#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACTR1B	10120	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	98275456	98275456	+	Missense_Mutation	SNP	A	A	C	rs148249069		TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr2:98275456A>C	ENST00000289228.5	-	5	542	c.326T>G	c.(325-327)cTc>cGc	p.L109R		NM_005735.3	NP_005726.1	P42025	ACTY_HUMAN	ARP1 actin-related protein 1 homolog B, centractin beta (yeast)	109					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)			endometrium(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	15						CTCCGTGAGGAGCACAGGATG	0.597																																					p.L109R		.											.	ACTR1B	91	0			c.T326G						.						97.0	107.0	104.0					2																	98275456		2203	4300	6503	SO:0001583	missense	10120	exon5			GTGAGGAGCACAG	X82207	CCDS2033.1	2q11.1-q11.2	2008-05-20	2001-11-28		ENSG00000115073	ENSG00000115073			168	protein-coding gene	gene with protein product		605144	"""ARP1 (actin-related protein 1, yeast) homolog B (centractin beta)"""	CTRN2		7696711, 10343100	Standard	NM_005735		Approved		uc002syb.2	P42025	OTTHUMG00000130549	ENST00000289228.5:c.326T>G	2.37:g.98275456A>C	ENSP00000289228:p.Leu109Arg	46.0	0.0		36.0	6.0	NM_005735	D3DVH2|Q53SK5|Q9BRB7	Missense_Mutation	SNP	ENST00000289228.5	37	CCDS2033.1	.	.	.	.	.	.	.	.	.	.	.	19.37	3.814851	0.70912	.	.	ENSG00000115073	ENST00000289228	D	0.97209	-4.29	5.26	5.26	0.73747	Actin/actin-like conserved site (1);	0.000000	0.64402	D	0.000003	D	0.99067	0.9680	H	0.98370	4.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99019	1.0817	10	0.87932	D	0	.	13.1237	0.59342	1.0:0.0:0.0:0.0	.	109	P42025	ACTY_HUMAN	R	109	ENSP00000289228:L109R	ENSP00000289228:L109R	L	-	2	0	ACTR1B	97641888	1.000000	0.71417	0.851000	0.33527	0.688000	0.40055	9.311000	0.96282	1.995000	0.58328	0.533000	0.62120	CTC	A|1.000;T|0.000		0.597	ACTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252973.1	NM_005735	
ADCY8	114	broad.mit.edu;bcgsc.ca	37	8	131848681	131848681	+	Silent	SNP	C	C	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr8:131848681C>A	ENST00000286355.5	-	12	4609	c.2517G>T	c.(2515-2517)acG>acT	p.T839T	ADCY8_ENST00000377928.3_Silent_p.T708T	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	839					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CCAACACCCCCGTGAAGACAA	0.532										HNSCC(32;0.087)																											p.T839T		.											.	ADCY8	157	0			c.G2517T						.						108.0	92.0	97.0					8																	131848681		2203	4300	6503	SO:0001819	synonymous_variant	114	exon12			CACCCCCGTGAAG	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2517G>T	8.37:g.131848681C>A		45.0	1.0		56.0	25.0	NM_001115		Silent	SNP	ENST00000286355.5	37	CCDS6363.1																																																																																			.		0.532	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
ALKBH7	84266	ucsc.edu;bcgsc.ca	37	19	6374235	6374235	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr19:6374235A>G	ENST00000245812.3	+	2	614	c.226A>G	c.(226-228)Aca>Gca	p.T76A	ALKBH7_ENST00000599849.1_Missense_Mutation_p.T15A|ALKBH7_ENST00000596657.1_5'UTR	NM_032306.3	NP_115682.1	Q9BT30	ALKB7_HUMAN	alkB, alkylation repair homolog 7 (E. coli)	76					cellular response to DNA damage stimulus (GO:0006974)|fatty acid metabolic process (GO:0006631)|regulation of lipid storage (GO:0010883)|regulation of mitochondrial membrane permeability involved in programmed necrotic cell death (GO:1902445)	mitochondrial matrix (GO:0005759)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						CTTCCGAGAGACAGAGAAGTC	0.652																																					p.T76A		.											.	ALKBH7	90	0			c.A226G						.						28.0	32.0	31.0					19																	6374235		2201	4298	6499	SO:0001583	missense	84266	exon2			CGAGAGACAGAGA	AY427650	CCDS12163.1	19p13.3	2008-02-05	2006-02-09	2006-02-09		ENSG00000125652		"""Alkylation repair homologs"""	21306	protein-coding gene	gene with protein product		613305	"""spermatogenesis associated 11"""	SPATA11		12477932	Standard	NM_032306		Approved	MGC10974	uc002meo.2	Q9BT30		ENST00000245812.3:c.226A>G	19.37:g.6374235A>G	ENSP00000245812:p.Thr76Ala	22.0	0.0		22.0	4.0	NM_032306	B2R4U9|Q53FF3	Missense_Mutation	SNP	ENST00000245812.3	37	CCDS12163.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.465170	0.84425	.	.	ENSG00000125652	ENST00000245812	T	0.11063	2.81	4.51	4.51	0.55191	.	0.103529	0.64402	D	0.000005	T	0.18130	0.0435	M	0.76574	2.34	0.50632	D	0.999888	P	0.49783	0.928	P	0.49421	0.61	T	0.10474	-1.0628	10	0.07030	T	0.85	-20.3274	13.2385	0.59983	1.0:0.0:0.0:0.0	.	76	Q9BT30	ALKB7_HUMAN	A	76	ENSP00000245812:T76A	ENSP00000245812:T76A	T	+	1	0	ALKBH7	6325235	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	7.966000	0.87956	2.024000	0.59613	0.454000	0.30748	ACA	.		0.652	ALKBH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453036.1	NM_032306	
ALPK2	115701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	56247067	56247067	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr18:56247067A>G	ENST00000361673.3	-	4	1154	c.941T>C	c.(940-942)aTa>aCa	p.I314T	ALPK2_ENST00000587399.1_5'Flank	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	314						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						GGTTAGGGTTATCTCTGGGCA	0.473											OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I314T		.											.	ALPK2	765	0			c.T941C						.						121.0	119.0	120.0					18																	56247067		2203	4300	6503	SO:0001583	missense	115701	exon4			AGGGTTATCTCTG	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.941T>C	18.37:g.56247067A>G	ENSP00000354991:p.Ile314Thr	139.0	0.0	1014	171.0	28.0	NM_052947	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	A	16.75	3.210392	0.58343	.	.	ENSG00000198796	ENST00000361673	T	0.57595	0.39	6.17	5.03	0.67393	.	0.361375	0.20142	N	0.098359	T	0.36276	0.0961	L	0.46157	1.445	0.26363	N	0.977016	P	0.43431	0.807	B	0.31016	0.123	T	0.39683	-0.9602	10	0.34782	T	0.22	-14.5358	6.9803	0.24700	0.7737:0.151:0.0753:0.0	.	314	Q86TB3	ALPK2_HUMAN	T	314	ENSP00000354991:I314T	ENSP00000354991:I314T	I	-	2	0	ALPK2	54398047	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.122000	0.31295	2.371000	0.80710	0.533000	0.62120	ATA	.		0.473	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
ANKFY1	51479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	4098292	4098292	+	Silent	SNP	G	G	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr17:4098292G>A	ENST00000341657.4	-	10	1388	c.1353C>T	c.(1351-1353)gaC>gaT	p.D451D	ANKFY1_ENST00000574367.1_Silent_p.D451D|ANKFY1_ENST00000433651.1_Silent_p.D451D|ANKFY1_ENST00000570535.1_Silent_p.D493D|Y_RNA_ENST00000384660.1_RNA	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	451					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						TGTCAGGTGCGTCTGTGTGGC	0.572																																					p.D493D		.											.	ANKFY1	93	0			c.C1479T						.						42.0	45.0	44.0					17																	4098292		2097	4233	6330	SO:0001819	synonymous_variant	51479	exon10			AGGTGCGTCTGTG	AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.1353C>T	17.37:g.4098292G>A		51.0	0.0		60.0	11.0	NM_001257999	A8KA65|Q5RKV4|Q9ULG5	Silent	SNP	ENST00000341657.4	37																																																																																				.		0.572	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1	NM_016376	
ARAP2	116984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	36230363	36230363	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr4:36230363T>C	ENST00000303965.4	-	2	1235	c.746A>G	c.(745-747)cAa>cGa	p.Q249R		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	249					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						CATTTCTCCTTGAAACTTAAA	0.388																																					p.Q249R		.											.	ARAP2	93	0			c.A746G						.						145.0	141.0	143.0					4																	36230363		2203	4300	6503	SO:0001583	missense	116984	exon2			TCTCCTTGAAACT	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.746A>G	4.37:g.36230363T>C	ENSP00000302895:p.Gln249Arg	170.0	0.0		193.0	39.0	NM_015230	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	ENST00000303965.4	37	CCDS3441.1	.	.	.	.	.	.	.	.	.	.	T	15.74	2.923499	0.52653	.	.	ENSG00000047365	ENST00000303965	T	0.09163	3.01	5.98	4.76	0.60689	.	0.085474	0.50627	D	0.000119	T	0.08088	0.0202	L	0.29908	0.895	0.27303	N	0.957524	P;P	0.35077	0.483;0.483	B;B	0.30943	0.122;0.122	T	0.23762	-1.0179	10	0.30854	T	0.27	.	12.256	0.54625	0.0:0.0:0.1409:0.8591	.	179;249	A7E2A5;Q8WZ64	.;ARAP2_HUMAN	R	249	ENSP00000302895:Q249R	ENSP00000302895:Q249R	Q	-	2	0	ARAP2	35906758	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	2.547000	0.45786	2.307000	0.77673	0.529000	0.55759	CAA	.		0.388	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	
ARHGEF4	50649	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	131797718	131797718	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr2:131797718C>T	ENST00000326016.5	+	7	1396	c.877C>T	c.(877-879)Ctc>Ttc	p.L293F	ARHGEF4_ENST00000409303.1_Missense_Mutation_p.L293F|ARHGEF4_ENST00000439368.2_3'UTR|ARHGEF4_ENST00000392953.3_Missense_Mutation_p.L293F|ARHGEF4_ENST00000428230.2_Intron|ARHGEF4_ENST00000525839.1_Missense_Mutation_p.L293F|ARHGEF4_ENST00000355771.3_Missense_Mutation_p.L222F	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	293	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		CAACGAGATCCTCAGCACTGA	0.692																																					p.L293F		.											.	ARHGEF4	292	0			c.C877T						.						70.0	67.0	68.0					2																	131797718		2203	4300	6503	SO:0001583	missense	50649	exon7			GAGATCCTCAGCA	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.877C>T	2.37:g.131797718C>T	ENSP00000316845:p.Leu293Phe	31.0	0.0		26.0	6.0	NM_032995	Q9HDC6|Q9UPP0	Missense_Mutation	SNP	ENST00000326016.5	37	CCDS2165.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.316524	0.81469	.	.	ENSG00000136002	ENST00000326016;ENST00000392953;ENST00000525839;ENST00000409303;ENST00000355771	T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;1.34;-0.19	4.93	3.96	0.45880	Src homology-3 domain (1);Dbl homology (DH) domain (5);	0.172913	0.48767	D	0.000180	T	0.73305	0.3570	M	0.82630	2.6	0.48571	D	0.999679	P;D;P	0.53619	0.834;0.961;0.915	P;P;P	0.60541	0.536;0.876;0.821	T	0.75983	-0.3125	10	0.87932	D	0	.	4.935	0.13935	0.2634:0.6257:0.0:0.1109	.	293;293;293	E9PEM0;Q9NR80-4;Q9NR80	.;.;ARHG4_HUMAN	F	293;293;293;293;222	ENSP00000316845:L293F;ENSP00000376680:L293F;ENSP00000432267:L293F;ENSP00000387285:L293F;ENSP00000348017:L222F	ENSP00000316845:L293F	L	+	1	0	ARHGEF4	131514188	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	3.096000	0.50243	2.284000	0.76573	0.491000	0.48974	CTC	.		0.692	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4		
ASPM	259266	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	197094016	197094016	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr1:197094016A>G	ENST00000367409.4	-	12	3408	c.3152T>C	c.(3151-3153)aTa>aCa	p.I1051T	ASPM_ENST00000294732.7_Missense_Mutation_p.I1051T|ASPM_ENST00000367408.1_Missense_Mutation_p.I301T	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1051	CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						AGCAAACGCTATTTTCCAAAG	0.274																																					p.I1051T		.											.	ASPM	615	0			c.T3152C						.						145.0	155.0	152.0					1																	197094016		2203	4299	6502	SO:0001583	missense	259266	exon12			AACGCTATTTTCC	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.3152T>C	1.37:g.197094016A>G	ENSP00000356379:p.Ile1051Thr	127.0	0.0		201.0	15.0	NM_001206846	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.107128	0.77096	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408	T;T;T	0.66099	-0.19;-0.19;-0.19	5.54	5.54	0.83059	Calponin homology domain (4);	0.000000	0.85682	D	0.000000	T	0.81795	0.4898	M	0.87758	2.905	0.80722	D	1	D;D	0.89917	0.986;1.0	P;D	0.79108	0.655;0.992	D	0.85328	0.1088	10	0.87932	D	0	.	15.9651	0.79966	1.0:0.0:0.0:0.0	.	1051;1051	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	T	1051;1051;301	ENSP00000356379:I1051T;ENSP00000294732:I1051T;ENSP00000356378:I301T	ENSP00000294732:I1051T	I	-	2	0	ASPM	195360639	1.000000	0.71417	0.973000	0.42090	0.913000	0.54294	8.405000	0.90213	2.230000	0.72887	0.455000	0.32223	ATA	.		0.274	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
ATAD2B	54454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	23980355	23980355	+	Silent	SNP	A	A	G			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr2:23980355A>G	ENST00000238789.5	-	25	4354	c.4011T>C	c.(4009-4011)tgT>tgC	p.C1337C	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	1337						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATTATTGCTACATTCCAGTG	0.383																																					p.C1337C		.											.	ATAD2B	68	0			c.T4011C						.						168.0	159.0	162.0					2																	23980355		1838	4098	5936	SO:0001819	synonymous_variant	54454	exon25			ATTGCTACATTCC	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.4011T>C	2.37:g.23980355A>G		167.0	0.0		160.0	39.0	NM_017552	B9ZVQ5|Q6ZNA6|Q8N9E7	Silent	SNP	ENST00000238789.5	37	CCDS46227.1	.	.	.	.	.	.	.	.	.	.	A	8.117	0.780074	0.16120	.	.	ENSG00000119778	ENST00000381024	.	.	.	5.27	-1.28	0.09318	.	.	.	.	.	T	0.55878	0.1948	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52102	-0.8620	4	.	.	.	.	10.4273	0.44387	0.4544:0.0:0.5456:0.0	.	.	.	.	A	613	.	.	V	-	2	0	ATAD2B	23833859	0.984000	0.35163	0.994000	0.49952	0.966000	0.64601	0.847000	0.27696	-0.131000	0.11578	-0.371000	0.07208	GTA	.		0.383	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552	
ATRNL1	26033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	117075032	117075032	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr10:117075032A>T	ENST00000355044.3	+	18	2949	c.2823A>T	c.(2821-2823)caA>caT	p.Q941H	ATRNL1_ENST00000423111.2_Missense_Mutation_p.Q38H|ATRNL1_ENST00000303745.7_5'UTR	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	941					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		ACGCAGCTCAAAATTGTTCTG	0.363																																					p.Q941H		.											.	ATRNL1	96	0			c.A2823T						.						128.0	116.0	120.0					10																	117075032		2203	4300	6503	SO:0001583	missense	26033	exon18			AGCTCAAAATTGT	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2823A>T	10.37:g.117075032A>T	ENSP00000347152:p.Gln941His	63.0	0.0		71.0	14.0	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	37	CCDS7592.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.49|16.49	3.138174|3.138174	0.56936|0.56936	.|.	.|.	ENSG00000107518|ENSG00000107518	ENST00000526373|ENST00000355044;ENST00000423111	.|T;D	.|0.84730	.|2.48;-1.89	5.47|5.47	0.417|0.417	0.16421|0.16421	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.88085	.|0.6342	M|M	0.67953|0.67953	2.075|2.075	0.80722|0.80722	D|D	1|1	.|D;D	.|0.67145	.|0.996;0.996	.|D;D	.|0.75484	.|0.986;0.986	.|D	.|0.83462	.|0.0054	.|10	.|0.15952	.|T	.|0.53	-11.9019|-11.9019	9.6941|9.6941	0.40147|0.40147	0.5711:0.0:0.4289:0.0|0.5711:0.0:0.4289:0.0	.|.	.|38;941	.|B4DH41;Q5VV63	.|.;ATRN1_HUMAN	X|H	71|941;38	.|ENSP00000347152:Q941H;ENSP00000409624:Q38H	.|ENSP00000347152:Q941H	K|Q	+|+	1|3	0|2	ATRNL1|ATRNL1	117065022|117065022	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.990000|0.990000	0.78478|0.78478	1.004000|1.004000	0.29822|0.29822	0.077000|0.077000	0.16863|0.16863	0.454000|0.454000	0.30748|0.30748	AAA|CAA	.		0.363	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
