	80243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	69104651	69104651	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr8:69104651G>A	ENST00000288368.4	+	37	4772	c.4495G>A	c.(4495-4497)Gca>Aca	p.A1499T		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1499					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AGCTGCCTGTGCAAACACAGC	0.537																																					p.A1499T		.											.	PREX2	390	0			c.G4495A						.						78.0	64.0	69.0					8																	69104651		2203	4300	6503	SO:0001583	missense	80243	exon37			GCCTGTGCAAACA	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.4495G>A	8.37:g.69104651G>A	ENSP00000288368:p.Ala1499Thr	73.0	0.0		68.0	17.0	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	G	18.50	3.636432	0.67130	.	.	ENSG00000046889	ENST00000288368	T	0.59906	0.23	4.89	4.89	0.63831	.	0.494062	0.21652	N	0.071168	T	0.42539	0.1207	N	0.11560	0.145	0.35876	D	0.828574	B	0.10296	0.003	B	0.17098	0.017	T	0.45056	-0.9287	10	0.39692	T	0.17	.	18.4181	0.90577	0.0:0.0:1.0:0.0	.	1499	Q70Z35	PREX2_HUMAN	T	1499	ENSP00000288368:A1499T	ENSP00000288368:A1499T	A	+	1	0	PREX2	69267205	0.992000	0.36948	0.982000	0.44146	0.991000	0.79684	5.460000	0.66691	2.427000	0.82271	0.467000	0.42956	GCA	.		0.537	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
PRF1	5551	hgsc.bcm.edu;bcgsc.ca	37	10	72357906	72357906	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr10:72357906C>A	ENST00000441259.1	-	3	1731	c.1571G>T	c.(1570-1572)aGg>aTg	p.R524M	PRF1_ENST00000373209.2_Missense_Mutation_p.R524M	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	524					apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						GGGCAAGCACCTGGCATGATA	0.582			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																												p.R524M		.	yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	.	PRF1	578	0			c.G1571T						.						106.0	100.0	102.0					10																	72357906		2203	4300	6503	SO:0001583	missense	5551	exon3	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AAGCACCTGGCAT	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.1571G>T	10.37:g.72357906C>A	ENSP00000398568:p.Arg524Met	88.0	0.0		79.0	6.0	NM_001083116	B2R6X4|Q59F57|Q86WX7	Missense_Mutation	SNP	ENST00000441259.1	37	CCDS7305.1	.	.	.	.	.	.	.	.	.	.	C	11.54	1.667704	0.29604	.	.	ENSG00000180644	ENST00000373209;ENST00000441259;ENST00000318971	D;D	0.91237	-2.81;-2.81	5.97	-11.9	0.00025	.	1.068430	0.07158	N	0.850236	T	0.78553	0.4301	N	0.14661	0.345	0.09310	N	1	B	0.13145	0.007	B	0.11329	0.006	T	0.65849	-0.6068	10	0.49607	T	0.09	-3.7194	12.2817	0.54767	0.0714:0.196:0.6362:0.0964	.	524	P14222	PERF_HUMAN	M	524	ENSP00000362305:R524M;ENSP00000398568:R524M	ENSP00000316746:R524M	R	-	2	0	PRF1	72027912	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.888000	0.01616	-2.925000	0.00303	-2.226000	0.00293	AGG	.		0.582	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048517.2	NM_005041	
PRKD1	5587	hgsc.bcm.edu;bcgsc.ca	37	14	30068321	30068321	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr14:30068321G>A	ENST00000331968.5	-	15	2307	c.2078C>T	c.(2077-2079)gCt>gTt	p.A693V	PRKD1_ENST00000415220.2_Missense_Mutation_p.A701V	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	693	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		GTGCCGCAAAGCCACGAGTAT	0.358																																					p.A693V		.											.	PRKD1	1534	0			c.C2078T						.						90.0	89.0	89.0					14																	30068321		2203	4300	6503	SO:0001583	missense	5587	exon15			CGCAAAGCCACGA		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2078C>T	14.37:g.30068321G>A	ENSP00000333568:p.Ala693Val	101.0	0.0		70.0	4.0	NM_002742	A6NL64|B2RAF6	Missense_Mutation	SNP	ENST00000331968.5	37	CCDS9637.1	.	.	.	.	.	.	.	.	.	.	G	34	5.352183	0.95830	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	D;D	0.88124	-2.34;-2.34	5.58	5.58	0.84498	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94618	0.8265	M	0.87269	2.87	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.94831	0.7996	10	0.87932	D	0	-15.3433	19.9348	0.97133	0.0:0.0:1.0:0.0	.	693	Q15139	KPCD1_HUMAN	V	693;701	ENSP00000333568:A693V;ENSP00000390535:A701V	ENSP00000333568:A693V	A	-	2	0	PRKD1	29138072	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.740000	0.98839	2.789000	0.95967	0.591000	0.81541	GCT	.		0.358	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742	
PRKCH	5583	hgsc.bcm.edu;bcgsc.ca	37	14	61920071	61920071	+	Splice_Site	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr14:61920071G>T	ENST00000332981.5	+	7	1345	c.960G>T	c.(958-960)tcG>tcT	p.S320S	PRKCH_ENST00000555082.1_Splice_Site_p.S159S	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	320					blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		CTCCAACCTCGGTGAGACTTT	0.483																																					p.S320S	Melanoma(135;863 1779 8064 14443 26348)	.											.	PRKCH	1063	0			c.G960T						.						76.0	64.0	68.0					14																	61920071		2203	4300	6503	SO:0001630	splice_region_variant	5583	exon7			AACCTCGGTGAGA	M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.960+1G>T	14.37:g.61920071G>T		114.0	0.0		112.0	5.0	NM_006255	B4DJN5|Q16246|Q8NE03	Silent	SNP	ENST00000332981.5	37	CCDS9752.1																																																																																			.		0.483	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276974.2	NM_006255	Silent
PROM2	150696	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	95950732	95950732	+	Missense_Mutation	SNP	C	C	T	rs553459907		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:95950732C>T	ENST00000317620.9	+	15	1877	c.1744C>T	c.(1744-1746)Cgg>Tgg	p.R582W	PROM2_ENST00000542147.1_Intron|PROM2_ENST00000403131.2_Missense_Mutation_p.R582W|PROM2_ENST00000317668.4_Missense_Mutation_p.R582W	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	582					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						CAACAAGCTACGGCAGGAGTT	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		17713	0.001		0.0	False		,,,				2504	0.0				p.R582W		.											.	PROM2	91	0			c.C1744T						.						33.0	30.0	31.0					2																	95950732		2203	4299	6502	SO:0001583	missense	150696	exon15			AAGCTACGGCAGG	AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.1744C>T	2.37:g.95950732C>T	ENSP00000318270:p.Arg582Trp	199.0	1.0		136.0	46.0	NM_001165977	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Missense_Mutation	SNP	ENST00000317620.9	37	CCDS2012.1	.	.	.	.	.	.	.	.	.	.	C	8.245	0.807747	0.16467	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620	T;T;T	0.44881	0.91;0.91;0.91	4.35	1.39	0.22231	.	0.549033	0.17264	N	0.180667	T	0.21427	0.0516	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16394	-1.0404	10	0.56958	D	0.05	-2.6235	8.3516	0.32305	0.0:0.5884:0.3185:0.0931	.	582	Q8N271	PROM2_HUMAN	W	582	ENSP00000385716:R582W;ENSP00000318520:R582W;ENSP00000318270:R582W	ENSP00000318270:R582W	R	+	1	2	PROM2	95314459	0.022000	0.18835	0.001000	0.08648	0.000000	0.00434	-0.029000	0.12329	-0.148000	0.11234	-1.598000	0.00824	CGG	.		0.627	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707	
PSD2	84249	hgsc.bcm.edu;bcgsc.ca	37	5	139189371	139189371	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr5:139189371C>A	ENST00000274710.3	+	2	551	c.346C>A	c.(346-348)Cca>Aca	p.P116T		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	116					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCCTCTACCCAGATGCTGA	0.592																																					p.P116T		.											.	PSD2	91	0			c.C346A						.						65.0	73.0	71.0					5																	139189371		2203	4300	6503	SO:0001583	missense	84249	exon2			CTCTACCCAGATG	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.346C>A	5.37:g.139189371C>A	ENSP00000274710:p.Pro116Thr	64.0	0.0		113.0	5.0	NM_032289	D3DQD3|Q8N3J8	Missense_Mutation	SNP	ENST00000274710.3	37	CCDS4216.1	.	.	.	.	.	.	.	.	.	.	C	2.704	-0.270254	0.05716	.	.	ENSG00000146005	ENST00000274710	T	0.26223	1.75	4.75	-1.13	0.09775	.	1.428600	0.04426	N	0.368474	T	0.17365	0.0417	N	0.19112	0.55	0.09310	N	1	B	0.13594	0.008	B	0.14578	0.011	T	0.30119	-0.9989	10	0.25106	T	0.35	.	9.8505	0.41055	0.0:0.3107:0.5936:0.0957	.	116	Q9BQI7	PSD2_HUMAN	T	116	ENSP00000274710:P116T	ENSP00000274710:P116T	P	+	1	0	PSD2	139169555	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	0.314000	0.19432	-0.331000	0.08501	-0.367000	0.07326	CCA	.		0.592	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
PSMG1	8624	hgsc.bcm.edu;bcgsc.ca	37	21	40553799	40553799	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr21:40553799A>G	ENST00000331573.3	-	2	605	c.140T>C	c.(139-141)gTg>gCg	p.V47A	AF129408.17_ENST00000608767.1_RNA|PSMG1_ENST00000380900.2_Missense_Mutation_p.V47A	NM_001261824.1|NM_003720.3	NP_001248753.1|NP_003711.1	O95456	PSMG1_HUMAN	proteasome (prosome, macropain) assembly chaperone 1	47					cerebellar granule cell precursor proliferation (GO:0021930)|proteasome assembly (GO:0043248)|proteasome core complex assembly (GO:0080129)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	8		Prostate(19;8.44e-08)				AAGGAGCCGCACTTCCCTAAC	0.328																																					p.V47A		.											.	PSMG1	68	0			c.T140C						.						46.0	46.0	46.0					21																	40553799		2202	4299	6501	SO:0001583	missense	8624	exon2			AGCCGCACTTCCC	AJ006291	CCDS13660.1, CCDS13661.1	21q22.3	2007-10-23	2007-10-23	2007-10-23	ENSG00000183527	ENSG00000183527			3043	protein-coding gene	gene with protein product		605296	"""Down syndrome critical region gene 2"""	DSCR2		10872820, 17189198	Standard	NM_003720		Approved	c21-LRP, LRPC21, PAC1	uc002yxi.4	O95456	OTTHUMG00000066034	ENST00000331573.3:c.140T>C	21.37:g.40553799A>G	ENSP00000329915:p.Val47Ala	94.0	0.0		89.0	6.0	NM_203433	B5BUN2|Q6FHA3|Q6FHD3|Q6S713	Missense_Mutation	SNP	ENST00000331573.3	37	CCDS13660.1	.	.	.	.	.	.	.	.	.	.	A	18.01	3.526782	0.64860	.	.	ENSG00000183527	ENST00000331573;ENST00000380900	T;T	0.57436	0.4;0.4	5.46	5.46	0.80206	.	0.191307	0.44285	D	0.000475	T	0.54951	0.1890	M	0.75264	2.295	0.42482	D	0.992866	B;B	0.33940	0.433;0.433	B;B	0.34452	0.183;0.183	T	0.61317	-0.7087	10	0.66056	D	0.02	-23.2354	13.4991	0.61442	1.0:0.0:0.0:0.0	.	47;47	O95456-2;O95456	.;PSMG1_HUMAN	A	47	ENSP00000329915:V47A;ENSP00000370286:V47A	ENSP00000329915:V47A	V	-	2	0	PSMG1	39475669	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.707000	0.68370	2.069000	0.61940	0.459000	0.35465	GTG	.		0.328	PSMG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141404.2	NM_003720	
PTK2	5747	hgsc.bcm.edu;bcgsc.ca	37	8	141753415	141753415	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr8:141753415C>A	ENST00000522684.1	-	20	1878	c.1649G>T	c.(1648-1650)cGg>cTg	p.R550L	PTK2_ENST00000520151.1_3'UTR|PTK2_ENST00000538769.1_Missense_Mutation_p.R218L|PTK2_ENST00000517887.1_Missense_Mutation_p.R594L|PTK2_ENST00000395218.2_Missense_Mutation_p.R550L|PTK2_ENST00000521059.1_Missense_Mutation_p.R550L|PTK2_ENST00000519465.1_Missense_Mutation_p.R178L|PTK2_ENST00000519419.1_Missense_Mutation_p.R594L|PTK2_ENST00000340930.3_Missense_Mutation_p.R550L|PTK2_ENST00000535192.1_Missense_Mutation_p.R550L	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	550	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			CAGAACATTCCGAGCAGCAAT	0.338																																					p.R572L		.											.	PTK2	1517	0			c.G1715T						.						105.0	102.0	103.0					8																	141753415		2203	4300	6503	SO:0001583	missense	5747	exon20			ACATTCCGAGCAG	L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.1649G>T	8.37:g.141753415C>A	ENSP00000429911:p.Arg550Leu	76.0	0.0		91.0	4.0	NM_005607	B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	ENST00000522684.1	37	CCDS6381.1	.	.	.	.	.	.	.	.	.	.	C	34	5.346651	0.95807	.	.	ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000519465;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000354438;ENST00000395221;ENST00000523539;ENST00000340930;ENST00000538769;ENST00000519419;ENST00000521986;ENST00000342207	D;D;D;D;D;D;D;D;D;D;D	0.87729	-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29	5.2	5.2	0.72013	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94499	0.8229	M	0.86864	2.845	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.997;0.999;0.996;1.0;0.996;0.996;0.999;0.999;0.996	D	0.95265	0.8372	10	0.87932	D	0	.	18.7608	0.91849	0.0:1.0:0.0:0.0	.	550;245;470;550;572;550;502;398;218;178	B4E2N6;B4DH13;Q59GN8;Q05397;Q658W2;Q8IYN9;Q59GM6;Q05397-2;Q8N9D7;E9PEI4	.;.;.;FAK1_HUMAN;.;.;.;.;.;.	L	550;550;178;594;550;502;550;471;245;222;550;218;594;248;396	ENSP00000429911:R550L;ENSP00000438009:R550L;ENSP00000429170:R178L;ENSP00000429082:R594L;ENSP00000429474:R550L;ENSP00000378644:R550L;ENSP00000428492:R222L;ENSP00000341189:R550L;ENSP00000445742:R218L;ENSP00000429129:R594L;ENSP00000430603:R248L	ENSP00000341189:R550L	R	-	2	0	PTK2	141822597	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.642000	0.83385	2.442000	0.82660	0.591000	0.81541	CGG	.		0.338	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	
PTPN21	11099	hgsc.bcm.edu;bcgsc.ca	37	14	88974267	88974267	+	Splice_Site	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr14:88974267C>T	ENST00000556564.1	-	4	732	c.448G>A	c.(448-450)Gcg>Acg	p.A150T	PTPN21_ENST00000554628.1_5'UTR|PTPN21_ENST00000328736.3_Splice_Site_p.A150T|RP11-507K2.2_ENST00000555444.1_RNA	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	150	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TCTTATTTACCTTGAACAGCT	0.313																																					p.A150T		.											.	PTPN21	230	0			c.G448A						.						73.0	68.0	70.0					14																	88974267		2202	4299	6501	SO:0001630	splice_region_variant	11099	exon4			ATTTACCTTGAAC	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.448+1G>A	14.37:g.88974267C>T		95.0	0.0		79.0	4.0	NM_007039		Missense_Mutation	SNP	ENST00000556564.1	37	CCDS9884.1	.	.	.	.	.	.	.	.	.	.	C	35	5.508892	0.96386	.	.	ENSG00000070778	ENST00000328736;ENST00000556564;ENST00000555243	T;T;T	0.79554	-1.28;-1.28;-1.28	5.36	5.36	0.76844	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.137638	0.48767	D	0.000178	D	0.92080	0.7490	M	0.91510	3.215	0.53005	D	0.999963	D;P	0.89917	1.0;0.875	D;P	0.78314	0.991;0.672	D	0.93399	0.6758	9	.	.	.	.	19.0908	0.93225	0.0:1.0:0.0:0.0	.	150;150	G3V3S6;Q16825	.;PTN21_HUMAN	T	150	ENSP00000330276:A150T;ENSP00000452414:A150T;ENSP00000451401:A150T	.	A	-	1	0	PTPN21	88044020	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.818000	0.86416	2.498000	0.84270	0.591000	0.81541	GCG	.		0.313	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1		Missense_Mutation
PTPRF	5792	hgsc.bcm.edu;bcgsc.ca	37	1	44083444	44083444	+	Silent	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:44083444C>A	ENST00000359947.4	+	25	4573	c.4233C>A	c.(4231-4233)atC>atA	p.I1411I	PTPRF_ENST00000422171.2_Silent_p.I770I|PTPRF_ENST00000438120.1_Silent_p.I1402I|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000372414.3_Silent_p.I1411I|PTPRF_ENST00000372413.3_Silent_p.I1402I	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1411	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCAACTACATCGATGGCTACC	0.602																																					p.I1411I		.											.	PTPRF	232	0			c.C4233A						.						63.0	62.0	62.0					1																	44083444		2203	4300	6503	SO:0001819	synonymous_variant	5792	exon25			CTACATCGATGGC	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.4233C>A	1.37:g.44083444C>A		144.0	0.0		116.0	6.0	NM_002840	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Silent	SNP	ENST00000359947.4	37	CCDS489.2	.	.	.	.	.	.	.	.	.	.	C	9.798	1.179769	0.21787	.	.	ENSG00000142949	ENST00000429895	.	.	.	5.58	-0.477	0.12097	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.5273	0.11988	0.226:0.3766:0.0:0.3974	.	.	.	.	X	1057	.	.	S	+	2	0	PTPRF	43856031	0.000000	0.05858	1.000000	0.80357	0.977000	0.68977	-2.533000	0.00942	0.237000	0.21200	-0.727000	0.03589	TCG	.		0.602	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
PTPRM	5797	hgsc.bcm.edu;bcgsc.ca	37	18	8378411	8378411	+	Splice_Site	SNP	G	G	T	rs202020478		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr18:8378411G>T	ENST00000332175.8	+	25	4609	c.3572G>T	c.(3571-3573)cGg>cTg	p.R1191L	PTPRM_ENST00000580170.1_Splice_Site_p.R1204L|PTPRM_ENST00000400053.4_Splice_Site_p.R1129L|PTPRM_ENST00000444013.1_Splice_Site_p.R978L|PTPRM_ENST00000400060.4_Splice_Site_p.R1205L	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1191	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GAGGAATTCCGGGTAAGTGAT	0.498																																					p.R1204L		.											.	PTPRM	228	0			c.G3611T						.						116.0	97.0	103.0					18																	8378411		2203	4300	6503	SO:0001630	splice_region_variant	5797	exon27			AATTCCGGGTAAG	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3573+1G>T	18.37:g.8378411G>T		156.0	0.0		87.0	4.0	NM_001105244	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.455861	0.84209	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.7	4.82	0.62117	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.058926	0.64402	D	0.000004	T	0.21186	0.0510	N	0.11673	0.155	0.80722	D	1	B;B;B	0.19817	0.006;0.039;0.039	B;B;B	0.22880	0.016;0.042;0.042	T	0.04203	-1.0969	10	0.72032	D	0.01	.	16.6777	0.85283	0.0:0.1298:0.8702:0.0	.	978;1204;1191	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	L	1191;1205;1129;978	ENSP00000331418:R1191L;ENSP00000382933:R1205L;ENSP00000382927:R1129L;ENSP00000387608:R978L	ENSP00000331418:R1191L	R	+	2	0	PTPRM	8368411	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.812000	0.75226	1.380000	0.46344	0.591000	0.81541	CGG	G|0.999;A|0.001		0.498	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		Missense_Mutation
PTPRS	5802	hgsc.bcm.edu;bcgsc.ca	37	19	5208037	5208037	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:5208037T>C	ENST00000587303.1	-	36	5773	c.5674A>G	c.(5674-5676)Acg>Gcg	p.T1892A	PTPRS_ENST00000588012.1_Missense_Mutation_p.T1854A|PTPRS_ENST00000348075.2_Missense_Mutation_p.T1854A|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000357368.4_Missense_Mutation_p.T1892A|PTPRS_ENST00000262963.6_Missense_Mutation_p.T1872A|PTPRS_ENST00000353284.2_Missense_Mutation_p.T1445A|PTPRS_ENST00000372412.4_Missense_Mutation_p.T1893A|PTPRS_ENST00000592099.1_Missense_Mutation_p.T1445A			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	1892	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	ATGCTAAGCGTGATGAAGACG	0.617																																					p.T1892A		.											.	PTPRS	357	0			c.A5674G						.						78.0	59.0	66.0					19																	5208037		2203	4300	6503	SO:0001583	missense	5802	exon37			TAAGCGTGATGAA	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.5674A>G	19.37:g.5208037T>C	ENSP00000467537:p.Thr1892Ala	63.0	0.0		52.0	4.0	NM_002850	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	T	14.94	2.685739	0.47991	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.09630	2.96;2.96;2.96;2.96;2.96	2.78	2.78	0.32641	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.64402	U	0.000002	T	0.08223	0.0205	N	0.00563	-1.375	0.80722	D	1	D;B;P;B;D;D	0.76494	0.999;0.05;0.882;0.384;0.995;0.995	D;B;P;B;D;D	0.87578	0.998;0.042;0.693;0.302;0.997;0.997	T	0.54609	-0.8268	10	0.66056	D	0.02	.	10.8984	0.47036	0.0:0.0:0.0:1.0	.	1474;1445;1449;1854;1892;1487	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	A	1487;1893;1892;1892;1883;1872;1854;1474;1449;1445	ENSP00000361489:T1893A;ENSP00000349932:T1892A;ENSP00000262963:T1872A;ENSP00000269907:T1854A;ENSP00000327313:T1445A	ENSP00000262963:T1872A	T	-	1	0	PTPRS	5159037	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	4.918000	0.63376	1.147000	0.42369	0.386000	0.25728	ACG	.		0.617	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		
PTPRS	5802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	5216748	5216748	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:5216748G>A	ENST00000587303.1	-	25	4178	c.4079C>T	c.(4078-4080)cCg>cTg	p.P1360L	PTPRS_ENST00000588012.1_Intron|PTPRS_ENST00000348075.2_Intron|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000357368.4_Missense_Mutation_p.P1360L|PTPRS_ENST00000262963.6_Intron|PTPRS_ENST00000353284.2_Intron|PTPRS_ENST00000372412.4_Missense_Mutation_p.P1361L|PTPRS_ENST00000592099.1_Intron			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	1360					cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	GTGAAACCCCGGCTCCCTGAG	0.532																																					p.P1360L		.											.	PTPRS	357	0			c.C4079T						.						36.0	44.0	41.0					19																	5216748		1851	4080	5931	SO:0001583	missense	5802	exon26			AACCCCGGCTCCC	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.4079C>T	19.37:g.5216748G>A	ENSP00000467537:p.Pro1360Leu	460.0	0.0		369.0	69.0	NM_002850	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.056332	0.36277	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000355322	T;T	0.52526	0.68;0.66	3.42	3.42	0.39159	.	0.947250	0.08463	U	0.942100	T	0.25419	0.0618	N	0.14661	0.345	0.80722	D	1	P;P	0.49253	0.524;0.921	B;B	0.26517	0.029;0.07	T	0.15065	-1.0450	10	0.72032	D	0.01	.	10.6094	0.45412	0.0:0.0:0.8074:0.1926	.	1360;955	Q13332;Q59FX6	PTPRS_HUMAN;.	L	955;1361;1360;1360;1351;942	ENSP00000361489:P1361L;ENSP00000349932:P1360L	ENSP00000347106:P1360L	P	-	2	0	PTPRS	5167748	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	5.412000	0.66392	1.614000	0.50241	0.462000	0.41574	CCG	.		0.532	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		
PTS	5805	hgsc.bcm.edu;bcgsc.ca	37	11	112104184	112104184	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:112104184G>T	ENST00000280362.3	+	6	423	c.344G>T	c.(343-345)tGg>tTg	p.W115L	PTS_ENST00000525803.1_3'UTR|PTS_ENST00000524931.1_Missense_Mutation_p.W47L	NM_000317.2	NP_000308.1	Q03393	PTPS_HUMAN	6-pyruvoyltetrahydropterin synthase	115					cellular amino acid metabolic process (GO:0006520)|central nervous system development (GO:0007417)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	6-pyruvoyltetrahydropterin synthase activity (GO:0003874)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|large_intestine(1)	2		all_cancers(61;2.51e-14)|all_epithelial(67;1.64e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.27e-06)|BRCA - Breast invasive adenocarcinoma(274;1.43e-06)|all cancers(92;2.1e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0519)		GTTTATATCTGGGACAACCTC	0.274																																					p.W115L		.											.	PTS	90	0			c.G344T						.						41.0	44.0	43.0					11																	112104184		2199	4296	6495	SO:0001583	missense	5805	exon6			ATATCTGGGACAA	U63382	CCDS8359.1	11q22.3	2014-04-01				ENSG00000150787	4.2.3.12		9689	protein-coding gene	gene with protein product		612719				8188266	Standard	NM_000317		Approved	PTPS	uc001pnj.4	Q03393		ENST00000280362.3:c.344G>T	11.37:g.112104184G>T	ENSP00000280362:p.Trp115Leu	114.0	0.0		93.0	5.0	NM_000317	B0YJ87|Q8WVG8	Missense_Mutation	SNP	ENST00000280362.3	37	CCDS8359.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.910445	0.92107	.	.	ENSG00000150787	ENST00000280362;ENST00000524931	D;D	0.99311	-5.73;-5.73	6.01	6.01	0.97437	.	0.054479	0.85682	D	0.000000	D	0.99417	0.9794	M	0.83852	2.665	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.99047	1.0826	10	0.72032	D	0.01	-6.6916	17.2452	0.87026	0.0:0.0:1.0:0.0	.	115	Q03393	PTPS_HUMAN	L	115;47	ENSP00000280362:W115L;ENSP00000434688:W47L	ENSP00000280362:W115L	W	+	2	0	PTS	111609394	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	8.828000	0.92047	2.845000	0.97973	0.643000	0.83706	TGG	.		0.274	PTS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393541.1	NM_000317	
PUF60	22827	hgsc.bcm.edu;bcgsc.ca	37	8	144904074	144904074	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr8:144904074A>G	ENST00000526683.1	-	3	676	c.121T>C	c.(121-123)Tcc>Ccc	p.S41P	PUF60_ENST00000527197.1_Missense_Mutation_p.S12P|PUF60_ENST00000313352.7_5'UTR|PUF60_ENST00000349157.6_Missense_Mutation_p.S41P|PUF60_ENST00000524570.1_5'UTR|PUF60_ENST00000453551.2_5'UTR|PUF60_ENST00000456095.2_Missense_Mutation_p.S12P	NM_001271098.1|NM_078480.2	NP_001258027.1|NP_510965.1	Q9UHX1	PUF60_HUMAN	poly-U binding splicing factor 60KDa	41	Inhibits homodimerization.				apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(3)|lung(7)|prostate(2)	14	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			ATCTTGATGGAGTCTGTGCCC	0.632																																					p.S41P		.											.	.	.	0			c.T121C						.						30.0	35.0	33.0					8																	144904074		2050	4183	6233	SO:0001583	missense	22827	exon3			TGATGGAGTCTGT	AF114818	CCDS47933.1, CCDS47934.1, CCDS47935.1, CCDS59514.1, CCDS59515.1, CCDS59516.1	8q24.3	2013-02-12	2007-07-27		ENSG00000179950	ENSG00000179950		"""RNA binding motif (RRM) containing"""	17042	protein-coding gene	gene with protein product	"""siah binding protein 1"", ""FBP interacting repressor"", ""pyrimidine tract binding splicing factor"", ""Ro ribonucleoprotein binding protein 1"""	604819				10668799, 10882074, 17579712	Standard	NM_078480		Approved	FIR, SIAHBP1, RoBPI	uc003yzs.4	Q9UHX1	OTTHUMG00000165155	ENST00000526683.1:c.121T>C	8.37:g.144904074A>G	ENSP00000434359:p.Ser41Pro	61.0	0.0		61.0	4.0	NM_078480	A8K8K8|Q969E7|Q96D94|Q96H63|Q99628|Q9NZA0|Q9UJY7	Missense_Mutation	SNP	ENST00000526683.1	37	CCDS47934.1	.	.	.	.	.	.	.	.	.	.	A	15.62	2.888214	0.52014	.	.	ENSG00000179950	ENST00000526683;ENST00000456095;ENST00000349157;ENST00000527197;ENST00000526459;ENST00000529999;ENST00000531897;ENST00000533162	T;T;T;T;T;T;T;T	0.21543	2.53;2.59;2.42;2.51;2.59;3.43;3.35;2.0	5.13	-2.14	0.07123	.	.	.	.	.	T	0.08492	0.0211	N	0.08118	0	0.35256	D	0.779152	P;B;P	0.52316	0.952;0.0;0.92	B;B;B	0.44315	0.446;0.0;0.178	T	0.42292	-0.9460	9	0.39692	T	0.17	.	0.7891	0.01054	0.4676:0.1478:0.1474:0.2372	.	12;41;41	Q9UHX1-5;Q9UHX1-2;Q9UHX1	.;.;PUF60_HUMAN	P	41;12;41;12;40;78;78;78	ENSP00000434359:S41P;ENSP00000395417:S12P;ENSP00000322036:S41P;ENSP00000431960:S12P;ENSP00000432610:S40P;ENSP00000434863:S78P;ENSP00000437309:S78P;ENSP00000433403:S78P	ENSP00000322036:S41P	S	-	1	0	PUF60	144976062	0.849000	0.29639	0.513000	0.27749	0.942000	0.58702	0.603000	0.24149	-0.654000	0.05394	0.460000	0.39030	TCC	.		0.632	PUF60-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382222.1	NM_014281	
RAB15	376267	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	14	65417736	65417736	+	Intron	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr14:65417736G>T	ENST00000533601.2	-	4	662				RAB15_ENST00000426039.3_Intron|RAB15_ENST00000267512.5_Missense_Mutation_p.A127E|CHURC1-FNTB_ENST00000549987.1_Intron|RAB15_ENST00000436278.2_Missense_Mutation_p.A81E|FNTB_ENST00000542227.1_Intron|FNTB_ENST00000447296.2_Intron			P59190	RAB15_HUMAN	RAB15, member RAS oncogene family						protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	GTP binding (GO:0005525)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	8				all cancers(60;0.00136)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.0102)		CCCTCGCCTTGCCTTCCCCGG	0.582																																					p.A127E		.											.	RAB15	228	0			c.C380A						.						68.0	61.0	63.0					14																	65417736		2203	4300	6503	SO:0001627	intron_variant	376267	exon4			CGCCTTGCCTTCC	BC014511	CCDS9768.1	14q23.2	2012-02-28	2012-02-28		ENSG00000139998	ENSG00000139998		"""RAB, member RAS oncogene"""	20150	protein-coding gene	gene with protein product						11697911	Standard	NM_198686		Approved		uc001xhz.2	P59190	OTTHUMG00000142810	ENST00000533601.2:c.324+55C>A	14.37:g.65417736G>T		31.0	0.0		35.0	5.0	NM_198686	G5EMR7|Q86TX7|Q8IW89	Missense_Mutation	SNP	ENST00000533601.2	37		.	.	.	.	.	.	.	.	.	.	G	9.336	1.061676	0.19987	.	.	ENSG00000139998	ENST00000267512	T	0.66099	-0.19	4.44	0.293	0.15742	.	0.752556	0.10886	N	0.623228	T	0.29976	0.0750	N	0.04768	-0.165	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.17289	-1.0374	10	0.10636	T	0.68	.	0.8357	0.01140	0.262:0.1695:0.395:0.1735	.	127	P59190-2	.	E	127	ENSP00000267512:A127E	ENSP00000267512:A127E	A	-	2	0	RAB15	64487489	0.000000	0.05858	0.001000	0.08648	0.125000	0.20455	-0.067000	0.11579	0.066000	0.16515	0.462000	0.41574	GCA	.		0.582	RAB15-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000390443.2	NM_198686	
