#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCF3	55324	hgsc.bcm.edu;bcgsc.ca	37	3	183907370	183907370	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:183907370T>C	ENST00000429586.2	+	13	1324	c.1139T>C	c.(1138-1140)gTc>gCc	p.V380A	EIF2B5_ENST00000444495.1_Intron|ABCF3_ENST00000292808.5_Missense_Mutation_p.V374A	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	380	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ATCCTAGTCGTCTCCCACGAC	0.602																																					p.V380A		.											.	ABCF3	94	0			c.T1139C						.						74.0	64.0	68.0					3																	183907370		2203	4300	6503	SO:0001583	missense	55324	exon13			TAGTCGTCTCCCA	U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.1139T>C	3.37:g.183907370T>C	ENSP00000411471:p.Val380Ala	124.0	0.0		151.0	8.0	NM_018358	A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Missense_Mutation	SNP	ENST00000429586.2	37	CCDS3254.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.076336	0.76415	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	D;D	0.95724	-3.79;-3.78	4.2	4.2	0.49525	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.97424	0.9157	M	0.82716	2.605	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.78314	0.991;0.979	D	0.97957	1.0335	10	0.87932	D	0	-21.3595	12.6127	0.56560	0.0:0.0:0.0:1.0	.	374;380	Q9NUQ8-2;Q9NUQ8	.;ABCF3_HUMAN	A	380;374	ENSP00000411471:V380A;ENSP00000292808:V374A	ENSP00000292808:V374A	V	+	2	0	ABCF3	185390064	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.283000	0.78640	1.775000	0.52247	0.460000	0.39030	GTC	.		0.602	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346047.1	NM_018358	
ADAMTS18	170692	hgsc.bcm.edu;bcgsc.ca	37	16	77326981	77326981	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:77326981A>G	ENST00000282849.5	-	20	3599	c.3181T>C	c.(3181-3183)Tgg>Cgg	p.W1061R	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1061	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ACCTCGCTCCACGAAGAAGCG	0.522																																					p.W1061R		.											.	ADAMTS18	1036	0			c.T3181C						.						72.0	67.0	69.0					16																	77326981		2198	4300	6498	SO:0001583	missense	170692	exon20			CGCTCCACGAAGA	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3181T>C	16.37:g.77326981A>G	ENSP00000282849:p.Trp1061Arg	44.0	0.0		63.0	4.0	NM_199355	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	A	14.51	2.556594	0.45487	.	.	ENSG00000140873	ENST00000282849	T	0.77489	-1.1	5.79	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.92919	0.7747	H	0.99425	4.56	0.58432	D	0.999992	D;D	0.89917	0.991;1.0	P;D	0.91635	0.905;0.999	D	0.94072	0.7336	10	0.87932	D	0	.	11.6097	0.51052	0.8667:0.0:0.0:0.1333	.	1061;1061	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	R	1061	ENSP00000282849:W1061R	ENSP00000282849:W1061R	W	-	1	0	ADAMTS18	75884482	1.000000	0.71417	0.791000	0.31998	0.009000	0.06853	8.596000	0.90844	1.013000	0.39391	0.455000	0.32223	TGG	.		0.522	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
ADAD2	161931	hgsc.bcm.edu;bcgsc.ca	37	16	84229269	84229269	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:84229269A>G	ENST00000315906.5	+	6	1070	c.1018A>G	c.(1018-1020)Agc>Ggc	p.S340G	RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA|RP11-486L19.2_ENST00000561900.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.S422G|RP11-486L19.2_ENST00000536986.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	340	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						CCTCTACATCAGCAACACCCC	0.721																																					p.S422G		.											.	ADAD2	68	0			c.A1264G						.						23.0	29.0	27.0					16																	84229269		2198	4298	6496	SO:0001583	missense	161931	exon7			TACATCAGCAACA	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.1018A>G	16.37:g.84229269A>G	ENSP00000325153:p.Ser340Gly	118.0	0.0		70.0	4.0	NM_139174	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	CCDS45536.1	.	.	.	.	.	.	.	.	.	.	A	16.89	3.246694	0.59103	.	.	ENSG00000140955	ENST00000315906;ENST00000268624	D;D	0.96265	-3.96;-3.96	5.22	5.22	0.72569	Adenosine deaminase/editase (2);	0.052582	0.85682	D	0.000000	D	0.98254	0.9422	M	0.92555	3.32	0.39297	D	0.964835	D;D	0.71674	0.998;0.998	D;D	0.69307	0.963;0.941	D	0.99910	1.1196	10	0.72032	D	0.01	-36.8217	11.7794	0.52003	1.0:0.0:0.0:0.0	.	340;422	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	G	340;422	ENSP00000325153:S340G;ENSP00000268624:S422G	ENSP00000268624:S422G	S	+	1	0	ADAD2	82786770	1.000000	0.71417	0.996000	0.52242	0.236000	0.25371	5.674000	0.68117	2.088000	0.63022	0.528000	0.53228	AGC	.		0.721	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
ALK	238	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	29451807	29451807	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:29451807C>A	ENST00000389048.3	-	16	3664	c.2758G>T	c.(2758-2760)Ggt>Tgt	p.G920C	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	920	Gly-rich.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CCTCCGAAACCCCCTCTTGTC	0.587			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.G920C		.	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	ALK	3833	0			c.G2758T						.						34.0	35.0	35.0					2																	29451807		2203	4300	6503	SO:0001583	missense	238	exon16	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	CGAAACCCCCTCT	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2758G>T	2.37:g.29451807C>A	ENSP00000373700:p.Gly920Cys	331.0	1.0		385.0	164.0	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	37	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691038	0.88735	.	.	ENSG00000171094	ENST00000389048	T	0.72835	-0.69	5.22	5.22	0.72569	.	0.000000	0.49305	D	0.000158	D	0.87904	0.6295	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90362	0.4374	9	.	.	.	.	18.7875	0.91961	0.0:1.0:0.0:0.0	.	920	Q9UM73	ALK_HUMAN	C	920	ENSP00000373700:G920C	.	G	-	1	0	ALK	29305311	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.263000	0.78421	2.420000	0.82092	0.561000	0.74099	GGT	.		0.587	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
ALPK2	115701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	18	56247584	56247584	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr18:56247584C>A	ENST00000361673.3	-	4	637	c.424G>T	c.(424-426)Gag>Tag	p.E142*	ALPK2_ENST00000587399.1_5'Flank	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	142						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TGTTCCTTCTCATCAATCTGA	0.493																																					p.E142X		.											.	ALPK2	765	0			c.G424T						.						279.0	268.0	272.0					18																	56247584		2139	4236	6375	SO:0001587	stop_gained	115701	exon4			CCTTCTCATCAAT	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.424G>T	18.37:g.56247584C>A	ENSP00000354991:p.Glu142*	270.0	1.0		306.0	125.0	NM_052947	Q6ZUX0|Q8NAT5|Q96L95	Nonsense_Mutation	SNP	ENST00000361673.3	37	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	C	34	5.320269	0.95682	.	.	ENSG00000198796	ENST00000361673	.	.	.	5.78	2.78	0.32641	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-0.0203	3.2863	0.06932	0.1426:0.5675:0.1381:0.1518	.	.	.	.	X	142	.	ENSP00000354991:E142X	E	-	1	0	ALPK2	54398564	0.001000	0.12720	0.002000	0.10522	0.096000	0.18686	0.715000	0.25822	0.732000	0.32470	0.467000	0.42956	GAG	.		0.493	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
AP3M2	10947	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	42022975	42022975	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:42022975C>T	ENST00000518421.1	+	7	991	c.700C>T	c.(700-702)Cat>Tat	p.H234Y	AP3M2_ENST00000517922.1_Missense_Mutation_p.H234Y|AP3M2_ENST00000520685.1_Intron|AP3M2_ENST00000396926.3_Missense_Mutation_p.H234Y|AP3M2_ENST00000174653.3_Missense_Mutation_p.H234Y	NM_001134296.1	NP_001127768.1	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	234	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|stomach(1)	17	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			TGTCAGCTTCCATCCTTGTGT	0.493																																					p.H234Y		.											.	AP3M2	90	0			c.C700T						.						291.0	236.0	255.0					8																	42022975		2203	4300	6503	SO:0001583	missense	10947	exon7			AGCTTCCATCCTT	D38293	CCDS6125.1	8p11.2	2008-07-07			ENSG00000070718	ENSG00000070718			570	protein-coding gene	gene with protein product		610469				7601449	Standard	NM_006803		Approved	CLA20, AP47B	uc003xoo.3	P53677	OTTHUMG00000164060	ENST00000518421.1:c.700C>T	8.37:g.42022975C>T	ENSP00000428787:p.His234Tyr	245.0	0.0		329.0	139.0	NM_001134296	B2RCR0|D3DSY2|Q7Z472	Missense_Mutation	SNP	ENST00000518421.1	37	CCDS6125.1	.	.	.	.	.	.	.	.	.	.	C	34	5.319393	0.95682	.	.	ENSG00000070718	ENST00000518421;ENST00000174653;ENST00000396926;ENST00000521280;ENST00000517922;ENST00000517499	T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68	5.83	5.83	0.93111	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.81555	0.4847	H	0.97732	4.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87460	0.2407	10	0.87932	D	0	-22.8363	20.126	0.97982	0.0:1.0:0.0:0.0	.	234;234	E7ER80;P53677	.;AP3M2_HUMAN	Y	234;234;234;119;234;97	ENSP00000428787:H234Y;ENSP00000174653:H234Y;ENSP00000380132:H234Y;ENSP00000430616:H119Y;ENSP00000429435:H234Y;ENSP00000429037:H97Y	ENSP00000174653:H234Y	H	+	1	0	AP3M2	42142132	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.487000	0.81328	2.749000	0.94314	0.655000	0.94253	CAT	.		0.493	AP3M2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376996.1		
AP3S1	1176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	115249174	115249174	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:115249174C>A	ENST00000316788.7	+	6	1126	c.569C>A	c.(568-570)cCc>cAc	p.P190H	AP3S1_ENST00000505423.1_3'UTR	NM_001284.2	NP_001275.1	Q92572	AP3S1_HUMAN	adaptor-related protein complex 3, sigma 1 subunit	190					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transport (GO:0006886)	AP-3 adaptor complex (GO:0030123)|AP-type membrane coat adaptor complex (GO:0030119)|Golgi apparatus (GO:0005794)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|pancreas(1)|prostate(1)	12		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;1.08e-07)|Epithelial(69;1.11e-06)|all cancers(49;5.2e-05)		CCAAACCTGCCCTCTTTTAAA	0.403																																					p.P190H		.											.	AP3S1	90	0			c.C569A						.						69.0	73.0	72.0					5																	115249174		2202	4300	6502	SO:0001583	missense	1176	exon6			ACCTGCCCTCTTT	D63643	CCDS4123.1	5q22	2010-06-29			ENSG00000177879	ENSG00000177879			2013	protein-coding gene	gene with protein product		601507		CLAPS3		8697810, 9118953	Standard	NM_001284		Approved		uc003krl.3	Q92572	OTTHUMG00000128887	ENST00000316788.7:c.569C>A	5.37:g.115249174C>A	ENSP00000325369:p.Pro190His	225.0	0.0		230.0	40.0	NM_001284	O00647|O00676|O00721|O00727|Q53XL4|Q6ICQ2	Missense_Mutation	SNP	ENST00000316788.7	37	CCDS4123.1	.	.	.	.	.	.	.	.	.	.	C	19.54	3.847210	0.71603	.	.	ENSG00000177879	ENST00000316788	T	0.44881	0.91	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.37571	0.1008	N	0.22421	0.69	0.80722	D	1	P;P	0.43885	0.72;0.82	B;B	0.42112	0.376;0.376	T	0.29671	-1.0004	10	0.87932	D	0	6.6671	19.8996	0.96980	0.0:1.0:0.0:0.0	.	190;190	B2R4I8;Q92572	.;AP3S1_HUMAN	H	190	ENSP00000325369:P190H	ENSP00000325369:P190H	P	+	2	0	AP3S1	115277073	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.686000	0.84128	2.878000	0.98634	0.650000	0.86243	CCC	.		0.403	AP3S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250847.2		
ARHGEF17	9828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	73076917	73076917	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:73076917C>A	ENST00000263674.3	+	20	6270	c.5920C>A	c.(5920-5922)Cgc>Agc	p.R1974S		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1974					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CGGCCACGTCCGCTTCTTGGC	0.647																																					p.R1974S		.											.	ARHGEF17	227	0			c.C5920A						.						53.0	53.0	53.0					11																	73076917		2200	4293	6493	SO:0001583	missense	9828	exon20			CACGTCCGCTTCT	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.5920C>A	11.37:g.73076917C>A	ENSP00000263674:p.Arg1974Ser	72.0	0.0		90.0	28.0	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.580432	0.86645	.	.	ENSG00000110237	ENST00000263674	T	0.34667	1.35	5.28	5.28	0.74379	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.61677	0.2366	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.67725	0.953	T	0.64356	-0.6427	10	0.62326	D	0.03	-21.8845	18.0725	0.89415	0.0:1.0:0.0:0.0	.	1974	Q96PE2	ARHGH_HUMAN	S	1974	ENSP00000263674:R1974S	ENSP00000263674:R1974S	R	+	1	0	ARHGEF17	72754565	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.172000	0.65003	2.755000	0.94549	0.655000	0.94253	CGC	.		0.647	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
ARHGAP32	9743	hgsc.bcm.edu;bcgsc.ca	37	11	128932247	128932247	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:128932247T>C	ENST00000310343.9	-	9	848	c.849A>G	c.(847-849)ggA>ggG	p.G283G	ARHGAP32_ENST00000524655.1_Silent_p.G209G	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	283	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						AAACAATGTCTCCCACCTAGG	0.383																																					p.G283G		.											.	ARHGAP32	231	0			c.A849G						.						99.0	89.0	92.0					11																	128932247		1566	3579	5145	SO:0001819	synonymous_variant	9743	exon9			AATGTCTCCCACC	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.849A>G	11.37:g.128932247T>C		43.0	0.0		47.0	4.0	NM_001142685	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Silent	SNP	ENST00000310343.9	37	CCDS44769.1																																																																																			.		0.383	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
ASXL3	80816	hgsc.bcm.edu;bcgsc.ca	37	18	31326119	31326119	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr18:31326119T>C	ENST00000269197.5	+	12	6307	c.6307T>C	c.(6307-6309)Tat>Cat	p.Y2103H		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	2103					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						ACAAGTTTCCTATGACCAGAA	0.413																																					p.Y2103H		.											.	ASXL3	49	0			c.T6307C						.						90.0	90.0	90.0					18																	31326119		1853	4098	5951	SO:0001583	missense	80816	exon12			GTTTCCTATGACC	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.6307T>C	18.37:g.31326119T>C	ENSP00000269197:p.Tyr2103His	48.0	0.0		80.0	4.0	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	T	16.83	3.230122	0.58777	.	.	ENSG00000141431	ENST00000269197	T	0.17370	2.28	5.86	5.86	0.93980	.	.	.	.	.	T	0.27832	0.0685	N	0.24115	0.695	0.41471	D	0.988105	D	0.89917	1.0	D	0.80764	0.994	T	0.05869	-1.0859	9	0.24483	T	0.36	.	16.2605	0.82541	0.0:0.0:0.0:1.0	.	2103	Q9C0F0	ASXL3_HUMAN	H	2103	ENSP00000269197:Y2103H	ENSP00000269197:Y2103H	Y	+	1	0	ASXL3	29580117	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.153000	0.71819	2.237000	0.73441	0.460000	0.39030	TAT	.		0.413	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
ATF7IP2	80063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	10527419	10527419	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:10527419G>A	ENST00000396560.2	+	4	1100	c.873G>A	c.(871-873)gaG>gaA	p.E291E	ATF7IP2_ENST00000324570.5_Silent_p.E291E|ATF7IP2_ENST00000543967.1_Intron|ATF7IP2_ENST00000396559.1_Silent_p.E291E|ATF7IP2_ENST00000356427.2_Silent_p.E291E	NM_024997.3	NP_079273.2	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting protein 2	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				large_intestine(3)	3						CAGAAAACGAGGAAAATGTTA	0.328																																					p.E291E		.											.	ATF7IP2	186	0			c.G873A						.						58.0	60.0	60.0					16																	10527419		2196	4299	6495	SO:0001819	synonymous_variant	80063	exon4			AAACGAGGAAAAT	AK022730	CCDS10540.1, CCDS58422.1	16p13.2	2008-02-05			ENSG00000166669	ENSG00000166669			20397	protein-coding gene	gene with protein product		613645					Standard	NM_001256160		Approved	FLJ12668	uc002czu.3	Q5U623	OTTHUMG00000129749	ENST00000396560.2:c.873G>A	16.37:g.10527419G>A		168.0	0.0		190.0	47.0	NM_024997	B2RNR2|Q53EZ7|Q658U2|Q6IS97|Q8N9X8|Q9H9L6	Silent	SNP	ENST00000396560.2	37	CCDS10540.1																																																																																			.		0.328	ATF7IP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251961.1	NM_024997	
ATP12A	479	hgsc.bcm.edu;bcgsc.ca	37	13	25266681	25266681	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:25266681A>G	ENST00000381946.3	+	9	1350	c.1183A>G	c.(1183-1185)Aca>Gca	p.T395A	ATP12A_ENST00000218548.6_Missense_Mutation_p.T401A			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	395					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		CAAGACTGGGACACTGACCCA	0.532																																					p.T401A	Pancreas(156;1582 1935 18898 22665 26498)	.											.	ATP12A	137	0			c.A1201G						.						97.0	85.0	89.0					13																	25266681		2203	4300	6503	SO:0001583	missense	479	exon9			ACTGGGACACTGA	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1183A>G	13.37:g.25266681A>G	ENSP00000371372:p.Thr395Ala	101.0	0.0		125.0	7.0	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	37	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.456532	0.84317	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.99143	-5.48;-5.48	5.63	5.63	0.86233	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.99588	0.9851	H	0.98577	4.27	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.85130	0.997;0.99	D	0.97737	1.0206	10	0.87932	D	0	.	13.789	0.63128	1.0:0.0:0.0:0.0	.	401;395	P54707-2;P54707	.;AT12A_HUMAN	A	401;395	ENSP00000218548:T401A;ENSP00000371372:T395A	ENSP00000218548:T401A	T	+	1	0	ATP12A	24164681	1.000000	0.71417	0.983000	0.44433	0.716000	0.41182	7.246000	0.78247	2.145000	0.66743	0.533000	0.62120	ACA	.		0.532	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
BANK1	55024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	102783739	102783739	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:102783739G>T	ENST00000322953.4	+	4	955	c.681G>T	c.(679-681)gaG>gaT	p.E227D	BANK1_ENST00000504592.1_Missense_Mutation_p.E212D|BANK1_ENST00000428908.1_Missense_Mutation_p.E94D|BANK1_ENST00000444316.2_Missense_Mutation_p.E197D|BANK1_ENST00000508653.1_Missense_Mutation_p.E94D	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	227	DBB. {ECO:0000255|PROSITE- ProRule:PRU00707}.				B cell activation (GO:0042113)					NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		ATACTGTAGAGGTTGAATTTA	0.338																																					p.E227D		.											.	BANK1	93	0			c.G681T						.						80.0	80.0	80.0					4																	102783739		2203	4299	6502	SO:0001583	missense	55024	exon4			TGTAGAGGTTGAA	AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.681G>T	4.37:g.102783739G>T	ENSP00000320509:p.Glu227Asp	144.0	0.0		187.0	73.0	NM_017935	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	ENST00000322953.4	37	CCDS34038.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980235	0.53827	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	T;T;T;T;T	0.27104	2.41;2.41;1.69;1.69;2.42	5.14	1.94	0.25998	DBB domain (1);	0.000000	0.64402	D	0.000005	T	0.42291	0.1196	M	0.65975	2.015	0.25299	N	0.989295	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.994;0.991;0.991	T	0.11397	-1.0589	10	0.49607	T	0.09	.	7.3529	0.26703	0.3815:0.0:0.6185:0.0	.	94;227;212	Q8NDB2-4;Q8NDB2;Q8NDB2-2	.;BANK1_HUMAN;.	D	212;227;94;94;197	ENSP00000421443:E212D;ENSP00000320509:E227D;ENSP00000412748:E94D;ENSP00000422314:E94D;ENSP00000388817:E197D	ENSP00000320509:E227D	E	+	3	2	BANK1	103002762	0.926000	0.31397	0.984000	0.44739	0.689000	0.40095	-0.093000	0.11111	0.527000	0.28560	0.585000	0.79938	GAG	.		0.338	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1	NM_017935	
TRAPPC3L	100128327	hgsc.bcm.edu;bcgsc.ca	37	6	116866643	116866643	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:116866643T>C	ENST00000368602.3	-	1	130	c.35A>G	c.(34-36)cAt>cGt	p.H12R	FAM26D_ENST00000416171.2_Intron|FAM26D_ENST00000368597.2_Intron|FAM26D_ENST00000405399.1_Intron	NM_001139444.2	NP_001132916.1	Q5T215	TPC3L_HUMAN	trafficking protein particle complex 3-like	12					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)											TACTATTTTATGGTATTCTGG	0.328																																					p.H12R		.											.	.	.	0			c.A35G						.						265.0	230.0	241.0					6																	116866643		692	1591	2283	SO:0001583	missense	100128327	exon1			ATTTTATGGTATT	AK002042	CCDS47468.1	6q22.31	2013-05-01	2013-05-01	2013-05-01	ENSG00000173626	ENSG00000173626			21090	protein-coding gene	gene with protein product		614137	"""BET3 like (S. cerevisiae)"""	BET3L		21525244	Standard	NM_001139444		Approved	bA259P20.2, FLJ11180		Q5T215	OTTHUMG00000015440	ENST00000368602.3:c.35A>G	6.37:g.116866643T>C	ENSP00000357591:p.His12Arg	189.0	0.0		98.0	4.0	NM_001139444	Q5T213|Q5T214	Missense_Mutation	SNP	ENST00000368602.3	37	CCDS47468.1	.	.	.	.	.	.	.	.	.	.	T	13.19	2.163927	0.38217	.	.	ENSG00000173626	ENST00000368602	.	.	.	5.77	-0.932	0.10435	NO signalling/Golgi transport  ligand-binding domain (1);	0.592256	0.16782	N	0.199733	T	0.23014	0.0556	L	0.38531	1.155	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08638	-1.0712	9	0.49607	T	0.09	-9.5315	6.003	0.19531	0.0:0.2724:0.1252:0.6025	.	12	Q5T215	TPC3L_HUMAN	R	12	.	ENSP00000357591:H12R	H	-	2	0	BET3L	116973336	0.927000	0.31430	0.889000	0.34880	0.995000	0.86356	0.873000	0.28052	-0.369000	0.08028	0.533000	0.62120	CAT	.		0.328	TRAPPC3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000101701.1	XM_166322	
BRCA2	675	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	32953916	32953924	+	In_Frame_Del	DEL	GATTTATAT	GATTTATAT	-	rs397508026|rs397508027|rs80359736|rs80359737|rs397508028		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	GATTTATAT	GATTTATAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:32953916_32953924delGATTTATAT	ENST00000380152.3	+	23	9216_9224	c.8983_8991delGATTTATAT	c.(8983-8991)gatttatatdel	p.DLY2995del	BRCA2_ENST00000544455.1_In_Frame_Del_p.DLY2995del			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2995					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.Y2997*(2)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TCCATCATCAGATTTATATTCTCTGTTAA	0.311			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.2995_2997del	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	3153	2	Substitution - Nonsense(2)	large_intestine(2)	c.8983_8991del	GRCh37	CM070045	BRCA2	M		.																																			SO:0001651	inframe_deletion	675	exon23	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	TCATCAGATTTAT	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.8983_8991delGATTTATAT	13.37:g.32953916_32953924delGATTTATAT	ENSP00000369497:p.Asp2995_Tyr2997del	181.0	0.0		168.0	17.0	NM_000059	O00183|O15008|Q13879|Q5TBJ7	In_Frame_Del	DEL	ENST00000380152.3	37	CCDS9344.1																																																																																			.		0.311	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
BRCA2	675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	32937516	32937516	+	Missense_Mutation	SNP	A	A	G	rs80359064		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:32937516A>G	ENST00000380152.3	+	18	8410	c.8177A>G	c.(8176-8178)tAt>tGt	p.Y2726C	BRCA2_ENST00000544455.1_Missense_Mutation_p.Y2726C			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2726					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		GATGGGTGGTATGCTGTTAAG	0.403			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.Y2726C	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	3153	0			c.A8177G						.	A	CYS/TYR	0,4406		0,0,2203	148.0	143.0	145.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	8177	5.5	1.0	13	dbSNP_132	145	1,8599	1.2+/-3.3	0,1,4299	no	missense	BRCA2	NM_000059.3	194	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging	2726/3419	32937516	1,13005	2203	4300	6503	SO:0001583	missense	675	exon18	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	GGTGGTATGCTGT	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.8177A>G	13.37:g.32937516A>G	ENSP00000369497:p.Tyr2726Cys	139.0	0.0		168.0	66.0	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	A	17.10	3.302460	0.60195	0.0	1.16E-4	ENSG00000139618	ENST00000380152;ENST00000544455	D;D	0.95482	-3.72;-3.72	5.49	5.49	0.81192	Nucleic acid-binding, OB-fold-like (1);BRCA2, oligonucleotide/oligosaccharide-binding 1 (1);	0.000000	0.85682	D	0.000000	D	0.98283	0.9431	M	0.93197	3.39	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.99560	1.0968	10	0.87932	D	0	.	15.5697	0.76323	1.0:0.0:0.0:0.0	.	2726	P51587	BRCA2_HUMAN	C	2726	ENSP00000369497:Y2726C;ENSP00000439902:Y2726C	ENSP00000369497:Y2726C	Y	+	2	0	BRCA2	31835516	1.000000	0.71417	0.992000	0.48379	0.414000	0.31173	8.962000	0.93254	2.084000	0.62774	0.260000	0.18958	TAT	.		0.403	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
C14orf1	11161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	76117958	76117958	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:76117958C>T	ENST00000256319.6	-	5	808	c.363G>A	c.(361-363)atG>atA	p.M121I	FLVCR2_ENST00000556241.1_Intron|FLVCR2_ENST00000553587.1_Intron	NM_007176.3	NP_009107.1	Q9UKR5	ERG28_HUMAN	chromosome 14 open reading frame 1	121					sterol biosynthetic process (GO:0016126)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	6		all_epithelial(191;0.125)|all_neural(303;0.13)|Myeloproliferative disorder(585;0.163)		BRCA - Breast invasive adenocarcinoma(234;0.00147)		GCCCGACCAGCATACCCAGGA	0.473																																					p.M121I		.											.	C14orf1	90	0			c.G363A						.						162.0	161.0	161.0					14																	76117958		2203	4300	6503	SO:0001583	missense	11161	exon5			GACCAGCATACCC	AF134159	CCDS9845.1	14q24.3	2012-08-16			ENSG00000133935	ENSG00000133935			1187	protein-coding gene	gene with protein product		604576				10449901, 12958361, 11160377	Standard	NM_007176		Approved	NET51, ERG28	uc001xrt.3	Q9UKR5	OTTHUMG00000171488	ENST00000256319.6:c.363G>A	14.37:g.76117958C>T	ENSP00000256319:p.Met121Ile	76.0	0.0		104.0	37.0	NM_007176	Q9P093|Q9UPI2	Missense_Mutation	SNP	ENST00000256319.6	37	CCDS9845.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.949887	0.92660	.	.	ENSG00000133935	ENST00000256319	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.85831	0.5788	M	0.91818	3.245	0.80722	D	1	D	0.57899	0.981	D	0.67900	0.954	D	0.88229	0.2902	9	0.72032	D	0.01	-35.6857	19.4226	0.94727	0.0:1.0:0.0:0.0	.	121	Q9UKR5	ERG28_HUMAN	I	121	.	ENSP00000256319:M121I	M	-	3	0	C14orf1	75187711	1.000000	0.71417	0.990000	0.47175	0.871000	0.50021	7.226000	0.78060	2.684000	0.91462	0.650000	0.86243	ATG	.		0.473	C14orf1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413683.1	NM_007176	
C15orf52	388115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	40628995	40628995	+	Silent	SNP	T	T	C	rs143912259		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr15:40628995T>C	ENST00000559313.1	-	8	909	c.894A>G	c.(892-894)aaA>aaG	p.K298K	C15orf52_ENST00000397536.2_Silent_p.K88K|C15orf52_ENST00000557973.1_5'Flank	NM_207380.2	NP_997263.2	Q6ZUT6	CO052_HUMAN	chromosome 15 open reading frame 52	298							poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	19		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		GGGGCTGTAGTTTCTGGTGGC	0.577																																					p.K298K		.											.	C15orf52	153	0			c.A894G						.	T		0,4406		0,0,2203	57.0	63.0	61.0		894	2.6	0.1	15	dbSNP_134	61	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C15orf52	NM_207380.2		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		298/535	40628995	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	388115	exon8			CTGTAGTTTCTGG	AK124643	CCDS10055.2	15q15.1	2007-06-14			ENSG00000188549	ENSG00000188549			33488	protein-coding gene	gene with protein product							Standard	NM_207380		Approved	FLJ43339	uc001zlh.4	Q6ZUT6	OTTHUMG00000129981	ENST00000559313.1:c.894A>G	15.37:g.40628995T>C		64.0	0.0		74.0	39.0	NM_207380	B9EIQ8|Q68DG9|Q6ZTM3|Q6ZU22	Silent	SNP	ENST00000559313.1	37	CCDS10055.2																																																																																			T|1.000;C|0.000		0.577	C15orf52-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319567.2	NM_207380	
C16orf78	123970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	49412388	49412388	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:49412388G>A	ENST00000299191.3	+	3	395	c.278G>A	c.(277-279)gGa>gAa	p.G93E		NM_144602.2	NP_653203.1	Q8WTQ4	CP078_HUMAN	chromosome 16 open reading frame 78	93						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(1)	22						AAGGCCTTAGGAAAGAGATTC	0.557																																					p.G93E		.											.	C16orf78	90	0			c.G278A						.						37.0	33.0	34.0					16																	49412388		2198	4299	6497	SO:0001583	missense	123970	exon3			CCTTAGGAAAGAG	BC021181	CCDS10738.1	16q12.1	2008-02-05			ENSG00000166152	ENSG00000166152			28479	protein-coding gene	gene with protein product						12477932	Standard	NM_144602		Approved	MGC33367	uc002efr.3	Q8WTQ4	OTTHUMG00000133149	ENST00000299191.3:c.278G>A	16.37:g.49412388G>A	ENSP00000299191:p.Gly93Glu	42.0	0.0		43.0	14.0	NM_144602		Missense_Mutation	SNP	ENST00000299191.3	37	CCDS10738.1	.	.	.	.	.	.	.	.	.	.	G	0.051	-1.249016	0.01469	.	.	ENSG00000166152	ENST00000299191	T	0.41065	1.01	3.04	-3.04	0.05412	.	6.024030	0.00424	N	0.000066	T	0.23766	0.0575	N	0.24115	0.695	0.09310	N	0.999999	B	0.21606	0.058	B	0.14023	0.01	T	0.03463	-1.1034	9	.	.	.	0.8377	0.4665	0.00525	0.3689:0.1722:0.2698:0.1891	.	93	Q8WTQ4	CP078_HUMAN	E	93	ENSP00000299191:G93E	.	G	+	2	0	C16orf78	47969889	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.057000	0.03486	-0.666000	0.05310	0.462000	0.41574	GGA	.		0.557	C16orf78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256846.1	NM_144602	
C16orf46	123775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	81095083	81095083	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:81095083G>A	ENST00000299578.5	-	4	1106	c.871C>T	c.(871-873)Ctg>Ttg	p.L291L	RP11-303E16.8_ENST00000564536.1_RNA|C16orf46_ENST00000378611.4_Silent_p.L291L|C16orf46_ENST00000444657.3_5'Flank	NM_152337.2	NP_689550.2	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46	291						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|large_intestine(3)|lung(9)|prostate(1)|stomach(1)|urinary_tract(1)	18						GGATCGGTCAGCAGGGATATC	0.592																																					p.L291L		.											.	C16orf46	90	0			c.C871T						.						105.0	101.0	102.0					16																	81095083		2202	4300	6502	SO:0001819	synonymous_variant	123775	exon3			CGGTCAGCAGGGA	BC064143	CCDS10932.1, CCDS42201.1	16q23.2	2012-10-09			ENSG00000166455	ENSG00000166455			26525	protein-coding gene	gene with protein product							Standard	NM_152337		Approved	FLJ32702	uc002fgc.4	Q6P387	OTTHUMG00000137629	ENST00000299578.5:c.871C>T	16.37:g.81095083G>A		184.0	0.0		208.0	67.0	NM_001100873	Q96MA7	Silent	SNP	ENST00000299578.5	37	CCDS10932.1																																																																																			.		0.592	C16orf46-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269054.2	NM_152337	
NELFB	25920	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	140147365	140147365	+	5'Flank	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:140147365G>A	ENST00000343053.4	+	0	0				C9orf173_ENST00000388931.3_Silent_p.S248S|C9orf173_ENST00000412566.1_Silent_p.S248S	NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B						gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											GCCCCCGCTCGCCGGCCTTCT	0.647																																					p.S248S		.											.	C9orf173	46	0			c.G744A						.						9.0	11.0	11.0					9																	140147365		1876	4087	5963	SO:0001631	upstream_gene_variant	441476	exon5			CCGCTCGCCGGCC	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778		9.37:g.140147365G>A	Exception_encountered	63.0	0.0		70.0	36.0	NM_001004353	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Silent	SNP	ENST00000343053.4	37	CCDS7040.1																																																																																			.		0.647	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1	NM_015456	
CAND1	55832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	67701207	67701207	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:67701207C>T	ENST00000545606.1	+	11	3397	c.2960C>T	c.(2959-2961)aCg>aTg	p.T987M		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	987					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TCAGTGGTTACGGCTGTGAAA	0.363																																					p.T987M		.											.	CAND1	516	0			c.C2960T						.						72.0	67.0	69.0					12																	67701207		2203	4298	6501	SO:0001583	missense	55832	exon11			TGGTTACGGCTGT		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.2960C>T	12.37:g.67701207C>T	ENSP00000442318:p.Thr987Met	57.0	0.0		82.0	34.0	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	37	CCDS8977.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.2|28.2	4.897587|4.897587	0.91962|0.91962	.|.	.|.	ENSG00000111530|ENSG00000111530	ENST00000540047|ENST00000545606;ENST00000299218;ENST00000544619	.|T;T	.|0.20200	.|2.09;2.09	5.26|5.26	5.26|5.26	0.73747|0.73747	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.55162|0.55162	0.1903|0.1903	M|M	0.88842|0.88842	2.985|2.985	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.80764	.|0.994;0.935	T|T	0.62124|0.62124	-0.6920|-0.6920	5|9	.|.	.|.	.|.	-13.9614|-13.9614	19.2139|19.2139	0.93768|0.93768	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|819;987	.|Q86VP6-2;Q86VP6	.|.;CAND1_HUMAN	W|M	401|987;987;527	.|ENSP00000442318:T987M;ENSP00000444089:T527M	.|.	R|T	+|+	1|2	2|0	CAND1|CAND1	65987474|65987474	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.970000|0.970000	0.65996|0.65996	7.719000|7.719000	0.84751|0.84751	2.628000|2.628000	0.89032|0.89032	0.585000|0.585000	0.79938|0.79938	CGG|ACG	.		0.363	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
CCDC108	255101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	219892384	219892384	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:219892384G>A	ENST00000341552.5	-	13	2282	c.2199C>T	c.(2197-2199)ttC>ttT	p.F733F	CCDC108_ENST00000441968.1_Silent_p.F733F|CCDC108_ENST00000409865.3_Silent_p.F722F|CCDC108_ENST00000453220.1_Silent_p.F733F|CCDC108_ENST00000410037.1_Silent_p.F668F	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	733						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TATAGATGGCGAAGGCTTCGA	0.617																																					p.F733F		.											.	CCDC108	94	0			c.C2199T						.						82.0	84.0	84.0					2																	219892384		2203	4300	6503	SO:0001819	synonymous_variant	255101	exon13			GATGGCGAAGGCT	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.2199C>T	2.37:g.219892384G>A		185.0	0.0		255.0	84.0	NM_194302	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Silent	SNP	ENST00000341552.5	37	CCDS2430.2																																																																																			.		0.617	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
CD163L1	283316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	7510070	7510070	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:7510070T>A	ENST00000313599.3	-	19	4349	c.4292A>T	c.(4291-4293)aAc>aTc	p.N1431I	CD163L1_ENST00000396630.1_Missense_Mutation_p.N1399I|CD163L1_ENST00000416109.2_Missense_Mutation_p.N1441I			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1431						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						ACAACCATGGTTGGGGGTGTC	0.458																																					p.N1431I		.											.	CD163L1	100	0			c.A4292T						.						79.0	79.0	79.0					12																	7510070		2203	4300	6503	SO:0001583	missense	283316	exon19			CCATGGTTGGGGG	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.4292A>T	12.37:g.7510070T>A	ENSP00000315945:p.Asn1431Ile	52.0	0.0		74.0	24.0	NM_174941	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0|0	-2.765064|-2.765064	0.00082|0.00082	.|.	.|.	ENSG00000177675|ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630|ENST00000539726	T;T;T|.	0.01963|.	5.0;5.0;4.53|.	1.07|1.07	-2.14|-2.14	0.07123|0.07123	.|.	.|.	.|.	.|.	.|.	T|T	0.13030|0.13030	0.0316|0.0316	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.25169|.	0.119;0.036|.	B;B|.	0.23018|.	0.029;0.043|.	T|T	0.07009|0.07009	-1.0795|-1.0795	9|5	0.36615|.	T|.	0.2|.	.|.	0.8518|0.8518	0.01174|0.01174	0.2098:0.163:0.1491:0.4781|0.2098:0.163:0.1491:0.4781	.|.	1441;1431|.	E7EVK4;Q9NR16|.	.;C163B_HUMAN|.	I|H	1431;1441;1399|86	ENSP00000315945:N1431I;ENSP00000393474:N1441I;ENSP00000379871:N1399I|.	ENSP00000315945:N1431I|.	N|Q	-|-	2|3	0|2	CD163L1|CD163L1	7401337|7401337	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-2.776000|-2.776000	0.00776|0.00776	-3.939000|-3.939000	0.00089|0.00089	-3.420000|-3.420000	0.00038|0.00038	AAC|CAA	.		0.458	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
CD22	933	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35832037	35832037	+	Silent	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:35832037C>G	ENST00000085219.5	+	7	1569	c.1503C>G	c.(1501-1503)gtC>gtG	p.V501V	CD22_ENST00000419549.2_Silent_p.V329V|CD22_ENST00000536635.2_Silent_p.V413V|CD22_ENST00000544992.2_Silent_p.V501V|CD22_ENST00000270311.6_Silent_p.V381V|CD22_ENST00000594250.1_Silent_p.V324V|CD22_ENST00000341773.6_Silent_p.V324V	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	501					cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCCTGAATGTCCAGTGTGAGT	0.617																																					p.V501V	Ovarian(42;1009 1133 23674 26041)	.											.	CD22	526	0			c.C1503G						.						70.0	64.0	66.0					19																	35832037		2203	4300	6503	SO:0001819	synonymous_variant	933	exon7			GAATGTCCAGTGT	X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.1503C>G	19.37:g.35832037C>G		127.0	1.0		122.0	58.0	NM_001185100	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Silent	SNP	ENST00000085219.5	37	CCDS12457.1																																																																																			.		0.617	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466099.1	NM_001771	