BATF2	116071	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64757247	64757247	+	Missense_Mutation	SNP	C	C	A	rs374070737		TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr11:64757247C>A	ENST00000301887.4	-	3	309	c.179G>T	c.(178-180)cGg>cTg	p.R60L	BATF2_ENST00000527716.1_Missense_Mutation_p.R36L|BATF2_ENST00000435842.2_5'UTR	NM_138456.3	NP_612465.3	Q8N1L9	BATF2_HUMAN	basic leucine zipper transcription factor, ATF-like 2	60	Leucine-zipper. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				defense response to protozoan (GO:0042832)|myeloid dendritic cell differentiation (GO:0043011)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|skin(1)	9						GATCTCCTTCCGCAGGGCGAG	0.652																																					p.R60L		.											.	BATF2	91	0			c.G179T						.						37.0	37.0	37.0					11																	64757247		2201	4297	6498	SO:0001583	missense	116071	exon3			TCCTTCCGCAGGG	AK092453	CCDS8087.1, CCDS73317.1	11q13.1	2013-01-10			ENSG00000168062	ENSG00000168062		"""basic leucine zipper proteins"""	25163	protein-coding gene	gene with protein product		614983					Standard	NM_138456		Approved	MGC20410	uc001ocf.1	Q8N1L9	OTTHUMG00000165633	ENST00000301887.4:c.179G>T	11.37:g.64757247C>A	ENSP00000301887:p.Arg60Leu	61.0	0.0		59.0	10.0	NM_138456	D9IC56|Q8NAF4|Q8NAL8|Q96EH4	Missense_Mutation	SNP	ENST00000301887.4	37	CCDS8087.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.417424	0.42918	.	.	ENSG00000168062	ENST00000301887;ENST00000527716;ENST00000534177	T;T	0.57907	0.37;0.37	3.62	0.625	0.17665	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.382732	0.18429	N	0.141495	T	0.65739	0.2720	M	0.80183	2.485	0.32888	D	0.511487	D	0.89917	1.0	D	0.87578	0.998	T	0.67860	-0.5561	10	0.87932	D	0	-29.101	2.8463	0.05545	0.2207:0.536:0.0:0.2434	.	60	Q8N1L9	BATF2_HUMAN	L	60;36;59	ENSP00000301887:R60L;ENSP00000435640:R59L	ENSP00000301887:R60L	R	-	2	0	BATF2	64513823	0.987000	0.35691	0.967000	0.41034	0.119000	0.20118	0.196000	0.17176	0.337000	0.23665	-0.347000	0.07816	CGG	.		0.652	BATF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385478.2	NM_138456	
BCR	613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	23656199	23656199	+	Missense_Mutation	SNP	C	C	G	rs200185744		TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr22:23656199C>G	ENST00000305877.8	+	21	4253	c.3502C>G	c.(3502-3504)Ctg>Gtg	p.L1168V	BCR_ENST00000436990.2_3'UTR|BCR_ENST00000359540.3_Missense_Mutation_p.L1124V	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	1168	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	GCTCAACCTGCTGCTGTCCCT	0.607			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																p.L1168V		.		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	.	BCR	1349	0			c.C3502G						.						148.0	134.0	139.0					22																	23656199		2203	4300	6503	SO:0001583	missense	613	exon21			AACCTGCTGCTGT		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.3502C>G	22.37:g.23656199C>G	ENSP00000303507:p.Leu1168Val	36.0	0.0		25.0	7.0	NM_004327	P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	ENST00000305877.8	37	CCDS13806.1	.	.	.	.	.	.	.	.	.	.	.	17.65	3.441507	0.63067	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000334149	T;T	0.21361	2.01;2.01	4.51	4.51	0.55191	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000001	T	0.26846	0.0657	N	0.21142	0.635	0.80722	D	1	D;P;P	0.55605	0.972;0.83;0.927	P;P;P	0.61940	0.896;0.821;0.842	T	0.01648	-1.1304	10	0.49607	T	0.09	.	10.2946	0.43616	0.0:0.896:0.0:0.104	.	757;1124;1168	B4E065;P11274-2;P11274	.;.;BCR_HUMAN	V	1168;1124;833	ENSP00000303507:L1168V;ENSP00000352535:L1124V	ENSP00000303507:L1168V	L	+	1	2	BCR	21986199	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	2.897000	0.48664	2.255000	0.74692	0.455000	0.32223	CTG	C|0.999;T|0.000		0.607	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327	
BRPF1	7862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	9776140	9776140	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr3:9776140C>T	ENST00000457855.1	+	1	327	c.316C>T	c.(316-318)Cgc>Tgc	p.R106C	BRPF1_ENST00000383829.2_Missense_Mutation_p.R106C|BRPF1_ENST00000424362.1_Missense_Mutation_p.R106C|BRPF1_ENST00000302054.3_Missense_Mutation_p.R106C|BRPF1_ENST00000433861.2_Missense_Mutation_p.R106C			P55201	BRPF1_HUMAN	bromodomain and PHD finger containing, 1	106	Interaction with KAT6A and KAT6B.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	49	Medulloblastoma(99;0.227)					CTTGCATGGCCGCGTCCACCG	0.602																																					p.R106C		.											.	BRPF1	92	0			c.C316T						.						106.0	111.0	109.0					3																	9776140		2203	4300	6503	SO:0001583	missense	7862	exon2			CATGGCCGCGTCC	M91585	CCDS2575.1, CCDS33692.1	3p26-p25	2008-07-18			ENSG00000156983	ENSG00000156983			14255	protein-coding gene	gene with protein product	"""peregrin"", ""bromodomain-containing protein, 140kD"""	602410				8946209, 7906940	Standard	NM_001003694		Approved	BR140	uc003bsf.3	P55201	OTTHUMG00000097033	ENST00000457855.1:c.316C>T	3.37:g.9776140C>T	ENSP00000410210:p.Arg106Cys	59.0	0.0		68.0	7.0	NM_001003694	B4DEZ6|Q7Z6E0|Q8TCM6|Q9UHI0	Missense_Mutation	SNP	ENST00000457855.1	37	CCDS2575.1	.	.	.	.	.	.	.	.	.	.	C	32	5.159886	0.94727	.	.	ENSG00000156983	ENST00000433861;ENST00000424362;ENST00000383829;ENST00000302054;ENST00000457855	T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53	5.73	5.73	0.89815	Enhancer of polycomb-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.75199	0.3817	M	0.78049	2.395	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.992;0.992;0.997	T	0.77225	-0.2666	10	0.87932	D	0	.	19.4877	0.95037	0.0:1.0:0.0:0.0	.	106;106;106;106	P55201-4;P55201-3;P55201-2;P55201	.;.;.;BRPF1_HUMAN	C	106	ENSP00000402485:R106C;ENSP00000398863:R106C;ENSP00000373340:R106C;ENSP00000306297:R106C;ENSP00000410210:R106C	ENSP00000306297:R106C	R	+	1	0	BRPF1	9751140	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.446000	0.60014	2.709000	0.92574	0.563000	0.77884	CGC	.		0.602	BRPF1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338485.1	NM_001003694	
BSCL2	26580	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	62458597	62458597	+	Missense_Mutation	SNP	C	C	T	rs144725547		TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr11:62458597C>T	ENST00000403550.1	-	8	1253	c.830G>A	c.(829-831)aGa>aAa	p.R277K	BSCL2_ENST00000407022.3_Missense_Mutation_p.R277K|BSCL2_ENST00000405837.1_Missense_Mutation_p.R341K|LRRN4CL_ENST00000317449.4_5'Flank|BSCL2_ENST00000360796.5_Missense_Mutation_p.R341K|BSCL2_ENST00000421906.1_Missense_Mutation_p.R277K|BSCL2_ENST00000433053.1_Missense_Mutation_p.R341K|BSCL2_ENST00000278893.7_Missense_Mutation_p.E230K|HNRNPUL2-BSCL2_ENST00000403734.2_3'UTR			Q96G97	BSCL2_HUMAN	Berardinelli-Seip congenital lipodystrophy 2 (seipin)	277					cell death (GO:0008219)|fat cell differentiation (GO:0045444)|lipid catabolic process (GO:0016042)|lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|negative regulation of lipid catabolic process (GO:0050995)	integral component of endoplasmic reticulum membrane (GO:0030176)				endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	12						GGAATTGTCTCTTTTTCGGAT	0.517																																					p.R341K		.											.	BSCL2	514	0			c.G1022A						.	C	LYS/ARG,LYS/GLU,LYS/ARG	0,4404		0,0,2202	99.0	86.0	90.0		830,688,1022	3.9	0.0	11	dbSNP_134	90	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense,missense	BSCL2	NM_032667.6,NM_001130702.2,NM_001122955.3	26,56,26	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	277/399,230/288,341/463	62458597	1,13001	2202	4299	6501	SO:0001583	missense	26580	exon8			TTGTCTCTTTTTC		CCDS8031.1, CCDS44627.1, CCDS55769.1	11q13	2014-09-17	2009-07-30		ENSG00000168000	ENSG00000168000			15832	protein-coding gene	gene with protein product		606158	"""spastic paraplegia 17 (Silver syndrome)"""	GNG3LG, SPG17		11479539, 14981520	Standard	NM_001122955		Approved		uc001nur.4	Q96G97	OTTHUMG00000150624	ENST00000403550.1:c.830G>A	11.37:g.62458597C>T	ENSP00000385561:p.Arg277Lys	100.0	0.0		76.0	16.0	NM_001122955	G3XAE4|Q567S1|Q96SV1|Q9BSQ0	Missense_Mutation	SNP	ENST00000403550.1	37	CCDS8031.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.46|12.46	1.945135|1.945135	0.34283|0.34283	0.0|0.0	1.16E-4|1.16E-4	ENSG00000168000|ENSG00000168000	ENST00000278893|ENST00000449636;ENST00000405837;ENST00000433053;ENST00000360796;ENST00000403550;ENST00000407022;ENST00000421906	D|D;D;D;D;D;D	0.88664|0.88975	-2.41|-2.45;-2.43;-2.43;-2.41;-2.41;-2.41	5.01|5.01	3.88|3.88	0.44766|0.44766	.|.	.|0.561612	.|0.16354	.|U	.|0.218064	T|T	0.79329|0.79329	0.4427|0.4427	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|B;B;B	0.02656|0.09022	0.0|0.0;0.002;0.0	B|B;B;B	0.04013|0.06405	0.001|0.001;0.002;0.001	T|T	0.63116|0.63116	-0.6709|-0.6709	8|8	0.72032|.	D|.	0.01|.	-0.0196|-0.0196	9.231|9.231	0.37437|0.37437	0.0:0.8823:0.0:0.1177|0.0:0.8823:0.0:0.1177	.|.	230|277;341;277	Q96G97-3|Q53EN3;G3XAE4;Q96G97	.|.;.;BSCL2_HUMAN	K|K	230|26;341;341;341;277;277;277	ENSP00000278893:E230K|ENSP00000385332:R341K;ENSP00000414002:R341K;ENSP00000354032:R341K;ENSP00000385561:R277K;ENSP00000384080:R277K;ENSP00000413209:R277K	ENSP00000278893:E230K|.	E|R	-|-	1|2	0|0	BSCL2|BSCL2	62215173|62215173	0.001000|0.001000	0.12720|0.12720	0.013000|0.013000	0.15412|0.15412	0.609000|0.609000	0.37215|0.37215	1.139000|1.139000	0.31504|0.31504	2.331000|2.331000	0.79229|0.79229	0.491000|0.491000	0.48974|0.48974	GAG|AGA	C|1.000;T|0.000		0.517	BSCL2-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000319185.1	NM_032667	
C9orf64	84267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	86571248	86571248	+	Silent	SNP	G	G	A	rs560017514		TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr9:86571248G>A	ENST00000376344.3	-	1	384	c.168C>T	c.(166-168)aaC>aaT	p.N56N	C9orf64_ENST00000314700.1_Intron|C9orf64_ENST00000376340.2_5'Flank	NM_032307.3	NP_115683.3	Q5T6V5	CI064_HUMAN	chromosome 9 open reading frame 64	56										central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						CCGCCCTGGGGTTCAGCTCAT	0.647													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16276	0.0		0.0	False		,,,				2504	0.0				p.N56N		.											.	C9orf64	90	0			c.C168T						.						58.0	59.0	59.0					9																	86571248		1992	4158	6150	SO:0001819	synonymous_variant	84267	exon1			CCTGGGGTTCAGC	AK090882	CCDS6666.2	9q22.1	2014-06-11			ENSG00000165118	ENSG00000165118			28144	protein-coding gene	gene with protein product		611342				24911101	Standard	NM_032307		Approved	MGC10999	uc004anb.3	Q5T6V5	OTTHUMG00000020111	ENST00000376344.3:c.168C>T	9.37:g.86571248G>A		54.0	0.0		55.0	8.0	NM_032307	B2RPI6|Q8N2B1|Q9BT18	Silent	SNP	ENST00000376344.3	37	CCDS6666.2																																																																																			.		0.647	C9orf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052865.1	NM_032307	
CACNG2	10369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	37098516	37098516	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr22:37098516A>T	ENST00000300105.6	-	1	1087	c.106T>A	c.(106-108)Tcc>Acc	p.S36T	RP1-293L6.1_ENST00000430281.1_RNA	NM_006078.3	NP_006069.1	Q9Y698	CCG2_HUMAN	calcium channel, voltage-dependent, gamma subunit 2	36					membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|neuromuscular junction development (GO:0007528)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	18						ACCCCTCTGGAGTAGAGCCAA	0.483																																					p.S36T		.											.	CACNG2	90	0			c.T106A						.						232.0	205.0	214.0					22																	37098516		2203	4300	6503	SO:0001583	missense	10369	exon1			CTCTGGAGTAGAG	AF096322	CCDS13931.1	22q13.1	2006-08-01			ENSG00000166862	ENSG00000166862		"""Calcium channel subunits"""	1406	protein-coding gene	gene with protein product		602911					Standard	NM_006078		Approved	stargazin, MGC138502, MGC138504	uc003aps.2	Q9Y698	OTTHUMG00000030612	ENST00000300105.6:c.106T>A	22.37:g.37098516A>T	ENSP00000300105:p.Ser36Thr	174.0	0.0		162.0	32.0	NM_006078	Q2M1M1|Q5TGT3|Q9UGZ7	Missense_Mutation	SNP	ENST00000300105.6	37	CCDS13931.1	.	.	.	.	.	.	.	.	.	.	a	17.39	3.377764	0.61735	.	.	ENSG00000166862	ENST00000300105	D	0.90444	-2.67	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.89660	0.6779	N	0.25789	0.76	0.58432	D	0.999993	D	0.53885	0.963	D	0.67231	0.95	D	0.85636	0.1273	10	0.05525	T	0.97	-16.2417	14.3496	0.66691	1.0:0.0:0.0:0.0	.	36	Q9Y698	CCG2_HUMAN	T	36	ENSP00000300105:S36T	ENSP00000300105:S36T	S	-	1	0	CACNG2	35428462	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.764000	0.91719	1.778000	0.52293	0.446000	0.29264	TCC	.		0.483	CACNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075500.2		
CHML	1122	broad.mit.edu;ucsc.edu	37	1	241798393	241798393	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr1:241798393C>T	ENST00000366553.1	-	1	839	c.676G>A	c.(676-678)Ggc>Agc	p.G226S	OPN3_ENST00000469376.1_Intron|OPN3_ENST00000366554.2_Intron|OPN3_ENST00000331838.5_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	226					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			AACCTCCTGCCTTCTTTAACT	0.318																																					p.G226S		.											.	CHML	96	0			c.G676A						.						122.0	126.0	124.0					1																	241798393		2201	4296	6497	SO:0001583	missense	1122	exon1			TCCTGCCTTCTTT	X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.676G>A	1.37:g.241798393C>T	ENSP00000355511:p.Gly226Ser	99.0	1.0		153.0	22.0	NM_001821	B2RAB9|Q17RE0|Q9H1Y4	Missense_Mutation	SNP	ENST00000366553.1	37	CCDS31073.1	.	.	.	.	.	.	.	.	.	.	C	15.21	2.766868	0.49574	.	.	ENSG00000203668	ENST00000366553	D	0.84800	-1.9	4.86	3.73	0.42828	.	0.108974	0.64402	N	0.000007	T	0.80204	0.4580	.	.	.	0.37676	D	0.923308	B	0.34181	0.44	B	0.43701	0.428	T	0.73817	-0.3863	9	0.16896	T	0.51	-0.7261	6.8142	0.23820	0.0:0.8322:0.0:0.1678	.	226	P26374	RAE2_HUMAN	S	226	ENSP00000355511:G226S	ENSP00000355511:G226S	G	-	1	0	CHML	239865016	0.934000	0.31675	0.998000	0.56505	0.871000	0.50021	0.325000	0.19628	1.114000	0.41781	0.650000	0.86243	GGC	.		0.318	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095712.1	NM_001821	
CHRNE	1145	broad.mit.edu;mdanderson.org	37	17	4802334	4802334	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr17:4802334C>A	ENST00000293780.4	-	11	1298	c.1288G>T	c.(1288-1290)Gtg>Ttg	p.V430L	CHRNE_ENST00000575637.1_5'Flank|C17orf107_ENST00000521575.1_5'Flank|C17orf107_ENST00000381365.3_5'Flank	NM_000080.3	NP_000071.1	Q04844	ACHE_HUMAN	cholinergic receptor, nicotinic, epsilon (muscle)	430					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)	12					Galantamine(DB00674)	CTCTCGGCCACGAAGTTCACG	0.701																																					p.V430L		.											.	CHRNE	90	0			c.G1288T						.						14.0	16.0	15.0					17																	4802334		2202	4297	6499	SO:0001583	missense	1145	exon11			CGGCCACGAAGTT	X66403	CCDS11058.1	17p13.2	2012-02-11	2012-02-07		ENSG00000108556	ENSG00000108556		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1966	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, epsilon (muscle)"""	100725	"""cholinergic receptor, nicotinic, epsilon"""			7688301	Standard	NM_000080		Approved	ACHRE	uc002fzk.1	Q04844	OTTHUMG00000090778	ENST00000293780.4:c.1288G>T	17.37:g.4802334C>A	ENSP00000293780:p.Val430Leu	19.0	0.0		26.0	4.0	NM_000080	D3DTK6	Missense_Mutation	SNP	ENST00000293780.4	37	CCDS11058.1	.	.	.	.	.	.	.	.	.	.	C	16.95	3.264328	0.59431	.	.	ENSG00000108556	ENST00000293780	D	0.85629	-2.01	5.44	-0.29	0.12847	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.348186	0.30781	N	0.008897	T	0.64000	0.2559	N	0.11064	0.09	0.28108	N	0.931135	B	0.14012	0.009	B	0.12837	0.008	T	0.54583	-0.8272	10	0.66056	D	0.02	.	0.9963	0.01468	0.1596:0.3418:0.139:0.3596	.	430	Q04844	ACHE_HUMAN	L	430	ENSP00000293780:V430L	ENSP00000293780:V430L	V	-	1	0	CHRNE	4743113	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	1.767000	0.38501	0.282000	0.22254	-0.140000	0.14226	GTG	.		0.701	CHRNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207560.3		