RADIL	55698	hgsc.bcm.edu;bcgsc.ca	37	7	4917718	4917718	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr7:4917718T>C	ENST00000399583.3	-	2	240	c.53A>G	c.(52-54)aAg>aGg	p.K18R	RADIL_ENST00000536091.1_Missense_Mutation_p.K18R	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	18					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		GCTCTGCCGCTTCAGTTTGCT	0.587																																					p.K18R		.											.	RADIL	994	0			c.A53G						.						22.0	26.0	24.0					7																	4917718		2085	4204	6289	SO:0001583	missense	55698	exon2			TGCCGCTTCAGTT	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.53A>G	7.37:g.4917718T>C	ENSP00000382492:p.Lys18Arg	98.0	0.0		83.0	4.0	NM_018059	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Missense_Mutation	SNP	ENST00000399583.3	37	CCDS43544.1	.	.	.	.	.	.	.	.	.	.	T	17.84	3.487848	0.64074	.	.	ENSG00000157927	ENST00000399583;ENST00000536091;ENST00000457174	T;T	0.26660	3.11;1.72	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.28764	0.0713	L	0.43152	1.355	0.35318	D	0.784559	P	0.48503	0.911	P	0.49387	0.609	T	0.18429	-1.0337	10	0.10377	T	0.69	-53.8006	13.9572	0.64157	0.0:0.0:0.0:1.0	.	18	Q96JH8	RADIL_HUMAN	R	18	ENSP00000382492:K18R;ENSP00000442533:K18R	ENSP00000382492:K18R	K	-	2	0	RADIL	4884244	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.365000	0.59486	2.235000	0.73313	0.459000	0.35465	AAG	.		0.587	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059	
RASA3	22821	hgsc.bcm.edu;bcgsc.ca	37	13	114780788	114780788	+	Silent	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr13:114780788C>T	ENST00000334062.7	-	14	1423	c.1302G>A	c.(1300-1302)gtG>gtA	p.V434V	RASA3_ENST00000389544.4_Silent_p.V402V	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	434	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			AGACGCGGTCCACATACTGCC	0.662																																					p.V434V		.											.	RASA3	658	0			c.G1302A						.						109.0	91.0	97.0					13																	114780788		2203	4299	6502	SO:0001819	synonymous_variant	22821	exon14			GCGGTCCACATAC		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.1302G>A	13.37:g.114780788C>T		81.0	0.0		59.0	4.0	NM_007368	A6NL15|F8W6X8|Q8IUY2	Silent	SNP	ENST00000334062.7	37	CCDS32016.1																																																																																			.		0.662	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	NM_007368	
RBM14	10432	hgsc.bcm.edu;bcgsc.ca	37	11	66392968	66392968	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:66392968C>A	ENST00000310137.4	+	2	1760	c.1621C>A	c.(1621-1623)Cgc>Agc	p.R541S	RBM4_ENST00000503028.2_Intron|RBM14_ENST00000409738.4_Intron|RBM14_ENST00000393979.3_Intron|RBM4_ENST00000514361.3_Intron|RBM14-RBM4_ENST00000511114.1_Intron|RBM14-RBM4_ENST00000412278.2_Intron|RBM14-RBM4_ENST00000500635.2_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	541	Ala-rich.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)		RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						TGCCTCCTACCGCGGCCAGCC	0.652																																					p.R541S		.											.	RBM14	92	0			c.C1621A						.						41.0	36.0	38.0					11																	66392968		2200	4295	6495	SO:0001583	missense	10432	exon2			TCCTACCGCGGCC	AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.1621C>A	11.37:g.66392968C>A	ENSP00000311747:p.Arg541Ser	88.0	0.0		126.0	6.0	NM_006328	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	ENST00000310137.4	37	CCDS8147.1	.	.	.	.	.	.	.	.	.	.	C	12.15	1.851892	0.32699	.	.	ENSG00000239306	ENST00000310137	D	0.83837	-1.77	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.81226	0.4778	N	0.08118	0	0.80722	D	1	D	0.53745	0.962	D	0.65010	0.931	D	0.84711	0.0734	10	0.87932	D	0	-2.0699	14.1553	0.65413	0.0:1.0:0.0:0.0	.	541	Q96PK6	RBM14_HUMAN	S	541	ENSP00000311747:R541S	ENSP00000311747:R541S	R	+	1	0	RBM14	66149544	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.116000	0.31221	2.720000	0.93068	0.655000	0.94253	CGC	.		0.652	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277128.1	NM_006328	
RLTPR	146206	hgsc.bcm.edu;bcgsc.ca	37	16	67679452	67679452	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:67679452C>T	ENST00000334583.6	+	2	378	c.50C>T	c.(49-51)aCc>aTc	p.T17I	RLTPR_ENST00000545661.1_Missense_Mutation_p.T17I	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	17					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		GGCGAGATCACCAGGTTCCTG	0.622																																					p.T17I		.											.	RLTPR	67	0			c.C50T						.																																			SO:0001583	missense	146206	exon2			AGATCACCAGGTT	AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.50C>T	16.37:g.67679452C>T	ENSP00000334958:p.Thr17Ile	109.0	0.0		75.0	4.0	NM_001013838	B8X2Z3	Missense_Mutation	SNP	ENST00000334583.6	37	CCDS45513.1	.	.	.	.	.	.	.	.	.	.	c	20.2	3.951096	0.73787	.	.	ENSG00000159753	ENST00000334583;ENST00000545661	T;T	0.16324	2.35;2.38	4.5	3.55	0.40652	.	1.135210	0.06547	N	0.744305	T	0.13841	0.0335	N	0.22421	0.69	0.32048	N	0.597355	B;P	0.43477	0.007;0.808	B;B	0.39590	0.007;0.304	T	0.14282	-1.0478	10	0.45353	T	0.12	-8.4582	9.8859	0.41262	0.0:0.9031:0.0:0.0969	.	17;17	B8X2Z3;Q6F5E8	.;LR16C_HUMAN	I	17	ENSP00000334958:T17I;ENSP00000441481:T17I	ENSP00000334958:T17I	T	+	2	0	RLTPR	66236953	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.862000	0.48388	1.253000	0.44018	0.556000	0.70494	ACC	.		0.622	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467858.1	NM_001013838	
RMDN2	151393	hgsc.bcm.edu;bcgsc.ca	37	2	38178622	38178622	+	Intron	SNP	T	T	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:38178622T>A	ENST00000406384.1	+	2	646				RMDN2_ENST00000402091.3_Silent_p.A88A|RMDN2_ENST00000417700.2_Intron|RMDN2_ENST00000354545.2_Intron|RMDN2_ENST00000407257.1_Silent_p.A88A|RMDN2-AS1_ENST00000414365.2_RNA|RMDN2_ENST00000234195.3_Silent_p.A88A	NM_001170792.1	NP_001164263.1	Q96LZ7	RMD2_HUMAN	regulator of microtubule dynamics 2							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)											AAAGAAATGCTTCCCCTTACT	0.353																																					p.A88A		.											.	.	.	0			c.T264A						.						83.0	87.0	86.0					2																	38178622		2203	4300	6503	SO:0001627	intron_variant	151393	exon2			AAATGCTTCCCCT	AK057516	CCDS1792.1, CCDS54351.1, CCDS54352.1	2p22.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000115841	ENSG00000115841			26567	protein-coding gene	gene with protein product		611872	"""family with sequence similarity 82, member A1"""	FAM82A, FAM82A1		12477932	Standard	XM_005264161		Approved	FLJ32954, RMD2	uc002rqn.2	Q96LZ7	OTTHUMG00000128487	ENST00000406384.1:c.452+21750T>A	2.37:g.38178622T>A		76.0	0.0		54.0	4.0	NM_144713	A9UMZ7|A9UN00|Q4ZG33|Q6UXN4|Q8N657|Q8N9A2|Q8NCV6|Q8NHM0	Silent	SNP	ENST00000406384.1	37	CCDS54351.1																																																																																			.		0.353	RMDN2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325577.1	NM_144713	
RNF112	7732	hgsc.bcm.edu;bcgsc.ca	37	17	19314770	19314770	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:19314770A>G	ENST00000461366.1	+	1	264	c.49A>G	c.(49-51)Aaa>Gaa	p.K17E	CTB-187M2.2_ENST00000579897.1_RNA	NM_007148.4	NP_009079.2	Q9ULX5	RN112_HUMAN	ring finger protein 112	17						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|urinary_tract(1)	12						TCGGCTTGGCAAACGGGCAAG	0.652																																					p.K17E		.											.	RNF112	92	0			c.A49G						.						39.0	40.0	40.0					17																	19314770		1893	4097	5990	SO:0001583	missense	7732	exon1			CTTGGCAAACGGG	AF054587	CCDS58529.1	17p11.2	2013-01-16	2008-06-13	2008-06-13	ENSG00000128482	ENSG00000128482		"""RING-type (C3HC4) zinc fingers"""	12968	protein-coding gene	gene with protein product		601237	"""zinc finger protein 179"""	ZNF179		8660987, 9806830	Standard	NM_007148		Approved	BFP	uc010vyw.2	Q9ULX5	OTTHUMG00000059601	ENST00000461366.1:c.49A>G	17.37:g.19314770A>G	ENSP00000454919:p.Lys17Glu	35.0	0.0		28.0	4.0	NM_007148	O60633|Q7Z5V9	Missense_Mutation	SNP	ENST00000461366.1	37	CCDS58529.1																																																																																			.		0.652	RNF112-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132549.4	NM_007148	
RNF213	57674	hgsc.bcm.edu;bcgsc.ca	37	17	78341922	78341922	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:78341922C>A	ENST00000582970.1	+	44	12277	c.12134C>A	c.(12133-12135)cCa>cAa	p.P4045Q	RNF213_ENST00000508628.2_Missense_Mutation_p.P4094Q|RNF213_ENST00000336301.6_Missense_Mutation_p.P2118Q|CTD-2047H16.4_ENST00000575034.1_RNA|CTD-2047H16.4_ENST00000572151.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4045					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GAATTCTCTCCAGCTGTTTCC	0.468																																					p.P4045Q		.											.	RNF213	577	0			c.C12134A						.						152.0	146.0	148.0					17																	78341922		2203	4300	6503	SO:0001583	missense	57674	exon44			TCTCTCCAGCTGT	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.12134C>A	17.37:g.78341922C>A	ENSP00000464087:p.Pro4045Gln	138.0	0.0		110.0	5.0	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.438437	0.43326	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T;T	0.24723	2.06;1.84	4.67	-5.25	0.02781	Zinc finger, RING/FYVE/PHD-type (1);	1.235290	0.05537	N	0.565002	T	0.47728	0.1461	M	0.80183	2.485	0.09310	N	1	D;P	0.61080	0.989;0.944	P;P	0.61201	0.885;0.642	T	0.58222	-0.7674	10	0.48119	T	0.1	.	13.5295	0.61613	0.0:0.278:0.0:0.722	.	4094;2118	C9JCP4;Q63HN8	.;RN213_HUMAN	Q	4045;4094;2118	ENSP00000425956:P4045Q;ENSP00000338218:P2118Q	ENSP00000338218:P2118Q	P	+	2	0	RNF213	75956517	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.289000	0.08365	-1.017000	0.03367	-0.768000	0.03414	CCA	.		0.468	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
RYR3	6263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	33855056	33855056	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr15:33855056G>T	ENST00000389232.4	+	11	1061	c.991G>T	c.(991-993)Gac>Tac	p.D331Y	RYR3_ENST00000415757.3_Missense_Mutation_p.D331Y	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	331	MIR 4. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGAGAAATTAGACTCCAGTCA	0.393																																					p.D331Y		.											.	RYR3	520	0			c.G991T						.						66.0	65.0	65.0					15																	33855056		1862	4106	5968	SO:0001583	missense	6263	exon11			AAATTAGACTCCA		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.991G>T	15.37:g.33855056G>T	ENSP00000373884:p.Asp331Tyr	120.0	0.0		86.0	30.0	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.335986	0.81801	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.93953	-3.32;-3.32	5.27	5.27	0.74061	MIR motif (2);MIR (2);	0.118731	0.56097	D	0.000026	D	0.95573	0.8561	L	0.54323	1.7	0.58432	D	0.999998	D;D	0.67145	0.996;0.989	D;P	0.65874	0.939;0.883	D	0.95691	0.8740	10	0.72032	D	0.01	.	18.6774	0.91534	0.0:0.0:1.0:0.0	.	331;331	Q15413-2;Q15413	.;RYR3_HUMAN	Y	331	ENSP00000373884:D331Y;ENSP00000399610:D331Y	ENSP00000354735:D331Y	D	+	1	0	RYR3	31642348	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.491000	0.97954	2.748000	0.94277	0.655000	0.94253	GAC	.		0.393	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SAA4	6291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	18253136	18253136	+	Silent	SNP	C	C	A	rs201938371		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:18253136C>A	ENST00000278222.4	-	4	486	c.306G>T	c.(304-306)tcG>tcT	p.S102S	SAA2-SAA4_ENST00000524555.1_RNA	NM_006512.3	NP_006503.2	P35542	SAA4_HUMAN	serum amyloid A4, constitutive	102					acute-phase response (GO:0006953)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)		p.S102S(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(1)|stomach(1)	13						CGTTGGACTTCGAGTCCTCCA	0.517																																					p.S180S		.											.	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G540T						.						105.0	105.0	105.0					11																	18253136		2199	4293	6492	SO:0001819	synonymous_variant	100528017	exon6			GGACTTCGAGTCC	M81349	CCDS7832.1	11p15.1-p14	2008-07-21			ENSG00000148965	ENSG00000148965			10516	protein-coding gene	gene with protein product		104752				8325654	Standard	NM_006512		Approved	C-SAA, CSAA		P35542	OTTHUMG00000166483	ENST00000278222.4:c.306G>T	11.37:g.18253136C>A		169.0	0.0		111.0	28.0	NM_001199744	Q6FHJ4	Silent	SNP	ENST00000278222.4	37	CCDS7832.1																																																																																			C|0.999;T|0.000		0.517	SAA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389988.1	NM_006512	
SACS	26278	hgsc.bcm.edu;bcgsc.ca	37	13	23908202	23908202	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr13:23908202A>G	ENST00000382292.3	-	9	10086	c.9813T>C	c.(9811-9813)gtT>gtC	p.V3271V	SACS_ENST00000402364.1_Silent_p.V2521V|SACS_ENST00000382298.3_Silent_p.V3271V			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3271					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GAGTATCAACAACAATGTCAA	0.398																																					p.V3271V		.											.	SACS	298	0			c.T9813C						.						107.0	99.0	102.0					13																	23908202		2203	4299	6502	SO:0001819	synonymous_variant	26278	exon10			ATCAACAACAATG	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.9813T>C	13.37:g.23908202A>G		98.0	0.0		84.0	4.0	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	ENST00000382292.3	37	CCDS9300.2																																																																																			.		0.398	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
SATB1	6304	hgsc.bcm.edu;bcgsc.ca	37	3	18393620	18393620	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:18393620T>C	ENST00000338745.6	-	10	3377	c.1643A>G	c.(1642-1644)aAc>aGc	p.N548S	SATB1_ENST00000454909.2_Missense_Mutation_p.N548S|SATB1_ENST00000417717.2_Missense_Mutation_p.N548S|TBC1D5_ENST00000414318.2_Intron	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	548					activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						CATGGAGAGGTTCTCCCACAG	0.517																																					p.N548S		.											.	SATB1	228	0			c.A1643G						.						103.0	96.0	98.0					3																	18393620		2203	4300	6503	SO:0001583	missense	6304	exon10			GAGAGGTTCTCCC		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.1643A>G	3.37:g.18393620T>C	ENSP00000341024:p.Asn548Ser	220.0	0.0		146.0	6.0	NM_002971	B3KXF1|C9JTR6|Q59EQ0	Missense_Mutation	SNP	ENST00000338745.6	37	CCDS2631.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.870657	0.91587	.	.	ENSG00000182568	ENST00000338745;ENST00000454909;ENST00000417717	T;T;T	0.63255	-0.01;-0.01;-0.03	5.52	5.52	0.82312	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.000000	0.85682	D	0.000000	T	0.79015	0.4375	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.81457	-0.0924	10	0.66056	D	0.02	-19.5847	15.6295	0.76893	0.0:0.0:0.0:1.0	.	548;548	Q01826-2;Q01826	.;SATB1_HUMAN	S	548	ENSP00000341024:N548S;ENSP00000399708:N548S;ENSP00000399518:N548S	ENSP00000341024:N548S	N	-	2	0	SATB1	18368624	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.013000	0.88655	2.091000	0.63221	0.533000	0.62120	AAC	.		0.517	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010	
SCN4A	6329	hgsc.bcm.edu;bcgsc.ca	37	17	62022891	62022891	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:62022891G>T	ENST00000435607.1	-	19	3625	c.3549C>A	c.(3547-3549)gcC>gcA	p.A1183A	SCN4A_ENST00000578147.1_Silent_p.A1183A	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1183					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGAACTTGCCGGCAAACAGGT	0.542																																					p.A1183A		.											.	SCN4A	93	0			c.C3549A						.						252.0	252.0	252.0					17																	62022891		2200	4300	6500	SO:0001819	synonymous_variant	6329	exon19			CTTGCCGGCAAAC	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.3549C>A	17.37:g.62022891G>T		204.0	0.0		136.0	6.0	NM_000334	Q15478|Q16447|Q7Z6B1	Silent	SNP	ENST00000435607.1	37	CCDS45761.1																																																																																			.		0.542	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
SEC16A	9919	hgsc.bcm.edu;bcgsc.ca	37	9	139370230	139370230	+	Missense_Mutation	SNP	G	G	T	rs371898934		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:139370230G>T	ENST00000371706.3	-	1	1337	c.1304C>A	c.(1303-1305)cCg>cAg	p.P435Q	SEC16A_ENST00000431893.2_Missense_Mutation_p.P435Q|SEC16A_ENST00000290037.6_Missense_Mutation_p.P435Q|SEC16A_ENST00000313050.7_Missense_Mutation_p.P613Q			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	435					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		AGATTTTACCGGTTCGAAAGA	0.522																																					p.P613Q		.											.	.	.	0			c.C1838A						.						36.0	38.0	37.0					9																	139370230		2061	4198	6259	SO:0001583	missense	9919	exon3			TTTACCGGTTCGA	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.1304C>A	9.37:g.139370230G>T	ENSP00000360771:p.Pro435Gln	84.0	0.0		51.0	4.0	NM_014866	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	ENST00000371706.3	37		.	.	.	.	.	.	.	.	.	.	G	26.6	4.749388	0.89753	.	.	ENSG00000148396	ENST00000313050;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925	T;T;T;T	0.42900	0.96;1.0;0.98;1.0	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.66167	0.2762	M	0.72894	2.215	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.67639	-0.5619	10	0.87932	D	0	-15.3679	18.9459	0.92622	0.0:0.0:1.0:0.0	.	613;435;435;240	F1T0I1;O15027-5;O15027-4;A4QN19	.;.;.;.	Q	613;435;435;435;240	ENSP00000325827:P613Q;ENSP00000360771:P435Q;ENSP00000290037:P435Q;ENSP00000387583:P435Q	ENSP00000290037:P435Q	P	-	2	0	SEC16A	138490051	1.000000	0.71417	0.997000	0.53966	0.856000	0.48823	7.833000	0.86765	2.796000	0.96246	0.650000	0.86243	CCG	.		0.522	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
SEC24C	9632	hgsc.bcm.edu;bcgsc.ca	37	10	75526220	75526220	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr10:75526220T>C	ENST00000339365.2	+	13	1882	c.1720T>C	c.(1720-1722)Tct>Cct	p.S574P	SEC24C_ENST00000546025.1_3'UTR|SEC24C_ENST00000540668.1_Intron|SEC24C_ENST00000345254.4_Missense_Mutation_p.S574P|SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000411652.2_Missense_Mutation_p.S455P	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	574					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					GATGGTTGTGTCTGATGTGGC	0.502																																					p.S574P		.											.	SEC24C	92	0			c.T1720C						.						100.0	83.0	89.0					10																	75526220		2203	4300	6503	SO:0001583	missense	9632	exon13			GTTGTGTCTGATG	D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.1720T>C	10.37:g.75526220T>C	ENSP00000343405:p.Ser574Pro	69.0	0.0		50.0	4.0	NM_004922	B4DZT4|Q8WV25	Missense_Mutation	SNP	ENST00000339365.2	37	CCDS7332.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.229951	0.79688	.	.	ENSG00000176986	ENST00000345254;ENST00000339365;ENST00000411652	T;T;T	0.76186	-1.0;-1.0;-1.0	5.93	5.93	0.95920	Sec23/Sec24, trunk domain (1);	0.000000	0.85682	D	0.000000	T	0.79992	0.4542	L	0.39245	1.2	0.80722	D	1	D;D;D	0.64830	0.987;0.992;0.994	P;P;D	0.68943	0.82;0.874;0.961	T	0.75952	-0.3136	10	0.21014	T	0.42	-20.5737	16.3798	0.83452	0.0:0.0:0.0:1.0	.	455;574;574	E7EP00;G5EA31;P53992	.;.;SC24C_HUMAN	P	574;574;455	ENSP00000321845:S574P;ENSP00000343405:S574P;ENSP00000402913:S455P	ENSP00000343405:S574P	S	+	1	0	SEC24C	75196226	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	8.040000	0.89188	2.271000	0.75665	0.533000	0.62120	TCT	.		0.502	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048679.1		
SECISBP2L	9728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	49320786	49320786	+	Missense_Mutation	SNP	G	G	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr15:49320786G>C	ENST00000559471.1	-	5	1021	c.758C>G	c.(757-759)cCt>cGt	p.P253R	SECISBP2L_ENST00000261847.3_Missense_Mutation_p.P253R	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	253							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						TTCAGCAGTAGGGTGGGATGC	0.498																																					p.P253R		.											.	SECISBP2L	136	0			c.C758G						.						144.0	129.0	134.0					15																	49320786		2197	4295	6492	SO:0001583	missense	9728	exon5			GCAGTAGGGTGGG	BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.758C>G	15.37:g.49320786G>C	ENSP00000453854:p.Pro253Arg	218.0	0.0		140.0	50.0	NM_001193489	Q8N767	Missense_Mutation	SNP	ENST00000559471.1	37	CCDS53942.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.900694	0.52227	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	D	0.88741	-2.42	5.78	5.78	0.91487	.	0.062479	0.64402	D	0.000004	D	0.91057	0.7186	L	0.29908	0.895	0.45295	D	0.998295	D;D	0.71674	0.998;0.996	P;P	0.62813	0.873;0.907	D	0.91760	0.5419	10	0.72032	D	0.01	.	20.0278	0.97529	0.0:0.0:1.0:0.0	.	253;253	Q93073;Q93073-2	SBP2L_HUMAN;.	R	253	ENSP00000261847:P253R	ENSP00000261847:P253R	P	-	2	0	SECISBP2L	47108078	1.000000	0.71417	0.959000	0.39883	0.299000	0.27559	5.734000	0.68580	2.732000	0.93576	0.655000	0.94253	CCT	.		0.498	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1	NM_014701	
SENP1	29843	hgsc.bcm.edu;bcgsc.ca	37	12	48491823	48491823	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:48491823G>A	ENST00000004980.5	-	3	567	c.89C>T	c.(88-90)cCa>cTa	p.P30L	SENP1_ENST00000551330.1_Missense_Mutation_p.P30L|SENP1_ENST00000549595.1_Missense_Mutation_p.P30L|SENP1_ENST00000549518.1_Missense_Mutation_p.P30L|SENP1_ENST00000547886.1_5'Flank|SENP1_ENST00000339976.6_Missense_Mutation_p.P62L|SENP1_ENST00000448372.1_Missense_Mutation_p.P30L			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	30					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				ACCTGTTTGTGGCAGGAGGTG	0.433																																					p.P30L		.											.	SENP1	660	0			c.C89T						.						83.0	93.0	90.0					12																	48491823		1880	4109	5989	SO:0001583	missense	29843	exon3			GTTTGTGGCAGGA	AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.89C>T	12.37:g.48491823G>A	ENSP00000004980:p.Pro30Leu	106.0	0.0		73.0	4.0	NM_001267594	A8K7P5|Q86XC8	Missense_Mutation	SNP	ENST00000004980.5	37	CCDS44868.2	.	.	.	.	.	.	.	.	.	.	G	12.78	2.040593	0.35989	.	.	ENSG00000079387	ENST00000004980;ENST00000339976;ENST00000448372;ENST00000551330;ENST00000549595;ENST00000549518;ENST00000551798	T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38	4.69	1.74	0.24563	.	1.314310	0.05034	N	0.475024	T	0.14657	0.0354	N	0.19112	0.55	0.30326	N	0.787074	B;B	0.11235	0.002;0.004	B;B	0.13407	0.004;0.009	T	0.33979	-0.9847	10	0.56958	D	0.05	3.0118	12.1929	0.54280	0.0:0.0:0.3573:0.6427	.	30;30	Q9P0U3;Q9P0U3-2	SENP1_HUMAN;.	L	30;62;30;30;30;30;23	ENSP00000004980:P30L;ENSP00000394791:P30L;ENSP00000446681:P30L;ENSP00000450076:P30L;ENSP00000447328:P30L	ENSP00000004980:P30L	P	-	2	0	SENP1	46778090	1.000000	0.71417	0.946000	0.38457	0.795000	0.44927	0.748000	0.26305	0.393000	0.25203	-0.274000	0.10170	CCA	.		0.433	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406471.1	NM_014554	
SENP1	29843	hgsc.bcm.edu;bcgsc.ca	37	12	48491866	48491866	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:48491866T>C	ENST00000004980.5	-	3	524	c.46A>G	c.(46-48)Act>Gct	p.T16A	SENP1_ENST00000551330.1_Missense_Mutation_p.T16A|SENP1_ENST00000549595.1_Missense_Mutation_p.T16A|SENP1_ENST00000549518.1_Missense_Mutation_p.T16A|SENP1_ENST00000547886.1_5'Flank|SENP1_ENST00000339976.6_Missense_Mutation_p.T48A|SENP1_ENST00000448372.1_Missense_Mutation_p.T16A			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	16					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				TTCACTAAAGTCACTTCTCCA	0.443																																					p.T16A		.											.	SENP1	660	0			c.A46G						.						95.0	102.0	99.0					12																	48491866		1934	4143	6077	SO:0001583	missense	29843	exon3			CTAAAGTCACTTC	AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.46A>G	12.37:g.48491866T>C	ENSP00000004980:p.Thr16Ala	117.0	0.0		81.0	4.0	NM_001267594	A8K7P5|Q86XC8	Missense_Mutation	SNP	ENST00000004980.5	37	CCDS44868.2	.	.	.	.	.	.	.	.	.	.	T	16.27	3.074817	0.55646	.	.	ENSG00000079387	ENST00000004980;ENST00000339976;ENST00000448372;ENST00000551330;ENST00000549595;ENST00000549518;ENST00000551798	T;T;T;T;T	0.16324	2.35;2.35;2.35;2.35;2.35	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000005	T	0.11110	0.0271	N	0.19112	0.55	0.20703	N	0.999865	B;B	0.25007	0.071;0.116	B;B	0.26969	0.034;0.075	T	0.15065	-1.0450	10	0.52906	T	0.07	-12.3831	7.7073	0.28657	0.0:0.092:0.0:0.908	.	16;16	Q9P0U3;Q9P0U3-2	SENP1_HUMAN;.	A	16;48;16;16;16;16;9	ENSP00000004980:T16A;ENSP00000394791:T16A;ENSP00000446681:T16A;ENSP00000450076:T16A;ENSP00000447328:T16A	ENSP00000004980:T16A	T	-	1	0	SENP1	46778133	0.958000	0.32768	0.973000	0.42090	0.992000	0.81027	1.176000	0.31957	2.272000	0.75746	0.460000	0.39030	ACT	.		0.443	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406471.1	NM_014554	
SENP2	59343	hgsc.bcm.edu;bcgsc.ca	37	3	185316214	185316214	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:185316214C>A	ENST00000296257.5	+	3	412	c.172C>A	c.(172-174)Caa>Aaa	p.Q58K	SENP2_ENST00000465201.1_3'UTR|SENP2_ENST00000545472.1_Missense_Mutation_p.Q48K|SENP2_ENST00000427465.2_5'UTR	NM_021627.2	NP_067640.2	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 2	58					cellular protein metabolic process (GO:0044267)|dorsal/ventral axis specification (GO:0009950)|heart development (GO:0007507)|labyrinthine layer development (GO:0060711)|mRNA transport (GO:0051028)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein binding (GO:0032091)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|protein transport (GO:0015031)|regulation of DNA endoreduplication (GO:0032875)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of Wnt signaling pathway (GO:0030111)|spongiotrophoblast layer development (GO:0060712)|trophoblast giant cell differentiation (GO:0060707)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	SUMO-specific protease activity (GO:0016929)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(3)	12	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			CTTTATTCACCAAGTGAAAAA	0.368																																					p.Q58K		.											.	SENP2	658	0			c.C172A						.						64.0	63.0	63.0					3																	185316214		2203	4300	6503	SO:0001583	missense	59343	exon3			ATTCACCAAGTGA	AF151697	CCDS33902.1	3q28	2005-08-17	2005-08-17		ENSG00000163904	ENSG00000163904			23116	protein-coding gene	gene with protein product		608261	"""SUMO1/sentrin/SMT3 specific protease 2"""			11896061, 11489887	Standard	XM_005247690		Approved	SMT3IP2, KIAA1331, DKFZp762A2316, AXAM2	uc003fpn.3	Q9HC62	OTTHUMG00000156658	ENST00000296257.5:c.172C>A	3.37:g.185316214C>A	ENSP00000296257:p.Gln58Lys	186.0	0.0		175.0	7.0	NM_021627	B4DQ42|Q8IW97|Q96SR2|Q9P2L5	Missense_Mutation	SNP	ENST00000296257.5	37	CCDS33902.1	.	.	.	.	.	.	.	.	.	.	C	19.91	3.914001	0.72983	.	.	ENSG00000163904	ENST00000430355;ENST00000545472;ENST00000296257;ENST00000437107	T;T	0.22945	1.93;1.94	4.98	4.98	0.66077	.	0.177411	0.27636	N	0.018485	T	0.15696	0.0378	N	0.14661	0.345	0.80722	D	1	B;B	0.23316	0.083;0.034	B;B	0.22601	0.04;0.025	T	0.08764	-1.0706	10	0.21014	T	0.42	-5.4854	13.9415	0.64057	0.0:1.0:0.0:0.0	.	48;58	B4DQ42;Q9HC62	.;SENP2_HUMAN	K	112;48;58;58	ENSP00000439653:Q48K;ENSP00000296257:Q58K	ENSP00000296257:Q58K	Q	+	1	0	SENP2	186798908	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.109000	0.41863	2.739000	0.93911	0.650000	0.86243	CAA	.		0.368	SENP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345159.1	NM_021627	