CEP164	22897	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	117222640	117222640	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:117222640A>C	ENST00000278935.3	+	5	476	c.329A>C	c.(328-330)aAg>aCg	p.K110T		NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	110	Interaction with ATRIP.|Lys-rich.			K -> N (in Ref. 5; AAH54015). {ECO:0000305}.	cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		GGGGCCATTaagaagaagaaa	0.512																																					p.K110T		.											.	CEP164	69	0			c.A329C						.						47.0	47.0	47.0					11																	117222640		2201	4296	6497	SO:0001583	missense	22897	exon4			CCATTAAGAAGAA	AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.329A>C	11.37:g.117222640A>C	ENSP00000278935:p.Lys110Thr	57.0	0.0		87.0	6.0	NM_001271933	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	ENST00000278935.3	37	CCDS31683.1	.	.	.	.	.	.	.	.	.	.	A	13.02	2.111278	0.37242	.	.	ENSG00000110274	ENST00000525734;ENST00000533153;ENST00000278935;ENST00000525416;ENST00000545330;ENST00000527609;ENST00000533570;ENST00000529538	T;T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19;-0.19	5.95	5.95	0.96441	.	0.625053	0.15094	N	0.280936	T	0.73426	0.3585	L	0.60455	1.87	0.30319	N	0.787799	D;B;P;D	0.69078	0.997;0.264;0.873;0.996	D;B;P;D	0.66847	0.921;0.049;0.544;0.947	T	0.72093	-0.4394	10	0.52906	T	0.07	-16.947	10.3413	0.43879	0.9238:0.0:0.0762:0.0	.	110;64;110;110	E9PI34;B7Z884;Q9UPV0;Q9UPV0-2	.;.;CE164_HUMAN;.	T	110;64;110;64;64;110;110;110	ENSP00000436609:K110T;ENSP00000436034:K64T;ENSP00000278935:K110T;ENSP00000435759:K64T;ENSP00000436351:K110T;ENSP00000431302:K110T	ENSP00000278935:K110T	K	+	2	0	CEP164	116727850	1.000000	0.71417	0.997000	0.53966	0.353000	0.29299	5.568000	0.67385	2.279000	0.76181	0.533000	0.62120	AAG	.		0.512	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956	
CEP290	80184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	88486591	88486591	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:88486591C>A	ENST00000552810.1	-	29	3671	c.3328G>T	c.(3328-3330)Gat>Tat	p.D1110Y	CEP290_ENST00000397838.3_Missense_Mutation_p.D170Y|CEP290_ENST00000547691.2_Missense_Mutation_p.D170Y|CEP290_ENST00000309041.7_Missense_Mutation_p.D1112Y	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1110					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TTCTGTGCATCCAAATTGATT	0.348																																					p.D1110Y		.											.	CEP290	96	0			c.G3328T						.						203.0	192.0	195.0					12																	88486591		1900	4119	6019	SO:0001583	missense	80184	exon29			GTGCATCCAAATT	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.3328G>T	12.37:g.88486591C>A	ENSP00000448012:p.Asp1110Tyr	176.0	0.0		177.0	64.0	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	37	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.466119	0.84425	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	T;T;T;T	0.64438	0.48;-0.1;-0.1;0.48	5.83	5.83	0.93111	.	0.183068	0.56097	D	0.000025	T	0.64091	0.2567	L	0.34521	1.04	0.48901	D	0.999726	P	0.48503	0.911	P	0.49226	0.603	T	0.66428	-0.5926	10	0.72032	D	0.01	.	20.1133	0.97917	0.0:1.0:0.0:0.0	.	1110	O15078	CE290_HUMAN	Y	170;1110;1112;170	ENSP00000446905:D170Y;ENSP00000448012:D1110Y;ENSP00000308021:D1112Y;ENSP00000380938:D170Y	ENSP00000308021:D1112Y	D	-	1	0	CEP290	87010722	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	5.464000	0.66719	2.762000	0.94881	0.591000	0.81541	GAT	.		0.348	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
CEP44	80817	hgsc.bcm.edu;bcgsc.ca	37	4	175225512	175225512	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:175225512T>C	ENST00000503780.1	+	6	913	c.499T>C	c.(499-501)Tca>Cca	p.S167P	CEP44_ENST00000426172.1_Missense_Mutation_p.S167P|CEP44_ENST00000296519.4_Missense_Mutation_p.S167P|CEP44_ENST00000457424.2_Missense_Mutation_p.S167P	NM_001040157.2	NP_001035247.1	Q9C0F1	CEP44_HUMAN	centrosomal protein 44kDa	167						centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|spindle pole (GO:0000922)				endometrium(2)|large_intestine(4)|lung(5)|stomach(1)	12						GTTTATGACCTCAGGAAAGGT	0.368																																					p.S167P		.											.	CEP44	68	0			c.T499C						.						61.0	64.0	63.0					4																	175225512		2203	4300	6503	SO:0001583	missense	80817	exon6			ATGACCTCAGGAA	AB051499	CCDS34106.1, CCDS47163.1	4q34	2014-02-20	2011-05-06	2011-05-06	ENSG00000164118	ENSG00000164118			29356	protein-coding gene	gene with protein product			"""KIAA1712"""	KIAA1712		21399614	Standard	NM_001040157		Approved		uc010iro.2	Q9C0F1	OTTHUMG00000160752	ENST00000503780.1:c.499T>C	4.37:g.175225512T>C	ENSP00000423153:p.Ser167Pro	146.0	0.0		167.0	11.0	NM_001040157	A8K8W9|A8MW11|B3KT53|D3DP42|Q8IXZ4	Missense_Mutation	SNP	ENST00000503780.1	37	CCDS34106.1	.	.	.	.	.	.	.	.	.	.	T	14.41	2.527136	0.44969	.	.	ENSG00000164118	ENST00000503780;ENST00000457424;ENST00000515299;ENST00000426172;ENST00000296519	T;T;T;T;T	0.54279	0.62;0.58;0.7;0.58;0.62	5.02	5.02	0.67125	.	0.299367	0.28420	N	0.015409	T	0.69424	0.3109	M	0.70595	2.14	0.33950	D	0.644319	D;D	0.76494	0.999;0.999	D;D	0.85130	0.996;0.997	T	0.79405	-0.1817	10	0.62326	D	0.03	.	11.418	0.49965	0.0:0.0:0.0:1.0	.	167;167	Q9C0F1-2;Q9C0F1	.;CEP44_HUMAN	P	167	ENSP00000423153:S167P;ENSP00000389427:S167P;ENSP00000421128:S167P;ENSP00000408221:S167P;ENSP00000296519:S167P	ENSP00000296519:S167P	S	+	1	0	CEP44	175462087	1.000000	0.71417	0.973000	0.42090	0.039000	0.13416	3.892000	0.56235	2.002000	0.58637	0.383000	0.25322	TCA	.		0.368	CEP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362109.2	NM_030633	
CHMP6	79643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	78972946	78972946	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:78972946C>G	ENST00000325167.5	+	8	677	c.599C>G	c.(598-600)gCt>gGt	p.A200G	CTD-2561B21.7_ENST00000576215.1_RNA|CTD-2561B21.7_ENST00000577061.2_RNA	NM_024591.4	NP_078867.2	Q96FZ7	CHMP6_HUMAN	charged multivesicular body protein 6	200					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein N-terminus binding (GO:0047485)			lung(2)|ovary(1)	3	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0175)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CTGGTGGCAGCTTCGTAACGT	0.617																																					p.A200G		.											.	CHMP6	91	0			c.C599G						.						119.0	98.0	105.0					17																	78972946		2203	4300	6503	SO:0001583	missense	79643	exon8			TGGCAGCTTCGTA	BC010108	CCDS11774.1	17q25.3	2014-08-13	2011-09-21		ENSG00000176108	ENSG00000176108		"""Charged multivesicular body proteins"""	25675	protein-coding gene	gene with protein product		610901	"""chromatin modifying protein 6"""			11559748, 15511219	Standard	NM_024591		Approved	FLJ11749, VPS20	uc002jyw.4	Q96FZ7	OTTHUMG00000177645	ENST00000325167.5:c.599C>G	17.37:g.78972946C>G	ENSP00000317468:p.Ala200Gly	95.0	0.0		128.0	37.0	NM_024591	A8K7U0|Q53FU4|Q9HAE8	Missense_Mutation	SNP	ENST00000325167.5	37	CCDS11774.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.484349	0.84854	.	.	ENSG00000176108	ENST00000325167	T	0.61040	0.14	4.77	4.77	0.60923	.	0.132704	0.49305	D	0.000158	T	0.72277	0.3440	L	0.60455	1.87	0.58432	D	0.999993	D	0.76494	0.999	D	0.78314	0.991	T	0.75602	-0.3261	10	0.72032	D	0.01	-16.2775	15.5945	0.76569	0.0:1.0:0.0:0.0	.	200	Q96FZ7	CHMP6_HUMAN	G	200	ENSP00000317468:A200G	ENSP00000317468:A200G	A	+	2	0	CHMP6	76587541	0.974000	0.33945	0.920000	0.36463	0.904000	0.53231	2.383000	0.44354	2.180000	0.69256	0.645000	0.84053	GCT	.		0.617	CHMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438215.1	NM_024591	
CHRM2	1129	ucsc.edu;mdanderson.org	37	7	136701056	136701056	+	3'UTR	SNP	G	G	T	rs550038279	byFrequency	TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:136701056G>T	ENST00000445907.2	+	0	1972				CHRM2_ENST00000397608.3_3'UTR|CHRM2_ENST00000402486.3_3'UTR|CHRM2_ENST00000401861.1_3'UTR|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000453373.1_3'UTR	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	GGGAGCTTGAGAAGAATAAAA	0.393																																					.		.											.	CHRM2	94	0			.						.						30.0	30.0	30.0					7																	136701056		2175	4283	6458	SO:0001624	3_prime_UTR_variant	1129	.			GCTTGAGAAGAAT		CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.*43G>T	7.37:g.136701056G>T		170.0	0.0		232.0	54.0	.	Q4VBK6|Q9P1X9	RNA	SNP	ENST00000445907.2	37	CCDS5843.1																																																																																			.		0.393	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1		
CIT	11113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	120172998	120172998	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:120172998C>T	ENST00000261833.7	-	24	3049	c.2997G>A	c.(2995-2997)acG>acA	p.T999T	CIT_ENST00000392521.2_Silent_p.T1041T|CIT_ENST00000537607.1_5'UTR	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	999					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TCTCTCGTTCCGTGATCTCCC	0.498																																					p.T1041T		.											.	CIT	399	0			c.G3123A						.						170.0	146.0	154.0					12																	120172998		2203	4300	6503	SO:0001819	synonymous_variant	11113	exon25			TCGTTCCGTGATC	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.2997G>A	12.37:g.120172998C>T		371.0	0.0		450.0	155.0	NM_001206999	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Silent	SNP	ENST00000261833.7	37	CCDS9192.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.053691	0.36277	.	.	ENSG00000122966	ENST00000392520;ENST00000546026	.	.	.	5.23	-10.5	0.00291	.	.	.	.	.	T	0.39489	0.1080	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53222	-0.8469	4	.	.	.	.	3.3542	0.07163	0.1814:0.2758:0.3843:0.1584	.	.	.	.	Q	627;25	.	.	R	-	2	0	CIT	118657381	0.000000	0.05858	0.083000	0.20561	0.966000	0.64601	-6.437000	0.00066	-4.113000	0.00072	-0.294000	0.09567	CGG	.		0.498	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
CLPTM1L	81037	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	1331943	1331943	+	Missense_Mutation	SNP	T	T	C	rs143530499		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:1331943T>C	ENST00000320895.5	-	8	1204	c.947A>G	c.(946-948)aAg>aGg	p.K316R	CLPTM1L_ENST00000507807.1_Missense_Mutation_p.K183R|CLPTM1L_ENST00000320927.6_Missense_Mutation_p.K316R	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	316					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		GATCATGCTCTTCTTCTTCTT	0.537																																					p.K316R		.											.	CLPTM1L	153	0			c.A947G						.						129.0	120.0	123.0					5																	1331943		2203	4298	6501	SO:0001583	missense	81037	exon8			ATGCTCTTCTTCT	AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.947A>G	5.37:g.1331943T>C	ENSP00000313854:p.Lys316Arg	115.0	2.0		184.0	47.0	NM_030782	D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Missense_Mutation	SNP	ENST00000320895.5	37	CCDS3862.1	.	.	.	.	.	.	.	.	.	.	t	14.30	2.494691	0.44352	.	.	ENSG00000049656	ENST00000320895;ENST00000507807;ENST00000320927	T;T;T	0.53423	0.7;0.68;0.62	5.01	5.01	0.66863	.	0.046889	0.85682	D	0.000000	T	0.48714	0.1515	M	0.70787	2.145	0.47276	D	0.999377	B;B	0.14805	0.011;0.001	B;B	0.20955	0.032;0.005	T	0.46076	-0.9217	10	0.35671	T	0.21	-34.6493	14.0181	0.64536	0.0:0.0:0.0:1.0	.	316;183	Q96KA5;G5E9Z2	CLP1L_HUMAN;.	R	316;183;316	ENSP00000313854:K316R;ENSP00000423321:K183R;ENSP00000315196:K316R	ENSP00000313854:K316R	K	-	2	0	CLPTM1L	1384943	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.233000	0.43027	2.006000	0.58801	0.478000	0.44815	AAG	.		0.537	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253649.2	NM_030782	
CNTROB	116840	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7842848	7842848	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:7842848T>C	ENST00000563694.1	+	8	1870	c.945T>C	c.(943-945)gcT>gcC	p.A315A	CNTROB_ENST00000380262.3_Silent_p.A315A|CNTROB_ENST00000380255.3_Silent_p.A315A|CNTROB_ENST00000565740.1_Silent_p.A315A	NM_053051.3	NP_444279.2	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	315					centriole replication (GO:0007099)|centrosome separation (GO:0051299)|cytokinesis (GO:0000910)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)	25		Prostate(122;0.173)				AAAGGCAAGCTCTGACTCTGA	0.577																																					p.A315A		.											.	CNTROB	153	0			c.T945C						.						101.0	97.0	98.0					17																	7842848		2203	4300	6503	SO:0001819	synonymous_variant	116840	exon8			GCAAGCTCTGACT	AF331638	CCDS32557.1, CCDS11126.1	17p13.1	2006-03-15				ENSG00000170037			29616	protein-coding gene	gene with protein product	"""centrobin"""	611425				11984006, 16275750	Standard	NM_001037144		Approved	LIP8, PP1221	uc002gjp.3	Q8N137		ENST00000563694.1:c.945T>C	17.37:g.7842848T>C		135.0	0.0		85.0	6.0	NM_001037144	A6NHQ1|Q331K3|Q69YV7|Q8NCB8|Q8WXV3|Q96CQ7|Q9C060	Silent	SNP	ENST00000563694.1	37	CCDS11126.1																																																																																			.		0.577	CNTROB-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421372.1	NM_053051	
COL27A1	85301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	117015214	117015214	+	Splice_Site	SNP	T	T	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:117015214T>A	ENST00000356083.3	+	27	3532		c.e27+2			NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1						extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						GGACCCCAGGTAAGCAAAGCC	0.552																																					.		.											.	COL27A1	94	0			c.3141+2T>A						.						113.0	102.0	106.0					9																	117015214		2203	4300	6503	SO:0001630	splice_region_variant	85301	exon27			CCCAGGTAAGCAA	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.3141+2T>A	9.37:g.117015214T>A		128.0	0.0		166.0	58.0	NM_032888	Q66K43|Q96JF7	Splice_Site	SNP	ENST00000356083.3	37	CCDS6802.1	.	.	.	.	.	.	.	.	.	.	T	15.39	2.818321	0.50633	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7228	0.46050	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL27A1	116055035	1.000000	0.71417	1.000000	0.80357	0.559000	0.35586	2.612000	0.46343	2.091000	0.63221	0.459000	0.35465	.	.		0.552	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	Intron
CPD	1362	hgsc.bcm.edu;bcgsc.ca	37	17	28770949	28770949	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:28770949T>C	ENST00000225719.4	+	11	2579	c.2503T>C	c.(2503-2505)Ttg>Ctg	p.L835L	CPD_ENST00000543464.2_Silent_p.L588L	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D	835	Carboxypeptidase-like 2.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						CTGGCGTCTCTTGGTTCCAGG	0.448																																					p.L835L		.											.	CPD	92	0			c.T2503C						.						166.0	166.0	166.0					17																	28770949		2203	4300	6503	SO:0001819	synonymous_variant	1362	exon11			CGTCTCTTGGTTC	U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.2503T>C	17.37:g.28770949T>C		61.0	0.0		90.0	5.0	NM_001304	B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Silent	SNP	ENST00000225719.4	37	CCDS11257.1																																																																																			.		0.448	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256214.3	NM_001304	
CSRNP2	81566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	51457625	51457625	+	Silent	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:51457625C>A	ENST00000228515.1	-	5	1833	c.1536G>T	c.(1534-1536)acG>acT	p.T512T		NM_030809.2	NP_110436.1	Q9H175	CSRN2_HUMAN	cysteine-serine-rich nuclear protein 2	512					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	14						CTTCATTGTCCGTGCGGAAGG	0.557																																					p.T512T		.											.	CSRNP2	90	0			c.G1536T						.						65.0	67.0	67.0					12																	51457625		2203	4300	6503	SO:0001819	synonymous_variant	81566	exon5			ATTGTCCGTGCGG	AJ298133	CCDS8807.1	12q13.11-q13.12	2012-04-17	2009-01-07	2009-01-07				"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16006	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 72"""		"""chromosome 12 open reading frame 22"", ""family with sequence similarity 130, member A1"""	C12orf22, FAM130A1		17726538	Standard	NM_030809		Approved	C12ORF2, TAIP-12, PPP1R72	uc001rxu.2	Q9H175		ENST00000228515.1:c.1536G>T	12.37:g.51457625C>A		154.0	0.0		152.0	71.0	NM_030809		Silent	SNP	ENST00000228515.1	37	CCDS8807.1																																																																																			.		0.557	CSRNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404893.1		
CSRNP2	81566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	51457641	51457641	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:51457641C>A	ENST00000228515.1	-	5	1817	c.1520G>T	c.(1519-1521)aGc>aTc	p.S507I		NM_030809.2	NP_110436.1	Q9H175	CSRN2_HUMAN	cysteine-serine-rich nuclear protein 2	507					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	14						GAAGGGGAGGCTTGAGGGGGA	0.552																																					p.S507I		.											.	CSRNP2	90	0			c.G1520T						.						76.0	80.0	79.0					12																	51457641		2203	4300	6503	SO:0001583	missense	81566	exon5			GGGAGGCTTGAGG	AJ298133	CCDS8807.1	12q13.11-q13.12	2012-04-17	2009-01-07	2009-01-07				"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16006	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 72"""		"""chromosome 12 open reading frame 22"", ""family with sequence similarity 130, member A1"""	C12orf22, FAM130A1		17726538	Standard	NM_030809		Approved	C12ORF2, TAIP-12, PPP1R72	uc001rxu.2	Q9H175		ENST00000228515.1:c.1520G>T	12.37:g.51457641C>A	ENSP00000228515:p.Ser507Ile	166.0	0.0		169.0	76.0	NM_030809		Missense_Mutation	SNP	ENST00000228515.1	37	CCDS8807.1	.	.	.	.	.	.	.	.	.	.	C	2.280	-0.365020	0.05103	.	.	ENSG00000110925	ENST00000228515	T	0.44881	0.91	4.7	-5.93	0.02254	.	0.731516	0.13256	N	0.401675	T	0.25568	0.0622	N	0.19112	0.55	0.09310	N	0.999992	B	0.24963	0.115	B	0.32624	0.149	T	0.31998	-0.9923	10	0.59425	D	0.04	-0.9344	9.8188	0.40869	0.0:0.1756:0.117:0.7074	.	507	Q9H175	CSRN2_HUMAN	I	507	ENSP00000228515:S507I	ENSP00000228515:S507I	S	-	2	0	CSRNP2	49743908	0.028000	0.19301	0.029000	0.17559	0.059000	0.15707	-2.027000	0.01433	-1.102000	0.03023	-0.474000	0.04947	AGC	.		0.552	CSRNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404893.1		
CXCR5	643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118764607	118764607	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:118764607G>A	ENST00000292174.4	+	2	530	c.354G>A	c.(352-354)ggG>ggA	p.G118G	BCL9L_ENST00000334801.3_3'UTR	NM_001716.4|NM_032966.2	NP_001707.1|NP_116743.1	P32302	CXCR5_HUMAN	chemokine (C-X-C motif) receptor 5	118					B cell activation (GO:0042113)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|lymph node development (GO:0048535)|positive regulation of cytokinesis (GO:0032467)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		GGGTCCTGGGGACCTTCCTCT	0.622																																					p.G118G		.											.	CXCR5	721	0			c.G354A						.						81.0	72.0	75.0					11																	118764607		2200	4295	6495	SO:0001819	synonymous_variant	643	exon2			CCTGGGGACCTTC	X68829	CCDS8402.1	11q23.3	2012-08-08	2008-01-22	2008-01-22	ENSG00000160683	ENSG00000160683		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	1060	protein-coding gene	gene with protein product		601613	"""Burkitt lymphoma receptor 1, GTP-binding protein"", ""Burkitt lymphoma receptor 1, GTP binding protein (chemokine (C-X-C motif) receptor 5)"""	BLR1		1425907	Standard	NM_001716		Approved	MDR15, CD185	uc001pue.4	P32302	OTTHUMG00000166345	ENST00000292174.4:c.354G>A	11.37:g.118764607G>A		173.0	0.0		177.0	42.0	NM_001716	Q14811	Silent	SNP	ENST00000292174.4	37	CCDS8402.1																																																																																			.		0.622	CXCR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389309.1	NM_001716	
CYGB	114757	hgsc.bcm.edu;bcgsc.ca	37	17	74527573	74527573	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:74527573A>G	ENST00000293230.5	-	2	706	c.344T>C	c.(343-345)cTc>cCc	p.L115P	PRCD_ENST00000592432.1_Intron|CYGB_ENST00000589342.1_Missense_Mutation_p.L115P|CYGB_ENST00000590175.1_Missense_Mutation_p.L50P|CYGB_ENST00000586160.1_5'Flank|CYGB_ENST00000589145.1_Missense_Mutation_p.L50P	NM_134268.4	NP_599030.1	Q8WWM9	CYGB_HUMAN	cytoglobin	115	Globin.				oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)|peroxidase activity (GO:0004601)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)	7						CTTGTGCTTGAGGGCGTGGGC	0.642																																					p.L115P		.											.	CYGB	90	0			c.T344C						.						107.0	91.0	97.0					17																	74527573		2203	4300	6503	SO:0001583	missense	114757	exon2			TGCTTGAGGGCGT	AJ315162	CCDS11746.1	17q25	2008-07-18				ENSG00000161544			16505	protein-coding gene	gene with protein product	"""stellate cell activation-associated protein"", ""histoglobin"""	608759				11919282	Standard	NM_134268		Approved	HGB, STAP	uc002jru.2	Q8WWM9		ENST00000293230.5:c.344T>C	17.37:g.74527573A>G	ENSP00000293230:p.Leu115Pro	57.0	0.0		119.0	5.0	NM_134268	Q541Y7|Q8N2X5	Missense_Mutation	SNP	ENST00000293230.5	37	CCDS11746.1	.	.	.	.	.	.	.	.	.	.	A	18.05	3.536854	0.65085	.	.	ENSG00000161544	ENST00000293230	D	0.92858	-3.12	5.52	5.52	0.82312	Globin-like (1);Globin, structural domain (1);	0.301352	0.35903	N	0.002907	D	0.91855	0.7422	M	0.75447	2.3	0.80722	D	1	B	0.15473	0.013	B	0.23275	0.045	D	0.89250	0.3590	10	0.51188	T	0.08	-10.1027	15.6427	0.77020	1.0:0.0:0.0:0.0	.	115	Q8WWM9	CYGB_HUMAN	P	115	ENSP00000293230:L115P	ENSP00000293230:L115P	L	-	2	0	CYGB	72039168	1.000000	0.71417	1.000000	0.80357	0.572000	0.35998	7.076000	0.76806	2.100000	0.63781	0.379000	0.24179	CTC	.		0.642	CYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450590.1	NM_134268	
DDX50	79009	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	70694063	70694063	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:70694063C>T	ENST00000373585.3	+	9	1455	c.1348C>T	c.(1348-1350)Cgt>Tgt	p.R450C	DDX50_ENST00000466265.1_Intron	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	450	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						TGTGGCTGCCCGTGGTTTGGA	0.403																																					p.R450C		.											.	DDX50	91	0			c.C1348T						.						83.0	85.0	84.0					10																	70694063		2203	4300	6503	SO:0001583	missense	79009	exon9			GCTGCCCGTGGTT	AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.1348C>T	10.37:g.70694063C>T	ENSP00000362687:p.Arg450Cys	52.0	0.0		66.0	24.0	NM_024045	Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	ENST00000373585.3	37	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079049	0.94050	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.79247	-1.25	5.48	5.48	0.80851	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.93151	0.7819	H	0.97852	4.09	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95239	0.8349	10	0.87932	D	0	-7.8583	19.7088	0.96084	0.0:1.0:0.0:0.0	.	450	Q9BQ39	DDX50_HUMAN	C	450	ENSP00000362687:R450C	ENSP00000362687:R450C	R	+	1	0	DDX50	70364069	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.165000	0.77544	2.722000	0.93159	0.561000	0.74099	CGT	.		0.403	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045	
DHRS4L1	728635	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	14	24517998	24517998	+	RNA	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:24517998T>C	ENST00000558293.1	+	0	646					NR_102693.1																						CCTGGACTTATCAAGACTAGC	0.522																																					p.I218T		.											.	.	.	0			c.T653C						.						141.0	137.0	139.0					14																	24517998		2203	4298	6501			728635	exon8			GACTTATCAAGAC																													14.37:g.24517998T>C		674.0	0.0		875.0	334.0	NM_001082488		Missense_Mutation	SNP	ENST00000558293.1	37		.	.	.	.	.	.	.	.	.	.	T	10.56	1.384474	0.25031	.	.	ENSG00000225766	ENST00000397065	.	.	.	4.67	4.67	0.58626	NAD(P)-binding domain (1);	.	.	.	.	T	0.70360	0.3215	L	0.60455	1.87	0.50813	D	0.999890	D	0.89917	1.0	D	0.97110	1.0	T	0.76694	-0.2865	7	0.46703	T	0.11	.	12.0988	0.53772	0.0:0.0:0.0:1.0	.	218	P0CG22	DR4L1_HUMAN	T	218	.	ENSP00000380255:I218T	I	+	2	0	AL136295.1	23587838	1.000000	0.71417	1.000000	0.80357	0.068000	0.16541	6.335000	0.72949	1.958000	0.56883	0.329000	0.21502	ATC	.		0.522	RP11-468E2.9-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417272.1		
DMD	1756	hgsc.bcm.edu;bcgsc.ca	37	X	31497178	31497178	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrX:31497178T>C	ENST00000357033.4	-	58	8796	c.8590A>G	c.(8590-8592)Agt>Ggt	p.S2864G	DMD_ENST00000474231.1_Missense_Mutation_p.S404G|DMD_ENST00000378677.2_Missense_Mutation_p.S2860G|DMD_ENST00000378707.3_Missense_Mutation_p.S404G|DMD_ENST00000343523.2_Missense_Mutation_p.S404G|DMD_ENST00000445312.1_5'UTR|DMD_ENST00000541735.1_Missense_Mutation_p.S404G|DMD_ENST00000359836.1_Missense_Mutation_p.S404G	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2864					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCAAGAGTACTCATGATTACA	0.393																																					p.S2864G		.											.	DMD	265	0			c.A8590G						.						96.0	85.0	89.0					X																	31497178		2202	4300	6502	SO:0001583	missense	1756	exon58			GAGTACTCATGAT	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8590A>G	X.37:g.31497178T>C	ENSP00000354923:p.Ser2864Gly	72.0	0.0		93.0	4.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.00|11.00	1.511477|1.511477	0.27036|0.27036	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000465285|ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231	.|T;T;T;T;T;T;T;T	.|0.36157	.|1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|0.159222	.|0.28533	.|U	.|0.015006	T|T	0.42854|0.42854	0.1221|0.1221	L|L	0.37850|0.37850	1.14|1.14	0.31735|0.31735	N|N	0.636534|0.636534	.|P;B;B;B;B;B;B;B;B;B;B	.|0.42337	.|0.776;0.001;0.001;0.001;0.001;0.002;0.001;0.001;0.0;0.001;0.007	.|P;B;B;B;B;B;B;B;B;B;B	.|0.51615	.|0.675;0.001;0.003;0.001;0.001;0.02;0.003;0.002;0.001;0.001;0.011	T|T	0.52873|0.52873	-0.8517|-0.8517	5|10	.|0.52906	.|T	.|0.07	.|.	14.2317|14.2317	0.65898|0.65898	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|2856;2864;2860;1523;1520;404;404;404;404;404;2741	.|P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3	.|.;DMD_HUMAN;.;.;.;.;.;.;.;.;.	G|G	592|2856;1523;1520;560;2860;2864;404;404;2864;2741;404;404;404	.|ENSP00000350765:S560G;ENSP00000367948:S2860G;ENSP00000354923:S2864G;ENSP00000352894:S404G;ENSP00000340057:S404G;ENSP00000367979:S404G;ENSP00000444119:S404G;ENSP00000417123:S404G	.|ENSP00000340057:S404G	E|S	-|-	2|1	0|0	DMD|DMD	31407099|31407099	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.244000|4.244000	0.58728|0.58728	1.807000|1.807000	0.52817|0.52817	0.486000|0.486000	0.48141|0.48141	GAG|AGT	.		0.393	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
DNAH2	146754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7721766	7721766	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:7721766T>C	ENST00000572933.1	+	69	11984	c.10524T>C	c.(10522-10524)gcT>gcC	p.A3508A	DNAH2_ENST00000389173.2_Silent_p.A3508A			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3508	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TCAACTTTGCTGTTAAAGAAC	0.488																																					p.A3508A		.											.	DNAH2	102	0			c.T10524C						.						171.0	168.0	169.0					17																	7721766		2203	4300	6503	SO:0001819	synonymous_variant	146754	exon68			CTTTGCTGTTAAA	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.10524T>C	17.37:g.7721766T>C		80.0	0.0		57.0	33.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	CCDS32551.1																																																																																			.		0.488	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
DOCK1	1793	ucsc.edu;bcgsc.ca	37	10	128835998	128835998	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:128835998T>C	ENST00000280333.6	+	19	1974	c.1865T>C	c.(1864-1866)cTc>cCc	p.L622P		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	622					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CTTCTGGGGCTCTTGAAATGG	0.468																																					p.L622P		.											.	DOCK1	698	0			c.T1865C						.						53.0	50.0	51.0					10																	128835998		1873	4109	5982	SO:0001583	missense	1793	exon19			TGGGGCTCTTGAA	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.1865T>C	10.37:g.128835998T>C	ENSP00000280333:p.Leu622Pro	78.0	0.0		46.0	4.0	NM_001380	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	37		.	.	.	.	.	.	.	.	.	.	T	19.80	3.894991	0.72639	.	.	ENSG00000150760	ENST00000280333	T	0.29397	1.57	4.73	4.73	0.59995	.	0.000000	0.64402	D	0.000003	T	0.66076	0.2753	H	0.94183	3.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.77186	-0.2680	10	0.87932	D	0	.	14.4146	0.67139	0.0:0.0:0.0:1.0	.	622;622	B2RUU3;Q14185	.;DOCK1_HUMAN	P	622	ENSP00000280333:L622P	ENSP00000280333:L622P	L	+	2	0	DOCK1	128725988	1.000000	0.71417	0.593000	0.28771	0.893000	0.52053	7.615000	0.83006	1.990000	0.58119	0.379000	0.24179	CTC	.		0.468	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
DRD3	1814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	113850192	113850192	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:113850192T>G	ENST00000460779.1	-	7	1068	c.779A>C	c.(778-780)cAg>cCg	p.Q260P	DRD3_ENST00000383673.2_Missense_Mutation_p.Q260P|DRD3_ENST00000467632.1_Missense_Mutation_p.Q260P|DRD3_ENST00000295881.7_Missense_Mutation_p.Q260P	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	260					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GGCAGTGTCCTGGCAGATGCT	0.542																																					p.Q260P		.											.	DRD3	93	0			c.A779C						.						136.0	139.0	138.0					3																	113850192		2203	4300	6503	SO:0001583	missense	1814	exon6			GTGTCCTGGCAGA		CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.779A>C	3.37:g.113850192T>G	ENSP00000419402:p.Gln260Pro	120.0	0.0		195.0	67.0	NM_033663	A1A4V5|Q4VBM8	Missense_Mutation	SNP	ENST00000460779.1	37	CCDS2978.1	.	.	.	.	.	.	.	.	.	.	T	11.89	1.772316	0.31411	.	.	ENSG00000151577	ENST00000460779;ENST00000467632;ENST00000383673;ENST00000281274;ENST00000295881	T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.65	5.64	5.64	0.86602	GPCR, rhodopsin-like superfamily (1);	0.229185	0.41605	D	0.000856	T	0.58133	0.2101	L	0.33668	1.02	0.47153	D	0.999332	B;B;B;B	0.12630	0.006;0.0;0.0;0.001	B;B;B;B	0.15870	0.014;0.004;0.004;0.009	T	0.53690	-0.8403	10	0.27785	T	0.31	.	10.8001	0.46483	0.0:0.0736:0.0:0.9264	.	260;260;260;260	A1A4V4;A8K8E4;P35462;E9PCM4	.;.;DRD3_HUMAN;.	P	260	ENSP00000419402:Q260P;ENSP00000420662:Q260P;ENSP00000373169:Q260P;ENSP00000295881:Q260P	ENSP00000281274:Q260P	Q	-	2	0	DRD3	115332882	1.000000	0.71417	0.999000	0.59377	0.913000	0.54294	5.399000	0.66314	2.367000	0.80283	0.528000	0.53228	CAG	.		0.542	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354699.1	NM_000796.3	
DUPD1	338599	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	76818256	76818256	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:76818256A>T	ENST00000338487.5	-	1	16	c.17T>A	c.(16-18)gTg>gAg	p.V6E		NM_001003892.1	NP_001003892.1	Q68J44	DUPD1_HUMAN	dual specificity phosphatase and pro isomerase domain containing 1	6					protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(2)|lung(5)|ovary(2)|urinary_tract(1)	11	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					GCTTGTCTTCACTTCTCCAGA	0.532																																					p.V6E		.											.	DUPD1	92	0			c.T17A						.						68.0	65.0	66.0					10																	76818256		2203	4300	6503	SO:0001583	missense	338599	exon1			GTCTTCACTTCTC		CCDS31223.1	10q22.3	2011-06-09			ENSG00000188716	ENSG00000188716		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	23481	protein-coding gene	gene with protein product							Standard	NM_001003892		Approved	DUSP27	uc001jwq.1	Q68J44	OTTHUMG00000018512	ENST00000338487.5:c.17T>A	10.37:g.76818256A>T	ENSP00000340609:p.Val6Glu	53.0	0.0		79.0	23.0	NM_001003892	B2RP93	Missense_Mutation	SNP	ENST00000338487.5	37	CCDS31223.1	.	.	.	.	.	.	.	.	.	.	A	0.014	-1.578326	0.00879	.	.	ENSG00000188716	ENST00000338487	T	0.04706	3.57	5.13	1.99	0.26369	.	3.565550	0.00861	N	0.001920	T	0.04452	0.0122	L	0.27053	0.805	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.42799	-0.9430	10	0.11794	T	0.64	0.0675	6.265	0.20922	0.1029:0.363:0.5341:0.0	.	6	Q68J44	DUPD1_HUMAN	E	6	ENSP00000340609:V6E	ENSP00000340609:V6E	V	-	2	0	DUPD1	76488262	0.002000	0.14202	0.020000	0.16555	0.727000	0.41649	1.316000	0.33620	0.530000	0.28619	-0.468000	0.05107	GTG	.		0.532	DUPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048777.2	XM_291741	
EIF4G2	1982	hgsc.bcm.edu;bcgsc.ca	37	11	10824623	10824623	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:10824623T>C	ENST00000526148.1	-	11	1460	c.950A>G	c.(949-951)gAc>gGc	p.D317G	EIF4G2_ENST00000525681.1_Missense_Mutation_p.D317G|SNORD97_ENST00000459187.1_RNA|EIF4G2_ENST00000525995.1_5'Flank|RP11-685M7.5_ENST00000532365.1_RNA|EIF4G2_ENST00000396525.2_Missense_Mutation_p.D317G|EIF4G2_ENST00000339995.5_Missense_Mutation_p.D317G	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		TGGTCCATTGTCAAGAAAAGC	0.348																																					p.D317G		.											.	EIF4G2	91	0			c.A950G						.						86.0	82.0	83.0					11																	10824623		2201	4294	6495	SO:0001583	missense	1982	exon11			CCATTGTCAAGAA	U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.950A>G	11.37:g.10824623T>C	ENSP00000433664:p.Asp317Gly	99.0	0.0		125.0	5.0	NM_001042559		Missense_Mutation	SNP	ENST00000526148.1	37	CCDS31428.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.322942	0.81580	.	.	ENSG00000110321	ENST00000526148;ENST00000525681;ENST00000339995;ENST00000396525;ENST00000429377;ENST00000531416	T;T;T;T;T	0.26660	2.04;2.04;2.04;2.05;1.72	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.43765	0.1262	L	0.59436	1.845	0.50171	D	0.999854	D;D;D	0.62365	0.991;0.985;0.985	P;P;P	0.56751	0.805;0.714;0.643	T	0.48091	-0.9065	9	0.66056	D	0.02	-7.3949	16.6407	0.85098	0.0:0.0:0.0:1.0	.	317;317;390	P78344-2;P78344;B4DZF2	.;IF4G2_HUMAN;.	G	317;317;317;317;390;317	ENSP00000433664:D317G;ENSP00000433371:D317G;ENSP00000340281:D317G;ENSP00000379778:D317G;ENSP00000431583:D317G	ENSP00000340281:D317G	D	-	2	0	EIF4G2	10781199	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.910000	0.87451	2.326000	0.78906	0.533000	0.62120	GAC	.		0.348	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386603.1	NM_001418	
EP400	57634	hgsc.bcm.edu;bcgsc.ca	37	12	132527997	132527997	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:132527997T>C	ENST00000333577.4	+	34	6573	c.6464T>C	c.(6463-6465)tTc>tCc	p.F2155S	EP400_ENST00000389561.2_Missense_Mutation_p.F2119S|EP400_ENST00000330386.6_Missense_Mutation_p.F2038S|EP400_ENST00000389562.2_Missense_Mutation_p.F2118S|EP400_ENST00000332482.4_Missense_Mutation_p.F2082S			Q96L91	EP400_HUMAN	E1A binding protein p400	2155					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CTAGCTGACTTCATGGAGCAG	0.408																																					p.F2119S		.											.	EP400	520	0			c.T6356C						.						115.0	104.0	108.0					12																	132527997		2203	4300	6503	SO:0001583	missense	57634	exon33			CTGACTTCATGGA	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.6464T>C	12.37:g.132527997T>C	ENSP00000333602:p.Phe2155Ser	82.0	0.0		82.0	4.0	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		.	.	.	.	.	.	.	.	.	.	T	11.83	1.756523	0.31137	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296	D;D;D;D;D	0.89875	-2.58;-2.57;-2.57;-2.57;-2.57	5.74	5.74	0.90152	.	0.169215	0.50627	D	0.000107	D	0.88153	0.6360	L	0.51422	1.61	0.40413	D	0.979764	P;P;P	0.45827	0.867;0.867;0.867	B;B;B	0.44044	0.439;0.439;0.439	D	0.89987	0.4105	10	0.87932	D	0	.	16.0315	0.80582	0.0:0.0:0.0:1.0	.	2119;2038;2118	Q96L91-2;Q96L91-4;Q96L91-5	.;.;.	S	2155;2119;2118;2082;2038;2119	ENSP00000333602:F2155S;ENSP00000374212:F2119S;ENSP00000374213:F2118S;ENSP00000331737:F2082S;ENSP00000330620:F2038S	ENSP00000330620:F2038S	F	+	2	0	EP400	131093950	1.000000	0.71417	0.997000	0.53966	0.355000	0.29361	7.305000	0.78891	2.186000	0.69663	0.455000	0.32223	TTC	.		0.408	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
EPHB2	2048	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	23232489	23232489	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:23232489G>T	ENST00000400191.3	+	10	1793	c.1775G>T	c.(1774-1776)gGc>gTc	p.G592V	EPHB2_ENST00000374627.1_Missense_Mutation_p.G587V|EPHB2_ENST00000374632.3_Missense_Mutation_p.G593V|EPHB2_ENST00000374630.3_Missense_Mutation_p.G592V	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	592					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		GTGACCCCAGGCATGAAGATC	0.522																																					p.G593V		.											.	EPHB2	1381	0			c.G1778T						.						85.0	79.0	81.0					1																	23232489		2203	4300	6503	SO:0001583	missense	2048	exon10			CCCCAGGCATGAA	AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.1775G>T	1.37:g.23232489G>T	ENSP00000383053:p.Gly592Val	99.0	0.0		89.0	38.0	NM_004442	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	ENST00000400191.3	37		.	.	.	.	.	.	.	.	.	.	G	21.6	4.180541	0.78677	.	.	ENSG00000133216	ENST00000374625;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	T;T;T;T	0.12465	2.68;2.68;2.68;2.68	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.46229	0.1382	M	0.90542	3.125	0.80722	D	1	B;D;D;D	0.76494	0.035;0.999;0.998;0.995	B;D;D;D	0.76575	0.026;0.988;0.98;0.985	T	0.54417	-0.8297	10	0.66056	D	0.02	.	17.4757	0.87658	0.0:0.0:1.0:0.0	.	534;592;610;593	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	V	534;592;592;593;587	ENSP00000363761:G592V;ENSP00000383053:G592V;ENSP00000363763:G593V;ENSP00000363758:G587V	ENSP00000363755:G534V	G	+	2	0	EPHB2	23105076	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.601000	0.98297	2.774000	0.95407	0.644000	0.83932	GGC	.		0.522	EPHB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000008060.2	NM_017449	