COBL	23242	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	51287547	51287547	+	Missense_Mutation	SNP	C	C	T	rs566661748		TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr7:51287547C>T	ENST00000265136.7	-	2	301	c.136G>A	c.(136-138)Ggg>Agg	p.G46R	COBL_ENST00000395542.2_Missense_Mutation_p.G46R|COBL_ENST00000395540.2_Missense_Mutation_p.G46R|COBL_ENST00000441453.1_Missense_Mutation_p.G46R	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	46					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					TGCTGCGACCCGAGGGCCCCA	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16046	0.0		0.0	False		,,,				2504	0.0				p.G46R	NSCLC(189;2119 2138 12223 30818 34679)	.											.	COBL	95	0			c.G136A						.						50.0	50.0	50.0					7																	51287547		2203	4300	6503	SO:0001583	missense	23242	exon2			GCGACCCGAGGGC	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.136G>A	7.37:g.51287547C>T	ENSP00000265136:p.Gly46Arg	74.0	0.0		62.0	10.0	NM_015198	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	37	CCDS34637.1	.	.	.	.	.	.	.	.	.	.	C	7.362	0.625104	0.14257	.	.	ENSG00000106078	ENST00000265136;ENST00000395542;ENST00000395540;ENST00000441453;ENST00000449281	T;T	0.11712	2.76;2.75	5.73	-2.45	0.06481	Cordon-bleu domain (1);	0.565367	0.14832	N	0.295802	T	0.05502	0.0145	L	0.47716	1.5	0.09310	N	1	P;B;P;P	0.48350	0.621;0.055;0.909;0.803	B;B;B;B	0.33196	0.12;0.011;0.159;0.129	T	0.45571	-0.9252	10	0.13108	T	0.6	.	6.1535	0.20324	0.0:0.2549:0.1786:0.5664	.	46;46;46;46	O75128-3;O75128-5;O75128-7;O75128	.;.;.;COBL_HUMAN	R	46;46;46;46;30	ENSP00000265136:G46R;ENSP00000378912:G46R	ENSP00000265136:G46R	G	-	1	0	COBL	51255041	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.685000	0.05167	-0.180000	0.10637	-0.345000	0.07892	GGG	.		0.622	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266104	41266104	+	Missense_Mutation	SNP	G	G	A	rs28931589|rs121913416		TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr3:41266104G>A	ENST00000349496.5	+	3	381	c.101G>A	c.(100-102)gGa>gAa	p.G34E	CTNNB1_ENST00000396185.3_Missense_Mutation_p.G34E|CTNNB1_ENST00000396183.3_Missense_Mutation_p.G34E|CTNNB1_ENST00000405570.1_Missense_Mutation_p.G34E|CTNNB1_ENST00000453024.1_Missense_Mutation_p.G27E	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	34			G -> E (in PTR). {ECO:0000269|PubMed:10192393}.|G -> R (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|G -> V (in hepatoblastoma; dbSNP:rs28931589). {ECO:0000269|PubMed:9927029}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.G34E(73)|p.G34V(72)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.A5_I35del(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CTGGACTCTGGAATCCATTCT	0.488	G34E(AGS_STOMACH)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.G34E	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0	CTNNB1	24361	276	Substitution - Missense(145)|Deletion - In frame(105)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(146)|endometrium(30)|large_intestine(27)|stomach(21)|central_nervous_system(20)|skin(8)|pancreas(8)|ovary(6)|small_intestine(2)|lung(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|pituitary(1)|prostate(1)|bone(1)	c.G101A						.						93.0	78.0	83.0					3																	41266104		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACTCTGGAATCCA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.101G>A	3.37:g.41266104G>A	ENSP00000344456:p.Gly34Glu	192.0	0.0		174.0	30.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.678424	0.88542	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74188	-0.3746	10	0.87932	D	0	-31.2232	19.9596	0.97236	0.0:0.0:1.0:0.0	.	34	P35222	CTNB1_HUMAN	E	27;34;34;34;34;27;34;34;34	ENSP00000400508:G27E;ENSP00000385604:G34E;ENSP00000412219:G34E;ENSP00000379486:G34E;ENSP00000344456:G34E;ENSP00000411226:G27E;ENSP00000379488:G34E;ENSP00000409302:G34E;ENSP00000401599:G34E	ENSP00000344456:G34E	G	+	2	0	CTNNB1	41241108	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.726000	0.93360	0.655000	0.94253	GGA	G|1.000;T|0.000		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
DDX46	9879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	134152221	134152221	+	Silent	SNP	T	T	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr5:134152221T>A	ENST00000354283.4	+	19	2673	c.2538T>A	c.(2536-2538)gcT>gcA	p.A846A	DDX46_ENST00000452510.2_Silent_p.A846A			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	846					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CAGGAAATGCTGAGAAATTAG	0.393																																					p.A846A	Colon(13;391 453 4901 21675 24897)	.											.	DDX46	227	0			c.T2538A						.						56.0	60.0	59.0					5																	134152221		2203	4300	6503	SO:0001819	synonymous_variant	9879	exon19			AAATGCTGAGAAA		CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.2538T>A	5.37:g.134152221T>A		69.0	0.0		67.0	12.0	NM_014829	O94894|Q96EI0|Q9Y658	Silent	SNP	ENST00000354283.4	37	CCDS34240.1																																																																																			.		0.393	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371584.1	NM_014829	
DGUOK	1716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	74185303	74185303	+	Silent	SNP	A	A	G			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr2:74185303A>G	ENST00000264093.4	+	6	823	c.738A>G	c.(736-738)ccA>ccG	p.P246P	DGUOK-AS1_ENST00000413452.1_RNA|DGUOK-AS1_ENST00000439192.1_RNA|DGUOK-AS1_ENST00000453103.1_RNA|DGUOK_ENST00000356837.6_Silent_p.P224P|DGUOK_ENST00000462685.1_3'UTR|DGUOK_ENST00000348222.1_Silent_p.P158P	NM_080916.2	NP_550438.1	Q16854	DGUOK_HUMAN	deoxyguanosine kinase	246					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|dGTP metabolic process (GO:0046070)|guanosine metabolic process (GO:0008617)|negative regulation of neuron projection development (GO:0010977)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|protein phosphorylation (GO:0006468)|purine deoxyribonucleoside metabolic process (GO:0046122)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|deoxyguanosine kinase activity (GO:0004138)|nucleoside kinase activity (GO:0019206)			endometrium(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	8					Nelarabine(DB01280)	TGAACATTCCAGTGCTGGTGT	0.423																																					p.P246P		.											.	DGUOK	115	0			c.A738G						.						126.0	121.0	123.0					2																	74185303		2203	4300	6503	SO:0001819	synonymous_variant	1716	exon6			CATTCCAGTGCTG	U41668	CCDS1931.1, CCDS1932.1	2p13	2008-02-05			ENSG00000114956	ENSG00000114956	2.7.1.113		2858	protein-coding gene	gene with protein product		601465					Standard	NM_080916		Approved	dGK	uc002sjx.3	Q16854	OTTHUMG00000129819	ENST00000264093.4:c.738A>G	2.37:g.74185303A>G		147.0	0.0		174.0	36.0	NM_080916	P78532|Q16759|Q4ZG09|Q7L1W9|Q96BC1	Silent	SNP	ENST00000264093.4	37	CCDS1931.1																																																																																			.		0.423	DGUOK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252050.1		
DLC1	10395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	13259101	13259101	+	Missense_Mutation	SNP	G	G	A	rs144283917	byFrequency	TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr8:13259101G>A	ENST00000276297.4	-	3	1460	c.1051C>T	c.(1051-1053)Cgg>Tgg	p.R351W	DLC1_ENST00000511869.1_Missense_Mutation_p.R351W|DLC1_ENST00000316609.5_Missense_Mutation_p.R351W	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	351					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.R351W(2)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						GAGTCCAGCCGCGCCCTATCT	0.448													G|||	2	0.000399361	0.0008	0.0	5008	,	,		17728	0.001		0.0	False		,,,				2504	0.0				p.R351W		.											.	DLC1	657	2	Substitution - Missense(2)	prostate(2)	c.C1051T						.	G	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	144.0	126.0	132.0		1051,1051	4.6	0.9	8	dbSNP_134	132	0,8600		0,0,4300	no	missense,missense	DLC1	NM_024767.3,NM_182643.2	101,101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	351/464,351/1529	13259101	1,13005	2203	4300	6503	SO:0001583	missense	10395	exon3			CCAGCCGCGCCCT	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.1051C>T	8.37:g.13259101G>A	ENSP00000276297:p.Arg351Trp	95.0	0.0		55.0	9.0	NM_182643	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.954015	0.73902	2.27E-4	0.0	ENSG00000164741	ENST00000276297;ENST00000316609;ENST00000511869	T;T;T	0.28069	2.71;1.63;1.68	5.49	4.59	0.56863	.	0.000000	0.38548	N	0.001653	T	0.48589	0.1508	L	0.46157	1.445	0.35472	D	0.797398	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	T	0.62158	-0.6913	10	0.87932	D	0	.	14.1929	0.65649	0.0:0.0:0.8503:0.1496	.	351;351;351	E9PF76;Q96QB1-3;Q96QB1	.;.;RHG07_HUMAN	W	351	ENSP00000276297:R351W;ENSP00000321034:R351W;ENSP00000425878:R351W	ENSP00000276297:R351W	R	-	1	2	DLC1	13303472	1.000000	0.71417	0.890000	0.34922	0.889000	0.51656	3.800000	0.55537	1.413000	0.46997	0.555000	0.69702	CGG	G|1.000;A|0.000		0.448	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
EPSTI1	94240	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	43566129	43566129	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr13:43566129T>C	ENST00000398762.3	-	1	172	c.173A>G	c.(172-174)cAc>cGc	p.H58R	EPSTI1_ENST00000313640.7_Missense_Mutation_p.H58R|EPSTI1_ENST00000476830.2_5'UTR|EPSTI1_ENST00000313624.7_Missense_Mutation_p.H58R			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)	58										endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		CTGGCCCGCGTGCACGACGCT	0.632																																					p.H58R		.											.	EPSTI1	91	0			c.A173G						.						44.0	53.0	50.0					13																	43566129		2196	4286	6482	SO:0001583	missense	94240	exon1			CCCGCGTGCACGA	AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814	ENST00000398762.3:c.173A>G	13.37:g.43566129T>C	ENSP00000381746:p.His58Arg	53.0	1.0		41.0	4.0	NM_001002264	Q8IVC7|Q8NDQ7	Missense_Mutation	SNP	ENST00000398762.3	37	CCDS9387.1	.	.	.	.	.	.	.	.	.	.	T	5.569	0.289843	0.10567	.	.	ENSG00000133106	ENST00000313640;ENST00000313624;ENST00000398762	T	0.20738	2.05	4.48	-8.97	0.00758	.	1.350640	0.04725	N	0.420068	T	0.12646	0.0307	L	0.47716	1.5	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.19451	-1.0305	10	0.21540	T	0.41	1.0105	1.4414	0.02355	0.2879:0.2802:0.292:0.14	.	58;58	Q96J88-2;Q96J88-3	.;.	R	58	ENSP00000318982:H58R	ENSP00000318643:H58R	H	-	2	0	EPSTI1	42464129	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.461000	0.00463	-2.909000	0.00309	0.528000	0.53228	CAC	.		0.632	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400321.1	NM_001002264	
FAM90A1	55138	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	8375287	8375287	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr12:8375287T>C	ENST00000538603.1	-	7	1084	c.526A>G	c.(526-528)Agg>Ggg	p.R176G	FAM90A1_ENST00000307435.6_Missense_Mutation_p.R176G	NM_018088.3	NP_060558.3	Q86YD7	F90A1_HUMAN	family with sequence similarity 90, member A1	176							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	25				Kidney(36;0.0866)		ACGGAGCCCCTGTCAGACATT	0.577																																					p.R176G		.											.	FAM90A1	91	0			c.A526G						.						34.0	49.0	44.0					12																	8375287		2081	3979	6060	SO:0001583	missense	55138	exon7			AGCCCCTGTCAGA	AK001270	CCDS31738.1	12p13.31	2011-08-31		2005-11-20	ENSG00000171847	ENSG00000171847			25526	protein-coding gene	gene with protein product		613041					Standard	NM_018088		Approved	FLJ10408	uc001qui.2	Q86YD7	OTTHUMG00000168641	ENST00000538603.1:c.526A>G	12.37:g.8375287T>C	ENSP00000445418:p.Arg176Gly	23.0	0.0		36.0	5.0	NM_018088	D3DUU9|Q9NVZ6	Missense_Mutation	SNP	ENST00000538603.1	37	CCDS31738.1	.	.	.	.	.	.	.	.	.	.	.	2.957	-0.215463	0.06101	.	.	ENSG00000171847	ENST00000307435;ENST00000538603	T;T	0.13778	2.56;2.56	0.158	0.158	0.14942	.	.	.	.	.	T	0.14270	0.0345	N	0.24115	0.695	0.09310	N	1	D	0.57899	0.981	P	0.56563	0.801	T	0.25537	-1.0129	8	0.30854	T	0.27	24.9965	.	.	.	.	176	Q86YD7	F90A1_HUMAN	G	176	ENSP00000307798:R176G;ENSP00000445418:R176G	ENSP00000307798:R176G	R	-	1	2	FAM90A1	8266554	0.002000	0.14202	0.002000	0.10522	0.010000	0.07245	0.270000	0.18607	0.175000	0.19841	0.172000	0.16884	AGG	.		0.577	FAM90A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400468.1	NM_018088	
FANCI	55215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	89844660	89844660	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr15:89844660C>T	ENST00000310775.7	+	27	3079	c.2993C>T	c.(2992-2994)cCc>cTc	p.P998L	FANCI_ENST00000300027.8_Missense_Mutation_p.P938L	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	998					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					TTACTGGAGCCCTCCTCTCCT	0.413								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.P998L		.											.	FANCI	92	0			c.C2993T						.						145.0	132.0	136.0					15																	89844660		2200	4299	6499	SO:0001583	missense	55215	exon27	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TGGAGCCCTCCTC	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.2993C>T	15.37:g.89844660C>T	ENSP00000310842:p.Pro998Leu	88.0	0.0		94.0	27.0	NM_001113378	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	ENST00000310775.7	37	CCDS45346.1	.	.	.	.	.	.	.	.	.	.	C	31	5.073351	0.94000	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	T;T;T	0.70869	-0.52;-0.49;0.18	5.4	5.4	0.78164	.	0.054186	0.85682	D	0.000000	D	0.82522	0.5055	L	0.61036	1.89	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.984;0.989;0.989	T	0.80605	-0.1308	10	0.36615	T	0.2	-13.2025	19.1729	0.93588	0.0:1.0:0.0:0.0	.	998;938;938	Q9NVI1;Q9NVI1-2;Q9NVI1-1	FANCI_HUMAN;.;.	L	938;998;938	ENSP00000300027:P938L;ENSP00000310842:P998L;ENSP00000413249:P938L	ENSP00000300027:P938L	P	+	2	0	FANCI	87645664	1.000000	0.71417	0.988000	0.46212	0.984000	0.73092	7.278000	0.78587	2.541000	0.85698	0.655000	0.94253	CCC	.		0.413	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421140.1	NM_018193	
GLIS1	148979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	53974802	53974802	+	Missense_Mutation	SNP	G	G	A	rs540910687		TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr1:53974802G>A	ENST00000312233.2	-	9	2262	c.1696C>T	c.(1696-1698)Cct>Tct	p.P566S		NM_147193.2	NP_671726.2			GLIS family zinc finger 1											endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						CCTGTGGCAGGCAAGGGCGTG	0.667																																					p.P566S		.											.	GLIS1	91	0			c.C1696T						.						33.0	28.0	30.0					1																	53974802		2193	4286	6479	SO:0001583	missense	148979	exon9			TGGCAGGCAAGGG	AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.1696C>T	1.37:g.53974802G>A	ENSP00000309653:p.Pro566Ser	39.0	0.0		56.0	9.0	NM_147193		Missense_Mutation	SNP	ENST00000312233.2	37	CCDS582.1	.	.	.	.	.	.	.	.	.	.	G	9.829	1.187991	0.21954	.	.	ENSG00000174332	ENST00000312233	T	0.09630	2.96	3.94	2.01	0.26516	.	0.423149	0.20122	N	0.098788	T	0.04003	0.0112	N	0.12746	0.255	0.24107	N	0.99586	B	0.10296	0.003	B	0.06405	0.002	T	0.43702	-0.9375	10	0.06494	T	0.89	.	3.8607	0.08994	0.234:0.2024:0.5637:0.0	.	566	Q8NBF1	GLIS1_HUMAN	S	566	ENSP00000309653:P566S	ENSP00000309653:P566S	P	-	1	0	GLIS1	53747390	0.996000	0.38824	0.997000	0.53966	0.679000	0.39708	0.547000	0.23299	0.422000	0.26005	0.561000	0.74099	CCT	.		0.667	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022109.1	NM_147193	