SERPINB3	6317	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	61324552	61324552	+	Missense_Mutation	SNP	C	C	A	rs150385073	byFrequency	TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr18:61324552C>A	ENST00000283752.5	-	6	707	c.564G>T	c.(562-564)aaG>aaT	p.K188N	SERPINB3_ENST00000332821.8_Missense_Mutation_p.K188N|SERPINB11_ENST00000489748.1_RNA	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	188					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						TATTAAATTTCTTCTCCCACT	0.279													C|||	16	0.00319489	0.0113	0.0014	5008	,	,		17148	0.0		0.0	False		,,,				2504	0.0				p.K188N		.											.	SERPINB3	228	0			c.G564T						.	C	ASN/LYS	32,4372	38.4+/-70.7	0,32,2170	69.0	72.0	71.0		564	-1.4	0.0	18	dbSNP_134	71	1,8599	1.2+/-3.3	0,1,4299	yes	missense	SERPINB3	NM_006919.2	94	0,33,6469	AA,AC,CC		0.0116,0.7266,0.2538	benign	188/391	61324552	33,12971	2202	4300	6502	SO:0001583	missense	6317	exon6			AAATTTCTTCTCC	U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.564G>T	18.37:g.61324552C>A	ENSP00000283752:p.Lys188Asn	955.0	1.0		852.0	227.0	NM_006919	A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Missense_Mutation	SNP	ENST00000283752.5	37	CCDS11987.1	12	0.005494505494505495	11	0.022357723577235773	1	0.0027624309392265192	0	0.0	0	0.0	C	0.009	-1.818656	0.00595	0.007266	1.16E-4	ENSG00000057149	ENST00000283752;ENST00000332821	D;D	0.84223	-1.82;-1.82	2.74	-1.41	0.08941	Serpin domain (3);	2.200360	0.02175	N	0.060045	T	0.62380	0.2423	L	0.43646	1.37	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.12837	0.002;0.008;0.008	T	0.51826	-0.8656	10	0.09084	T	0.74	.	2.1893	0.03894	0.1323:0.4585:0.1356:0.2736	.	188;188;188	P29508-2;P29508;Q5K684	.;SPB3_HUMAN;.	N	188	ENSP00000283752:K188N;ENSP00000329498:K188N	ENSP00000283752:K188N	K	-	3	2	SERPINB3	59475532	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.746000	0.01829	-0.769000	0.04620	-2.157000	0.00329	AAG	C|0.997;A|0.003		0.279	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133791.1	NM_006919	
SETD1A	9739	hgsc.bcm.edu;bcgsc.ca	37	16	30976649	30976649	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:30976649A>G	ENST00000262519.8	+	7	2272	c.1586A>G	c.(1585-1587)gAg>gGg	p.E529G		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	529	Pro-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						ACAGGGAGTGAGGTGCCTTCT	0.612																																					p.E529G		.											.	SETD1A	93	0			c.A1586G						.						58.0	63.0	61.0					16																	30976649		2197	4300	6497	SO:0001583	missense	9739	exon7			GGAGTGAGGTGCC	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.1586A>G	16.37:g.30976649A>G	ENSP00000262519:p.Glu529Gly	133.0	0.0		101.0	5.0	NM_014712	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	37	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	A	12.51	1.960356	0.34565	.	.	ENSG00000099381	ENST00000262519	D	0.94862	-3.54	5.53	5.53	0.82687	.	0.282904	0.32161	N	0.006486	D	0.87981	0.6315	N	0.11427	0.14	0.36161	D	0.848091	B	0.18610	0.029	B	0.17433	0.018	D	0.86817	0.2002	10	0.48119	T	0.1	.	13.5996	0.62011	1.0:0.0:0.0:0.0	.	529	O15047	SET1A_HUMAN	G	529	ENSP00000262519:E529G	ENSP00000262519:E529G	E	+	2	0	SETD1A	30884150	0.998000	0.40836	0.997000	0.53966	0.637000	0.38172	2.181000	0.42547	2.100000	0.63781	0.459000	0.35465	GAG	.		0.612	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
SETD8	387893	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	123880916	123880924	+	In_Frame_Del	DEL	TCGCAAACT	TCGCAAACT	-	rs148212570|rs372757608|rs77198130	byFrequency	TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	TCGCAAACT	TCGCAAACT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:123880916_123880924delTCGCAAACT	ENST00000402868.3	+	5	960_968	c.534_542delTCGCAAACT	c.(532-543)aatcgcaaactt>aat	p.RKL179del	SETD8_ENST00000330479.4_In_Frame_Del_p.RKL179del|SETD8_ENST00000478781.2_3'UTR			Q9NQR1	SETD8_HUMAN	SET domain containing (lysine methyltransferase) 8	220					histone lysine methylation (GO:0034968)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|urinary_tract(1)	13	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)		CGCAACAGAATCGCAAACTTACGGATTTC	0.502																																					p.178_181del		.											.	SETD8	90	0			c.534_542del						.																																			SO:0001651	inframe_deletion	387893	exon5			ACAGAATCGCAAA	AY102937	CCDS9247.1	12q24.31	2011-07-01			ENSG00000183955	ENSG00000183955		"""Chromatin-modifying enzymes / K-methyltransferases"""	29489	protein-coding gene	gene with protein product		607240				15933070, 12086618, 12121615	Standard	NM_020382		Approved	SET8, SET07, PR-Set7, KMT5A	uc001uew.3	Q9NQR1	OTTHUMG00000150477	ENST00000402868.3:c.534_542delTCGCAAACT	12.37:g.123880916_123880924delTCGCAAACT	ENSP00000384629:p.Arg179_Leu181del	93.0	0.0		54.0	16.0	NM_020382	A8K9D0|Q86W83|Q8TD09	In_Frame_Del	DEL	ENST00000402868.3	37	CCDS9247.1																																																																																			.		0.502	SETD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318263.1	NM_020382	
SGSM3	27352	hgsc.bcm.edu;bcgsc.ca	37	22	40803251	40803251	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr22:40803251G>T	ENST00000248929.9	+	12	1476	c.1287G>T	c.(1285-1287)acG>acT	p.T429T	SGSM3_ENST00000454798.2_Silent_p.T362T	NM_015705.4	NP_056520.2			small G protein signaling modulator 3									p.T429T(1)		cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)	19						TCAAGCAGACGGAACTGGTGG	0.632																																					p.T429T		.											.	SGSM3	494	1	Substitution - coding silent(1)	endometrium(1)	c.G1287T						.						59.0	58.0	58.0					22																	40803251		2203	4300	6503	SO:0001819	synonymous_variant	27352	exon12			GCAGACGGAACTG	AL022238	CCDS14002.1	22q13.1-q13.2	2013-07-09	2007-08-14	2007-08-14	ENSG00000100359	ENSG00000100359		"""Small G protein signaling modulators"""	25228	protein-coding gene	gene with protein product	"""RUN and SH3 containing 3"""	610440	"""RUN and TBC1 domain containing 3"""	RUTBC3		11214971, 17509819	Standard	XM_005261572		Approved	DJ1042K10.2, RUSC3, RabGAP-5, RABGAP5	uc003ayu.1	Q96HU1	OTTHUMG00000151141	ENST00000248929.9:c.1287G>T	22.37:g.40803251G>T		113.0	0.0		94.0	6.0	NM_015705		Silent	SNP	ENST00000248929.9	37	CCDS14002.1																																																																																			.		0.632	SGSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321504.2	NM_015705	
SH3D19	152503	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	152060939	152060939	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr4:152060939C>T	ENST00000409252.2	-	13	2220	c.1513G>A	c.(1513-1515)Gat>Aat	p.D505N	SH3D19_ENST00000427414.2_Missense_Mutation_p.D446N|SH3D19_ENST00000514152.1_Missense_Mutation_p.D482N|SH3D19_ENST00000304527.4_Missense_Mutation_p.D505N|SH3D19_ENST00000409598.4_Missense_Mutation_p.D482N|RP11-372K14.2_ENST00000603472.1_RNA|SH3D19_ENST00000424281.1_Missense_Mutation_p.D446N|SH3D19_ENST00000455740.1_Missense_Mutation_p.D482N			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	505	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				GCTGGGAAATCATGAAGAACG	0.512																																					p.D505N		.											.	SH3D19	92	0			c.G1513A						.						107.0	100.0	103.0					4																	152060939		2203	4300	6503	SO:0001583	missense	152503	exon14			GGAAATCATGAAG	BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.1513G>A	4.37:g.152060939C>T	ENSP00000386848:p.Asp505Asn	157.0	1.0		91.0	21.0	NM_001009555	B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Missense_Mutation	SNP	ENST00000409252.2	37	CCDS34077.2	.	.	.	.	.	.	.	.	.	.	C	24.5	4.539993	0.85917	.	.	ENSG00000109686	ENST00000409598;ENST00000304527;ENST00000455740;ENST00000424281;ENST00000427414;ENST00000409252;ENST00000514152	T;T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	5.35	5.35	0.76521	Src homology-3 domain (4);	0.499782	0.19801	N	0.105750	T	0.67202	0.2868	M	0.63843	1.955	0.80722	D	1	P;P;P;B	0.43857	0.572;0.517;0.819;0.234	B;B;P;B	0.44921	0.445;0.317;0.464;0.253	T	0.65438	-0.6168	10	0.30854	T	0.27	-16.4976	13.3734	0.60725	0.0:0.9242:0.0:0.0758	.	505;482;446;260	Q5HYK7;Q5HYK7-2;Q5HYK7-3;B3KY23	SH319_HUMAN;.;.;.	N	482;505;482;446;446;505;482	ENSP00000387030:D482N;ENSP00000302913:D505N;ENSP00000416708:D482N;ENSP00000404542:D446N;ENSP00000415694:D446N;ENSP00000386848:D505N;ENSP00000423449:D482N	ENSP00000302913:D505N	D	-	1	0	SH3D19	152280389	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.776000	0.55356	2.484000	0.83849	0.655000	0.94253	GAT	.		0.512	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335132.3	NM_001009555	
SHANK2	22941	hgsc.bcm.edu;bcgsc.ca	37	11	70332784	70332784	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:70332784A>G	ENST00000423696.2	-	15	2513	c.2477T>C	c.(2476-2478)cTc>cCc	p.L826P	SHANK2_ENST00000409161.1_Missense_Mutation_p.L609P|SHANK2_ENST00000338508.4_Missense_Mutation_p.L1206P|SHANK2_ENST00000449833.2_Missense_Mutation_p.L610P			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	826					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CCGCCCTGTGAGTGGGTGGAC	0.677																																					p.L617P		.											.	SHANK2	94	0			c.T1850C						.						29.0	36.0	34.0					11																	70332784		2199	4294	6493	SO:0001583	missense	22941	exon10			CCTGTGAGTGGGT	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.2477T>C	11.37:g.70332784A>G	ENSP00000394536:p.Leu826Pro	87.0	0.0		101.0	5.0	NM_133266	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	ENST00000423696.2	37		.	.	.	.	.	.	.	.	.	.	A	11.91	1.781106	0.31502	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04;-0.04	4.88	4.88	0.63580	.	0.056200	0.64402	D	0.000001	T	0.76990	0.4065	M	0.78049	2.395	0.80722	D	1	D;D;D	0.67145	0.986;0.992;0.996	P;P;P	0.62089	0.828;0.898;0.898	T	0.81048	-0.1109	10	0.87932	D	0	.	14.486	0.67616	1.0:0.0:0.0:0.0	.	826;1205;610	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	P	610;609;484;1206;826;844;829	ENSP00000399423:L610P;ENSP00000386491:L609P;ENSP00000402944:L484P;ENSP00000345193:L1206P;ENSP00000394536:L826P;ENSP00000294018:L829P	ENSP00000294018:L829P	L	-	2	0	SHANK2	70010432	1.000000	0.71417	1.000000	0.80357	0.318000	0.28184	8.722000	0.91452	1.819000	0.53055	0.459000	0.35465	CTC	.		0.677	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309	
SHCBP1	79801	hgsc.bcm.edu;bcgsc.ca	37	16	46633834	46633834	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:46633834G>T	ENST00000303383.3	-	9	1520	c.1254C>A	c.(1252-1254)ggC>ggA	p.G418G		NM_024745.4	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	418					fibroblast growth factor receptor signaling pathway (GO:0008543)|regulation of neural precursor cell proliferation (GO:2000177)					breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				TGTCGCCTTTGCCCCTCTTTT	0.413																																					p.G418G		.											.	SHCBP1	154	0			c.C1254A						.						91.0	84.0	86.0					16																	46633834		2203	4300	6503	SO:0001819	synonymous_variant	79801	exon9			GCCTTTGCCCCTC	AK055931	CCDS10720.1	16q11	2008-02-05			ENSG00000171241	ENSG00000171241			29547	protein-coding gene	gene with protein product		611027				10086341	Standard	NM_024745		Approved	FLJ22009	uc002eec.4	Q8NEM2	OTTHUMG00000132540	ENST00000303383.3:c.1254C>A	16.37:g.46633834G>T		110.0	0.0		70.0	4.0	NM_024745	Q96N60|Q9BVS0|Q9H6P6	Silent	SNP	ENST00000303383.3	37	CCDS10720.1																																																																																			.		0.413	SHCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255740.1	NM_024745	
SHMT2	6472	hgsc.bcm.edu;bcgsc.ca	37	12	57627867	57627867	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:57627867T>C	ENST00000328923.3	+	11	1813	c.1361T>C	c.(1360-1362)aTt>aCt	p.I454T	SHMT2_ENST00000393827.4_Missense_Mutation_p.I358T|SHMT2_ENST00000557487.1_Missense_Mutation_p.I444T|SHMT2_ENST00000553474.1_Missense_Mutation_p.I433T|SHMT2_ENST00000449049.3_Missense_Mutation_p.I433T|SHMT2_ENST00000414700.3_Missense_Mutation_p.I433T	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	454					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	GGGGTCAACATTGGCTTAGAG	0.567																																					p.I454T	Esophageal Squamous(150;1369 2416 49071 49364)	.											.	SHMT2	91	0			c.T1361C						.						88.0	92.0	91.0					12																	57627867		2203	4300	6503	SO:0001583	missense	6472	exon11			TCAACATTGGCTT	AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.1361T>C	12.37:g.57627867T>C	ENSP00000333667:p.Ile454Thr	98.0	0.0		94.0	5.0	NM_005412	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Missense_Mutation	SNP	ENST00000328923.3	37	CCDS8934.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.287601	0.80803	.	.	ENSG00000182199	ENST00000328923;ENST00000557487;ENST00000414700;ENST00000553474;ENST00000449049;ENST00000393827	T;T;T;T;T;T	0.35421	1.52;1.38;1.52;1.52;1.52;1.31	4.98	4.98	0.66077	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.67832	0.2935	M	0.93150	3.385	0.80722	D	1	P;P;D;D;D	0.76494	0.944;0.895;0.999;0.972;0.996	P;P;D;P;P	0.73380	0.696;0.652;0.98;0.778;0.894	T	0.77035	-0.2737	10	0.87932	D	0	-12.3206	12.9362	0.58316	0.0:0.0:0.0:1.0	.	463;444;358;385;454	B4DWA7;Q8N1A5;B4DLV4;B4DP88;P34897	.;.;.;.;GLYM_HUMAN	T	454;444;433;433;433;358	ENSP00000333667:I454T;ENSP00000452315:I444T;ENSP00000406881:I433T;ENSP00000452419:I433T;ENSP00000413770:I433T;ENSP00000377413:I358T	ENSP00000333667:I454T	I	+	2	0	SHMT2	55914134	0.999000	0.42202	0.588000	0.28705	0.936000	0.57629	4.989000	0.63870	2.011000	0.59026	0.533000	0.62120	ATT	.		0.567	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412525.2	NM_005412	
SIK3	23387	hgsc.bcm.edu;bcgsc.ca	37	11	116746722	116746722	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:116746722A>G	ENST00000292055.4	-	9	960	c.925T>C	c.(925-927)Tta>Cta	p.L309L	SIK3_ENST00000542607.1_Intron|SIK3_ENST00000375288.1_5'UTR|SIK3_ENST00000375300.1_Silent_p.L367L|SIK3_ENST00000446921.2_Intron|SIK3_ENST00000434315.2_Silent_p.L208L	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	309	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						TCTGATCTTAATGACTACCAA	0.433																																					p.L309L		.											.	SIK3	919	0			c.T925C						.						81.0	75.0	77.0					11																	116746722		2201	4296	6497	SO:0001819	synonymous_variant	23387	exon9			ATCTTAATGACTA	AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.925T>C	11.37:g.116746722A>G		101.0	0.0		76.0	4.0	NM_025164	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Silent	SNP	ENST00000292055.4	37	CCDS8379.1	.	.	.	.	.	.	.	.	.	.	A	9.192	1.026248	0.19512	.	.	ENSG00000160584	ENST00000445177;ENST00000413553	.	.	.	5.45	3.17	0.36434	.	.	.	.	.	T	0.55832	0.1945	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52808	-0.8526	4	.	.	.	.	6.9859	0.24727	0.7012:0.0:0.2988:0.0	.	.	.	.	T	360;269	.	.	I	-	2	0	SIK3	116251932	0.993000	0.37304	1.000000	0.80357	0.996000	0.88848	2.547000	0.45786	2.062000	0.61559	0.454000	0.30748	ATT	.		0.433	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_025164	
SLC12A5	57468	hgsc.bcm.edu;bcgsc.ca	37	20	44676618	44676618	+	Splice_Site	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr20:44676618A>G	ENST00000454036.2	+	16	2025		c.e16-1		SLC12A5_ENST00000243964.3_Splice_Site	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5						cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCCGGCTCCCAGGGCAGAGAA	0.612																																					.		.											.	SLC12A5	156	0			c.1977-2A>G						.						46.0	41.0	43.0					20																	44676618		2203	4300	6503	SO:0001630	splice_region_variant	57468	exon16			GCTCCCAGGGCAG	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.1977-1A>G	20.37:g.44676618A>G		60.0	0.0		42.0	4.0	NM_001134771	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Splice_Site	SNP	ENST00000454036.2	37	CCDS46610.1	.	.	.	.	.	.	.	.	.	.	A	13.44	2.237439	0.39498	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	.	.	.	3.92	3.92	0.45320	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7426	0.51801	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC12A5	44110025	1.000000	0.71417	0.995000	0.50966	0.308000	0.27856	9.067000	0.93955	1.621000	0.50320	0.374000	0.22700	.	.		0.612	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1		Intron
SLC16A5	9121	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	73100204	73100204	+	Silent	SNP	G	G	C	rs141647560	byFrequency	TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:73100204G>C	ENST00000450736.2	+	5	1708	c.1293G>C	c.(1291-1293)gcG>gcC	p.A431A	SLC16A5_ENST00000538213.2_Silent_p.A471A|SLC16A5_ENST00000580123.1_Silent_p.A431A|SLC16A5_ENST00000329783.4_Silent_p.A431A			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5	431					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	CTGTCGCGGCGGATGCCCTGG	0.567																																					p.A431A		.											SLC16A5,brain,glioma,+2	SLC16A5	90	0			c.G1293C						.						71.0	66.0	68.0					17																	73100204		2203	4300	6503	SO:0001819	synonymous_variant	9121	exon6			CGCGGCGGATGCC	U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.1293G>C	17.37:g.73100204G>C		176.0	0.0		133.0	39.0	NM_001271765	B4E288	Silent	SNP	ENST00000450736.2	37	CCDS11713.1																																																																																			G|0.999;A|0.001		0.567	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445547.1	NM_004695	
SLC22A23	63027	hgsc.bcm.edu;bcgsc.ca	37	6	3416016	3416016	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr6:3416016C>T	ENST00000406686.3	-	2	727	c.728G>A	c.(727-729)gGc>gAc	p.G243D	SLC22A23_ENST00000436008.2_Missense_Mutation_p.G243D|SLC22A23_ENST00000380302.4_5'UTR|SLC22A23_ENST00000490273.1_5'UTR|SLC22A23_ENST00000380298.2_Missense_Mutation_p.G243D	NM_015482.1	NP_056297.1	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23	243					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				TATTAGGTAGCCAAAGATTAA	0.458																																					p.G243D		.											.	SLC22A23	23	0			c.G728A						.						164.0	144.0	150.0					6																	3416016		692	1591	2283	SO:0001583	missense	63027	exon2			AGGTAGCCAAAGA	AJ420525	CCDS34331.1, CCDS47363.1, CCDS75389.1	6p25.2	2013-05-22	2008-01-11	2008-01-11	ENSG00000137266	ENSG00000137266		"""Solute carriers"""	21106	protein-coding gene	gene with protein product		611697	"""chromosome 6 open reading frame 85"""	C6orf85		17714910	Standard	NM_015482		Approved	FLJ22174	uc003mvm.3	A1A5C7	OTTHUMG00000014144	ENST00000406686.3:c.728G>A	6.37:g.3416016C>T	ENSP00000385028:p.Gly243Asp	174.0	0.0		104.0	5.0	NM_015482	A1A5C8|Q5T8B8|Q6ZMH3|Q8IW73	Missense_Mutation	SNP	ENST00000406686.3	37	CCDS47363.1	.	.	.	.	.	.	.	.	.	.	C	31	5.102966	0.94245	.	.	ENSG00000137266	ENST00000436008;ENST00000406686;ENST00000485307;ENST00000467177;ENST00000380298	D;D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57;-2.57	5.4	5.4	0.78164	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	.	.	.	.	D	0.94335	0.8179	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94692	0.7875	9	0.87932	D	0	-17.0608	19.1812	0.93623	0.0:1.0:0.0:0.0	.	243;243	C9J4Z0;A1A5C7	.;S22AN_HUMAN	D	243;243;71;69;243	ENSP00000410245:G243D;ENSP00000385028:G243D;ENSP00000418134:G71D;ENSP00000418985:G69D;ENSP00000369653:G243D	ENSP00000369653:G243D	G	-	2	0	SLC22A23	3361015	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.313000	0.78978	2.530000	0.85305	0.563000	0.77884	GGC	.		0.458	SLC22A23-006	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353059.1	NM_021945	
SLC26A6	65010	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	48669737	48669737	+	Nonsense_Mutation	SNP	T	T	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:48669737T>A	ENST00000395550.2	-	5	573	c.526A>T	c.(526-528)Aga>Tga	p.R176*	SLC26A6_ENST00000383733.3_Nonsense_Mutation_p.R176*|SLC26A6_ENST00000337000.8_Intron|SLC26A6_ENST00000455886.2_Intron|SLC26A6_ENST00000482282.1_5'UTR|SLC26A6_ENST00000358747.6_Nonsense_Mutation_p.R155*|SLC26A6_ENST00000420764.2_Nonsense_Mutation_p.R176*			Q9BXS9	S26A6_HUMAN	solute carrier family 26 (anion exchanger), member 6	176					angiotensin-activated signaling pathway (GO:0038166)|anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular response to cAMP (GO:0071320)|cellular response to fructose stimulus (GO:0071332)|cellular response to interferon-gamma (GO:0071346)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|epithelial fluid transport (GO:0042045)|formate transport (GO:0015724)|intestinal absorption (GO:0050892)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|mannitol transport (GO:0015797)|oxalate transport (GO:0019532)|oxalic acid secretion (GO:0046724)|positive regulation of dipeptide transmembrane transport (GO:2001150)|protein kinase C signaling (GO:0070528)|regulation of intracellular pH (GO:0051453)|sperm capacitation (GO:0048240)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transepithelial chloride transport (GO:0030321)|transepithelial transport (GO:0070633)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|chloride channel complex (GO:0034707)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle membrane (GO:0012506)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|chloride transmembrane transporter activity (GO:0015108)|efflux transmembrane transporter activity (GO:0015562)|formate efflux transmembrane transporter activity (GO:0015660)|formate transmembrane transporter activity (GO:0015499)|formate uptake transmembrane transporter activity (GO:0015659)|oxalate transmembrane transporter activity (GO:0019531)|PDZ domain binding (GO:0030165)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)		SLC26A6/PRKAR2A(2)	NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		GCAGCATCTCTGGCTGTCTCA	0.582																																					p.R176X	NSCLC(13;369 479 28271 30152 44026)	.											.	SLC26A6	946	0			c.A526T						.						63.0	70.0	68.0					3																	48669737		2132	4239	6371	SO:0001587	stop_gained	65010	exon5			CATCTCTGGCTGT	AF279265	CCDS43087.1, CCDS46824.1, CCDS46825.1, CCDS46826.1, CCDS63627.1, CCDS63628.1	3p21.31	2013-08-05	2013-07-18		ENSG00000225697	ENSG00000225697		"""Solute carriers"""	14472	protein-coding gene	gene with protein product	"""pendrin-like protein 1"", ""pendrin L1"", ""sulfate anion transporter"", ""anion transporter 1"""	610068	"""solute carrier family 26, member 6"""			11087667, 11247665	Standard	NM_022911		Approved	DKFZp586E1422		Q9BXS9	OTTHUMG00000186381	ENST00000395550.2:c.526A>T	3.37:g.48669737T>A	ENSP00000378920:p.Arg176*	340.0	0.0		262.0	109.0	NM_022911	B4DMZ1|Q548A7|Q96Q90|Q9NQU1	Nonsense_Mutation	SNP	ENST00000395550.2	37	CCDS43087.1	.	.	.	.	.	.	.	.	.	.	T	13.10	2.136113	0.37728	.	.	ENSG00000225697	ENST00000420764;ENST00000395550;ENST00000383733;ENST00000447978;ENST00000358747;ENST00000421649	.	.	.	3.87	0.197	0.15164	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.0949	0.14727	0.0:0.2673:0.1592:0.5734	.	.	.	.	X	176;176;176;189;155;22	.	ENSP00000351597:R155X	R	-	1	2	SLC26A6	48644741	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.144000	0.16135	-0.123000	0.11745	0.455000	0.32223	AGA	.		0.582	SLC26A6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345040.1	NM_022911	
SLC9C1	285335	hgsc.bcm.edu;bcgsc.ca	37	3	111985087	111985089	+	In_Frame_Del	DEL	AAG	AAG	-	rs557883834	byFrequency	TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:111985087_111985089delAAG	ENST00000305815.5	-	8	1126_1128	c.874_876delCTT	c.(874-876)cttdel	p.L292del	SLC9C1_ENST00000487372.1_In_Frame_Del_p.L292del	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	292					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										CCACTTACTCAAGAAGAAGTGTT	0.315														4	0.000798722	0.003	0.0	5008	,	,		14903	0.0		0.0	False		,,,				2504	0.0				p.292_292del		.											.	.	.	0			c.874_876del						.																																			SO:0001651	inframe_deletion	285335	exon8			TTACTCAAGAAGA	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.874_876delCTT	3.37:g.111985093_111985095delAAG	ENSP00000306627:p.Leu292del	407.0	0.0		413.0	145.0	NM_183061	Q6ZRP4|Q7RTP2	In_Frame_Del	DEL	ENST00000305815.5	37	CCDS33817.1																																																																																			.		0.315	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
SLC51A	200931	hgsc.bcm.edu;bcgsc.ca	37	3	195944788	195944788	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:195944788A>G	ENST00000296327.5	+	2	323	c.114A>G	c.(112-114)acA>acG	p.T38T		NM_152672.5	NP_689885.4	Q86UW1	OSTA_HUMAN	solute carrier family 51, alpha subunit	38					bile acid and bile salt transport (GO:0015721)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)									Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)	AGCCTCCCACAGCAGCCCAAC	0.607																																					p.T38T		.											.	.	.	0			c.A114G						.						51.0	46.0	48.0					3																	195944788		2203	4300	6503	SO:0001819	synonymous_variant	200931	exon2			TCCCACAGCAGCC		CCDS3314.1	3q29	2013-05-22			ENSG00000163959	ENSG00000163959		"""Solute carriers"""	29955	protein-coding gene	gene with protein product	"""organic solute transporter, alpha subunit"""	612084				12719432, 20538072	Standard	NM_152672		Approved	OSTalpha	uc003fwd.3	Q86UW1	OTTHUMG00000155684	ENST00000296327.5:c.114A>G	3.37:g.195944788A>G		85.0	0.0		43.0	5.0	NM_152672	Q6ZMC7	Silent	SNP	ENST00000296327.5	37	CCDS3314.1	.	.	.	.	.	.	.	.	.	.	A	4.040	0.005065	0.07866	.	.	ENSG00000163959	ENST00000428985	.	.	.	5.89	-11.8	0.00035	.	.	.	.	.	T	0.30510	0.0767	.	.	.	0.53005	D	0.999965	.	.	.	.	.	.	T	0.38824	-0.9643	4	.	.	.	.	1.3954	0.02260	0.4026:0.1863:0.2685:0.1426	.	.	.	.	R	9	.	.	Q	+	2	0	AC069257.9	197429185	0.000000	0.05858	0.326000	0.25389	0.519000	0.34347	-4.969000	0.00165	-2.420000	0.00564	-0.908000	0.02827	CAG	.		0.607	SLC51A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341253.1	NM_152672	
SLITRK2	84631	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	144906050	144906050	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:144906050C>A	ENST00000370490.1	+	1	6362	c.2107C>A	c.(2107-2109)Cag>Aag	p.Q703K	SLITRK2_ENST00000428560.2_Missense_Mutation_p.Q703K|SLITRK2_ENST00000413937.2_Missense_Mutation_p.Q703K|TMEM257_ENST00000408967.2_5'Flank|SLITRK2_ENST00000447897.2_Missense_Mutation_p.Q703K|SLITRK2_ENST00000434188.2_Missense_Mutation_p.Q703K			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	703					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					CATCTACATGCAGAAGGAAGG	0.493																																					p.Q703K		.											.	SLITRK2	136	0			c.C2107A						.						71.0	71.0	71.0					X																	144906050		2203	4300	6503	SO:0001583	missense	84631	exon5			TACATGCAGAAGG	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.2107C>A	X.37:g.144906050C>A	ENSP00000359521:p.Gln703Lys	114.0	1.0		101.0	23.0	NM_001144005	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	C	8.803	0.933452	0.18206	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.50548	0.8;0.74;0.74;0.74;0.74;0.74	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.45796	0.1360	L	0.54323	1.7	0.58432	D	0.999999	P	0.41597	0.756	B	0.41236	0.351	T	0.35574	-0.9783	10	0.22706	T	0.39	-7.8392	15.3882	0.74718	0.0:1.0:0.0:0.0	.	703	Q9H156	SLIK2_HUMAN	K	703	ENSP00000334374:Q703K;ENSP00000411681:Q703K;ENSP00000359521:Q703K;ENSP00000397015:Q703K;ENSP00000407347:Q703K;ENSP00000412010:Q703K	ENSP00000334374:Q703K	Q	+	1	0	SLITRK2	144713742	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.965000	0.63708	2.224000	0.72417	0.513000	0.50165	CAG	.		0.493	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