EVX1	2128	broad.mit.edu;mdanderson.org	37	7	27285622	27285622	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:27285622G>C	ENST00000496902.4	+	3	1288	c.802G>C	c.(802-804)Ggc>Cgc	p.G268R	EVX1-AS_ENST00000517726.1_RNA|EVX1_ENST00000222761.3_3'UTR|EVX1_ENST00000535619.1_Missense_Mutation_p.G86R|EVX1-AS_ENST00000519218.1_RNA			P49640	EVX1_HUMAN	even-skipped homeobox 1	268					embryo development ending in birth or egg hatching (GO:0009792)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|liver(1)|lung(10)|prostate(1)|skin(1)	14						GGCCGCGGGCGGCCTGCCCTA	0.731																																					p.G268R		.											.	EVX1	91	0			c.G802C						.						13.0	17.0	16.0					7																	27285622		2193	4279	6472	SO:0001583	missense	2128	exon3			GCGGGCGGCCTGC		CCDS5413.1	7p15.2	2012-03-09	2007-02-15		ENSG00000106038	ENSG00000106038		"""Homeoboxes / ANTP class : HOXL subclass"""	3506	protein-coding gene	gene with protein product		142996	"""eve, even-skipped homeobox homolog 1 (Drosophila)"""			1684419	Standard	XM_005249640		Approved		uc003szd.1	P49640	OTTHUMG00000023093	ENST00000496902.4:c.802G>C	7.37:g.27285622G>C	ENSP00000419266:p.Gly268Arg	31.0	0.0		11.0	6.0	NM_001989	A4D199|B4DQJ0	Missense_Mutation	SNP	ENST00000496902.4	37	CCDS5413.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.745628	0.49151	.	.	ENSG00000106038	ENST00000496902;ENST00000535619	D;D	0.92595	-2.9;-3.07	5.26	3.18	0.36537	.	0.182222	0.56097	D	0.000024	T	0.74696	0.3750	N	0.03608	-0.345	0.36078	D	0.842604	P	0.39216	0.664	B	0.30401	0.115	T	0.75795	-0.3192	10	0.40728	T	0.16	-14.3194	4.1216	0.10108	0.5097:0.0:0.4903:0.0	.	268	P49640	EVX1_HUMAN	R	268;86	ENSP00000419266:G268R;ENSP00000446458:G86R	ENSP00000419266:G268R	G	+	1	0	EVX1	27252147	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.040000	0.64191	1.207000	0.43291	0.462000	0.41574	GGC	.		0.731	EVX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358750.3		
EXTL3	2137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	28575571	28575571	+	Silent	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:28575571G>T	ENST00000220562.4	+	3	2897	c.1995G>T	c.(1993-1995)gtG>gtT	p.V665V	EXTL3_ENST00000523149.1_Silent_p.V281V|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	665					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		AGTTCACGGTGGTGATGTTGA	0.542																																					p.V665V		.											.	EXTL3	92	0			c.G1995T						.						132.0	125.0	127.0					8																	28575571		2203	4300	6503	SO:0001819	synonymous_variant	2137	exon3			CACGGTGGTGATG	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.1995G>T	8.37:g.28575571G>T		222.0	1.0		165.0	94.0	NM_001440	D3DST8|O00225|Q53XT3	Silent	SNP	ENST00000220562.4	37	CCDS6070.1																																																																																			.		0.542	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440	
F3	2152	hgsc.bcm.edu;bcgsc.ca	37	1	95001634	95001634	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:95001634T>C	ENST00000334047.7	-	3	462	c.299A>G	c.(298-300)aAg>aGg	p.K100R	F3_ENST00000480356.1_5'UTR|F3_ENST00000370207.4_Missense_Mutation_p.K100R	NM_001993.4	NP_001984.1	P13726	TF_HUMAN	coagulation factor III (thromboplastin, tissue factor)	100					activation of blood coagulation via clotting cascade (GO:0002543)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of plasma proteins involved in acute inflammatory response (GO:0002541)|blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)|protease binding (GO:0002020)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)	14		all_lung(203;0.00106)|Lung NSC(277;0.00475)		all cancers(265;0.0232)|Epithelial(280;0.121)	Coagulation factor VIIa(DB00036)	GTACGTCTGCTTCACATCCTT	0.493																																					p.K100R	Melanoma(40;358 1339 15970 39161)	.											.	F3	90	0			c.A299G						.						257.0	229.0	239.0					1																	95001634		2203	4300	6503	SO:0001583	missense	2152	exon3			GTCTGCTTCACAT	BC011029	CCDS750.1, CCDS53345.1	1p22-p21	2012-10-02			ENSG00000117525	ENSG00000117525		"""CD molecules"""	3541	protein-coding gene	gene with protein product		134390					Standard	NM_001993		Approved	CD142	uc001dqr.3	P13726	OTTHUMG00000010716	ENST00000334047.7:c.299A>G	1.37:g.95001634T>C	ENSP00000334145:p.Lys100Arg	108.0	0.0		121.0	5.0	NM_001993	D3DT47|Q6FHG2|Q86WH4	Missense_Mutation	SNP	ENST00000334047.7	37	CCDS750.1	.	.	.	.	.	.	.	.	.	.	T	8.932	0.963624	0.18583	.	.	ENSG00000117525	ENST00000334047;ENST00000370207	T;T	0.74737	-0.87;-0.87	5.48	-5.38	0.02673	Fibronectin, type III (1);Immunoglobulin-like fold (1);	1.429860	0.04043	N	0.303347	T	0.28830	0.0715	N	0.21097	0.63	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.05767	-1.0865	10	0.23302	T	0.38	.	1.8111	0.03090	0.128:0.3306:0.2626:0.2788	.	100;100	P13726-2;P13726	.;TF_HUMAN	R	100	ENSP00000334145:K100R;ENSP00000359226:K100R	ENSP00000334145:K100R	K	-	2	0	F3	94774222	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.596000	0.05720	-0.867000	0.04063	-0.479000	0.04858	AAG	.		0.493	F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029593.1	NM_001993	
FBXO38	81545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	147807217	147807217	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:147807217G>A	ENST00000340253.5	+	15	2528	c.2360G>A	c.(2359-2361)aGa>aAa	p.R787K	FBXO38_ENST00000394370.3_Missense_Mutation_p.R787K|FBXO38_ENST00000513826.1_Intron|FBXO38_ENST00000296701.6_Intron|CTD-2283N19.1_ENST00000520980.2_RNA			Q6PIJ6	FBX38_HUMAN	F-box protein 38	787					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)			ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCCAAAGGAGAACTAGCAGG	0.572																																					p.R787K		.											.	FBXO38	231	0			c.G2360A						.						56.0	51.0	53.0					5																	147807217		2203	4300	6503	SO:0001583	missense	81545	exon15			AAAGGAGAACTAG	BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.2360G>A	5.37:g.147807217G>A	ENSP00000342023:p.Arg787Lys	82.0	0.0		100.0	33.0	NM_030793	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	ENST00000340253.5	37		.	.	.	.	.	.	.	.	.	.	G	13.21	2.169095	0.38315	.	.	ENSG00000145868	ENST00000340253;ENST00000394370	T;T	0.32988	1.51;1.43	6.04	6.04	0.98038	.	0.233362	0.46145	D	0.000307	T	0.23171	0.0560	N	0.24115	0.695	0.80722	D	1	B;P	0.36837	0.206;0.571	B;B	0.33392	0.124;0.163	T	0.02411	-1.1163	10	0.24483	T	0.36	-16.3308	19.1586	0.93522	0.0:0.0:1.0:0.0	.	787;787	Q6PIJ6-2;Q6PIJ6	.;FBX38_HUMAN	K	787	ENSP00000342023:R787K;ENSP00000377895:R787K	ENSP00000342023:R787K	R	+	2	0	FBXO38	147787410	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.698000	0.68302	2.873000	0.98535	0.563000	0.77884	AGA	.		0.572	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793	
FAT2	2196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	150908876	150908876	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:150908876T>C	ENST00000261800.5	-	14	9901	c.9889A>G	c.(9889-9891)Agc>Ggc	p.S3297G		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3297	Cadherin 29. {ECO:0000255|PROSITE- ProRule:PRU00043}.|Poly-Ser.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAAGAGGAGCTCTTCCGGCTG	0.522																																					p.S3297G		.											.	FAT2	96	0			c.A9889G						.						148.0	137.0	141.0					5																	150908876		2203	4300	6503	SO:0001583	missense	2196	exon14			AGGAGCTCTTCCG	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.9889A>G	5.37:g.150908876T>C	ENSP00000261800:p.Ser3297Gly	106.0	0.0		122.0	44.0	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.941|3.941	-0.014242|-0.014242	0.07681|0.07681	.|.	.|.	ENSG00000086570|ENSG00000086570	ENST00000520200|ENST00000261800	.|T	.|0.29917	.|1.55	5.58|5.58	1.56|1.56	0.23342|0.23342	.|Cadherin (4);Cadherin-like (1);	.|0.268112	.|0.32416	.|N	.|0.006121	T|T	0.05547|0.05547	0.0146|0.0146	N|N	0.00204|0.00204	-1.855|-1.855	0.26777|0.26777	N|N	0.96967|0.96967	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.42447|0.42447	-0.9451|-0.9451	5|10	.|0.02654	.|T	.|1	.|.	9.0585|9.0585	0.36421|0.36421	0.0:0.5909:0.0:0.4091|0.0:0.5909:0.0:0.4091	.|.	.|3297	.|Q9NYQ8	.|FAT2_HUMAN	G|G	155|3297	.|ENSP00000261800:S3297G	.|ENSP00000261800:S3297G	E|S	-|-	2|1	0|0	FAT2|FAT2	150889069|150889069	0.036000|0.036000	0.19791|0.19791	0.999000|0.999000	0.59377|0.59377	0.968000|0.968000	0.65278|0.65278	0.598000|0.598000	0.24074|0.24074	0.246000|0.246000	0.21394|0.21394	0.519000|0.519000	0.50382|0.50382	GAG|AGC	.		0.522	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
FLT4	2324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	180036905	180036905	+	Splice_Site	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:180036905C>A	ENST00000261937.6	-	28	3885	c.3807G>T	c.(3805-3807)gtG>gtT	p.V1269V	FLT4_ENST00000502649.1_Splice_Site_p.V1269V|FLT4_ENST00000393347.3_Splice_Site_p.V1269V	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	1269					blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGTGAAGTACCACAGAGCCTT	0.607																																					p.V1269V	Colon(97;1075 1466 27033 27547 35871)	.											.	FLT4	1490	0			c.G3807T						.						135.0	127.0	129.0					5																	180036905		2203	4300	6503	SO:0001630	splice_region_variant	2324	exon28			AAGTACCACAGAG	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.3807+1G>T	5.37:g.180036905C>A		109.0	0.0		124.0	49.0	NM_182925	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Silent	SNP	ENST00000261937.6	37	CCDS4457.1																																																																																			.		0.607	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		Silent
FNTA	2339	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	42939883	42939883	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:42939883T>C	ENST00000302279.3	+	8	1070	c.876T>C	c.(874-876)taT>taC	p.Y292Y	FNTA_ENST00000529687.1_Silent_p.Y141Y|FNTA_ENST00000342116.4_Silent_p.Y225Y	NM_002027.2	NP_002018.1	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha	292					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|phototransduction, visible light (GO:0007603)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of tubulin deacetylation (GO:0090044)|protein farnesylation (GO:0018343)|protein geranylgeranylation (GO:0018344)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transforming growth factor beta receptor signaling pathway (GO:0007179)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	alpha-tubulin binding (GO:0043014)|CAAX-protein geranylgeranyltransferase activity (GO:0004662)|microtubule binding (GO:0008017)|protein farnesyltransferase activity (GO:0004660)|protein geranylgeranyltransferase activity (GO:0004661)			cervix(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	16	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			TTTCCAAATATCCTAATCTGT	0.343																																					p.Y292Y		.											.	FNTA	91	0			c.T876C						.						70.0	67.0	68.0					8																	42939883		2203	4300	6503	SO:0001819	synonymous_variant	2339	exon8			CAAATATCCTAAT	L10413	CCDS6140.1	8p11.21	2011-06-27			ENSG00000168522	ENSG00000168522		"""Prenyltransferase alpha subunit repeat containing"""	3782	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 2"""	134635				8276393	Standard	NR_033698		Approved	FPTA, PGGT1A, PTAR2	uc003xps.3	P49354	OTTHUMG00000165279	ENST00000302279.3:c.876T>C	8.37:g.42939883T>C		89.0	0.0		104.0	6.0	NM_002027	A6NJW0|Q53XJ9|Q9UDC1	Silent	SNP	ENST00000302279.3	37	CCDS6140.1																																																																																			.		0.343	FNTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383178.1	NM_002027	
GALNT6	11226	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	51748219	51748219	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:51748219G>T	ENST00000543196.2	-	11	2018	c.1813C>A	c.(1813-1815)Cca>Aca	p.P605T	GALNT6_ENST00000356317.3_Missense_Mutation_p.P605T			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	605	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GCCATGGCTGGCTTTTTGTCC	0.547																																					p.P605T		.											.	GALNT6	92	0			c.C1813A						.						89.0	83.0	85.0					12																	51748219		2203	4300	6503	SO:0001583	missense	11226	exon12			TGGCTGGCTTTTT	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.1813C>A	12.37:g.51748219G>T	ENSP00000444171:p.Pro605Thr	159.0	1.0		210.0	23.0	NM_007210	Q8IYH4|Q9H6G2|Q9UIV5	Missense_Mutation	SNP	ENST00000543196.2	37	CCDS8813.1	.	.	.	.	.	.	.	.	.	.	G	16.67	3.188865	0.57909	.	.	ENSG00000139629	ENST00000543196;ENST00000356317;ENST00000546163	T;T	0.77489	-1.1;-1.1	4.18	4.18	0.49190	Ricin B-related lectin (1);Ricin B lectin (3);	0.481828	0.23012	N	0.052949	D	0.88123	0.6352	M	0.89904	3.07	0.40042	D	0.975661	D	0.60575	0.988	D	0.62955	0.909	D	0.88017	0.2766	10	0.32370	T	0.25	.	14.45	0.67379	0.0:0.0:1.0:0.0	.	605	Q8NCL4	GALT6_HUMAN	T	605;605;586	ENSP00000444171:P605T;ENSP00000348668:P605T	ENSP00000348668:P605T	P	-	1	0	GALNT6	50034486	1.000000	0.71417	0.980000	0.43619	0.531000	0.34715	5.000000	0.63940	2.614000	0.88457	0.561000	0.74099	CCA	.		0.547	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210	
GAS2L2	246176	hgsc.bcm.edu;bcgsc.ca	37	17	34073039	34073039	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:34073039A>G	ENST00000254466.6	-	6	1504	c.1477T>C	c.(1477-1479)Tct>Cct	p.S493P	GAS2L2_ENST00000587565.1_Missense_Mutation_p.S477P	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	493					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGGGTTGGAGAACGGACAGAC	0.627																																					p.S493P		.											.	GAS2L2	227	0			c.T1477C						.						95.0	97.0	96.0					17																	34073039		2203	4300	6503	SO:0001583	missense	246176	exon6			TTGGAGAACGGAC	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1477T>C	17.37:g.34073039A>G	ENSP00000254466:p.Ser493Pro	53.0	0.0		77.0	4.0	NM_139285	Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	37	CCDS11298.1	.	.	.	.	.	.	.	.	.	.	A	5.721	0.317597	0.10845	.	.	ENSG00000132139	ENST00000254466	T	0.25579	1.79	4.99	2.71	0.32032	.	0.511250	0.19144	N	0.121624	T	0.14141	0.0342	N	0.20986	0.625	0.09310	N	0.999999	B	0.24533	0.105	B	0.22880	0.042	T	0.19353	-1.0308	10	0.49607	T	0.09	-5.9467	3.2615	0.06850	0.6464:0.0:0.1822:0.1714	.	493	Q8NHY3	GA2L2_HUMAN	P	493	ENSP00000254466:S493P	ENSP00000254466:S493P	S	-	1	0	GAS2L2	31097152	0.005000	0.15991	0.000000	0.03702	0.004000	0.04260	0.273000	0.18662	0.362000	0.24319	-0.290000	0.09829	TCT	.		0.627	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285	
GIMAP8	155038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150171348	150171348	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:150171348A>G	ENST00000307271.3	+	4	1505	c.931A>G	c.(931-933)Aac>Gac	p.N311D		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	311	AIG1-type G 2.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		ATCTTTAAAGAACATTGACTC	0.453																																					p.N311D		.											.	GIMAP8	95	0			c.A931G						.						73.0	79.0	77.0					7																	150171348		2203	4300	6503	SO:0001583	missense	155038	exon4			TTAAAGAACATTG	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.931A>G	7.37:g.150171348A>G	ENSP00000305107:p.Asn311Asp	63.0	0.0		126.0	31.0	NM_175571		Missense_Mutation	SNP	ENST00000307271.3	37	CCDS34777.1	.	.	.	.	.	.	.	.	.	.	A	0.331	-0.956063	0.02267	.	.	ENSG00000171115	ENST00000307271	T	0.60797	0.16	4.47	-4.85	0.03142	AIG1 (1);	1.311810	0.05394	N	0.539498	T	0.18087	0.0434	N	0.00991	-1.07	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.19745	-1.0296	10	0.05833	T	0.94	.	2.3223	0.04214	0.479:0.1544:0.2523:0.1143	.	311	Q8ND71	GIMA8_HUMAN	D	311	ENSP00000305107:N311D	ENSP00000305107:N311D	N	+	1	0	GIMAP8	149802281	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-2.558000	0.00923	-0.941000	0.03700	-0.297000	0.09499	AAC	.		0.453	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571	
GLDC	2731	hgsc.bcm.edu;bcgsc.ca	37	9	6554742	6554742	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:6554742A>G	ENST00000321612.6	-	19	2392	c.2242T>C	c.(2242-2244)Tcg>Ccg	p.S748P		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	748					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	TTTAGGTGCGAGACATCAGAC	0.552																																					p.S748P		.											.	GLDC	92	0			c.T2242C						.						64.0	54.0	57.0					9																	6554742		2203	4300	6503	SO:0001583	missense	2731	exon19			GGTGCGAGACATC	D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.2242T>C	9.37:g.6554742A>G	ENSP00000370737:p.Ser748Pro	52.0	0.0		74.0	5.0	NM_000170	Q2M2F8	Missense_Mutation	SNP	ENST00000321612.6	37	CCDS34987.1	.	.	.	.	.	.	.	.	.	.	A	18.54	3.645367	0.67358	.	.	ENSG00000178445	ENST00000321612	D	0.98060	-4.69	5.37	5.37	0.77165	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.99099	0.9690	H	0.96365	3.81	0.80722	D	1	D	0.76494	0.999	D	0.68621	0.959	D	0.99271	1.0893	10	0.72032	D	0.01	-11.6913	15.6542	0.77121	1.0:0.0:0.0:0.0	.	748	P23378	GCSP_HUMAN	P	748	ENSP00000370737:S748P	ENSP00000370737:S748P	S	-	1	0	GLDC	6544742	1.000000	0.71417	0.997000	0.53966	0.288000	0.27193	8.927000	0.92846	2.162000	0.67917	0.379000	0.24179	TCG	.		0.552	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051674.2	NM_000170	
GMEB1	10691	hgsc.bcm.edu;bcgsc.ca	37	1	29040628	29040628	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:29040628T>C	ENST00000294409.2	+	10	1155	c.1065T>C	c.(1063-1065)gaT>gaC	p.D355D	GMEB1_ENST00000480454.1_3'UTR|GMEB1_ENST00000361872.4_Silent_p.D345D|GMEB1_ENST00000373816.1_Silent_p.D345D	NM_006582.3	NP_006573.2	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding protein 1	355					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)	11		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		AAGGCCAGGATCACAGGCTGA	0.493																																					p.D355D		.											.	GMEB1	90	0			c.T1065C						.						89.0	96.0	94.0					1																	29040628		2203	4300	6503	SO:0001819	synonymous_variant	10691	exon10			CCAGGATCACAGG	AF099013	CCDS327.1, CCDS328.1	1p35	2008-02-05			ENSG00000162419	ENSG00000162419			4370	protein-coding gene	gene with protein product		604409				10386584, 10523663	Standard	NM_006582		Approved	P96PIF, PIF96	uc001bra.3	Q9Y692	OTTHUMG00000003647	ENST00000294409.2:c.1065T>C	1.37:g.29040628T>C		88.0	0.0		89.0	4.0	NM_006582	B1AT48|Q9NWH1|Q9UKD0	Silent	SNP	ENST00000294409.2	37	CCDS327.1																																																																																			.		0.493	GMEB1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000010333.1	NM_006582	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	89954088	89954088	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:89954088T>C	ENST00000405460.2	+	21	4841	c.4745T>C	c.(4744-4746)aTa>aCa	p.I1582T		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1582	Calx-beta 11. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GGAGCTTGTATACCAGAGGTA	0.368																																					p.I1582T		.											.	GPR98	103	0			c.T4745C						.						66.0	63.0	64.0					5																	89954088		1814	4080	5894	SO:0001583	missense	84059	exon21			CTTGTATACCAGA	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.4745T>C	5.37:g.89954088T>C	ENSP00000384582:p.Ile1582Thr	165.0	0.0		189.0	73.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.559747	0.86335	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.30182	1.54	5.75	5.75	0.90469	Na-Ca exchanger/integrin-beta4 (1);	0.000000	0.85682	D	0.000000	T	0.46171	0.1379	L	0.38838	1.175	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.27971	-1.0058	10	0.35671	T	0.21	.	16.0573	0.80814	0.0:0.0:0.0:1.0	.	1582	Q8WXG9	GPR98_HUMAN	T	1582	ENSP00000384582:I1582T	ENSP00000296619:I1582T	I	+	2	0	GPR98	89989844	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.777000	0.85628	2.191000	0.70037	0.528000	0.53228	ATA	.		0.368	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
HEATR1	55127	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	236749177	236749177	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:236749177C>G	ENST00000366582.3	-	16	2106	c.1992G>C	c.(1990-1992)atG>atC	p.M664I	HEATR1_ENST00000366581.2_Missense_Mutation_p.M664I	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	664					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			ACAACTCAATCATCTTCTGAT	0.353																																					p.M664I		.											.	HEATR1	93	0			c.G1992C						.						104.0	96.0	99.0					1																	236749177		2203	4300	6503	SO:0001583	missense	55127	exon16			CTCAATCATCTTC	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.1992G>C	1.37:g.236749177C>G	ENSP00000355541:p.Met664Ile	149.0	0.0		274.0	17.0	NM_018072	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	C	18.13	3.554774	0.65425	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.61510	0.1;0.72	5.76	5.76	0.90799	Armadillo-type fold (1);	0.049130	0.85682	D	0.000000	T	0.55386	0.1917	M	0.64997	1.995	0.80722	D	1	B	0.16396	0.017	B	0.08055	0.003	T	0.49380	-0.8946	10	0.25106	T	0.35	.	16.2348	0.82365	0.1333:0.8667:0.0:0.0	.	664	Q9H583	HEAT1_HUMAN	I	664	ENSP00000355541:M664I;ENSP00000355540:M664I	ENSP00000355540:M664I	M	-	3	0	HEATR1	234815800	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	1.585000	0.36600	2.721000	0.93114	0.591000	0.81541	ATG	.		0.353	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
HELZ	9931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	65105654	65105654	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:65105654G>A	ENST00000358691.5	-	29	4233	c.4067C>T	c.(4066-4068)cCt>cTt	p.P1356L	HELZ_ENST00000580168.1_Missense_Mutation_p.P1357L	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1356						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					GTGGCGATTAGGGATTGCATA	0.463																																					p.P1356L		.											.	HELZ	92	0			c.C4067T						.						197.0	199.0	198.0					17																	65105654		2018	4180	6198	SO:0001583	missense	9931	exon29			CGATTAGGGATTG	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.4067C>T	17.37:g.65105654G>A	ENSP00000351524:p.Pro1356Leu	305.0	0.0		501.0	131.0	NM_014877	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	G	11.56	1.674680	0.29693	.	.	ENSG00000198265	ENST00000358691	D	0.83506	-1.73	5.82	5.82	0.92795	.	0.152258	0.64402	D	0.000011	T	0.81278	0.4789	L	0.34521	1.04	0.80722	D	1	D;D	0.54207	0.965;0.965	P;P	0.45913	0.497;0.497	D	0.83499	0.0074	10	0.87932	D	0	-15.2697	20.0939	0.97831	0.0:0.0:1.0:0.0	.	1357;1356	B7ZLW2;P42694	.;HELZ_HUMAN	L	1356	ENSP00000351524:P1356L	ENSP00000351524:P1356L	P	-	2	0	HELZ	62536116	1.000000	0.71417	0.904000	0.35570	0.364000	0.29643	6.629000	0.74267	2.756000	0.94617	0.643000	0.83706	CCT	.		0.463	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
HLA-E	3133	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	30458995	30458995	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:30458995C>G	ENST00000376630.4	+	4	757	c.692C>G	c.(691-693)cCt>cGt	p.P231R		NM_005516.5	NP_005507.3	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	231	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of endogenous peptide antigen via MHC class Ib (GO:0002476)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of natural killer cell mediated immunity (GO:0002717)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protection from natural killer cell mediated cytotoxicity (GO:0042270)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(2)|lung(1)|ovary(3)|skin(1)|urinary_tract(1)	18						GGCTTCTACCCTGCGGAGATC	0.622																																					p.P231R		.											.	HLA-E	516	0			c.C692G						.						112.0	124.0	120.0					6																	30458995		1511	2708	4219	SO:0001583	missense	3133	exon4			TCTACCCTGCGGA	M20022	CCDS34379.1	6p21.3	2013-01-11			ENSG00000204592	ENSG00000204592		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4962	protein-coding gene	gene with protein product		143010				3131426	Standard	NM_005516		Approved		uc003nqg.3	P13747	OTTHUMG00000031155	ENST00000376630.4:c.692C>G	6.37:g.30458995C>G	ENSP00000365817:p.Pro231Arg	130.0	0.0		166.0	58.0	NM_005516	Q30169|Q9BT83|Q9GIY7|Q9GIY8	Missense_Mutation	SNP	ENST00000376630.4	37	CCDS34379.1	.	.	.	.	.	.	.	.	.	.	.	15.63	2.890421	0.52014	.	.	ENSG00000204592	ENST00000376630	T	0.57907	0.37	1.67	1.67	0.24075	.	0.000000	0.41712	U	0.000826	T	0.75781	0.3896	H	0.99682	4.7	0.27796	N	0.942642	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.66056	-0.6018	10	0.87932	D	0	.	6.7735	0.23607	0.0:1.0:0.0:0.0	.	272;231	E7ENN9;Q6DU44	.;.	R	231	ENSP00000365817:P231R	ENSP00000365817:P231R	P	+	2	0	HLA-E	30566974	0.989000	0.36119	1.000000	0.80357	0.989000	0.77384	3.777000	0.55364	1.235000	0.43724	0.462000	0.41574	CCT	.		0.622	HLA-E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076282.2	NM_005516	
HEY2	23493	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	126080600	126080600	+	Silent	SNP	C	C	T	rs376521140		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:126080600C>T	ENST00000368364.3	+	5	863	c.666C>T	c.(664-666)caC>caT	p.H222H	HEY2_ENST00000368365.1_Silent_p.H176H	NM_012259.2	NP_036391.1	Q9UBP5	HEY2_HUMAN	hes-related family bHLH transcription factor with YRPW motif 2	222					anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|ascending aorta morphogenesis (GO:0035910)|atrial septum morphogenesis (GO:0060413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate commitment (GO:0045165)|cochlea development (GO:0090102)|coronary vasculature morphogenesis (GO:0060977)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|mesenchymal cell development (GO:0014031)|muscular septum morphogenesis (GO:0003150)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cardiac vascular smooth muscle cell differentiation (GO:2000723)|negative regulation of gene expression (GO:0010629)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription initiation from RNA polymerase II promoter (GO:0060633)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of heart rate (GO:0010460)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of auditory receptor cell differentiation (GO:0045607)|regulation of vasculogenesis (GO:2001212)|smooth muscle cell differentiation (GO:0051145)|tricuspid valve formation (GO:0003195)|tricuspid valve morphogenesis (GO:0003186)|umbilical cord morphogenesis (GO:0036304)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	histone deacetylase binding (GO:0042826)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.H222H(1)		breast(1)|large_intestine(7)|lung(5)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)		CTCCTGCCCACGGCTCTGCTC	0.657																																					p.H222H		.											.	HEY2	658	1	Substitution - coding silent(1)	prostate(1)	c.C666T						.	C		1,4405		0,1,2202	160.0	152.0	155.0		666	-2.8	1.0	6		155	0,8600		0,0,4300	no	coding-synonymous	HEY2	NM_012259.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		222/338	126080600	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23493	exon5			TGCCCACGGCTCT	AJ249545	CCDS5131.1	6q	2013-10-17	2013-10-17		ENSG00000135547	ENSG00000135547		"""Basic helix-loop-helix proteins"""	4881	protein-coding gene	gene with protein product		604674	"""hairy/enhancer-of-split related with YRPW motif 2"""			10415358	Standard	NM_012259		Approved	bHLHb32, HERP1, HESR2	uc003qad.3	Q9UBP5	OTTHUMG00000015512	ENST00000368364.3:c.666C>T	6.37:g.126080600C>T		80.0	0.0		48.0	32.0	NM_012259		Silent	SNP	ENST00000368364.3	37	CCDS5131.1																																																																																			.		0.657	HEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042077.1		
HNRNPUL1	11100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	41800283	41800283	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:41800283C>A	ENST00000392006.3	+	9	1480	c.1307C>A	c.(1306-1308)aCa>aAa	p.T436K	HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.T347K|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.T336K|HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.T336K|HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.T336K|HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.T322K|HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.T436K	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	436	Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						GGCAAGACCACATGGGCCATC	0.542																																					p.T436K		.											.	HNRNPUL1	69	0			c.C1307A						.						176.0	128.0	144.0					19																	41800283		2203	4300	6503	SO:0001583	missense	11100	exon9			AGACCACATGGGC	AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.1307C>A	19.37:g.41800283C>A	ENSP00000375863:p.Thr436Lys	190.0	0.0		235.0	82.0	NM_007040	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	ENST00000392006.3	37	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.505392	0.85282	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	T;T;T;T	0.58797	0.31;0.31;0.31;0.31	5.46	3.35	0.38373	.	0.050683	0.85682	D	0.000000	T	0.75384	0.3842	M	0.85462	2.755	0.48975	D	0.999737	D;D;D;P;D;D	0.63046	0.985;0.969;0.968;0.934;0.992;0.981	D;D;P;P;D;P	0.70935	0.944;0.944;0.66;0.517;0.971;0.835	T	0.77736	-0.2476	10	0.62326	D	0.03	-11.1853	11.2933	0.49263	0.0:0.8505:0.0:0.1495	.	347;336;436;322;436;336	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;.;HNRL1_HUMAN;.	K	336;436;322;347	ENSP00000340857:T336K;ENSP00000375863:T436K;ENSP00000367460:T322K;ENSP00000263367:T347K	ENSP00000263367:T347K	T	+	2	0	HNRNPUL1	46492123	1.000000	0.71417	0.727000	0.30756	0.994000	0.84299	5.833000	0.69349	0.872000	0.35775	0.655000	0.94253	ACA	.		0.542	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040	
HPSE2	60495	hgsc.bcm.edu;bcgsc.ca	37	10	100904083	100904083	+	Silent	SNP	C	C	T	rs200038077		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:100904083C>T	ENST00000370552.3	-	3	581	c.522G>A	c.(520-522)ctG>ctA	p.L174L	HPSE2_ENST00000370549.1_Silent_p.L174L|HPSE2_ENST00000370546.1_Silent_p.L174L|HPSE2_ENST00000404542.1_Intron	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	174					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		TTTGGAGCTCCAGCATAACAT	0.428																																					p.L174L		.											.	HPSE2	91	0			c.G522A						.						113.0	111.0	112.0					10																	100904083		2203	4300	6503	SO:0001819	synonymous_variant	60495	exon3			GAGCTCCAGCATA	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.522G>A	10.37:g.100904083C>T		69.0	0.0		62.0	4.0	NM_001166246	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Silent	SNP	ENST00000370552.3	37	CCDS7477.1																																																																																			C|0.999;T|0.001		0.428	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828	
HS1BP3	64342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	20823705	20823705	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:20823705C>A	ENST00000304031.3	-	6	896	c.871G>T	c.(871-873)Ggg>Tgg	p.G291W		NM_022460.3	NP_071905.3	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	291							phosphatidylinositol binding (GO:0035091)			endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	15	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTGTGGGCCCTCCACTCTCA	0.642																																					p.G291W		.											.	HS1BP3	91	0			c.G871T						.						29.0	31.0	31.0					2																	20823705		2203	4299	6502	SO:0001583	missense	64342	exon6			TGGGCCCTCCACT		CCDS1700.1	2p24.1	2006-08-15			ENSG00000118960	ENSG00000118960			24979	protein-coding gene	gene with protein product		609359				10590261, 15699368	Standard	NM_022460		Approved	HS1-BP3,FLJ14249	uc002rdw.1	Q53T59	OTTHUMG00000122099	ENST00000304031.3:c.871G>T	2.37:g.20823705C>A	ENSP00000305193:p.Gly291Trp	84.0	0.0		103.0	33.0	NM_022460	B2RAW2|D6W529|Q86VC2|Q8N367	Missense_Mutation	SNP	ENST00000304031.3	37	CCDS1700.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	13.96|13.96|13.96	2.391889|2.391889|2.391889	0.42410|0.42410|0.42410	.|.|.	.|.|.	ENSG00000118960|ENSG00000118960|ENSG00000118960	ENST00000415264|ENST00000304031;ENST00000458740|ENST00000445102	.|T;T|.	.|0.34072|.	.|2.16;1.38|.	4.16|4.16|4.16	-0.339|-0.339|-0.339	0.12647|0.12647|0.12647	.|.|.	.|0.574784|.	.|0.17430|.	.|N|.	.|0.174509|.	T|T|T	0.39253|0.39253|0.39253	0.1071|0.1071|0.1071	L|L|L	0.60455|0.60455|0.60455	1.87|1.87|1.87	0.09310|0.09310|0.09310	N|N|N	0.99999|0.99999|0.99999	.|D|.	.|0.63046|.	.|0.992|.	.|P|.	.|0.54499|.	.|0.754|.	T|T|T	0.35201|0.35201|0.35201	-0.9798|-0.9798|-0.9798	5|10|5	.|0.72032|.	.|D|.	.|0.01|.	-4.5709|-4.5709|-4.5709	4.1741|4.1741|4.1741	0.10343|0.10343|0.10343	0.0:0.468:0.2176:0.3144|0.0:0.468:0.2176:0.3144|0.0:0.468:0.2176:0.3144	.|.|.	.|291|.	.|Q53T59|.	.|H1BP3_HUMAN|.	D|W|M	43|291;110|83	.|ENSP00000305193:G291W;ENSP00000392203:G110W|.	.|ENSP00000305193:G291W|.	E|G|R	-|-|-	3|1|2	2|0|0	HS1BP3|HS1BP3|HS1BP3	20687186|20687186|20687186	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.000000|0.000000|0.000000	0.03702|0.03702|0.03702	0.039000|0.039000|0.039000	0.13416|0.13416|0.13416	-0.176000|-0.176000|-0.176000	0.09811|0.09811|0.09811	-0.155000|-0.155000|-0.155000	0.11098|0.11098|0.11098	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GAG|GGG|AGG	.		0.642	HS1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242863.1	NM_022460	
HSDL2	84263	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	9	115232768	115232768	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:115232768A>G	ENST00000398805.3	+	11	1428	c.1201A>G	c.(1201-1203)Atg>Gtg	p.M401V	HSDL2_ENST00000539114.1_Missense_Mutation_p.M196V|HSDL2_ENST00000262542.7_Missense_Mutation_p.M281V|HSDL2_ENST00000398803.1_Missense_Mutation_p.M328V	NM_032303.4	NP_115679.2	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	401	SCP2.					membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|cervix(2)|endometrium(1)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	13						TAAAGGTAACATGGCCCTAGC	0.368																																					p.M401V		.											.	HSDL2	90	0			c.A1201G						.						87.0	80.0	82.0					9																	115232768		1844	4093	5937	SO:0001583	missense	84263	exon11			GGTAACATGGCCC	AY093428	CCDS43864.1, CCDS56582.1	9q32	2011-09-14			ENSG00000119471	ENSG00000119471		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18572	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 13C, member 1"""		"""chromosome 9 open reading frame 99"""	C9orf99		12834046, 19027726	Standard	NM_032303		Approved	SDR13C1	uc004bga.2	Q6YN16	OTTHUMG00000020504	ENST00000398805.3:c.1201A>G	9.37:g.115232768A>G	ENSP00000381785:p.Met401Val	54.0	0.0		42.0	4.0	NM_032303	A8K1L4|A8K8X1|A8MSV3|Q658M8|Q9BT58	Missense_Mutation	SNP	ENST00000398805.3	37	CCDS43864.1	.	.	.	.	.	.	.	.	.	.	A	15.09	2.729957	0.48833	.	.	ENSG00000119471	ENST00000398805;ENST00000398803;ENST00000262542;ENST00000539114	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	5.89	4.74	0.60224	SCP2 sterol-binding domain (2);	0.076479	0.85682	D	0.000000	T	0.42449	0.1203	M	0.64997	1.995	0.49915	D	0.999839	B;B;D	0.55172	0.029;0.134;0.97	B;B;P	0.58520	0.011;0.167;0.84	T	0.33420	-0.9869	10	0.87932	D	0	.	11.7592	0.51892	0.8528:0.1472:0.0:0.0	.	328;328;401	Q6YN16-2;B2R923;Q6YN16	.;.;HSDL2_HUMAN	V	401;328;281;196	ENSP00000381785:M401V;ENSP00000381783:M328V;ENSP00000262542:M281V;ENSP00000442278:M196V	ENSP00000262542:M281V	M	+	1	0	HSDL2	114272589	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.859000	0.69539	1.029000	0.39812	0.455000	0.32223	ATG	.		0.368	HSDL2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053681.1	NM_032303	
HSPA4L	22824	hgsc.bcm.edu;bcgsc.ca	37	4	128724944	128724944	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:128724944A>G	ENST00000296464.4	+	7	1235	c.824A>G	c.(823-825)aAg>aGg	p.K275R	HSPA4L_ENST00000439123.2_Missense_Mutation_p.K306R|HSPA4L_ENST00000508776.1_Missense_Mutation_p.K275R|HSPA4L_ENST00000505726.1_Missense_Mutation_p.K249R	NM_014278.2	NP_055093.2	O95757	HS74L_HUMAN	heat shock 70kDa protein 4-like	275					protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)			central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						AAACTAAAGAAGCTAATGAGT	0.353																																					p.K275R		.											.	HSPA4L	228	0			c.A824G						.						82.0	85.0	84.0					4																	128724944		2203	4300	6503	SO:0001583	missense	22824	exon7			TAAAGAAGCTAAT	AB023421	CCDS3734.1	4q28	2011-09-07			ENSG00000164070	ENSG00000164070		"""Heat shock proteins / HSP70"""	17041	protein-coding gene	gene with protein product						10524232	Standard	NM_014278		Approved	APG-1, Osp94, HSPH3	uc003ifm.3	O95757	OTTHUMG00000133302	ENST00000296464.4:c.824A>G	4.37:g.128724944A>G	ENSP00000296464:p.Lys275Arg	111.0	0.0		99.0	4.0	NM_014278	A2ICT2|Q4W5M5|Q8IWA2	Missense_Mutation	SNP	ENST00000296464.4	37	CCDS3734.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.869552	0.91587	.	.	ENSG00000164070	ENST00000508776;ENST00000439123;ENST00000296464;ENST00000508549;ENST00000505726	T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.36441	0.0967	N	0.12422	0.21	0.58432	D	0.999999	P;D;D	0.76494	0.584;0.999;0.999	P;D;D	0.81914	0.539;0.995;0.995	T	0.32079	-0.9920	10	0.40728	T	0.16	.	14.6317	0.68660	1.0:0.0:0.0:0.0	.	249;275;275	E9PDE8;A2ICT2;O95757	.;.;HS74L_HUMAN	R	275;306;275;234;249	ENSP00000422482:K275R;ENSP00000393926:K306R;ENSP00000296464:K275R;ENSP00000427305:K234R;ENSP00000425645:K249R	ENSP00000296464:K275R	K	+	2	0	HSPA4L	128944394	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.313000	0.89978	2.055000	0.61198	0.477000	0.44152	AAG	.		0.353	HSPA4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257096.3	NM_014278	