GMIP	51291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19745495	19745495	+	Missense_Mutation	SNP	G	G	C			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr19:19745495G>C	ENST00000203556.4	-	18	2042	c.1905C>G	c.(1903-1905)atC>atG	p.I635M	GMIP_ENST00000445806.2_Missense_Mutation_p.I606M|GMIP_ENST00000587238.1_Missense_Mutation_p.I609M|GMIP_ENST00000586269.1_Intron	NM_016573.2	NP_057657.2	Q9P107	GMIP_HUMAN	GEM interacting protein	635	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				intracellular signal transduction (GO:0035556)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						GGTGGAAGGGGATCACGGGCT	0.662																																					p.I635M		.											.	GMIP	91	0			c.C1905G						.						125.0	127.0	126.0					19																	19745495		2203	4300	6503	SO:0001583	missense	51291	exon18			GAAGGGGATCACG	AF132541	CCDS12408.1, CCDS74318.1	19p13.11	2011-09-07				ENSG00000089639		"""Rho GTPase activating proteins"""	24852	protein-coding gene	gene with protein product		609694				12093360, 16086184	Standard	XM_005259927		Approved	ARHGAP46	uc002nnd.3	Q9P107		ENST00000203556.4:c.1905C>G	19.37:g.19745495G>C	ENSP00000203556:p.Ile635Met	81.0	0.0		79.0	8.0	NM_016573	A0AVN9|B7ZLZ0	Missense_Mutation	SNP	ENST00000203556.4	37	CCDS12408.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.627043	0.28978	.	.	ENSG00000089639	ENST00000203556;ENST00000445806	T;T	0.22134	1.97;1.97	4.85	2.66	0.31614	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.413090	0.17679	N	0.165690	T	0.15262	0.0368	L	0.35542	1.07	0.25262	N	0.989587	P;B;P	0.35155	0.487;0.028;0.487	B;B;B	0.37047	0.24;0.065;0.24	T	0.14476	-1.0471	10	0.32370	T	0.25	-13.9627	7.3109	0.26473	0.0911:0.0:0.7409:0.168	.	606;609;635	E7ERB7;B7ZLZ0;Q9P107	.;.;GMIP_HUMAN	M	635;606	ENSP00000203556:I635M;ENSP00000397075:I606M	ENSP00000203556:I635M	I	-	3	3	GMIP	19606495	0.201000	0.23410	1.000000	0.80357	0.993000	0.82548	0.025000	0.13577	0.439000	0.26476	0.561000	0.74099	ATC	.		0.662	GMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460551.1	NM_016573	
GREB1	9687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	11738862	11738862	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr2:11738862C>G	ENST00000381486.2	+	15	2509	c.2209C>G	c.(2209-2211)Cag>Gag	p.Q737E	GREB1_ENST00000234142.5_Missense_Mutation_p.Q737E	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	737						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GAGGGTGGAACAGTATGTTCT	0.453																																					p.Q737E	Ovarian(39;850 945 2785 23371 33093)	.											.	GREB1	91	0			c.C2209G						.						200.0	203.0	202.0					2																	11738862		1986	4174	6160	SO:0001583	missense	9687	exon15			GTGGAACAGTATG		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.2209C>G	2.37:g.11738862C>G	ENSP00000370896:p.Gln737Glu	85.0	0.0		87.0	25.0	NM_014668	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	37	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	C	11.97	1.798630	0.31777	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000432985	T;T;T	0.46451	3.2;3.2;0.87	5.16	5.16	0.70880	.	0.332987	0.29908	N	0.010887	T	0.40909	0.1136	L	0.56769	1.78	0.58432	D	0.999998	P;P	0.41131	0.739;0.604	B;B	0.33454	0.164;0.164	T	0.50206	-0.8855	10	0.66056	D	0.02	-12.7435	18.6712	0.91512	0.0:1.0:0.0:0.0	.	371;737	C9JIG0;Q4ZG55	.;GREB1_HUMAN	E	737;737;371	ENSP00000370896:Q737E;ENSP00000234142:Q737E;ENSP00000403886:Q371E	ENSP00000234142:Q737E	Q	+	1	0	GREB1	11656313	1.000000	0.71417	0.019000	0.16419	0.006000	0.05464	5.547000	0.67249	2.413000	0.81919	0.655000	0.94253	CAG	.		0.453	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
GPR17	2840	ucsc.edu;bcgsc.ca	37	2	128408409	128408409	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr2:128408409T>C	ENST00000272644.3	+	3	258	c.184T>C	c.(184-186)Ttc>Ctc	p.F62L	GPR17_ENST00000393018.3_Missense_Mutation_p.F62L|LIMS2_ENST00000355119.4_Intron|LIMS2_ENST00000409254.1_5'Flank|LIMS2_ENST00000410038.1_5'Flank|LIMS2_ENST00000409808.2_Intron|LIMS2_ENST00000409455.1_Intron|LIMS2_ENST00000545738.2_Intron|GPR17_ENST00000544369.1_Missense_Mutation_p.F62L|LIMS2_ENST00000410011.1_Intron|LIMS2_ENST00000324938.5_Intron|GPR17_ENST00000486700.1_3'UTR	NM_001161416.1|NM_001161417.1|NM_005291.2	NP_001154888.1|NP_001154889.1|NP_005282.1	Q13304	GPR17_HUMAN	G protein-coupled receptor 17	62					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)|urinary_tract(1)	19	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		gaacatgctgttcgcctcctt	0.562											OREG0014966	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F62L		.											.	GPR17	514	0			c.T184C						.						130.0	122.0	125.0					2																	128408409		2203	4300	6503	SO:0001583	missense	2840	exon3			ATGCTGTTCGCCT		CCDS2148.1	2q21	2014-01-30			ENSG00000144230	ENSG00000144230		"""GPCR / Class A : Orphans"""	4471	protein-coding gene	gene with protein product		603071				8558062	Standard	NM_001161415		Approved		uc002tpc.3	Q13304	OTTHUMG00000131533	ENST00000272644.3:c.184T>C	2.37:g.128408409T>C	ENSP00000272644:p.Phe62Leu	60.0	0.0	1564	35.0	4.0	NM_005291	A8K9L0|B2R9X0|Q8N5S7|Q9UDZ6|Q9UE21	Missense_Mutation	SNP	ENST00000272644.3	37	CCDS2148.1	.	.	.	.	.	.	.	.	.	.	t	10.28	1.307704	0.23821	.	.	ENSG00000144230	ENST00000544369;ENST00000339805;ENST00000272644;ENST00000423019;ENST00000393018	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.17	4.02	0.46733	.	0.052823	0.85682	N	0.000000	T	0.12220	0.0297	N	0.08118	0	0.50632	D	0.999886	B	0.06786	0.001	B	0.04013	0.001	T	0.13818	-1.0495	10	0.02654	T	1	.	8.273	0.31855	0.0:0.1539:0.0:0.8461	.	62	Q13304	GPR17_HUMAN	L	62;34;62;62;62	ENSP00000442982:F62L;ENSP00000272644:F62L;ENSP00000387970:F62L;ENSP00000376741:F62L	ENSP00000272644:F62L	F	+	1	0	GPR17	128124879	0.997000	0.39634	0.304000	0.25085	0.981000	0.71138	2.241000	0.43097	0.925000	0.37094	0.533000	0.62120	TTC	.		0.562	GPR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254390.1		
HEY1	23462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	80679323	80679323	+	Missense_Mutation	SNP	A	A	C			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr8:80679323A>C	ENST00000354724.3	-	3	369	c.170T>G	c.(169-171)aTt>aGt	p.I57S	RP11-26J3.1_ENST00000502766.2_lincRNA|HEY1_ENST00000523976.1_5'Flank|RP11-27N21.3_ENST00000607172.1_lincRNA|HEY1_ENST00000435063.2_5'Flank|HEY1_ENST00000337919.5_Missense_Mutation_p.I57S	NM_012258.3	NP_036390.3	Q9Y5J3	HEY1_HUMAN	hes-related family bHLH transcription factor with YRPW motif 1	57	Transcriptional repression and interaction with NCOR1 and SIN3A. {ECO:0000250}.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				angiogenesis (GO:0001525)|anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular valve formation (GO:0003190)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac septum morphogenesis (GO:0060411)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to glucocorticoid stimulus (GO:0071385)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion morphogenesis (GO:0003203)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve morphogenesis (GO:0003184)|regulation of vasculogenesis (GO:2001212)|transcription from RNA polymerase II promoter (GO:0006366)|umbilical cord morphogenesis (GO:0036304)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		HEY1/NCOA2(10)	cervix(1)|kidney(2)|large_intestine(5)|lung(14)	22	all_lung(9;5.1e-05)		Epithelial(68;0.076)|all cancers(69;0.179)			GCGCTTCTCAATTATCTGCAG	0.408			T	NCOA2	mesenchymal chondrosarcoma																																p.I57S		.		Dom	yes		8	8q21	23462	hairy/enhancer-of-split related with YRPW motif 1		M	.	HEY1	658	0			c.T170G						.						79.0	81.0	80.0					8																	80679323		2203	4300	6503	SO:0001583	missense	23462	exon3			TTCTCAATTATCT	AF151522	CCDS6225.1, CCDS43749.1, CCDS64915.1	8q21	2013-10-17	2013-10-17					"""Basic helix-loop-helix proteins"""	4880	protein-coding gene	gene with protein product		602953	"""hairy/enhancer-of-split related with YRPW motif 1"""			10415358, 10403790	Standard	NM_001040708		Approved	HESR-1, CHF2, HESR1, HRT-1, CHF-2, HERP2, BHLHb31	uc003ybl.3	Q9Y5J3		ENST00000354724.3:c.170T>G	8.37:g.80679323A>C	ENSP00000346761:p.Ile57Ser	74.0	0.0		79.0	16.0	NM_012258	B2R883|Q5TZS3|Q8NAM2|Q9NYP4	Missense_Mutation	SNP	ENST00000354724.3	37	CCDS6225.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.145600	0.77888	.	.	ENSG00000164683	ENST00000354724;ENST00000542205;ENST00000337919;ENST00000518733	D;D;D	0.98135	-4.74;-4.74;-4.74	4.67	4.67	0.58626	Helix-loop-helix DNA-binding (5);	0.093833	0.64402	D	0.000001	D	0.98210	0.9408	L	0.61218	1.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99353	1.0915	10	0.87932	D	0	-13.5869	14.1195	0.65177	1.0:0.0:0.0:0.0	.	57;57	Q9Y5J3;Q9Y5J3-2	HEY1_HUMAN;.	S	57;57;57;19	ENSP00000346761:I57S;ENSP00000338272:I57S;ENSP00000429705:I19S	ENSP00000338272:I57S	I	-	2	0	HEY1	80841878	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.924000	0.92827	1.740000	0.51718	0.459000	0.35465	ATT	.		0.408	HEY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000379516.1	NM_012258	
IL18RAP	8807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	103039738	103039738	+	Start_Codon_SNP	SNP	A	A	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr2:103039738A>T	ENST00000264260.2	+	3	590	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	IL18RAP_ENST00000409369.1_De_novo_Start_OutOfFrame	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	1					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						CGGGAGAACAATGCTCTGTTT	0.418																																					p.M1L		.											.	IL18RAP	95	0			c.A1T						.						256.0	246.0	249.0					2																	103039738		2203	4300	6503	SO:0001582	initiator_codon_variant	8807	exon3			AGAACAATGCTCT	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.1A>T	2.37:g.103039738A>T	ENSP00000264260:p.Met1Leu	195.0	0.0		185.0	44.0	NM_003853	B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	ENST00000264260.2	37	CCDS2061.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.423221	0.83559	.	.	ENSG00000115607	ENST00000264260;ENST00000450855	T	0.02525	4.26	5.6	5.6	0.85130	.	0.141713	0.50627	D	0.000103	T	0.03608	0.0103	.	.	.	0.80722	D	1	B	0.29378	0.243	B	0.23716	0.048	T	0.44467	-0.9326	9	0.87932	D	0	.	12.4534	0.55688	1.0:0.0:0.0:0.0	.	1	O95256	I18RA_HUMAN	L	1	ENSP00000264260:M1L	ENSP00000264260:M1L	M	+	1	0	IL18RAP	102406170	0.954000	0.32549	0.018000	0.16275	0.499000	0.33736	4.194000	0.58393	2.259000	0.74868	0.482000	0.46254	ATG	.		0.418	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253291.2	NM_003853	Missense_Mutation
IL2RB	3560	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	37524431	37524431	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr22:37524431C>T	ENST00000216223.5	-	10	1559	c.1361G>A	c.(1360-1362)aGg>aAg	p.R454K		NM_000878.3	NP_000869.1	P14784	IL2RB_HUMAN	interleukin 2 receptor, beta	454					cytokine-mediated signaling pathway (GO:0019221)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of apoptotic process (GO:0043066)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-2 binding (GO:0019976)|interleukin-2 receptor activity (GO:0004911)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(5)	23					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	AGGGGGCATCCTCTCTTCACC	0.662																																					p.R454K		.											.	IL2RB	90	0			c.G1361A						.						11.0	13.0	13.0					22																	37524431		2081	4116	6197	SO:0001583	missense	3560	exon10			GGCATCCTCTCTT	M26062	CCDS13942.1	22q13	2011-02-15			ENSG00000100385	ENSG00000100385		"""Interleukins and interleukin receptors"", ""CD molecules"""	6009	protein-coding gene	gene with protein product		146710	"""interleukin 15 receptor, beta"""	IL15RB			Standard	NM_000878		Approved	CD122	uc003aqv.1	P14784	OTTHUMG00000150534	ENST00000216223.5:c.1361G>A	22.37:g.37524431C>T	ENSP00000216223:p.Arg454Lys	25.0	0.0		32.0	8.0	NM_000878	B2R765	Missense_Mutation	SNP	ENST00000216223.5	37	CCDS13942.1	.	.	.	.	.	.	.	.	.	.	C	8.146	0.786378	0.16189	.	.	ENSG00000100385	ENST00000216223	T	0.08193	3.12	4.55	-1.13	0.09775	.	6.192590	0.00974	N	0.003289	T	0.03651	0.0104	N	0.05510	-0.035	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.33445	-0.9868	10	0.11794	T	0.64	-13.4104	0.3876	0.00405	0.1871:0.2786:0.1844:0.3498	.	454	P14784	IL2RB_HUMAN	K	454	ENSP00000216223:R454K	ENSP00000216223:R454K	R	-	2	0	IL2RB	35854377	0.000000	0.05858	0.025000	0.17156	0.078000	0.17371	-0.316000	0.08071	0.226000	0.20979	0.655000	0.94253	AGG	.		0.662	IL2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318792.1		
KCP	375616	broad.mit.edu;ucsc.edu;mdanderson.org	37	7	128517710	128517710	+	RNA	SNP	G	G	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr7:128517710G>A	ENST00000476647.2	-	0	4488							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						CAGCATGGCAGCGACTGAATG	0.652																																					.		.											.	KCP	68	0			.						.						109.0	138.0	129.0					7																	128517710		692	1591	2283			375616	.			ATGGCAGCGACTG	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128517710G>A		117.0	0.0		103.0	30.0	.	Q8NBE0	RNA	SNP	ENST00000476647.2	37																																																																																				.		0.652	KCP-006	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000403051.1	NM_199349	
KIF1C	10749	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	4923807	4923807	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr17:4923807A>G	ENST00000320785.5	+	20	2128	c.1771A>G	c.(1771-1773)Aag>Gag	p.K591E	KIF1C_ENST00000573815.1_3'UTR|AC109333.10_ENST00000438266.1_RNA	NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	591					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						TGTGATGGGCAAGAACCACGT	0.572																																					p.K591E	Melanoma(96;1023 1447 10250 19259 33730)	.											.	KIF1C	92	0			c.A1771G						.						41.0	41.0	41.0					17																	4923807		2203	4300	6503	SO:0001583	missense	10749	exon20			ATGGGCAAGAACC	U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.1771A>G	17.37:g.4923807A>G	ENSP00000320821:p.Lys591Glu	50.0	0.0		61.0	10.0	NM_006612	D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	ENST00000320785.5	37	CCDS11065.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.138866	0.77775	.	.	ENSG00000129250	ENST00000320785	T	0.77229	-1.08	5.68	5.68	0.88126	Forkhead-associated (FHA) domain (1);SMAD/FHA domain (1);	.	.	.	.	D	0.87513	0.6196	M	0.82056	2.57	0.58432	D	0.999998	D	0.63880	0.993	D	0.70935	0.971	D	0.87897	0.2688	9	0.46703	T	0.11	.	13.8941	0.63761	1.0:0.0:0.0:0.0	.	591	O43896	KIF1C_HUMAN	E	591	ENSP00000320821:K591E	ENSP00000320821:K591E	K	+	1	0	KIF1C	4864531	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.248000	0.95456	2.168000	0.68352	0.533000	0.62120	AAG	.		0.572	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216916.1		