SMARCA2	6595	hgsc.bcm.edu;bcgsc.ca	37	9	2056807	2056807	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:2056807A>G	ENST00000382203.1	+	7	1518	c.1309A>G	c.(1309-1311)Aag>Gag	p.K437E	SMARCA2_ENST00000349721.2_Missense_Mutation_p.K437E|SMARCA2_ENST00000382194.1_Missense_Mutation_p.K437E|SMARCA2_ENST00000357248.2_Missense_Mutation_p.K437E			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	437	HSA. {ECO:0000255|PROSITE- ProRule:PRU00549}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		GAAGCAGCAGAAGATTGAGCA	0.532																																					p.K437E		.											.	SMARCA2	653	0			c.A1309G						.						82.0	77.0	79.0					9																	2056807		2203	4300	6503	SO:0001583	missense	6595	exon7			CAGCAGAAGATTG	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.1309A>G	9.37:g.2056807A>G	ENSP00000371638:p.Lys437Glu	107.0	0.0		65.0	4.0	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.860069	0.91433	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000450198;ENST00000382203;ENST00000382194	T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;-0.62	5.17	5.17	0.71159	Helicase/SANT-associated, DNA binding (1);HAS subgroup (1);HSA (1);	0.000000	0.85682	D	0.000000	D	0.85287	0.5662	M	0.86343	2.81	0.80722	D	1	D;D;D	0.69078	0.992;0.996;0.997	D;D;D	0.79108	0.933;0.987;0.992	D	0.86819	0.2003	10	0.46703	T	0.11	-33.2005	14.69	0.69080	1.0:0.0:0.0:0.0	.	38;437;437	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	E	437	ENSP00000265773:K437E;ENSP00000349788:K437E;ENSP00000392081:K437E;ENSP00000371638:K437E;ENSP00000371629:K437E	ENSP00000265773:K437E	K	+	1	0	SMARCA2	2046807	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.305000	0.96197	1.946000	0.56461	0.533000	0.62120	AAG	.		0.532	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
SMARCC2	6601	broad.mit.edu;bcgsc.ca	37	12	56558092	56558093	+	Frame_Shift_Ins	INS	-	-	GT			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	-	-	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:56558092_56558093insGT	ENST00000267064.4	-	27	3648_3649	c.3562_3563insAC	c.(3562-3564)ctgfs	p.L1188fs	SMARCC2_ENST00000394023.3_Frame_Shift_Ins_p.L1126fs|SMARCC2_ENST00000550164.1_Frame_Shift_Ins_p.L1219fs|RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000347471.4_Intron	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	1188	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CTCACCTGGCAGTGGGCTGGCA	0.653																																					p.L1188fs		.											.	SMARCC2	229	0			c.3563_3564insAC						.																																			SO:0001589	frameshift_variant	6601	exon27			CCTGGCAGTGGGC	U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.3561_3562dupAC	12.37:g.56558093_56558094dupGT	ENSP00000267064:p.Leu1188fs	48.0	0.0		28.0	8.0	NM_003075	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Frame_Shift_Ins	INS	ENST00000267064.4	37	CCDS8907.1																																																																																			.		0.653	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1		
SNAP91	9892	hgsc.bcm.edu;bcgsc.ca	37	6	84300973	84300973	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr6:84300973A>G	ENST00000439399.2	-	22	2287	c.1971T>C	c.(1969-1971)tcT>tcC	p.S657S	SNAP91_ENST00000520302.1_Silent_p.S627S|SNAP91_ENST00000521485.1_Silent_p.S657S|SNAP91_ENST00000520213.1_Intron|SNAP91_ENST00000428679.2_Silent_p.S657S|SNAP91_ENST00000195649.6_Silent_p.S657S|SNAP91_ENST00000521743.1_Silent_p.S657S|SNAP91_ENST00000437520.1_Intron|SNAP91_ENST00000369694.2_Silent_p.S657S	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	657					clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		AAGCAGCCTGAGATGCAGGTT	0.363																																					p.S657S		.											.	SNAP91	23	0			c.T1971C						.						124.0	118.0	120.0					6																	84300973		1865	4103	5968	SO:0001819	synonymous_variant	9892	exon21			AGCCTGAGATGCA	AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.1971T>C	6.37:g.84300973A>G		87.0	0.0		44.0	4.0	NM_001242792	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Silent	SNP	ENST00000439399.2	37	CCDS47455.1																																																																																			.		0.363	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375296.1		
SNX12	29934	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	70282707	70282707	+	Silent	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:70282707G>A	ENST00000374274.3	-	2	374	c.258C>T	c.(256-258)agC>agT	p.S86S	SNX12_ENST00000276105.3_Silent_p.S82S|SNX12_ENST00000465030.1_5'UTR	NM_001256185.1|NM_001256188.1|NM_013346.3	NP_001243114.1|NP_001243117.1|NP_037478.2	Q9UMY4	SNX12_HUMAN	sorting nexin 12	86	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|negative regulation of early endosome to late endosome transport (GO:2000642)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of protein transport (GO:0051224)|regulation of endocytosis (GO:0030100)	early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	Renal(35;0.156)					GCCATACCTTGCTATCTCTCT	0.483																																					p.S86S		.											.	SNX12	226	0			c.C258T						.						105.0	81.0	89.0					X																	70282707		2203	4300	6503	SO:0001819	synonymous_variant	29934	exon3			TACCTTGCTATCT	AF171229	CCDS14405.1, CCDS59169.1	Xq13.1	2008-03-11			ENSG00000147164	ENSG00000147164		"""Sorting nexins"""	14976	protein-coding gene	gene with protein product		300883					Standard	NM_013346		Approved		uc004dyr.2	Q9UMY4	OTTHUMG00000021786	ENST00000374274.3:c.258C>T	X.37:g.70282707G>A		128.0	0.0		87.0	19.0	NM_001256185	F8W8K5|Q8WUG9	Silent	SNP	ENST00000374274.3	37	CCDS14405.1																																																																																			.		0.483	SNX12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057094.1	NM_013346	
SPACA3	124912	hgsc.bcm.edu;bcgsc.ca	37	17	31323887	31323887	+	Missense_Mutation	SNP	G	G	T	rs548141074		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:31323887G>T	ENST00000269053.3	+	3	440	c.370G>T	c.(370-372)Ggt>Tgt	p.G124C	SPACA3_ENST00000394637.2_3'UTR|SPACA3_ENST00000394638.1_Missense_Mutation_p.G21C|SPACA3_ENST00000580599.1_Missense_Mutation_p.G55C	NM_173847.3	NP_776246.1	Q8IXA5	SACA3_HUMAN	sperm acrosome associated 3	124					cell wall macromolecule catabolic process (GO:0016998)|defense response to Gram-positive bacterium (GO:0050830)|monocyte activation (GO:0042117)|peptidoglycan catabolic process (GO:0009253)|positive regulation of macrophage activation (GO:0043032)|positive regulation of phagocytosis (GO:0050766)|response to virus (GO:0009615)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|secretory granule (GO:0030141)	lysozyme activity (GO:0003796)			breast(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(9;0.193)			TTTCACAAGCGGTTTCAACGC	0.582																																					p.G124C		.											.	SPACA3	92	0			c.G370T						.						105.0	94.0	98.0					17																	31323887		2203	4300	6503	SO:0001583	missense	124912	exon3			ACAAGCGGTTTCA	AF216311, AF099029	CCDS11275.1	17q12	2014-07-23			ENSG00000141316	ENSG00000141316			16260	protein-coding gene	gene with protein product	"""cancer/testis antigen 54"", ""sperm lyzozyme-like acrosomal protein 1"""	612749				12606493	Standard	NM_173847		Approved	ALLP17, SLLP1, LYC3, LYZL3, CT54	uc002hhs.1	Q8IXA5	OTTHUMG00000132886	ENST00000269053.3:c.370G>T	17.37:g.31323887G>T	ENSP00000269053:p.Gly124Cys	141.0	0.0		123.0	5.0	NM_173847	Q7Z4Y5	Missense_Mutation	SNP	ENST00000269053.3	37	CCDS11275.1	.	.	.	.	.	.	.	.	.	.	G	14.20	2.464729	0.43736	.	.	ENSG00000141316	ENST00000269053;ENST00000394638;ENST00000394637;ENST00000411740	T;T	0.78126	-1.15;-1.15	4.59	3.62	0.41486	Lysozyme-like domain (1);	0.112963	0.42821	D	0.000642	D	0.88876	0.6556	M	0.92970	3.365	0.35113	D	0.766342	D	0.89917	1.0	D	0.85130	0.997	D	0.91633	0.5320	10	0.87932	D	0	-6.5689	8.2126	0.31492	0.108:0.0:0.892:0.0	.	124	Q8IXA5	SACA3_HUMAN	C	124;21;125;32	ENSP00000269053:G124C;ENSP00000378134:G21C	ENSP00000269053:G124C	G	+	1	0	SPACA3	28348000	1.000000	0.71417	0.955000	0.39395	0.345000	0.29048	1.265000	0.33027	1.148000	0.42385	0.448000	0.29417	GGT	.		0.582	SPACA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256380.1	NM_173847	
SPATA16	83893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	172835323	172835323	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:172835323T>C	ENST00000351008.3	-	2	382	c.199A>G	c.(199-201)Aag>Gag	p.K67E		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	67					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			TTGATGCCCTTTGTCATTTTT	0.388																																					p.K67E		.											.	SPATA16	94	0			c.A199G						.						340.0	323.0	329.0					3																	172835323		2203	4300	6503	SO:0001583	missense	83893	exon2			TGCCCTTTGTCAT	AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.199A>G	3.37:g.172835323T>C	ENSP00000341765:p.Lys67Glu	696.0	0.0		1219.0	190.0	NM_031955	Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Missense_Mutation	SNP	ENST00000351008.3	37	CCDS3221.1	.	.	.	.	.	.	.	.	.	.	T	15.03	2.710873	0.48517	.	.	ENSG00000144962	ENST00000351008	T	0.16196	2.36	5.27	5.27	0.74061	.	0.107922	0.41396	D	0.000884	T	0.09862	0.0242	N	0.17082	0.46	0.32811	D	0.501493	B	0.31318	0.319	B	0.26416	0.069	T	0.13388	-1.0511	10	0.38643	T	0.18	-15.4234	9.0924	0.36619	0.0:0.0845:0.0:0.9155	.	67	Q9BXB7	SPT16_HUMAN	E	67	ENSP00000341765:K67E	ENSP00000341765:K67E	K	-	1	0	SPATA16	174318017	0.897000	0.30589	1.000000	0.80357	0.976000	0.68499	1.652000	0.37313	1.985000	0.57927	0.528000	0.53228	AAG	.		0.388	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346322.1	NM_031955	
SPATA5L1	79029	hgsc.bcm.edu;bcgsc.ca	37	15	45713246	45713246	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr15:45713246T>C	ENST00000305560.6	+	8	2199	c.2100T>C	c.(2098-2100)gcT>gcC	p.A700A	SPATA5L1_ENST00000533841.1_3'UTR	NM_024063.2	NP_076968.2	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1	700						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		AATAGGCTGCTTTGCTGGCTC	0.403																																					p.A700A		.											.	SPATA5L1	94	0			c.T2100C						.						52.0	53.0	53.0					15																	45713246		2198	4298	6496	SO:0001819	synonymous_variant	79029	exon8			GGCTGCTTTGCTG	AK023232	CCDS10123.1	15q15.1	2010-04-21			ENSG00000171763	ENSG00000171763		"""ATPases / AAA-type"""	28762	protein-coding gene	gene with protein product						12477932	Standard	NM_024063		Approved	MGC5347, FLJ12286	uc001zve.3	Q9BVQ7	OTTHUMG00000131425	ENST00000305560.6:c.2100T>C	15.37:g.45713246T>C		43.0	0.0		60.0	4.0	NM_024063	C9JHR5|Q9H8W7|Q9HA41	Silent	SNP	ENST00000305560.6	37	CCDS10123.1	.	.	.	.	.	.	.	.	.	.	T	9.528	1.110046	0.20714	.	.	ENSG00000171763	ENST00000531624	.	.	.	5.6	2.22	0.28083	.	.	.	.	.	T	0.58264	0.2110	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53143	-0.8480	4	.	.	.	-26.8576	9.1663	0.37054	0.0:0.6612:0.0:0.3388	.	.	.	.	P	205	.	.	L	+	2	0	SPATA5L1	43500538	0.966000	0.33281	1.000000	0.80357	0.980000	0.70556	-0.056000	0.11787	0.705000	0.31890	-0.366000	0.07423	CTT	.		0.403	SPATA5L1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254218.1	NM_024063	
SPECC1	92521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	20107661	20107661	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:20107661C>G	ENST00000261503.5	+	4	350	c.299C>G	c.(298-300)aCt>aGt	p.T100S	SPECC1_ENST00000584527.1_5'Flank|SPECC1_ENST00000395525.3_Missense_Mutation_p.T19S|SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000395522.2_Missense_Mutation_p.T19S|SPECC1_ENST00000395529.3_Missense_Mutation_p.T100S|SPECC1_ENST00000395530.2_Missense_Mutation_p.T19S|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395527.4_Missense_Mutation_p.T100S|SPECC1_ENST00000536879.1_Intron	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	100					cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		TTTACAACAACTAAACGGACA	0.433																																					p.T100S		.											.	SPECC1	639	0			c.C299G						.						140.0	153.0	148.0					17																	20107661		2203	4300	6503	SO:0001583	missense	92521	exon4			CAACAACTAAACG	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.299C>G	17.37:g.20107661C>G	ENSP00000261503:p.Thr100Ser	102.0	0.0		63.0	26.0	NM_001033553	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	ENST00000261503.5	37	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.829683	0.32329	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	T;T;T;T	0.62364	0.03;2.97;2.92;2.92	5.13	5.13	0.70059	.	0.379873	0.32244	N	0.006373	T	0.49423	0.1556	L	0.28115	0.83	0.80722	D	1	B;B;B;B	0.21381	0.035;0.035;0.035;0.055	B;B;B;B	0.20955	0.02;0.032;0.032;0.015	T	0.40831	-0.9542	10	0.19590	T	0.45	-6.8572	16.4284	0.83832	0.0:1.0:0.0:0.0	.	19;19;100;100	Q5M775-4;Q5M775-3;Q5M775-2;Q5M775	.;.;.;CYTSB_HUMAN	S	100;100;100;19;19;19	ENSP00000261503:T100S;ENSP00000378900:T100S;ENSP00000378893:T19S;ENSP00000378896:T19S	ENSP00000261503:T100S	T	+	2	0	SPECC1	20048253	0.011000	0.17503	0.744000	0.31058	0.874000	0.50279	0.888000	0.28268	2.558000	0.86282	0.591000	0.81541	ACT	.		0.433	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904	
SPG11	80208	hgsc.bcm.edu;bcgsc.ca	37	15	44876208	44876208	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr15:44876208A>G	ENST00000261866.7	-	30	5686	c.5670T>C	c.(5668-5670)tgT>tgC	p.C1890C	SPG11_ENST00000427534.2_Silent_p.C1890C|SPG11_ENST00000558319.1_Silent_p.C1890C|SPG11_ENST00000558253.1_5'Flank|SPG11_ENST00000535302.2_Silent_p.C1890C	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	1890					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		CTTCATGCACACAGCCATCAT	0.453																																					p.C1890C		.											.	SPG11	95	0			c.T5670C						.						120.0	99.0	106.0					15																	44876208		2198	4298	6496	SO:0001819	synonymous_variant	80208	exon30			ATGCACACAGCCA		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.5670T>C	15.37:g.44876208A>G		102.0	0.0		98.0	5.0	NM_025137	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Silent	SNP	ENST00000261866.7	37	CCDS10112.1																																																																																			.		0.453	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1		
SPN	6693	hgsc.bcm.edu;bcgsc.ca	37	16	29675060	29675060	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:29675060T>C	ENST00000360121.3	+	2	103	c.11T>C	c.(10-12)cTt>cCt	p.L4P	SPN_ENST00000395389.2_Missense_Mutation_p.L4P	NM_001030288.2|NM_003123.4	NP_001025459.1|NP_003114.1	O75398	DEAF1_HUMAN	sialophorin	0	Ala-rich.				anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|stomach(1)	15						ATGGCCACGCTTCTCCTTCTC	0.627																																					p.L4P		.											.	SPN	514	0			c.T11C						.						118.0	129.0	125.0					16																	29675060		2197	4300	6497	SO:0001583	missense	6693	exon2			CCACGCTTCTCCT	J04536	CCDS10650.1	16p11.2	2008-07-31	2008-07-31		ENSG00000197471	ENSG00000197471		"""CD molecules"""	11249	protein-coding gene	gene with protein product	"""leukosialin"""	182160	"""sialophorin (gpL115, leukosialin, CD43)"""			2784859, 2521952	Standard	NM_001030288		Approved	LSN, CD43, GPL115	uc002dtm.4	P16150	OTTHUMG00000097765	ENST00000360121.3:c.11T>C	16.37:g.29675060T>C	ENSP00000353238:p.Leu4Pro	122.0	0.0		104.0	5.0	NM_001030288	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Missense_Mutation	SNP	ENST00000360121.3	37	CCDS10650.1	.	.	.	.	.	.	.	.	.	.	.	13.37	2.217088	0.39201	.	.	ENSG00000197471	ENST00000395389;ENST00000436527;ENST00000360121	T;T;T	0.47869	0.87;0.83;0.87	4.51	3.42	0.39159	.	0.203527	0.24481	N	0.038145	T	0.34978	0.0916	L	0.39898	1.24	0.20638	N	0.999877	B	0.31931	0.347	B	0.29176	0.099	T	0.32107	-0.9919	10	0.87932	D	0	-6.7037	7.0944	0.25301	0.0:0.1065:0.0:0.8935	.	4	P16150	LEUK_HUMAN	P	4	ENSP00000378787:L4P;ENSP00000412907:L4P;ENSP00000353238:L4P	ENSP00000353238:L4P	L	+	2	0	SPN	29582561	0.012000	0.17670	0.124000	0.21820	0.011000	0.07611	1.911000	0.39937	0.839000	0.34971	0.459000	0.35465	CTT	.		0.627	SPN-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215001.2		
SPRR2A	6700	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	153029108	153029108	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:153029108G>T	ENST00000392653.2	-	2	189	c.104C>A	c.(103-105)cCc>cAc	p.P35H		NM_005988.2	NP_005979.1	P35326	SPR2A_HUMAN	small proline-rich protein 2A	35	3 X 9 AA tandem repeats of P-K-C-P-[EQ]- P-C-P-P.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)				large_intestine(2)|ovary(1)	3	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGGTGGGCAGGGCTCAGGGCA	0.607																																					p.P35H		.											.	SPRR2A	69	0			c.C104A						.						68.0	65.0	66.0					1																	153029108		2202	4278	6480	SO:0001583	missense	6700	exon2			GGGCAGGGCTCAG	X53064	CCDS1034.1	1q21-q22	2008-02-05			ENSG00000241794	ENSG00000241794			11261	protein-coding gene	gene with protein product		182267				8325635	Standard	NM_005988		Approved		uc001fbd.3	P35326	OTTHUMG00000014395	ENST00000392653.2:c.104C>A	1.37:g.153029108G>T	ENSP00000376423:p.Pro35His	183.0	0.0		183.0	34.0	NM_005988	B2R4T3|D3DV35|Q5T529	Missense_Mutation	SNP	ENST00000392653.2	37	CCDS1034.1	.	.	.	.	.	.	.	.	.	.	G	9.563	1.118924	0.20877	.	.	ENSG00000241794	ENST00000392653	T	0.53857	0.6	2.79	2.79	0.32731	.	0.000000	0.32671	N	0.005794	T	0.56717	0.2004	.	.	.	0.18873	N	0.999981	D	0.89917	1.0	D	0.87578	0.998	T	0.44065	-0.9352	9	0.87932	D	0	.	9.1956	0.37226	0.0:0.0:1.0:0.0	.	35	P35326	SPR2A_HUMAN	H	35	ENSP00000376423:P35H	ENSP00000376423:P35H	P	-	2	0	SPRR2A	151295732	1.000000	0.71417	0.419000	0.26584	0.386000	0.30323	4.127000	0.57944	1.551000	0.49450	0.400000	0.26472	CCC	.		0.607	SPRR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040049.1	NM_005988	
SRPX	8406	hgsc.bcm.edu;bcgsc.ca	37	X	38013812	38013812	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:38013812G>T	ENST00000378533.3	-	9	1220	c.1114C>A	c.(1114-1116)Cga>Aga	p.R372R	SRPX_ENST00000343800.6_Silent_p.R359R|SRPX_ENST00000538295.1_Intron|SRPX_ENST00000479015.1_Intron|SRPX_ENST00000544439.1_Silent_p.R352R|SRPX_ENST00000432886.2_Silent_p.R313R|TM4SF2_ENST00000465127.1_Intron	NM_006307.4	NP_006298.1	P78539	SRPX_HUMAN	sushi-repeat containing protein, X-linked	372					autophagy (GO:0006914)|cell adhesion (GO:0007155)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|phagolysosome assembly (GO:0001845)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|response to endoplasmic reticulum stress (GO:0034976)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				autonomic_ganglia(1)|breast(2)|endometrium(5)|large_intestine(5)|lung(10)|prostate(2)	25						GTGATGTGTCGAAGATCAAGG	0.502																																					p.R372R		.											.	SRPX	130	0			c.C1114A						.						92.0	63.0	73.0					X																	38013812		2202	4300	6502	SO:0001819	synonymous_variant	8406	exon9			TGTGTCGAAGATC	U78093	CCDS14245.1, CCDS55400.1, CCDS55401.1, CCDS55402.1	Xp21.1	2011-01-25	2011-01-25		ENSG00000101955	ENSG00000101955			11309	protein-coding gene	gene with protein product		300187	"""sushi-repeat-containing protein, X chromosome"", ""sushi-repeat-containing protein, X-linked"""			8634708, 8634709	Standard	NM_006307		Approved	ETX1	uc004ddy.2	P78539	OTTHUMG00000021362	ENST00000378533.3:c.1114C>A	X.37:g.38013812G>T		79.0	0.0		81.0	4.0	NM_006307	A8K065|B3KWP8|B4DDB8|B4DQH5|F5H4D7|G3V1L0|Q4VX66|Q99652|Q99913	Silent	SNP	ENST00000378533.3	37	CCDS14245.1																																																																																			.		0.502	SRPX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056243.1	NM_006307	
SRRM2	23524	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2812361	2812361	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:2812361G>T	ENST00000301740.8	+	11	2381	c.1832G>T	c.(1831-1833)cGg>cTg	p.R611L		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	611	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						ACACCAGCCCGGAGGGGCAGG	0.622																																					p.R611L		.											.	SRRM2	93	0			c.G1832T						.						57.0	59.0	58.0					16																	2812361		2198	4300	6498	SO:0001583	missense	23524	exon11			CAGCCCGGAGGGG	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.1832G>T	16.37:g.2812361G>T	ENSP00000301740:p.Arg611Leu	89.0	0.0		54.0	5.0	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.536390	0.27475	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000426305	T	0.26223	1.75	5.91	5.91	0.95273	.	0.000000	0.56097	D	0.000031	T	0.35248	0.0925	L	0.27053	0.805	0.36903	D	0.890505	D	0.63880	0.993	D	0.74023	0.982	T	0.23619	-1.0183	10	0.44086	T	0.13	-8.1276	11.1017	0.48179	0.0836:0.0:0.9164:0.0	.	611	Q9UQ35	SRRM2_HUMAN	L	611;611;576	ENSP00000301740:R611L	ENSP00000301740:R611L	R	+	2	0	SRRM2	2752362	0.139000	0.22563	0.924000	0.36721	0.284000	0.27059	3.181000	0.50903	2.801000	0.96364	0.655000	0.94253	CGG	.		0.622	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
SRSF11	9295	hgsc.bcm.edu;bcgsc.ca	37	1	70710417	70710417	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:70710417G>T	ENST00000370950.3	+	9	933	c.851G>T	c.(850-852)cGg>cTg	p.R284L	SRSF11_ENST00000370949.1_Missense_Mutation_p.R224L|SRSF11_ENST00000405432.1_Missense_Mutation_p.R284L|SRSF11_ENST00000484162.1_3'UTR|SRSF11_ENST00000370951.1_Missense_Mutation_p.R284L			Q05519	SRS11_HUMAN	serine/arginine-rich splicing factor 11	284	10 X 8 AA approximate repeats of R-R-S-R- S-R-S-R.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|ovary(2)|skin(1)	6						TCTAGGAGTCGGCGACGATCC	0.443																																					p.R284L		.											.	SRSF11	227	0			c.G851T						.						94.0	90.0	91.0					1																	70710417		2203	4300	6503	SO:0001583	missense	9295	exon9			GGAGTCGGCGACG	M74002	CCDS647.1, CCDS53332.1	1p31.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000116754	ENSG00000116754		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10782	protein-coding gene	gene with protein product	"""SR splicing factor 11"""	602010	"""splicing factor, arginine/serine-rich 11"""	SFRS11		1896467, 20516191	Standard	NM_004768		Approved	p54, NET2	uc001des.3	Q05519	OTTHUMG00000009342	ENST00000370950.3:c.851G>T	1.37:g.70710417G>T	ENSP00000359988:p.Arg284Leu	129.0	0.0		115.0	5.0	NM_001190987	Q5T758|Q8IWE6	Missense_Mutation	SNP	ENST00000370950.3	37	CCDS647.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.201992	0.79127	.	.	ENSG00000116754	ENST00000370951;ENST00000370950;ENST00000405432;ENST00000395136;ENST00000370949	D;D;D;T;T	0.82167	-1.58;-1.58;-1.58;2.56;-0.45	5.53	5.53	0.82687	.	0.038654	0.85682	D	0.000000	D	0.89591	0.6759	M	0.82517	2.595	0.80722	D	1	D;D;D;D	0.60575	0.988;0.983;0.983;0.958	P;P;P;P	0.57911	0.829;0.549;0.549;0.451	D	0.90381	0.4388	10	0.87932	D	0	.	19.8223	0.96603	0.0:0.0:1.0:0.0	.	224;284;284;284	Q5T757;Q6PJB9;Q8IWE6;Q05519	.;.;.;SRS11_HUMAN	L	284;284;284;284;224	ENSP00000359989:R284L;ENSP00000359988:R284L;ENSP00000384357:R284L;ENSP00000378568:R284L;ENSP00000359987:R224L	ENSP00000359987:R224L	R	+	2	0	SRSF11	70483005	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.281000	0.72632	2.763000	0.94921	0.555000	0.69702	CGG	.		0.443	SRSF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025889.1	NM_004768	
FAM47E-STBD1	100631383	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	77230621	77230621	+	Missense_Mutation	SNP	G	G	T	rs147970715	byFrequency	TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr4:77230621G>T	ENST00000237642.6	+	2	1289	c.545G>T	c.(544-546)aGa>aTa	p.R182I	FAM47E_ENST00000515604.1_3'UTR|FAM47E-STBD1_ENST00000539752.1_Missense_Mutation_p.R33I	NM_003943.4	NP_003934.1			FAM47E-STBD1 readthrough																		CTCAAGAACAGAGCTAAAGAA	0.478																																					p.R182I		.											.	STBD1	69	0			c.G545T						.						53.0	55.0	55.0					4																	77230621		2203	4300	6503	SO:0001583	missense	8987	exon2			AGAACAGAGCTAA		CCDS58908.1	4q21.1	2013-04-23			ENSG00000118804	ENSG00000118804			44667	other	readthrough							Standard	NM_001242939		Approved				OTTHUMG00000160966	ENST00000237642.6:c.545G>T	4.37:g.77230621G>T	ENSP00000237642:p.Arg182Ile	150.0	1.0		128.0	34.0	NM_003943		Missense_Mutation	SNP	ENST00000237642.6	37	CCDS3578.1	.	.	.	.	.	.	.	.	.	.	G	11.39	1.623330	0.28889	.	.	ENSG00000118804	ENST00000539752;ENST00000237642	.	.	.	4.73	2.06	0.26882	.	0.510243	0.18127	N	0.150841	T	0.46151	0.1378	L	0.34521	1.04	0.33693	D	0.613597	P	0.52316	0.952	P	0.54460	0.753	T	0.58612	-0.7606	9	0.72032	D	0.01	-6.5183	8.1831	0.31322	0.3238:0.0:0.6762:0.0	.	182	O95210	STBD1_HUMAN	I	33;182	.	ENSP00000237642:R182I	R	+	2	0	STBD1	77449645	0.539000	0.26402	0.109000	0.21407	0.001000	0.01503	0.842000	0.27627	0.712000	0.32039	-0.136000	0.14681	AGA	G|0.999;A|0.001		0.478	FAM47E-STBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252415.2		
STK38L	23012	hgsc.bcm.edu;bcgsc.ca	37	12	27475143	27475143	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:27475143C>T	ENST00000389032.3	+	13	1412	c.1243C>T	c.(1243-1245)Cct>Tct	p.P415S	STK38L_ENST00000539577.1_Missense_Mutation_p.P322S	NM_015000.3	NP_055815.1			serine/threonine kinase 38 like											breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12	Colorectal(261;0.0847)					TGATGACTTCCCTGAATCTGA	0.328																																					p.P415S		.											.	STK38L	980	0			c.C1243T						.						103.0	116.0	112.0					12																	27475143		2203	4299	6502	SO:0001583	missense	23012	exon13			GACTTCCCTGAAT	AB023182	CCDS31761.1	12p11.23	2014-04-23			ENSG00000211455	ENSG00000211455			17848	protein-coding gene	gene with protein product	"""nuclear Dbf2-related 2"""	615836				16488889	Standard	NM_015000		Approved	KIAA0965, NDR2	uc001rhr.3	Q9Y2H1	OTTHUMG00000169284	ENST00000389032.3:c.1243C>T	12.37:g.27475143C>T	ENSP00000373684:p.Pro415Ser	75.0	0.0		58.0	5.0	NM_015000		Missense_Mutation	SNP	ENST00000389032.3	37	CCDS31761.1	.	.	.	.	.	.	.	.	.	.	C	17.93	3.509477	0.64522	.	.	ENSG00000211455	ENST00000389032;ENST00000539577	T;T	0.56941	0.43;0.43	4.98	4.98	0.66077	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.71651	0.3365	M	0.71871	2.18	0.80722	D	1	D;D	0.67145	0.996;0.988	D;P	0.68039	0.955;0.904	T	0.74990	-0.3475	10	0.66056	D	0.02	.	18.6314	0.91361	0.0:1.0:0.0:0.0	.	322;415	B4E3J8;Q9Y2H1	.;ST38L_HUMAN	S	415;322	ENSP00000373684:P415S;ENSP00000446386:P322S	ENSP00000373684:P415S	P	+	1	0	STK38L	27366410	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	5.671000	0.68095	2.477000	0.83638	0.305000	0.20034	CCT	.		0.328	STK38L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403297.1	NM_015000	
STX19	415117	hgsc.bcm.edu;bcgsc.ca	37	3	93733245	93733245	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:93733245C>T	ENST00000315099.2	-	2	1125	c.869G>A	c.(868-870)tGc>tAc	p.C290Y	ARL13B_ENST00000394222.3_Intron|ARL13B_ENST00000471138.1_Intron|ARL13B_ENST00000539730.1_Intron|ARL13B_ENST00000535334.1_Intron|ARL13B_ENST00000303097.7_Intron|ARL13B_ENST00000486562.1_Intron	NM_001001850.2	NP_001001850.1	Q8N4C7	STX19_HUMAN	syntaxin 19	290	Cys-rich.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)				kidney(2)|large_intestine(2)|lung(4)|prostate(1)	9						TGAGCTACAGCATGGACAGCA	0.318																																					p.C290Y		.											.	STX19	90	0			c.G869A						.						46.0	43.0	44.0					3																	93733245		2203	4298	6501	SO:0001583	missense	415117	exon2			CTACAGCATGGAC	AF461456	CCDS33793.1	3q11	2005-12-30			ENSG00000178750	ENSG00000178750			19300	protein-coding gene	gene with protein product							Standard	NM_001001850		Approved	MGC21382	uc003drh.1	Q8N4C7	OTTHUMG00000159013	ENST00000315099.2:c.869G>A	3.37:g.93733245C>T	ENSP00000320679:p.Cys290Tyr	99.0	0.0		84.0	5.0	NM_001001850		Missense_Mutation	SNP	ENST00000315099.2	37	CCDS33793.1	.	.	.	.	.	.	.	.	.	.	C	14.16	2.453435	0.43531	.	.	ENSG00000178750	ENST00000315099	T	0.50548	0.74	5.2	5.2	0.72013	.	0.103138	0.64402	D	0.000002	T	0.49321	0.1550	M	0.69358	2.11	0.39259	D	0.964184	B	0.31054	0.306	B	0.27500	0.08	T	0.54964	-0.8214	10	0.54805	T	0.06	-5.212	18.6137	0.91295	0.0:1.0:0.0:0.0	.	290	Q8N4C7	STX19_HUMAN	Y	290	ENSP00000320679:C290Y	ENSP00000320679:C290Y	C	-	2	0	STX19	95215935	0.677000	0.27577	0.959000	0.39883	0.983000	0.72400	1.587000	0.36622	2.805000	0.96524	0.655000	0.94253	TGC	.		0.318	STX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352909.1	NM_001001850	