HYDIN	54768	hgsc.bcm.edu;bcgsc.ca	37	16	70884467	70884467	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:70884467T>C	ENST00000393567.2	-	74	12685	c.12535A>G	c.(12535-12537)Aca>Gca	p.T4179A	RNU6ATAC25P_ENST00000408798.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4179					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				ACATTTAATGTCACAGGGTGG	0.448																																					p.T4179A		.											.	HYDIN	92	0			c.A12535G						.						31.0	30.0	30.0					16																	70884467		1822	4079	5901	SO:0001583	missense	54768	exon74			TTAATGTCACAGG	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.12535A>G	16.37:g.70884467T>C	ENSP00000377197:p.Thr4179Ala	149.0	0.0		212.0	38.0	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	T	11.89	1.774801	0.31411	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01015	5.44	5.56	4.42	0.53409	.	0.269330	0.19193	U	0.120392	T	0.01627	0.0052	M	0.74881	2.28	0.51767	D	0.999937	B	0.14805	0.011	B	0.19391	0.025	T	0.50825	-0.8782	10	0.17832	T	0.49	.	9.8956	0.41316	0.3173:0.0:0.0:0.6827	.	4178	F8WD23	.	A	4179;4178	ENSP00000377197:T4179A	ENSP00000313052:T4178A	T	-	1	0	HYDIN	69441968	0.918000	0.31147	0.958000	0.39756	0.503000	0.33858	1.845000	0.39279	2.113000	0.64589	0.418000	0.28097	ACA	.		0.448	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
IFI16	3428	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158988074	158988074	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:158988074A>T	ENST00000295809.7	+	5	860	c.605A>T	c.(604-606)aAa>aTa	p.K202I	IFI16_ENST00000430894.2_Missense_Mutation_p.K150I|IFI16_ENST00000359709.3_Missense_Mutation_p.K146I|IFI16_ENST00000368131.4_Missense_Mutation_p.K202I|IFI16_ENST00000340979.6_Missense_Mutation_p.K202I|IFI16_ENST00000448393.2_Missense_Mutation_p.K202I|IFI16_ENST00000368132.3_Missense_Mutation_p.K202I			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	202	HIN-200 1. {ECO:0000255|PROSITE- ProRule:PRU00106}.|Interaction with TP53 C-terminus.		K -> E (in dbSNP:rs11585341).		activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					GTTCTCCAAAAACGCCCAGTG	0.398																																					p.K202I		.											.	IFI16	91	0			c.A605T						.						86.0	81.0	82.0					1																	158988074		2203	4300	6503	SO:0001583	missense	3428	exon5			TCCAAAAACGCCC	M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.605A>T	1.37:g.158988074A>T	ENSP00000295809:p.Lys202Ile	128.0	0.0		364.0	120.0	NM_005531	B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	ENST00000295809.7	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	13.97|13.97	2.396697|2.396697	0.42512|0.42512	.|.	.|.	ENSG00000163565|ENSG00000163565	ENST00000359709;ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894|ENST00000448393	T;T;T;T;T|.	0.15952|.	2.38;2.38;2.38;2.38;2.38|.	2.78|2.78	-4.66|-4.66	0.03329|0.03329	HIN-200/IF120x (2);Nucleic acid-binding, OB-fold (1);|.	.|.	.|.	.|.	.|.	T|T	0.22936|0.22936	0.0554|0.0554	M|M	0.69358|0.69358	2.11|2.11	0.09310|0.09310	N|N	1|1	B;B;B|.	0.29508|.	0.139;0.114;0.246|.	P;B;P|.	0.45428|.	0.48;0.348;0.48|.	T|T	0.42682|0.42682	-0.9437|-0.9437	9|5	0.72032|.	D|.	0.01|.	.|.	5.6331|5.6331	0.17522|0.17522	0.2787:0.5828:0.1384:0.0|0.2787:0.5828:0.1384:0.0	.|.	150;202;202|.	E7EPR3;Q16666-2;Q16666|.	.;.;IF16_HUMAN|.	I|Y	202;202;202;202;202;150|23	ENSP00000295809:K202I;ENSP00000342741:K202I;ENSP00000357113:K202I;ENSP00000357114:K202I;ENSP00000394935:K150I|.	ENSP00000295809:K202I|.	K|N	+|+	2|1	0|0	IFI16|IFI16	157254698|157254698	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-0.797000|-0.797000	0.04570|0.04570	-0.568000|-0.568000	0.06038|0.06038	0.379000|0.379000	0.24179|0.24179	AAA|AAC	.		0.398	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531	
IFNA6	3443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	21350645	21350645	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:21350645T>G	ENST00000380210.1	-	1	732	c.242A>C	c.(241-243)cAt>cCt	p.H81P		NM_021002.2	NP_066282.1	P05013	IFNA6_HUMAN	interferon, alpha 6	81					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			large_intestine(3)|lung(7)|skin(1)	11				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		AATCACCTCATGGAGGACAGA	0.473																																					p.H81P		.											.	IFNA6	68	0			c.A242C						.						107.0	104.0	105.0					9																	21350645		2203	4300	6503	SO:0001583	missense	3443	exon1			ACCTCATGGAGGA		CCDS6504.1	9p22	2010-12-10			ENSG00000120235	ENSG00000120235		"""Interferons"""	5427	protein-coding gene	gene with protein product		147566				1385305	Standard	NM_021002		Approved	IFN-alphaK	uc011lni.2	P05013	OTTHUMG00000019676	ENST00000380210.1:c.242A>C	9.37:g.21350645T>G	ENSP00000369558:p.His81Pro	193.0	0.0		239.0	110.0	NM_021002	Q5VYQ1	Missense_Mutation	SNP	ENST00000380210.1	37	CCDS6504.1	.	.	.	.	.	.	.	.	.	.	T	19.15	3.772671	0.69992	.	.	ENSG00000120235	ENST00000380210	T	0.03745	3.82	3.78	2.55	0.30701	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.749872	0.12726	N	0.444311	T	0.19087	0.0458	M	0.89353	3.025	0.09310	N	1	D	0.67145	0.996	D	0.83275	0.996	T	0.04781	-1.0927	10	0.87932	D	0	.	7.2998	0.26413	0.0:0.1115:0.0:0.8885	.	81	P05013	IFNA6_HUMAN	P	81	ENSP00000369558:H81P	ENSP00000369558:H81P	H	-	2	0	IFNA6	21340645	0.776000	0.28616	0.009000	0.14445	0.827000	0.46813	1.890000	0.39728	0.379000	0.24794	0.482000	0.46254	CAT	.		0.473	IFNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051905.1	NM_021002	
IL31RA	133396	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	55206415	55206415	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:55206415G>T	ENST00000447346.2	+	12	1622	c.1557G>T	c.(1555-1557)aaG>aaT	p.K519N	IL31RA_ENST00000354961.4_Missense_Mutation_p.K500N|IL31RA_ENST00000359040.5_Missense_Mutation_p.K519N|IL31RA_ENST00000396834.1_Missense_Mutation_p.K500N|IL31RA_ENST00000490985.1_Missense_Mutation_p.K377N	NM_001242636.1|NM_139017.5	NP_001229565.1|NP_620586.3	Q8NI17	IL31R_HUMAN	interleukin 31 receptor A	487					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|homeostatic process (GO:0042592)|JAK-STAT cascade (GO:0007259)|macrophage differentiation (GO:0030225)|MAPK cascade (GO:0000165)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of macrophage activation (GO:0043031)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)	21		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				TGAAACGAAAGACCTCTTACA	0.468																																					p.K519N		.											.	IL31RA	91	0			c.G1557T						.						156.0	135.0	142.0					5																	55206415		2203	4300	6503	SO:0001583	missense	133396	exon12			ACGAAAGACCTCT	AY499339	CCDS3970.2, CCDS56365.1, CCDS56366.1, CCDS56367.1, CCDS75244.1, CCDS75245.1	5q11.2	2013-02-11			ENSG00000164509	ENSG00000164509		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	18969	protein-coding gene	gene with protein product		609510				15184896, 11877449	Standard	NM_139017		Approved	CRL3, GLM-R, CRL, Glmr, IL-31RA	uc003jql.3	Q8NI17	OTTHUMG00000097045	ENST00000447346.2:c.1557G>T	5.37:g.55206415G>T	ENSP00000415900:p.Lys519Asn	233.0	0.0		267.0	105.0	NM_001242637	A6NIF8|Q2TBA1|Q6EBC3|Q6EBC4|Q6EBC5|Q6EBC6|Q6UWL8|Q8WYJ0	Missense_Mutation	SNP	ENST00000447346.2	37	CCDS3970.2	.	.	.	.	.	.	.	.	.	.	G	7.502	0.652814	0.14580	.	.	ENSG00000164509	ENST00000396834;ENST00000447346;ENST00000359040;ENST00000490985;ENST00000354961	T;T;T;T;T	0.56275	0.47;0.47;0.47;0.47;0.47	5.01	2.27	0.28462	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.713450	0.14220	N	0.333513	T	0.29389	0.0732	N	0.17082	0.46	0.80722	D	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.08055	0.003;0.003;0.002;0.003	T	0.07252	-1.0782	10	0.22109	T	0.4	-3.1832	3.2914	0.06950	0.1018:0.3087:0.4529:0.1366	.	487;519;500;519	Q8NI17;Q8NI17-5;Q8NI17-3;Q8NI17-2	IL31R_HUMAN;.;.;.	N	500;519;519;377;500	ENSP00000380046:K500N;ENSP00000415900:K519N;ENSP00000351935:K519N;ENSP00000427533:K377N;ENSP00000347047:K500N	ENSP00000347047:K500N	K	+	3	2	IL31RA	55242172	0.932000	0.31603	0.868000	0.34077	0.953000	0.61014	0.524000	0.22940	0.380000	0.24823	0.557000	0.71058	AAG	.		0.468	IL31RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214148.1	NM_139017	
INSIG1	3638	hgsc.bcm.edu;bcgsc.ca	37	7	155090257	155090257	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:155090257A>G	ENST00000340368.4	+	2	473	c.262A>G	c.(262-264)Agc>Ggc	p.S88G	INSIG1_ENST00000342407.5_Missense_Mutation_p.S88G|INSIG1_ENST00000344756.4_Intron|AC144652.1_ENST00000609974.1_lincRNA	NM_005542.4	NP_005533.2	O15503	INSI1_HUMAN	insulin induced gene 1	88					cell proliferation (GO:0008283)|cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|metabolic process (GO:0008152)|middle ear morphogenesis (GO:0042474)|negative regulation of cargo loading into COPII-coated vesicle (GO:1901303)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)				endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	19	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTTGCAGAGGAGCCTCGTGCT	0.667																																					p.S88G		.											.	INSIG1	90	0			c.A262G						.						51.0	47.0	48.0					7																	155090257		2202	4299	6501	SO:0001583	missense	3638	exon2			CAGAGGAGCCTCG		CCDS5938.1, CCDS5939.1	7q36	2008-07-18			ENSG00000186480	ENSG00000186480			6083	protein-coding gene	gene with protein product	"""INSIG-1 membrane protein"""	602055				9268630	Standard	NM_005542		Approved	CL-6, MGC1405	uc003wly.3	O15503	OTTHUMG00000151330	ENST00000340368.4:c.262A>G	7.37:g.155090257A>G	ENSP00000344741:p.Ser88Gly	59.0	0.0		77.0	4.0	NM_198337	A4D2N1|A8K6L0|Q53XW8|Q9BUV5	Missense_Mutation	SNP	ENST00000340368.4	37	CCDS5938.1	.	.	.	.	.	.	.	.	.	.	A	11.38	1.621302	0.28889	.	.	ENSG00000186480	ENST00000340368;ENST00000425172;ENST00000342407	T;T;T	0.43294	0.95;0.99;1.05	4.85	1.18	0.20946	.	0.092218	0.85682	N	0.000000	T	0.15132	0.0365	N	0.00771	-1.2	0.80722	D	1	P;B	0.37370	0.592;0.004	B;B	0.42738	0.396;0.01	T	0.07635	-1.0762	10	0.14656	T	0.56	.	8.3313	0.32189	0.7662:0.0:0.2338:0.0	.	88;88	A4D2N1;O15503	.;INSI1_HUMAN	G	88	ENSP00000344741:S88G;ENSP00000414691:S88G;ENSP00000344035:S88G	ENSP00000344741:S88G	S	+	1	0	INSIG1	154721190	1.000000	0.71417	0.896000	0.35187	0.993000	0.82548	4.629000	0.61290	-0.029000	0.13827	0.529000	0.55759	AGC	.		0.667	INSIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322244.3	NM_198336	
IP6K3	117283	hgsc.bcm.edu;bcgsc.ca	37	6	33696059	33696059	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:33696059A>G	ENST00000293756.4	-	3	544	c.218T>C	c.(217-219)cTc>cCc	p.L73P	IP6K3_ENST00000451316.1_Missense_Mutation_p.L73P	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	73					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			skin(1)	1						GTCTTTCCAGAGGTGCACTGT	0.597																																					p.L73P		.											.	IP6K3	240	0			c.T218C						.						69.0	63.0	65.0					6																	33696059		2203	4300	6503	SO:0001583	missense	117283	exon4			TTCCAGAGGTGCA	AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.218T>C	6.37:g.33696059A>G	ENSP00000293756:p.Leu73Pro	89.0	0.0		113.0	6.0	NM_001142883	Q96MQ9	Missense_Mutation	SNP	ENST00000293756.4	37	CCDS34435.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.198304	0.79015	.	.	ENSG00000161896	ENST00000451316;ENST00000293756	T;T	0.13778	2.56;2.56	5.69	5.69	0.88448	.	0.000000	0.56097	D	0.000039	T	0.28896	0.0717	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.04467	-1.0949	10	0.72032	D	0.01	-37.138	14.1824	0.65583	1.0:0.0:0.0:0.0	.	73	Q96PC2	IP6K3_HUMAN	P	73	ENSP00000398861:L73P;ENSP00000293756:L73P	ENSP00000293756:L73P	L	-	2	0	IP6K3	33804037	1.000000	0.71417	0.990000	0.47175	0.960000	0.62799	6.743000	0.74848	2.168000	0.68352	0.533000	0.62120	CTC	.		0.597	IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040203.1	NM_054111	
ITGA2	3673	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	52356813	52356813	+	Silent	SNP	A	A	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:52356813A>T	ENST00000296585.5	+	12	1538	c.1395A>T	c.(1393-1395)atA>atT	p.I465I		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	465					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				CCGGCCAGATAGTGCTATATA	0.438																																					p.I465I		.											.	ITGA2	226	0			c.A1395T						.						111.0	104.0	106.0					5																	52356813		2203	4300	6503	SO:0001819	synonymous_variant	3673	exon12			CCAGATAGTGCTA		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.1395A>T	5.37:g.52356813A>T		189.0	0.0		194.0	73.0	NM_002203	Q14595	Silent	SNP	ENST00000296585.5	37	CCDS3957.1																																																																																			.		0.438	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	
IRF1	3659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	131825125	131825125	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:131825125T>G	ENST00000245414.4	-	2	304	c.46A>C	c.(46-48)Att>Ctt	p.I16L	IRF1_ENST00000405885.2_Missense_Mutation_p.I16L|IRF1_ENST00000463784.1_Intron	NM_002198.2	NP_002189.1	P10914	IRF1_HUMAN	interferon regulatory factor 1	16					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell cycle arrest (GO:0007050)|cellular response to interferon-beta (GO:0035458)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta T cell proliferation (GO:2000564)|regulation of cell cycle (GO:0051726)|regulation of innate immune response (GO:0045088)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)		TTGGAATTAATCTGCATCTCT	0.473																																					p.I16L		.											.	IRF1	226	0			c.A46C						.						110.0	109.0	110.0					5																	131825125		2203	4300	6503	SO:0001583	missense	3659	exon2			AATTAATCTGCAT		CCDS4155.1	5q23-q31	2008-07-18			ENSG00000125347	ENSG00000125347			6116	protein-coding gene	gene with protein product	"""interferon regulatory factor-1"""	147575				2726461, 1680796	Standard	NM_002198		Approved	MAR	uc003kxa.2	P10914	OTTHUMG00000059497	ENST00000245414.4:c.46A>C	5.37:g.131825125T>G	ENSP00000245414:p.Ile16Leu	114.0	0.0		128.0	41.0	NM_002198	Q96GG7	Missense_Mutation	SNP	ENST00000245414.4	37	CCDS4155.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.544270	0.86022	.	.	ENSG00000125347	ENST00000245414;ENST00000405885;ENST00000437654;ENST00000458069	D;D;D;D	0.98192	-4.78;-4.78;-4.78;-4.78	5.59	5.59	0.84812	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.98560	0.9519	L	0.60845	1.875	0.80722	D	1	P;D	0.55385	0.924;0.971	D;D	0.76575	0.972;0.988	D	0.99891	1.1134	10	0.87932	D	0	-14.9777	16.0664	0.80878	0.0:0.0:0.0:1.0	.	16;16	Q5FBX3;P10914	.;IRF1_HUMAN	L	16	ENSP00000245414:I16L;ENSP00000384406:I16L;ENSP00000405655:I16L;ENSP00000396318:I16L	ENSP00000245414:I16L	I	-	1	0	IRF1	131853024	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.905000	0.87416	2.254000	0.74563	0.459000	0.35465	ATT	.		0.473	IRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132340.1	NM_002198	
ITGB8	3696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	20438493	20438493	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:20438493C>A	ENST00000222573.4	+	9	1841	c.1157C>A	c.(1156-1158)tCa>tAa	p.S386*	ITGB8_ENST00000537992.1_Nonsense_Mutation_p.S251*	NM_002214.2	NP_002205.1	P26012	ITB8_HUMAN	integrin, beta 8	386					cartilage development (GO:0051216)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|ganglioside metabolic process (GO:0001573)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of gene expression (GO:0010629)|placenta blood vessel development (GO:0060674)|positive regulation of gene expression (GO:0010628)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	extracellular matrix protein binding (GO:1990430)|receptor activity (GO:0004872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(4)|stomach(2)|urinary_tract(1)	37						AAGCTCATTTCAGAAGTGAAA	0.388																																					p.S386X		.											.	ITGB8	227	0			c.C1157A						.						83.0	84.0	83.0					7																	20438493		2203	4300	6503	SO:0001587	stop_gained	3696	exon9			TCATTTCAGAAGT		CCDS5370.1	7p15.3	2010-03-23			ENSG00000105855	ENSG00000105855		"""Integrins"""	6163	protein-coding gene	gene with protein product		604160					Standard	XM_005249751		Approved		uc003suu.3	P26012	OTTHUMG00000023594	ENST00000222573.4:c.1157C>A	7.37:g.20438493C>A	ENSP00000222573:p.Ser386*	127.0	0.0		159.0	60.0	NM_002214	A4D133|B4DHD4	Nonsense_Mutation	SNP	ENST00000222573.4	37	CCDS5370.1	.	.	.	.	.	.	.	.	.	.	C	43	10.295639	0.99378	.	.	ENSG00000105855	ENST00000537992;ENST00000222573	.	.	.	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.4084	0.94658	0.0:1.0:0.0:0.0	.	.	.	.	X	251;386	.	ENSP00000222573:S386X	S	+	2	0	ITGB8	20405018	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.010000	0.70753	2.593000	0.87608	0.655000	0.94253	TCA	.		0.388	ITGB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059915.3	NM_002214	
JMJD4	65094	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	227922402	227922402	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:227922402G>A	ENST00000366758.3	-	2	515	c.516C>T	c.(514-516)ggC>ggT	p.G172G	SNAP47_ENST00000366760.1_Intron|SNAP47_ENST00000315781.5_5'Flank|JMJD4_ENST00000438896.2_Silent_p.G172G|JMJD4_ENST00000485807.1_5'Flank|SNAP47_ENST00000366759.4_5'Flank	NM_023007.2	NP_075383.2	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4	172										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	9		Prostate(94;0.0885)				GAGAGGAGTAGCCCGCCTGTA	0.562																																					p.G172G		.											.	JMJD4	226	0			c.C516T						.						221.0	184.0	197.0					1																	227922402		2203	4300	6503	SO:0001819	synonymous_variant	65094	exon2			GGAGTAGCCCGCC	AK022579	CCDS1561.1, CCDS59203.1	1q42.13	2008-02-05			ENSG00000081692	ENSG00000081692			25724	protein-coding gene	gene with protein product						12477932	Standard	NM_023007		Approved	FLJ12517	uc001hrb.3	Q9H9V9	OTTHUMG00000037698	ENST00000366758.3:c.516C>T	1.37:g.227922402G>A		287.0	0.0		562.0	285.0	NM_023007	Q5TBZ1|Q5TBZ6|Q9H970	Silent	SNP	ENST00000366758.3	37	CCDS1561.1	.	.	.	.	.	.	.	.	.	.	.	11.00	1.509531	0.27036	.	.	ENSG00000081692	ENST00000438896	.	.	.	4.55	2.44	0.29823	.	.	.	.	.	T	0.56077	0.1961	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50898	-0.8773	4	.	.	.	-12.0369	7.9626	0.30081	0.0945:0.1617:0.7439:0.0	.	.	.	.	V	165	.	.	A	-	2	0	JMJD4	225989025	0.720000	0.27996	0.755000	0.31263	0.903000	0.53119	0.932000	0.28884	0.991000	0.38814	0.555000	0.69702	GCT	.		0.562	JMJD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091970.1	NM_023007	
KAT6B	23522	hgsc.bcm.edu;bcgsc.ca	37	10	76741556	76741556	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:76741556T>C	ENST00000287239.4	+	11	2732	c.2243T>C	c.(2242-2244)cTt>cCt	p.L748P	KAT6B_ENST00000372725.1_Missense_Mutation_p.L456P|KAT6B_ENST00000490365.1_3'UTR|KAT6B_ENST00000372714.1_Missense_Mutation_p.L456P|KAT6B_ENST00000372711.1_Missense_Mutation_p.L565P|KAT6B_ENST00000372724.1_Missense_Mutation_p.L456P	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	748	Catalytic.|MYST-type HAT.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TTACCAAAGCTTTACCTGTGT	0.299																																					p.L748P		.											.	.	.	0			c.T2243C						.						46.0	56.0	53.0					10																	76741556		2202	4299	6501	SO:0001583	missense	23522	exon11			CAAAGCTTTACCT	AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.2243T>C	10.37:g.76741556T>C	ENSP00000287239:p.Leu748Pro	52.0	0.0		76.0	4.0	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	ENST00000287239.4	37	CCDS7345.1	.	.	.	.	.	.	.	.	.	.	T	15.52	2.857335	0.51376	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	D;D;D;D;D	0.85955	-1.99;-1.99;-2.05;-1.99;-2.03	5.73	5.73	0.89815	.	0.000000	0.41294	D	0.000915	D	0.92795	0.7709	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.996	D	0.93761	0.7067	10	0.87932	D	0	-8.7284	16.0173	0.80450	0.0:0.0:0.0:1.0	.	565;456;748	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	P	456;456;748;456;565	ENSP00000361810:L456P;ENSP00000361809:L456P;ENSP00000287239:L748P;ENSP00000361799:L456P;ENSP00000361796:L565P	ENSP00000287239:L748P	L	+	2	0	KAT6B	76411562	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.191000	0.70037	0.528000	0.53228	CTT	.		0.299	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
KDM4D	55693	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	94732090	94732104	+	In_Frame_Del	DEL	CTGGGCCCCTGTGCC	CTGGGCCCCTGTGCC	-	rs373516844		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	CTGGGCCCCTGTGCC	CTGGGCCCCTGTGCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:94732090_94732104delCTGGGCCCCTGTGCC	ENST00000335080.5	+	3	2386_2400	c.1554_1568delCTGGGCCCCTGTGCC	c.(1552-1569)agctgggcccctgtgccc>agc	p.WAPVP519del	KDM4D_ENST00000536741.1_In_Frame_Del_p.WAPVP519del	NM_018039.2	NP_060509.2	Q6B0I6	KDM4D_HUMAN	lysine (K)-specific demethylase 4D	519					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(16)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CTGGGTGCAGCTGGGCCCCTGTGCCCTAAGTCCAC	0.549																																					p.518_523del		.											.	KDM4D	226	0			c.1554_1568del						.																																			SO:0001651	inframe_deletion	55693	exon3			GTGCAGCTGGGCC	AK001113	CCDS8302.1	11q21	2012-03-28	2009-04-06	2009-04-06	ENSG00000186280	ENSG00000186280		"""Chromatin-modifying enzymes / K-demethylases"""	25498	protein-coding gene	gene with protein product		609766	"""jumonji domain containing 2D"""	JMJD2D		15138608	Standard	NM_018039		Approved	FLJ10251	uc001pfe.3	Q6B0I6	OTTHUMG00000167838	ENST00000335080.5:c.1554_1568delCTGGGCCCCTGTGCC	11.37:g.94732090_94732104delCTGGGCCCCTGTGCC	ENSP00000334181:p.Trp519_Pro523del	126.0	0.0		135.0	20.0	NM_018039	B3KPC4|Q0VF39|Q9NT41|Q9NW76	In_Frame_Del	DEL	ENST00000335080.5	37	CCDS8302.1																																																																																			.		0.549	KDM4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396558.2	NM_018039	
KIAA1210	57481	hgsc.bcm.edu;bcgsc.ca	37	X	118221124	118221124	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chrX:118221124T>C	ENST00000402510.2	-	11	4068	c.4069A>G	c.(4069-4071)Aag>Gag	p.K1357E		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1357										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						CTGCTCTGCTTTACAGGTACA	0.473																																					p.K1357E		.											.	KIAA1210	67	0			c.A4069G						.						201.0	192.0	195.0					X																	118221124		1967	4139	6106	SO:0001583	missense	57481	exon11			TCTGCTTTACAGG	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.4069A>G	X.37:g.118221124T>C	ENSP00000384670:p.Lys1357Glu	43.0	0.0		92.0	4.0	NM_020721	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	CCDS48156.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.488|0.488	-0.876829|-0.876829	0.02550|0.02550	.|.	.|.	ENSG00000250423|ENSG00000248857	ENST00000402510|ENST00000440399	T|.	0.08370|.	3.1|.	4.34|4.34	-2.17|-2.17	0.07059|0.07059	.|.	.|.	.|.	.|.	.|.	T|T	0.13798|0.13798	0.0334|0.0334	N|N	0.05124|0.05124	-0.11|-0.11	0.09310|0.09310	N|N	1|1	B|.	0.12630|.	0.006|.	B|.	0.14023|.	0.01|.	T|T	0.27331|0.27331	-1.0077|-1.0077	9|5	0.07030|.	T|.	0.85|.	.|.	5.429|5.429	0.16442|0.16442	0.0:0.2972:0.155:0.5478|0.0:0.2972:0.155:0.5478	.|.	1357|.	Q9ULL0|.	K1210_HUMAN|.	E|R	1357|763	ENSP00000384670:K1357E|.	ENSP00000384670:K1357E|.	K|K	-|-	1|2	0|0	RP13-347D8.6|KIAA1210	118105152|118105152	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-0.726000|-0.726000	0.04936|0.04936	-0.654000|-0.654000	0.05394|0.05394	-0.700000|-0.700000	0.03674|0.03674	AAG|AAA	.		0.473	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	
KIAA1551	55196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	32136525	32136525	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:32136525C>T	ENST00000312561.4	+	4	3050	c.2636C>T	c.(2635-2637)tCa>tTa	p.S879L	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	879																	TCACAGGAGTCAAGGAATAGT	0.368																																					p.S879L		.											.	.	.	0			c.C2636T						.						113.0	104.0	107.0					12																	32136525		2203	4300	6503	SO:0001583	missense	55196	exon4			AGGAGTCAAGGAA	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.2636C>T	12.37:g.32136525C>T	ENSP00000310338:p.Ser879Leu	137.0	0.0		170.0	47.0	NM_018169	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	37	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	C	15.50	2.853414	0.51270	.	.	ENSG00000174718	ENST00000312561	T	0.13420	2.59	5.26	3.11	0.35812	.	1.228570	0.05849	N	0.620894	T	0.13756	0.0333	L	0.48362	1.52	0.09310	N	1	B	0.28713	0.22	B	0.25614	0.062	T	0.29212	-1.0019	9	.	.	.	.	7.5112	0.27575	0.0:0.7065:0.1722:0.1213	.	879	Q9HCM1	CL035_HUMAN	L	879	ENSP00000310338:S879L	.	S	+	2	0	C12orf35	32027792	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	1.297000	0.33400	1.175000	0.42826	0.655000	0.94253	TCA	.		0.368	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169	
KIF2A	3796	hgsc.bcm.edu;bcgsc.ca	37	5	61659121	61659121	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:61659121A>G	ENST00000401507.3	+	13	1547	c.1236A>G	c.(1234-1236)aaA>aaG	p.K412K	KIF2A_ENST00000407818.3_Silent_p.K412K|KIF2A_ENST00000506857.1_Silent_p.K366K|KIF2A_ENST00000509663.2_Intron|KIF2A_ENST00000381103.2_Silent_p.K392K	NM_001243953.1|NM_004520.4	NP_001230882.1|NP_004511.2	O00139	KIF2A_HUMAN	kinesin heavy chain member 2A	412	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|nervous system development (GO:0007399)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	15		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		ATGTACTGAAACTCATTGACA	0.368																																					p.K412K		.											.	KIF2A	228	0			c.A1236G						.						84.0	80.0	82.0					5																	61659121		2203	4300	6503	SO:0001819	synonymous_variant	3796	exon13			ACTGAAACTCATT	BC031828	CCDS3980.2, CCDS47216.1, CCDS58949.1	5q12-q13	2008-02-05	2006-09-26	2006-09-26	ENSG00000068796	ENSG00000068796		"""Kinesins"""	6318	protein-coding gene	gene with protein product		602591	"""kinesin heavy chain member 2"""	KIF2		9177777	Standard	NM_001098511		Approved	HK2	uc003jsz.4	O00139	OTTHUMG00000097755	ENST00000401507.3:c.1236A>G	5.37:g.61659121A>G		45.0	0.0		92.0	6.0	NM_001098511	A5YM42|A5YM54|B4DY54|D3DW97|E9PB70|Q7Z5I3|Q8N5Q7	Silent	SNP	ENST00000401507.3	37	CCDS3980.2	.	.	.	.	.	.	.	.	.	.	A	10.40	1.339866	0.24339	.	.	ENSG00000068796	ENST00000512006	.	.	.	5.56	1.99	0.26369	.	.	.	.	.	T	0.54191	0.1843	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44298	-0.9337	4	.	.	.	.	6.5643	0.22503	0.3959:0.0:0.6041:0.0	.	.	.	.	S	48	.	.	N	+	2	0	KIF2A	61694878	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.439000	0.44846	0.437000	0.26423	0.533000	0.62120	AAC	.		0.368	KIF2A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317989.1	NM_004520	
KRTAP1-4	728255	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	17	39186236	39186236	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:39186236G>T	ENST00000377747.4	-	1	120	c.95C>A	c.(94-96)aCc>aAc	p.T32N	KRTAP1-5_ENST00000361883.5_5'Flank	NM_001257305.1	NP_001244234.1	P0C5Y4	KRA14_HUMAN	keratin associated protein 1-4	32						keratin filament (GO:0045095)				lung(1)	1						GCAGGAGCTGGTCTGGCAGCA	0.632																																					p.T32N		.											.	.	.	0			c.C95A						.																																			SO:0001583	missense	728255	exon1			GAGCTGGTCTGGC	AC007455	CCDS58548.1	17q21.2	2010-06-22			ENSG00000204887	ENSG00000204887		"""Keratin associated proteins"""	18904	protein-coding gene	gene with protein product		608821					Standard	NM_001257305		Approved	KAP1.4	uc031raf.1	P0C5Y4	OTTHUMG00000133631	ENST00000377747.4:c.95C>A	17.37:g.39186236G>T	ENSP00000366976:p.Thr32Asn	69.0	0.0		101.0	46.0	NM_001257305	A6NJ92	Missense_Mutation	SNP	ENST00000377747.4	37	CCDS58548.1	.	.	.	.	.	.	.	.	.	.	G	8.823	0.938036	0.18206	.	.	ENSG00000204887	ENST00000377747	T	0.32988	1.43	4.23	1.04	0.20106	.	1.178950	0.06498	N	0.735867	T	0.32526	0.0832	.	.	.	.	.	.	.	.	.	.	.	.	T	0.43572	-0.9383	6	0.52906	T	0.07	.	7.6968	0.28600	0.0:0.3425:0.4807:0.1768	.	.	.	.	N	32	ENSP00000366976:T32N	ENSP00000366976:T32N	T	-	2	0	KRTAP1-4	36439762	0.031000	0.19500	0.202000	0.23494	0.337000	0.28794	0.352000	0.20113	0.292000	0.22492	0.655000	0.94253	ACC	.		0.632	KRTAP1-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257776.3		
KRT17	3872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39778675	39778675	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:39778675C>A	ENST00000311208.8	-	3	671	c.604G>T	c.(604-606)Gcc>Tcc	p.A202S	JUP_ENST00000540235.1_Missense_Mutation_p.A361S	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17	202	Coil 1B.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				TCCAGGTCGGCTCTGGCCAGG	0.607																																					p.A202S	Pancreas(92;1242 2086 39193 50508)	.											.	KRT17	92	0			c.G604T						.						75.0	77.0	77.0					17																	39778675		2203	4300	6503	SO:0001583	missense	3872	exon3			GGTCGGCTCTGGC	X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505	ENST00000311208.8:c.604G>T	17.37:g.39778675C>A	ENSP00000308452:p.Ala202Ser	438.0	0.0		608.0	224.0	NM_000422	A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	Missense_Mutation	SNP	ENST00000311208.8	37	CCDS11402.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.258354	0.39896	.	.	ENSG00000128422;ENSG00000173801	ENST00000311208;ENST00000540235	T;T	0.76578	-1.03;-1.03	3.87	3.87	0.44632	Prefoldin (1);Filament (1);	0.000000	0.44097	D	0.000489	T	0.63165	0.2488	N	0.16790	0.44	0.24686	N	0.993332	B	0.23185	0.081	B	0.33799	0.17	T	0.50676	-0.8800	10	0.18710	T	0.47	.	10.1206	0.42618	0.0:0.9072:0.0:0.0928	.	202	Q04695	K1C17_HUMAN	S	202;361	ENSP00000308452:A202S;ENSP00000441751:A361S	ENSP00000441751:A361S	A	-	1	0	JUP;KRT17	37032201	0.388000	0.25197	0.983000	0.44433	0.957000	0.61999	1.001000	0.29783	2.164000	0.68074	0.655000	0.94253	GCC	.		0.607	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257460.1	NM_000422	
LACC1	144811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	44455558	44455558	+	Missense_Mutation	SNP	C	C	A	rs150202700		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:44455558C>A	ENST00000441843.1	+	2	922	c.437C>A	c.(436-438)tCc>tAc	p.S146Y	LACC1_ENST00000325686.6_Missense_Mutation_p.S146Y|CCDC122_ENST00000444614.3_5'Flank|CCDC122_ENST00000476570.2_5'Flank	NM_001128303.1	NP_001121775.1	Q8IV20	LACC1_HUMAN	laccase (multicopper oxidoreductase) domain containing 1	146																	TTTAAACAGTCCATTGAAATA	0.328																																					p.S146Y		.											.	.	.	0			c.C437A						.	C	TYR/SER,TYR/SER	0,4406		0,0,2203	77.0	83.0	81.0		437,437	3.9	0.7	13	dbSNP_134	81	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	LACC1	NM_001128303.1,NM_153218.2	144,144	0,2,6501	AA,AC,CC		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging	146/431,146/431	44455558	2,13004	2203	4300	6503	SO:0001583	missense	144811	exon2			AACAGTCCATTGA	AK096044	CCDS9391.1	13q14.11	2012-05-11	2011-08-09	2011-08-09	ENSG00000179630	ENSG00000179630			26789	protein-coding gene	gene with protein product		613409	"""chromosome 13 open reading frame 31"""	C13orf31		16740638, 22504414	Standard	NM_153218		Approved	FLJ38725	uc010acg.3	Q8IV20	OTTHUMG00000016826	ENST00000441843.1:c.437C>A	13.37:g.44455558C>A	ENSP00000391747:p.Ser146Tyr	76.0	0.0		76.0	25.0	NM_001128303	A2A3Z6|Q8N8X5	Missense_Mutation	SNP	ENST00000441843.1	37	CCDS9391.1	.	.	.	.	.	.	.	.	.	.	C	11.82	1.752758	0.31046	0.0	2.33E-4	ENSG00000179630	ENST00000441843;ENST00000425906;ENST00000325686	T;T	0.49432	0.78;0.78	5.66	3.87	0.44632	.	0.582429	0.19783	N	0.106171	T	0.51176	0.1659	M	0.70595	2.14	0.20307	N	0.999917	P	0.52842	0.956	P	0.44732	0.459	T	0.50048	-0.8873	10	0.66056	D	0.02	0.0021	13.1243	0.59344	0.4207:0.5793:0.0:0.0	.	146	Q8IV20	LACC1_HUMAN	Y	146	ENSP00000391747:S146Y;ENSP00000317619:S146Y	ENSP00000317619:S146Y	S	+	2	0	LACC1	43353558	0.002000	0.14202	0.658000	0.29665	0.241000	0.25554	1.504000	0.35726	0.793000	0.33875	0.655000	0.94253	TCC	C|1.000;A|0.000		0.328	LACC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044726.3	NM_153218	
LINC00205	257103	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	46713386	46713386	+	lincRNA	SNP	C	C	T	rs556480336		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr21:46713386C>T	ENST00000433465.1	+	0	187				BX322557.10_ENST00000454115.2_RNA			P59089	CU086_HUMAN	long intergenic non-protein coding RNA 205																		TTCTAGGAGACGAGAGAGCGA	0.602													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18635	0.0		0.0	False		,,,				2504	0.0				.		.											.	.	.	0			.						.																																					0	.			AGGAGACGAGAGA	AF426264		21q22.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000223768	ENSG00000223768		"""Long non-coding RNAs"""	16420	non-coding RNA	RNA, long non-coding			"""chromosome 21 open reading frame 86"", ""non-protein coding RNA 205"""	C21orf86, NCRNA00205		12036297	Standard			Approved			P59089	OTTHUMG00000090403		21.37:g.46713386C>T		89.0	0.0		91.0	29.0	.		RNA	SNP	ENST00000433465.1	37																																																																																				.		0.602	LINC00205-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000206823.2		
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	141819744	141819744	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:141819744T>G	ENST00000389484.3	-	8	2083	c.1112A>C	c.(1111-1113)cAg>cCg	p.Q371P		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	371					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGCAGCTGGCTGCTCTGTCTT	0.423										TSP Lung(27;0.18)																											p.Q371P	Colon(99;50 2074 2507 20106)	.											.	LRP1B	311	0			c.A1112C						.						174.0	153.0	160.0					2																	141819744		2203	4300	6503	SO:0001583	missense	53353	exon8			GCTGGCTGCTCTG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1112A>C	2.37:g.141819744T>G	ENSP00000374135:p.Gln371Pro	163.0	0.0		173.0	62.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	12.14	1.847611	0.32606	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.94184	-3.37	5.63	5.63	0.86233	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.153604	0.44688	D	0.000436	D	0.92535	0.7629	M	0.71036	2.16	0.34714	D	0.728065	P	0.51653	0.947	B	0.41374	0.355	D	0.96039	0.9023	10	0.62326	D	0.03	.	16.1307	0.81436	0.0:0.0:0.0:1.0	.	371	Q9NZR2	LRP1B_HUMAN	P	371;309	ENSP00000374135:Q371P	ENSP00000374135:Q371P	Q	-	2	0	LRP1B	141536214	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.529000	0.45632	2.263000	0.75096	0.533000	0.62120	CAG	.		0.423	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
MCL1	4170	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	150551951	150551951	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:150551951G>A	ENST00000369026.2	-	1	115	c.56C>T	c.(55-57)gCc>gTc	p.A19V	MCL1_ENST00000464132.1_5'Flank|MCL1_ENST00000307940.3_Missense_Mutation_p.A19V	NM_001197320.1|NM_021960.4	NP_001184249.1|NP_068779.1	Q07820	MCL1_HUMAN	myeloid cell leukemia 1	19					apoptotic mitochondrial changes (GO:0008637)|cell fate determination (GO:0001709)|cellular homeostasis (GO:0019725)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|protein transmembrane transport (GO:0071806)|regulation of response to DNA damage stimulus (GO:2001020)|response to cytokine (GO:0034097)	Bcl-2 family protein complex (GO:0097136)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	BH3 domain binding (GO:0051434)|protein channel activity (GO:0015266)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)	8	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CCCCAAGCCGGCCCCCCCACA	0.682																																					p.A19V		.											.	MCL1	227	0			c.C56T						.						9.0	13.0	12.0					1																	150551951		1246	2578	3824	SO:0001583	missense	4170	exon1			AAGCCGGCCCCCC	BC017197	CCDS956.1, CCDS957.1, CCDS72909.1	1q21	2014-03-07	2014-03-07		ENSG00000143384	ENSG00000143384			6943	protein-coding gene	gene with protein product		159552	"""myeloid cell leukemia sequence 1 (BCL2-related)"""			7682708, 7835896	Standard	NM_021960		Approved	BCL2L3, Mcl-1	uc001euz.3	Q07820	OTTHUMG00000034867	ENST00000369026.2:c.56C>T	1.37:g.150551951G>A	ENSP00000358022:p.Ala19Val	82.0	0.0		138.0	33.0	NM_182763	B2R6B2|D3DV03|D3DV04|Q9HD91|Q9NRQ3|Q9NRQ4|Q9UHR7|Q9UHR8|Q9UHR9|Q9UNJ1	Missense_Mutation	SNP	ENST00000369026.2	37	CCDS957.1	.	.	.	.	.	.	.	.	.	.	g	17.64	3.440387	0.63067	.	.	ENSG00000143384	ENST00000369026;ENST00000307940;ENST00000439749	T;T	0.35421	2.42;1.31	4.72	4.72	0.59763	.	0.633271	0.13115	N	0.412699	T	0.26448	0.0646	L	0.29908	0.895	0.09310	N	0.999999	D;P	0.53619	0.961;0.476	P;B	0.52909	0.713;0.225	T	0.08576	-1.0715	10	0.66056	D	0.02	-4.2208	13.0603	0.59003	0.0:0.0:1.0:0.0	.	19;19	Q07820-2;Q07820	.;MCL1_HUMAN	V	19	ENSP00000358022:A19V;ENSP00000309973:A19V	ENSP00000309973:A19V	A	-	2	0	MCL1	148818575	0.744000	0.28250	0.162000	0.22713	0.008000	0.06430	3.040000	0.49799	2.459000	0.83118	0.556000	0.70494	GCC	.		0.682	MCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084402.1	NM_021960	
MDC1	9656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	30679231	30679231	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:30679231G>A	ENST00000376406.3	-	7	2826	c.2179C>T	c.(2179-2181)Ccc>Tcc	p.P727S	MDC1_ENST00000376405.2_Missense_Mutation_p.P727S|MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000494654.1_5'Flank	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	727				Missing (in Ref. 2; CAH18685). {ECO:0000305}.	DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						AGCTCTTGGGGTGGAGTCAAC	0.493								Other conserved DNA damage response genes																													p.P727S		.											.	MDC1	273	0			c.C2179T						.						168.0	124.0	140.0					6																	30679231		1511	2709	4220	SO:0001583	missense	9656	exon7			CTTGGGGTGGAGT	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.2179C>T	6.37:g.30679231G>A	ENSP00000365588:p.Pro727Ser	184.0	0.0		228.0	83.0	NM_014641	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	37	CCDS34384.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.15|13.15	2.151893|2.151893	0.38021|0.38021	.|.	.|.	ENSG00000137337|ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104|ENST00000417033	T;T|.	0.09538|.	3.12;2.97|.	5.1|5.1	4.23|4.23	0.50019|0.50019	.|.	0.000000|.	0.37906|.	N|.	0.001891|.	T|T	0.31071|0.31071	0.0785|0.0785	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	N|N	1|1	P;B;P|.	0.50943|.	0.94;0.259;0.886|.	P;B;B|.	0.47015|.	0.534;0.103;0.381|.	T|T	0.17745|0.17745	-1.0359|-1.0359	10|5	0.72032|.	D|.	0.01|.	0.1256|0.1256	9.6749|9.6749	0.40034|0.40034	0.097:0.0:0.903:0.0|0.097:0.0:0.903:0.0	.|.	727;727;727|.	Q14676-2;Q14676;Q14676-4|.	.;MDC1_HUMAN;.|.	S|I	727;727;727;598|51	ENSP00000365588:P727S;ENSP00000365587:P727S|.	ENSP00000365587:P727S|.	P|T	-|-	1|2	0|0	MDC1|MDC1	30787210|30787210	0.139000|0.139000	0.22563|0.22563	0.026000|0.026000	0.17262|0.17262	0.178000|0.178000	0.23041|0.23041	1.202000|1.202000	0.32271|0.32271	1.280000|1.280000	0.44463|0.44463	0.549000|0.549000	0.68633|0.68633	CCC|ACC	.		0.493	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	