L3MBTL3	84456	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	130455007	130455007	+	Missense_Mutation	SNP	G	G	C			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr6:130455007G>C	ENST00000529410.1	+	24	2635	c.2156G>C	c.(2155-2157)aGc>aCc	p.S719T	L3MBTL3_ENST00000533560.1_Missense_Mutation_p.S694T|RP11-73O6.3_ENST00000591297.1_RNA|RP11-73O6.3_ENST00000415964.1_RNA|L3MBTL3_ENST00000368139.2_Missense_Mutation_p.S694T|L3MBTL3_ENST00000368136.2_Missense_Mutation_p.S719T|L3MBTL3_ENST00000526019.1_Missense_Mutation_p.S694T|RP11-73O6.3_ENST00000609978.1_RNA|L3MBTL3_ENST00000361794.2_Missense_Mutation_p.S719T			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	719	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		TTTATACAGAGCTTACCTGGG	0.338																																					p.S719T		.											.	L3MBTL3	96	0			c.G2156C						.						114.0	108.0	110.0					6																	130455007		2203	4300	6503	SO:0001583	missense	84456	exon22			TACAGAGCTTACC	AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.2156G>C	6.37:g.130455007G>C	ENSP00000431962:p.Ser719Thr	62.0	0.0		30.0	6.0	NM_032438	Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	ENST00000529410.1	37	CCDS34537.1	.	.	.	.	.	.	.	.	.	.	G	9.528	1.109998	0.20714	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	T;T;T;T;T;T	0.56444	0.46;0.46;0.46;0.46;0.46;0.46	5.37	4.48	0.54585	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.537613	0.21802	N	0.068903	T	0.22205	0.0535	N	0.20986	0.625	0.28057	N	0.933143	P;B	0.45474	0.859;0.379	P;B	0.44394	0.448;0.241	T	0.12863	-1.0531	10	0.10902	T	0.67	.	14.1835	0.65590	0.0:0.15:0.85:0.0	.	694;719	Q96JM7-2;Q96JM7	.;LMBL3_HUMAN	T	719;694;719;694;694;719	ENSP00000431962:S719T;ENSP00000437185:S694T;ENSP00000354526:S719T;ENSP00000357121:S694T;ENSP00000436706:S694T;ENSP00000357118:S719T	ENSP00000354526:S719T	S	+	2	0	L3MBTL3	130496700	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.591000	0.46163	1.357000	0.45904	0.561000	0.74099	AGC	.		0.338	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042195.2	XM_027074	
METTL10	399818	broad.mit.edu;bcgsc.ca	37	10	126454118	126454118	+	Silent	SNP	T	T	C			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr10:126454118T>C	ENST00000368836.2	-	5	495	c.459A>G	c.(457-459)aaA>aaG	p.K153K	Y_RNA_ENST00000362596.1_RNA|RP11-12J10.3_ENST00000494792.1_Missense_Mutation_p.K118R	NM_212554.2	NP_997719.2	Q5JPI9	MET10_HUMAN	methyltransferase like 10	153							methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5		all_lung(145;0.0186)|Lung NSC(174;0.0295)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.101)|COAD - Colon adenocarcinoma(40;0.111)		CAAAAGTCCCTTTGTCAATAC	0.353																																					p.K153K		.											.	METTL10	22	0			c.A459G						.						90.0	89.0	89.0					10																	126454118		2203	4300	6503	SO:0001819	synonymous_variant	399818	exon5			AGTCCCTTTGTCA		CCDS31307.1	10q26.13	2010-01-15			ENSG00000203791	ENSG00000203791			33787	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 138"""	C10orf138			Standard	NM_212554		Approved	Em:AC068896.3	uc001lhy.1	Q5JPI9	OTTHUMG00000019217	ENST00000368836.2:c.459A>G	10.37:g.126454118T>C		102.0	0.0		113.0	5.0	NM_212554	A8MPY7	Silent	SNP	ENST00000368836.2	37	CCDS31307.1																																																																																			.		0.353	METTL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050884.1	NM_212554	
MMP2	4313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	55517934	55517934	+	Silent	SNP	T	T	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr16:55517934T>A	ENST00000219070.4	+	3	896	c.387T>A	c.(385-387)atT>atA	p.I129I	MMP2_ENST00000570308.1_Silent_p.I53I|MMP2_ENST00000437642.2_Silent_p.I79I|MMP2_ENST00000543485.1_Silent_p.I53I	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	129	Collagenase-like 1.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	CCAGGATCATTGGCTACACAC	0.478																																					p.I129I		.											.	MMP2	1149	0			c.T387A						.						197.0	151.0	166.0					16																	55517934		2198	4300	6498	SO:0001819	synonymous_variant	4313	exon3			GATCATTGGCTAC		CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.387T>A	16.37:g.55517934T>A		72.0	0.0		80.0	21.0	NM_004530	B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Silent	SNP	ENST00000219070.4	37	CCDS10752.1																																																																																			.		0.478	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256913.3		
MRPS24	64951	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	43906467	43906467	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr7:43906467C>T	ENST00000317534.5	-	4	396	c.335G>A	c.(334-336)cGc>cAc	p.R112H	URGCP-MRPS24_ENST00000603700.1_3'UTR|MRPS24_ENST00000467084.1_5'UTR	NM_032014.2	NP_114403.1	Q96EL2	RT24_HUMAN	mitochondrial ribosomal protein S24	112					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrial small ribosomal subunit (GO:0005763)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	5						GTTACCCCGGCGCTTTAAAAC	0.557																																					p.R112H		.											.	MRPS24	90	0			c.G335A						.						66.0	62.0	63.0					7																	43906467		2203	4300	6503	SO:0001583	missense	64951	exon4			CCCCGGCGCTTTA	AB061207	CCDS5473.1	7p14	2012-09-13			ENSG00000062582	ENSG00000062582		"""Mitochondrial ribosomal proteins / small subunits"""	14510	protein-coding gene	gene with protein product		611986				8127713, 11279123	Standard	NM_032014		Approved	MRP-S24, HSPC335	uc003tit.1	Q96EL2	OTTHUMG00000023175	ENST00000317534.5:c.335G>A	7.37:g.43906467C>T	ENSP00000318158:p.Arg112His	41.0	0.0		52.0	11.0	NM_032014	A4D1U9|P82668|Q96Q23|Q9P047	Missense_Mutation	SNP	ENST00000317534.5	37	CCDS5473.1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.747046	0.69418	.	.	ENSG00000062582	ENST00000317534	T	0.63417	-0.04	5.0	4.12	0.48240	.	0.000000	0.85682	D	0.000000	T	0.79381	0.4436	M	0.89601	3.045	0.80722	D	1	D	0.76494	0.999	P	0.62014	0.897	T	0.82723	-0.0316	10	0.87932	D	0	-12.1142	11.1372	0.48381	0.0:0.9091:0.0:0.0909	.	112	Q96EL2	RT24_HUMAN	H	112	ENSP00000318158:R112H	ENSP00000318158:R112H	R	-	2	0	MRPS24	43872992	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	7.099000	0.76981	1.110000	0.41699	-0.136000	0.14681	CGC	.		0.557	MRPS24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250949.1	NM_032014	
MYBPC3	4607	broad.mit.edu;bcgsc.ca	37	11	47368980	47368980	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr11:47368980T>C	ENST00000545968.1	-	9	956	c.902A>G	c.(901-903)aAg>aGg	p.K301R	MYBPC3_ENST00000399249.2_Missense_Mutation_p.K301R|MYBPC3_ENST00000256993.4_Missense_Mutation_p.K301R	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	301					cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		GACTCACCTCTTTTTCAGCAG	0.572																																					p.K301R		.											.	MYBPC3	92	0			c.A902G						.						37.0	39.0	38.0					11																	47368980		2006	4187	6193	SO:0001583	missense	4607	exon9			CACCTCTTTTTCA	X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.902A>G	11.37:g.47368980T>C	ENSP00000442795:p.Lys301Arg	57.0	0.0		51.0	4.0	NM_000256	A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	ENST00000545968.1	37	CCDS53621.1	.	.	.	.	.	.	.	.	.	.	t	15.21	2.766052	0.49574	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.64085	-0.08;-0.07;0.0	4.15	4.15	0.48705	.	.	.	.	.	T	0.55049	0.1896	L	0.52266	1.64	0.52501	D	0.999956	B	0.24258	0.1	B	0.26310	0.068	T	0.51236	-0.8731	9	0.21540	T	0.41	.	13.0232	0.58800	0.0:0.0:0.0:1.0	.	301	Q14896	MYPC3_HUMAN	R	301	ENSP00000442795:K301R;ENSP00000382193:K301R;ENSP00000256993:K301R	ENSP00000256993:K301R	K	-	2	0	MYBPC3	47325556	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.271000	0.78506	1.750000	0.51863	0.449000	0.29647	AAG	.		0.572	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392271.3		
N4BP2L2	10443	broad.mit.edu;bcgsc.ca	37	13	33110778	33110778	+	Silent	SNP	T	T	C			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr13:33110778T>C	ENST00000267068.3	-	2	551	c.387A>G	c.(385-387)aaA>aaG	p.K129K	N4BP2L2_ENST00000399396.3_Intron|N4BP2L2_ENST00000446957.2_Silent_p.K129K|N4BP2L2_ENST00000504114.1_Intron|N4BP2L2_ENST00000357505.6_Intron	NM_014887.2	NP_055702.1	Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	129					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)			kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		TCTCAGGGGGTTTGTAAATGG	0.388																																					p.K129K		.											.	N4BP2L2	68	0			c.A387G						.						158.0	167.0	164.0					13																	33110778		2203	4300	6503	SO:0001819	synonymous_variant	10443	exon2			AGGGGGTTTGTAA	U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000267068.3:c.387A>G	13.37:g.33110778T>C		139.0	0.0		110.0	5.0	NM_014887	A3KME8	Silent	SNP	ENST00000267068.3	37	CCDS9346.1																																																																																			.		0.388	N4BP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044421.1	NM_014887	
NAGA	4668	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	42456385	42456385	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr22:42456385A>T	ENST00000396398.3	-	9	1666	c.1134T>A	c.(1132-1134)agT>agA	p.S378R	NAGA_ENST00000402937.1_Missense_Mutation_p.S378R|NAGA_ENST00000403363.1_Missense_Mutation_p.S378R	NM_000262.2	NP_000253.1	P17050	NAGAB_HUMAN	N-acetylgalactosaminidase, alpha-	378					carbohydrate catabolic process (GO:0016052)|glycolipid catabolic process (GO:0019377)|glycoside catabolic process (GO:0016139)|glycosylceramide catabolic process (GO:0046477)|oligosaccharide metabolic process (GO:0009311)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-galactosidase activity (GO:0004557)|alpha-N-acetylgalactosaminidase activity (GO:0008456)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	11						CTCGGAGGCCACTGATGATGT	0.562																																					p.S378R		.											.	NAGA	90	0			c.T1134A						.						176.0	156.0	163.0					22																	42456385		2203	4300	6503	SO:0001583	missense	4668	exon9			GAGGCCACTGATG		CCDS14030.1	22q13.2	2010-07-09			ENSG00000198951	ENSG00000198951	3.2.1.49		7631	protein-coding gene	gene with protein product		104170					Standard	NM_000262		Approved	D22S674	uc003bbw.4	P17050	OTTHUMG00000151276	ENST00000396398.3:c.1134T>A	22.37:g.42456385A>T	ENSP00000379680:p.Ser378Arg	45.0	0.0		32.0	5.0	NM_000262		Missense_Mutation	SNP	ENST00000396398.3	37	CCDS14030.1	.	.	.	.	.	.	.	.	.	.	A	4.988	0.183418	0.09495	.	.	ENSG00000198951	ENST00000396398;ENST00000403363;ENST00000402937	D;D;D	0.89196	-2.48;-2.48;-2.48	5.07	-1.38	0.09027	Glycosyl hydrolase, family 13, all-beta (1);	0.268128	0.44483	D	0.000460	D	0.83533	0.5275	M	0.70595	2.14	0.21782	N	0.999548	B	0.06786	0.001	B	0.08055	0.003	T	0.72883	-0.4157	10	0.62326	D	0.03	-9.9902	3.9995	0.09574	0.4354:0.0:0.317:0.2475	.	378	P17050	NAGAB_HUMAN	R	378	ENSP00000379680:S378R;ENSP00000385283:S378R;ENSP00000384603:S378R	ENSP00000379680:S378R	S	-	3	2	NAGA	40786331	0.000000	0.05858	0.345000	0.25642	0.105000	0.19272	-1.146000	0.03191	-0.308000	0.08792	0.482000	0.46254	AGT	.		0.562	NAGA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322056.1		
NFATC4	4776	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24843036	24843036	+	Silent	SNP	C	C	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr14:24843036C>A	ENST00000250373.4	+	5	1836	c.1695C>A	c.(1693-1695)gtC>gtA	p.V565V	NFATC4_ENST00000413692.2_Silent_p.V628V|NFATC4_ENST00000555453.1_Silent_p.V553V|NFATC4_ENST00000556279.1_Silent_p.V597V|NFATC4_ENST00000554473.1_Silent_p.V100V|NFATC4_ENST00000554661.1_Silent_p.V495V|NFATC4_ENST00000553469.1_Silent_p.V597V|NFATC4_ENST00000554591.1_Silent_p.V628V|NFATC4_ENST00000555802.1_5'Flank|NFATC4_ENST00000557767.1_5'Flank|NFATC4_ENST00000554050.1_Silent_p.V565V|NFATC4_ENST00000553708.1_Silent_p.V565V|NFATC4_ENST00000555590.1_Silent_p.V578V|NFATC4_ENST00000554966.1_Silent_p.V578V|NFATC4_ENST00000422617.3_Silent_p.V553V|NFATC4_ENST00000556169.1_Silent_p.V553V|NFATC4_ENST00000553879.1_Silent_p.V495V|NFATC4_ENST00000555167.1_Silent_p.V100V|NFATC4_ENST00000539237.2_Silent_p.V597V|NFATC4_ENST00000424781.2_Silent_p.V578V|NFATC4_ENST00000557451.1_Silent_p.V495V|NFATC4_ENST00000556759.1_Silent_p.V100V|NFATC4_ENST00000555393.1_5'Flank|NFATC4_ENST00000554344.1_Silent_p.V495V	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	565	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		GCGGGAAGGTCGTCTCAGTAC	0.587																																					p.V628V		.											.	NFATC4	92	0			c.C1884A						.						75.0	67.0	69.0					14																	24843036		2203	4300	6503	SO:0001819	synonymous_variant	4776	exon6			GAAGGTCGTCTCA	BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.1695C>A	14.37:g.24843036C>A		70.0	1.0		59.0	12.0	NM_001198967	B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Silent	SNP	ENST00000250373.4	37	CCDS9629.1																																																																																			.		0.587	NFATC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073206.6	NM_004554	
NLRX1	79671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	119044251	119044251	+	Missense_Mutation	SNP	G	G	A	rs548995927		TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr11:119044251G>A	ENST00000409109.1	+	5	880	c.293G>A	c.(292-294)cGc>cAc	p.R98H	NLRX1_ENST00000409991.1_Missense_Mutation_p.R98H|NLRX1_ENST00000525863.1_Missense_Mutation_p.R98H|NLRX1_ENST00000409265.4_Missense_Mutation_p.R98H|NLRX1_ENST00000292199.2_Missense_Mutation_p.R98H|NLRX1_ENST00000474751.2_3'UTR	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1	98	Required for interaction with MAVS.				innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)			cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		AGGGAGGAGCGCCAGTTTGGC	0.617																																					p.R98H		.											.	NLRX1	92	0			c.G293A						.						59.0	59.0	59.0					11																	119044251		2200	4295	6495	SO:0001583	missense	79671	exon5			AGGAGCGCCAGTT	AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.293G>A	11.37:g.119044251G>A	ENSP00000387334:p.Arg98His	41.0	0.0		40.0	9.0	NM_024618	A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Missense_Mutation	SNP	ENST00000409109.1	37	CCDS8416.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.135233	0.56828	.	.	ENSG00000160703	ENST00000454811;ENST00000449394;ENST00000422249;ENST00000409991;ENST00000292199;ENST00000409265;ENST00000409109;ENST00000525863	T;T;T;T;T;T;T;T	0.71817	1.09;1.09;1.1;-0.51;-0.51;-0.6;-0.51;-0.6	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000007	T	0.62913	0.2467	L	0.32530	0.975	0.47476	D	0.999432	B;B	0.25667	0.131;0.042	B;B	0.22880	0.042;0.013	T	0.60697	-0.7212	10	0.52906	T	0.07	.	17.3764	0.87392	0.0:0.0:1.0:0.0	.	98;98	Q86UT6-2;Q86UT6	.;NLRX1_HUMAN	H	98	ENSP00000400268:R98H;ENSP00000402801:R98H;ENSP00000402381:R98H;ENSP00000386851:R98H;ENSP00000292199:R98H;ENSP00000386858:R98H;ENSP00000387334:R98H;ENSP00000433442:R98H	ENSP00000292199:R98H	R	+	2	0	NLRX1	118549461	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.818000	0.62657	2.637000	0.89404	0.561000	0.74099	CGC	.		0.617	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335403.1	NM_170722	
NPY2R	4887	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	156135479	156135479	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr4:156135479C>A	ENST00000329476.3	+	2	877	c.388C>A	c.(388-390)Cag>Aag	p.Q130K	NPY2R_ENST00000506608.1_Missense_Mutation_p.Q130K	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	130					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	GCCCTATGCCCAGGGCCTGGC	0.527																																					p.Q130K		.											.	NPY2R	523	0			c.C388A						.						62.0	61.0	61.0					4																	156135479		2203	4300	6503	SO:0001583	missense	4887	exon2			TATGCCCAGGGCC	U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.388C>A	4.37:g.156135479C>A	ENSP00000332591:p.Gln130Lys	42.0	1.0		47.0	6.0	NM_000910	Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	ENST00000329476.3	37	CCDS3791.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.575732	0.86645	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	T;T	0.37752	1.18;1.18	5.44	5.44	0.79542	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.65626	0.2709	M	0.87682	2.9	0.80722	D	1	D	0.69078	0.997	D	0.65773	0.938	T	0.71310	-0.4631	10	0.72032	D	0.01	.	18.6168	0.91305	0.0:1.0:0.0:0.0	.	130	P49146	NPY2R_HUMAN	K	130	ENSP00000332591:Q130K;ENSP00000426366:Q130K	ENSP00000332591:Q130K	Q	+	1	0	NPY2R	156354929	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.776000	0.85560	2.709000	0.92574	0.643000	0.83706	CAG	.		0.527	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910	