SWI5	375757	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	131038431	131038431	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:131038431C>T	ENST00000320188.5	+	1	7	c.7C>T	c.(7-9)Cgg>Tgg	p.R3W	GOLGA2_ENST00000490628.1_5'Flank|GOLGA2_ENST00000609374.1_5'Flank|SWI5_ENST00000418976.1_5'Flank|SWI5_ENST00000608796.1_5'Flank|GOLGA2_ENST00000421699.2_5'Flank|SWI5_ENST00000419867.2_5'Flank|SWI5_ENST00000495313.1_Intron	NM_001040011.1	NP_001035100.1	Q1ZZU3	SWI5_HUMAN	SWI5 recombination repair homolog (yeast)	3					cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)	nucleus (GO:0005634)|Swi5-Sfr1 complex (GO:0032798)											GGCTATGCAGCGGCGTGGCCA	0.632																																					p.R3W		.											.	.	.	0			c.C7T						.						50.0	59.0	56.0					9																	131038431		2046	4145	6191	SO:0001583	missense	375757	exon1			ATGCAGCGGCGTG	BC029911	CCDS43883.1	9q34.13	2011-07-29	2011-07-29	2011-07-29	ENSG00000175854	ENSG00000175854			31412	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 119"""	C9orf119		21252223, 20976249	Standard	NM_001040011		Approved	bA395P17.9	uc004bup.3	Q1ZZU3	OTTHUMG00000020729	ENST00000320188.5:c.7C>T	9.37:g.131038431C>T	ENSP00000316609:p.Arg3Trp	61.0	1.0		49.0	17.0	NM_001040011	Q5SYX7|Q5SYX8|Q8N2W6	Missense_Mutation	SNP	ENST00000320188.5	37	CCDS43883.1	.	.	.	.	.	.	.	.	.	.	C	16.53	3.147847	0.57151	.	.	ENSG00000175854	ENST00000320188	.	.	.	4.43	0.182	0.15077	.	.	.	.	.	T	0.11750	0.0286	N	0.14661	0.345	0.09310	N	1	D	0.67145	0.996	B	0.41764	0.366	T	0.16808	-1.0390	8	0.87932	D	0	.	0.6972	0.00901	0.3218:0.3246:0.1578:0.1958	.	3	Q1ZZU3	SWI5_HUMAN	W	3	.	ENSP00000316609:R3W	R	+	1	2	SWI5	130078252	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.095000	0.03356	-0.157000	0.11059	0.650000	0.86243	CGG	.		0.632	SWI5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001040011	
SYNE2	23224	hgsc.bcm.edu;bcgsc.ca	37	14	64641845	64641845	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr14:64641845A>G	ENST00000344113.4	+	95	17631	c.17419A>G	c.(17419-17421)Agc>Ggc	p.S5807G	ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000554584.1_Missense_Mutation_p.S5672G|SYNE2_ENST00000555002.1_Missense_Mutation_p.S2441G|SYNE2_ENST00000358025.3_Missense_Mutation_p.S5807G|SYNE2_ENST00000357395.3_Missense_Mutation_p.S2192G|SYNE2_ENST00000394768.2_Missense_Mutation_p.S2192G	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5807					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GCAGTTCCAGAGCACTGTAGA	0.413																																					p.S5807G		.											.	SYNE2	164	0			c.A17419G						.						71.0	73.0	72.0					14																	64641845		2203	4300	6503	SO:0001583	missense	23224	exon95			TTCCAGAGCACTG	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.17419A>G	14.37:g.64641845A>G	ENSP00000341781:p.Ser5807Gly	88.0	0.0		113.0	5.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	A	9.500	1.103026	0.20632	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.75589	1.31;1.31;1.31;-0.95;1.31;1.31	5.46	3.09	0.35607	.	0.395446	0.23847	N	0.043988	T	0.60143	0.2246	L	0.52364	1.645	0.41980	D	0.990793	B;B;B;B;B	0.18310	0.003;0.001;0.004;0.004;0.027	B;B;B;B;B	0.15484	0.011;0.003;0.006;0.005;0.013	T	0.49244	-0.8960	10	0.02654	T	1	.	7.6073	0.28110	0.8192:0.0:0.1808:0.0	.	2192;195;5672;5807;5807	Q8WXH0-7;Q7Z362;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;.;SYNE2_HUMAN;.	G	5807;2192;5807;5672;5678;2441;2192	ENSP00000350719:S5807G;ENSP00000349969:S2192G;ENSP00000341781:S5807G;ENSP00000452570:S5672G;ENSP00000450831:S2441G;ENSP00000378249:S2192G	ENSP00000261678:S5678G	S	+	1	0	SYNE2	63711598	0.975000	0.34042	0.703000	0.30354	0.173000	0.22820	1.135000	0.31454	0.446000	0.26666	0.482000	0.46254	AGC	.		0.413	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
TAF15	8148	hgsc.bcm.edu;bcgsc.ca	37	17	34171487	34171487	+	Missense_Mutation	SNP	G	G	T	rs71381481	byFrequency	TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:34171487G>T	ENST00000588240.1	+	15	1299	c.1184G>T	c.(1183-1185)cGg>cTg	p.R395L	TAF15_ENST00000311979.3_Missense_Mutation_p.R392L|TAF15_ENST00000592237.1_Missense_Mutation_p.R304L	NM_003487.3|NM_139215.2	NP_003478.1|NP_631961.1	Q16514	TAF12_HUMAN	TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa	33					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of RNA biosynthetic process (GO:2001141)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)		TAF15/NR4A3(33)	lung(1)|ovary(1)|skin(2)|stomach(1)	5		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		GCAGATTTCCGGGGGAGAGGC	0.542			T	"""TEC, CHN1, ZNF384"""	"""extraskeletal myxoid chondrosarcomas, ALL"""																																p.R395L		.		Dom	yes		17	17q11.1-q11.2	8148	"""TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa"""		"""L, M"""	.	TAF15	723	0			c.G1184T						.						108.0	120.0	116.0					17																	34171487		2202	4299	6501	SO:0001583	missense	8148	exon15			ATTTCCGGGGGAG	U51334	CCDS32623.1, CCDS59279.1	17q11.1-q11.2	2013-02-12	2002-08-29	2001-12-07		ENSG00000270647		"""RNA binding motif (RRM) containing"""	11547	protein-coding gene	gene with protein product		601574	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA-binding protein 56)"""	TAF2N		8954779, 9795213	Standard	NM_003487		Approved	hTAFII68, RBP56, Npl3	uc002hkd.4	Q92804		ENST00000588240.1:c.1184G>T	17.37:g.34171487G>T	ENSP00000466950:p.Arg395Leu	158.0	0.0		182.0	8.0	NM_139215	D3DPM5|Q15775|Q5T077	Missense_Mutation	SNP	ENST00000588240.1	37	CCDS32623.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.532489	0.45073	.	.	ENSG00000172660	ENST00000311979;ENST00000536077	.	.	.	4.84	3.86	0.44501	.	.	.	.	.	T	0.33059	0.0850	N	0.08118	0	0.40380	D	0.979438	P;P	0.38300	0.492;0.626	B;B	0.38712	0.145;0.28	T	0.33701	-0.9858	8	0.49607	T	0.09	-5.036	11.3543	0.49607	0.093:0.0:0.907:0.0	.	395;392	Q92804;Q92804-2	RBP56_HUMAN;.	L	395;198	.	ENSP00000309558:R395L	R	+	2	0	TAF15	31195600	1.000000	0.71417	1.000000	0.80357	0.446000	0.32137	3.369000	0.52365	2.249000	0.74217	0.591000	0.81541	CGG	G|0.999;A|0.001		0.542	TAF15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449134.1	NM_139215	
TAS2R43	259289	hgsc.bcm.edu;bcgsc.ca	37	12	11244577	11244577	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:11244577A>G	ENST00000531678.1	-	1	335	c.252T>C	c.(250-252)gcT>gcC	p.A84A	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	84					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		AGATATTATAAGCAGTAGTTC	0.378																																					p.A84A		.											.	TAS2R43	1	0			c.T252C						.						52.0	45.0	48.0					12																	11244577		1879	3859	5738	SO:0001819	synonymous_variant	259289	exon1			ATTATAAGCAGTA	AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.252T>C	12.37:g.11244577A>G		152.0	0.0		107.0	6.0	NM_176884	P59546|Q645X4	Silent	SNP	ENST00000531678.1	37	CCDS53749.1																																																																																			.		0.378	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383561.1	NM_176884	
TBC1D5	9779	hgsc.bcm.edu;bcgsc.ca	37	3	17333464	17333464	+	Missense_Mutation	SNP	C	C	A	rs143029277		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:17333464C>A	ENST00000253692.7	-	15	2832	c.1168G>T	c.(1168-1170)Ggc>Tgc	p.G390C	TBC1D5_ENST00000446818.2_Missense_Mutation_p.G390C|TBC1D5_ENST00000414318.2_Intron|TBC1D5_ENST00000429924.2_Missense_Mutation_p.G342C|TBC1D5_ENST00000429383.4_Missense_Mutation_p.G390C	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5	390						retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						ATCAGAAGGCCGAGACAGGTC	0.383																																					p.G390C		.											.	TBC1D5	91	0			c.G1168T						.						89.0	87.0	88.0					3																	17333464		2203	4300	6503	SO:0001583	missense	9779	exon15			GAAGGCCGAGACA	D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.1168G>T	3.37:g.17333464C>A	ENSP00000253692:p.Gly390Cys	103.0	0.0		72.0	4.0	NM_014744	A6NP25|C9JP52	Missense_Mutation	SNP	ENST00000253692.7	37	CCDS33714.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962192	0.74016	.	.	ENSG00000131374	ENST00000253692;ENST00000429383;ENST00000446818;ENST00000429924	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	6.03	6.03	0.97812	Rab-GAP/TBC domain (1);	0.000000	0.85682	D	0.000000	T	0.34687	0.0906	M	0.61703	1.905	0.80722	D	1	B;P;P	0.44241	0.345;0.801;0.829	B;P;P	0.46253	0.2;0.509;0.509	T	0.02081	-1.1217	10	0.62326	D	0.03	-19.4637	20.1672	0.98154	0.0:1.0:0.0:0.0	.	342;390;390	C9J3F6;C9JP52;Q92609	.;.;TBCD5_HUMAN	C	390;390;390;342	ENSP00000253692:G390C;ENSP00000398127:G390C;ENSP00000402935:G390C;ENSP00000411925:G342C	ENSP00000253692:G390C	G	-	1	0	TBC1D5	17308468	1.000000	0.71417	0.976000	0.42696	0.993000	0.82548	7.284000	0.78650	2.861000	0.98227	0.655000	0.94253	GGC	C|1.000;T|0.000		0.383	TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340301.3	NM_014744	
TCF3	6929	hgsc.bcm.edu;bcgsc.ca	37	19	1611812	1611812	+	Missense_Mutation	SNP	C	C	A	rs538013937		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:1611812C>A	ENST00000262965.5	-	19	2203	c.1859G>T	c.(1858-1860)cGg>cTg	p.R620L	TCF3_ENST00000395423.3_Missense_Mutation_p.R624L|TCF3_ENST00000588136.1_Missense_Mutation_p.R617L|TCF3_ENST00000344749.5_Missense_Mutation_p.R617L|TCF3_ENST00000453954.2_Missense_Mutation_p.R532L	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCTTCTCGCCGTTTCAAACA	0.617			T	"""PBX1, HLF, TFPT"""	pre B-ALL																																p.R620L		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3	721	0			c.G1859T						.						77.0	61.0	66.0					19																	1611812		2203	4300	6503	SO:0001583	missense	6929	exon19			TCTCGCCGTTTCA	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1859G>T	19.37:g.1611812C>A	ENSP00000262965:p.Arg620Leu	168.0	0.0		122.0	5.0	NM_003200	Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	ENST00000262965.5	37	CCDS12074.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.307236	0.81247	.	.	ENSG00000071564	ENST00000262965;ENST00000344749;ENST00000453954;ENST00000395423	T;T;T	0.58652	1.76;1.63;0.32	4.69	4.69	0.59074	Helix-loop-helix DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.77538	0.4145	M	0.79693	2.465	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;1.0	D;D;D;D	0.91635	0.999;0.987;0.999;0.998	T	0.81658	-0.0833	10	0.87932	D	0	-13.7286	16.981	0.86327	0.0:1.0:0.0:0.0	.	617;620;624;557	P15923-2;P15923;Q2TB39;Q6PJU3	.;TFE2_HUMAN;.;.	L	620;617;617;624	ENSP00000262965:R620L;ENSP00000344375:R617L;ENSP00000378813:R624L	ENSP00000262965:R620L	R	-	2	0	TCF3	1562812	1.000000	0.71417	0.863000	0.33907	0.418000	0.31294	7.631000	0.83237	2.309000	0.77851	0.561000	0.74099	CGG	.		0.617	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCIRG1	10312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	67818045	67818045	+	Silent	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:67818045C>A	ENST00000265686.3	+	19	2436	c.2328C>A	c.(2326-2328)atC>atA	p.I776I	TCIRG1_ENST00000530802.1_Intron|RP11-802E16.3_ENST00000534517.1_RNA|RP11-802E16.3_ENST00000526897.1_RNA|CHKA_ENST00000533728.1_5'Flank|TCIRG1_ENST00000532635.1_Silent_p.I560I|RP11-802E16.3_ENST00000529934.1_RNA	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	776					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						TGGTCCCCATCTTTGCCGCCT	0.662																																					p.I776I		.											.	TCIRG1	227	0			c.C2328A						.						108.0	118.0	115.0					11																	67818045		2200	4294	6494	SO:0001819	synonymous_variant	10312	exon19			CCCCATCTTTGCC	AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.2328C>A	11.37:g.67818045C>A		433.0	1.0		386.0	167.0	NM_006019	O75877|Q8WVC5	Silent	SNP	ENST00000265686.3	37	CCDS8177.1																																																																																			.		0.662	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394305.1	NM_006019	
TDRD9	122402	hgsc.bcm.edu;bcgsc.ca	37	14	104470585	104470585	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr14:104470585A>G	ENST00000409874.4	+	14	1542	c.1494A>G	c.(1492-1494)ggA>ggG	p.G498G	TDRD9_ENST00000339063.5_Silent_p.G498G	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	498	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				GCCGTGCTGGACGAGTGTCTA	0.408																																					p.G498G		.											.	TDRD9	70	0			c.A1494G						.						112.0	86.0	95.0					14																	104470585		2203	4300	6503	SO:0001819	synonymous_variant	122402	exon14			TGCTGGACGAGTG	AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.1494A>G	14.37:g.104470585A>G		137.0	0.0		91.0	4.0	NM_153046	A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Silent	SNP	ENST00000409874.4	37	CCDS9987.2	.	.	.	.	.	.	.	.	.	.	A	10.50	1.368680	0.24771	.	.	ENSG00000156414	ENST00000557332	.	.	.	5.87	-2.58	0.06228	.	.	.	.	.	T	0.51924	0.1703	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47736	-0.9094	4	.	.	.	.	8.437	0.32793	0.4929:0.107:0.4001:0.0	.	.	.	.	A	225	.	.	T	+	1	0	TDRD9	103540338	0.281000	0.24258	0.963000	0.40424	0.943000	0.58893	-0.382000	0.07408	-0.394000	0.07727	-0.250000	0.11733	ACG	.		0.408	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328325.3	NM_153046	
TEKT1	83659	hgsc.bcm.edu;bcgsc.ca	37	17	6716342	6716342	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:6716342G>T	ENST00000338694.2	-	6	789	c.660C>A	c.(658-660)ttC>ttA	p.F220L	TEKT1_ENST00000535086.1_Missense_Mutation_p.F74L	NM_053285.1	NP_444515.1	Q969V4	TEKT1_HUMAN	tektin 1	220						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20		Myeloproliferative disorder(207;0.0255)				TGGTGCTGGAGAAGTCCAACC	0.547																																					p.F220L		.											.	TEKT1	92	0			c.C660A						.						76.0	68.0	71.0					17																	6716342		2203	4300	6503	SO:0001583	missense	83659	exon6			GCTGGAGAAGTCC		CCDS11083.1	17p13.2	2011-05-23			ENSG00000167858	ENSG00000167858			15534	protein-coding gene	gene with protein product		609002				11606253	Standard	NM_053285		Approved		uc002gdt.3	Q969V4	OTTHUMG00000102063	ENST00000338694.2:c.660C>A	17.37:g.6716342G>T	ENSP00000341346:p.Phe220Leu	95.0	0.0		65.0	4.0	NM_053285	D3DTM7	Missense_Mutation	SNP	ENST00000338694.2	37	CCDS11083.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.311936	0.81358	.	.	ENSG00000167858	ENST00000338694;ENST00000535086	T;T	0.02916	4.11;4.11	4.96	4.96	0.65561	.	0.237839	0.43747	D	0.000533	T	0.09730	0.0239	M	0.87900	2.915	0.34957	D	0.751854	B	0.24576	0.106	B	0.34452	0.183	T	0.02546	-1.1143	10	0.44086	T	0.13	.	16.0725	0.80946	0.0:0.0:1.0:0.0	.	220	Q969V4	TEKT1_HUMAN	L	220;74	ENSP00000341346:F220L;ENSP00000444142:F74L	ENSP00000341346:F220L	F	-	3	2	TEKT1	6657066	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.093000	0.57714	2.458000	0.83093	0.591000	0.81541	TTC	.		0.547	TEKT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219867.2	NM_053285	
TENM2	57451	hgsc.bcm.edu;bcgsc.ca	37	5	167689229	167689229	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr5:167689229G>T	ENST00000518659.1	+	29	7778	c.7739G>T	c.(7738-7740)cGg>cTg	p.R2580L	TENM2_ENST00000519204.1_Missense_Mutation_p.R2459L|TENM2_ENST00000545108.1_Missense_Mutation_p.R2579L|TENM2_ENST00000403607.2_Missense_Mutation_p.R2404L|TENM2_ENST00000520394.1_Missense_Mutation_p.R2341L	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2580					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										AAAGAAGGGCGGGTGACCACG	0.557																																					p.R2571L		.											.	.	.	0			c.G7712T						.						29.0	33.0	32.0					5																	167689229		2034	4204	6238	SO:0001583	missense	57451	exon29			AAGGGCGGGTGAC	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.7739G>T	5.37:g.167689229G>T	ENSP00000429430:p.Arg2580Leu	115.0	0.0		89.0	6.0	NM_001122679	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		.	.	.	.	.	.	.	.	.	.	G	12.85	2.062122	0.36373	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.90197	-2.15;-2.14;-2.26;-2.61;-2.63	5.42	4.53	0.55603	.	0.108147	0.64402	D	0.000006	D	0.86422	0.5929	L	0.49126	1.545	0.35424	D	0.793446	B;B;P	0.35226	0.125;0.076;0.491	B;B;B	0.33521	0.165;0.079;0.092	D	0.88191	0.2877	10	0.48119	T	0.1	.	10.0276	0.42081	0.1599:0.0:0.8401:0.0	.	2579;2580;2341	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	L	2580;2579;2459;2341;2404	ENSP00000429430:R2580L;ENSP00000438635:R2579L;ENSP00000428964:R2459L;ENSP00000427874:R2341L;ENSP00000384905:R2404L	ENSP00000384905:R2404L	R	+	2	0	ODZ2	167621807	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.017000	0.64047	1.349000	0.45751	0.655000	0.94253	CGG	.		0.557	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
TET2	54790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	106155605	106155605	+	Missense_Mutation	SNP	A	A	T	rs545616524		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr4:106155605A>T	ENST00000540549.1	+	3	1366	c.506A>T	c.(505-507)cAt>cTt	p.H169L	TET2_ENST00000305737.2_Missense_Mutation_p.H169L|TET2_ENST00000545826.1_Missense_Mutation_p.H169L|TET2_ENST00000380013.4_Missense_Mutation_p.H169L|TET2_ENST00000513237.1_Missense_Mutation_p.H190L|TET2_ENST00000394764.1_Missense_Mutation_p.H169L|TET2_ENST00000413648.2_Missense_Mutation_p.H169L			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	169					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TTTTCAACACATAACTGCAGT	0.388			"""Mis N, F"""		MDS																																p.H169L		.		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	.	TET2	4618	0			c.A506T						.						44.0	42.0	43.0					4																	106155605		2203	4300	6503	SO:0001583	missense	54790	exon3			CAACACATAACTG	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.506A>T	4.37:g.106155605A>T	ENSP00000442788:p.His169Leu	220.0	0.0		149.0	43.0	NM_001127208	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	ENST00000540549.1	37	CCDS47120.1	.	.	.	.	.	.	.	.	.	.	A	7.287	0.610195	0.14066	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648;ENST00000535110	T;T;T;T;T;T;T	0.03717	3.83;4.5;3.83;4.5;4.5;3.83;3.84	5.28	-3.22	0.05125	.	14.800100	0.00728	N	0.000920	T	0.03348	0.0097	N	0.19112	0.55	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.0;0.0;0.002	T	0.46938	-0.9155	10	0.56958	D	0.05	.	8.0142	0.30372	0.3563:0.0:0.5205:0.1233	.	190;169;169	E7EQS8;Q6N021;Q6N021-2	.;TET2_HUMAN;.	L	169;169;169;190;169;169;169;169	ENSP00000306705:H169L;ENSP00000442788:H169L;ENSP00000442867:H169L;ENSP00000425443:H190L;ENSP00000369351:H169L;ENSP00000378245:H169L;ENSP00000391448:H169L	ENSP00000265149:H169L	H	+	2	0	TET2	106375054	0.000000	0.05858	0.002000	0.10522	0.219000	0.24729	-0.261000	0.08694	-0.319000	0.08652	0.533000	0.62120	CAT	.		0.388	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
TEX14	56155	hgsc.bcm.edu;bcgsc.ca	37	17	56690838	56690838	+	Missense_Mutation	SNP	G	G	T	rs150820263	byFrequency	TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:56690838G>T	ENST00000240361.8	-	9	1052	c.967C>A	c.(967-969)Cgc>Agc	p.R323S	TEX14_ENST00000349033.5_Missense_Mutation_p.R317S|TEX14_ENST00000389934.3_Missense_Mutation_p.R317S			Q8IWB6	TEX14_HUMAN	testis expressed 14	323	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TACACAAGGCGGGTTTTCTCT	0.502																																					p.R323S		.											TEX14,NS,carcinoma,+1	TEX14	810	0			c.C967A						.						168.0	144.0	152.0					17																	56690838		2203	4300	6503	SO:0001583	missense	56155	exon9			CAAGGCGGGTTTT	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.967C>A	17.37:g.56690838G>T	ENSP00000240361:p.Arg323Ser	198.0	1.0		144.0	7.0	NM_001201457	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	37	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	G	8.134	0.783782	0.16189	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.40756	1.02;1.02;1.02	5.68	3.72	0.42706	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.538685	0.18620	N	0.135891	T	0.28400	0.0702	N	0.13235	0.315	0.09310	N	1	P;B;B	0.37781	0.608;0.232;0.227	B;B;B	0.41466	0.358;0.159;0.114	T	0.09509	-1.0671	10	0.40728	T	0.16	-3.5586	8.7353	0.34525	0.2317:0.0:0.7683:0.0	.	323;317;317	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	S	323;317;317	ENSP00000240361:R323S;ENSP00000374584:R317S;ENSP00000268910:R317S	ENSP00000240361:R323S	R	-	1	0	TEX14	54045837	0.988000	0.35896	0.005000	0.12908	0.004000	0.04260	3.332000	0.52083	0.770000	0.33336	-0.254000	0.11334	CGC	G|1.000;A|0.000		0.502	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1		
TGM2	7052	ucsc.edu;bcgsc.ca	37	20	36769692	36769692	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr20:36769692T>C	ENST00000361475.2	-	8	1264	c.1091A>G	c.(1090-1092)aAg>aGg	p.K364R	TGM2_ENST00000536724.1_Missense_Mutation_p.K304R|TGM2_ENST00000536701.1_Missense_Mutation_p.K283R	NM_004613.2|NM_198951.1	NP_004604.2|NP_945189.1	P21980	TGM2_HUMAN	transglutaminase 2	364					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|branching involved in salivary gland morphogenesis (GO:0060445)|isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein homooligomerization (GO:0051260)|salivary gland cavitation (GO:0060662)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			endometrium(2)|large_intestine(11)|liver(1)|lung(7)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	ACCTTCGCTCTTCTCCTGGGG	0.637																																					p.K364R		.											.	TGM2	155	0			c.A1091G						.						19.0	17.0	18.0					20																	36769692		2194	4288	6482	SO:0001583	missense	7052	exon8			TCGCTCTTCTCCT	M98478	CCDS13302.1	20q12	2013-05-02	2013-05-02		ENSG00000198959	ENSG00000198959	2.3.2.13	"""Transglutaminases"""	11778	protein-coding gene	gene with protein product	"""C polypeptide, protein-glutamine-gamma-glutamyltransferase"""	190196	"""transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7912692, 11390390	Standard	NM_004613		Approved	TGC	uc002xhr.3	P21980	OTTHUMG00000032437	ENST00000361475.2:c.1091A>G	20.37:g.36769692T>C	ENSP00000355330:p.Lys364Arg	65.0	0.0		32.0	4.0	NM_198951	E1P5V9|Q16436|Q6B838|Q9BTN7|Q9UH35	Missense_Mutation	SNP	ENST00000361475.2	37	CCDS13302.1	.	.	.	.	.	.	.	.	.	.	T	12.46	1.946101	0.34377	.	.	ENSG00000198959	ENST00000361475;ENST00000536701;ENST00000536724	T;T;T	0.19669	2.13;2.13;2.13	4.96	3.85	0.44370	.	0.145114	0.64402	D	0.000009	T	0.14700	0.0355	L	0.33093	0.98	0.46317	D	0.998983	P;B;P;P;B	0.49090	0.804;0.121;0.919;0.704;0.121	B;B;B;B;B	0.42343	0.279;0.028;0.384;0.144;0.028	T	0.06972	-1.0797	10	0.15066	T	0.55	-13.0734	9.6562	0.39928	0.0:0.0817:0.0:0.9183	.	304;283;364;304;364	F5H6P0;B4DIT7;P21980-2;B4DTN7;P21980	.;.;.;.;TGM2_HUMAN	R	364;283;304	ENSP00000355330:K364R;ENSP00000444701:K283R;ENSP00000437479:K304R	ENSP00000355330:K364R	K	-	2	0	TGM2	36203106	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.721000	0.38032	0.923000	0.37045	0.379000	0.24179	AAG	.		0.637	TGM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079151.2	NM_198951	
TIAM1	7074	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	21	32639202	32639202	+	Silent	SNP	G	G	T	rs139712298		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr21:32639202G>T	ENST00000286827.3	-	5	558	c.87C>A	c.(85-87)tcC>tcA	p.S29S	TIAM1_ENST00000541036.1_Silent_p.S29S|TIAM1_ENST00000469412.1_Intron	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	29					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						AGAGGCGCAGGGAGCGGGAAG	0.582																																					p.S29S		.											.	TIAM1	724	0			c.C87A						.						45.0	47.0	46.0					21																	32639202		2203	4300	6503	SO:0001819	synonymous_variant	7074	exon5			GCGCAGGGAGCGG		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.87C>A	21.37:g.32639202G>T		87.0	0.0		41.0	4.0	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	ENST00000286827.3	37	CCDS13609.1																																																																																			G|0.999;A|0.001		0.582	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
TMEM30A	55754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	75970580	75970580	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr6:75970580T>C	ENST00000230461.6	-	4	830	c.501A>G	c.(499-501)ccA>ccG	p.P167P	TMEM30A_ENST00000370050.5_Silent_p.P48P|TMEM30A_ENST00000475111.2_Silent_p.P131P	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	167					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						AAGGAGCAATTGGTTTGTCTT	0.338																																					p.P167P		.											.	TMEM30A	90	0			c.A501G						.						165.0	151.0	156.0					6																	75970580		2203	4300	6503	SO:0001819	synonymous_variant	55754	exon4			AGCAATTGGTTTG	AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.501A>G	6.37:g.75970580T>C		263.0	0.0		189.0	69.0	NM_018247	A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Silent	SNP	ENST00000230461.6	37	CCDS4983.1																																																																																			.		0.338	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041248.2	NM_018247	
TMPRSS11BNL	401136	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	69078095	69078095	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr4:69078095G>T	ENST00000432593.3	-	2	275	c.109C>A	c.(109-111)Cat>Aat	p.H37N	FTLP10_ENST00000503647.1_RNA|RP11-646E20.6_ENST00000510782.1_RNA					TMPRSS11B N-terminal like, pseudogene											autonomic_ganglia(1)	1						GCCAGAAAATGAACAAGGAGA	0.328																																					p.H37N		.											.	.	.	0			c.C109A						.						126.0	95.0	105.0					4																	69078095		692	1591	2283	SO:0001583	missense	401136	exon2			GAAAATGAACAAG			4q13.2	2014-05-09	2014-05-08		ENSG00000226894	ENSG00000250026			37262	pseudogene	pseudogene			"""TMPRSS11B N terminal-like"", ""TMPRSS11B N-terminal like"""				Standard	NR_104048		Approved	FLJ41562	uc003hdv.1		OTTHUMG00000160802	ENST00000432593.3:c.109C>A	4.37:g.69078095G>T	ENSP00000391149:p.His37Asn	437.0	0.0		306.0	89.0	NM_001129907		Missense_Mutation	SNP	ENST00000432593.3	37	CCDS47066.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.461041	0.43736	.	.	ENSG00000226894	ENST00000432593	T	0.34667	1.35	5.16	5.16	0.70880	.	.	.	.	.	T	0.60470	0.2271	M	0.74647	2.275	0.24997	N	0.991495	D	0.67145	0.996	D	0.79784	0.993	T	0.53968	-0.8363	9	0.72032	D	0.01	.	14.0064	0.64465	0.0:0.0:1.0:0.0	.	37	B3KVV0	TM11L_HUMAN	N	37	ENSP00000391149:H37N	ENSP00000391149:H37N	H	-	1	0	TMPRSS11BNL	68760690	1.000000	0.71417	1.000000	0.80357	0.203000	0.24098	2.684000	0.46951	2.697000	0.92050	0.650000	0.86243	CAT	.		0.328	TMPRSS11BNL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001129907	
TNRC6C	57690	hgsc.bcm.edu;bcgsc.ca	37	17	76046560	76046560	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:76046560G>A	ENST00000588061.1	+	5	2144	c.1417G>A	c.(1417-1419)Gac>Aac	p.D473N	TNRC6C_ENST00000301624.4_Missense_Mutation_p.D473N|TNRC6C_ENST00000541771.1_Missense_Mutation_p.D473N|TNRC6C_ENST00000544502.1_Missense_Mutation_p.D473N|TNRC6C_ENST00000588847.1_Missense_Mutation_p.D473N|TNRC6C_ENST00000335749.4_Missense_Mutation_p.D473N			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	473	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AAGGAAAAATGACAATGGGAC	0.478																																					p.D473N		.											.	TNRC6C	24	0			c.G1417A						.						75.0	76.0	76.0					17																	76046560		1883	4117	6000	SO:0001583	missense	57690	exon4			AAAAATGACAATG	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.1417G>A	17.37:g.76046560G>A	ENSP00000468647:p.Asp473Asn	99.0	0.0		76.0	4.0	NM_018996	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	ENST00000588061.1	37	CCDS45798.1	.	.	.	.	.	.	.	.	.	.	G	18.25	3.582408	0.65992	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.23348	1.91;2.1;2.1;1.91	5.07	5.07	0.68467	.	0.268851	0.41396	D	0.000885	T	0.51143	0.1657	M	0.71036	2.16	0.46222	D	0.998935	D;D;B	0.89917	0.999;1.0;0.397	D;D;B	0.91635	0.995;0.999;0.085	T	0.40040	-0.9584	10	0.31617	T	0.26	-26.0189	18.6486	0.91421	0.0:0.0:1.0:0.0	.	473;473;473	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	N	473	ENSP00000336783:D473N;ENSP00000301624:D473N;ENSP00000440310:D473N;ENSP00000442421:D473N	ENSP00000301624:D473N	D	+	1	0	TNRC6C	73558155	1.000000	0.71417	0.991000	0.47740	0.998000	0.95712	5.249000	0.65427	2.644000	0.89710	0.563000	0.77884	GAC	.		0.478	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996	