MITF	4286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	69813025	69813025	+	Intron	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:69813025C>T	ENST00000448226.2	+	1	231				MITF_ENST00000352241.4_Intron|MITF_ENST00000328528.6_Silent_p.F11F|MITF_ENST00000472437.1_Intron			O75030	MITF_HUMAN	microphthalmia-associated transcription factor						bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		CAGTGGTTTTCCCACGAGCTA	0.398			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														p.F11F	Melanoma(29;269 969 31479 41502 42961)	.		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	.	MITF	524	0			c.C33T						.						53.0	51.0	51.0					3																	69813025		1824	4083	5907	SO:0001627	intron_variant	4286	exon1			GGTTTTCCCACGA		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.104+24173C>T	3.37:g.69813025C>T		81.0	0.0		94.0	37.0	NM_006722	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Silent	SNP	ENST00000448226.2	37																																																																																				.		0.398	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
MFSD1	64747	hgsc.bcm.edu;bcgsc.ca	37	3	158527010	158527010	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:158527010T>C	ENST00000264266.8	+	6	545	c.483T>C	c.(481-483)gcT>gcC	p.A161A	MFSD1_ENST00000392813.4_Silent_p.A171A|MFSD1_ENST00000415822.2_Silent_p.A210A			Q9H3U5	MFSD1_HUMAN	major facilitator superfamily domain containing 1	161					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	26			Lung(72;0.00372)|LUSC - Lung squamous cell carcinoma(72;0.00523)			ATACATATGCTGTGAGCTGGT	0.358																																					p.A210A	Pancreas(62;1186 1654 36636 37908)	.											.	MFSD1	90	0			c.T630C						.						119.0	120.0	120.0					3																	158527010		2203	4300	6503	SO:0001819	synonymous_variant	64747	exon6			ATATGCTGTGAGC	BC017661	CCDS3185.1, CCDS3185.2, CCDS54666.1	3q25.32	2005-11-17			ENSG00000118855	ENSG00000118855			25874	protein-coding gene	gene with protein product							Standard	NM_022736		Approved	FLJ14153, UG0581B09	uc003fcl.2	Q9H3U5	OTTHUMG00000158835	ENST00000264266.8:c.483T>C	3.37:g.158527010T>C		58.0	0.0		74.0	4.0	NM_022736	B4DGJ8|B4DMR8|B4DU49|B4DWU1|C9JS94|J3KQL7|Q05C07|Q5XKJ1|Q8IVS1|Q8IXG4|Q9H7X1	Silent	SNP	ENST00000264266.8	37																																																																																				.		0.358	MFSD1-018	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470730.1	NM_022736	
MLLT3	4300	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	20414041	20414041	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:20414041T>C	ENST00000380338.4	-	5	1089	c.803A>G	c.(802-804)aAc>aGc	p.N268S	MLLT3_ENST00000429426.2_Missense_Mutation_p.N265S|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR|MIR4473_ENST00000583731.1_RNA	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	268					anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		GGTGAGTAAGTTACTATCTGG	0.398			T	MLL	ALL																																p.N268S		.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	.	MLLT3	660	0			c.A803G						.						278.0	280.0	279.0					9																	20414041		2203	4300	6503	SO:0001583	missense	4300	exon5			AGTAAGTTACTAT	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.803A>G	9.37:g.20414041T>C	ENSP00000369695:p.Asn268Ser	439.0	1.0		451.0	179.0	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Missense_Mutation	SNP	ENST00000380338.4	37	CCDS6494.1	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.835467	0.00579	.	.	ENSG00000171843	ENST00000380338;ENST00000429426;ENST00000540751	.	.	.	5.88	1.92	0.25849	.	0.417336	0.26492	N	0.024065	T	0.35856	0.0946	L	0.29908	0.895	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.11717	-1.0576	9	0.06891	T	0.86	-17.8633	7.2808	0.26310	0.0:0.219:0.1242:0.6568	.	265;268	B7Z755;P42568	.;AF9_HUMAN	S	268;265;307	.	ENSP00000369695:N268S	N	-	2	0	MLLT3	20404041	1.000000	0.71417	0.998000	0.56505	0.318000	0.28184	1.235000	0.32671	0.499000	0.27970	-0.250000	0.11733	AAC	.		0.398	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
MME	4311	broad.mit.edu;bcgsc.ca	37	3	154861272	154861272	+	Missense_Mutation	SNP	G	G	C	rs201238171		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:154861272G>C	ENST00000460393.1	+	13	1349	c.1229G>C	c.(1228-1230)cGt>cCt	p.R410P	MME_ENST00000360490.2_Missense_Mutation_p.R410P|MME_ENST00000493237.1_Missense_Mutation_p.R410P|MME_ENST00000492661.1_Missense_Mutation_p.R410P|MME_ENST00000462745.1_Missense_Mutation_p.R410P	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	410					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	ACTTGGAGACGTTGTGCAAAC	0.428																																					p.R410P		.											.	MME	516	0			c.G1229C						.						204.0	198.0	200.0					3																	154861272		2203	4300	6503	SO:0001583	missense	4311	exon13			GGAGACGTTGTGC		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.1229G>C	3.37:g.154861272G>C	ENSP00000418525:p.Arg410Pro	204.0	1.0		150.0	7.0	NM_007287	A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	37	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.028571	0.75390	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96	5.91	5.03	0.67393	Peptidase M13 (1);Metallopeptidase, catalytic domain (1);	0.261454	0.41001	D	0.000961	T	0.75895	0.3912	L	0.48642	1.525	0.44562	D	0.997521	D	0.69078	0.997	P	0.54629	0.757	T	0.75744	-0.3210	10	0.44086	T	0.13	-12.2593	11.0688	0.47991	0.1407:0.0:0.8593:0.0	.	410	P08473	NEP_HUMAN	P	410	ENSP00000420389:R410P;ENSP00000418525:R410P;ENSP00000419653:R410P;ENSP00000417079:R410P;ENSP00000353679:R410P	ENSP00000353679:R410P	R	+	2	0	MME	156343966	1.000000	0.71417	0.960000	0.40013	0.991000	0.79684	5.202000	0.65169	1.494000	0.48533	0.655000	0.94253	CGT	.		0.428	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	
MMP13	4322	ucsc.edu;bcgsc.ca;mdanderson.org	37	11	102826137	102826137	+	Missense_Mutation	SNP	C	C	T	rs558630699	byFrequency	TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:102826137C>T	ENST00000260302.3	-	2	234	c.206G>A	c.(205-207)cGa>cAa	p.R69Q	MMP13_ENST00000340273.4_Missense_Mutation_p.R69Q	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	69					bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	CTGCATTTCTCGGAGCCTCTC	0.483													C|||	2	0.000399361	0.0008	0.0	5008	,	,		20115	0.0		0.0	False		,,,				2504	0.001				p.R69Q		.											.	MMP13	229	0			c.G206A						.						160.0	154.0	156.0					11																	102826137		2202	4299	6501	SO:0001583	missense	4322	exon2			ATTTCTCGGAGCC	X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.206G>A	11.37:g.102826137C>T	ENSP00000260302:p.Arg69Gln	134.0	2.0		220.0	84.0	NM_002427	A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	ENST00000260302.3	37	CCDS8324.1	.	.	.	.	.	.	.	.	.	.	C	8.483	0.860285	0.17178	.	.	ENSG00000137745	ENST00000260302;ENST00000546012;ENST00000340273	T;T	0.38240	1.15;1.15	5.77	5.77	0.91146	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.158225	0.53938	N	0.000060	T	0.28234	0.0697	L	0.43598	1.365	0.34696	D	0.726281	B	0.15719	0.014	B	0.19946	0.027	T	0.25363	-1.0134	10	0.10636	T	0.68	.	10.7153	0.46008	0.0:0.8585:0.0:0.1415	.	69	P45452	MMP13_HUMAN	Q	69	ENSP00000260302:R69Q;ENSP00000339672:R69Q	ENSP00000260302:R69Q	R	-	2	0	MMP13	102331347	0.019000	0.18553	1.000000	0.80357	0.947000	0.59692	0.084000	0.14891	2.885000	0.99019	0.655000	0.94253	CGA	.		0.483	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386648.1	NM_002427	
MORC2	22880	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	31333805	31333805	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr22:31333805T>C	ENST00000397641.3	-	14	1774	c.1366A>G	c.(1366-1368)Atc>Gtc	p.I456V	MORC2_ENST00000215862.4_Missense_Mutation_p.I394V|MORC2_ENST00000469915.1_Intron			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	456						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						CCATTACCGATGGCAATATCC	0.547																																					p.I394V		.											.	MORC2	92	0			c.A1180G						.						92.0	88.0	89.0					22																	31333805		2203	4300	6503	SO:0001583	missense	22880	exon15			TACCGATGGCAAT	AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.1366A>G	22.37:g.31333805T>C	ENSP00000380763:p.Ile456Val	140.0	0.0		228.0	110.0	NM_014941	B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	ENST00000397641.3	37		.	.	.	.	.	.	.	.	.	.	T	13.73	2.323669	0.41096	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	T;T	0.13420	2.59;2.59	5.33	3.16	0.36331	.	0.000000	0.85682	D	0.000000	T	0.10337	0.0253	L	0.40543	1.245	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.18241	-1.0343	10	0.21014	T	0.42	.	8.2169	0.31516	0.0:0.1606:0.0:0.8394	.	456	Q9Y6X9	MORC2_HUMAN	V	456;394	ENSP00000380763:I456V;ENSP00000215862:I394V	ENSP00000215862:I394V	I	-	1	0	MORC2	29663805	1.000000	0.71417	0.997000	0.53966	0.712000	0.41017	5.909000	0.69923	0.398000	0.25338	0.413000	0.27773	ATC	.		0.547	MORC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321710.2	NM_014941	
MPEG1	219972	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	58979671	58979671	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:58979671G>A	ENST00000361050.3	-	1	753	c.668C>T	c.(667-669)gCc>gTc	p.A223V	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	223	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.					integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				GAGGAAGGAGGCCCTGAGGTG	0.557																																					p.A223V		.											.	MPEG1	70	0			c.C668T						.						55.0	55.0	55.0					11																	58979671		1959	4125	6084	SO:0001583	missense	219972	exon1			AAGGAGGCCCTGA	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.668C>T	11.37:g.58979671G>A	ENSP00000354335:p.Ala223Val	44.0	0.0		49.0	21.0	NM_001039396	Q2M1T6|Q8TEF8	Missense_Mutation	SNP	ENST00000361050.3	37	CCDS41650.1	.	.	.	.	.	.	.	.	.	.	G	8.324	0.824912	0.16678	.	.	ENSG00000197629	ENST00000361050	D	0.84370	-1.84	5.21	4.27	0.50696	Membrane attack complex component/perforin (MACPF) domain (3);	1.165770	0.06199	N	0.682903	T	0.78136	0.4236	N	0.14661	0.345	0.09310	N	1	B	0.27910	0.193	B	0.30716	0.119	T	0.65804	-0.6079	10	0.42905	T	0.14	-1.5054	12.5026	0.55964	0.0:0.215:0.785:0.0	.	223	Q2M385	MPEG1_HUMAN	V	223	ENSP00000354335:A223V	ENSP00000354335:A223V	A	-	2	0	MPEG1	58736247	0.837000	0.29446	0.052000	0.19188	0.161000	0.22273	4.656000	0.61483	1.107000	0.41642	0.650000	0.86243	GCC	.		0.557	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
MYLK2	85366	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	30409394	30409394	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr20:30409394A>G	ENST00000375994.2	+	3	899	c.626A>G	c.(625-627)gAg>gGg	p.E209G	MYLK2_ENST00000375985.4_Missense_Mutation_p.E209G			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2	209					cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GAAGTGGGAGAGAAAACCCCA	0.597																																					p.E209G		.											.	MYLK2	760	0			c.A626G						.						83.0	90.0	87.0					20																	30409394		2203	4300	6503	SO:0001583	missense	85366	exon4			TGGGAGAGAAAAC	AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.626A>G	20.37:g.30409394A>G	ENSP00000365162:p.Glu209Gly	150.0	1.0		182.0	70.0	NM_033118	Q569L1|Q96I84	Missense_Mutation	SNP	ENST00000375994.2	37	CCDS13191.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.970901	0.74246	.	.	ENSG00000101306	ENST00000375994;ENST00000375985	T;T	0.68765	-0.35;-0.35	4.67	4.67	0.58626	.	.	.	.	.	T	0.64778	0.2629	M	0.65975	2.015	0.38283	D	0.942484	D	0.53151	0.958	P	0.45138	0.471	T	0.67142	-0.5745	9	0.27785	T	0.31	.	10.6689	0.45747	1.0:0.0:0.0:0.0	.	209	Q9H1R3	MYLK2_HUMAN	G	209	ENSP00000365162:E209G;ENSP00000365152:E209G	ENSP00000365152:E209G	E	+	2	0	MYLK2	29873055	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	4.470000	0.60175	2.091000	0.63221	0.459000	0.35465	GAG	.		0.597	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078583.2	NM_033118	
MYO10	4651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	16783454	16783454	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:16783454G>T	ENST00000513610.1	-	5	1046	c.592C>A	c.(592-594)Ctt>Att	p.L198I		NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	198	Myosin motor.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						CTGCTTTCAAGAATAGCTCGT	0.358																																					p.L198I		.											.	MYO10	3	0			c.C592A						.						81.0	74.0	76.0					5																	16783454		1848	4103	5951	SO:0001583	missense	4651	exon5			TTTCAAGAATAGC	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.592C>A	5.37:g.16783454G>T	ENSP00000421280:p.Leu198Ile	54.0	0.0		105.0	20.0	NM_012334	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	ENST00000513610.1	37	CCDS54834.1	.	.	.	.	.	.	.	.	.	.	G	14.64	2.596256	0.46318	.	.	ENSG00000145555	ENST00000513610;ENST00000513882;ENST00000502436	D;D;D	0.89270	-2.49;-2.49;-2.49	5.52	5.52	0.82312	Myosin head, motor domain (2);	.	.	.	.	D	0.91023	0.7176	M	0.73430	2.235	0.80722	D	1	P;D	0.55605	0.868;0.972	P;P	0.52672	0.706;0.528	D	0.91402	0.5144	9	0.72032	D	0.01	.	9.9945	0.41891	0.1488:0.0:0.8512:0.0	.	165;198	E9PCN3;Q9HD67	.;MYO10_HUMAN	I	198;209;165	ENSP00000421280:L198I;ENSP00000421309:L209I;ENSP00000426783:L165I	ENSP00000426783:L165I	L	-	1	0	MYO10	16836454	1.000000	0.71417	0.904000	0.35570	0.346000	0.29079	2.650000	0.46665	2.595000	0.87683	0.655000	0.94253	CTT	.		0.358	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
NAA16	79612	hgsc.bcm.edu;bcgsc.ca	37	13	41941630	41941630	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:41941630A>G	ENST00000379406.3	+	14	1919	c.1595A>G	c.(1594-1596)aAg>aGg	p.K532R	NAA16_ENST00000497143.1_3'UTR	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	532					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						TGCATGAGAAAGATGACCCTT	0.333																																					p.K532R		.											.	NAA16	90	0			c.A1595G						.						101.0	96.0	97.0					13																	41941630		2203	4300	6503	SO:0001583	missense	79612	exon14			TGAGAAAGATGAC	AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.1595A>G	13.37:g.41941630A>G	ENSP00000368716:p.Lys532Arg	74.0	0.0		91.0	4.0	NM_024561	B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Missense_Mutation	SNP	ENST00000379406.3	37	CCDS9379.1	.	.	.	.	.	.	.	.	.	.	A	18.27	3.587641	0.66105	.	.	ENSG00000172766	ENST00000379406	T	0.57752	0.38	5.27	4.09	0.47781	.	0.076964	0.52532	N	0.000061	T	0.55878	0.1948	M	0.64567	1.98	0.80722	D	1	B	0.26635	0.155	B	0.39935	0.314	T	0.52373	-0.8584	10	0.36615	T	0.2	-7.9668	10.9292	0.47207	0.9259:0.0:0.0741:0.0	.	532	Q6N069	NAA16_HUMAN	R	532	ENSP00000368716:K532R	ENSP00000368716:K532R	K	+	2	0	NAA16	40839630	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.784000	0.68990	0.846000	0.35142	0.477000	0.44152	AAG	.		0.333	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044672.2	NM_018527	
NAV3	89795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	78513703	78513703	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:78513703A>G	ENST00000397909.2	+	15	3900	c.3727A>G	c.(3727-3729)Att>Gtt	p.I1243V	NAV3_ENST00000266692.7_Missense_Mutation_p.I1243V|NAV3_ENST00000536525.2_Missense_Mutation_p.I1243V|NAV3_ENST00000228327.6_Missense_Mutation_p.I1243V			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1243	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GTATCCAGATATTGCCTCACC	0.428										HNSCC(70;0.22)																											p.I1243V		.											.	NAV3	279	0			c.A3727G						.						53.0	52.0	52.0					12																	78513703		1872	4117	5989	SO:0001583	missense	89795	exon15			CCAGATATTGCCT	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3727A>G	12.37:g.78513703A>G	ENSP00000381007:p.Ile1243Val	155.0	0.0		200.0	75.0	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.33|10.33	1.319165|1.319165	0.23994|0.23994	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692|ENST00000552895	T;T;T;T|.	0.26223|.	1.9;1.9;1.88;1.75|.	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	0.000000|.	0.40554|.	U|.	0.001076|.	T|T	0.49355|0.49355	0.1552|0.1552	N|N	0.16567|0.16567	0.415|0.415	0.80722|0.80722	D|D	1|1	B;D;D;D|.	0.63880|.	0.089;0.993;0.988;0.991|.	B;D;D;D|.	0.74674|.	0.052;0.984;0.968;0.978|.	T|T	0.46386|0.46386	-0.9195|-0.9195	10|5	0.06494|.	T|.	0.89|.	-17.4833|-17.4833	15.2698|15.2698	0.73693|0.73693	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1243;1243;1243;1243|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	V|C	1243|314	ENSP00000446132:I1243V;ENSP00000381007:I1243V;ENSP00000228327:I1243V;ENSP00000266692:I1243V|.	ENSP00000228327:I1243V|.	I|Y	+|+	1|2	0|0	NAV3|NAV3	77037834|77037834	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.936000|0.936000	0.57629|0.57629	9.017000|9.017000	0.93651|0.93651	2.010000|2.010000	0.58986|0.58986	0.533000|0.533000	0.62120|0.62120	ATT|TAT	.		0.428	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
NF1	4763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	29576138	29576138	+	Splice_Site	SNP	G	G	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:29576138G>C	ENST00000358273.4	+	30	4493		c.e30+1		NF1_ENST00000356175.3_Splice_Site	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1						actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(5)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TTTATACCAGGTATGCTTACA	0.393			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											.		.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	3353	13	Whole gene deletion(8)|Unknown(5)	soft_tissue(8)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	c.4110+1G>C	GRCh37	CS000898|CS971829	NF1	S		.						150.0	136.0	141.0					17																	29576138		2203	4300	6503	SO:0001630	splice_region_variant	4763	exon30	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	TACCAGGTATGCT		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4110+1G>C	17.37:g.29576138G>C		87.0	0.0		94.0	28.0	NM_000267	O00662|Q14284|Q14930|Q14931|Q9UMK3	Splice_Site	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849295	0.91277	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2982	0.98569	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NF1	26600264	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.378000	0.97191	2.873000	0.98535	0.563000	0.77884	.	.		0.393	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	Intron
NFXL1	152518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	47916121	47916121	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:47916121C>T	ENST00000507489.1	-	2	276	c.100G>A	c.(100-102)Gga>Aga	p.G34R	NFXL1_ENST00000381538.3_Missense_Mutation_p.G34R|NFXL1_ENST00000329043.3_Missense_Mutation_p.G34R	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	34						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						CGCCCTCCTCCGGCGCCGCGG	0.726																																					p.G34R		.											.	NFXL1	524	0			c.G100A						.						7.0	10.0	9.0					4																	47916121		2141	4184	6325	SO:0001583	missense	152518	exon2			CTCCTCCGGCGCC	AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.100G>A	4.37:g.47916121C>T	ENSP00000422037:p.Gly34Arg	89.0	0.0		37.0	15.0	NM_152995	B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	ENST00000507489.1	37	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	C	26.1	4.705928	0.89018	.	.	ENSG00000170448	ENST00000381538;ENST00000507489;ENST00000329043	T;T;T	0.23950	1.9;1.9;1.88	4.32	4.32	0.51571	.	0.382466	0.19009	N	0.125132	T	0.29684	0.0741	L	0.50333	1.59	0.39457	D	0.967506	P	0.49862	0.929	P	0.45971	0.499	T	0.10917	-1.0609	10	0.45353	T	0.12	-13.028	13.5399	0.61668	0.0:1.0:0.0:0.0	.	34	Q6ZNB6	NFXL1_HUMAN	R	34	ENSP00000370949:G34R;ENSP00000422037:G34R;ENSP00000333113:G34R	ENSP00000333113:G34R	G	-	1	0	NFXL1	47610878	0.903000	0.30736	0.988000	0.46212	0.969000	0.65631	1.368000	0.34216	1.949000	0.56562	0.484000	0.47621	GGA	.		0.726	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995	
NPC1L1	29881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44555505	44555505	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:44555505C>T	ENST00000289547.4	-	19	3829	c.3774G>A	c.(3772-3774)aaG>aaA	p.K1258K	NPC1L1_ENST00000381160.3_Silent_p.K1231K|NPC1L1_ENST00000546276.1_Silent_p.K1185K	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	1258					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	TGAGCTGGGCCTTGGCGAGGC	0.612																																					p.K1258K		.											.	NPC1L1	94	0			c.G3774A						.						61.0	63.0	62.0					7																	44555505		2203	4300	6503	SO:0001819	synonymous_variant	29881	exon19			CTGGGCCTTGGCG		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.3774G>A	7.37:g.44555505C>T		68.0	0.0		93.0	38.0	NM_013389	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	37	CCDS5491.1																																																																																			.		0.612	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
NPHS1	4868	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	36342181	36342181	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:36342181A>T	ENST00000378910.5	-	3	379	c.380T>A	c.(379-381)gTg>gAg	p.V127E	NPHS1_ENST00000591817.1_5'Flank|NPHS1_ENST00000353632.6_Missense_Mutation_p.V127E	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	127	Ig-like C2-type 1.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGAGAGGATCACTCTGGGAGA	0.637																																					p.V127E		.											.	NPHS1	49	0			c.T380A						.						37.0	40.0	39.0					19																	36342181		2203	4300	6503	SO:0001583	missense	4868	exon3			AGGATCACTCTGG		CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.380T>A	19.37:g.36342181A>T	ENSP00000368190:p.Val127Glu	82.0	0.0		110.0	26.0	NM_004646	A6NDH2|C3RX61	Missense_Mutation	SNP	ENST00000378910.5	37	CCDS32996.1	.	.	.	.	.	.	.	.	.	.	A	15.11	2.734747	0.48939	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	T;T	0.51325	0.71;0.71	5.92	4.9	0.64082	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.328619	0.27518	N	0.019013	T	0.51873	0.1700	L	0.36672	1.1	0.36219	D	0.851889	D	0.67145	0.996	D	0.63957	0.92	T	0.61618	-0.7026	10	0.72032	D	0.01	-14.0379	6.1768	0.20449	0.7554:0.1642:0.0804:0.0	.	127	O60500	NPHN_HUMAN	E	127	ENSP00000368190:V127E;ENSP00000343634:V127E	ENSP00000343634:V127E	V	-	2	0	NPHS1	41034021	0.997000	0.39634	1.000000	0.80357	0.190000	0.23558	2.197000	0.42696	1.050000	0.40346	0.529000	0.55759	GTG	.		0.637	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1		
NYNRIN	57523	hgsc.bcm.edu;bcgsc.ca	37	14	24879219	24879219	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:24879219A>C	ENST00000382554.3	+	4	2537	c.2219A>C	c.(2218-2220)cAg>cCg	p.Q740P		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	740					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						CACCAGTTTCAGATGGAGGGG	0.637																																					p.Q740P		.											.	NYNRIN	3	0			c.A2219C						.						21.0	24.0	23.0					14																	24879219		1938	4122	6060	SO:0001583	missense	57523	exon4			AGTTTCAGATGGA	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.2219A>C	14.37:g.24879219A>C	ENSP00000371994:p.Gln740Pro	98.0	0.0		138.0	8.0	NM_025081	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	37	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	A	10.33	1.320603	0.23994	.	.	ENSG00000205978	ENST00000382554	T	0.10860	2.83	4.85	0.987	0.19790	.	.	.	.	.	T	0.06096	0.0158	N	0.24115	0.695	0.09310	N	1	P	0.46277	0.875	B	0.38378	0.272	T	0.31138	-0.9954	9	0.66056	D	0.02	.	3.7416	0.08532	0.5625:0.0:0.0946:0.3429	.	740	Q9P2P1	NYNRI_HUMAN	P	740	ENSP00000371994:Q740P	ENSP00000371994:Q740P	Q	+	2	0	NYNRIN	23949059	0.036000	0.19791	0.001000	0.08648	0.004000	0.04260	0.934000	0.28910	0.070000	0.16634	-0.256000	0.11100	CAG	.		0.637	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
OR51G1	79324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4944635	4944635	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:4944635A>G	ENST00000321961.2	-	1	1002	c.935T>C	c.(934-936)aTa>aCa	p.I312T	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAGTGACTTTATAAACTGAAA	0.413																																					p.I312T		.											.	OR51G1	70	0			c.T935C						.						93.0	92.0	92.0					11																	4944635		2201	4298	6499	SO:0001583	missense	79324	exon1			GACTTTATAAACT	AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.935T>C	11.37:g.4944635A>G	ENSP00000322546:p.Ile312Thr	113.0	0.0		117.0	16.0	NM_001005237	B9EGW8|Q6IFH6	Missense_Mutation	SNP	ENST00000321961.2	37	CCDS31366.1	.	.	.	.	.	.	.	.	.	.	A	8.544	0.873893	0.17395	.	.	ENSG00000176879	ENST00000321961	T	0.36878	1.23	4.17	2.96	0.34315	.	1.754140	0.03997	U	0.295786	T	0.19167	0.0460	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.09509	-1.0671	10	0.31617	T	0.26	.	7.6017	0.28079	0.7844:0.2156:0.0:0.0	.	312	Q8NGK1	O51G1_HUMAN	T	312	ENSP00000322546:I312T	ENSP00000322546:I312T	I	-	2	0	OR51G1	4901211	0.002000	0.14202	0.097000	0.21041	0.664000	0.39144	1.714000	0.37961	1.746000	0.51805	0.455000	0.32223	ATA	.		0.413	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142345.1	NM_001005237	
OR4S2	219431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	55418935	55418935	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:55418935G>T	ENST00000312422.2	+	1	556	c.556G>T	c.(556-558)Gcc>Tcc	p.A186S		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				GTTGAAACTTGCCTGCACAGA	0.438																																					p.A186S		.											.	OR4S2	71	0			c.G556T						.						265.0	199.0	222.0					11																	55418935		2182	4053	6235	SO:0001583	missense	219431	exon1			AAACTTGCCTGCA	BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.556G>T	11.37:g.55418935G>T	ENSP00000310337:p.Ala186Ser	235.0	0.0		301.0	114.0	NM_001004059	Q6IF72	Missense_Mutation	SNP	ENST00000312422.2	37	CCDS31505.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.546866	0.65198	.	.	ENSG00000174982	ENST00000312422	T	0.00021	9.02	5.35	4.43	0.53597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000063	T	0.00210	0.0006	L	0.39326	1.205	0.31411	N	0.675523	D	0.58620	0.983	P	0.54544	0.755	T	0.63906	-0.6531	10	0.62326	D	0.03	.	12.213	0.54389	0.0:0.0:0.692:0.308	.	186	Q8NH73	OR4S2_HUMAN	S	186	ENSP00000310337:A186S	ENSP00000310337:A186S	A	+	1	0	OR4S2	55175511	0.000000	0.05858	1.000000	0.80357	0.954000	0.61252	-0.531000	0.06171	1.231000	0.43661	0.542000	0.68232	GCC	.		0.438	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1	NM_001004059	
PARP14	54625	hgsc.bcm.edu;bcgsc.ca	37	3	122419294	122419294	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:122419294T>C	ENST00000474629.2	+	6	2159	c.1893T>C	c.(1891-1893)acT>acC	p.T631T		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	631					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		CCCCAAACACTGTAATCATCA	0.358																																					p.T631T		.											.	PARP14	525	0			c.T1893C						.						31.0	30.0	30.0					3																	122419294		1841	4102	5943	SO:0001819	synonymous_variant	54625	exon6			AAACACTGTAATC	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.1893T>C	3.37:g.122419294T>C		85.0	0.0		77.0	4.0	NM_017554	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Silent	SNP	ENST00000474629.2	37	CCDS46894.1																																																																																			.		0.358	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554	
P2RY12	64805	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	151055763	151055763	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:151055763C>A	ENST00000302632.3	-	3	1170	c.871G>T	c.(871-873)Gca>Tca	p.A291S	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000491549.1_Intron	NM_022788.4|NM_176876.2	NP_073625.1|NP_795345.1	Q9H244	P2Y12_HUMAN	purinergic receptor P2Y, G-protein coupled, 12	291					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell projection organization (GO:0030030)|G-protein coupled purinergic nucleotide receptor signaling pathway (GO:0035589)|G-protein coupled receptor signaling pathway (GO:0007186)|hemostasis (GO:0007599)|negative regulation of cell differentiation (GO:0045596)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of GTPase activity (GO:0043547)|positive regulation of ion transport (GO:0043270)|potassium ion transmembrane transport (GO:0071805)|protein kinase B signaling (GO:0043491)|regulation of calcium ion transport (GO:0051924)	basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	ADP receptor activity (GO:0001621)|G-protein coupled adenosine receptor activity (GO:0001609)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	17			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		Clopidogrel(DB00758)|Epoprostenol(DB01240)|Prasugrel(DB06209)|Ticagrelor(DB08816)|Ticlopidine(DB00208)|Treprostinil(DB00374)	TCCAGGCATGCATTTAAGGAA	0.438																																					p.A291S		.											.	P2RY12	501	0			c.G871T						.						116.0	113.0	114.0					3																	151055763		2203	4300	6503	SO:0001583	missense	64805	exon3			GGCATGCATTTAA	AJ320495	CCDS3159.1	3q24-q25	2014-09-17			ENSG00000169313	ENSG00000169313		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	18124	protein-coding gene	gene with protein product		600515				11502873, 11104774	Standard	NM_022788		Approved	P2Y12, SP1999, HORK3	uc003eyw.1	Q9H244	OTTHUMG00000159863	ENST00000302632.3:c.871G>T	3.37:g.151055763C>A	ENSP00000307259:p.Ala291Ser	111.0	0.0		66.0	46.0	NM_022788	D3DNJ5|Q546J7	Missense_Mutation	SNP	ENST00000302632.3	37	CCDS3159.1	.	.	.	.	.	.	.	.	.	.	C	13.83	2.355428	0.41700	.	.	ENSG00000169313	ENST00000302632;ENST00000455408	T	0.62788	-0.0	5.33	5.33	0.75918	GPCR, rhodopsin-like superfamily (1);	0.158495	0.56097	D	0.000028	T	0.26011	0.0634	N	0.00382	-1.575	0.49213	D	0.999766	B	0.24258	0.1	B	0.25405	0.06	T	0.49031	-0.8981	10	0.02654	T	1	-20.4475	16.3945	0.83586	0.0:0.8686:0.1314:0.0	.	291	Q9H244	P2Y12_HUMAN	S	291;194	ENSP00000307259:A291S	ENSP00000307259:A291S	A	-	1	0	P2RY12	152538453	1.000000	0.71417	0.330000	0.25442	0.972000	0.66771	4.726000	0.61986	2.654000	0.90174	0.655000	0.94253	GCA	.		0.438	P2RY12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357796.1		
PCMTD1	115294	hgsc.bcm.edu;bcgsc.ca	37	8	52746162	52746162	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:52746162T>C	ENST00000360540.5	-	5	904	c.498A>G	c.(496-498)ggA>ggG	p.G166G	PCMTD1_ENST00000544451.1_Silent_p.G90G|PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000522514.1_Silent_p.G166G	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	166						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				GCACTCCAGCTCCACAATAAA	0.388																																					p.G166G		.											.	PCMTD1	68	0			c.A498G						.						147.0	131.0	136.0					8																	52746162		2203	4300	6503	SO:0001819	synonymous_variant	115294	exon4			TCCAGCTCCACAA		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.498A>G	8.37:g.52746162T>C		84.0	0.0		74.0	4.0	NM_052937	Q96FK9	Silent	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	T	10.67	1.414317	0.25465	.	.	ENSG00000168300	ENST00000519554	.	.	.	5.48	-7.11	0.01542	.	.	.	.	.	T	0.35189	0.0923	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37865	-0.9687	4	.	.	.	-29.4437	1.9579	0.03380	0.4189:0.1175:0.1001:0.3635	.	.	.	.	G	58	.	.	E	-	2	0	PCMTD1	52908715	0.984000	0.35163	0.871000	0.34182	0.972000	0.66771	0.110000	0.15437	-1.607000	0.01589	-0.468000	0.05107	GAG	.		0.388	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
PDE11A	50940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	178545631	178545631	+	Splice_Site	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:178545631C>A	ENST00000286063.6	-	16	2663	c.2346G>T	c.(2344-2346)gaG>gaT	p.E782D	PDE11A_ENST00000389683.3_Splice_Site_p.E338D|PDE11A_ENST00000449286.2_Splice_Site_p.E424D|PDE11A_ENST00000358450.4_Splice_Site_p.E532D|PDE11A_ENST00000409504.1_Splice_Site_p.E424D	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	782	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	CAGTTCTCCTCCTGCAGGAAA	0.348									Primary Pigmented Nodular Adrenocortical Disease, Familial																												p.E782D		.											.	PDE11A	93	0			c.G2346T						.						86.0	83.0	84.0					2																	178545631		2201	4297	6498	SO:0001630	splice_region_variant	50940	exon16	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	TCTCCTCCTGCAG	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.2346-1G>T	2.37:g.178545631C>A		38.0	0.0		24.0	10.0	NM_016953	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	ENST00000286063.6	37	CCDS33334.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.72|14.72	2.618248|2.618248	0.46736|0.46736	.|.	.|.	ENSG00000128655|ENSG00000128655	ENST00000286063;ENST00000358450;ENST00000409504;ENST00000389683;ENST00000449286|ENST00000433879	T;T;T;T;T|.	0.78246|.	-1.16;-1.16;-1.16;-1.16;-1.16|.	5.61|5.61	3.8|3.8	0.43715|0.43715	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);|.	0.143299|.	0.64402|.	D|.	0.000008|.	T|T	0.53948|0.53948	0.1828|0.1828	L|L	0.41492|0.41492	1.28|1.28	0.80722|0.80722	D|D	1|1	B;B|.	0.16166|.	0.004;0.016|.	B;B|.	0.16722|.	0.004;0.016|.	T|T	0.49753|0.49753	-0.8906|-0.8906	10|5	0.87932|.	D|.	0|.	.|.	9.3756|9.3756	0.38281|0.38281	0.0:0.7845:0.0:0.2155|0.0:0.7845:0.0:0.2155	.|.	532;782|.	Q9HCR9-2;Q9HCR9|.	.;PDE11_HUMAN|.	D|I	782;532;424;338;424|390	ENSP00000286063:E782D;ENSP00000351232:E532D;ENSP00000386539:E424D;ENSP00000374333:E338D;ENSP00000390599:E424D|.	ENSP00000286063:E782D|.	E|R	-|-	3|2	2|0	PDE11A|PDE11A	178253877|178253877	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.659000|1.659000	0.37387|0.37387	1.516000|1.516000	0.48900|0.48900	0.655000|0.655000	0.94253|0.94253	GAG|AGA	.		0.348	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2		Missense_Mutation
PEAR1	375033	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	156878092	156878092	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:156878092T>C	ENST00000338302.3	+	10	1300	c.1075T>C	c.(1075-1077)Tgc>Cgc	p.C359R	PEAR1_ENST00000292357.7_Missense_Mutation_p.C359R			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	359					recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CGGTCTCAGCTGCCAGGCCCC	0.677																																					p.C359R		.											.	PEAR1	71	0			c.T1075C						.						16.0	14.0	15.0					1																	156878092		2194	4282	6476	SO:0001583	missense	375033	exon9			CTCAGCTGCCAGG	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.1075T>C	1.37:g.156878092T>C	ENSP00000344465:p.Cys359Arg	61.0	1.0		123.0	18.0	NM_001080471	Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	T	18.57	3.653425	0.67472	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	T;T	0.72835	-0.69;-0.69	4.33	4.33	0.51752	EGF-like, laminin (1);	0.000000	0.48767	D	0.000168	D	0.88142	0.6357	H	0.99058	4.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91608	0.5300	10	0.87932	D	0	.	11.5001	0.50433	0.0:0.0:0.0:1.0	.	160;359	Q8N780;Q5VY43	.;PEAR1_HUMAN	R	359	ENSP00000344465:C359R;ENSP00000292357:C359R	ENSP00000292357:C359R	C	+	1	0	PEAR1	155144716	1.000000	0.71417	0.997000	0.53966	0.854000	0.48673	7.253000	0.78320	1.809000	0.52856	0.459000	0.35465	TGC	.		0.677	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	
PELP1	27043	hgsc.bcm.edu;bcgsc.ca	37	17	4585844	4585844	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:4585844T>C	ENST00000574876.1	-	5	612	c.595A>G	c.(595-597)Atg>Gtg	p.M199V	PELP1_ENST00000436683.2_Missense_Mutation_p.M52V|AC091153.4_ENST00000441700.2_RNA|PELP1_ENST00000570823.1_5'Flank|PELP1_ENST00000301396.4_Missense_Mutation_p.M199V|PELP1_ENST00000269230.7_Missense_Mutation_p.M199V|PELP1_ENST00000572293.1_Missense_Mutation_p.M249V			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	199					cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						CAAGCCTTCATTCCTTCCAAT	0.493																																					p.M199V		.											.	PELP1	24	0			c.A595G						.						109.0	103.0	105.0					17																	4585844		2029	4188	6217	SO:0001583	missense	27043	exon5			CCTTCATTCCTTC		CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.595A>G	17.37:g.4585844T>C	ENSP00000461625:p.Met199Val	75.0	0.0		61.0	4.0	NM_014389	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Missense_Mutation	SNP	ENST00000574876.1	37	CCDS58503.1	.	.	.	.	.	.	.	.	.	.	t	15.50	2.851703	0.51270	.	.	ENSG00000141456	ENST00000301396;ENST00000269230;ENST00000436683	T;T;T	0.66460	-0.21;-0.11;-0.13	4.59	4.59	0.56863	.	0.051642	0.64402	D	0.000001	T	0.67702	0.2921	N	0.19112	0.55	0.30407	N	0.779429	D;D	0.53885	0.963;0.963	D;D	0.69824	0.966;0.966	T	0.67715	-0.5599	10	0.66056	D	0.02	-21.1964	10.2857	0.43566	0.0:0.0:0.0:1.0	.	52;199	E7EV54;Q8IZL8	.;PELP1_HUMAN	V	199;199;52	ENSP00000301396:M199V;ENSP00000269230:M199V;ENSP00000416231:M52V	ENSP00000269230:M199V	M	-	1	0	AC091153.1	4532593	1.000000	0.71417	0.997000	0.53966	0.820000	0.46376	6.190000	0.72057	1.934000	0.56057	0.375000	0.23000	ATG	.		0.493	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000439140.2	NM_014389	