NUDT11	55190	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	51238814	51238814	+	Missense_Mutation	SNP	A	A	C			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chrX:51238814A>C	ENST00000375992.3	-	1	634	c.483T>G	c.(481-483)gaT>gaG	p.D161E		NM_018159.3	NP_060629.2	Q96G61	NUD11_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 11	161					inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)	diphosphoinositol-polyphosphate diphosphatase activity (GO:0008486)|inositol diphosphate tetrakisphosphate diphosphatase activity (GO:0052840)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 1-diphosphatase activity (GO:0052846)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052847)|inositol-1-diphosphate-2,3,4,5,6-pentakisphosphate diphosphatase activity (GO:0052843)|inositol-3,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052848)|inositol-3-diphosphate-1,2,4,5,6-pentakisphosphate diphosphatase activity (GO:0052844)|inositol-5-diphosphate-1,2,3,4,6-pentakisphosphate diphosphatase activity (GO:0052845)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	9	Ovarian(276;0.236)					AGGGATCGCTATCTGGCGAGG	0.572										HNSCC(48;0.14)																											p.D161E	GBM(38;198 791 1498 11752 13599)	.											.	NUDT11	130	0			c.T483G						.						49.0	51.0	50.0					X																	51238814		2202	4299	6501	SO:0001583	missense	55190	exon1			ATCGCTATCTGGC	AK001490	CCDS43952.1	Xp11.22-p11.1	2014-05-20			ENSG00000196368	ENSG00000196368		"""Nudix motif containing"""	18011	protein-coding gene	gene with protein product						12105228	Standard	NM_018159		Approved	DIPP3b, FLJ10628, hDIPP3beta	uc010njt.3	Q96G61	OTTHUMG00000021531	ENST00000375992.3:c.483T>G	X.37:g.51238814A>C	ENSP00000365160:p.Asp161Glu	173.0	1.0		234.0	134.0	NM_018159	Q9NVN0	Missense_Mutation	SNP	ENST00000375992.3	37	CCDS43952.1	.	.	.	.	.	.	.	.	.	.	A	3.962	-0.010127	0.07727	.	.	ENSG00000196368	ENST00000375992	T	0.29655	1.56	3.25	-5.4	0.02656	.	0.842308	0.10621	N	0.653294	T	0.14614	0.0353	L	0.36672	1.1	0.20638	N	0.999876	B	0.09022	0.002	B	0.04013	0.001	T	0.41324	-0.9515	9	0.07644	T	0.81	-31.7994	3.5269	0.07762	0.149:0.3229:0.4137:0.1143	.	161	Q96G61	NUD11_HUMAN	E	161	ENSP00000365160:D161E	ENSP00000365160:D161E	D	-	3	2	NUDT11	51255554	0.012000	0.17670	0.000000	0.03702	0.394000	0.30568	-0.269000	0.08596	-1.368000	0.02149	-0.471000	0.05019	GAT	.		0.572	NUDT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056579.1		
PALMD	54873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	100154970	100154970	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr1:100154970C>G	ENST00000263174.4	+	7	1529	c.1154C>G	c.(1153-1155)tCa>tGa	p.S385*	PALMD_ENST00000605497.1_Nonsense_Mutation_p.S385*	NM_017734.4	NP_060204.1	Q9NP74	PALMD_HUMAN	palmdelphin	385				S -> L (in Ref. 4; CAC01335). {ECO:0000305}.	regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(6)|pancreas(1)|prostate(2)	31		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)		CAGAATTCTTCACCCACTTGT	0.448																																					p.S385X		.											.	PALMD	71	0			c.C1154G						.						54.0	46.0	49.0					1																	100154970		2203	4300	6503	SO:0001587	stop_gained	54873	exon7			ATTCTTCACCCAC	AJ312214	CCDS758.1	1p22-p21	2008-07-18			ENSG00000099260	ENSG00000099260			15846	protein-coding gene	gene with protein product		610182		C1orf11		11478809	Standard	NM_017734		Approved	FLJ20271, PALML	uc001dsg.3	Q9NP74	OTTHUMG00000010764	ENST00000263174.4:c.1154C>G	1.37:g.100154970C>G	ENSP00000263174:p.Ser385*	88.0	0.0		77.0	19.0	NM_017734	Q9H7E6|Q9NPM5|Q9NPM6|Q9NPS0	Nonsense_Mutation	SNP	ENST00000263174.4	37	CCDS758.1	.	.	.	.	.	.	.	.	.	.	C	33	5.274693	0.95459	.	.	ENSG00000099260	ENST00000263174	.	.	.	5.68	3.77	0.43336	.	0.813719	0.11449	N	0.562931	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-0.221	6.9823	0.24709	0.1311:0.6738:0.1265:0.0687	.	.	.	.	X	385	.	ENSP00000263174:S385X	S	+	2	0	PALMD	99927558	0.001000	0.12720	0.013000	0.15412	0.042000	0.13812	0.996000	0.29719	0.702000	0.31825	-0.253000	0.11424	TCA	.		0.448	PALMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029672.1	NM_017734	
PDE6A	5145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	149324082	149324082	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr5:149324082G>A	ENST00000255266.5	-	1	274	c.155C>T	c.(154-156)cCg>cTg	p.P52L		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	52					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	CATGCTGCTCGGGGAGTGGTA	0.517																																					p.P52L		.											.	PDE6A	92	0			c.C155T						.						62.0	60.0	61.0					5																	149324082		2203	4300	6503	SO:0001583	missense	5145	exon1			CTGCTCGGGGAGT		CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.155C>T	5.37:g.149324082G>A	ENSP00000255266:p.Pro52Leu	59.0	0.0		48.0	9.0	NM_000440	Q0P638	Missense_Mutation	SNP	ENST00000255266.5	37	CCDS4299.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.262729	0.00262	.	.	ENSG00000132915	ENST00000255266	T	0.57907	0.37	5.47	2.87	0.33458	.	1.746250	0.03262	N	0.183402	T	0.16685	0.0401	N	0.00179	-1.91	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.45308	-0.9270	10	0.02654	T	1	.	7.1312	0.25502	0.7419:0.0:0.2581:0.0	.	52	P16499	PDE6A_HUMAN	L	52	ENSP00000255266:P52L	ENSP00000255266:P52L	P	-	2	0	PDE6A	149304275	1.000000	0.71417	0.287000	0.24848	0.191000	0.23601	4.943000	0.63554	0.366000	0.24427	-1.069000	0.02264	CCG	.		0.517	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252326.2		
PER2	8864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	239161713	239161713	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr2:239161713C>A	ENST00000254657.3	-	19	3230	c.2951G>T	c.(2950-2952)cGc>cTc	p.R984L	AC096574.4_ENST00000456601.1_RNA|PER2_ENST00000254658.3_3'UTR	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	984	Interaction with PPARG. {ECO:0000250|UniProtKB:O54943}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		CGAGCTGCTGCGGGACTGAAA	0.677																																					p.R984L		.											.	PER2	154	0			c.G2951T						.						35.0	38.0	37.0					2																	239161713		2203	4299	6502	SO:0001583	missense	8864	exon19			CTGCTGCGGGACT	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.2951G>T	2.37:g.239161713C>A	ENSP00000254657:p.Arg984Leu	61.0	0.0		56.0	14.0	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	37	CCDS2528.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.522094	0.64747	.	.	ENSG00000132326	ENST00000254657	T	0.29917	1.55	4.64	4.64	0.57946	.	0.055536	0.64402	N	0.000001	T	0.60907	0.2305	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.69003	-0.5260	10	0.72032	D	0.01	-18.9691	15.3952	0.74787	0.0:1.0:0.0:0.0	.	984;984	B4DH14;O15055	.;PER2_HUMAN	L	984	ENSP00000254657:R984L	ENSP00000254657:R984L	R	-	2	0	PER2	238826452	1.000000	0.71417	0.915000	0.36163	0.075000	0.17131	5.419000	0.66435	2.290000	0.77057	0.655000	0.94253	CGC	.		0.677	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
PLA2G4A	5321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	186880477	186880477	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr1:186880477C>T	ENST00000367466.3	+	7	666	c.514C>T	c.(514-516)Ctc>Ttc	p.L172F	PLA2G4A_ENST00000442353.2_Intron|PLA2G4A_ENST00000466600.1_3'UTR	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	172	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.|Phospholipid binding. {ECO:0000305}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	CATGAAGAAACTCTTGGGTCC	0.393																																					p.L172F		.											.	PLA2G4A	721	0			c.C514T						.						132.0	136.0	135.0					1																	186880477		2203	4300	6503	SO:0001583	missense	5321	exon7			AAGAAACTCTTGG	M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.514C>T	1.37:g.186880477C>T	ENSP00000356436:p.Leu172Phe	124.0	0.0		133.0	24.0	NM_024420	B1AKG4|Q29R80	Missense_Mutation	SNP	ENST00000367466.3	37	CCDS1372.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.884991	0.33255	.	.	ENSG00000116711	ENST00000367466	T	0.04360	3.64	4.94	4.03	0.46877	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.119689	0.56097	N	0.000023	T	0.04452	0.0122	N	0.25825	0.765	0.80722	D	1	B	0.12013	0.005	B	0.10450	0.005	T	0.40794	-0.9544	10	0.42905	T	0.14	-11.2159	11.5527	0.50729	0.0:0.9108:0.0:0.0892	.	172	P47712	PA24A_HUMAN	F	172	ENSP00000356436:L172F	ENSP00000356436:L172F	L	+	1	0	PLA2G4A	185147100	1.000000	0.71417	1.000000	0.80357	0.684000	0.39900	1.416000	0.34759	1.200000	0.43188	-0.157000	0.13467	CTC	.		0.393	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086236.1	NM_024420	
PPM1H	57460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	63195713	63195713	+	Silent	SNP	G	G	A	rs201542231		TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr12:63195713G>A	ENST00000228705.6	-	3	939	c.639C>T	c.(637-639)cgC>cgT	p.R213R		NM_020700.1	NP_065751.1	Q9ULR3	PPM1H_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1H	213	PP2C-like.						phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)	18			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		CCACCCCTCCGCGCAGGGAGG	0.677													G|||	1	0.000199681	0.0	0.0	5008	,	,		14244	0.001		0.0	False		,,,				2504	0.0				p.R213R		.											.	PPM1H	637	0			c.C639T						.	G		0,3790		0,0,1895	27.0	33.0	31.0		639	-0.1	1.0	12		31	1,8185		0,1,4092	no	coding-synonymous	PPM1H	NM_020700.1		0,1,5987	AA,AG,GG		0.0122,0.0,0.0084		213/515	63195713	1,11975	1895	4093	5988	SO:0001819	synonymous_variant	57460	exon3			CCCTCCGCGCAGG	AB032983	CCDS44934.1	12q14.1	2012-04-17	2010-03-05	2004-03-26	ENSG00000111110	ENSG00000111110	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	18583	protein-coding gene	gene with protein product	"""neurite extension-related protein phosphatase related to PP2C"""		"""ras homolog gene family, member C like 1"", ""protein phosphatase 1H (PP2C domain containing)"""	ARHCL1			Standard	NM_020700		Approved	KIAA1157, FLJ13253, NERPP-2C	uc001srk.3	Q9ULR3	OTTHUMG00000169990	ENST00000228705.6:c.639C>T	12.37:g.63195713G>A		21.0	0.0		14.0	7.0	NM_020700	B1Q2A9|B2RXG4|Q6PI86	Silent	SNP	ENST00000228705.6	37	CCDS44934.1																																																																																			G|0.999;A|0.000		0.677	PPM1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406760.2	NM_020700	
PPP5C	5536	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	46890688	46890688	+	Silent	SNP	G	G	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr19:46890688G>A	ENST00000012443.4	+	9	1216	c.1113G>A	c.(1111-1113)cgG>cgA	p.R371R	PPP5C_ENST00000391919.1_Silent_p.R243R	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	371	Catalytic.				cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		AAATTGAGCGGAATCGACAAC	0.622																																					p.R371R		.											.	PPP5C	227	0			c.G1113A						.						76.0	62.0	67.0					19																	46890688		2203	4300	6503	SO:0001819	synonymous_variant	5536	exon9			TGAGCGGAATCGA		CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.1113G>A	19.37:g.46890688G>A		44.0	0.0		47.0	13.0	NM_006247	Q16722|Q53XV2	Silent	SNP	ENST00000012443.4	37	CCDS12684.1																																																																																			.		0.622	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258969.2	NM_006247	
PTPRT	11122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	40944364	40944364	+	Splice_Site	SNP	C	C	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr20:40944364C>T	ENST00000373187.1	-	12	2137	c.2138G>A	c.(2137-2139)gGa>gAa	p.G713E	PTPRT_ENST00000373190.1_Splice_Site_p.G713E|PTPRT_ENST00000356100.2_Splice_Site_p.G713E|PTPRT_ENST00000373201.1_Splice_Site_p.G713E|PTPRT_ENST00000373193.3_Splice_Site_p.G713E|PTPRT_ENST00000373184.1_Splice_Site_p.G713E|PTPRT_ENST00000373198.4_Splice_Site_p.G713E			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	713	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CATACTTACTCCATTGGCTTT	0.458																																					p.G713E		.											.	PTPRT	664	0			c.G2138A						.						70.0	67.0	68.0					20																	40944364		1943	4139	6082	SO:0001630	splice_region_variant	11122	exon12			CTTACTCCATTGG	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2139+1G>A	20.37:g.40944364C>T		110.0	0.0		86.0	13.0	NM_007050	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.162735	0.78226	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.35421	1.33;1.32;1.32;1.33;1.31;1.36;1.35	5.82	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.64046	0.2563	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.77557	0.99;0.967	T	0.71354	-0.4618	10	0.87932	D	0	.	16.3453	0.83126	0.1331:0.8669:0.0:0.0	.	713;713	O14522-1;O14522	.;PTPRT_HUMAN	E	713	ENSP00000362286:G713E;ENSP00000362283:G713E;ENSP00000362289:G713E;ENSP00000348408:G713E;ENSP00000362294:G713E;ENSP00000362280:G713E;ENSP00000362297:G713E	ENSP00000348408:G713E	G	-	2	0	PTPRT	40377778	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.060000	0.71141	1.440000	0.47531	0.655000	0.94253	GGA	.		0.458	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		Missense_Mutation
PREX1	57580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	47307560	47307560	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr20:47307560C>A	ENST00000371941.3	-	9	1133	c.1111G>T	c.(1111-1113)Gtc>Ttc	p.V371F	PREX1_ENST00000396220.1_Missense_Mutation_p.V371F	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	371	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GCCATGCAGACAAACCACTTA	0.592																																					p.V371F		.											.	PREX1	231	0			c.G1111T						.						181.0	137.0	152.0					20																	47307560		2203	4300	6503	SO:0001583	missense	57580	exon9			TGCAGACAAACCA	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.1111G>T	20.37:g.47307560C>A	ENSP00000361009:p.Val371Phe	131.0	0.0		132.0	30.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402320	0.83230	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	D;D	0.88277	-2.36;-2.36	5.32	5.32	0.75619	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.48767	U	0.000165	D	0.94016	0.8083	M	0.67625	2.065	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94449	0.7665	10	0.87932	D	0	.	19.0098	0.92868	0.0:1.0:0.0:0.0	.	371	Q8TCU6	PREX1_HUMAN	F	371	ENSP00000361009:V371F;ENSP00000379522:V371F	ENSP00000361009:V371F	V	-	1	0	PREX1	46740967	1.000000	0.71417	0.988000	0.46212	0.374000	0.29953	7.818000	0.86416	2.491000	0.84063	0.655000	0.94253	GTC	.		0.592	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
PYGM	5837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64522286	64522286	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr11:64522286C>T	ENST00000164139.3	-	8	1276	c.878G>A	c.(877-879)cGg>cAg	p.R293Q	PYGM_ENST00000377432.3_Missense_Mutation_p.R205Q|PYGM_ENST00000462303.1_5'Flank	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	293					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CTGCTTCAGCCGCAGCTCCTT	0.622																																					p.R293Q		.											.	PYGM	92	0			c.G878A						.						72.0	58.0	63.0					11																	64522286		2201	4297	6498	SO:0001583	missense	5837	exon8			TTCAGCCGCAGCT		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.878G>A	11.37:g.64522286C>T	ENSP00000164139:p.Arg293Gln	38.0	0.0		29.0	8.0	NM_005609	A0AVK1|A6NDY6	Missense_Mutation	SNP	ENST00000164139.3	37	CCDS8079.1	.	.	.	.	.	.	.	.	.	.	C	37	6.060709	0.97246	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.98028	-3.89;-4.67	4.89	4.89	0.63831	.	0.000000	0.49305	D	0.000149	D	0.99074	0.9682	H	0.97587	4.035	0.80722	D	1	D;D	0.76494	0.998;0.999	P;P	0.61477	0.889;0.844	D	0.99116	1.0848	10	0.87932	D	0	-29.6636	15.5838	0.76465	0.0:1.0:0.0:0.0	.	205;293	A6NDY6;P11217	.;PYGM_HUMAN	Q	205;293;274	ENSP00000366650:R205Q;ENSP00000164139:R293Q	ENSP00000164139:R293Q	R	-	2	0	PYGM	64278862	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.651000	0.83577	2.551000	0.86045	0.561000	0.74099	CGG	.		0.622	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2	NM_005609	