TNXB	7148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32038106	32038106	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr6:32038106G>T	ENST00000375244.3	-	14	5277	c.5076C>A	c.(5074-5076)ctC>ctA	p.L1692L	TNXB_ENST00000375247.2_Silent_p.L1692L			P22105	TENX_HUMAN	tenascin XB	1774	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CCGTCCAGGAGAGGCGCAGTG	0.657																																					p.L1692L		.											.	TNXB	90	0			c.C5076A						.						20.0	21.0	21.0					6																	32038106		1915	4123	6038	SO:0001819	synonymous_variant	7148	exon14			CCAGGAGAGGCGC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5076C>A	6.37:g.32038106G>T		187.0	0.0		166.0	31.0	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000375244.3	37																																																																																				.		0.657	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
TOM1L2	146691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	17801962	17801962	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:17801962T>C	ENST00000379504.3	-	3	247	c.164A>G	c.(163-165)aAg>aGg	p.K55R	TOM1L2_ENST00000540946.1_Missense_Mutation_p.K55R|TOM1L2_ENST00000535933.1_Missense_Mutation_p.K55R|TOM1L2_ENST00000581396.1_Missense_Mutation_p.K55R|TOM1L2_ENST00000542206.1_Missense_Mutation_p.K55R|TOM1L2_ENST00000318094.10_Missense_Mutation_p.K55R|TOM1L2_ENST00000395739.4_Missense_Mutation_p.K55R	NM_001082968.1	NP_001076437.1	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 (chicken)	55	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				intracellular protein transport (GO:0006886)|negative regulation of mitosis (GO:0045839)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	clathrin binding (GO:0030276)|protein kinase binding (GO:0019901)			endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(2)	10	all_neural(463;0.228)					GAGCCGCTTCTTCAGGGCTCG	0.468																																					p.K55R	Melanoma(192;2505 2909 14455 25269)	.											.	TOM1L2	90	0			c.A164G						.						144.0	115.0	125.0					17																	17801962		2203	4300	6503	SO:0001583	missense	146691	exon3			CGCTTCTTCAGGG	AJ230803	CCDS32584.1, CCDS42270.1, CCDS74000.1, CCDS74001.1, CCDS74002.1, CCDS74003.1	17p11.2	2008-07-03	2001-11-28		ENSG00000175662	ENSG00000175662			11984	protein-coding gene	gene with protein product		615519	"""target of myb1 (chicken) homolog-like 1"""			10036180	Standard	NM_001082968		Approved		uc002grz.4	Q6ZVM7	OTTHUMG00000059353	ENST00000379504.3:c.164A>G	17.37:g.17801962T>C	ENSP00000368818:p.Lys55Arg	314.0	1.0		295.0	119.0	NM_001033551	B7Z2L7|B7Z7F4|Q86V61|Q8TDE7|Q96M88	Missense_Mutation	SNP	ENST00000379504.3	37	CCDS42270.1	.	.	.	.	.	.	.	.	.	.	T	17.35	3.367733	0.61513	.	.	ENSG00000175662	ENST00000379504;ENST00000318094;ENST00000395739;ENST00000535933;ENST00000540946;ENST00000542206;ENST00000537091	T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.9	5.21	4.1	0.47936	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.089139	0.85682	D	0.000000	T	0.22936	0.0554	N	0.25647	0.755	0.24949	N	0.991804	B;B;B;B;P;B;P	0.36010	0.151;0.233;0.011;0.036;0.532;0.444;0.532	B;B;B;B;B;B;B	0.43680	0.17;0.389;0.01;0.033;0.427;0.262;0.281	T	0.12293	-1.0553	10	0.33141	T	0.24	-32.9027	11.3667	0.49677	0.0:0.0726:0.0:0.9274	.	55;55;55;55;55;55;55	B7Z8F0;B7Z2U2;F5H3S6;B7Z2L7;Q6ZVM7-3;Q6ZVM7;Q6ZVM7-2	.;.;.;.;.;TM1L2_HUMAN;.	R	55	ENSP00000368818:K55R;ENSP00000312860:K55R;ENSP00000379088:K55R;ENSP00000438621:K55R;ENSP00000437655:K55R;ENSP00000445188:K55R	ENSP00000312860:K55R	K	-	2	0	TOM1L2	17742687	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.315000	0.51951	2.198000	0.70561	0.533000	0.62120	AAG	.		0.468	TOM1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131928.1		
TPH2	121278	hgsc.bcm.edu;bcgsc.ca	37	12	72416258	72416258	+	Missense_Mutation	SNP	C	C	A	rs371065822		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr12:72416258C>A	ENST00000333850.3	+	9	1289	c.1148C>A	c.(1147-1149)tCc>tAc	p.S383Y		NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	383					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	CTCCTTTCCTCCATTGGAGAA	0.418																																					p.S383Y		.											.	TPH2	93	0			c.C1148A						.						101.0	95.0	97.0					12																	72416258		2203	4300	6503	SO:0001583	missense	121278	exon9			TTTCCTCCATTGG	AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.1148C>A	12.37:g.72416258C>A	ENSP00000329093:p.Ser383Tyr	111.0	0.0		74.0	4.0	NM_173353	A6NGA4|Q14CB0	Missense_Mutation	SNP	ENST00000333850.3	37	CCDS31859.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.690515	0.88735	.	.	ENSG00000139287	ENST00000333850	D	0.99801	-6.81	5.98	5.98	0.97165	Aromatic amino acid hydroxylase, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.99891	0.9948	H	0.98218	4.175	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.96636	0.9470	10	0.87932	D	0	-25.8637	20.452	0.99131	0.0:1.0:0.0:0.0	.	383	Q8IWU9	TPH2_HUMAN	Y	383	ENSP00000329093:S383Y	ENSP00000329093:S383Y	S	+	2	0	TPH2	70702525	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.818000	0.86416	2.838000	0.97847	0.591000	0.81541	TCC	.		0.418	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1	NM_173353	
TRIM59	286827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	160155954	160155954	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:160155954C>G	ENST00000309784.4	-	3	1203	c.1018G>C	c.(1018-1020)Gta>Cta	p.V340L	RP11-432B6.3_ENST00000483754.1_Intron|TRIM59_ENST00000543469.1_Intron	NM_173084.2	NP_775107.1	Q8IWR1	TRI59_HUMAN	tripartite motif containing 59	340					innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral entry into host cell (GO:0046597)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|urinary_tract(3)	15			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			ATCAGTATTACTGAAATTAAT	0.308																																					p.V340L		.											.	TRIM59	658	0			c.G1018C						.						59.0	62.0	61.0					3																	160155954		2201	4297	6498	SO:0001583	missense	286827	exon3			GTATTACTGAAAT	AY159379	CCDS3190.1	3q26	2013-01-09	2011-01-25		ENSG00000213186	ENSG00000213186		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	30834	protein-coding gene	gene with protein product			"""tripartite motif-containing 57"", ""tripartite motif-containing 59"""	TRIM57		12095697	Standard	NM_173084		Approved	TSBF1, Mrf1, RNF104	uc003fdm.3	Q8IWR1	OTTHUMG00000159034	ENST00000309784.4:c.1018G>C	3.37:g.160155954C>G	ENSP00000311219:p.Val340Leu	299.0	0.0		271.0	85.0	NM_173084	A8K5G9|D3DNL9	Missense_Mutation	SNP	ENST00000309784.4	37	CCDS3190.1	.	.	.	.	.	.	.	.	.	.	C	6.199	0.404851	0.11754	.	.	ENSG00000213186	ENST00000309784	T	0.22539	1.95	5.77	1.75	0.24633	.	0.507764	0.20377	N	0.093523	T	0.12732	0.0309	L	0.40543	1.245	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.22730	-1.0208	9	.	.	.	-1.2124	2.1154	0.03713	0.2416:0.3814:0.2378:0.1392	.	340	Q8IWR1	TRI59_HUMAN	L	340	ENSP00000311219:V340L	.	V	-	1	0	TRIM59	161638648	0.000000	0.05858	0.724000	0.30704	0.843000	0.47879	0.012000	0.13287	0.334000	0.23590	0.561000	0.74099	GTA	.		0.308	TRIM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352963.1	NM_173084	
TRIM66	9866	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	8642090	8642090	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr11:8642090C>T	ENST00000299550.6	-	16	3241	c.3047G>A	c.(3046-3048)aGc>aAc	p.S1016N	TRIM66_ENST00000402157.2_Missense_Mutation_p.S1045N	NM_014818.1	NP_055633.1	O15016	TRI66_HUMAN	tripartite motif containing 66	1016						aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						CTGGGTCAGGCTGCGGCACAA	0.597																																					p.S1016N		.											.	TRIM66	68	0			c.G3047A						.						50.0	43.0	45.0					11																	8642090		692	1591	2283	SO:0001583	missense	9866	exon16			GTCAGGCTGCGGC	AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000299550.6:c.3047G>A	11.37:g.8642090C>T	ENSP00000299550:p.Ser1016Asn	167.0	0.0		132.0	34.0	NM_014818	Q9BQQ4	Missense_Mutation	SNP	ENST00000299550.6	37		.	.	.	.	.	.	.	.	.	.	C	11.28	1.592835	0.28357	.	.	ENSG00000166436	ENST00000299550;ENST00000402157	D;D	0.84516	-1.86;-1.86	4.68	4.68	0.58851	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Bromodomain (1);Zinc finger, FYVE/PHD-type (1);	0.065897	0.64402	D	0.000014	T	0.68851	0.3046	N	0.12443	0.215	0.27191	N	0.960418	B	0.20261	0.043	B	0.32533	0.147	T	0.56601	-0.7952	10	0.06757	T	0.87	-17.127	5.8163	0.18494	0.0:0.7674:0.0:0.2326	.	1016	O15016	TRI66_HUMAN	N	1016;1045	ENSP00000299550:S1016N;ENSP00000384876:S1045N	ENSP00000299550:S1016N	S	-	2	0	TRIM66	8598666	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.963000	0.49184	2.594000	0.87642	0.555000	0.69702	AGC	.		0.597	TRIM66-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_084529	
TSC1	7248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	135779080	135779080	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:135779080C>A	ENST00000298552.3	-	17	2387	c.2166G>T	c.(2164-2166)aaG>aaT	p.K722N	TSC1_ENST00000545250.1_Missense_Mutation_p.K671N|TSC1_ENST00000440111.2_Missense_Mutation_p.K722N	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	722					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.R721fs*9(1)|p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		CTTTGATCACCTTGCGGAGGA	0.537			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.K722N		.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	TSC1	1906	2	Unknown(1)|Deletion - Frameshift(1)	ovary(1)|bone(1)	c.G2166T						.						69.0	70.0	70.0					9																	135779080		2203	4300	6503	SO:0001583	missense	7248	exon17	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	GATCACCTTGCGG	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.2166G>T	9.37:g.135779080C>A	ENSP00000298552:p.Lys722Asn	94.0	0.0		82.0	33.0	NM_000368	B7Z897|Q5VVN5	Missense_Mutation	SNP	ENST00000298552.3	37	CCDS6956.1	.	.	.	.	.	.	.	.	.	.	C	16.30	3.085869	0.55861	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250	D;D;D	0.85339	-1.97;-1.97;-1.84	5.32	3.47	0.39725	.	0.209808	0.49916	D	0.000125	T	0.73976	0.3656	L	0.27053	0.805	0.80722	D	1	P;P	0.36753	0.568;0.568	B;B	0.37550	0.253;0.253	T	0.72887	-0.4156	10	0.66056	D	0.02	-7.8598	5.4933	0.16789	0.0:0.6389:0.0:0.3611	.	671;722	B7Z897;Q92574	.;TSC1_HUMAN	N	722;722;671	ENSP00000298552:K722N;ENSP00000394524:K722N;ENSP00000444017:K671N	ENSP00000298552:K722N	K	-	3	2	TSC1	134768901	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	0.810000	0.27183	1.242000	0.43836	0.650000	0.86243	AAG	.		0.537	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
TSHZ1	10194	hgsc.bcm.edu;bcgsc.ca	37	18	72999514	72999514	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr18:72999514C>A	ENST00000580243.1	+	2	2500	c.2152C>A	c.(2152-2154)Cct>Act	p.P718T	TSHZ1_ENST00000322038.5_Missense_Mutation_p.P673T			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	718					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		TGGCACAGAGCCTCTCAAAGC	0.577																																					p.P673T		.											.	TSHZ1	90	0			c.C2017A						.						123.0	103.0	109.0					18																	72999514		2203	4300	6503	SO:0001583	missense	10194	exon2			ACAGAGCCTCTCA	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.2152C>A	18.37:g.72999514C>A	ENSP00000464391:p.Pro718Thr	85.0	0.0		64.0	4.0	NM_005786	O60534|Q4LE29|Q53EU4	Missense_Mutation	SNP	ENST00000580243.1	37		.	.	.	.	.	.	.	.	.	.	C	3.444	-0.113403	0.06881	.	.	ENSG00000179981	ENST00000322038	T	0.38560	1.13	5.12	4.21	0.49690	.	0.183175	0.48286	N	0.000185	T	0.33933	0.0880	L	0.54323	1.7	0.36873	D	0.88902	B	0.22346	0.068	B	0.13407	0.009	T	0.30416	-0.9979	10	0.30078	T	0.28	-11.3758	8.1816	0.31313	0.158:0.7633:0.0:0.0786	.	718	Q6ZSZ6	TSH1_HUMAN	T	673	ENSP00000323584:P673T	ENSP00000323584:P673T	P	+	1	0	TSHZ1	71128502	1.000000	0.71417	0.832000	0.32986	0.592000	0.36648	1.284000	0.33249	2.385000	0.81259	0.561000	0.74099	CCT	.		0.577	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1	NM_005786	
CFAP46	54777	hgsc.bcm.edu;bcgsc.ca	37	10	134694527	134694527	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr10:134694527T>C	ENST00000368586.5	-	28	3737	c.3637A>G	c.(3637-3639)Atg>Gtg	p.M1213V	TTC40_ENST00000368582.2_Missense_Mutation_p.M1213V	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						TGCCACTCCATCTCAGGCTTC	0.537																																					p.M1213V		.											.	.	.	0			c.A3637G						.																																			SO:0001583	missense	54777	exon28			ACTCCATCTCAGG																												ENST00000368586.5:c.3637A>G	10.37:g.134694527T>C	ENSP00000357575:p.Met1213Val	91.0	0.0		51.0	4.0	NM_001200049		Missense_Mutation	SNP	ENST00000368586.5	37	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	T	2.166	-0.391002	0.04932	.	.	ENSG00000171811	ENST00000368586;ENST00000368582	T;T	0.40756	3.0;1.02	3.63	3.63	0.41609	.	.	.	.	.	T	0.40398	0.1115	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.27938	-1.0059	6	0.48119	T	0.1	.	7.829	0.29332	0.1858:0.0:0.0:0.8141	.	.	.	.	V	1213	ENSP00000357575:M1213V;ENSP00000357571:M1213V	ENSP00000357571:M1213V	M	-	1	0	C10orf93	134544517	0.497000	0.26067	0.346000	0.25655	0.011000	0.07611	1.077000	0.30741	1.425000	0.47237	0.402000	0.26972	ATG	.		0.537	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
TTN	7273	hgsc.bcm.edu;bcgsc.ca	37	2	179577619	179577619	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:179577619T>C	ENST00000591111.1	-	92	26406	c.26182A>G	c.(26182-26184)Aca>Gca	p.T8728A	TTN_ENST00000342992.6_Missense_Mutation_p.T7801A|TTN_ENST00000589042.1_Missense_Mutation_p.T9045A|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12884	Ig-like 70.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAAGGAGGTGTTCCTTTTACG	0.423																																					p.T9045A		.											.	TTN	636	0			c.A27133G						.						59.0	54.0	55.0					2																	179577619		1925	4121	6046	SO:0001583	missense	7273	exon94			GAGGTGTTCCTTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.26182A>G	2.37:g.179577619T>C	ENSP00000465570:p.Thr8728Ala	59.0	0.0		84.0	4.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	11.08	1.533562	0.27387	.	.	ENSG00000155657	ENST00000342992	T	0.66995	-0.24	5.48	4.3	0.51218	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.60077	0.2241	L	0.52266	1.64	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	T	0.58381	-0.7646	9	0.87932	D	0	.	10.4484	0.44507	0.3117:0.0:0.0:0.6883	.	8728	Q8WZ42	TITIN_HUMAN	A	7801	ENSP00000343764:T7801A	ENSP00000343764:T7801A	T	-	1	0	TTN	179285864	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.774000	0.47694	0.973000	0.38340	0.533000	0.62120	ACA	.		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SH2B1	25970	hgsc.bcm.edu;bcgsc.ca	37	16	28856082	28856082	+	5'Flank	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:28856082G>T	ENST00000322610.8	+	0	0				TUFM_ENST00000313511.3_Silent_p.T207T|MIR4721_ENST00000577590.1_RNA			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1						blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						AGCCAAACTCGGTGAGCAGCT	0.592																																					p.T207T		.											TUFM,NS,carcinoma,-2	TUFM	91	0			c.C621A						.						110.0	103.0	106.0					16																	28856082		2197	4300	6497	SO:0001631	upstream_gene_variant	7284	exon5			AAACTCGGTGAGC	AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2			16.37:g.28856082G>T	Exception_encountered	126.0	0.0		100.0	4.0	NM_003321	A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Silent	SNP	ENST00000322610.8	37	CCDS53996.1																																																																																			.		0.592	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	NM_015503	
UBR4	23352	hgsc.bcm.edu;bcgsc.ca	37	1	19433073	19433073	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:19433073C>A	ENST00000375254.3	-	83	12410	c.12383G>T	c.(12382-12384)tGg>tTg	p.W4128L	UBR4_ENST00000375224.1_5'Flank|UBR4_ENST00000375217.2_Missense_Mutation_p.W4121L|UBR4_ENST00000375226.2_Missense_Mutation_p.W4104L|UBR4_ENST00000375267.2_Missense_Mutation_p.W4128L	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	4128					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TTGTCGCAGCCAGTTGTTATG	0.552																																					p.W4128L		.											.	UBR4	612	0			c.G12383T						.						90.0	83.0	85.0					1																	19433073		2203	4300	6503	SO:0001583	missense	23352	exon83			CGCAGCCAGTTGT	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.12383G>T	1.37:g.19433073C>A	ENSP00000364403:p.Trp4128Leu	46.0	0.0		30.0	4.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.902347	0.92035	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.49139	0.8;0.79;0.85;0.86	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.65026	0.2652	M	0.64997	1.995	0.80722	D	1	D	0.54601	0.967	P	0.62382	0.901	T	0.67154	-0.5742	10	0.87932	D	0	.	17.5745	0.87944	0.0:1.0:0.0:0.0	.	4128	Q5T4S7	UBR4_HUMAN	L	4128;4128;4121;4104	ENSP00000364403:W4128L;ENSP00000364416:W4128L;ENSP00000364365:W4121L;ENSP00000364374:W4104L	ENSP00000364365:W4121L	W	-	2	0	UBR4	19305660	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.320000	0.79064	2.733000	0.93635	0.561000	0.74099	TGG	.		0.552	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
UBR4	23352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	19407897	19407897	+	Missense_Mutation	SNP	C	C	T	rs372882903		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:19407897C>T	ENST00000375254.3	-	103	15206	c.15179G>A	c.(15178-15180)cGg>cAg	p.R5060Q	UBR4_ENST00000375225.3_Missense_Mutation_p.R135Q|UBR4_ENST00000375224.1_Missense_Mutation_p.R767Q|UBR4_ENST00000375217.2_Missense_Mutation_p.R5053Q|UBR4_ENST00000429347.2_Missense_Mutation_p.R583Q|UBR4_ENST00000375226.2_Missense_Mutation_p.R5036Q|UBR4_ENST00000543981.1_Missense_Mutation_p.R724Q|UBR4_ENST00000375267.2_Missense_Mutation_p.R5060Q|AL137127.1_ENST00000582644.1_RNA	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	5060					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CAACAGCCTCCGCAAGATTTC	0.587																																					p.R5060Q		.											.	UBR4	612	0			c.G15179A						.	C	GLN/ARG	0,4406		0,0,2203	99.0	104.0	103.0		15179	2.5	1.0	1		103	1,8599	1.2+/-3.3	0,1,4299	no	missense	UBR4	NM_020765.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	5060/5184	19407897	1,13005	2203	4300	6503	SO:0001583	missense	23352	exon103			AGCCTCCGCAAGA	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.15179G>A	1.37:g.19407897C>T	ENSP00000364403:p.Arg5060Gln	94.0	0.0		103.0	11.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255837	0.80135	0.0	1.16E-4	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000375225;ENST00000375224;ENST00000429347;ENST00000543981	T;T;T;T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57;1.57;1.57;1.57	5.69	2.48	0.30137	.	0.060957	0.64402	N	0.000002	T	0.19446	0.0467	L	0.27053	0.805	0.50313	D	0.999865	B;B;B;B	0.15719	0.001;0.001;0.014;0.003	B;B;B;B	0.08055	0.002;0.002;0.002;0.003	T	0.05419	-1.0886	10	0.25106	T	0.35	.	10.6625	0.45710	0.0:0.744:0.0:0.256	.	724;583;5060;5036	B4DYV5;B4DPF6;Q5T4S7;Q5T4S7-3	.;.;UBR4_HUMAN;.	Q	5060;5060;5053;5036;135;767;583;724	ENSP00000364403:R5060Q;ENSP00000364416:R5060Q;ENSP00000364365:R5053Q;ENSP00000364374:R5036Q;ENSP00000364373:R135Q;ENSP00000364372:R767Q;ENSP00000394173:R583Q;ENSP00000444070:R724Q	ENSP00000364365:R5053Q	R	-	2	0	UBR4	19280484	0.691000	0.27709	1.000000	0.80357	0.984000	0.73092	1.169000	0.31871	0.630000	0.30394	0.462000	0.41574	CGG	.		0.587	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
UBR4	23352	hgsc.bcm.edu;bcgsc.ca	37	1	19501462	19501462	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:19501462G>T	ENST00000375254.3	-	21	2866	c.2839C>A	c.(2839-2841)Cga>Aga	p.R947R	UBR4_ENST00000375217.2_Silent_p.R947R|UBR4_ENST00000375226.2_Silent_p.R947R|UBR4_ENST00000375267.2_Silent_p.R947R	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	947					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GAATCAAGTCGGTTCAAATCA	0.443																																					p.R947R		.											.	UBR4	612	0			c.C2839A						.						102.0	94.0	97.0					1																	19501462		2203	4300	6503	SO:0001819	synonymous_variant	23352	exon21			CAAGTCGGTTCAA	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.2839C>A	1.37:g.19501462G>T		133.0	0.0		109.0	5.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	37	CCDS189.1																																																																																			.		0.443	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
UBXN6	80700	hgsc.bcm.edu;bcgsc.ca	37	19	4448329	4448329	+	Silent	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:4448329C>A	ENST00000301281.6	-	5	649	c.525G>T	c.(523-525)gtG>gtT	p.V175V	UBXN6_ENST00000394765.3_Silent_p.V122V|MIR4746_ENST00000579802.1_RNA|CTB-50L17.7_ENST00000588798.1_RNA	NM_025241.2	NP_079517.1	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6	175	PUB.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	12						CAATGGTGTCCACACCCAGCT	0.637																																					p.V175V		.											.	UBXN6	90	0			c.G525T						.						117.0	87.0	97.0					19																	4448329		2202	4299	6501	SO:0001819	synonymous_variant	80700	exon5			GGTGTCCACACCC	AF272893	CCDS12129.1, CCDS54201.1	19p13	2008-07-25	2008-07-25	2008-07-25		ENSG00000167671		"""UBX domain containing"""	14928	protein-coding gene	gene with protein product		611946	"""UBX domain-containing 1"", ""UBX domain containing 1"""	UBXD1		11342112	Standard	NM_025241		Approved	UBXDC2	uc002man.2	Q9BZV1		ENST00000301281.6:c.525G>T	19.37:g.4448329C>A		71.0	0.0		65.0	4.0	NM_025241	D6W626|Q96AH1|Q96IK9|Q9BZV0	Silent	SNP	ENST00000301281.6	37	CCDS12129.1																																																																																			.		0.637	UBXN6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458447.3	NM_025241	
UNC79	57578	hgsc.bcm.edu;bcgsc.ca	37	14	94158258	94158258	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr14:94158258C>A	ENST00000393151.2	+	47	7553	c.7553C>A	c.(7552-7554)cCc>cAc	p.P2518H	UNC79_ENST00000256339.4_Missense_Mutation_p.P2341H|UNC79_ENST00000555664.1_Missense_Mutation_p.P2479H|UNC79_ENST00000553484.1_Missense_Mutation_p.P2540H			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2518					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AGGGTGACACCCAGCATCCTT	0.463																																					p.P2341H		.											.	.	.	0			c.C7022A						.						139.0	126.0	130.0					14																	94158258		2203	4300	6503	SO:0001583	missense	57578	exon47			TGACACCCAGCAT	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.7553C>A	14.37:g.94158258C>A	ENSP00000376858:p.Pro2518His	173.0	0.0		138.0	8.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	C	26.9	4.783060	0.90282	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.33438	1.42;1.47;1.41;1.42	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.59662	0.2210	M	0.74647	2.275	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.60984	-0.7154	10	0.87932	D	0	-20.8729	20.0784	0.97758	0.0:1.0:0.0:0.0	.	2540	C9JQL1	.	H	2341;2479;2540;2518;2540	ENSP00000256339:P2341H;ENSP00000450868:P2479H;ENSP00000451360:P2540H;ENSP00000376858:P2518H	ENSP00000256339:P2341H	P	+	2	0	KIAA1409	93228011	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	7.818000	0.86416	2.736000	0.93811	0.655000	0.94253	CCC	.		0.463	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
USP20	10868	hgsc.bcm.edu;bcgsc.ca	37	9	132642472	132642472	+	Missense_Mutation	SNP	C	C	A	rs200854092	byFrequency	TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr9:132642472C>A	ENST00000315480.4	+	25	2823	c.2665C>A	c.(2665-2667)Cgc>Agc	p.R889S	USP20_ENST00000472108.1_3'UTR|USP20_ENST00000358355.1_Missense_Mutation_p.R889S|USP20_ENST00000372429.3_Missense_Mutation_p.R889S			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	889	DUSP 2. {ECO:0000255|PROSITE- ProRule:PRU00613}.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				GATTGCCATCCGCCAGAGTGT	0.632																																					p.R889S		.											.	USP20	658	0			c.C2665A						.						32.0	43.0	39.0					9																	132642472		2066	4205	6271	SO:0001583	missense	10868	exon25			GCCATCCGCCAGA	AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.2665C>A	9.37:g.132642472C>A	ENSP00000313811:p.Arg889Ser	112.0	0.0		50.0	4.0	NM_001008563	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Missense_Mutation	SNP	ENST00000315480.4	37	CCDS43892.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.863098	0.51482	.	.	ENSG00000136878	ENST00000372429;ENST00000315480;ENST00000358355	T;T;T	0.18657	2.2;2.2;2.2	5.11	5.11	0.69529	Peptidase C19, ubiquitin-specific peptidase, DUSP domain (2);	0.000000	0.85682	D	0.000000	T	0.48714	0.1515	M	0.83953	2.67	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.51631	-0.8681	10	0.54805	T	0.06	.	13.2032	0.59780	0.1698:0.8302:0.0:0.0	.	889	Q9Y2K6	UBP20_HUMAN	S	889	ENSP00000361506:R889S;ENSP00000313811:R889S;ENSP00000351122:R889S	ENSP00000313811:R889S	R	+	1	0	USP20	131682293	1.000000	0.71417	0.998000	0.56505	0.054000	0.15201	1.766000	0.38491	2.387000	0.81309	0.655000	0.94253	CGC	C|0.999;T|0.000		0.632	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054604.2		
USP31	57478	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	23080459	23080459	+	Silent	SNP	G	G	T	rs201814190		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:23080459G>T	ENST00000219689.7	-	16	2966	c.2967C>A	c.(2965-2967)atC>atA	p.I989I	USP31_ENST00000567975.1_Silent_p.I282I	NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.I989I(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		CCACATAAGCGATCTGATTAT	0.522																																					p.I989I		.											.	USP31	663	1	Substitution - coding silent(1)	skin(1)	c.C2967A						.						78.0	82.0	81.0					16																	23080459		2197	4300	6497	SO:0001819	synonymous_variant	57478	exon16			ATAAGCGATCTGA	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.2967C>A	16.37:g.23080459G>T		50.0	0.0		27.0	4.0	NM_020718	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	ENST00000219689.7	37	CCDS10607.1																																																																																			G|0.999;A|0.000		0.522	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718	
USP31	57478	hgsc.bcm.edu;bcgsc.ca	37	16	23091273	23091273	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:23091273A>G	ENST00000219689.7	-	13	2169	c.2170T>C	c.(2170-2172)Tac>Cac	p.Y724H		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	354	DUSP 3. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		AGACCTGTGTAGTGCCCCCCT	0.577																																					p.Y724H		.											.	USP31	663	0			c.T2170C						.						84.0	66.0	72.0					16																	23091273		2197	4300	6497	SO:0001583	missense	57478	exon13			CTGTGTAGTGCCC	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.2170T>C	16.37:g.23091273A>G	ENSP00000219689:p.Tyr724His	116.0	0.0		75.0	4.0	NM_020718	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000219689.7	37	CCDS10607.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.602357	0.87157	.	.	ENSG00000103404	ENST00000219689	T	0.21361	2.01	5.11	5.11	0.69529	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.64402	D	0.000001	T	0.60741	0.2292	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75260	-0.3380	10	0.87932	D	0	-13.1175	14.0861	0.64957	1.0:0.0:0.0:0.0	.	724	Q70CQ4	UBP31_HUMAN	H	724	ENSP00000219689:Y724H	ENSP00000219689:Y724H	Y	-	1	0	USP31	22998774	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.958000	0.93099	1.917000	0.55516	0.455000	0.32223	TAC	.		0.577	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718	