PIGN	23556	hgsc.bcm.edu;bcgsc.ca	37	18	59713126	59713126	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr18:59713126A>G	ENST00000357637.5	-	31	3174	c.2759T>C	c.(2758-2760)cTc>cCc	p.L920P	PIGN_ENST00000400334.3_Missense_Mutation_p.L920P	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	920					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				ACATAGTCTGAGTTTCTTCGT	0.448																																					p.L920P		.											.	PIGN	227	0			c.T2759C						.						102.0	100.0	101.0					18																	59713126		2006	4195	6201	SO:0001583	missense	23556	exon31			AGTCTGAGTTTCT	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.2759T>C	18.37:g.59713126A>G	ENSP00000350263:p.Leu920Pro	77.0	0.0		94.0	5.0	NM_176787	Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	ENST00000357637.5	37	CCDS45879.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.089235	0.76756	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.32272	1.46;1.46	5.23	5.23	0.72850	.	0.165198	0.41001	D	0.000968	T	0.52289	0.1725	M	0.75777	2.31	0.80722	D	1	D;D	0.89917	0.993;1.0	P;D	0.65987	0.868;0.94	T	0.53732	-0.8397	10	0.45353	T	0.12	-11.2283	12.6467	0.56738	1.0:0.0:0.0:0.0	.	920;920	B2RCI8;O95427	.;PIGN_HUMAN	P	920	ENSP00000350263:L920P;ENSP00000383188:L920P	ENSP00000350263:L920P	L	-	2	0	PIGN	57864106	1.000000	0.71417	0.923000	0.36655	0.920000	0.55202	6.969000	0.76092	1.963000	0.57068	0.460000	0.39030	CTC	.		0.448	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449757.2	NM_176787	
PKD2	5311	hgsc.bcm.edu;bcgsc.ca	37	4	88940628	88940628	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:88940628T>C	ENST00000237596.2	+	2	680	c.614T>C	c.(613-615)cTc>cCc	p.L205P		NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		GGAACAAGACTCATGGAGGAA	0.353																																					p.L205P		.											.	PKD2	91	0			c.T614C						.						85.0	82.0	83.0					4																	88940628		2203	4300	6503	SO:0001583	missense	5311	exon2			CAAGACTCATGGA	U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.614T>C	4.37:g.88940628T>C	ENSP00000237596:p.Leu205Pro	44.0	0.0		61.0	4.0	NM_000297	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000237596.2	37	CCDS3627.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.175702	0.78564	.	.	ENSG00000118762	ENST00000237596	T	0.71103	-0.54	5.9	5.9	0.94986	.	0.146176	0.47852	D	0.000220	T	0.79299	0.4422	M	0.77103	2.36	0.80722	D	1	D	0.60575	0.988	P	0.52514	0.701	T	0.82123	-0.0613	10	0.62326	D	0.03	-12.3317	14.562	0.68148	0.0:0.0:0.0:1.0	.	205	Q13563	PKD2_HUMAN	P	205	ENSP00000237596:L205P	ENSP00000237596:L205P	L	+	2	0	PKD2	89159652	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.669000	0.68081	2.251000	0.74343	0.528000	0.53228	CTC	.		0.353	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253042.4	NM_000297	
PLA2G4C	8605	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	48565265	48565265	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:48565265T>C	ENST00000599921.1	-	14	1604	c.1247A>G	c.(1246-1248)gAt>gGt	p.D416G	PLA2G4C_ENST00000413144.2_Missense_Mutation_p.D416G|CTD-2265M8.2_ENST00000601950.1_RNA|PLA2G4C_ENST00000596510.1_5'UTR|CTD-2265M8.2_ENST00000596552.1_RNA|PLA2G4C_ENST00000354276.3_Missense_Mutation_p.D416G|PLA2G4C_ENST00000599111.1_Missense_Mutation_p.D426G|CTD-2265M8.2_ENST00000601548.1_RNA			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)	416	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		CTCGAAAGGATCTCCGGCACT	0.627																																					p.D426G		.											.	PLA2G4C	92	0			c.A1277G						.						90.0	88.0	89.0					19																	48565265		2203	4300	6503	SO:0001583	missense	8605	exon14			AAAGGATCTCCGG	AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.1247A>G	19.37:g.48565265T>C	ENSP00000469473:p.Asp416Gly	45.0	0.0		59.0	26.0	NM_001159322	B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	Missense_Mutation	SNP	ENST00000599921.1	37	CCDS12710.1	.	.	.	.	.	.	.	.	.	.	T	13.56	2.274278	0.40194	.	.	ENSG00000105499	ENST00000354276;ENST00000413144	T;T	0.11063	2.81;2.81	2.79	2.79	0.32731	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.174869	0.36482	U	0.002575	T	0.08358	0.0208	L	0.31664	0.95	0.27953	N	0.93709	P;P	0.45428	0.858;0.835	B;B	0.43867	0.434;0.363	T	0.16394	-1.0404	10	0.27082	T	0.32	-5.1386	7.4822	0.27411	0.0:0.0:0.0:1.0	.	426;416	B4DI40;Q9UP65	.;PA24C_HUMAN	G	416	ENSP00000346228:D416G;ENSP00000400036:D416G	ENSP00000346228:D416G	D	-	2	0	PLA2G4C	53257077	1.000000	0.71417	0.386000	0.26170	0.550000	0.35303	3.354000	0.52254	1.045000	0.40225	0.333000	0.21579	GAT	.		0.627	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465551.1		
PLIN2	123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	19116605	19116605	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:19116605G>C	ENST00000276914.2	-	8	1134	c.955C>G	c.(955-957)Cag>Gag	p.Q319E	PLIN2_ENST00000411567.1_Missense_Mutation_p.Q238E	NM_001122.3	NP_001113.2	Q99541	PLIN2_HUMAN	perilipin 2	319					cellular lipid metabolic process (GO:0044255)|lipid storage (GO:0019915)|long-chain fatty acid transport (GO:0015909)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	19						TGGAGCTGCTGAGTCAGGTTG	0.473																																					p.Q319E		.											.	PLIN2	92	0			c.C955G						.						146.0	120.0	129.0					9																	19116605		2203	4300	6503	SO:0001583	missense	123	exon8			GCTGCTGAGTCAG	X97324	CCDS6490.1	9p22.1	2009-08-12	2009-08-12	2009-08-12	ENSG00000147872	ENSG00000147872		"""Perilipins"""	248	protein-coding gene	gene with protein product	"""adipophilin"""	103195	"""adipose differentiation-related protein"""	ADFP		9003395, 19638644	Standard	NM_001122		Approved	ADRP	uc003zno.3	Q99541	OTTHUMG00000019624	ENST00000276914.2:c.955C>G	9.37:g.19116605G>C	ENSP00000276914:p.Gln319Glu	200.0	0.0		217.0	97.0	NM_001122	Q9BSC3	Missense_Mutation	SNP	ENST00000276914.2	37	CCDS6490.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.755120	0.89843	.	.	ENSG00000147872	ENST00000411567;ENST00000276914	T;T	0.06068	3.35;3.35	6.0	6.0	0.97389	.	0.000000	0.85682	D	0.000000	T	0.29850	0.0746	M	0.82132	2.575	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00184	-1.1944	10	0.40728	T	0.16	.	20.4945	0.99205	0.0:0.0:1.0:0.0	.	319	Q99541	PLIN2_HUMAN	E	238;319	ENSP00000415270:Q238E;ENSP00000276914:Q319E	ENSP00000276914:Q319E	Q	-	1	0	PLIN2	19106605	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.835000	0.99442	2.846000	0.97976	0.650000	0.86243	CAG	.		0.473	PLIN2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051835.1	NM_001122	
PMS2	5395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	6026652	6026652	+	Missense_Mutation	SNP	C	C	G	rs63750739		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:6026652C>G	ENST00000265849.7	-	11	1849	c.1744G>C	c.(1744-1746)Gaa>Caa	p.E582Q	PMS2_ENST00000441476.2_Missense_Mutation_p.E476Q|PMS2_ENST00000382321.4_Intron|PMS2_ENST00000469652.1_Intron|PMS2_ENST00000406569.3_Intron	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	582					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		AGAATTTCTTCTTTTTTAAAA	0.383			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.E582Q		.	yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	.	PMS2	1083	0			c.G1744C						.						102.0	111.0	108.0					7																	6026652		2203	4300	6503	SO:0001583	missense	5395	exon11	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	TTTCTTCTTTTTT		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.1744G>C	7.37:g.6026652C>G	ENSP00000265849:p.Glu582Gln	77.0	0.0		86.0	41.0	NM_000535	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Missense_Mutation	SNP	ENST00000265849.7	37	CCDS5343.1	.	.	.	.	.	.	.	.	.	.	c	13.74	2.328625	0.41197	.	.	ENSG00000122512	ENST00000265849;ENST00000382322;ENST00000441476	T;T	0.46063	0.88;0.88	5.49	3.68	0.42216	.	0.158719	0.53938	D	0.000045	T	0.50463	0.1617	M	0.68952	2.095	0.09310	N	1	D;D	0.62365	0.977;0.991	P;P	0.58331	0.611;0.837	T	0.37056	-0.9722	10	0.33940	T	0.23	-7.4577	5.998	0.19505	0.0:0.6986:0.0:0.3014	.	582;476	P54278;C9J167	PMS2_HUMAN;.	Q	582;535;476	ENSP00000265849:E582Q;ENSP00000392843:E476Q	ENSP00000265849:E582Q	E	-	1	0	PMS2	5993178	0.929000	0.31497	0.018000	0.16275	0.083000	0.17756	3.430000	0.52807	1.337000	0.45525	-0.384000	0.06662	GAA	.		0.383	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535	
PPIL4	85313	hgsc.bcm.edu;bcgsc.ca	37	6	149867088	149867088	+	Silent	SNP	G	G	A	rs200555722		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:149867088G>A	ENST00000253329.2	-	1	86	c.54C>T	c.(52-54)acC>acT	p.T18T		NM_139126.3	NP_624311.1	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 4	18	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	13		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		GCCGTTCTTCGGTGTACAAGT	0.647																																					p.T18T		.											.	PPIL4	90	0			c.C54T						.						34.0	28.0	30.0					6																	149867088		2199	4290	6489	SO:0001819	synonymous_variant	85313	exon1			TTCTTCGGTGTAC		CCDS34550.1	6q25.1	2013-02-12			ENSG00000131013	ENSG00000131013		"""RNA binding motif (RRM) containing"""	15702	protein-coding gene	gene with protein product		607609					Standard	NM_139126		Approved		uc003qmo.2	Q8WUA2	OTTHUMG00000015788	ENST00000253329.2:c.54C>T	6.37:g.149867088G>A		86.0	0.0		49.0	4.0	NM_139126	B2RD34|Q7Z3Q5	Silent	SNP	ENST00000253329.2	37	CCDS34550.1																																																																																			G|0.997;C|0.003		0.647	PPIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042642.1		
PPP3CA	5530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	101982264	101982264	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:101982264G>A	ENST00000394854.3	-	10	1819	c.1136C>T	c.(1135-1137)tCa>tTa	p.S379L	PPP3CA_ENST00000512215.1_Missense_Mutation_p.S147L|PPP3CA_ENST00000523694.2_Missense_Mutation_p.S312L|PPP3CA_ENST00000394853.4_Missense_Mutation_p.S379L|PPP3CA_ENST00000323055.6_Missense_Mutation_p.S337L|PPP3CA_ENST00000507176.1_Missense_Mutation_p.S281L	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	379					calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		ATCTTCTTCTGACCCTAGTTC	0.368																																					p.S379L		.											.	PPP3CA	227	0			c.C1136T						.						128.0	121.0	123.0					4																	101982264		2203	4300	6503	SO:0001583	missense	5530	exon10			TCTTCTGACCCTA		CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.1136C>T	4.37:g.101982264G>A	ENSP00000378323:p.Ser379Leu	424.0	0.0		405.0	86.0	NM_000944	A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Missense_Mutation	SNP	ENST00000394854.3	37	CCDS34037.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.222758	0.79464	.	.	ENSG00000138814	ENST00000512215;ENST00000394854;ENST00000323055;ENST00000394853;ENST00000507176;ENST00000523694	T;T;T;T;T;T	0.05717	3.4;3.4;3.4;3.4;3.4;3.4	5.34	5.34	0.76211	.	0.312988	0.31031	N	0.008391	T	0.06005	0.0156	N	0.17474	0.49	0.58432	D	0.999998	B;B;B;B;B;B	0.23058	0.0;0.079;0.001;0.001;0.0;0.0	B;B;B;B;B;B	0.18263	0.001;0.021;0.002;0.005;0.001;0.001	T	0.44329	-0.9335	10	0.38643	T	0.18	-10.1385	19.0616	0.93095	0.0:0.0:1.0:0.0	.	379;147;337;379;281;312	Q08209;A8W6Z8;A8W6Z7;Q08209-2;E7ETC2;A1A441	PP2BA_HUMAN;.;.;.;.;.	L	147;379;337;379;281;312	ENSP00000422781:S147L;ENSP00000378323:S379L;ENSP00000320580:S337L;ENSP00000378322:S379L;ENSP00000422990:S281L;ENSP00000429350:S312L	ENSP00000320580:S337L	S	-	2	0	PPP3CA	102201287	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.327000	0.72910	2.499000	0.84300	0.591000	0.81541	TCA	.		0.368	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258379.2	NM_000944	
PPP3CA	5530	hgsc.bcm.edu;bcgsc.ca	37	4	102030182	102030182	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:102030182C>T	ENST00000394854.3	-	3	996	c.313G>A	c.(313-315)Ggg>Agg	p.G105R	PPP3CA_ENST00000512215.1_Intron|PPP3CA_ENST00000523694.2_Missense_Mutation_p.G38R|PPP3CA_ENST00000394853.4_Missense_Mutation_p.G105R|PPP3CA_ENST00000323055.6_Missense_Mutation_p.G105R|PPP3CA_ENST00000510292.1_5'UTR|PPP3CA_ENST00000507176.1_Missense_Mutation_p.G7R	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	105	Catalytic.				calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		GGAGATCCCCCGACTTCAAAG	0.393																																					p.G105R		.											.	PPP3CA	227	0			c.G313A						.						87.0	82.0	83.0					4																	102030182		2203	4300	6503	SO:0001583	missense	5530	exon3			ATCCCCCGACTTC		CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.313G>A	4.37:g.102030182C>T	ENSP00000378323:p.Gly105Arg	76.0	0.0		86.0	4.0	NM_000944	A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Missense_Mutation	SNP	ENST00000394854.3	37	CCDS34037.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.935218	0.92458	.	.	ENSG00000138814	ENST00000394854;ENST00000323055;ENST00000394853;ENST00000507176;ENST00000523694;ENST00000529324;ENST00000525819	T;T;T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;3.39;3.39;-0.35;-0.35	4.93	4.93	0.64822	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	D	0.88009	0.6322	H	0.96460	3.825	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0	D;D;P;D;D	0.97110	0.999;1.0;0.825;1.0;0.998	D	0.92027	0.5630	10	0.87932	D	0	-13.7346	18.5379	0.91017	0.0:1.0:0.0:0.0	.	105;105;105;7;38	Q08209;A8W6Z7;Q08209-2;E7ETC2;A1A441	PP2BA_HUMAN;.;.;.;.	R	105;105;105;7;38;55;55	ENSP00000378323:G105R;ENSP00000320580:G105R;ENSP00000378322:G105R;ENSP00000422990:G7R;ENSP00000429350:G38R;ENSP00000431619:G55R;ENSP00000434599:G55R	ENSP00000320580:G105R	G	-	1	0	PPP3CA	102249205	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.538000	0.82048	2.423000	0.82170	0.650000	0.86243	GGG	.		0.393	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258379.2	NM_000944	
PRRC2C	23215	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	171510373	171510373	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:171510373C>T	ENST00000338920.4	+	16	3999	c.3762C>T	c.(3760-3762)gtC>gtT	p.V1254V	PRRC2C_ENST00000367742.3_Silent_p.V1256V|PRRC2C_ENST00000392078.3_Silent_p.V1256V|PRRC2C_ENST00000426496.2_Silent_p.V1254V	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1254					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										TTGAAGTTGTCCCCAAAAGAA	0.458																																					p.V1254V		.											.	.	.	0			c.C3762T						.						51.0	51.0	51.0					1																	171510373		2203	4300	6503	SO:0001819	synonymous_variant	23215	exon16			AGTTGTCCCCAAA	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.3762C>T	1.37:g.171510373C>T		157.0	0.0		431.0	29.0	NM_015172	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Silent	SNP	ENST00000338920.4	37	CCDS1296.2																																																																																			.		0.458	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
PSMF1	9491	hgsc.bcm.edu;bcgsc.ca	37	20	1145055	1145055	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr20:1145055T>C	ENST00000335877.6	+	6	875	c.699T>C	c.(697-699)ccT>ccC	p.P233P	PSMF1_ENST00000246015.4_Silent_p.P233P|PSMF1_ENST00000438768.2_Silent_p.P171P|PSMF1_ENST00000333082.3_Silent_p.P233P|PSMF1_ENST00000381898.4_Silent_p.P145P|PSMF1_ENST00000484891.1_3'UTR	NM_006814.3	NP_006805.2	Q92530	PSMF1_HUMAN	proteasome (prosome, macropain) inhibitor subunit 1 (PI31)	233	Pro-rich.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteasomal protein catabolic process (GO:1901799)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome core complex (GO:0005839)	endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)	13						ACCGACTTCCTCCAGGCGCTG	0.602																																					p.P233P		.											.	PSMF1	90	0			c.T699C						.						146.0	157.0	153.0					20																	1145055		2203	4300	6503	SO:0001819	synonymous_variant	9491	exon6			ACTTCCTCCAGGC	D88378	CCDS13010.1	20p13	2008-07-02			ENSG00000125818	ENSG00000125818		"""Proteasome (prosome, macropain) subunits"""	9571	protein-coding gene	gene with protein product	"""proteasome inhibitor hP131 subunit"""					10363639	Standard	NM_006814		Approved	PI31	uc002wen.4	Q92530	OTTHUMG00000031656	ENST00000335877.6:c.699T>C	20.37:g.1145055T>C		111.0	0.0		118.0	6.0	NM_006814	A0AVQ9|D3DVW3|Q9H4I1	Silent	SNP	ENST00000335877.6	37	CCDS13010.1	.	.	.	.	.	.	.	.	.	.	T	11.21	1.571433	0.28003	.	.	ENSG00000125818	ENST00000435720	.	.	.	6.07	-0.646	0.11472	.	.	.	.	.	T	0.40297	0.1111	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25467	-1.0131	4	.	.	.	-11.7571	1.6783	0.02827	0.1123:0.1958:0.2565:0.4353	.	.	.	.	P	75	.	.	S	+	1	0	PSMF1	1093055	0.888000	0.30383	1.000000	0.80357	0.937000	0.57800	-0.156000	0.10100	0.161000	0.19458	-0.333000	0.08304	TCC	.		0.602	PSMF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077504.2	NM_178578	
PTGER3	5733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	71478142	71478142	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:71478142T>A	ENST00000306666.5	-	2	1133	c.923A>T	c.(922-924)aAt>aTt	p.N308I	PTGER3_ENST00000414819.1_Missense_Mutation_p.N308I|PTGER3_ENST00000354608.5_Missense_Mutation_p.N308I|PTGER3_ENST00000370932.2_Missense_Mutation_p.N308I|PTGER3_ENST00000370924.4_Missense_Mutation_p.N308I|PTGER3_ENST00000356595.4_Missense_Mutation_p.N308I|PTGER3_ENST00000370931.3_Missense_Mutation_p.N308I|PTGER3_ENST00000351052.5_Missense_Mutation_p.N308I|PTGER3_ENST00000460330.1_Missense_Mutation_p.N308I	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)	308					cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	TGATGTCTGATTGAAGATCAT	0.393																																					p.N308I		.											.	PTGER3	660	0			c.A923T						.						103.0	98.0	100.0					1																	71478142		2203	4300	6503	SO:0001583	missense	5733	exon2			GTCTGATTGAAGA	X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.923A>T	1.37:g.71478142T>A	ENSP00000302313:p.Asn308Ile	65.0	0.0		99.0	35.0	NM_001126044	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation	SNP	ENST00000306666.5	37	CCDS657.1	.	.	.	.	.	.	.	.	.	.	T	15.59	2.877568	0.51801	.	.	ENSG00000050628	ENST00000370931;ENST00000370932;ENST00000351052;ENST00000460330;ENST00000370934;ENST00000354608;ENST00000356595;ENST00000414819;ENST00000306666;ENST00000370924	T;T;T;T;T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62	5.64	3.31	0.37934	GPCR, rhodopsin-like superfamily (1);	0.309163	0.32134	N	0.006525	T	0.70360	0.3215	M	0.72353	2.195	0.36597	D	0.874467	D;D;D;D;D;D;D;D	0.71674	0.996;0.991;0.995;0.996;0.998;0.989;0.995;0.996	D;P;D;D;D;P;D;D	0.66602	0.945;0.903;0.909;0.945;0.945;0.843;0.909;0.945	T	0.69064	-0.5244	10	0.23302	T	0.38	-12.724	9.8856	0.41260	0.0:0.1424:0.0:0.8576	.	308;308;308;308;308;308;308;308	Q147U0;Q6TTN3;F5H821;B1AK19;Q147X8;P43115-3;P43115-4;P43115	.;.;.;.;.;.;.;PE2R3_HUMAN	I	308	ENSP00000359969:N308I;ENSP00000359970:N308I;ENSP00000280208:N308I;ENSP00000418073:N308I;ENSP00000346624:N308I;ENSP00000349003:N308I;ENSP00000401423:N308I;ENSP00000302313:N308I;ENSP00000359962:N308I	ENSP00000302313:N308I	N	-	2	0	PTGER3	71250730	0.997000	0.39634	1.000000	0.80357	0.764000	0.43329	0.270000	0.18607	0.982000	0.38575	-0.425000	0.05940	AAT	.		0.393	PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026076.1	NM_000957	
PTPN22	26191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	114380814	114380814	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:114380814G>A	ENST00000359785.5	-	13	1343	c.1208C>T	c.(1207-1209)cCa>cTa	p.P403L	PTPN22_ENST00000525799.1_Missense_Mutation_p.P276L|PTPN22_ENST00000528414.1_Missense_Mutation_p.P348L|PTPN22_ENST00000460620.1_Intron|PTPN22_ENST00000420377.2_Missense_Mutation_p.P403L|PTPN22_ENST00000538253.1_Missense_Mutation_p.P159L	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	403					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCCAACTATTGGAAATGCCTT	0.403																																					p.P403L		.											.	PTPN22	227	0			c.C1208T						.						86.0	88.0	87.0					1																	114380814		2203	4300	6503	SO:0001583	missense	26191	exon13			ACTATTGGAAATG	AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.1208C>T	1.37:g.114380814G>A	ENSP00000352833:p.Pro403Leu	126.0	0.0		124.0	45.0	NM_015967	A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	ENST00000359785.5	37	CCDS863.1	.	.	.	.	.	.	.	.	.	.	G	7.931	0.740675	0.15642	.	.	ENSG00000134242	ENST00000359785;ENST00000528414;ENST00000538253;ENST00000420377;ENST00000525799;ENST00000354605	T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25	5.58	2.66	0.31614	.	0.342816	0.25546	N	0.029933	T	0.13286	0.0322	L	0.55103	1.725	0.09310	N	0.999998	B;B;B;B;B;B	0.24043	0.096;0.034;0.004;0.005;0.008;0.004	B;B;B;B;B;B	0.27608	0.081;0.012;0.005;0.005;0.008;0.005	T	0.17806	-1.0357	10	0.38643	T	0.18	.	4.8974	0.13757	0.2456:0.1581:0.5963:0.0	.	159;276;403;348;403;403	F5H2S8;E9PPI1;E9PMT0;E9PLD8;G5E984;Q9Y2R2	.;.;.;.;.;PTN22_HUMAN	L	403;348;159;403;276;403	ENSP00000352833:P403L;ENSP00000435176:P348L;ENSP00000439372:P159L;ENSP00000388229:P403L;ENSP00000432674:P276L	ENSP00000346621:P403L	P	-	2	0	PTPN22	114182337	0.026000	0.19158	0.011000	0.14972	0.413000	0.31143	1.052000	0.30429	0.702000	0.31825	0.655000	0.94253	CCA	.		0.403	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033015.1	NM_015967	
RAB28	9364	hgsc.bcm.edu;bcgsc.ca	37	4	13462450	13462450	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:13462450T>C	ENST00000330852.5	-	4	478	c.264A>G	c.(262-264)ggA>ggG	p.G88G	RAB28_ENST00000338176.4_Silent_p.G88G|RAB28_ENST00000288723.4_Silent_p.G88G	NM_001017979.2	NP_001017979.1	P51157	RAB28_HUMAN	RAB28, member RAS oncogene family	88					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	8						CCAAGAGGACTCCCTGTCACA	0.333																																					p.G88G		.											.	RAB28	228	0			c.A264G						.						50.0	53.0	52.0					4																	13462450		2203	4299	6502	SO:0001819	synonymous_variant	9364	exon4			GAGGACTCCCTGT	X94703	CCDS3409.1, CCDS33961.1, CCDS54741.1	4p16.1	2014-04-24			ENSG00000157869	ENSG00000157869		"""RAB, member RAS oncogene"""	9768	protein-coding gene	gene with protein product		612994				8647132	Standard	NM_004249		Approved		uc003gmu.2	P51157	OTTHUMG00000090543	ENST00000330852.5:c.264A>G	4.37:g.13462450T>C		63.0	0.0		104.0	5.0	NM_004249	G8JLC5|Q8IYR8|Q8NI05	Silent	SNP	ENST00000330852.5	37	CCDS33961.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.96|10.96	1.498836|1.498836	0.26861|0.26861	.|.	.|.	ENSG00000157869|ENSG00000157869	ENST00000510528|ENST00000511649	.|.	.|.	.|.	6.01|6.01	0.932|0.932	0.19466|0.19466	.|.	.|.	.|.	.|.	.|.	T|T	0.51193|0.51193	0.1660|0.1660	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.34625|0.34625	-0.9821|-0.9821	4|4	.|.	.|.	.|.	.|.	5.2801|5.2801	0.15670|0.15670	0.1447:0.278:0.0:0.5773|0.1447:0.278:0.0:0.5773	.|.	.|.	.|.	.|.	G|G	3|11	.|.	.|.	E|S	-|-	2|1	0|0	RAB28|RAB28	13071548|13071548	0.935000|0.935000	0.31712|0.31712	0.846000|0.846000	0.33378|0.33378	0.939000|0.939000	0.58152|0.58152	0.234000|0.234000	0.17930|0.17930	-0.037000|-0.037000	0.13646|0.13646	-0.263000|-0.263000	0.10527|0.10527	GAG|AGT	.		0.333	RAB28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207068.2	NM_001017979	
RBM6	10180	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	50103698	50103698	+	Frame_Shift_Del	DEL	C	C	-	rs150609021		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:50103698delC	ENST00000266022.4	+	17	2965	c.2706delC	c.(2704-2706)atcfs	p.I902fs	RBM6_ENST00000422955.1_Frame_Shift_Del_p.I380fs|RBM6_ENST00000443081.1_Frame_Shift_Del_p.I770fs|RBM6_ENST00000421682.1_5'Flank|RBM6_ENST00000441115.1_3'UTR|RBM6_ENST00000539992.1_Frame_Shift_Del_p.I244fs|RBM6_ENST00000442092.1_Frame_Shift_Del_p.I380fs	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	902					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		ACCCACTGATCGGCCTCTTGG	0.498																																					p.I902fs		.											.	RBM6	280	0			c.2706delC						.						38.0	42.0	41.0					3																	50103698		2203	4300	6503	SO:0001589	frameshift_variant	10180	exon17			ACTGATCGGCCTC	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.2706delC	3.37:g.50103698delC	ENSP00000266022:p.Ile902fs	44.0	0.0		53.0	16.0	NM_005777	O60549|O75524|Q86SS3	Frame_Shift_Del	DEL	ENST00000266022.4	37	CCDS2809.1																																																																																			.		0.498	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777	
REV1	51455	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	100029414	100029414	+	Splice_Site	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr2:100029414C>T	ENST00000258428.3	-	13	2180		c.e13-1		REV1_ENST00000393445.3_Splice_Site|REV1_ENST00000465835.1_Splice_Site	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)						DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGTCCAACTCCTAGGAAAGGG	0.333								Direct reversal of damage																													.		.											.	REV1	92	0			c.1952-1G>A						.						56.0	56.0	56.0					2																	100029414		2203	4300	6503	SO:0001630	splice_region_variant	51455	exon14			CAACTCCTAGGAA	AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.1952-1G>A	2.37:g.100029414C>T		120.0	0.0		117.0	46.0	NM_016316	O95941|Q53SI7|Q9C0J4|Q9NUP2	Splice_Site	SNP	ENST00000258428.3	37	CCDS2045.1	.	.	.	.	.	.	.	.	.	.	C	9.216	1.032067	0.19590	.	.	ENSG00000135945	ENST00000393445;ENST00000258428	.	.	.	5.21	4.33	0.51752	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.806	0.63233	0.0:0.9256:0.0:0.0744	.	.	.	.	.	-1	.	.	.	-	.	.	REV1	99395846	1.000000	0.71417	0.979000	0.43373	0.171000	0.22731	7.107000	0.77047	1.317000	0.45149	0.563000	0.77884	.	.		0.333	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	Intron
RP1	6101	hgsc.bcm.edu;bcgsc.ca	37	8	55537397	55537397	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:55537397A>G	ENST00000220676.1	+	4	1103	c.955A>G	c.(955-957)Att>Gtt	p.I319V		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	319					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TGAAGATGATATTGAGAAATC	0.313																																					p.I319V	Colon(91;1014 1389 7634 14542 40420)	.											.	RP1	102	0			c.A955G						.						61.0	64.0	63.0					8																	55537397		2203	4298	6501	SO:0001583	missense	6101	exon4			GATGATATTGAGA	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.955A>G	8.37:g.55537397A>G	ENSP00000220676:p.Ile319Val	79.0	0.0		94.0	4.0	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	A	7.976	0.750055	0.15778	.	.	ENSG00000104237	ENST00000220676	T	0.28454	1.61	5.08	-1.72	0.08107	.	0.574928	0.16670	N	0.204416	T	0.14657	0.0354	N	0.16166	0.38	0.28204	N	0.927216	B	0.21606	0.058	B	0.22386	0.039	T	0.30357	-0.9981	10	0.17369	T	0.5	.	9.8635	0.41129	0.627:0.0:0.373:0.0	.	319	P56715	RP1_HUMAN	V	319	ENSP00000220676:I319V	ENSP00000220676:I319V	I	+	1	0	RP1	55699950	1.000000	0.71417	0.981000	0.43875	0.996000	0.88848	2.456000	0.44997	-0.591000	0.05859	0.533000	0.62120	ATT	.		0.313	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
RPAP2	79871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	92789250	92789250	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:92789250C>G	ENST00000610020.1	+	8	882	c.773C>G	c.(772-774)tCc>tGc	p.S258C	RPAP2_ENST00000484158.1_3'UTR	NM_024813.2	NP_079089.2	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2	258					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|snRNA transcription (GO:0009301)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleolus (GO:0005730)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	22		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		AAAGCTAACTCCAAACACAAA	0.393																																					p.S258C		.											.	RPAP2	91	0			c.C773G						.						117.0	111.0	113.0					1																	92789250		2203	4300	6503	SO:0001583	missense	79871	exon8			CTAACTCCAAACA	AK023212	CCDS740.1	1p22.1	2014-01-28	2007-07-26	2007-07-26	ENSG00000122484	ENSG00000122484			25791	protein-coding gene	gene with protein product		611476	"""chromosome 1 open reading frame 82"""	C1orf82		17643375	Standard	NM_024813		Approved	FLJ13150	uc001dot.2	Q8IXW5	OTTHUMG00000010288	ENST00000610020.1:c.773C>G	1.37:g.92789250C>G	ENSP00000476948:p.Ser258Cys	125.0	0.0		149.0	73.0	NM_024813	C9JKB5|Q49AS7|Q9H8Y2	Missense_Mutation	SNP	ENST00000610020.1	37	CCDS740.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026453	0.54683	.	.	ENSG00000122484	ENST00000370343;ENST00000394482	.	.	.	6.07	5.11	0.69529	.	0.457271	0.24613	N	0.037021	T	0.60637	0.2284	M	0.69823	2.125	0.31756	N	0.633972	D	0.64830	0.994	P	0.57371	0.819	T	0.64740	-0.6336	8	0.39692	T	0.17	-2.6866	14.1725	0.65519	0.0:0.923:0.0:0.077	.	258	Q8IXW5	RPAP2_HUMAN	C	258	.	ENSP00000359368:S258C	S	+	2	0	RPAP2	92561838	0.729000	0.28090	0.430000	0.26722	0.397000	0.30659	2.250000	0.43178	1.443000	0.47586	0.655000	0.94253	TCC	.		0.393	RPAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028368.2	NM_024813	
SAMD12	401474	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	119452108	119452108	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:119452108C>G	ENST00000314727.4	-	3	421	c.285G>C	c.(283-285)caG>caC	p.Q95H	SAMD12_ENST00000409003.4_Missense_Mutation_p.Q95H	NM_207506.2	NP_997389.2	Q8N8I0	SAM12_HUMAN	sterile alpha motif domain containing 12	95	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.									endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)	9	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)			CACTGTAGATCTGATACTGAT	0.428																																					p.Q95H		.											.	SAMD12	227	0			c.G285C						.						242.0	204.0	217.0					8																	119452108		2203	4300	6503	SO:0001583	missense	401474	exon3			GTAGATCTGATAC	AK096777	CCDS6325.1, CCDS47913.1	8q24.12	2013-01-10			ENSG00000177570	ENSG00000177570		"""Sterile alpha motif (SAM) domain containing"""	31750	protein-coding gene	gene with protein product							Standard	NM_207506		Approved	FLJ39458	uc003yom.2	Q8N8I0	OTTHUMG00000059817	ENST00000314727.4:c.285G>C	8.37:g.119452108C>G	ENSP00000314173:p.Gln95His	172.0	0.0		176.0	70.0	NM_207506	Q0P502	Missense_Mutation	SNP	ENST00000314727.4	37	CCDS6325.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	11.83|11.83|11.83	1.754250|1.754250|1.754250	0.31046|0.31046|0.31046	.|.|.	.|.|.	ENSG00000177570|ENSG00000177570|ENSG00000177570	ENST00000453675|ENST00000409003;ENST00000524796;ENST00000314727;ENST00000526328|ENST00000526765	.|T;T;T;T|.	.|0.30981|.	.|1.51;1.51;1.51;1.51|.	5.68|5.68|5.68	3.49|3.49|3.49	0.39957|0.39957|0.39957	.|Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);|.	.|0.059657|.	.|0.64402|.	.|N|.	.|0.000002|.	T|T|T	0.42877|0.42877|0.42877	0.1222|0.1222|0.1222	L|L|L	0.34521|0.34521|0.34521	1.04|1.04|1.04	0.36478|0.36478|0.36478	D|D|D	0.867694|0.867694|0.867694	.|B;B|.	.|0.20368|.	.|0.0;0.044|.	.|B;B|.	.|0.24848|.	.|0.001;0.056|.	T|T|T	0.40850|0.40850|0.40850	-0.9541|-0.9541|-0.9541	5|9|5	.|.|.	.|.|.	.|.|.	-6.6264|-6.6264|-6.6264	5.9633|5.9633|5.9633	0.19310|0.19310|0.19310	0.0:0.607:0.1501:0.243|0.0:0.607:0.1501:0.243|0.0:0.607:0.1501:0.243	.|.|.	.|95;95|.	.|B8ZZB7;Q8N8I0|.	.|.;SAM12_HUMAN|.	H|H|T	92|95;87;95;95|110	.|ENSP00000387133:Q95H;ENSP00000435927:Q87H;ENSP00000314173:Q95H;ENSP00000431360:Q95H|.	.|.|.	D|Q|R	-|-|-	1|3|2	0|2|0	SAMD12|SAMD12|SAMD12	119521289|119521289|119521289	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	2.308000|2.308000|2.308000	0.43690|0.43690|0.43690	0.630000|0.630000|0.630000	0.30394|0.30394|0.30394	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GAT|CAG|AGA	.		0.428	SAMD12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132989.3	NM_207506	
SCAMP5	192683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	75310253	75310253	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr15:75310253C>T	ENST00000361900.6	+	6	543	c.336C>T	c.(334-336)ttC>ttT	p.F112F	SCAMP5_ENST00000545456.1_Silent_p.F41F|SCAMP5_ENST00000568081.1_Silent_p.F45F|SCAMP5_ENST00000565923.1_3'UTR|SCAMP5_ENST00000425597.3_Silent_p.F112F|SCAMP5_ENST00000562212.1_Silent_p.F112F	NM_001178111.1	NP_001171582.1	Q8TAC9	SCAM5_HUMAN	secretory carrier membrane protein 5	112					exocytosis (GO:0006887)|negative regulation of endocytosis (GO:0045806)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of cytokine secretion (GO:0050715)|protein transport (GO:0015031)|response to endoplasmic reticulum stress (GO:0034976)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)|trans-Golgi network membrane (GO:0032588)				large_intestine(1)|lung(1)|ovary(1)|urinary_tract(2)	5						TCTTTACCTTCATGGCTCAGT	0.632																																					p.F112F		.											.	SCAMP5	23	0			c.C336T						.						127.0	126.0	126.0					15																	75310253		2078	4202	6280	SO:0001819	synonymous_variant	192683	exon6			TACCTTCATGGCT	AL833230	CCDS45306.1	15q24.2	2014-05-20			ENSG00000198794	ENSG00000198794		"""Secretory carrier membrane proteins"""	30386	protein-coding gene	gene with protein product		613766				12477932	Standard	NM_001178111		Approved	MGC24969	uc002azk.2	Q8TAC9	OTTHUMG00000172704	ENST00000361900.6:c.336C>T	15.37:g.75310253C>T		121.0	0.0		135.0	50.0	NM_001178111	B3KPJ7|B7Z762|D3DW71|Q8N3M4	Silent	SNP	ENST00000361900.6	37	CCDS45306.1																																																																																			.		0.632	SCAMP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420015.2	NM_138967	
SEMA3A	10371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	83590840	83590840	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:83590840G>T	ENST00000265362.4	-	17	2477	c.2163C>A	c.(2161-2163)ttC>ttA	p.F721L	SEMA3A_ENST00000436949.1_Missense_Mutation_p.F721L	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	721					apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)	p.F721F(1)		breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						CTTGTTCACAGAACTCATCCA	0.453																																					p.F721L		.											.	SEMA3A	156	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.C2163A						.						195.0	170.0	178.0					7																	83590840		2203	4300	6503	SO:0001583	missense	10371	exon17			TTCACAGAACTCA	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.2163C>A	7.37:g.83590840G>T	ENSP00000265362:p.Phe721Leu	238.0	0.0		549.0	109.0	NM_006080		Missense_Mutation	SNP	ENST00000265362.4	37	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469099	0.43839	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.25749	1.78;1.78	5.78	3.03	0.35002	.	0.043033	0.85682	D	0.000000	T	0.17023	0.0409	N	0.22421	0.69	0.58432	D	0.999997	B	0.09022	0.002	B	0.09377	0.004	T	0.04103	-1.0977	10	0.42905	T	0.14	.	11.115	0.48256	0.1987:0.0:0.8013:0.0	.	721	Q14563	SEM3A_HUMAN	L	721	ENSP00000265362:F721L;ENSP00000415260:F721L	ENSP00000265362:F721L	F	-	3	2	SEMA3A	83428776	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.253000	0.51469	0.473000	0.27368	-0.140000	0.14226	TTC	.		0.453	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
SETD9	133383	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	56205565	56205565	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:56205565C>T	ENST00000285947.2	+	1	479	c.93C>T	c.(91-93)aaC>aaT	p.N31N	AC008937.3_ENST00000453721.1_RNA|SETD9_ENST00000541720.1_Silent_p.N31N|SETD9_ENST00000475908.1_Intron	NM_153706.3	NP_714917.2	Q8NE22	SETD9_HUMAN	SET domain containing 9	31							methyltransferase activity (GO:0008168)										TAAGCCACAACCCGAGGTGAG	0.677																																					p.N31N		.											.	.	.	0			c.C93T						.						47.0	31.0	37.0					5																	56205565		2203	4300	6503	SO:0001819	synonymous_variant	133383	exon1			CCACAACCCGAGG	BC036528	CCDS3972.1	5q11.2	2012-02-23	2012-02-23	2012-02-23	ENSG00000155542	ENSG00000155542			28508	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 35"""	C5orf35		20930037	Standard	NM_153706		Approved	MGC33648	uc003jqx.3	Q8NE22	OTTHUMG00000059485	ENST00000285947.2:c.93C>T	5.37:g.56205565C>T		131.0	0.0		132.0	52.0	NM_153706	F5H713	Silent	SNP	ENST00000285947.2	37	CCDS3972.1																																																																																			.		0.677	SETD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132304.2	NM_153706	
SFPQ	6421	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	35656352	35656352	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:35656352T>G	ENST00000357214.5	-	3	1360	c.1262A>C	c.(1261-1263)aAg>aCg	p.K421T		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	421	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)		SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				TGCTGCTGGCTTAGAAGCAAA	0.383			T	TFE3	papillary renal cell																																p.K421T		.		Dom	yes		1	1p34.3	6421	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)		E	.	SFPQ	231	0			c.A1262C						.						139.0	135.0	137.0					1																	35656352		2203	4300	6503	SO:0001583	missense	6421	exon3			GCTGGCTTAGAAG	X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.1262A>C	1.37:g.35656352T>G	ENSP00000349748:p.Lys421Thr	137.0	0.0		155.0	57.0	NM_005066	P30808|Q5SZ71	Missense_Mutation	SNP	ENST00000357214.5	37	CCDS388.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.481314	0.84747	.	.	ENSG00000116560	ENST00000357214	T	0.18016	2.24	5.52	5.52	0.82312	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.138027	0.64402	D	0.000004	T	0.35158	0.0922	L	0.45698	1.435	0.80722	D	1	D	0.76494	0.999	D	0.69307	0.963	T	0.05468	-1.0883	10	0.72032	D	0.01	-13.1554	15.6879	0.77426	0.0:0.0:0.0:1.0	.	421	P23246	SFPQ_HUMAN	T	421	ENSP00000349748:K421T	ENSP00000349748:K421T	K	-	2	0	SFPQ	35428939	1.000000	0.71417	0.986000	0.45419	0.986000	0.74619	4.867000	0.63013	2.102000	0.63906	0.451000	0.29950	AAG	.		0.383	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011984.4	NM_005066	