RB1CC1	9821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	53536345	53536345	+	Silent	SNP	T	T	C	rs145350535		TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr8:53536345T>C	ENST00000025008.5	-	24	5305	c.4782A>G	c.(4780-4782)gtA>gtG	p.V1594V	RB1CC1_ENST00000539297.1_Silent_p.V1591V|RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000435644.2_Silent_p.V1591V	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1594					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				CCATAAGTTATACTTTCTTAT	0.348																																					p.V1594V	GBM(180;1701 2102 13475 42023 52570)	.											.	RB1CC1	170	0			c.A4782G						.	C	,	1,4405	2.1+/-5.4	0,1,2202	70.0	70.0	70.0		4773,4782	2.8	1.0	8	dbSNP_134	70	0,8596		0,0,4298	no	coding-synonymous,coding-synonymous	RB1CC1	NM_001083617.1,NM_014781.4	,	0,1,6500	CC,CT,TT		0.0,0.0227,0.0077	,	1591/1592,1594/1595	53536345	1,13001	2203	4298	6501	SO:0001819	synonymous_variant	9821	exon24			AAGTTATACTTTC	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.4782A>G	8.37:g.53536345T>C		72.0	0.0		99.0	19.0	NM_014781	Q86YR4|Q8WVU9|Q92601	Silent	SNP	ENST00000025008.5	37	CCDS34892.1																																																																																			T|1.000;C|0.000		0.348	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
RPP30	10556	broad.mit.edu;bcgsc.ca	37	10	92635370	92635370	+	Splice_Site	SNP	A	A	G			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr10:92635370A>G	ENST00000371703.3	+	3	465	c.194A>G	c.(193-195)cAg>cGg	p.Q65R	RPP30_ENST00000413330.1_Splice_Site_p.Q65R	NM_006413.4	NP_006404.1	P78346	RPP30_HUMAN	ribonuclease P/MRP 30kDa subunit	65				Q -> R (in Ref. 3; AK225532). {ECO:0000305}.	RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ribonuclease P activity (GO:0004526)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	8						CCAATTGTACAGGTAGGTGTT	0.338																																					p.Q65R		.											.	RPP30	226	0			c.A194G						.						179.0	184.0	182.0					10																	92635370		2203	4300	6503	SO:0001630	splice_region_variant	10556	exon3			TTGTACAGGTAGG	BC006991	CCDS7411.1, CCDS44458.1	10q23.32-q23.33	2012-05-21			ENSG00000148688	ENSG00000148688			17688	protein-coding gene	gene with protein product		606115				9037013, 9308968	Standard	NM_006413		Approved	TSG15	uc001khd.2	P78346	OTTHUMG00000018733	ENST00000371703.3:c.195+1A>G	10.37:g.92635370A>G		111.0	0.0		109.0	5.0	NM_006413	B2R799|E9PB02	Missense_Mutation	SNP	ENST00000371703.3	37	CCDS7411.1	.	.	.	.	.	.	.	.	.	.	A	19.89	3.910180	0.72983	.	.	ENSG00000148688	ENST00000371703;ENST00000413330;ENST00000371705;ENST00000277882;ENST00000414836	T;T;T	0.44083	0.93;0.93;0.94	5.69	5.69	0.88448	Polymerase/histidinol phosphatase-like (1);	0.000000	0.85682	D	0.000000	T	0.54175	0.1842	M	0.63428	1.95	0.53688	D	0.999977	P;D;D	0.54601	0.932;0.967;0.967	P;P;P	0.53185	0.645;0.605;0.72	T	0.58109	-0.7694	10	0.66056	D	0.02	-22.7006	14.9226	0.70851	1.0:0.0:0.0:0.0	.	65;65;65	B4DJR3;P78346;E9PB02	.;RPP30_HUMAN;.	R	65;65;65;87;19	ENSP00000360768:Q65R;ENSP00000389182:Q65R;ENSP00000277882:Q87R	ENSP00000277882:Q87R	Q	+	2	0	RPP30	92625350	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	3.201000	0.51059	2.156000	0.67533	0.533000	0.62120	CAG	.		0.338	RPP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049347.1	NM_006413	Missense_Mutation
SCN5A	6331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38597244	38597244	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr3:38597244C>A	ENST00000333535.4	-	26	4594	c.4445G>T	c.(4444-4446)gGc>gTc	p.G1482V	SCN5A_ENST00000425664.1_Missense_Mutation_p.G1464V|SCN5A_ENST00000449557.2_Missense_Mutation_p.G1428V|SCN5A_ENST00000414099.2_Missense_Mutation_p.G1464V|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000443581.1_Missense_Mutation_p.G1481V|SCN5A_ENST00000450102.2_Missense_Mutation_p.G1428V|SCN5A_ENST00000451551.2_Missense_Mutation_p.G1428V|SCN5A_ENST00000413689.1_Missense_Mutation_p.G1482V|SCN5A_ENST00000423572.2_Missense_Mutation_p.G1481V|SCN5A_ENST00000455624.2_Missense_Mutation_p.G1481V			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1482					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GATGTCCTGGCCCCCTAAGTG	0.567																																					p.G1482V		.											.	SCN5A	98	0			c.G4445T						.						85.0	92.0	89.0					3																	38597244		2203	4300	6503	SO:0001583	missense	6331	exon26			TCCTGGCCCCCTA	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.4445G>T	3.37:g.38597244C>A	ENSP00000328968:p.Gly1482Val	122.0	0.0		116.0	14.0	NM_198056	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.942477	0.73672	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.96967	-4.04;-4.05;-4.05;-4.08;-4.05;-4.04;-4.05;-4.19;-4.08;-4.08	4.47	3.6	0.41247	.	0.048825	0.85682	D	0.000000	D	0.98460	0.9487	H	0.94264	3.515	0.80722	D	1	D;D;D;D;D;B	0.89917	1.0;1.0;1.0;0.998;1.0;0.388	D;D;D;D;D;B	0.97110	0.995;0.999;0.998;0.972;1.0;0.203	D	0.99094	1.0841	10	0.87932	D	0	.	12.7104	0.57086	0.0:0.9199:0.0:0.0801	.	1428;1481;1464;1482;1481;1482	E9PEF3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;SCN5A_HUMAN;.;.	V	1464;1481;1482;1428;1481;1464;1482;1481;1428;1428	ENSP00000398962:G1464V;ENSP00000398266:G1481V;ENSP00000410257:G1482V;ENSP00000388797:G1428V;ENSP00000397915:G1481V;ENSP00000416634:G1464V;ENSP00000328968:G1482V;ENSP00000399524:G1481V;ENSP00000403355:G1428V;ENSP00000413996:G1428V	ENSP00000328968:G1482V	G	-	2	0	SCN5A	38572248	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.606000	0.82863	1.112000	0.41740	0.644000	0.83932	GGC	.		0.567	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
SDS	10993	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	113834987	113834988	+	Frame_Shift_Ins	INS	-	-	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr12:113834987_113834988insT	ENST00000257549.4	-	6	757_758	c.635_636insA	c.(634-636)tccfs	p.S212fs		NM_006843.2	NP_006834.2	P20132	SDHL_HUMAN	serine dehydratase	212					gluconeogenesis (GO:0006094)|L-serine catabolic process (GO:0006565)|pyruvate biosynthetic process (GO:0042866)|response to amino acid (GO:0043200)|response to cobalamin (GO:0033590)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	L-serine ammonia-lyase activity (GO:0003941)|L-threonine ammonia-lyase activity (GO:0004794)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			large_intestine(2)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(1)	11					L-Serine(DB00133)	TCTTGGGCAGGGAGACAAGTTT	0.629																																					p.S212fs		.											.	SDS	91	0			c.636_637insA						.																																			SO:0001589	frameshift_variant	10993	exon6			GGGCAGGGAGACA	J05037	CCDS9169.1	12q24.13	2014-06-24			ENSG00000135094	ENSG00000135094	4.3.1.17		10691	protein-coding gene	gene with protein product	"""L-serine ammonia-lyase"""	182128				2674117	Standard	NM_006843		Approved	SDH	uc001tvg.3	P20132	OTTHUMG00000169554	ENST00000257549.4:c.635_636insA	12.37:g.113834987_113834988insT	ENSP00000257549:p.Ser212fs	84.0	0.0		69.0	12.0	NM_006843	A8K9P5	Frame_Shift_Ins	INS	ENST00000257549.4	37	CCDS9169.1																																																																																			.		0.629	SDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404790.1	NM_006843	
SEMA3A	10371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	83592651	83592651	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr7:83592651C>T	ENST00000265362.4	-	16	2044	c.1730G>A	c.(1729-1731)gGc>gAc	p.G577D	SEMA3A_ENST00000436949.1_Missense_Mutation_p.G577D	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	577					apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						AGGGCTGTGGCCATGGTGATT	0.398																																					p.G577D		.											.	SEMA3A	156	0			c.G1730A						.						96.0	92.0	93.0					7																	83592651		2203	4300	6503	SO:0001583	missense	10371	exon16			CTGTGGCCATGGT	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1730G>A	7.37:g.83592651C>T	ENSP00000265362:p.Gly577Asp	75.0	0.0		62.0	10.0	NM_006080		Missense_Mutation	SNP	ENST00000265362.4	37	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	C	8.717	0.913383	0.17907	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.27890	1.64;1.64	5.96	3.18	0.36537	.	0.763914	0.12855	N	0.433563	T	0.24275	0.0588	L	0.50333	1.59	0.45806	D	0.998687	B	0.26512	0.151	B	0.27715	0.082	T	0.03017	-1.1082	10	0.12103	T	0.63	.	6.308	0.21149	0.1325:0.6786:0.0:0.1888	.	577	Q14563	SEM3A_HUMAN	D	577	ENSP00000265362:G577D;ENSP00000415260:G577D	ENSP00000265362:G577D	G	-	2	0	SEMA3A	83430587	0.992000	0.36948	0.984000	0.44739	0.833000	0.47200	3.027000	0.49697	0.417000	0.25871	0.585000	0.79938	GGC	.		0.398	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
SLC2A6	11182	bcgsc.ca;mdanderson.org	37	9	136340664	136340664	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr9:136340664A>G	ENST00000371899.4	-	5	709	c.632T>C	c.(631-633)cTc>cCc	p.L211P	SLC2A6_ENST00000485978.1_5'UTR|SLC2A6_ENST00000371897.4_Missense_Mutation_p.L211P	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	211					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		CATGAAGCTGAGCAGCAGGAT	0.711																																					p.L211P		.											.	SLC2A6	90	0			c.T632C						.						20.0	21.0	20.0					9																	136340664		2198	4295	6493	SO:0001583	missense	11182	exon5			AAGCTGAGCAGCA	AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.632T>C	9.37:g.136340664A>G	ENSP00000360966:p.Leu211Pro	20.0	0.0		13.0	3.0	NM_017585	A6NNU6|Q5SXD7|Q8NCC2	Missense_Mutation	SNP	ENST00000371899.4	37	CCDS6975.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.588456	0.86851	.	.	ENSG00000160326	ENST00000371897;ENST00000371899	T;T	0.61627	0.09;0.09	5.22	5.22	0.72569	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.79370	0.4434	M	0.89287	3.02	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.83661	0.0161	10	0.72032	D	0.01	.	14.2759	0.66179	1.0:0.0:0.0:0.0	.	211;211	Q9UGQ3-2;Q9UGQ3	.;GTR6_HUMAN	P	211	ENSP00000360964:L211P;ENSP00000360966:L211P	ENSP00000360964:L211P	L	-	2	0	SLC2A6	135330485	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.189000	0.72051	1.968000	0.57251	0.459000	0.35465	CTC	.		0.711	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054909.1	NM_017585	
SLIT1	6585	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	98761962	98761962	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr10:98761962G>A	ENST00000266058.4	-	36	4564	c.4319C>T	c.(4318-4320)gCa>gTa	p.A1440V	SLIT1_ENST00000371070.4_Intron|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	1440	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		CACACAGTGTGCCCCCTTGGT	0.677																																					p.A1440V		.											.	SLIT1	94	0			c.C4319T						.						10.0	11.0	11.0					10																	98761962		2183	4282	6465	SO:0001583	missense	6585	exon36			CAGTGTGCCCCCT	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.4319C>T	10.37:g.98761962G>A	ENSP00000266058:p.Ala1440Val	43.0	0.0		35.0	9.0	NM_003061	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	37	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	G	16.85	3.235884	0.58886	.	.	ENSG00000187122	ENST00000266058	T	0.81163	-1.46	4.92	3.08	0.35506	Follistatin-like, N-terminal (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.289141	0.37261	N	0.002172	T	0.70561	0.3238	L	0.47190	1.495	0.80722	D	1	P	0.39665	0.682	B	0.35413	0.202	T	0.64841	-0.6312	10	0.27785	T	0.31	.	10.5431	0.45045	0.1545:0.0:0.8455:0.0	.	1440	O75093	SLIT1_HUMAN	V	1440	ENSP00000266058:A1440V	ENSP00000266058:A1440V	A	-	2	0	SLIT1	98751952	0.990000	0.36364	0.876000	0.34364	0.988000	0.76386	4.345000	0.59360	0.673000	0.31224	0.561000	0.74099	GCA	.		0.677	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	
SPATA13	221178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	24798144	24798144	+	Intron	SNP	C	C	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr13:24798144C>T	ENST00000382095.4	+	2	185				RP11-307N16.6_ENST00000382141.4_Silent_p.D359D|SPATA13_ENST00000424834.2_Silent_p.D359D|SPATA13_ENST00000382108.3_Silent_p.D359D	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13						cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		GGCTGCATGACGACTACTCCC	0.672																																					p.D359D		.											.	SPATA13	229	0			c.C1077T						.						14.0	20.0	18.0					13																	24798144		692	1590	2282	SO:0001627	intron_variant	221178	exon2			GCATGACGACTAC	AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.-222-25471C>T	13.37:g.24798144C>T		29.0	0.0		34.0	11.0	NM_001166271	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Silent	SNP	ENST00000382095.4	37	CCDS9305.1	.	.	.	.	.	.	.	.	.	.	C	2.779	-0.253857	0.05829	.	.	ENSG00000182957	ENST00000424834	.	.	.	4.68	-0.709	0.11237	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.9277	0.41503	0.0:0.4233:0.0:0.5767	.	.	.	.	X	397	.	.	R	+	1	2	SPATA13	23696144	0.013000	0.17824	0.800000	0.32199	0.175000	0.22909	-1.432000	0.02430	-0.589000	0.05874	-0.361000	0.07541	CGA	.		0.672	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044180.2	NM_153023	
SPEG	10290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	220326612	220326612	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr2:220326612A>G	ENST00000312358.7	+	7	2581	c.2449A>G	c.(2449-2451)Aca>Gca	p.T817A	SPEG_ENST00000396695.2_Missense_Mutation_p.T25A|SPEG_ENST00000396686.1_5'UTR|SPEG_ENST00000396698.1_Missense_Mutation_p.T713A|SPEG_ENST00000485813.1_3'UTR|SPEG_ENST00000396688.1_5'UTR|SPEG_ENST00000396689.2_5'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	817					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		AGGTGGGTCTACATCCCCTTT	0.632																																					p.T817A		.											.	SPEG	383	0			c.A2449G						.						73.0	82.0	79.0					2																	220326612		2013	4189	6202	SO:0001583	missense	10290	exon7			GGGTCTACATCCC	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2449A>G	2.37:g.220326612A>G	ENSP00000311684:p.Thr817Ala	76.0	0.0		75.0	15.0	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	A	6.684	0.494829	0.12702	.	.	ENSG00000072195	ENST00000312358;ENST00000265327;ENST00000396698;ENST00000396695	T;T;T	0.64618	-0.11;0.26;0.71	5.3	-2.07	0.07276	.	0.769546	0.11051	N	0.605041	T	0.35128	0.0921	N	0.14661	0.345	0.09310	N	1	B;B;B	0.14012	0.0;0.006;0.009	B;B;B	0.11329	0.0;0.001;0.006	T	0.16689	-1.0394	10	0.16896	T	0.51	.	4.0769	0.09908	0.3991:0.0:0.2018:0.3991	.	817;25;713	Q15772;Q15772-3;B9ZVR7	SPEG_HUMAN;.;.	A	817;817;713;25	ENSP00000311684:T817A;ENSP00000379926:T713A;ENSP00000379923:T25A	ENSP00000265327:T817A	T	+	1	0	SPEG	220034856	0.014000	0.17966	0.812000	0.32479	0.055000	0.15305	0.191000	0.17076	-0.721000	0.04929	-2.877000	0.00098	ACA	.		0.632	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