USP39	10713	broad.mit.edu;ucsc.edu	37	2	85843340	85843340	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr2:85843340G>A	ENST00000323701.6	+	1	32	c.22G>A	c.(22-24)Gag>Aag	p.E8K	USP39_ENST00000409470.1_Missense_Mutation_p.E8K|USP39_ENST00000459775.1_Intron|USP39_ENST00000409766.3_Missense_Mutation_p.E8K|USP39_ENST00000450066.2_Intron|USP39_ENST00000409025.1_Missense_Mutation_p.E8K	NM_006590.3	NP_006581.2	Q53GS9	SNUT2_HUMAN	ubiquitin specific peptidase 39	8	Arg-rich.				cell cycle (GO:0007049)|cell division (GO:0051301)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|ubiquitin-dependent protein catabolic process (GO:0006511)	spliceosomal complex (GO:0005681)	ubiquitinyl hydrolase activity (GO:0036459)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	19						GTCTAAGCGGGAGTCTCGCGG	0.706																																					p.E8K		.											.	USP39	658	0			c.G22A						.						7.0	8.0	8.0					2																	85843340		2168	4247	6415	SO:0001583	missense	10713	exon1			AAGCGGGAGTCTC	AF132955	CCDS33234.1, CCDS58716.1, CCDS58717.1, CCDS74534.1	2p11.2	2009-01-06	2005-08-08		ENSG00000168883	ENSG00000168883		"""Ubiquitin-specific peptidases"""	20071	protein-coding gene	gene with protein product	"""snRNP assembly defective 1 homolog (S.cerevisiae)"", ""small nuclear ribonucleoprotein 65kDa (U4/U6.U5)"""	611594	"""ubiquitin specific protease 39"""			12838346	Standard	NM_006590		Approved	SAD1, CGI-21, SNRNP65	uc002sqg.4	Q53GS9	OTTHUMG00000153090	ENST00000323701.6:c.22G>A	2.37:g.85843340G>A	ENSP00000312981:p.Glu8Lys	53.0	2.0		68.0	12.0	NM_001256725	A8K086|B3KM40|B4DHT4|D6W5L4|G5E9H0|Q6NX47|Q96RK9|Q9BV89|Q9H381|Q9P050|Q9Y310	Missense_Mutation	SNP	ENST00000323701.6	37	CCDS33234.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.685616	0.68157	.	.	ENSG00000168883	ENST00000409268;ENST00000409025;ENST00000409470;ENST00000323701;ENST00000409766	T;T;T;T	0.16457	2.34;2.61;2.61;2.34	5.27	4.37	0.52481	.	0.271795	0.26136	N	0.026124	T	0.08626	0.0214	N	0.08118	0	0.80722	D	1	B;B;B;B	0.21905	0.062;0.006;0.006;0.002	B;B;B;B	0.20767	0.031;0.01;0.01;0.01	T	0.23904	-1.0175	10	0.18276	T	0.48	-4.7547	11.4387	0.50083	0.0:0.1898:0.8102:0.0	.	8;8;8;8	G5E9H0;B3KM40;B9A018;Q53GS9	.;.;.;SNUT2_HUMAN	K	8	ENSP00000386572:E8K;ENSP00000386864:E8K;ENSP00000312981:E8K;ENSP00000386803:E8K	ENSP00000312981:E8K	E	+	1	0	USP39	85696851	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	2.889000	0.48601	1.418000	0.47098	0.561000	0.74099	GAG	.		0.706	USP39-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329892.1	NM_006590	
USP7	7874	hgsc.bcm.edu;bcgsc.ca	37	16	9015082	9015082	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:9015082G>T	ENST00000344836.4	-	4	652	c.454C>A	c.(454-456)Cgt>Agt	p.R152S	USP7_ENST00000381886.4_Missense_Mutation_p.R136S|USP7_ENST00000566224.1_5'Flank|USP7_ENST00000535863.1_Missense_Mutation_p.R53S	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	152	Interaction with TSPYL5.|Interaction with p53/TP53, MDM2 and EBNA1.|MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.|Necessary for nuclear localization.				maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						CTAATACGACGACTGAACGAC	0.358																																					p.R152S		.											.	USP7	661	0			c.C454A						.						95.0	86.0	89.0					16																	9015082		2197	4300	6497	SO:0001583	missense	7874	exon4			TACGACGACTGAA	Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.454C>A	16.37:g.9015082G>T	ENSP00000343535:p.Arg152Ser	148.0	0.0		134.0	7.0	NM_003470	A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	ENST00000344836.4	37	CCDS32385.1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.179091	0.57692	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863;ENST00000544549;ENST00000542333	T;T;T	0.42131	0.98;0.98;0.98	5.9	5.9	0.94986	TRAF-like (1);MATH (3);	0.000000	0.85682	D	0.000000	T	0.63570	0.2522	M	0.86420	2.815	0.80722	D	1	P;P	0.44946	0.846;0.846	P;P	0.51550	0.673;0.673	T	0.61466	-0.7057	10	0.29301	T	0.29	.	20.3398	0.98759	0.0:0.0:1.0:0.0	.	152;136	Q93009;B7Z815	UBP7_HUMAN;.	S	152;160;53;53;94	ENSP00000343535:R152S;ENSP00000443646:R53S;ENSP00000439272:R94S	ENSP00000343535:R152S	R	-	1	0	USP7	8922583	1.000000	0.71417	0.801000	0.32222	0.921000	0.55340	9.509000	0.98002	2.817000	0.96982	0.552000	0.68991	CGT	.		0.358	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434268.2		
VILL	50853	hgsc.bcm.edu;bcgsc.ca	37	3	38044030	38044030	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:38044030G>T	ENST00000283713.6	+	14	1889	c.1623G>T	c.(1621-1623)ctG>ctT	p.L541L	VILL_ENST00000383759.2_Silent_p.L541L|VILL_ENST00000465644.1_Silent_p.L259L			O15195	VILL_HUMAN	villin-like	541					actin filament capping (GO:0051693)|cytoskeleton organization (GO:0007010)	actin cytoskeleton (GO:0015629)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|urinary_tract(2)	28				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		TCTTCTTGCTGGTCACAGCCA	0.577																																					p.L541L		.											.	VILL	90	0			c.G1623T						.						153.0	118.0	130.0					3																	38044030		2203	4300	6503	SO:0001819	synonymous_variant	50853	exon13			CTTGCTGGTCACA		CCDS2670.2	3p21	2004-07-28			ENSG00000136059	ENSG00000136059			30906	protein-coding gene	gene with protein product						9179494	Standard	XM_005265191		Approved		uc003chl.3	O15195	OTTHUMG00000130814	ENST00000283713.6:c.1623G>T	3.37:g.38044030G>T		87.0	0.0		119.0	7.0	NM_015873	A8MZP1|Q9BT80|Q9BWH7	Silent	SNP	ENST00000283713.6	37	CCDS2670.2																																																																																			.		0.577	VILL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253360.3	NM_015873	
VNN2	8875	hgsc.bcm.edu;bcgsc.ca	37	6	133071001	133071001	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr6:133071001A>G	ENST00000326499.6	-	6	1328	c.1204T>C	c.(1204-1206)Tgc>Cgc	p.C402R	VNN2_ENST00000525289.1_Missense_Mutation_p.C181R|RP1-55C23.7_ENST00000430895.1_RNA|VNN2_ENST00000525270.1_Missense_Mutation_p.C349R	NM_004665.2	NP_004656	O95498	VNN2_HUMAN	vanin 2	402					cellular component movement (GO:0006928)|pantothenate metabolic process (GO:0015939)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		AGCAGTGTGCAGACCTATGTG	0.403																																					p.C402R		.											.	VNN2	90	0			c.T1204C						.						84.0	75.0	78.0					6																	133071001		2203	4300	6503	SO:0001583	missense	8875	exon6			GTGTGCAGACCTA	AB026705	CCDS5161.1, CCDS5162.1, CCDS56451.1	6q23-q24	2013-02-13			ENSG00000112303	ENSG00000112303	3.5.1.92	"""Vanins"""	12706	protein-coding gene	gene with protein product	"""pantetheinase"""	603571				9790769, 11491533	Standard	NM_078488		Approved	FOAP-4, GPI-80	uc003qdt.3	O95498	OTTHUMG00000015588	ENST00000326499.6:c.1204T>C	6.37:g.133071001A>G	ENSP00000322276:p.Cys402Arg	115.0	0.0		93.0	4.0	NM_004665	A0AUZ3|A6NDY1|A8K4E3|A8K7W0|B2DFZ0|B2DFZ1|B2DFZ2|B2DFZ3|F6XL73|Q2XUN1|Q9UJF3|Q9UMW2	Missense_Mutation	SNP	ENST00000326499.6	37	CCDS5161.1	.	.	.	.	.	.	.	.	.	.	A	16.97	3.268007	0.59540	.	.	ENSG00000112303	ENST00000326499;ENST00000525270;ENST00000525289	D;D;D	0.96041	-3.89;-3.89;-3.89	5.2	5.2	0.72013	.	0.000000	0.64402	D	0.000002	D	0.98134	0.9384	H	0.94264	3.515	0.44643	D	0.997629	D;D	0.89917	1.0;1.0	D;D	0.91635	0.967;0.999	D	0.99466	1.0944	10	0.87932	D	0	-10.9792	14.0292	0.64604	1.0:0.0:0.0:0.0	.	181;402	O95498-2;O95498	.;VNN2_HUMAN	R	402;349;181	ENSP00000322276:C402R;ENSP00000436822:C349R;ENSP00000436935:C181R	ENSP00000322276:C402R	C	-	1	0	VNN2	133112694	1.000000	0.71417	0.119000	0.21687	0.003000	0.03518	5.911000	0.69939	1.967000	0.57214	0.533000	0.62120	TGC	.		0.403	VNN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042264.2		
VPS13C	54832	hgsc.bcm.edu;bcgsc.ca	37	15	62202491	62202491	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr15:62202491C>A	ENST00000261517.5	-	64	8802	c.8729G>T	c.(8728-8730)tGg>tTg	p.W2910L	VPS13C_ENST00000395898.3_Missense_Mutation_p.W2867L|VPS13C_ENST00000395896.4_Missense_Mutation_p.W2910L|VPS13C_ENST00000249837.3_Missense_Mutation_p.W2867L	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						ACTTTCTGGCCAAAATGGAAG	0.333																																					p.W2910L		.											.	VPS13C	92	0			c.G8729T						.						48.0	50.0	49.0					15																	62202491		2203	4300	6503	SO:0001583	missense	54832	exon64			TCTGGCCAAAATG	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.8729G>T	15.37:g.62202491C>A	ENSP00000261517:p.Trp2910Leu	100.0	0.0		78.0	4.0	NM_020821		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.903713	0.92035	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.30448	1.53;1.53;1.53	5.85	5.85	0.93711	Vacuolar protein sorting-associated protein (1);	0.000000	0.85682	D	0.000000	T	0.64114	0.2569	M	0.88310	2.945	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.998;0.998;0.998;0.999	T	0.63576	-0.6606	10	0.33940	T	0.23	.	20.1649	0.98147	0.0:1.0:0.0:0.0	.	2910;2867;2910;2867;2910	F5GZG8;Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;.;VP13C_HUMAN	L	2867;2910;2910;2910	ENSP00000249837:W2867L;ENSP00000261517:W2910L;ENSP00000379233:W2910L	ENSP00000249837:W2867L	W	-	2	0	VPS13C	59989783	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.766000	0.74970	2.753000	0.94483	0.655000	0.94253	TGG	.		0.333	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
VPS13D	55187	hgsc.bcm.edu;bcgsc.ca	37	1	12516140	12516140	+	Silent	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:12516140C>A	ENST00000358136.3	+	66	12550	c.12420C>A	c.(12418-12420)gcC>gcA	p.A4140A	VPS13D_ENST00000543766.1_Silent_p.A138A|VPS13D_ENST00000496628.1_Intron|VPS13D_ENST00000356315.4_Silent_p.A4115A	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		ACCATGCAGCCACAAGTGGTG	0.527																																					p.A4140A		.											.	VPS13D	95	0			c.C12420A						.						112.0	83.0	93.0					1																	12516140		2203	4300	6503	SO:0001819	synonymous_variant	55187	exon66			TGCAGCCACAAGT	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.12420C>A	1.37:g.12516140C>A		84.0	0.0		62.0	4.0	NM_015378		Silent	SNP	ENST00000358136.3	37	CCDS30588.1	.	.	.	.	.	.	.	.	.	.	C	9.015	0.983490	0.18889	.	.	ENSG00000048707	ENST00000011700	.	.	.	5.84	0.112	0.14623	.	.	.	.	.	T	0.42268	0.1195	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21245	-1.0251	4	.	.	.	.	2.0973	0.03671	0.3234:0.3773:0.0836:0.2157	.	.	.	.	Q	2962	.	.	P	+	2	0	VPS13D	12438727	1.000000	0.71417	0.932000	0.37286	0.788000	0.44548	1.310000	0.33551	-0.099000	0.12263	-0.813000	0.03139	CCA	.		0.527	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
VPS25	84313	hgsc.bcm.edu;bcgsc.ca	37	17	40928289	40928289	+	Silent	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:40928289C>A	ENST00000253794.2	+	5	409	c.369C>A	c.(367-369)tcC>tcA	p.S123S		NM_032353.2	NP_115729.1	Q9BRG1	VPS25_HUMAN	vacuolar protein sorting 25 homolog (S. cerevisiae)	123					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)	5		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		AGAACAACTCCGTCTTTACCC	0.423																																					p.S123S		.											.	VPS25	90	0			c.C369A						.						91.0	88.0	89.0					17																	40928289		2203	4300	6503	SO:0001819	synonymous_variant	84313	exon5			CAACTCCGTCTTT	AB014763	CCDS11438.1	17q21.31	2014-02-12	2006-04-04		ENSG00000131475	ENSG00000131475			28122	protein-coding gene	gene with protein product		610907	"""vacuolar protein sorting 25 (yeast)"""			15511219	Standard	NM_032353		Approved	MGC10540, EAP20, DERP9	uc002ibi.3	Q9BRG1		ENST00000253794.2:c.369C>A	17.37:g.40928289C>A		174.0	0.0		121.0	5.0	NM_032353	B2R581	Silent	SNP	ENST00000253794.2	37	CCDS11438.1																																																																																			.		0.423	VPS25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452383.1	NM_032353	
VPS33B	26276	hgsc.bcm.edu;bcgsc.ca	37	15	91549273	91549273	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr15:91549273C>T	ENST00000333371.3	-	12	1222	c.869G>A	c.(868-870)cGg>cAg	p.R290Q	VPS33B_ENST00000535906.1_Missense_Mutation_p.R263Q|VPS33B_ENST00000535843.1_Missense_Mutation_p.R199Q	NM_018668.3	NP_061138.3	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33 homolog B (yeast)	290					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|membrane fusion (GO:0061025)|platelet alpha granule organization (GO:0070889)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule (GO:0031091)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|stomach(2)	16	Lung NSC(78;0.0987)|all_lung(78;0.175)					GTGCTCGTTCCGAATCTCATT	0.483																																					p.R290Q		.											.	VPS33B	92	0			c.G869A						.						59.0	55.0	56.0					15																	91549273		2198	4298	6496	SO:0001583	missense	26276	exon12			TCGTTCCGAATCT	AF201694	CCDS10369.1, CCDS73783.1	15q26.1	2006-12-19	2006-12-19		ENSG00000184056	ENSG00000184056			12712	protein-coding gene	gene with protein product		608552	"""vacuolar protein sorting 33B (yeast homolog)"""			8996080	Standard	XM_005254887		Approved	FLJ14848	uc002bqp.1	Q9H267	OTTHUMG00000149835	ENST00000333371.3:c.869G>A	15.37:g.91549273C>T	ENSP00000327650:p.Arg290Gln	113.0	0.0		110.0	5.0	NM_018668	B3KQF6|Q96K14|Q9NRP6|Q9NSF3	Missense_Mutation	SNP	ENST00000333371.3	37	CCDS10369.1	.	.	.	.	.	.	.	.	.	.	C	32	5.134609	0.94517	.	.	ENSG00000184056	ENST00000333371;ENST00000535906;ENST00000535843;ENST00000537510	T;T;T	0.80909	-1.43;-1.43;-1.43	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.92057	0.7483	M	0.90922	3.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72982	0.979;0.979	D	0.93060	0.6473	10	0.87932	D	0	-10.9832	19.2714	0.94011	0.0:1.0:0.0:0.0	.	263;290	F5H008;Q9H267	.;VP33B_HUMAN	Q	290;263;199;245	ENSP00000327650:R290Q;ENSP00000444053:R263Q;ENSP00000446267:R199Q	ENSP00000327650:R290Q	R	-	2	0	VPS33B	89350277	1.000000	0.71417	0.971000	0.41717	0.575000	0.36095	6.684000	0.74538	2.884000	0.98904	0.655000	0.94253	CGG	.		0.483	VPS33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313496.1	NM_018668	
VPS37A	137492	hgsc.bcm.edu;bcgsc.ca	37	8	17126365	17126365	+	Splice_Site	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr8:17126365T>C	ENST00000324849.4	+	4	990	c.316T>C	c.(316-318)Ttt>Ctt	p.F106L	VPS37A_ENST00000324815.3_Splice_Site_p.F106L|VPS37A_ENST00000521829.1_Splice_Site_p.F81L	NM_001145152.1|NM_152415.2	NP_001138624.1|NP_689628.2	Q8NEZ2	VP37A_HUMAN	vacuolar protein sorting 37 homolog A (S. cerevisiae)	106					cell death (GO:0008219)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|kidney(2)|large_intestine(1)|lung(4)|skin(1)	10				Colorectal(111;0.0553)|COAD - Colon adenocarcinoma(73;0.212)		TTACTTTCAGTTTACAATGCA	0.333																																					p.F106L		.											.	VPS37A	90	0			c.T316C						.						86.0	84.0	85.0					8																	17126365		2203	4297	6500	SO:0001630	splice_region_variant	137492	exon4			TTTCAGTTTACAA		CCDS6001.1, CCDS47811.1	8p22	2012-06-29	2006-04-04		ENSG00000155975	ENSG00000155975			24928	protein-coding gene	gene with protein product	"""hepatocellular carcinoma related protein 1"""	609927	"""vacuolar protein sorting 37A (yeast)"", ""polyglutamine binding protein 2"""	PQBP2		15240819, 15218037, 22717650	Standard	NM_152415		Approved	FLJ32642, HCRP1, SPG53	uc003wxj.3	Q8NEZ2	OTTHUMG00000130785	ENST00000324849.4:c.316-1T>C	8.37:g.17126365T>C		117.0	0.0		79.0	4.0	NM_152415	Q336D5|Q6NW27|Q8N3D7|Q8TBL7|Q96DL9	Missense_Mutation	SNP	ENST00000324849.4	37	CCDS6001.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.897638	0.91962	.	.	ENSG00000155975	ENST00000324849;ENST00000324815;ENST00000521829	T;T	0.65549	-0.16;-0.08	5.0	5.0	0.66597	Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.66107	0.2756	M	0.71581	2.175	0.80722	D	1	P;B	0.48230	0.907;0.412	P;B	0.45712	0.491;0.134	T	0.69101	-0.5234	9	.	.	.	-17.9103	15.0191	0.71613	0.0:0.0:0.0:1.0	.	81;106	Q8NEZ2-2;Q8NEZ2	.;VP37A_HUMAN	L	106;106;81	ENSP00000318629:F106L;ENSP00000429680:F81L	.	F	+	1	0	VPS37A	17170736	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	7.262000	0.78410	2.011000	0.59026	0.533000	0.62120	TTT	.		0.333	VPS37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253301.2	NM_152415	Missense_Mutation
WASF1	8936	hgsc.bcm.edu;bcgsc.ca	37	6	110426738	110426738	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr6:110426738T>C	ENST00000392589.1	-	8	1421	c.585A>G	c.(583-585)agA>agG	p.R195R	WASF1_ENST00000392588.1_Silent_p.R195R|WASF1_ENST00000359451.2_Silent_p.R195R|WASF1_ENST00000392587.2_Silent_p.R195R|WASF1_ENST00000392586.1_Silent_p.R195R	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	195					actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		CATGAGGTGCTCTTGGCACTT	0.418																																					p.R195R		.											.	WASF1	90	0			c.A585G						.						101.0	96.0	98.0					6																	110426738		2203	4300	6503	SO:0001819	synonymous_variant	8936	exon7			AGGTGCTCTTGGC	D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.585A>G	6.37:g.110426738T>C		103.0	0.0		95.0	4.0	NM_001024935	E1P5F2|Q5SZK7	Silent	SNP	ENST00000392589.1	37	CCDS5080.1																																																																																			.		0.418	WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041784.3	NM_003931	
WBSCR17	64409	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	70880904	70880904	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr7:70880904G>A	ENST00000333538.5	+	4	1253	c.619G>A	c.(619-621)Gtc>Atc	p.V207I	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	207	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				AGAGGAGTATGTCCACAAACG	0.507																																					p.V207I		.											.	WBSCR17	96	0			c.G619A						.						72.0	67.0	69.0					7																	70880904		2203	4300	6503	SO:0001583	missense	64409	exon4			GAGTATGTCCACA	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.619G>A	7.37:g.70880904G>A	ENSP00000329654:p.Val207Ile	154.0	0.0		86.0	21.0	NM_022479	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	G	19.88	3.908797	0.72868	.	.	ENSG00000185274	ENST00000333538;ENST00000447516	T;T	0.61040	0.31;0.14	5.17	4.23	0.50019	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.65260	0.2674	L	0.43646	1.37	0.58432	D	0.999996	D	0.76494	0.999	D	0.73708	0.981	T	0.58951	-0.7545	10	0.20519	T	0.43	.	13.5761	0.61875	0.0:0.0:0.8442:0.1558	.	207	Q6IS24	GLTL3_HUMAN	I	207;185	ENSP00000329654:V207I;ENSP00000392019:V185I	ENSP00000329654:V207I	V	+	1	0	WBSCR17	70518840	1.000000	0.71417	0.994000	0.49952	0.944000	0.59088	7.462000	0.80851	2.421000	0.82119	0.563000	0.77884	GTC	.		0.507	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
WDR7	23335	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	54349915	54349915	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr18:54349915delC	ENST00000254442.3	+	5	562	c.351delC	c.(349-351)tacfs	p.Y117fs	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Frame_Shift_Del_p.Y117fs	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	117					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		TGTAGTTCTACCAGTTCTCTG	0.368																																					p.Y117fs		.											.	WDR7	93	0			c.351delC						.						147.0	135.0	139.0					18																	54349915		2203	4300	6503	SO:0001589	frameshift_variant	23335	exon5			GTTCTACCAGTTC	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.351delC	18.37:g.54349915delC	ENSP00000254442:p.Tyr117fs	223.0	0.0		167.0	41.0	NM_052834	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Frame_Shift_Del	DEL	ENST00000254442.3	37	CCDS11962.1																																																																																			.		0.368	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1		
WDTC1	23038	hgsc.bcm.edu;bcgsc.ca	37	1	27627864	27627864	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr1:27627864A>G	ENST00000319394.3	+	13	1915	c.1380A>G	c.(1378-1380)aaA>aaG	p.K460K	WDTC1_ENST00000361771.3_Silent_p.K459K	NM_001276252.1|NM_015023.3	NP_001263181.1|NP_055838.2	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1	460					cellular chemical homeostasis (GO:0055082)|cellular response to insulin stimulus (GO:0032869)|glucose metabolic process (GO:0006006)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell size (GO:0008361)	cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	21		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		ACGACTTCAAAGGGAAATTTC	0.572											OREG0013280	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K460K		.											.	WDTC1	91	0			c.A1380G						.						70.0	68.0	69.0					1																	27627864		2203	4300	6503	SO:0001819	synonymous_variant	23038	exon13			CTTCAAAGGGAAA	AK023778	CCDS296.1, CCDS60044.1	1p35.3	2013-01-11			ENSG00000142784	ENSG00000142784		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29175	protein-coding gene	gene with protein product	"""adipose homolog (Drosophila)"", ""DDB1 and CUL4 associated factor 9"""					12717455, 19238144	Standard	NM_015023		Approved	KIAA1037, ADP, DCAF9	uc009vst.3	Q8N5D0	OTTHUMG00000004273	ENST00000319394.3:c.1380A>G	1.37:g.27627864A>G		116.0	0.0	795	74.0	4.0	NM_001276252	D3DPL5|Q5SSC5|Q9NV87|Q9UPW4	Silent	SNP	ENST00000319394.3	37																																																																																				.		0.572	WDTC1-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015023	
WFIKKN2	124857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48913333	48913333	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr17:48913333G>A	ENST00000311378.4	+	1	563	c.35G>A	c.(34-36)cGc>cAc	p.R12H	WFIKKN2_ENST00000426127.1_Intron	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	12					muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			TTCTGGTCTCGCTGGGAGCAG	0.706																																					p.R12H		.											.	WFIKKN2	93	0			c.G35A						.						14.0	15.0	15.0					17																	48913333		2199	4296	6495	SO:0001583	missense	124857	exon1			GGTCTCGCTGGGA	AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.35G>A	17.37:g.48913333G>A	ENSP00000311184:p.Arg12His	127.0	0.0		110.0	41.0	NM_175575	Q6UXZ9	Missense_Mutation	SNP	ENST00000311378.4	37	CCDS11575.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.361150	0.24684	.	.	ENSG00000173714	ENST00000311378	T	0.81415	-1.49	5.24	0.186	0.15105	.	1.186510	0.05938	N	0.636435	T	0.58652	0.2137	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.40001	-0.9586	10	0.13853	T	0.58	.	4.3165	0.10995	0.3569:0.1618:0.4813:0.0	.	12	Q8TEU8	WFKN2_HUMAN	H	12	ENSP00000311184:R12H	ENSP00000311184:R12H	R	+	2	0	WFIKKN2	46268332	0.000000	0.05858	0.613000	0.29037	0.950000	0.60333	-0.841000	0.04359	-0.239000	0.09710	0.655000	0.94253	CGC	.		0.706	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368358.1	NM_175575	
XIRP1	165904	hgsc.bcm.edu;bcgsc.ca	37	3	39229162	39229162	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr3:39229162T>C	ENST00000340369.3	-	2	2003	c.1775A>G	c.(1774-1776)cAg>cGg	p.Q592R	XIRP1_ENST00000421646.1_Intron|XIRP1_ENST00000396251.1_Missense_Mutation_p.Q592R	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	592	Interaction with CTNNB1. {ECO:0000250}.				cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CCGGATGGTCTGCACATCGCC	0.587																																					p.Q592R		.											.	XIRP1	158	0			c.A1775G						.						74.0	63.0	67.0					3																	39229162		2203	4300	6503	SO:0001583	missense	165904	exon2			ATGGTCTGCACAT	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.1775A>G	3.37:g.39229162T>C	ENSP00000343140:p.Gln592Arg	189.0	0.0		134.0	8.0	NM_001198621	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	T	14.75	2.629289	0.46944	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.36520	1.25;1.25	4.8	-1.23	0.09465	.	0.246709	0.38005	N	0.001842	T	0.30916	0.0780	L	0.55103	1.725	0.80722	D	1	B;D	0.57899	0.012;0.981	B;P	0.48454	0.018;0.578	T	0.13656	-1.0501	10	0.56958	D	0.05	.	2.4487	0.04512	0.1401:0.0845:0.2887:0.4867	.	592;592	Q702N8;Q702N8-2	XIRP1_HUMAN;.	R	592	ENSP00000379550:Q592R;ENSP00000343140:Q592R	ENSP00000343140:Q592R	Q	-	2	0	XIRP1	39204166	1.000000	0.71417	0.986000	0.45419	0.622000	0.37654	3.934000	0.56553	-0.037000	0.13646	0.379000	0.24179	CAG	.		0.587	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
XPO6	23214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	28167437	28167437	+	Missense_Mutation	SNP	T	T	A	rs369899782		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:28167437T>A	ENST00000304658.5	-	7	1555	c.1055A>T	c.(1054-1056)aAt>aTt	p.N352I	XPO6_ENST00000565698.1_Missense_Mutation_p.N338I|XPO6_ENST00000561488.1_5'UTR	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	352					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						TGTGTGGGCATTGTTATCCTT	0.478																																					p.N352I		.											.	XPO6	227	0			c.A1055T						.						108.0	95.0	100.0					16																	28167437		1963	4151	6114	SO:0001583	missense	23214	exon7			TGGGCATTGTTAT	AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.1055A>T	16.37:g.28167437T>A	ENSP00000302790:p.Asn352Ile	773.0	0.0		544.0	173.0	NM_015171	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	ENST00000304658.5	37	CCDS42135.1	.	.	.	.	.	.	.	.	.	.	T	14.32	2.500126	0.44455	.	.	ENSG00000169180	ENST00000304658	T	0.51071	0.72	5.87	5.87	0.94306	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.43389	0.1245	L	0.46157	1.445	0.80722	D	1	P;P	0.51933	0.949;0.893	B;B	0.40901	0.343;0.343	T	0.48969	-0.8987	10	0.72032	D	0.01	-17.8237	14.5226	0.67863	0.0:0.0:0.0:1.0	.	352;352	B7ZM10;Q96QU8	.;XPO6_HUMAN	I	352	ENSP00000302790:N352I	ENSP00000302790:N352I	N	-	2	0	XPO6	28074938	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.371000	0.80710	0.533000	0.62120	AAT	.		0.478	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195	
ZDHHC1	29800	hgsc.bcm.edu;bcgsc.ca	37	16	67432186	67432186	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:67432186G>T	ENST00000348579.2	-	8	1197	c.856C>A	c.(856-858)Cgc>Agc	p.R286S	ZDHHC1_ENST00000566075.1_5'Flank	NM_013304.2	NP_037436.1	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	286					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|urinary_tract(1)	10		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		TGTGGTGGGCGGTGCTGCACG	0.622																																					p.R286S		.											.	ZDHHC1	90	0			c.C856A						.						119.0	100.0	107.0					16																	67432186		2198	4300	6498	SO:0001583	missense	29800	exon8			GTGGGCGGTGCTG	U90653	CCDS10836.1	16q22.1	2010-03-25	2003-01-27		ENSG00000159714	ENSG00000159714		"""Zinc fingers, DHHC-type"""	17916	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 1"""	C16orf1		10395086	Standard	NM_013304		Approved	HSU90653, ZNF377	uc010vjm.2	Q8WTX9	OTTHUMG00000137522	ENST00000348579.2:c.856C>A	16.37:g.67432186G>T	ENSP00000340299:p.Arg286Ser	78.0	0.0		61.0	4.0	NM_013304	O15461	Missense_Mutation	SNP	ENST00000348579.2	37	CCDS10836.1	.	.	.	.	.	.	.	.	.	.	G	33	5.262895	0.95399	.	.	ENSG00000159714	ENST00000348579	T	0.42513	0.97	5.46	5.46	0.80206	.	0.682773	0.14213	N	0.333908	T	0.56093	0.1962	L	0.29908	0.895	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.54741	-0.8248	10	0.51188	T	0.08	.	18.2808	0.90097	0.0:0.0:1.0:0.0	.	286	Q8WTX9	ZDHC1_HUMAN	S	286	ENSP00000340299:R286S	ENSP00000340299:R286S	R	-	1	0	ZDHHC1	65989687	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	5.438000	0.66550	2.563000	0.86464	0.407000	0.27541	CGC	.		0.622	ZDHHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268845.1	NM_013304	
ZIC3	7547	hgsc.bcm.edu;bcgsc.ca	37	X	136649847	136649847	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chrX:136649847C>A	ENST00000287538.5	+	1	1547	c.997C>A	c.(997-999)Ccg>Acg	p.P333T	ZIC3_ENST00000370606.3_Missense_Mutation_p.P333T	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	333	Nuclear localization signal.				anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					ATGCCCCTTCCCGGGCTGCGG	0.597																																					p.P333T		.											.	ZIC3	195	0			c.C997A						.						67.0	73.0	71.0					X																	136649847		2202	4299	6501	SO:0001583	missense	7547	exon1			CCCTTCCCGGGCT	AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.997C>A	X.37:g.136649847C>A	ENSP00000287538:p.Pro333Thr	199.0	0.0		125.0	5.0	NM_003413	B2CNW4|Q14DE5|Q5JY75	Missense_Mutation	SNP	ENST00000287538.5	37	CCDS14663.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.798537	0.70567	.	.	ENSG00000156925	ENST00000287538;ENST00000370606	D;D	0.91124	-2.79;-2.79	4.96	4.96	0.65561	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.052480	0.85682	D	0.000000	D	0.91436	0.7297	L	0.41415	1.275	0.80722	D	1	P	0.39737	0.685	P	0.51777	0.679	D	0.92506	0.6012	10	0.87932	D	0	.	16.2665	0.82581	0.0:1.0:0.0:0.0	.	333	O60481	ZIC3_HUMAN	T	333	ENSP00000287538:P333T;ENSP00000359638:P333T	ENSP00000287538:P333T	P	+	1	0	ZIC3	136477513	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.837000	0.69381	2.299000	0.77371	0.596000	0.82720	CCG	.		0.597	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058526.1		