SLC10A2	6555	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	103701761	103701761	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:103701761T>C	ENST00000245312.3	-	5	1393	c.797A>G	c.(796-798)aAc>aGc	p.N266S		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	266					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)			breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	TAGCTGCGTGTTCTGCATCCC	0.458																																					p.N266S		.											.	SLC10A2	94	0			c.A797G						.						148.0	111.0	124.0					13																	103701761		2203	4300	6503	SO:0001583	missense	6555	exon5			TGCGTGTTCTGCA	U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.797A>G	13.37:g.103701761T>C	ENSP00000245312:p.Asn266Ser	143.0	0.0		187.0	70.0	NM_000452	A1L4F4|Q13839	Missense_Mutation	SNP	ENST00000245312.3	37	CCDS9506.1	.	.	.	.	.	.	.	.	.	.	T	19.08	3.758437	0.69763	.	.	ENSG00000125255	ENST00000245312	T	0.75938	-0.98	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.88062	0.6336	M	0.87971	2.92	0.58432	D	0.999993	D	0.89917	1.0	D	0.87578	0.998	D	0.90071	0.4163	10	0.87932	D	0	-20.8516	16.2484	0.82467	0.0:0.0:0.0:1.0	.	266	Q12908	NTCP2_HUMAN	S	266	ENSP00000245312:N266S	ENSP00000245312:N266S	N	-	2	0	SLC10A2	102499762	1.000000	0.71417	0.951000	0.38953	0.146000	0.21551	7.989000	0.88205	2.291000	0.77112	0.533000	0.62120	AAC	.		0.458	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1		
SLC22A11	55867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64326710	64326710	+	Splice_Site	SNP	G	G	A	rs571324325		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr11:64326710G>A	ENST00000301891.4	+	2	871	c.497G>A	c.(496-498)cGg>cAg	p.R166Q	SLC22A11_ENST00000490834.1_Intron|SLC22A11_ENST00000377585.3_Splice_Site_p.R166Q|SLC22A11_ENST00000377581.3_Splice_Site_p.R166Q	NM_018484.2	NP_060954.1	Q9NSA0	S22AB_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 11	166					organic anion transport (GO:0015711)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23					Aminohippurate(DB00345)|Aspartame(DB00168)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Estradiol(DB00783)|Furosemide(DB00695)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Novobiocin(DB01051)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Salicylic acid(DB00936)|Tetracycline(DB00759)|Zidovudine(DB00495)	CTCTCCTACCGGTGAGTGCCT	0.587													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15989	0.0		0.0	False		,,,				2504	0.0				p.R166Q		.											.	SLC22A11	91	0			c.G497A						.						95.0	84.0	87.0					11																	64326710		2201	4297	6498	SO:0001630	splice_region_variant	55867	exon2			CCTACCGGTGAGT	AB026116	CCDS8074.1	11q13.3	2013-05-22	2008-01-11		ENSG00000168065	ENSG00000168065		"""Solute carriers"""	18120	protein-coding gene	gene with protein product		607097				10660625, 15576633, 17229912	Standard	NM_018484		Approved	OAT4	uc001oai.3	Q9NSA0	OTTHUMG00000045142	ENST00000301891.4:c.497+1G>A	11.37:g.64326710G>A		67.0	0.0		98.0	39.0	NM_018484	A8K426|Q53GR2|Q6ZP72|Q8NBU4	Missense_Mutation	SNP	ENST00000301891.4	37	CCDS8074.1	.	.	.	.	.	.	.	.	.	.	.	20.6	4.013927	0.75161	.	.	ENSG00000168065	ENST00000301891;ENST00000377585;ENST00000377581	T;T;T	0.68181	-0.31;-0.31;-0.31	3.37	2.43	0.29744	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	U	0.000000	T	0.81103	0.4753	M	0.91090	3.175	0.31483	N	0.666961	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.78974	-0.1992	10	0.87932	D	0	.	4.328	0.11050	0.1216:0.0:0.6521:0.2262	.	166;166;166	Q9NSA0-2;A6NCG2;Q9NSA0	.;.;S22AB_HUMAN	Q	166	ENSP00000301891:R166Q;ENSP00000366809:R166Q;ENSP00000366804:R166Q	ENSP00000301891:R166Q	R	+	2	0	SLC22A11	64083286	0.993000	0.37304	0.914000	0.36105	0.153000	0.21895	1.303000	0.33470	0.746000	0.32786	0.485000	0.47835	CGG	.		0.587	SLC22A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104886.4	NM_018484	Missense_Mutation
SLC24A4	123041	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	92953018	92953024	+	Frame_Shift_Del	DEL	TATCGGA	TATCGGA	-			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	TATCGGA	TATCGGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:92953018_92953024delTATCGGA	ENST00000532405.1	+	14	1657_1663	c.1431_1437delTATCGGA	c.(1429-1437)attatcggafs	p.IIG477fs	SLC24A4_ENST00000298877.1_Frame_Shift_Del_p.IIG460fs|SLC24A4_ENST00000351924.5_Frame_Shift_Del_p.IIG441fs|SLC24A4_ENST00000531433.1_Frame_Shift_Del_p.IIG458fs|SLC24A4_ENST00000393265.2_Frame_Shift_Del_p.IIG413fs			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4	477					amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)	p.I461I(1)|p.G462R(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		AGGTGACTATTATCGGATACACACTTG	0.478																																					p.477_479del	NSCLC(10;315 435 10383 28450 38798)	.											.	SLC24A4	93	2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|large_intestine(1)	c.1431_1437del						.																																			SO:0001589	frameshift_variant	123041	exon14			GACTATTATCGGA	AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.1431_1437delTATCGGA	14.37:g.92953018_92953024delTATCGGA	ENSP00000431840:p.Ile477fs	226.0	0.0		242.0	38.0	NM_153646	B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Frame_Shift_Del	DEL	ENST00000532405.1	37	CCDS9903.2																																																																																			.		0.478	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395240.1	NM_153646	
SLC35D1	23169	hgsc.bcm.edu;bcgsc.ca	37	1	67512974	67512974	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:67512974A>G	ENST00000235345.5	-	7	695	c.610T>C	c.(610-612)Tac>Cac	p.Y204H	SLC35D1_ENST00000506472.2_Missense_Mutation_p.Y125H	NM_015139.2	NP_055954.1	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-GlcA/UDP-GalNAc transporter), member D1	204					carbohydrate transport (GO:0008643)|cellular glucuronidation (GO:0052695)|chondroitin sulfate biosynthetic process (GO:0030206)|embryonic skeletal system development (GO:0048706)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|UDP-glucuronate biosynthetic process (GO:0006065)|UDP-glucuronic acid transport (GO:0015787)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	UDP-glucuronic acid transmembrane transporter activity (GO:0005461)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	10						TGTTTTACGTATGCACCATTT	0.358																																					p.Y204H		.											.	SLC35D1	90	0			c.T610C						.						170.0	156.0	161.0					1																	67512974		2203	4300	6503	SO:0001583	missense	23169	exon7			TTACGTATGCACC	AB044343	CCDS636.1	1p32-p31	2013-07-17	2013-07-17		ENSG00000116704	ENSG00000116704		"""Solute carriers"""	20800	protein-coding gene	gene with protein product		610804	"""solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1"""			11322953	Standard	NM_015139		Approved	UGTREL7, KIAA0260	uc001ddk.2	Q9NTN3	OTTHUMG00000009360	ENST00000235345.5:c.610T>C	1.37:g.67512974A>G	ENSP00000235345:p.Tyr204His	61.0	0.0		75.0	4.0	NM_015139	A8K185|B7Z3X2|Q52LU5|Q92548	Missense_Mutation	SNP	ENST00000235345.5	37	CCDS636.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.336122	0.81801	.	.	ENSG00000116704	ENST00000235345;ENST00000506472	T;T	0.68624	-0.34;0.13	5.15	5.15	0.70609	Domain of unknown function DUF250 (1);	0.293349	0.39544	N	0.001333	T	0.75428	0.3848	M	0.76574	2.34	0.80722	D	1	D;D	0.71674	0.998;0.996	D;D	0.70016	0.967;0.928	T	0.77525	-0.2555	10	0.48119	T	0.1	-7.5711	14.2723	0.66159	1.0:0.0:0.0:0.0	.	125;204	B7Z3X2;Q9NTN3	.;S35D1_HUMAN	H	204;125	ENSP00000235345:Y204H;ENSP00000445189:Y125H	ENSP00000235345:Y204H	Y	-	1	0	SLC35D1	67285562	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	8.864000	0.92294	2.076000	0.62316	0.533000	0.62120	TAC	.		0.358	SLC35D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025948.1	NM_015139	
SLC6A13	6540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	333670	333670	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:333670A>G	ENST00000343164.4	-	10	1122	c.1070T>C	c.(1069-1071)cTg>cCg	p.L357P	SLC6A13_ENST00000539668.1_5'Flank|SLC6A13_ENST00000445055.2_Missense_Mutation_p.L265P	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	357					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			GATGAAAGCCAGGCCAGGGCC	0.627																																					p.L357P		.											.	SLC6A13	90	0			c.T1070C						.						88.0	77.0	81.0					12																	333670		2203	4298	6501	SO:0001583	missense	6540	exon10			AAAGCCAGGCCAG	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.1070T>C	12.37:g.333670A>G	ENSP00000339260:p.Leu357Pro	152.0	0.0		176.0	63.0	NM_016615	B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	ENST00000343164.4	37	CCDS8502.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.118608	0.77323	.	.	ENSG00000010379	ENST00000445055;ENST00000313154;ENST00000343164	D;D	0.84873	-1.91;-1.91	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.96364	0.8814	H	0.99806	4.795	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.98476	1.0603	10	0.87932	D	0	.	15.8025	0.78463	1.0:0.0:0.0:0.0	.	265;336;357	B4DJL1;B4DJS3;Q9NSD5	.;.;S6A13_HUMAN	P	265;336;357	ENSP00000407104:L265P;ENSP00000339260:L357P	ENSP00000318097:L336P	L	-	2	0	SLC6A13	203931	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	9.339000	0.96797	2.138000	0.66242	0.368000	0.22195	CTG	.		0.627	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615	
SLC9A3	6550	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	477525	477525	+	Missense_Mutation	SNP	G	G	T	rs371187218		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:477525G>T	ENST00000264938.3	-	11	1691	c.1682C>A	c.(1681-1683)tCc>tAc	p.S561Y	CTD-2228K2.7_ENST00000607286.1_RNA|SLC9A3_ENST00000514375.1_Missense_Mutation_p.S552Y|CTD-2228K2.7_ENST00000607005.1_RNA|CTD-2228K2.7_ENST00000606319.1_RNA|CTD-2228K2.7_ENST00000606288.1_RNA	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	561					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GGTGCTGGGGGAGCGGATGAA	0.642																																					p.S561Y		.											.	SLC9A3	90	0			c.C1682A						.	G	TYR/SER	0,4406		0,0,2203	84.0	63.0	70.0		1682	4.9	1.0	5		70	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC9A3	NM_004174.2	144	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	probably-damaging	561/835	477525	1,13005	2203	4300	6503	SO:0001583	missense	6550	exon11			CTGGGGGAGCGGA		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.1682C>A	5.37:g.477525G>T	ENSP00000264938:p.Ser561Tyr	106.0	0.0		189.0	44.0	NM_004174	B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	ENST00000264938.3	37	CCDS3855.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.764383	0.89932	0.0	1.16E-4	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.76839	-1.05;-1.05	4.88	4.88	0.63580	.	0.114937	0.64402	D	0.000011	D	0.88062	0.6336	M	0.77103	2.36	0.41372	D	0.987493	D;D	0.76494	0.997;0.999	D;D	0.83275	0.931;0.996	D	0.88561	0.3123	10	0.45353	T	0.12	.	17.6513	0.88164	0.0:0.0:1.0:0.0	.	552;561	E9PF67;P48764	.;SL9A3_HUMAN	Y	561;552	ENSP00000264938:S561Y;ENSP00000422983:S552Y	ENSP00000264938:S561Y	S	-	2	0	SLC9A3	530525	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.478000	0.73596	2.251000	0.74343	0.561000	0.74099	TCC	.		0.642	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	
SMC3	9126	hgsc.bcm.edu;bcgsc.ca	37	10	112356255	112356255	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr10:112356255A>G	ENST00000361804.4	+	19	2189	c.2063A>G	c.(2062-2064)gAa>gGa	p.E688G		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	688					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		GCAGAAGAAGAACTAGGTGAA	0.403																																					p.E688G		.											.	SMC3	92	0			c.A2063G						.						107.0	108.0	108.0					10																	112356255		2203	4300	6503	SO:0001583	missense	9126	exon19			AAGAAGAACTAGG	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.2063A>G	10.37:g.112356255A>G	ENSP00000354720:p.Glu688Gly	61.0	0.0		61.0	4.0	NM_005445	A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.959914	0.74016	.	.	ENSG00000108055	ENST00000361804	D	0.89050	-2.46	5.13	5.13	0.70059	SMCs flexible hinge (1);RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.90219	0.6942	M	0.66939	2.045	0.80722	D	1	P	0.49961	0.93	P	0.48524	0.58	D	0.90969	0.4818	10	0.56958	D	0.05	.	14.9491	0.71057	1.0:0.0:0.0:0.0	.	688	Q9UQE7	SMC3_HUMAN	G	688	ENSP00000354720:E688G	ENSP00000354720:E688G	E	+	2	0	SMC3	112346245	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	8.962000	0.93254	1.930000	0.55929	0.260000	0.18958	GAA	.		0.403	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445	
SNX25	83891	hgsc.bcm.edu;bcgsc.ca	37	4	186185597	186185597	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:186185597A>G	ENST00000504273.1	+	4	539	c.245A>G	c.(244-246)gAa>gGa	p.E82G	SNX25_ENST00000264694.8_Missense_Mutation_p.E82G			Q9H3E2	SNX25_HUMAN	sorting nexin 25	82	PXA. {ECO:0000255|PROSITE- ProRule:PRU00147, ECO:0000255|PROSITE- ProRule:PRU00553}.				negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		TTTAGACATGAAGAACAGCCA	0.343																																					p.E82G		.											.	SNX25	273	0			c.A245G						.						126.0	120.0	122.0					4																	186185597		2203	4300	6503	SO:0001583	missense	83891	exon4			GACATGAAGAACA	AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.245A>G	4.37:g.186185597A>G	ENSP00000426255:p.Glu82Gly	104.0	0.0		60.0	4.0	NM_031953	Q3ZT30|Q8N6K3	Missense_Mutation	SNP	ENST00000504273.1	37	CCDS34116.1	.	.	.	.	.	.	.	.	.	.	A	14.87	2.663181	0.47572	.	.	ENSG00000109762	ENST00000504273;ENST00000264694	T;T	0.11277	2.79;2.79	5.15	5.15	0.70609	Phox-associated domain (2);	0.000000	0.85682	D	0.000000	T	0.11024	0.0269	L	0.28740	0.885	0.53688	D	0.999975	B	0.31752	0.338	B	0.37015	0.239	T	0.26087	-1.0113	10	0.25106	T	0.35	-19.9126	15.1313	0.72527	1.0:0.0:0.0:0.0	.	82	Q9H3E2	SNX25_HUMAN	G	82	ENSP00000426255:E82G;ENSP00000264694:E82G	ENSP00000264694:E82G	E	+	2	0	SNX25	186422591	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.845000	0.86875	2.163000	0.67991	0.533000	0.62120	GAA	.		0.343	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360756.1	NM_031953	
SPOP	8405	hgsc.bcm.edu;bcgsc.ca	37	17	47684733	47684733	+	Splice_Site	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:47684733T>C	ENST00000393328.2	-	9	1081	c.716A>G	c.(715-717)aAt>aGt	p.N239S	SPOP_ENST00000347630.2_Splice_Site_p.N239S|SPOP_ENST00000503676.1_Splice_Site_p.N239S|SPOP_ENST00000504102.1_Splice_Site_p.N239S|SPOP_ENST00000393331.3_Splice_Site_p.N239S	NM_003563.3	NP_003554.1	O43791	SPOP_HUMAN	speckle-type POZ protein	239	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.			N -> S (in Ref. 3; BAD96309). {ECO:0000305}.	glucose homeostasis (GO:0042593)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			endometrium(18)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(3)|prostate(33)	63						TTCAACTCGATTCTATGCCAG	0.368										Prostate(2;0.17)																											p.N239S		.											.	SPOP	660	0			c.A716G						.						74.0	70.0	72.0					17																	47684733		2203	4300	6503	SO:0001630	splice_region_variant	8405	exon8			ACTCGATTCTATG	AJ000644	CCDS11551.1	17q21.33	2013-01-09			ENSG00000121067	ENSG00000121067		"""BTB/POZ domain containing"""	11254	protein-coding gene	gene with protein product		602650				9414087	Standard	NM_001007227		Approved	TEF2, BTBD32	uc002ipg.3	O43791	OTTHUMG00000161496	ENST00000393328.2:c.715-1A>G	17.37:g.47684733T>C		81.0	0.0		67.0	4.0	NM_001007228	B2R6S3|D3DTW7|Q53HJ1	Missense_Mutation	SNP	ENST00000393328.2	37	CCDS11551.1	.	.	.	.	.	.	.	.	.	.	T	17.64	3.438941	0.63067	.	.	ENSG00000121067	ENST00000393328;ENST00000393331;ENST00000347630;ENST00000504102;ENST00000503536;ENST00000503676;ENST00000513872;ENST00000509079	T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	5.43	5.43	0.79202	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.53465	0.1798	L	0.35723	1.085	0.80722	D	1	B	0.18968	0.032	B	0.18263	0.021	T	0.48948	-0.8989	10	0.35671	T	0.21	-14.0961	15.3001	0.73940	0.0:0.0:0.0:1.0	.	239	O43791	SPOP_HUMAN	S	239;239;239;239;123;239;192;239	ENSP00000377001:N239S;ENSP00000377004:N239S;ENSP00000240327:N239S;ENSP00000425905:N239S;ENSP00000420908:N239S;ENSP00000426986:N239S	ENSP00000240327:N239S	N	-	2	0	SPOP	45039732	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.868000	0.87116	2.279000	0.76181	0.533000	0.62120	AAT	.		0.368	SPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365154.2	NM_003563	Missense_Mutation
SRP72	6731	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	57340266	57340277	+	In_Frame_Del	DEL	ATCTCGTCCGAA	ATCTCGTCCGAA	-	rs201653221|rs145817936		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	ATCTCGTCCGAA	ATCTCGTCCGAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:57340266_57340277delATCTCGTCCGAA	ENST00000342756.5	+	4	1122_1133	c.401_412delATCTCGTCCGAA	c.(400-414)gatctcgtccgaaac>gac	p.LVRN135del	SRP72_ENST00000510663.1_In_Frame_Del_p.LVRN135del|SRP72_ENST00000504757.1_In_Frame_Del_p.LVRN135del	NM_006947.3	NP_008878.3	O76094	SRP72_HUMAN	signal recognition particle 72kDa	135					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(7)|ovary(2)	22	Glioma(25;0.08)|all_neural(26;0.101)					GTGTATAGAGATCTCGTCCGAAACTCCCAAGA	0.377																																					p.134_138del		.											.	SRP72	116	0			c.401_412del						.																																			SO:0001651	inframe_deletion	6731	exon4			ATAGAGATCTCGT	AF069765	CCDS3506.1, CCDS58898.1	4q11	2013-01-10	2002-08-29		ENSG00000174780	ENSG00000174780		"""Tetratricopeptide (TTC) repeat domain containing"""	11303	protein-coding gene	gene with protein product		602122	"""signal recognition particle 72kD"""			9224693, 9857079	Standard	NM_006947		Approved		uc003hbv.3	O76094	OTTHUMG00000128843	ENST00000342756.5:c.401_412delATCTCGTCCGAA	4.37:g.57340266_57340277delATCTCGTCCGAA	ENSP00000342181:p.Leu135_Asn138del	126.0	0.0		126.0	20.0	NM_006947	G5E9Z8|Q7Z3C0	In_Frame_Del	DEL	ENST00000342756.5	37	CCDS3506.1																																																																																			.		0.377	SRP72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250782.7		
SSBP1	6742	hgsc.bcm.edu;bcgsc.ca	37	7	141441987	141441987	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:141441987A>G	ENST00000481508.1	+	3	478	c.43A>G	c.(43-45)Aga>Gga	p.R15G	SSBP1_ENST00000465582.1_Missense_Mutation_p.R15G|SSBP1_ENST00000469123.1_3'UTR|SSBP1_ENST00000484178.1_Missense_Mutation_p.R15G|SSBP1_ENST00000265304.6_Missense_Mutation_p.R15G|SSBP1_ENST00000498107.1_Missense_Mutation_p.R15G	NM_001256510.1	NP_001243439.1	Q04837	SSBP_HUMAN	single-stranded DNA binding protein 1, mitochondrial	15					DNA replication (GO:0006260)|mitochondrion morphogenesis (GO:0070584)|positive regulation of helicase activity (GO:0051096)	extracellular vesicular exosome (GO:0070062)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)			large_intestine(3)|lung(1)|ovary(1)|pancreas(1)|skin(1)	7	Melanoma(164;0.0171)					TCAGTTTGTAAGACATGAGTC	0.313																																					p.R15G		.											.	SSBP1	91	0			c.A43G						.						123.0	111.0	115.0					7																	141441987		2202	4300	6502	SO:0001583	missense	6742	exon3			TTTGTAAGACATG	M94556	CCDS5866.1	7q34	2012-05-25	2012-05-25		ENSG00000106028	ENSG00000106028			11317	protein-coding gene	gene with protein product		600439	"""single-stranded DNA-binding protein"", ""single-stranded DNA binding protein 1"""			7789991	Standard	NM_001256510		Approved	SSBP, mtSSB	uc031szi.1	Q04837	OTTHUMG00000157572	ENST00000481508.1:c.43A>G	7.37:g.141441987A>G	ENSP00000419665:p.Arg15Gly	41.0	0.0		61.0	4.0	NM_001256513		Missense_Mutation	SNP	ENST00000481508.1	37	CCDS5866.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.500008	0.85176	.	.	ENSG00000106028	ENST00000265304;ENST00000498107;ENST00000467681;ENST00000465582;ENST00000463093;ENST00000484178;ENST00000473783;ENST00000481508	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.77246	0.4102	M	0.64997	1.995	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.83275	0.994;0.996	T	0.78440	-0.2203	9	0.56958	D	0.05	-24.6187	16.188	0.81967	1.0:0.0:0.0:0.0	.	15;15	B7Z268;Q04837	.;SSBP_HUMAN	G	15	.	ENSP00000265304:R15G	R	+	1	2	SSBP1	141088456	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	3.683000	0.54663	2.216000	0.71823	0.528000	0.53228	AGA	.		0.313	SSBP1-006	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000349187.1	NM_003143	
SST	6750	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	187388043	187388043	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:187388043G>A	ENST00000287641.3	-	1	144	c.37C>T	c.(37-39)Ctg>Ttg	p.L13L		NM_001048.3	NP_001039.1	P61278	SMS_HUMAN	somatostatin	13					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hyperosmotic response (GO:0006972)|negative regulation of cell proliferation (GO:0008285)|regulation of cell migration (GO:0030334)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to heat (GO:0009408)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)	hormone activity (GO:0005179)			kidney(1)|large_intestine(1)|lung(6)|pancreas(1)	9	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.00444)	Cysteamine(DB00847)	ACGATGGACAGCGCAGCCAGC	0.677											OREG0004470	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=SST|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.L13L		.											.	SST	91	0			c.C37T						.						18.0	17.0	17.0					3																	187388043		2194	4294	6488	SO:0001819	synonymous_variant	6750	exon1			TGGACAGCGCAGC		CCDS3288.1	3q28	2013-02-28			ENSG00000157005	ENSG00000157005		"""Endogenous ligands"""	11329	protein-coding gene	gene with protein product	"""somatostatin-14"", ""somatostatin-28"", ""prepro-somatostatin"""	182450				6126875, 6142531	Standard	NM_001048		Approved	SMST	uc003frn.3	P61278	OTTHUMG00000156462	ENST00000287641.3:c.37C>T	3.37:g.187388043G>A		131.0	0.0	2014	108.0	50.0	NM_001048	B2R5G3|P01166	Silent	SNP	ENST00000287641.3	37	CCDS3288.1																																																																																			.		0.677	SST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344278.1	NM_001048	
SUSD2	56241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	24582054	24582054	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr22:24582054G>A	ENST00000358321.3	+	9	1671	c.1410G>A	c.(1408-1410)gaG>gaA	p.E470E		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	470	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						GGCGCGGAGAGTACGTGCTGC	0.662																																					p.E470E		.											.	SUSD2	91	0			c.G1410A						.						31.0	32.0	32.0					22																	24582054		2203	4300	6503	SO:0001819	synonymous_variant	56241	exon9			CGGAGAGTACGTG	AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.1410G>A	22.37:g.24582054G>A		136.0	0.0		220.0	52.0	NM_019601	Q9H5Y6	Silent	SNP	ENST00000358321.3	37	CCDS13824.1																																																																																			.		0.662	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320088.1	NM_019601	
SYNGAP1	8831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	33405455	33405455	+	Missense_Mutation	SNP	G	G	A	rs538281267		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:33405455G>A	ENST00000418600.2	+	8	874	c.773G>A	c.(772-774)cGc>cAc	p.R258H	SYNGAP1_ENST00000293748.5_Missense_Mutation_p.R258H|SYNGAP1_ENST00000428982.2_Missense_Mutation_p.R199H|SYNGAP1_ENST00000496374.1_3'UTR|MIR5004_ENST00000579078.1_RNA	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	258	C2.				dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						GACAACAGCCGCCGGGTAGAC	0.542													G|||	1	0.000199681	0.0	0.0014	5008	,	,		13786	0.0		0.0	False		,,,				2504	0.0				p.R258H		.											.	SYNGAP1	48	0			c.G773A						.						160.0	180.0	173.0					6																	33405455		2203	4300	6503	SO:0001583	missense	8831	exon8			ACAGCCGCCGGGT	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.773G>A	6.37:g.33405455G>A	ENSP00000403636:p.Arg258His	59.0	0.0		64.0	24.0	NM_006772	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	ENST00000418600.2	37	CCDS34434.2	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041630	0.75732	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	D;D;D	0.93488	-3.23;-3.23;-3.23	4.51	4.51	0.55191	SynGAP C2 domain, N-terminal (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000001	D	0.96097	0.8728	M	0.80028	2.48	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;P	0.83275	0.991;0.996;0.842	D	0.96595	0.9440	10	0.87932	D	0	.	14.7891	0.69827	0.0:0.0:1.0:0.0	.	258;258;258	Q96PV0;Q96PV0-4;B7ZCA0	SYGP1_HUMAN;.;.	H	258;258;258;199	ENSP00000293748:R258H;ENSP00000403636:R258H;ENSP00000412475:R199H	ENSP00000293748:R258H	R	+	2	0	SYNGAP1	33513433	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.860000	0.86993	2.341000	0.79615	0.655000	0.94253	CGC	.		0.542	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	
TAS2R7	50837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	10954420	10954420	+	Silent	SNP	G	G	A	rs201086265		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:10954420G>A	ENST00000240687.2	-	1	806	c.750C>T	c.(748-750)tcC>tcT	p.S250S		NM_023919.2	NP_076408.1	Q9NYW3	TA2R7_HUMAN	taste receptor, type 2, member 7	250					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			kidney(1)|large_intestine(1)|lung(3)|skin(2)|stomach(3)	10						CAATGAGAAAGGACAAATAGT	0.468													G|||	1	0.000199681	0.0	0.0	5008	,	,		19264	0.0		0.001	False		,,,				2504	0.0				p.S250S		.											.	TAS2R7	91	0			c.C750T						.	G		0,4406		0,0,2203	92.0	96.0	94.0		750	1.4	0.1	12		94	1,8599		0,1,4299	yes	coding-synonymous	TAS2R7	NM_023919.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		250/319	10954420	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	50837	exon1			GAGAAAGGACAAA	AF227133	CCDS8631.1	12p13	2012-08-22			ENSG00000121377	ENSG00000121377		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14913	protein-coding gene	gene with protein product		604793				10761934, 10766242	Standard	NM_023919		Approved	T2R7, TRB4	uc001qyv.3	Q9NYW3	OTTHUMG00000168505	ENST00000240687.2:c.750C>T	12.37:g.10954420G>A		112.0	0.0		177.0	69.0	NM_023919	Q645Y1	Silent	SNP	ENST00000240687.2	37	CCDS8631.1																																																																																			G|0.997;A|0.003		0.468	TAS2R7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399931.1		
TBK1	29110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	64889483	64889483	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr12:64889483G>C	ENST00000331710.5	+	15	1987	c.1648G>C	c.(1648-1650)Gaa>Caa	p.E550Q		NM_013254.3	NP_037386.1	Q9UHD2	TBK1_HUMAN	TANK-binding kinase 1	550					defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of gene expression (GO:0010629)|negative regulation of type I interferon production (GO:0032480)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to virus (GO:0009615)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon production (GO:0032606)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)	ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)	20				GBM - Glioblastoma multiforme(28;0.0386)		AAATAGTGTAGAAAAACTACA	0.289																																					p.E550Q		.											.	TBK1	1459	0			c.G1648C						.						42.0	43.0	43.0					12																	64889483		2202	4300	6502	SO:0001583	missense	29110	exon15			AGTGTAGAAAAAC	AF191838	CCDS8968.1	12q14.2	2006-06-10			ENSG00000183735	ENSG00000183735			11584	protein-coding gene	gene with protein product		604834				10581243, 10783893	Standard	NM_013254		Approved	NAK	uc001ssc.2	Q9UHD2	OTTHUMG00000168796	ENST00000331710.5:c.1648G>C	12.37:g.64889483G>C	ENSP00000329967:p.Glu550Gln	58.0	0.0		109.0	50.0	NM_013254	A8K4S4|Q8IYV3|Q9NUJ5	Missense_Mutation	SNP	ENST00000331710.5	37	CCDS8968.1	.	.	.	.	.	.	.	.	.	.	G	6.703	0.498447	0.12762	.	.	ENSG00000183735	ENST00000331710	T	0.08807	3.05	4.77	4.77	0.60923	.	0.178480	0.50627	D	0.000115	T	0.19685	0.0473	L	0.32530	0.975	0.58432	D	0.999998	D	0.63880	0.993	D	0.72982	0.979	T	0.02015	-1.1229	9	.	.	.	-15.0624	18.6721	0.91516	0.0:0.0:1.0:0.0	.	550	Q9UHD2	TBK1_HUMAN	Q	550	ENSP00000329967:E550Q	.	E	+	1	0	TBK1	63175750	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	8.249000	0.89833	2.582000	0.87167	0.655000	0.94253	GAA	.		0.289	TBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401130.1	NM_013254	
TCTEX1D1	200132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	67241997	67241997	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:67241997C>G	ENST00000282670.2	+	4	375	c.247C>G	c.(247-249)Cat>Gat	p.H83D		NM_152665.2	NP_689878.2	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1	83										large_intestine(2)|lung(10)|skin(1)	13						CACCGTCAATCATATTTTGAA	0.378																																					p.H83D		.											.	TCTEX1D1	90	0			c.C247G						.						104.0	102.0	103.0					1																	67241997		2203	4300	6503	SO:0001583	missense	200132	exon4			GTCAATCATATTT	AK098192	CCDS633.1	1p31.2	2008-02-05			ENSG00000152760	ENSG00000152760			26882	protein-coding gene	gene with protein product							Standard	NM_152665		Approved	FLJ40873	uc001dcv.3	Q8N7M0	OTTHUMG00000009162	ENST00000282670.2:c.247C>G	1.37:g.67241997C>G	ENSP00000282670:p.His83Asp	174.0	0.0		231.0	95.0	NM_152665	Q06YR9|Q5VYE1	Missense_Mutation	SNP	ENST00000282670.2	37	CCDS633.1	.	.	.	.	.	.	.	.	.	.	C	5.556	0.287404	0.10513	.	.	ENSG00000152760	ENST00000282670	T	0.27890	1.64	5.92	4.99	0.66335	.	0.452764	0.25971	N	0.027123	T	0.04497	0.0123	N	0.04787	-0.16	0.24258	N	0.99529	B	0.02656	0.0	B	0.04013	0.001	T	0.36504	-0.9745	10	0.13853	T	0.58	-18.0728	9.3461	0.38109	0.2651:0.5979:0.137:0.0	.	83	Q8N7M0	TC1D1_HUMAN	D	83	ENSP00000282670:H83D	ENSP00000282670:H83D	H	+	1	0	TCTEX1D1	67014585	0.714000	0.27936	0.988000	0.46212	0.894000	0.52154	2.053000	0.41326	1.452000	0.47756	0.655000	0.94253	CAT	.		0.378	TCTEX1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025399.2	NM_152665	
THEM4	117145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	151867506	151867506	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:151867506T>G	ENST00000368814.3	-	2	613	c.264A>C	c.(262-264)caA>caC	p.Q88H	THEM4_ENST00000489410.1_Missense_Mutation_p.Q88H	NM_053055.4	NP_444283.2	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	88					epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein kinase B signaling (GO:0043491)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	cell projection (GO:0042995)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(4)|lung(3)|urinary_tract(1)	9	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTTTGAAGTCTTGAATCCATT	0.373																																					p.Q88H		.											.	THEM4	522	0			c.A264C						.						119.0	119.0	119.0					1																	151867506		2203	4300	6503	SO:0001583	missense	117145	exon2			GAAGTCTTGAATC	AJ313515	CCDS1006.1	1q21.3	2008-02-05			ENSG00000159445	ENSG00000159445			17947	protein-coding gene	gene with protein product	"""C-terminal modulator protein"""	606388				11598301	Standard	NM_053055		Approved	CTMP	uc001ezj.2	Q5T1C6	OTTHUMG00000013049	ENST00000368814.3:c.264A>C	1.37:g.151867506T>G	ENSP00000357804:p.Gln88His	97.0	0.0		241.0	11.0	NM_053055	B2RBX2|Q96KR2	Missense_Mutation	SNP	ENST00000368814.3	37	CCDS1006.1	.	.	.	.	.	.	.	.	.	.	T	13.76	2.332748	0.41297	.	.	ENSG00000159445	ENST00000368814;ENST00000489410	T;T	0.36340	2.4;1.26	3.67	0.0402	0.14208	.	0.876505	0.10037	N	0.723986	T	0.13628	0.0330	L	0.59436	1.845	0.09310	N	1	P	0.41041	0.736	B	0.38712	0.28	T	0.15723	-1.0427	10	0.51188	T	0.08	0.114	3.3509	0.07151	0.0:0.2256:0.2073:0.5671	.	88	Q5T1C6	THEM4_HUMAN	H	88	ENSP00000357804:Q88H;ENSP00000433304:Q88H	ENSP00000357804:Q88H	Q	-	3	2	THEM4	150134130	0.002000	0.14202	0.000000	0.03702	0.015000	0.08874	0.470000	0.22084	-0.013000	0.14199	-0.280000	0.10049	CAA	.		0.373	THEM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036615.1	NM_053055	
TDRD5	163589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	179564922	179564922	+	Nonsense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr1:179564922C>G	ENST00000367614.1	+	4	1159	c.800C>G	c.(799-801)tCa>tGa	p.S267*	TDRD5_ENST00000444136.1_Nonsense_Mutation_p.S267*|TDRD5_ENST00000294848.8_Nonsense_Mutation_p.S267*	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	267					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						GTGGAGACTTCAAGACTGAAT	0.358																																					p.S267X		.											.	TDRD5	94	0			c.C800G						.						75.0	77.0	76.0					1																	179564922		2203	4300	6503	SO:0001587	stop_gained	163589	exon4			AGACTTCAAGACT	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.800C>G	1.37:g.179564922C>G	ENSP00000356586:p.Ser267*	102.0	0.0		259.0	42.0	NM_173533	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Nonsense_Mutation	SNP	ENST00000367614.1	37	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	C	40	8.082449	0.98646	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136	.	.	.	5.69	4.78	0.61160	.	0.232509	0.30126	N	0.010349	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-14.4089	10.5493	0.45079	0.0:0.9112:0.0:0.0888	.	.	.	.	X	267	.	ENSP00000294848:S267X	S	+	2	0	TDRD5	177831545	0.998000	0.40836	0.982000	0.44146	0.711000	0.40976	1.278000	0.33179	1.404000	0.46819	0.585000	0.79938	TCA	.		0.358	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
TMEM181	57583	hgsc.bcm.edu;bcgsc.ca	37	6	159005001	159005001	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr6:159005001A>G	ENST00000367090.3	+	4	606	c.595A>G	c.(595-597)Ata>Gta	p.I199V		NM_020823.1	NP_065874.1	Q9P2C4	TM181_HUMAN	transmembrane protein 181	199					pathogenesis (GO:0009405)	integral component of membrane (GO:0016021)	toxic substance binding (GO:0015643)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)	22		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		GCCAATTCAAATACTTTCAAA	0.348																																					p.I199V		.											.	TMEM181	70	0			c.A595G						.						118.0	104.0	109.0					6																	159005001		1861	4099	5960	SO:0001583	missense	57583	exon4			ATTCAAATACTTT	AB037844	CCDS43520.1	6q25.3	2012-08-10	2006-10-19	2006-10-19	ENSG00000146433	ENSG00000146433			20958	protein-coding gene	gene with protein product		613209	"""G protein-coupled receptor 178"", ""KIAA1423"""	KIAA1423, GPR178		16452613	Standard	NM_020823		Approved		uc003qrm.4	Q9P2C4	OTTHUMG00000015913	ENST00000367090.3:c.595A>G	6.37:g.159005001A>G	ENSP00000356057:p.Ile199Val	65.0	0.0		48.0	4.0	NM_020823	Q5VTU1	Missense_Mutation	SNP	ENST00000367090.3	37	CCDS43520.1	.	.	.	.	.	.	.	.	.	.	A	7.991	0.753328	0.15778	.	.	ENSG00000146433	ENST00000314630;ENST00000367090	.	.	.	5.62	0.334	0.15948	.	0.235735	0.43747	D	0.000534	T	0.05686	0.0149	N	0.14661	0.345	0.09310	N	1	B;B	0.17268	0.007;0.021	B;B	0.13407	0.009;0.006	T	0.37150	-0.9718	9	0.23891	T	0.37	.	5.1626	0.15070	0.3299:0.2924:0.0:0.3777	.	199;110	Q9P2C4;Q8N4V6	TM181_HUMAN;.	V	106;199	.	ENSP00000323755:I106V	I	+	1	0	TMEM181	158924989	0.159000	0.22864	0.617000	0.29091	0.995000	0.86356	0.689000	0.25437	0.363000	0.24346	0.528000	0.53228	ATA	.		0.348	TMEM181-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042873.1	NM_020823	
TMEM43	79188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	14180787	14180787	+	Silent	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:14180787C>T	ENST00000306077.4	+	11	1244	c.990C>T	c.(988-990)ctC>ctT	p.L330L	RP11-434D12.1_ENST00000608606.1_Silent_p.L76L|RP11-434D12.1_ENST00000601399.1_3'UTR	NM_024334.2	NP_077310.1	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	330					nuclear membrane organization (GO:0071763)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|cervix(3)|endometrium(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(2)	19						CACGGATCCTCTACACCTTGG	0.582																																					p.L330L		.											.	TMEM43	91	0			c.C990T						.						125.0	109.0	114.0					3																	14180787		2203	4300	6503	SO:0001819	synonymous_variant	79188	exon11			GATCCTCTACACC	BC008054	CCDS2618.1	3p25.1	2014-09-17			ENSG00000170876	ENSG00000170876			28472	protein-coding gene	gene with protein product		612048	"""arrhythmogenic right ventricular dysplasia 5"""	ARVD5		11230166, 18313022	Standard	NM_024334		Approved	MGC3222, DKFZp586G1919, LUMA	uc003byk.2	Q9BTV4	OTTHUMG00000129802	ENST00000306077.4:c.990C>T	3.37:g.14180787C>T		109.0	0.0		174.0	72.0	NM_024334	Q7L4N5|Q8NC30|Q96A63|Q96F19|Q96JX0|Q9H076	Silent	SNP	ENST00000306077.4	37	CCDS2618.1																																																																																			.		0.582	TMEM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252030.2	NM_024334	
TNRC6A	27327	hgsc.bcm.edu;bcgsc.ca	37	16	24801289	24801289	+	Silent	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:24801289A>G	ENST00000395799.3	+	6	1455	c.1326A>G	c.(1324-1326)caA>caG	p.Q442Q	TNRC6A_ENST00000315183.7_Silent_p.Q442Q	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	442	Interaction with argonaute family proteins.|Sufficient for interaction with AGO1, AGO3 and AGO4.|Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		TCAGTGGTCAACCTCAAAATA	0.423																																					p.Q442Q		.											.	TNRC6A	92	0			c.A1326G						.						64.0	61.0	62.0					16																	24801289		2197	4300	6497	SO:0001819	synonymous_variant	27327	exon6			TGGTCAACCTCAA	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.1326A>G	16.37:g.24801289A>G		72.0	0.0		83.0	4.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Silent	SNP	ENST00000395799.3	37	CCDS10624.2																																																																																			.		0.423	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