SPTAN1	6709	broad.mit.edu;mdanderson.org	37	9	131386761	131386761	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr9:131386761G>T	ENST00000372731.4	+	45	6082	c.5972G>T	c.(5971-5973)tGg>tTg	p.W1991L	SPTAN1_ENST00000358161.5_Missense_Mutation_p.W1996L|SPTAN1_ENST00000372739.3_Missense_Mutation_p.W1996L	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1991					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						GTGGAGTCCTGGATCGGTGAG	0.547																																					p.W1996L	NSCLC(120;833 1744 2558 35612 37579)	.											.	SPTAN1	158	0			c.G5987T						.						54.0	45.0	48.0					9																	131386761		2203	4300	6503	SO:0001583	missense	6709	exon46			AGTCCTGGATCGG	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.5972G>T	9.37:g.131386761G>T	ENSP00000361816:p.Trp1991Leu	25.0	0.0		27.0	7.0	NM_001130438	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.401264	0.83120	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719;ENST00000372721	T;T;T	0.70164	-0.46;-0.46;-0.46	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.87585	0.6214	H	0.94964	3.605	0.80722	D	1	D;D;D	0.89917	1.0;0.981;0.985	D;D;D	0.91635	0.999;0.954;0.973	D	0.90548	0.4507	10	0.87932	D	0	.	19.5707	0.95413	0.0:0.0:1.0:0.0	.	1971;1996;1991	Q13813-3;Q13813-2;Q13813	.;.;SPTA2_HUMAN	L	1996;1991;1996;1971;240	ENSP00000350882:W1996L;ENSP00000361816:W1991L;ENSP00000361824:W1996L	ENSP00000350882:W1996L	W	+	2	0	SPTAN1	130426582	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.420000	0.97426	2.709000	0.92574	0.655000	0.94253	TGG	.		0.547	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
TBC1D7	51256	broad.mit.edu;mdanderson.org	37	6	13321159	13321159	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr6:13321159C>A	ENST00000379300.3	-	4	605	c.362G>T	c.(361-363)cGa>cTa	p.R121L	TBC1D7_ENST00000607658.1_Missense_Mutation_p.R94L|TBC1D7_ENST00000356436.4_Missense_Mutation_p.R121L|TBC1D7_ENST00000343141.4_Missense_Mutation_p.R121L|TBC1D7_ENST00000379307.2_Missense_Mutation_p.R94L|TBC1D7_ENST00000607532.1_5'UTR	NM_001143964.2|NM_016495.4	NP_001137436.1|NP_057579.1	Q9P0N9	TBCD7_HUMAN	TBC1 domain family, member 7	121	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				activation of Rho GTPase activity (GO:0032862)|negative regulation of cilium assembly (GO:1902018)|negative regulation of TOR signaling (GO:0032007)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of Rab GTPase activity (GO:0032851)|response to growth factor (GO:0070848)	ciliary basal body (GO:0036064)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)	22	Breast(50;0.0296)|Ovarian(93;0.0339)	all_hematologic(90;0.135)	Epithelial(50;0.0784)|BRCA - Breast invasive adenocarcinoma(129;0.13)|all cancers(50;0.21)			AGAGGGACTTCGAGGTAACTT	0.488																																					p.R121L		.											.	TBC1D7	91	0			c.G362T						.						191.0	167.0	176.0					6																	13321159		2203	4300	6503	SO:0001583	missense	51256	exon4			GGACTTCGAGGTA	AF151073	CCDS4523.1, CCDS47376.1, CCDS58995.1	6p23	2013-07-10			ENSG00000145979	ENSG00000145979			21066	protein-coding gene	gene with protein product		612655				11042152, 17646400	Standard	XM_005249163		Approved	dJ257A7.3, FLJ32666	uc003nan.3	Q9P0N9	OTTHUMG00000014272	ENST00000379300.3:c.362G>T	6.37:g.13321159C>A	ENSP00000368602:p.Arg121Leu	37.0	0.0		41.0	7.0	NM_001143965	E7EV96|Q2TU37|Q53F44|Q5SZL7|Q86VM8|Q96MB8	Missense_Mutation	SNP	ENST00000379300.3	37	CCDS4523.1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.289570	0.40494	.	.	ENSG00000145979	ENST00000334971;ENST00000421203;ENST00000356436;ENST00000379300;ENST00000379307;ENST00000343141;ENST00000452989;ENST00000450347;ENST00000422136;ENST00000446018;ENST00000420456;ENST00000428109;ENST00000416436;ENST00000379291	T;T;T;T;T;T;T;T;T;T;T;T;T	0.50001	2.33;2.33;2.33;1.53;1.47;1.53;1.53;2.33;1.53;1.54;2.33;2.33;0.76	5.85	4.03	0.46877	Rab-GAP/TBC domain (1);	0.177468	0.51477	N	0.000087	T	0.23094	0.0558	L	0.39397	1.21	0.43275	D	0.995233	B;D;B;B;B	0.52996	0.011;0.957;0.002;0.011;0.009	B;P;B;B;B	0.49665	0.019;0.618;0.003;0.019;0.002	T	0.12553	-1.0543	10	0.11182	T	0.66	-1.6428	5.9575	0.19281	0.1437:0.6469:0.1381:0.0714	.	121;94;94;94;121	Q2TU37;Q5JPB9;Q5SZL5;Q9P0N9-2;Q9P0N9	.;.;.;.;TBCD7_HUMAN	L	62;121;121;121;94;121;94;94;121;94;94;121;121;121	ENSP00000401438:R121L;ENSP00000348813:R121L;ENSP00000368602:R121L;ENSP00000368609:R94L;ENSP00000343100:R121L;ENSP00000414292:R94L;ENSP00000404680:R94L;ENSP00000394425:R121L;ENSP00000417005:R94L;ENSP00000412102:R94L;ENSP00000414101:R121L;ENSP00000401339:R121L;ENSP00000368593:R121L	ENSP00000334212:R62L	R	-	2	0	TBC1D7	13429138	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	4.188000	0.58351	0.775000	0.33450	0.555000	0.69702	CGA	.		0.488	TBC1D7-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039896.2	NM_016495	
TBCCD1	55171	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	186269064	186269064	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr3:186269064G>T	ENST00000424280.1	-	7	2028	c.1549C>A	c.(1549-1551)Caa>Aaa	p.Q517K	TBCCD1_ENST00000479590.1_5'Flank|TBCCD1_ENST00000338733.5_Missense_Mutation_p.Q517K|TBCCD1_ENST00000446782.1_Missense_Mutation_p.Q421K	NM_001134415.1	NP_001127887.1	Q9NVR7	TBCC1_HUMAN	TBCC domain containing 1	517					cell morphogenesis (GO:0000902)|cytoskeleton organization (GO:0007010)|maintenance of centrosome location (GO:0051661)|maintenance of Golgi location (GO:0051684)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|spindle pole centrosome (GO:0031616)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|skin(1)	17	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)		TGCTTCCTTTGATCCCTAAAA	0.348																																					p.Q517K		.											.	TBCCD1	108	0			c.C1549A						.						91.0	80.0	84.0					3																	186269064		2203	4300	6503	SO:0001583	missense	55171	exon7			TCCTTTGATCCCT	BC025748	CCDS3276.1, CCDS75061.1	3q27.3	2006-03-09			ENSG00000113838	ENSG00000113838			25546	protein-coding gene	gene with protein product						12477932	Standard	NM_001134415		Approved	FLJ10560	uc003fqg.3	Q9NVR7	OTTHUMG00000156613	ENST00000424280.1:c.1549C>A	3.37:g.186269064G>T	ENSP00000411253:p.Gln517Lys	94.0	0.0		108.0	19.0	NM_001134415	B3KW69|D3DNU6|G5E9J4	Missense_Mutation	SNP	ENST00000424280.1	37	CCDS3276.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.713053	0.89112	.	.	ENSG00000113838	ENST00000424280;ENST00000338733;ENST00000446782	D;D;D	0.83591	-1.74;-1.74;-1.74	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.88851	0.6549	M	0.71296	2.17	0.58432	D	0.999997	D;D	0.62365	0.981;0.991	P;P	0.58331	0.829;0.837	D	0.89917	0.4056	10	0.66056	D	0.02	-10.6982	16.3537	0.83227	0.0:0.0:1.0:0.0	.	421;517	G5E9J4;Q9NVR7	.;TBCC1_HUMAN	K	517;517;421	ENSP00000411253:Q517K;ENSP00000341652:Q517K;ENSP00000397091:Q421K	ENSP00000341652:Q517K	Q	-	1	0	TBCCD1	187751758	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.031000	0.93731	2.460000	0.83146	0.557000	0.71058	CAA	.		0.348	TBCCD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344774.1	NM_018138	
THAP3	90326	broad.mit.edu;bcgsc.ca	37	1	6692557	6692557	+	Splice_Site	SNP	T	T	C			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr1:6692557T>C	ENST00000054650.4	+	5	596		c.e5+2		DNAJC11_ENST00000465508.1_5'Flank|THAP3_ENST00000307896.6_Splice_Site|THAP3_ENST00000377627.3_Splice_Site	NM_001195753.1	NP_001182682.1	Q8WTV1	THAP3_HUMAN	THAP domain containing, apoptosis associated protein 3								DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|large_intestine(1)|prostate(1)	4	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		GTAAAACAGGTAAGACTGAGT	0.547																																					.		.											.	THAP3	514	0			c.438+2T>C						.						65.0	57.0	60.0					1																	6692557		2203	4300	6503	SO:0001630	splice_region_variant	90326	exon5			AACAGGTAAGACT	BC022081	CCDS86.1, CCDS55572.1, CCDS55573.1	1p36.1	2013-01-25			ENSG00000041988	ENSG00000041988		"""THAP (C2CH-type zinc finger) domain containing"""	20855	protein-coding gene	gene with protein product		612532				12575992	Standard	NM_138350		Approved		uc001aod.3	Q8WTV1	OTTHUMG00000001440	ENST00000054650.4:c.438+2T>C	1.37:g.6692557T>C		72.0	1.0		60.0	4.0	NM_001195753	Q569K1|Q5TH66|Q5TH67|Q8N8T6|Q9BSC7|Q9Y3H2|Q9Y3H3	Splice_Site	SNP	ENST00000054650.4	37	CCDS55572.1	.	.	.	.	.	.	.	.	.	.	T	18.33	3.600130	0.66332	.	.	ENSG00000041988	ENST00000054650;ENST00000307896;ENST00000377627	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6944	0.45890	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	THAP3	6615144	1.000000	0.71417	0.951000	0.38953	0.500000	0.33767	3.489000	0.53237	1.774000	0.52232	0.379000	0.24179	.	.		0.547	THAP3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004203.1	NM_138350	Intron
TMED7	51014	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	114952130	114952130	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr5:114952130A>G	ENST00000456936.3	-	3	831	c.451T>C	c.(451-453)Tgt>Cgt	p.C151R	AC010226.4_ENST00000515570.1_RNA|TICAM2_ENST00000408996.4_Missense_Mutation_p.C151R|TMED7_ENST00000503010.1_5'UTR|AC010226.4_ENST00000508517.1_RNA|TMED7-TICAM2_ENST00000333314.3_Missense_Mutation_p.C151R|TMED7-TICAM2_ENST00000282382.4_Missense_Mutation_p.C151R	NM_181836.5	NP_861974.1	Q9Y3B3	TMED7_HUMAN	transmembrane emp24 protein transport domain containing 7	151					protein transport (GO:0015031)	COPI vesicle coat (GO:0030126)|COPII vesicle coat (GO:0030127)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|liver(1)|lung(1)|urinary_tract(1)	6		all_cancers(142;0.0223)|all_epithelial(76;0.000869)|Prostate(80;0.0115)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;3.34e-07)|Epithelial(69;1.08e-06)|all cancers(49;4.56e-05)		ATTGAAACACAGGCAGATTCC	0.388																																					p.C151R	Pancreas(167;237 2002 3207 14549 49356)	.											.	.	.	0			c.T451C						.						60.0	60.0	60.0					5																	114952130		2202	4300	6502	SO:0001583	missense	100302736	exon3			AAACACAGGCAGA	AK074962	CCDS4120.1	5q22.3	2011-04-19			ENSG00000134970	ENSG00000134970			24253	protein-coding gene	gene with protein product						10810093	Standard	NM_181836		Approved	CGI-109, FLJ90481		Q9Y3B3	OTTHUMG00000132013	ENST00000456936.3:c.451T>C	5.37:g.114952130A>G	ENSP00000405926:p.Cys151Arg	87.0	0.0		121.0	25.0	NM_001164468	Q8NBU8|Q8WUU6|Q96K51	Missense_Mutation	SNP	ENST00000456936.3	37	CCDS4120.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.288538	0.80914	.	.	ENSG00000243414;ENSG00000251201;ENSG00000251201;ENSG00000134970	ENST00000408996;ENST00000282382;ENST00000333314;ENST00000456936	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	5.95	5.95	0.96441	GOLD (1);	0.221872	0.51477	D	0.000083	T	0.46678	0.1405	M	0.83852	2.665	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.989;0.999	T	0.50575	-0.8812	10	0.72032	D	0.01	-17.7955	15.3926	0.74758	1.0:0.0:0.0:0.0	.	151;151	Q9Y3B3;Q6JUT2	TMED7_HUMAN;.	R	151	ENSP00000386341:C151R;ENSP00000282382:C151R;ENSP00000333650:C151R;ENSP00000405926:C151R	ENSP00000405926:C151R	C	-	1	0	TMED7;TICAM2;TMED7-TICAM2	114980029	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.339000	0.96797	2.280000	0.76307	0.460000	0.39030	TGT	.		0.388	TMED7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254990.4	NM_181836	
UBR2	23304	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	42612241	42612241	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr6:42612241G>A	ENST00000372899.1	+	20	2509	c.2251G>A	c.(2251-2253)Gaa>Aaa	p.E751K	UBR2_ENST00000372901.1_Missense_Mutation_p.E751K|UBR2_ENST00000372883.3_Missense_Mutation_p.E255K	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	751					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TACTCTAATAGAAGAAATGCT	0.308																																					p.E751K		.											.	UBR2	94	0			c.G2251A						.						95.0	98.0	97.0					6																	42612241		2203	4299	6502	SO:0001583	missense	23304	exon20			CTAATAGAAGAAA	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.2251G>A	6.37:g.42612241G>A	ENSP00000361990:p.Glu751Lys	64.0	0.0		96.0	22.0	NM_015255	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	37	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	G	36	5.616641	0.96649	.	.	ENSG00000024048	ENST00000372899;ENST00000372901;ENST00000372883	T;T;T	0.57436	0.4;0.4;0.4	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.73552	0.3601	M	0.82193	2.58	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.978	T	0.74565	-0.3623	10	0.66056	D	0.02	-26.7082	20.5632	0.99335	0.0:0.0:1.0:0.0	.	751;751	Q8IWV8-4;Q8IWV8	.;UBR2_HUMAN	K	751;751;255	ENSP00000361990:E751K;ENSP00000361992:E751K;ENSP00000361974:E255K	ENSP00000361974:E255K	E	+	1	0	UBR2	42720219	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.268000	0.78473	2.937000	0.99478	0.650000	0.86243	GAA	.		0.308	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255	
ZNF629	23361	ucsc.edu;bcgsc.ca	37	16	30793870	30793870	+	Silent	SNP	T	T	C			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr16:30793870T>C	ENST00000262525.4	-	3	1986	c.1779A>G	c.(1777-1779)ggA>ggG	p.G593G	RP11-2C24.6_ENST00000575562.1_RNA	NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	593					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			AGGGGTTTTCTCCGATGTGGA	0.577																																					p.G593G		.											.	.	.	0			c.A1779G						.						74.0	81.0	78.0					16																	30793870		2055	4190	6245	SO:0001819	synonymous_variant	23361	exon3			GTTTTCTCCGATG	AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.1779A>G	16.37:g.30793870T>C		60.0	0.0		42.0	4.0	NM_001080417	Q15938	Silent	SNP	ENST00000262525.4	37	CCDS45463.1																																																																																			.		0.577	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434291.1	NM_015309	
ZNF665	79788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53669326	53669326	+	Silent	SNP	A	A	G			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr19:53669326A>G	ENST00000600412.1	-	2	337	c.222T>C	c.(220-222)aaT>aaC	p.N74N	ZNF665_ENST00000396424.3_Silent_p.N139N|CTD-2245F17.2_ENST00000600257.1_RNA			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	74					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		CTCCAAGCTGATTTTCAATAT	0.373																																					p.N139N		.											.	ZNF665	70	0			c.T417C						.						119.0	125.0	123.0					19																	53669326		2145	4278	6423	SO:0001819	synonymous_variant	79788	exon4			AAGCTGATTTTCA		CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.222T>C	19.37:g.53669326A>G		138.0	0.0		162.0	42.0	NM_024733	A8K5T8	Silent	SNP	ENST00000600412.1	37																																																																																				.		0.373	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733	
ZNF677	342926	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53747007	53747007	+	Silent	SNP	A	A	T			TCGA-EP-A3RK-01A-11D-A22F-10	TCGA-EP-A3RK-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d259ac2-03d1-4814-9b0b-d05e3a6029b7	f4ebcdb4-5fcb-4fbc-bb8c-d961ef98312b	g.chr19:53747007A>T	ENST00000598513.1	-	4	309	c.159T>A	c.(157-159)ccT>ccA	p.P53P	ZNF677_ENST00000601828.1_Silent_p.P53P|ZNF677_ENST00000333952.4_Silent_p.P53P|ZNF677_ENST00000599012.1_Silent_p.P53P|ZNF677_ENST00000594681.1_Silent_p.P53P|ZNF677_ENST00000601413.1_Silent_p.P53P|ZNF677_ENST00000598806.1_Silent_p.P53P|CTD-2245F17.6_ENST00000596041.1_RNA	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	53	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		CATCTTCTGGAGGGATGTTAT	0.502																																					p.P53P		.											.	ZNF677	91	0			c.T159A						.						115.0	106.0	109.0					19																	53747007		2203	4300	6503	SO:0001819	synonymous_variant	342926	exon4			TTCTGGAGGGATG	BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.159T>A	19.37:g.53747007A>T		71.0	0.0		82.0	21.0	NM_182609		Silent	SNP	ENST00000598513.1	37	CCDS12861.1																																																																																			.		0.502	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464189.1	NM_182609	