ZNF107	51427	hgsc.bcm.edu;bcgsc.ca	37	7	64166707	64166707	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr7:64166707T>C	ENST00000395391.1	+	4	1400	c.25T>C	c.(25-27)Tct>Cct	p.S9P	ZNF107_ENST00000344930.3_Missense_Mutation_p.S9P|ZNF107_ENST00000423627.1_Missense_Mutation_p.S9P			Q9UII5	ZN107_HUMAN	zinc finger protein 107	9					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(18)|ovary(1)|stomach(1)	37		Lung NSC(55;0.00948)|all_lung(88;0.0249)				TTCAGTAATGTCTTTTCATTT	0.299																																					p.S9P		.											.	ZNF107	69	0			c.T25C						.						39.0	40.0	40.0					7																	64166707		2194	4295	6489	SO:0001583	missense	51427	exon7			GTAATGTCTTTTC	AB027251	CCDS5527.1, CCDS75605.1, CCDS75606.1	7q11.2	2013-01-08	2007-06-26			ENSG00000196247		"""Zinc fingers, C2H2-type"""	12887	protein-coding gene	gene with protein product		603989	"""zinc finger protein 588"", ""zinc finger protein 107 (Y8)"""	ZNF588		8467795	Standard	NM_016220		Approved	ZFD25, smap-7	uc003tte.3	Q9UII5		ENST00000395391.1:c.25T>C	7.37:g.64166707T>C	ENSP00000378789:p.Ser9Pro	78.0	0.0		63.0	4.0	NM_016220		Missense_Mutation	SNP	ENST00000395391.1	37	CCDS5527.1	.	.	.	.	.	.	.	.	.	.	.	9.217	1.032386	0.19590	.	.	ENSG00000196247	ENST00000541526;ENST00000360117;ENST00000344930;ENST00000423627;ENST00000395391	T;T;T;T	0.08370	4.81;3.1;3.1;3.1	0.596	0.596	0.17496	.	.	.	.	.	T	0.07007	0.0178	L	0.38175	1.15	0.23628	N	0.997252	B	0.02656	0.0	B	0.01281	0.0	T	0.32877	-0.9890	8	0.59425	D	0.04	.	.	.	.	.	9	Q9UII5	ZN107_HUMAN	P	9	ENSP00000353234:S9P;ENSP00000343443:S9P;ENSP00000400037:S9P;ENSP00000378789:S9P	ENSP00000343443:S9P	S	+	1	0	ZNF107	63804142	0.000000	0.05858	0.057000	0.19452	0.129000	0.20672	-0.013000	0.12678	0.478000	0.27488	0.254000	0.18369	TCT	.		0.299	ZNF107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251593.1	NM_016220	
ZNF229	7772	hgsc.bcm.edu;bcgsc.ca	37	19	44934658	44934658	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:44934658G>T	ENST00000588931.1	-	6	731	c.298C>A	c.(298-300)Cac>Aac	p.H100N	ZNF229_ENST00000291187.4_Missense_Mutation_p.H94N|CTC-512J12.4_ENST00000588655.1_RNA|ZNF229_ENST00000591289.1_Intron	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	100	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				AGCTCTTTGTGTGAAAAGAAC	0.398																																					p.H100N		.											.	ZNF229	94	0			c.C298A						.						57.0	55.0	56.0					19																	44934658		1841	4091	5932	SO:0001583	missense	7772	exon6			CTTTGTGTGAAAA	AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.298C>A	19.37:g.44934658G>T	ENSP00000466519:p.His100Asn	118.0	0.0		95.0	4.0	NM_014518	B2RWN3|Q59FV2|Q86WL9	Missense_Mutation	SNP	ENST00000588931.1	37	CCDS42574.1	.	.	.	.	.	.	.	.	.	.	G	2.312	-0.357768	0.05138	.	.	ENSG00000167383	ENST00000291187	.	.	.	2.99	0.432	0.16529	Krueppel-associated box (1);	.	.	.	.	T	0.19565	0.0470	N	0.24115	0.695	0.09310	N	1	B	0.30068	0.267	B	0.27500	0.08	T	0.20472	-1.0274	8	0.25106	T	0.35	.	5.1714	0.15112	0.1491:0.2006:0.6504:0.0	.	100	Q9UJW7	ZN229_HUMAN	N	100	.	ENSP00000291187:H100N	H	-	1	0	ZNF229	49626498	0.001000	0.12720	0.002000	0.10522	0.295000	0.27426	0.233000	0.17911	0.145000	0.18977	0.609000	0.83330	CAC	.		0.398	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460833.1	NM_014518	
ZNF132	7691	hgsc.bcm.edu;bcgsc.ca	37	19	58945140	58945140	+	Silent	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:58945140A>G	ENST00000254166.3	-	3	2071	c.1671T>C	c.(1669-1671)acT>acC	p.T557T	CTD-2619J13.17_ENST00000594816.1_lincRNA	NM_003433.3	NP_003424.3	P52740	ZN132_HUMAN	zinc finger protein 132	557					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(1)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		GTTCAATGAGAGTGGAGCTGT	0.458																																					p.T557T		.											.	ZNF132	92	0			c.T1671C						.						90.0	90.0	90.0					19																	58945140		2203	4300	6503	SO:0001819	synonymous_variant	7691	exon3			AATGAGAGTGGAG	U09411	CCDS12980.1	19q13.4	2013-01-08	2006-06-13			ENSG00000131849		"""Zinc fingers, C2H2-type"", ""-"""	12916	protein-coding gene	gene with protein product		604074	"""zinc finger protein 132 (clone pHZ-12)"""			7557990	Standard	NM_003433		Approved	pHZ-12	uc002qst.4	P52740		ENST00000254166.3:c.1671T>C	19.37:g.58945140A>G		166.0	0.0		91.0	4.0	NM_003433	Q32MI9	Silent	SNP	ENST00000254166.3	37	CCDS12980.1																																																																																			.		0.458	ZNF132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467035.1	NM_003433	
ZNF248	57209	hgsc.bcm.edu;bcgsc.ca	37	10	38126943	38126943	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr10:38126943G>T	ENST00000395867.3	-	4	662	c.112C>A	c.(112-114)Ctg>Atg	p.L38M	ZNF248_ENST00000357328.4_Missense_Mutation_p.L38M|ZNF248_ENST00000494133.1_5'UTR|ZNF248_ENST00000374648.3_Missense_Mutation_p.L38M	NM_001267605.1|NM_001267606.1|NM_001267607.1|NM_021045.2	NP_001254534.1|NP_001254535.1|NP_001254536.1|NP_066383.1	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	38	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|urinary_tract(1)	20						TAATTTTCCAGGATCACATCT	0.418																																					p.L38M		.											.	ZNF248	91	0			c.C112A						.						159.0	151.0	153.0					10																	38126943		2203	4300	6503	SO:0001583	missense	57209	exon2			TTTCCAGGATCAC	AJ491695	CCDS7194.1, CCDS58077.1, CCDS73087.1	10p11.21	2013-01-08			ENSG00000198105	ENSG00000198105		"""Zinc fingers, C2H2-type"", ""-"""	13041	protein-coding gene	gene with protein product						12566394	Standard	NM_021045		Approved	bA162G10.3	uc010qeu.2	Q8NDW4	OTTHUMG00000017980	ENST00000395867.3:c.112C>A	10.37:g.38126943G>T	ENSP00000379208:p.Leu38Met	148.0	0.0		96.0	4.0	NM_001267606	Q8NDV8|Q9UMP3	Missense_Mutation	SNP	ENST00000395867.3	37	CCDS7194.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.255122	0.39896	.	.	ENSG00000198105	ENST00000395867;ENST00000374648;ENST00000357328;ENST00000395873;ENST00000395874	T;T;T;T;T	0.58506	4.03;0.33;4.03;0.33;0.33	4.43	3.53	0.40419	Krueppel-associated box (4);	0.000000	0.35495	N	0.003172	T	0.79143	0.4396	M	0.93016	3.37	0.33771	D	0.623008	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.86561	0.1841	10	0.87932	D	0	.	10.4631	0.44592	0.097:0.0:0.903:0.0	.	38;38	Q8NDW4;Q8NDV8	ZN248_HUMAN;.	M	38	ENSP00000379208:L38M;ENSP00000363778:L38M;ENSP00000349882:L38M;ENSP00000379214:L38M;ENSP00000379215:L38M	ENSP00000349882:L38M	L	-	1	2	ZNF248	38166949	1.000000	0.71417	0.999000	0.59377	0.244000	0.25665	1.997000	0.40786	1.213000	0.43380	0.563000	0.77884	CTG	.		0.418	ZNF248-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047609.1	NM_021045	
ZNF33B	7582	hgsc.bcm.edu;bcgsc.ca	37	10	43088543	43088543	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr10:43088543A>G	ENST00000359467.3	-	5	1969	c.1855T>C	c.(1855-1857)Tgc>Cgc	p.C619R	ZNF33B_ENST00000486187.1_RNA	NM_006955.1	NP_008886.1	Q06732	ZN33B_HUMAN	zinc finger protein 33B	619					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(15)|skin(1)|stomach(1)	29						GACTTCTGGCAGAAGGTTTTT	0.373																																					p.C619R	Melanoma(137;1247 1767 16772 25727 43810)	.											.	ZNF33B	90	0			c.T1855C						.						95.0	95.0	95.0					10																	43088543		2203	4300	6503	SO:0001583	missense	7582	exon5			TCTGGCAGAAGGT	X68688, AJ491697	CCDS7198.1	10q11.2	2013-01-08	2005-03-18		ENSG00000196693	ENSG00000196693		"""Zinc fingers, C2H2-type"", ""-"""	13097	protein-coding gene	gene with protein product		194522	"""zinc finger protein 33b (KOX 31)"", ""zinc finger protein 11B"""	ZNF11B		2014798	Standard	NM_006955		Approved	KOX31, KOX2	uc001jaf.1	Q06732	OTTHUMG00000018014	ENST00000359467.3:c.1855T>C	10.37:g.43088543A>G	ENSP00000352444:p.Cys619Arg	129.0	0.0		121.0	5.0	NM_006955	Q06731|Q32MA2|Q86XY8|Q8NDW3	Missense_Mutation	SNP	ENST00000359467.3	37	CCDS7198.1	.	.	.	.	.	.	.	.	.	.	A	2.623	-0.288063	0.05605	.	.	ENSG00000196693	ENST00000359467;ENST00000395836	T	0.07327	3.2	2.58	2.58	0.30949	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36740	N	0.002422	T	0.03783	0.0107	N	0.02202	-0.64	0.37728	D	0.925189	B	0.28552	0.215	B	0.34590	0.186	T	0.47497	-0.9113	10	0.35671	T	0.21	.	9.025	0.36224	1.0:0.0:0.0:0.0	.	619	Q06732	ZN33B_HUMAN	R	619;585	ENSP00000352444:C619R	ENSP00000352444:C619R	C	-	1	0	ZNF33B	42408549	0.012000	0.17670	0.995000	0.50966	0.982000	0.71751	0.506000	0.22658	1.446000	0.47643	0.336000	0.21669	TGC	.		0.373	ZNF33B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_006955	
ZNF341	84905	hgsc.bcm.edu;bcgsc.ca	37	20	32328755	32328755	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr20:32328755C>A	ENST00000375200.1	+	2	444	c.79C>A	c.(79-81)Caa>Aaa	p.Q27K	ZNF341_ENST00000342427.2_Missense_Mutation_p.Q27K	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	27					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						ATTGGATGGCCAAGGAGCAGT	0.537																																					p.Q27K		.											.	ZNF341	92	0			c.C79A						.						110.0	93.0	99.0					20																	32328755		2203	4300	6503	SO:0001583	missense	84905	exon2			GATGGCCAAGGAG	AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.79C>A	20.37:g.32328755C>A	ENSP00000364346:p.Gln27Lys	105.0	0.0		55.0	4.0	NM_032819	A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Missense_Mutation	SNP	ENST00000375200.1	37		.	.	.	.	.	.	.	.	.	.	C	18.50	3.637217	0.67130	.	.	ENSG00000131061	ENST00000342427;ENST00000375200	T;T	0.11169	3.05;2.8	5.27	4.32	0.51571	.	0.062422	0.64402	N	0.000004	T	0.10680	0.0261	L	0.34521	1.04	0.54753	D	0.999984	B;B	0.17268	0.012;0.021	B;B	0.20184	0.012;0.028	T	0.06445	-1.0826	10	0.54805	T	0.06	-11.631	14.361	0.66771	0.1497:0.8503:0.0:0.0	.	27;27	Q9BYN7;Q9BYN7-2	ZN341_HUMAN;.	K	27	ENSP00000344308:Q27K;ENSP00000364346:Q27K	ENSP00000344308:Q27K	Q	+	1	0	ZNF341	31792416	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.378000	0.79679	1.344000	0.45657	-0.293000	0.09583	CAA	.		0.537	ZNF341-201	KNOWN	basic	protein_coding	protein_coding			
ZNF346	23567	hgsc.bcm.edu;bcgsc.ca	37	5	176477805	176477805	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr5:176477805C>T	ENST00000358149.3	+	5	614	c.571C>T	c.(571-573)Cat>Tat	p.H191Y	ZNF346_ENST00000511834.1_Missense_Mutation_p.H207Y|ZNF346-IT1_ENST00000515264.1_RNA|ZNF346_ENST00000503039.1_Missense_Mutation_p.H216Y|ZNF346_ENST00000512315.1_Intron|ZNF346_ENST00000261948.4_Missense_Mutation_p.H216Y|ZNF346_ENST00000503425.1_Missense_Mutation_p.H159Y|ZNF346_ENST00000506693.1_Missense_Mutation_p.H93Y	NM_012279.2	NP_036411.1	Q9UL40	ZN346_HUMAN	zinc finger protein 346	191					positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	14	all_cancers(89;6.3e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAGCCTCTGCCATGCAACTTT	0.483																																					p.H191Y		.											.	ZNF346	90	0			c.C571T						.						119.0	110.0	113.0					5																	176477805		2203	4300	6503	SO:0001583	missense	23567	exon5			CTCTGCCATGCAA	AF083340	CCDS4409.1	5q35.3	2012-10-05			ENSG00000113761	ENSG00000113761			16403	protein-coding gene	gene with protein product		605308				10488071	Standard	NM_012279		Approved	JAZ, Zfp346	uc003mfi.3	Q9UL40	OTTHUMG00000130848	ENST00000358149.3:c.571C>T	5.37:g.176477805C>T	ENSP00000350869:p.His191Tyr	129.0	0.0		71.0	4.0	NM_012279	B7Z367|Q68CV9|Q6ZMW1	Missense_Mutation	SNP	ENST00000358149.3	37	CCDS4409.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.461267	0.84317	.	.	ENSG00000113761	ENST00000358149;ENST00000506693;ENST00000503425;ENST00000261948;ENST00000511834;ENST00000503039	T;T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97;1.97	5.47	4.59	0.56863	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);Zinc finger, C2H2 (1);	0.261330	0.45606	D	0.000360	T	0.38401	0.1039	L	0.54323	1.7	0.38262	D	0.941917	P;P;D;P	0.62365	0.945;0.954;0.991;0.953	P;P;P;P	0.59221	0.74;0.816;0.854;0.768	T	0.42699	-0.9436	10	0.72032	D	0.01	.	16.2029	0.82102	0.0:0.8666:0.1334:0.0	.	93;159;216;191	B7Z4J8;B7Z367;Q9UL40-2;Q9UL40	.;.;.;ZN346_HUMAN	Y	191;93;159;216;207;216	ENSP00000350869:H191Y;ENSP00000423515:H93Y;ENSP00000421212:H159Y;ENSP00000261948:H216Y;ENSP00000425725:H207Y;ENSP00000424495:H216Y	ENSP00000261948:H216Y	H	+	1	0	ZNF346	176410411	1.000000	0.71417	0.913000	0.36048	0.952000	0.60782	5.175000	0.65021	1.266000	0.44231	0.655000	0.94253	CAT	.		0.483	ZNF346-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253415.2	NM_012279	
ZNF354C	30832	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	178506014	178506014	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr5:178506014G>T	ENST00000315475.6	+	5	887	c.581G>T	c.(580-582)gGg>gTg	p.G194V		NM_014594.1	NP_055409.1	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	194					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|urinary_tract(3)	30	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		TATACATTTGGGAAAGATTTT	0.363																																					p.G194V		.											.	ZNF354C	91	0			c.G581T						.						54.0	58.0	57.0					5																	178506014		2201	4299	6500	SO:0001583	missense	30832	exon5			CATTTGGGAAAGA		CCDS4443.1	5q35	2013-01-08			ENSG00000177932	ENSG00000177932		"""Zinc fingers, C2H2-type"", ""-"""	16736	protein-coding gene	gene with protein product						10786630	Standard	NM_014594		Approved	KID3	uc003mju.3	Q86Y25	OTTHUMG00000130888	ENST00000315475.6:c.581G>T	5.37:g.178506014G>T	ENSP00000324064:p.Gly194Val	71.0	0.0		70.0	5.0	NM_014594	Q6P4P9|Q8NFX1	Missense_Mutation	SNP	ENST00000315475.6	37	CCDS4443.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.743763	0.49151	.	.	ENSG00000177932	ENST00000315475	T	0.36520	1.25	3.94	1.59	0.23543	.	.	.	.	.	T	0.57417	0.2052	M	0.90870	3.155	0.53688	D	0.999975	D	0.63880	0.993	P	0.59012	0.85	T	0.58306	-0.7659	9	0.66056	D	0.02	-4.7609	6.9571	0.24578	0.2915:0.0:0.7085:0.0	.	194	Q86Y25	Z354C_HUMAN	V	194	ENSP00000324064:G194V	ENSP00000324064:G194V	G	+	2	0	ZNF354C	178438620	1.000000	0.71417	0.004000	0.12327	0.011000	0.07611	3.680000	0.54641	0.202000	0.20498	-0.229000	0.12294	GGG	.		0.363	ZNF354C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253473.2		
ZNF429	353088	hgsc.bcm.edu;bcgsc.ca	37	19	21712459	21712459	+	Splice_Site	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:21712459G>T	ENST00000358491.4	+	2	211		c.e2-1		ZNF429_ENST00000594022.1_Splice_Site|ZNF429_ENST00000597078.1_Splice_Site	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						GTGTGTTTCAGGGACCATTGA	0.403																																					.		.											.	ZNF429	516	0			c.4-1G>T						.						72.0	79.0	76.0					19																	21712459		2200	4299	6499	SO:0001630	splice_region_variant	353088	exon2			GTTTCAGGGACCA	AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.4-1G>T	19.37:g.21712459G>T		109.0	0.0		59.0	4.0	NM_001001415	A6NLV7|Q9BZE6	Splice_Site	SNP	ENST00000358491.4	37	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	G	3.591	-0.083509	0.07141	.	.	ENSG00000197013	ENST00000358491	.	.	.	0.926	0.926	0.19430	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.6024	0.33754	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF429	21504299	0.994000	0.37717	0.179000	0.23059	0.257000	0.26127	3.033000	0.49743	0.308000	0.22923	0.313000	0.20887	.	.		0.403	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463981.1	NM_001001415	Intron
ZNF521	25925	hgsc.bcm.edu;bcgsc.ca	37	18	22806400	22806400	+	Silent	SNP	T	T	C			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr18:22806400T>C	ENST00000361524.3	-	4	1630	c.1482A>G	c.(1480-1482)gaA>gaG	p.E494E	ZNF521_ENST00000538137.2_Silent_p.E494E|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Silent_p.E274E	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	494					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					ATCGGATGTGTTCCTGAAGAG	0.463			T	PAX5	ALL																																p.E494E		.		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	ZNF521,NS,carcinoma,-2	ZNF521	275	0			c.A1482G						.						101.0	100.0	101.0					18																	22806400		2203	4300	6503	SO:0001819	synonymous_variant	25925	exon4			GATGTGTTCCTGA	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1482A>G	18.37:g.22806400T>C		183.0	0.0		135.0	6.0	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Silent	SNP	ENST00000361524.3	37	CCDS32806.1																																																																																			.		0.463	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
ZNF585B	92285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	37677107	37677107	+	Silent	SNP	C	C	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:37677107C>T	ENST00000532828.2	-	5	1583	c.1332G>A	c.(1330-1332)ggG>ggA	p.G444G	ZNF585B_ENST00000531805.1_Silent_p.G389G|ZNF585B_ENST00000527838.1_3'UTR|CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000312908.5_Silent_p.G32G	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	444					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TAAACAATTTCCCACAGTGAC	0.403																																					p.G444G	Melanoma(93;882 1454 18863 28917 48427)	.											.	ZNF585B	91	0			c.G1332A						.						111.0	111.0	111.0					19																	37677107		2203	4300	6503	SO:0001819	synonymous_variant	92285	exon5			CAATTTCCCACAG	AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.1332G>A	19.37:g.37677107C>T		243.0	0.0		198.0	61.0	NM_152279	Q8IZD3|Q96JW6	Silent	SNP	ENST00000532828.2	37	CCDS12500.1																																																																																			.		0.403	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388272.2	NM_152279	
ZNF655	79027	hgsc.bcm.edu;bcgsc.ca	37	7	99169920	99169920	+	Silent	SNP	G	G	T	rs531904406		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr7:99169920G>T	ENST00000394163.2	+	3	372	c.189G>T	c.(187-189)tcG>tcT	p.S63S	GS1-259H13.10_ENST00000455905.1_Intron|ZNF655_ENST00000425063.1_3'UTR|GS1-259H13.10_ENST00000486324.1_Intron|ZNF655_ENST00000424881.1_Silent_p.S98S|ZNF655_ENST00000493277.1_Silent_p.S98S|ZNF655_ENST00000252713.4_Silent_p.S63S|ZNF655_ENST00000419215.2_3'UTR	NM_001009960.1|NM_138494.2	NP_001009960.1|NP_612503.1	Q8N720	ZN655_HUMAN	zinc finger protein 655	63					negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	16	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					AGAAAATTTCGGAAGAAGTGC	0.378																																					p.S98S		.											.	ZNF655	91	0			c.G294T						.						82.0	85.0	84.0					7																	99169920		2203	4300	6503	SO:0001819	synonymous_variant	79027	exon4			AATTTCGGAAGAA	AY099353	CCDS5669.1, CCDS5670.1, CCDS34695.1, CCDS47655.1	7q22.1	2013-01-08			ENSG00000197343	ENSG00000197343		"""Zinc fingers, C2H2-type"", ""-"""	30899	protein-coding gene	gene with protein product						11179890, 15558030	Standard	NM_001083956		Approved	VIK-1, VIK	uc010lgc.3	Q8N720	OTTHUMG00000156637	ENST00000394163.2:c.189G>T	7.37:g.99169920G>T		64.0	0.0		123.0	5.0	NM_001085368	A4D291|A6NGD3|B4E3M4|B7Z9Q9|D6W5T4|Q8IV00|Q8TA89|Q96EZ3|Q9BQ85	Silent	SNP	ENST00000394163.2	37	CCDS5669.1																																																																																			.		0.378	ZNF655-009	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000344929.1	NM_138494	
ZNF675	171392	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	23836432	23836432	+	Silent	SNP	G	G	T	rs199957959		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:23836432G>T	ENST00000359788.4	-	4	1471	c.1303C>A	c.(1303-1305)Cga>Aga	p.R435R	ZNF675_ENST00000596211.1_Intron|ZNF675_ENST00000600313.1_Intron|ZNF675_ENST00000601935.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	435					bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTTGAGGATCGGTTAAAAGCT	0.378																																					p.R435R		.											.	ZNF675	228	0			c.C1303A						.						52.0	55.0	54.0					19																	23836432		2202	4300	6502	SO:0001819	synonymous_variant	171392	exon4			AGGATCGGTTAAA		CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.1303C>A	19.37:g.23836432G>T		54.0	0.0		33.0	4.0	NM_138330	Q8N211	Silent	SNP	ENST00000359788.4	37	CCDS32981.1																																																																																			G|0.999;A|0.001		0.378	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466433.1	NM_138330	
ZNF75A	7627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3367499	3367499	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr16:3367499C>G	ENST00000574298.1	+	6	994	c.521C>G	c.(520-522)tCt>tGt	p.S174C	ZNF75A_ENST00000498240.2_3'UTR	NM_153028.2	NP_694573.1	Q96N20	ZN75A_HUMAN	zinc finger protein 75a	174					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|lung(7)|prostate(1)	12						AGAGTTAGCTCTGACCTTATT	0.383																																					p.S174C		.											.	ZNF75A	153	0			c.C521G						.						81.0	79.0	79.0					16																	3367499		2197	4300	6497	SO:0001583	missense	7627	exon6			TTAGCTCTGACCT	X91826	CCDS10501.1	16p13.11	2013-01-08			ENSG00000162086	ENSG00000162086		"""Zinc fingers, C2H2-type"", ""-"""	13146	protein-coding gene	gene with protein product		601473				8661144	Standard	NM_153028		Approved	FLJ31529	uc002cut.4	Q96N20	OTTHUMG00000129356	ENST00000574298.1:c.521C>G	16.37:g.3367499C>G	ENSP00000459566:p.Ser174Cys	220.0	0.0		199.0	62.0	NM_153028	Q0VDI8|Q92669	Missense_Mutation	SNP	ENST00000574298.1	37	CCDS10501.1	.	.	.	.	.	.	.	.	.	.	C	16.73	3.202946	0.58234	.	.	ENSG00000162086	ENST00000293995	.	.	.	4.57	3.6	0.41247	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44285	D	0.000464	T	0.54775	0.1879	M	0.80028	2.48	0.26965	N	0.96573	B	0.22414	0.069	B	0.19946	0.027	T	0.56649	-0.7944	9	0.66056	D	0.02	.	12.5959	0.56470	0.0:0.8312:0.1688:0.0	.	174	Q96N20	ZN75A_HUMAN	C	174	.	ENSP00000293995:S174C	S	+	2	0	ZNF75A	3307500	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	0.207000	0.17395	1.253000	0.44018	0.557000	0.71058	TCT	.		0.383	ZNF75A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251506.2	NM_153028	
ZNF839	55778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	102805186	102805186	+	Silent	SNP	C	C	A	rs535523717		TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr14:102805186C>A	ENST00000558850.1	+	6	1695	c.1345C>A	c.(1345-1347)Cgg>Agg	p.R449R	ZNF839_ENST00000420933.2_3'UTR|AL137229.1_ENST00000577622.1_RNA|ZNF839_ENST00000559185.1_Silent_p.R449R|ZNF839_ENST00000442396.2_Silent_p.R565R|ZNF839_ENST00000262236.5_Silent_p.R449R	NM_001267827.1	NP_001254756.1	A8K0R7	ZN839_HUMAN	zinc finger protein 839	449							metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						AGAATTCCTACGGAAGAAAGA	0.502																																					p.R565R		.											.	ZNF839	91	0			c.C1693A						.						95.0	93.0	94.0					14																	102805186		1960	4144	6104	SO:0001819	synonymous_variant	55778	exon6			TTCCTACGGAAGA	AK093342	CCDS45164.1, CCDS58336.1	14q32.32	2010-05-06	2008-06-23	2008-06-23	ENSG00000022976	ENSG00000022976			20345	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 131"""	C14orf131			Standard	NM_018335		Approved		uc010awk.2	A8K0R7		ENST00000558850.1:c.1345C>A	14.37:g.102805186C>A		217.0	0.0		149.0	35.0	NM_018335	B3KSD2|Q53FH5|Q6GPI5|Q86TU1|Q9BQ86|Q9NUU3	Silent	SNP	ENST00000558850.1	37	CCDS58336.1																																																																																			.		0.502	ZNF839-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000415492.2	NM_018335	
ZNF841	284371	hgsc.bcm.edu;bcgsc.ca	37	19	52569527	52569527	+	Silent	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:52569527G>T	ENST00000426391.2	-	5	1811	c.1260C>A	c.(1258-1260)acC>acA	p.T420T	ZNF841_ENST00000594295.1_Silent_p.T536T|ZNF432_ENST00000598446.1_Intron|ZNF841_ENST00000389534.4_Silent_p.T536T|ZNF841_ENST00000359973.2_Intron|CTC-471J1.2_ENST00000569091.1_RNA			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	420					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						GTTTCTCTCCGGTATGAATTC	0.398																																					p.T536T		.											.	.	.	0			c.C1608A						.						87.0	81.0	83.0					19																	52569527		692	1591	2283	SO:0001819	synonymous_variant	284371	exon7			CTCTCCGGTATGA	AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.1260C>A	19.37:g.52569527G>T		74.0	0.0		79.0	4.0	NM_001136499	B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Silent	SNP	ENST00000426391.2	37																																																																																				.		0.398	ZNF841-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000462435.1	XM_209155	
ZNF85	7639	hgsc.bcm.edu;bcgsc.ca	37	19	21132473	21132473	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:21132473C>A	ENST00000328178.8	+	4	1266	c.1153C>A	c.(1153-1155)Ctt>Att	p.L385I	ZNF85_ENST00000601023.1_Missense_Mutation_p.L326I|ZNF85_ENST00000345030.6_Missense_Mutation_p.L352I	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	385					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						TTTCTCACACCTTACTACACA	0.348																																					p.L415I		.											.	ZNF85	514	0			c.C1243A						.						35.0	38.0	37.0					19																	21132473		2195	4295	6490	SO:0001583	missense	7639	exon5			TCACACCTTACTA	U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.1153C>A	19.37:g.21132473C>A	ENSP00000329793:p.Leu385Ile	82.0	0.0		72.0	4.0	NM_001256171	B9ZVP4|Q6NVI0	Missense_Mutation	SNP	ENST00000328178.8	37	CCDS32977.1	.	.	.	.	.	.	.	.	.	.	.	11.14	1.551047	0.27739	.	.	ENSG00000105750	ENST00000328178;ENST00000345030;ENST00000421385	T;T	0.53857	0.6;0.6	1.35	1.35	0.21983	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.69691	0.3139	M	0.85542	2.76	0.09310	N	0.999997	D;P;D	0.89917	0.957;0.95;1.0	D;D;D	0.91635	0.937;0.991;0.999	T	0.55029	-0.8204	9	0.72032	D	0.01	.	4.9635	0.14078	0.0:0.79:0.0:0.2099	.	352;326;385	Q03923-2;Q49A12;Q03923	.;.;ZNF85_HUMAN	I	385;352;260	ENSP00000329793:L385I;ENSP00000342340:L352I	ENSP00000329793:L385I	L	+	1	0	ZNF85	20924313	0.068000	0.21057	0.002000	0.10522	0.002000	0.02628	0.707000	0.25704	0.681000	0.31386	0.462000	0.41574	CTT	.		0.348	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463430.1	NM_003429	
ZNF841	284371	hgsc.bcm.edu;bcgsc.ca	37	19	52570470	52570470	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KA-01A-11D-A183-10	TCGA-EP-A2KA-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	484a41c8-fcaf-488d-97dc-bfe6a4b88a95	a9d75099-91a1-40aa-a8f1-e6035acd821d	g.chr19:52570470G>T	ENST00000426391.2	-	5	868	c.317C>A	c.(316-318)cCa>cAa	p.P106Q	ZNF841_ENST00000594295.1_Missense_Mutation_p.P222Q|ZNF432_ENST00000598446.1_Intron|ZNF841_ENST00000389534.4_Missense_Mutation_p.P222Q|ZNF841_ENST00000359973.2_Missense_Mutation_p.P106Q			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	106					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						TCTTTGAAGTGGTGAAGCTAA	0.353																																					p.P222Q		.											.	.	.	0			c.C665A						.						81.0	63.0	69.0					19																	52570470		692	1591	2283	SO:0001583	missense	284371	exon7			TGAAGTGGTGAAG	AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.317C>A	19.37:g.52570470G>T	ENSP00000415453:p.Pro106Gln	103.0	0.0		76.0	4.0	NM_001136499	B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Missense_Mutation	SNP	ENST00000426391.2	37		.	.	.	.	.	.	.	.	.	.	G	1.875	-0.459228	0.04508	.	.	ENSG00000197608	ENST00000389534;ENST00000426391;ENST00000359973	T;T;T	0.08370	3.51;3.33;3.1	1.74	0.511	0.16989	.	.	.	.	.	T	0.04679	0.0127	N	0.00869	-1.13	0.09310	N	1	D;P;D	0.76494	0.999;0.946;0.998	D;P;D	0.83275	0.996;0.654;0.987	T	0.29701	-1.0003	9	0.10636	T	0.68	.	1.9647	0.03393	0.2407:0.0:0.4599:0.2994	.	222;106;106	Q6ZN19-3;Q6ZN19-2;Q6ZN19	.;.;ZN841_HUMAN	Q	222;106;106	ENSP00000374185:P222Q;ENSP00000415453:P106Q;ENSP00000353060:P106Q	ENSP00000353060:P106Q	P	-	2	0	ZNF841	57262282	0.001000	0.12720	0.016000	0.15963	0.322000	0.28314	-0.184000	0.09698	0.195000	0.20347	0.313000	0.20887	CCA	.		0.353	ZNF841-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000462435.1	XM_209155	