TNRC6B	23112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	40660706	40660706	+	Missense_Mutation	SNP	G	G	A	rs367663125		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr22:40660706G>A	ENST00000454349.2	+	5	683	c.472G>A	c.(472-474)Ggt>Agt	p.G158S	TNRC6B_ENST00000335727.9_Missense_Mutation_p.G158S|TNRC6B_ENST00000402203.1_Intron|TNRC6B_ENST00000301923.9_Intron	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	158	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						AACCCTTGGAGGTGCTGCTGC	0.493																																					p.G158S		.											.	TNRC6B	22	0			c.G472A						.						41.0	39.0	40.0					22																	40660706		1889	4121	6010	SO:0001583	missense	23112	exon5			CTTGGAGGTGCTG	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.472G>A	22.37:g.40660706G>A	ENSP00000401946:p.Gly158Ser	94.0	0.0		138.0	36.0	NM_001162501	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	ENST00000454349.2	37	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.758997	0.31137	.	.	ENSG00000100354	ENST00000454349;ENST00000400140;ENST00000335727	T;T	0.11495	2.78;2.77	5.44	5.44	0.79542	.	0.327663	0.32736	N	0.005701	T	0.08537	0.0212	N	0.14661	0.345	0.45837	D	0.998709	P;P	0.46784	0.884;0.705	B;B	0.41466	0.358;0.271	T	0.41251	-0.9519	10	0.22706	T	0.39	-4.8462	18.2777	0.90088	0.0:0.0:1.0:0.0	.	158;158	Q9UPQ9;Q9UPQ9-1	TNR6B_HUMAN;.	S	158	ENSP00000401946:G158S;ENSP00000338371:G158S	ENSP00000338371:G158S	G	+	1	0	TNRC6B	38990652	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.979000	0.63806	2.559000	0.86315	0.650000	0.86243	GGT	.		0.493	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
TONSL	4796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145659589	145659589	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:145659589G>A	ENST00000409379.3	-	21	3188	c.3159C>T	c.(3157-3159)gcC>gcT	p.A1053A	AC084125.4_ENST00000544423.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	1053					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						CCTGGTCCAGGGCCAGGGAGC	0.687																																					p.A1053A		.											.	TONSL	92	0			c.C3159T						.						17.0	19.0	18.0					8																	145659589		2197	4287	6484	SO:0001819	synonymous_variant	4796	exon21			GTCCAGGGCCAGG		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.3159C>T	8.37:g.145659589G>A		123.0	0.0		100.0	9.0	NM_013432	B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Silent	SNP	ENST00000409379.3	37	CCDS34968.2																																																																																			.		0.687	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432	
TXN	7295	hgsc.bcm.edu;bcgsc.ca	37	9	113018699	113018699	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:113018699T>C	ENST00000374517.5	-	1	221	c.17A>G	c.(16-18)gAg>gGg	p.E6G	TXN_ENST00000374515.5_Missense_Mutation_p.E6G	NM_003329.3	NP_003320.2	P10599	THIO_HUMAN	thioredoxin	6	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|glycerol ether metabolic process (GO:0006662)|innate immune response (GO:0045087)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|oxidation-reduction process (GO:0055114)|positive regulation of DNA binding (GO:0043388)|regulation of protein import into nucleus, translocation (GO:0033158)|response to radiation (GO:0009314)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	peptide disulfide oxidoreductase activity (GO:0015037)|poly(A) RNA binding (GO:0044822)|protein disulfide oxidoreductase activity (GO:0015035)			kidney(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(323;7.36e-07)		TACCTTGCTCTCGATCTGCTT	0.642																																					p.E6G		.											.	TXN	90	0			c.A17G						.						43.0	35.0	38.0					9																	113018699		2203	4298	6501	SO:0001583	missense	7295	exon1			TTGCTCTCGATCT	X77584	CCDS35103.1, CCDS59139.1	9q31	2008-02-05			ENSG00000136810	ENSG00000136810			12435	protein-coding gene	gene with protein product		187700					Standard	NM_003329		Approved	TRX	uc004bep.2	P10599	OTTHUMG00000020480	ENST00000374517.5:c.17A>G	9.37:g.113018699T>C	ENSP00000363641:p.Glu6Gly	52.0	0.0		65.0	6.0	NM_001244938	B1ALW1|O60744|Q53X69|Q96KI3|Q9UDG5	Missense_Mutation	SNP	ENST00000374517.5	37	CCDS35103.1	.	.	.	.	.	.	.	.	.	.	T	14.08	2.427853	0.43122	.	.	ENSG00000136810	ENST00000374517;ENST00000374515	T;T	0.03301	3.98;3.98	4.34	4.34	0.51931	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.176785	0.34268	N	0.004104	T	0.05044	0.0135	L	0.53617	1.68	0.35802	D	0.823206	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.15122	-1.0448	10	0.38643	T	0.18	-3.3249	10.467	0.44614	0.0:0.0:0.0:1.0	.	6;6	B1ALW1;P10599	.;THIO_HUMAN	G	6	ENSP00000363641:E6G;ENSP00000363639:E6G	ENSP00000363639:E6G	E	-	2	0	TXN	112058520	0.905000	0.30787	0.796000	0.32109	0.868000	0.49771	1.251000	0.32862	1.896000	0.54893	0.459000	0.35465	GAG	.		0.642	TXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053614.1		
TSC1	7248	hgsc.bcm.edu;bcgsc.ca	37	9	135798881	135798881	+	Splice_Site	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr9:135798881T>C	ENST00000298552.3	-	6	585		c.e6-2		TSC1_ENST00000475903.1_Splice_Site|TSC1_ENST00000440111.2_Splice_Site|TSC1_ENST00000403810.1_Splice_Site|TSC1_ENST00000545250.1_Splice_Site	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1						activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)			NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		AGTGTCCATCTGCAGGAGAAA	0.473			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												.		.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	TSC1	1906	0			c.211-2A>G						.						105.0	89.0	94.0					9																	135798881		2203	4300	6503	SO:0001630	splice_region_variant	7248	exon6	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	TCCATCTGCAGGA	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.364-2A>G	9.37:g.135798881T>C		119.0	0.0		127.0	7.0	NM_001162427	B7Z897|Q5VVN5	Splice_Site	SNP	ENST00000298552.3	37	CCDS6956.1	.	.	.	.	.	.	.	.	.	.	T	16.25	3.070589	0.55539	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250;ENST00000403810	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3559	0.66738	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TSC1	134788702	1.000000	0.71417	0.419000	0.26584	0.649000	0.38597	7.482000	0.81143	1.994000	0.58287	0.533000	0.62120	.	.		0.473	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		Intron
TYW1	55253	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	66660199	66660199	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr7:66660199A>T	ENST00000359626.5	+	15	2016	c.1852A>T	c.(1852-1854)Atg>Ttg	p.M618L		NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	618					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				CAGTCTTACCATGGCCCACGT	0.483																																					p.M618L		.											.	TYW1	91	0			c.A1852T						.						173.0	154.0	161.0					7																	66660199		2203	4300	6503	SO:0001583	missense	55253	exon15			CTTACCATGGCCC	AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.1852A>T	7.37:g.66660199A>T	ENSP00000352645:p.Met618Leu	179.0	1.0		227.0	77.0	NM_018264	Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Missense_Mutation	SNP	ENST00000359626.5	37	CCDS5538.1	.	.	.	.	.	.	.	.	.	.	A	19.09	3.760683	0.69763	.	.	ENSG00000198874	ENST00000359626	T	0.49139	0.79	3.7	3.7	0.42460	tRNA wybutosine-synthesis (1);	0.000000	0.85682	U	0.000000	T	0.50188	0.1601	M	0.75264	2.295	0.58432	D	0.999993	B	0.20459	0.045	B	0.30943	0.122	T	0.55016	-0.8206	10	0.62326	D	0.03	.	10.612	0.45427	1.0:0.0:0.0:0.0	.	618	Q9NV66	TYW1_HUMAN	L	618	ENSP00000352645:M618L	ENSP00000352645:M618L	M	+	1	0	TYW1	66297634	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.915000	0.87484	1.433000	0.47394	0.421000	0.28195	ATG	.		0.483	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251932.2	NM_018264	
UBLCP1	134510	hgsc.bcm.edu;bcgsc.ca	37	5	158705274	158705274	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:158705274A>G	ENST00000296786.6	+	9	1039	c.713A>G	c.(712-714)aAg>aGg	p.K238R		NM_145049.3	NP_659486.2	Q8WVY7	UBCP1_HUMAN	ubiquitin-like domain containing CTD phosphatase 1	238	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.|Phosphatase.					nucleolus (GO:0005730)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)			endometrium(1)|kidney(3)|large_intestine(4)|ovary(1)	9	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATATGGGGAAAGTTTTCGGAG	0.328																																					p.K238R		.											.	UBLCP1	91	0			c.A713G						.						97.0	97.0	97.0					5																	158705274		2203	4300	6503	SO:0001583	missense	134510	exon9			GGGGAAAGTTTTC	AK057996	CCDS4345.1	5q33.3	2010-06-21			ENSG00000164332	ENSG00000164332	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	28110	protein-coding gene	gene with protein product	"""CTD phosphatase-like with ubiquitin domain 1"""	609867				15883030	Standard	NM_145049		Approved	MGC10067, CPUB1	uc003lxq.2	Q8WVY7	OTTHUMG00000130305	ENST00000296786.6:c.713A>G	5.37:g.158705274A>G	ENSP00000296786:p.Lys238Arg	46.0	0.0		74.0	4.0	NM_145049	D3DQJ7|Q96DK5	Missense_Mutation	SNP	ENST00000296786.6	37	CCDS4345.1	.	.	.	.	.	.	.	.	.	.	A	18.87	3.715111	0.68844	.	.	ENSG00000164332	ENST00000296786	.	.	.	5.44	4.27	0.50696	HAD-superfamily hydrolase, subfamily IIID (1);NLI interacting factor (3);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.77150	0.4088	M	0.82716	2.605	0.51767	D	0.999936	D	0.89917	1.0	D	0.74023	0.982	T	0.75833	-0.3178	9	0.33141	T	0.24	-10.282	10.2956	0.43623	0.9245:0.0:0.0755:0.0	.	238	Q8WVY7	UBCP1_HUMAN	R	238	.	ENSP00000296786:K238R	K	+	2	0	UBLCP1	158637852	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.905000	0.92613	0.987000	0.38709	-0.290000	0.09829	AAG	.		0.328	UBLCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252650.2	NM_145049	
ULK2	9706	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	19700945	19700945	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr17:19700945T>C	ENST00000395544.4	-	18	2072	c.1573A>G	c.(1573-1575)Aga>Gga	p.R525G	ULK2_ENST00000580130.1_5'UTR|ULK2_ENST00000361658.2_Missense_Mutation_p.R525G	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	525					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					CTCTGCAGTCTAGCACCCGAT	0.517																																					p.R525G		.											.	ULK2	334	0			c.A1573G						.						53.0	46.0	48.0					17																	19700945		2203	4300	6503	SO:0001583	missense	9706	exon18			GCAGTCTAGCACC	AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.1573A>G	17.37:g.19700945T>C	ENSP00000378914:p.Arg525Gly	42.0	0.0		33.0	4.0	NM_001142610	A8MY69|O75119	Missense_Mutation	SNP	ENST00000395544.4	37	CCDS11213.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.198751	0.79015	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.36340	1.26;1.26	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.56046	0.1959	M	0.77820	2.39	0.44424	D	0.997341	D	0.65815	0.995	P	0.55455	0.776	T	0.61544	-0.7041	10	0.72032	D	0.01	-21.2887	15.642	0.77012	0.0:0.0:0.0:1.0	.	525	Q8IYT8	ULK2_HUMAN	G	525	ENSP00000354877:R525G;ENSP00000378914:R525G	ENSP00000354877:R525G	R	-	1	2	ULK2	19641537	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.643000	0.46604	2.288000	0.76882	0.533000	0.62120	AGA	.		0.517	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683	
UVSSA	57654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	1377635	1377635	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr4:1377635G>A	ENST00000389851.4	+	13	2390	c.1943G>A	c.(1942-1944)gGc>gAc	p.G648D	UVSSA_ENST00000511563.1_Missense_Mutation_p.G199D|UVSSA_ENST00000507531.1_Missense_Mutation_p.G648D|UVSSA_ENST00000512728.1_Missense_Mutation_p.G199D|UVSSA_ENST00000511216.1_Missense_Mutation_p.G648D	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	648					protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)	p.G648V(1)									AGCGGGAAAGGCAGGGGGAAG	0.572																																					p.G648D		.											.	.	.	1	Substitution - Missense(1)	endometrium(1)	c.G1943A						.						113.0	98.0	103.0					4																	1377635		2203	4300	6503	SO:0001583	missense	57654	exon13			GGAAAGGCAGGGG	BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.1943G>A	4.37:g.1377635G>A	ENSP00000374501:p.Gly648Asp	64.0	0.0		48.0	24.0	NM_020894	A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Missense_Mutation	SNP	ENST00000389851.4	37	CCDS33938.1	.	.	.	.	.	.	.	.	.	.	G	10.14	1.268830	0.23136	.	.	ENSG00000163945	ENST00000511216;ENST00000389851;ENST00000507531;ENST00000511563;ENST00000512728	T;T;T;T;T	0.48201	1.38;1.38;1.38;0.82;0.82	5.04	4.2	0.49525	.	0.259729	0.43110	D	0.000620	T	0.44286	0.1286	L	0.52905	1.665	0.48975	D	0.999737	B	0.24768	0.111	B	0.22386	0.039	T	0.40251	-0.9573	10	0.48119	T	0.1	.	14.0277	0.64594	0.0743:0.0:0.9257:0.0	.	648	Q2YD98	K1530_HUMAN	D	648;648;648;199;199	ENSP00000425130:G648D;ENSP00000374501:G648D;ENSP00000421741:G648D;ENSP00000423340:G199D;ENSP00000427701:G199D	ENSP00000374501:G648D	G	+	2	0	KIAA1530	1367635	1.000000	0.71417	0.351000	0.25721	0.057000	0.15508	4.383000	0.59600	1.255000	0.44051	-0.272000	0.10252	GGC	.		0.572	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359480.1	NM_020894	
VCAN	1462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	82835029	82835029	+	Silent	SNP	G	G	A	rs563628544		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:82835029G>A	ENST00000265077.3	+	8	6772	c.6207G>A	c.(6205-6207)acG>acA	p.T2069T	VCAN_ENST00000502527.2_Intron|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000343200.5_Silent_p.T1082T|VCAN-AS1_ENST00000512090.1_RNA|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000513016.1_3'UTR	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2069	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TGGAAGGTACGAAAGCTCCAG	0.443																																					p.T2069T		.											.	VCAN	238	0			c.G6207A						.						68.0	65.0	66.0					5																	82835029		2203	4300	6503	SO:0001819	synonymous_variant	1462	exon8			AGGTACGAAAGCT	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.6207G>A	5.37:g.82835029G>A		66.0	0.0		91.0	36.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	CCDS4060.1																																																																																			.		0.443	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
VPS37A	137492	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	17132309	17132309	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:17132309C>A	ENST00000324849.4	+	5	1158	c.484C>A	c.(484-486)Cct>Act	p.P162T	VPS37A_ENST00000324815.3_Missense_Mutation_p.S171Y|VPS37A_ENST00000521829.1_Missense_Mutation_p.P137T	NM_001145152.1|NM_152415.2	NP_001138624.1|NP_689628.2	Q8NEZ2	VP37A_HUMAN	vacuolar protein sorting 37 homolog A (S. cerevisiae)	162					cell death (GO:0008219)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|kidney(2)|large_intestine(1)|lung(4)|skin(1)	10				Colorectal(111;0.0553)|COAD - Colon adenocarcinoma(73;0.212)		TCCTCCATATCCTCCACAAGA	0.418																																					p.P162T		.											.	VPS37A	90	0			c.C484A						.						105.0	89.0	95.0					8																	17132309		2203	4300	6503	SO:0001583	missense	137492	exon5			CCATATCCTCCAC		CCDS6001.1, CCDS47811.1	8p22	2012-06-29	2006-04-04		ENSG00000155975	ENSG00000155975			24928	protein-coding gene	gene with protein product	"""hepatocellular carcinoma related protein 1"""	609927	"""vacuolar protein sorting 37A (yeast)"", ""polyglutamine binding protein 2"""	PQBP2		15240819, 15218037, 22717650	Standard	NM_152415		Approved	FLJ32642, HCRP1, SPG53	uc003wxj.3	Q8NEZ2	OTTHUMG00000130785	ENST00000324849.4:c.484C>A	8.37:g.17132309C>A	ENSP00000318629:p.Pro162Thr	174.0	0.0		117.0	64.0	NM_152415	Q336D5|Q6NW27|Q8N3D7|Q8TBL7|Q96DL9	Missense_Mutation	SNP	ENST00000324849.4	37	CCDS6001.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.66|11.66	1.705839|1.705839	0.30232|0.30232	.|.	.|.	ENSG00000155975|ENSG00000155975	ENST00000324849;ENST00000521829|ENST00000324815	T;T|.	0.57595|.	0.39;0.45|.	4.25|4.25	3.38|3.38	0.38709|0.38709	.|.	0.436137|.	0.25823|.	N|.	0.028073|.	T|T	0.51295|0.51295	0.1666|0.1666	L|L	0.47716|0.47716	1.5|1.5	0.23473|0.23473	N|N	0.997602|0.997602	B;B|.	0.33583|.	0.418;0.047|.	B;B|.	0.30855|.	0.121;0.014|.	T|T	0.48410|0.48410	-0.9038|-0.9038	10|6	0.62326|0.72032	D|D	0.03|0.01	-13.1633|-13.1633	13.3433|13.3433	0.60557|0.60557	0.0:0.9219:0.0:0.0781|0.0:0.9219:0.0:0.0781	.|.	137;162|.	Q8NEZ2-2;Q8NEZ2|.	.;VP37A_HUMAN|.	T|Y	162;137|171	ENSP00000318629:P162T;ENSP00000429680:P137T|.	ENSP00000318629:P162T|ENSP00000318173:S171Y	P|S	+|+	1|2	0|0	VPS37A|VPS37A	17176680|17176680	0.785000|0.785000	0.28726|0.28726	0.708000|0.708000	0.30435|0.30435	0.272000|0.272000	0.26649|0.26649	2.024000|2.024000	0.41049|0.41049	1.398000|1.398000	0.46701|0.46701	-0.232000|-0.232000	0.12228|0.12228	CCT|TCC	.		0.418	VPS37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253301.2	NM_152415	
YY1	7528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	100742844	100742844	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:100742844C>G	ENST00000262238.4	+	4	1181	c.921C>G	c.(919-921)ttC>ttG	p.F307L		NM_003403.3	NP_003394.1	P25490	TYY1_HUMAN	YY1 transcription factor	307	Binding to DNA.|Involved in nuclear matrix association.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|cell differentiation (GO:0030154)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromosome organization (GO:0051276)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to prostaglandin F (GO:0034696)|response to UV-C (GO:0010225)|RNA localization (GO:0006403)|spermatogenesis (GO:0007283)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|four-way junction DNA binding (GO:0000400)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)|prostate(4)|skin(1)	11		Melanoma(154;0.152)				CAAAGATGTTCAGGGATAACT	0.428																																					p.F307L		.											.	YY1	226	0			c.C921G						.						76.0	73.0	74.0					14																	100742844		2203	4300	6503	SO:0001583	missense	7528	exon4			GATGTTCAGGGAT	BC020324	CCDS9957.1	14q	2013-01-08			ENSG00000100811	ENSG00000100811		"""INO80 complex subunits"", ""Zinc fingers, C2H2-type"""	12856	protein-coding gene	gene with protein product	"""INO80 complex subunit S"", ""Yin and Yang 1 protein"""	600013				1655281, 7912122	Standard	NM_003403		Approved	NF-E1, DELTA, UCRBP, YIN-YANG-1, INO80S	uc001ygy.2	P25490	OTTHUMG00000150479	ENST00000262238.4:c.921C>G	14.37:g.100742844C>G	ENSP00000262238:p.Phe307Leu	85.0	0.0		105.0	27.0	NM_003403	Q14935	Missense_Mutation	SNP	ENST00000262238.4	37	CCDS9957.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.566514	0.86439	.	.	ENSG00000100811	ENST00000262238;ENST00000553625	T	0.18502	2.21	5.63	5.63	0.86233	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	U	0.000000	T	0.40423	0.1116	L	0.55743	1.74	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.02844	-1.1103	10	0.52906	T	0.07	.	20.0344	0.97551	0.0:1.0:0.0:0.0	.	307	P25490	TYY1_HUMAN	L	307;117	ENSP00000262238:F307L	ENSP00000262238:F307L	F	+	3	2	YY1	99812597	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.943000	0.70211	2.803000	0.96430	0.650000	0.86243	TTC	.		0.428	YY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318277.1	NM_003403	
ZCCHC10	54819	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	132334321	132334321	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr5:132334321T>C	ENST00000509437.1	-	5	540	c.533A>G	c.(532-534)gAt>gGt	p.D178G	ZCCHC10_ENST00000324170.3_Missense_Mutation_p.D156G|ZCCHC10_ENST00000513541.1_3'UTR|ZCCHC10_ENST00000508080.1_5'UTR|ZCCHC10_ENST00000509008.1_3'UTR|ZCCHC10_ENST00000513848.1_Missense_Mutation_p.D142G|ZCCHC10_ENST00000355372.2_Missense_Mutation_p.D172G			Q8TBK6	ZCH10_HUMAN	zinc finger, CCHC domain containing 10	178	Ser-rich.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGAGCTGCTATCTGTGCTGGT	0.453																																					p.D156G		.											.	ZCCHC10	90	0			c.A467G						.						74.0	77.0	76.0					5																	132334321		2203	4300	6503	SO:0001583	missense	54819	exon4			CTGCTATCTGTGC	BC005211	CCDS4165.1, CCDS75300.1, CCDS75301.1, CCDS75302.1	5q31.1	2008-05-02			ENSG00000155329	ENSG00000155329		"""Zinc fingers, CCHC domain containing"""	25954	protein-coding gene	gene with protein product						12477932	Standard	XM_005272024		Approved	FLJ20094	uc003kyg.3	Q8TBK6	OTTHUMG00000129013	ENST00000509437.1:c.533A>G	5.37:g.132334321T>C	ENSP00000423276:p.Asp178Gly	82.0	0.0		100.0	36.0	NM_017665	Q9NXR4	Missense_Mutation	SNP	ENST00000509437.1	37		.	.	.	.	.	.	.	.	.	.	T	12.00	1.806386	0.31961	.	.	ENSG00000155329	ENST00000324170;ENST00000355372;ENST00000509437;ENST00000513848	.	.	.	4.82	2.4	0.29515	.	0.427167	0.24242	N	0.040252	T	0.46678	0.1405	.	.	.	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.38993	-0.9635	8	0.72032	D	0.01	.	8.8543	0.35219	0.0:0.1573:0.0:0.8427	.	142;178;156	G3XAM1;Q8TBK6;Q8TBK6-2	.;ZCH10_HUMAN;.	G	156;172;178;142	.	ENSP00000324274:D156G	D	-	2	0	ZCCHC10	132362220	0.350000	0.24878	0.029000	0.17559	0.718000	0.41266	1.131000	0.31406	0.298000	0.22638	0.460000	0.39030	GAT	.		0.453	ZCCHC10-004	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000370163.1	NM_017665	
ZFAT	57623	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	135545117	135545124	+	Frame_Shift_Del	DEL	CACGTTGG	CACGTTGG	-	rs554415466|rs374006917		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	CACGTTGG	CACGTTGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:135545117_135545124delCACGTTGG	ENST00000377838.3	-	12	3242_3249	c.3068_3075delCCAACGTG	c.(3067-3075)gccaacgtgfs	p.ANV1023fs	ZFAT_ENST00000523399.1_Frame_Shift_Del_p.ANV961fs|ZFAT_ENST00000520214.1_Frame_Shift_Del_p.ANV1011fs|ZFAT_ENST00000520727.1_Frame_Shift_Del_p.ANV1011fs|ZFAT_ENST00000429442.2_Frame_Shift_Del_p.ANV1011fs|ZFAT_ENST00000517307.1_5'UTR|ZFAT_ENST00000520356.1_Frame_Shift_Del_p.ANV1011fs	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	1023					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CCCCGGTGCCCACGTTGGCATACTCCTC	0.615																																					p.1023_1025del		.											.	ZFAT	90	0			c.3068_3075del						.																																			SO:0001589	frameshift_variant	57623	exon12			GGTGCCCACGTTG	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.3068_3075delCCAACGTG	8.37:g.135545117_135545124delCACGTTGG	ENSP00000367069:p.Ala1023fs	66.0	0.0		64.0	10.0	NM_020863	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Frame_Shift_Del	DEL	ENST00000377838.3	37	CCDS47924.1																																																																																			.		0.615	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939	
ZFHX4	79776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	77616371	77616371	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:77616371G>A	ENST00000521891.2	+	2	496	c.48G>A	c.(46-48)caG>caA	p.Q16Q	ZFHX4_ENST00000518282.1_Silent_p.Q16Q|ZFHX4_ENST00000455469.2_Silent_p.Q16Q|ZFHX4_ENST00000050961.6_Silent_p.Q16Q|ZFHX4_ENST00000517683.1_Intron	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	16					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAAATGGGCAGAGCACATCAA	0.498										HNSCC(33;0.089)																											p.Q16Q		.											.	ZFHX4	98	0			c.G48A						.						54.0	53.0	53.0					8																	77616371		1985	4193	6178	SO:0001819	synonymous_variant	79776	exon2			TGGGCAGAGCACA		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.48G>A	8.37:g.77616371G>A		126.0	0.0		144.0	63.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2																																																																																			.		0.498	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ZFHX4	79776	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	77768488	77768488	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:77768488G>A	ENST00000521891.2	+	10	9779	c.9331G>A	c.(9331-9333)Gga>Aga	p.G3111R	ZFHX4_ENST00000518282.1_Missense_Mutation_p.G3085R|ZFHX4_ENST00000455469.2_Missense_Mutation_p.G3066R|ZFHX4_ENST00000050961.6_Missense_Mutation_p.G3066R	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3066	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CCTTCTCCCCGGAATGAACGG	0.522										HNSCC(33;0.089)																											p.G3111R		.											.	ZFHX4	98	0			c.G9331A						.						42.0	43.0	42.0					8																	77768488		1939	4142	6081	SO:0001583	missense	79776	exon10			CTCCCCGGAATGA		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9331G>A	8.37:g.77768488G>A	ENSP00000430497:p.Gly3111Arg	66.0	0.0		69.0	5.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	18.00	3.525555	0.64860	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.60040	0.26;0.25;0.25;0.22	5.45	5.45	0.79879	.	0.000000	0.43579	U	0.000559	T	0.77491	0.4138	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	T	0.78912	-0.2017	10	0.87932	D	0	.	19.4735	0.94973	0.0:0.0:1.0:0.0	.	3066;3066;3111	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	R	3111;3095;3066;3066;3085	ENSP00000430497:G3111R;ENSP00000399605:G3066R;ENSP00000050961:G3066R;ENSP00000430848:G3085R	ENSP00000050961:G3066R	G	+	1	0	ZFHX4	77931043	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.657000	0.98554	2.836000	0.97738	0.655000	0.94253	GGA	.		0.522	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ZFYVE26	23503	hgsc.bcm.edu;bcgsc.ca	37	14	68220472	68220472	+	Silent	SNP	T	T	C			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr14:68220472T>C	ENST00000347230.4	-	39	7278	c.7140A>G	c.(7138-7140)ggA>ggG	p.G2380G	ZFYVE26_ENST00000557306.1_Silent_p.G226G|RN7SL213P_ENST00000463482.2_RNA	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2380					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CATTTTTCCCTCCCAGCATGA	0.393																																					p.G2380G		.											.	ZFYVE26	162	0			c.A7140G						.						73.0	63.0	66.0					14																	68220472		2203	4300	6503	SO:0001819	synonymous_variant	23503	exon39			TTTCCCTCCCAGC	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.7140A>G	14.37:g.68220472T>C		61.0	0.0		77.0	4.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Silent	SNP	ENST00000347230.4	37	CCDS9788.1																																																																																			.		0.393	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
ZHX2	22882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	123964092	123964092	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr8:123964092A>T	ENST00000314393.4	+	3	1177	c.342A>T	c.(340-342)gaA>gaT	p.E114D		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	114					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			TGTGTGCAGAATGTAACTTCA	0.488																																					p.E114D	Esophageal Squamous(94;1056 1388 11767 13799 49639)	.											.	ZHX2	227	0			c.A342T						.						104.0	94.0	97.0					8																	123964092		2203	4300	6503	SO:0001583	missense	22882	exon3			TGCAGAATGTAAC	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.342A>T	8.37:g.123964092A>T	ENSP00000314709:p.Glu114Asp	43.0	0.0		75.0	21.0	NM_014943		Missense_Mutation	SNP	ENST00000314393.4	37	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	A	17.07	3.295241	0.60086	.	.	ENSG00000178764	ENST00000314393	T	0.53640	0.61	5.56	-0.804	0.10882	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.058448	0.64402	D	0.000003	T	0.52837	0.1759	L	0.46157	1.445	0.34967	D	0.752741	D	0.69078	0.997	D	0.64410	0.925	T	0.59936	-0.7360	10	0.49607	T	0.09	-19.01	9.7281	0.40344	0.6344:0.0:0.3656:0.0	.	114	Q9Y6X8	ZHX2_HUMAN	D	114	ENSP00000314709:E114D	ENSP00000314709:E114D	E	+	3	2	ZHX2	124033273	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	1.042000	0.30303	-0.124000	0.11724	0.374000	0.22700	GAA	.		0.488	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
ZIC1	7545	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	147128512	147128526	+	In_Frame_Del	DEL	GCCGCGCATCACGGC	GCCGCGCATCACGGC	-	rs370404401		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	GCCGCGCATCACGGC	GCCGCGCATCACGGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr3:147128512_147128526delGCCGCGCATCACGGC	ENST00000282928.4	+	1	1342_1356	c.613_627delGCCGCGCATCACGGC	c.(613-627)gccgcgcatcacggcdel	p.AAHHG205del		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	205					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G209C(1)|p.H208N(1)		central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						CGTGAACATGGCCGCGCATCACGGCGCCGGCGCCT	0.647																																					p.205_209del		.											.	ZIC1	91	2	Substitution - Missense(2)	lung(1)|prostate(1)	c.613_627del						.																																			SO:0001651	inframe_deletion	7545	exon1			AACATGGCCGCGC	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.613_627delGCCGCGCATCACGGC	3.37:g.147128512_147128526delGCCGCGCATCACGGC	ENSP00000282928:p.Ala205_Gly209del	119.0	0.0		51.0	15.0	NM_003412	Q2M3N1	In_Frame_Del	DEL	ENST00000282928.4	37	CCDS3136.1																																																																																			.		0.647	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412	
ZMYM2	7750	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	20567643	20567643	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr13:20567643C>T	ENST00000382874.2	+	4	621	c.431C>T	c.(430-432)cCt>cTt	p.P144L	ZMYM2_ENST00000382869.3_Missense_Mutation_p.P144L|ZMYM2_ENST00000382881.3_Missense_Mutation_p.P144L|ZMYM2_ENST00000382871.2_Missense_Mutation_p.P144L	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		CGAAGACCTCCTGAGACTAAA	0.383																																					p.P144L		.											.	ZMYM2	685	0			c.C431T						.						101.0	106.0	105.0					13																	20567643		2108	4249	6357	SO:0001583	missense	7750	exon4			GACCTCCTGAGAC	AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.431C>T	13.37:g.20567643C>T	ENSP00000372327:p.Pro144Leu	91.0	0.0		113.0	43.0	NM_001190964	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	ENST00000382874.2	37	CCDS45016.1	.	.	.	.	.	.	.	.	.	.	C	12.54	1.968388	0.34754	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382881;ENST00000382874;ENST00000382871	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.39	4.45	0.53987	.	0.742403	0.12412	N	0.471194	T	0.29126	0.0724	L	0.52573	1.65	0.80722	D	1	B;B;B	0.20261	0.002;0.002;0.043	B;B;B	0.18871	0.008;0.008;0.023	T	0.03296	-1.1051	10	0.34782	T	0.22	-0.1595	10.415	0.44316	0.0:0.8386:0.0:0.1614	.	144;144;144	A8K126;Q9UBW7;Q9UBW7-2	.;ZMYM2_HUMAN;.	L	144	ENSP00000372322:P144L;ENSP00000372334:P144L;ENSP00000372327:P144L;ENSP00000372324:P144L	ENSP00000372322:P144L	P	+	2	0	ZMYM2	19465643	0.338000	0.24775	0.837000	0.33122	0.982000	0.71751	1.128000	0.31369	1.232000	0.43678	0.650000	0.86243	CCT	.		0.383	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2	NM_003453	
ZNF208	7757	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	22157531	22157531	+	Missense_Mutation	SNP	C	C	G	rs267605388		TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:22157531C>G	ENST00000397126.4	-	4	453	c.305G>C	c.(304-306)aGg>aCg	p.R102T	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Splice_Site_p.R102T	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	102					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTTTTCATACCTTCTCAATAT	0.328																																					p.R102T		.											.	ZNF208	7	0			c.G305C						.						57.0	56.0	57.0					19																	22157531		2038	4230	6268	SO:0001583	missense	7757	exon4			TCATACCTTCTCA	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.305G>C	19.37:g.22157531C>G	ENSP00000380315:p.Arg102Thr	80.0	1.0		100.0	37.0	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.643234	0.00792	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.07908	3.15	1.54	-3.08	0.05347	.	.	.	.	.	T	0.04907	0.0132	.	.	.	0.09310	N	1	B;B	0.26975	0.073;0.165	B;B	0.28465	0.031;0.09	T	0.40040	-0.9584	8	0.29301	T	0.29	.	3.6596	0.08233	0.0:0.2643:0.396:0.3397	.	102;102	O43345;F8WEA0	ZN208_HUMAN;.	T	102	ENSP00000380315:R102T	ENSP00000380315:R102T	R	-	2	0	ZNF208	21949371	0.000000	0.05858	0.000000	0.03702	0.214000	0.24535	0.141000	0.16076	-1.448000	0.01941	0.297000	0.19635	AGG	.		0.328	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
ZNF629	23361	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30793663	30793663	+	Silent	SNP	G	G	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:30793663G>A	ENST00000262525.4	-	3	2193	c.1986C>T	c.(1984-1986)taC>taT	p.Y662Y	RP11-2C24.6_ENST00000575562.1_RNA	NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	662					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			GGGAGCAGATGTAGGTCTTGG	0.627																																					p.Y662Y		.											.	.	.	0			c.C1986T						.						16.0	17.0	17.0					16																	30793663		2033	4188	6221	SO:0001819	synonymous_variant	23361	exon3			GCAGATGTAGGTC	AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.1986C>T	16.37:g.30793663G>A		58.0	0.0		56.0	18.0	NM_001080417	Q15938	Silent	SNP	ENST00000262525.4	37	CCDS45463.1																																																																																			.		0.627	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434291.1	NM_015309	
ZNF319	57567	hgsc.bcm.edu;bcgsc.ca	37	16	58031121	58031121	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr16:58031121A>G	ENST00000299237.2	-	2	1671	c.1049T>C	c.(1048-1050)aTg>aCg	p.M350T	USB1_ENST00000561743.1_5'Flank	NM_020807.1	NP_065858.1	Q9P2F9	ZN319_HUMAN	zinc finger protein 319	350					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8						CTTGAAGCCCATGGGGCACAG	0.652																																					p.M350T		.											.	ZNF319	90	0			c.T1049C						.						65.0	58.0	60.0					16																	58031121		2198	4300	6498	SO:0001583	missense	57567	exon2			AAGCCCATGGGGC	AB037809	CCDS32462.1	16q21	2013-01-08				ENSG00000166188		"""Zinc fingers, C2H2-type"""	13644	protein-coding gene	gene with protein product						10718198, 11161788	Standard	XM_005256069		Approved	KIAA1388, Zfp319	uc002emx.1	Q9P2F9		ENST00000299237.2:c.1049T>C	16.37:g.58031121A>G	ENSP00000299237:p.Met350Thr	88.0	0.0		75.0	5.0	NM_020807	Q52LH8	Missense_Mutation	SNP	ENST00000299237.2	37	CCDS32462.1	.	.	.	.	.	.	.	.	.	.	A	8.695	0.908443	0.17833	.	.	ENSG00000166188	ENST00000299237	T	0.17370	2.28	4.97	3.86	0.44501	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	U	0.000000	T	0.20861	0.0502	N	0.14661	0.345	0.52501	D	0.999958	D	0.65815	0.995	D	0.63381	0.914	T	0.03212	-1.1060	10	0.87932	D	0	-22.5478	10.2792	0.43530	0.852:0.0:0.0:0.148	.	350	Q9P2F9	ZN319_HUMAN	T	350	ENSP00000299237:M350T	ENSP00000299237:M350T	M	-	2	0	ZNF319	56588622	1.000000	0.71417	1.000000	0.80357	0.013000	0.08279	6.098000	0.71458	0.725000	0.32318	-0.333000	0.08304	ATG	.		0.652	ZNF319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430317.1		
ZNF681	148213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	23938330	23938330	+	Silent	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:23938330C>A	ENST00000402377.3	-	2	168	c.27G>T	c.(25-27)gtG>gtT	p.V9V	ZNF681_ENST00000395385.3_Intron	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	9	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				ATTCTATGGCCACATCCCTAA	0.418																																					p.V9V		.											.	.	.	0			c.G27T						.						64.0	70.0	68.0					19																	23938330		2203	4300	6503	SO:0001819	synonymous_variant	148213	exon2			TATGGCCACATCC	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.27G>T	19.37:g.23938330C>A		36.0	0.0		36.0	10.0	NM_138286	B3KVF7	Silent	SNP	ENST00000402377.3	37	CCDS12414.2																																																																																			.		0.418	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
ZSWIM4	65249	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	13910558	13910558	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:13910558C>T	ENST00000254323.2	+	2	367	c.178C>T	c.(178-180)Cct>Tct	p.P60S	CTD-3252C9.2_ENST00000591242.1_RNA	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	60							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			CTCCCGGGTGCCTGAGCCCGT	0.592																																					p.P60S		.											.	ZSWIM4	90	0			c.C178T						.						118.0	108.0	111.0					19																	13910558		2203	4300	6503	SO:0001583	missense	65249	exon2			CGGGTGCCTGAGC	AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.178C>T	19.37:g.13910558C>T	ENSP00000254323:p.Pro60Ser	129.0	2.0		151.0	55.0	NM_023072		Missense_Mutation	SNP	ENST00000254323.2	37	CCDS32924.1	.	.	.	.	.	.	.	.	.	.	N	26.8	4.771624	0.90108	.	.	ENSG00000132003	ENST00000254323	T	0.30448	1.53	4.37	4.37	0.52481	.	0.000000	0.56097	D	0.000040	T	0.62245	0.2412	M	0.90019	3.08	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.72178	-0.4369	10	0.87932	D	0	-17.2125	14.4888	0.67637	0.0:1.0:0.0:0.0	.	60	Q9H7M6	ZSWM4_HUMAN	S	60	ENSP00000254323:P60S	ENSP00000254323:P60S	P	+	1	0	ZSWIM4	13771558	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	6.725000	0.74752	1.991000	0.58162	0.549000	0.68633	CCT	.		0.592	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457457.1	XM_031342	
ZNF835	90485	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	57175640	57175640	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A2QR-01A-11D-A20W-10	TCGA-FV-A2QR-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	34b26fff-981d-4f15-b59f-68a9208af0f5	39ada55b-dcea-4e2e-81da-374a3020c56e	g.chr19:57175640C>A	ENST00000537055.2	-	2	1158	c.927G>T	c.(925-927)caG>caT	p.Q309H		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	309					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						CGCCGCAGTCCTGGCACGTGT	0.711																																					p.Q309H		.											.	ZNF835	72	0			c.G927T						.						17.0	17.0	17.0					19																	57175640		2196	4298	6494	SO:0001583	missense	90485	exon2			GCAGTCCTGGCAC	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.927G>T	19.37:g.57175640C>A	ENSP00000444747:p.Gln309His	16.0	0.0		21.0	12.0	NM_001005850	B7Z5Y0|G3V1S0	Missense_Mutation	SNP	ENST00000537055.2	37	CCDS56105.1	.	.	.	.	.	.	.	.	.	.	C	10.02	1.236947	0.22711	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.07800	3.16	2.12	-3.63	0.04529	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04724	0.0128	N	0.21097	0.63	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.39820	-0.9595	9	0.54805	T	0.06	.	3.6697	0.08269	0.1257:0.5286:0.1992:0.1465	.	331	Q9Y2P0	ZN835_HUMAN	H	331;309	ENSP00000444747:Q309H	ENSP00000341756:Q331H	Q	-	3	2	ZNF835	61867452	0.000000	0.05858	0.001000	0.08648	0.271000	0.26615	-5.498000	0.00118	-0.746000	0.04766	-0.258000	0.10820	CAG	.		0.711	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850	
