#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADSSL1	122622	ucsc.edu;bcgsc.ca	37	14	105196358	105196358	+	Silent	SNP	T	T	C			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr14:105196358T>C	ENST00000332972.5	+	1	288	c.129T>C	c.(127-129)agT>agC	p.S43S	ADSSL1_ENST00000330877.2_Intron	NM_199165.1	NP_954634.1			adenylosuccinate synthase like 1											central_nervous_system(1)|cervix(1)|kidney(1)|lung(5)|ovary(2)|prostate(1)	11		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)		CTCCAAGGAGTCTCCAGTTAC	0.667																																					p.S43S		.											.	ADSSL1	515	0			c.T129C						.						37.0	33.0	34.0					14																	105196358		2185	4291	6476	SO:0001819	synonymous_variant	122622	exon1			AAGGAGTCTCCAG	AK095921	CCDS9990.1, CCDS9991.1	14q32.33	2010-08-05			ENSG00000185100	ENSG00000185100			20093	protein-coding gene	gene with protein product		612498					Standard	NM_199165		Approved	FLJ38602	uc001ype.3	Q8N142		ENST00000332972.5:c.129T>C	14.37:g.105196358T>C		48.0	1.0		48.0	5.0	NM_199165		Silent	SNP	ENST00000332972.5	37	CCDS9991.1																																																																																			.		0.667	ADSSL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410531.1		
AKR1C2	1646	broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	5043738	5043738	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr10:5043738C>T	ENST00000380753.4	-	2	407	c.220G>A	c.(220-222)Gtg>Atg	p.V74M	AKR1C2_ENST00000455190.1_Missense_Mutation_p.V74M|AKR1C2_ENST00000421196.3_Missense_Mutation_p.V74M|AKR1C2_ENST00000407674.1_Missense_Mutation_p.V74M	NM_205845.2	NP_995317.1	P52895	AK1C2_HUMAN	aldo-keto reductase family 1, member C2	74					cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway (GO:0007186)|oxidation-reduction process (GO:0055114)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone metabolic process (GO:0042448)|prostaglandin metabolic process (GO:0006693)|response to prostaglandin (GO:0034694)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|prostaglandin F receptor activity (GO:0004958)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(1)|large_intestine(5)|lung(3)|skin(1)	10					Ursodeoxycholic acid(DB01586)	TCTCTCTTCACACTGCCATCT	0.443																																					p.V74M		.											.	AKR1C2	514	0			c.G220A						.						138.0	117.0	124.0					10																	5043738		2203	4297	6500	SO:0001583	missense	1646	exon4			TCTTCACACTGCC	L32592	CCDS7062.1, CCDS44350.1	10p15-p14	2014-01-29	2012-12-04		ENSG00000151632	ENSG00000151632	1.3.1.20, 1.1.1.213	"""Aldo-keto reductases"""	385	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III"""	600450	"""aldo-keto reductase family 1, member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III)"", ""testicular 17,20-desmolase deficiency"""	DDH2, TDD		9716498, 21802064	Standard	NM_001354		Approved	DD, BABP, DD2, HAKRD, MCDR2	uc001iht.3	P52895	OTTHUMG00000017584	ENST00000380753.4:c.220G>A	10.37:g.5043738C>T	ENSP00000370129:p.Val74Met	214.0	1.0		241.0	15.0	NM_001354	A8K2N9|B4DKR9|Q14133|Q5SR16|Q7M4N1|Q96A71	Missense_Mutation	SNP	ENST00000380753.4	37	CCDS7062.1	.	.	.	.	.	.	.	.	.	.	C	13.77	2.336912	0.41398	.	.	ENSG00000151632	ENST00000380753;ENST00000421196;ENST00000407674;ENST00000455190	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	2.35	2.35	0.29111	NADP-dependent oxidoreductase domain (3);	0.000000	0.48767	D	0.000166	T	0.70640	0.3247	M	0.82517	2.595	0.36173	D	0.848884	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.77557	0.99;0.983;0.983	T	0.79538	-0.1762	10	0.87932	D	0	.	10.778	0.46361	0.0:1.0:0.0:0.0	.	74;74;74	B4DKR9;B4DK69;P52895	.;.;AK1C2_HUMAN	M	74	ENSP00000370129:V74M;ENSP00000392694:V74M;ENSP00000385221:V74M;ENSP00000408440:V74M	ENSP00000370129:V74M	V	-	1	0	AKR1C2	5033738	0.976000	0.34144	0.998000	0.56505	0.227000	0.25037	2.420000	0.44679	1.601000	0.50113	0.205000	0.17691	GTG	.		0.443	AKR1C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046531.1	NM_001354	
ANO4	121601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	101333093	101333093	+	Splice_Site	SNP	T	T	A			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr12:101333093T>A	ENST00000392977.3	+	4	371	c.161T>A	c.(160-162)aTg>aAg	p.M54K	ANO4_ENST00000392979.3_Splice_Site_p.V19E|ANO4_ENST00000299222.9_5'UTR|ANO4_ENST00000538618.1_Splice_Site_p.M220K			Q32M45	ANO4_HUMAN	anoctamin 4	54					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						TTGGTTCTAGTGGCCAAGGAT	0.378										HNSCC(74;0.22)																											p.V19E		.											.	ANO4	96	0			c.T56A						.						111.0	110.0	110.0					12																	101333093		2203	4300	6503	SO:0001630	splice_region_variant	121601	exon3			TTCTAGTGGCCAA	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.161-1T>A	12.37:g.101333093T>A		165.0	0.0		171.0	37.0	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.88|14.88	2.667839|2.667839	0.47677|0.47677	.|.	.|.	ENSG00000151572|ENSG00000151572	ENST00000538618;ENST00000392977|ENST00000392979	T;T|T	0.39592|0.35973	1.07;1.07|1.28	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	.|0.563867	.|0.17673	.|N	.|0.165919	T|T	0.14442|0.14442	0.0349|0.0349	N|N	0.02011|0.02011	-0.69|-0.69	0.80722|0.80722	D|D	1|1	B|B	0.12630|0.02656	0.006|0.0	B|B	0.15052|0.04013	0.012|0.001	T|T	0.17167|0.17167	-1.0378|-1.0378	8|9	.|.	.|.	.|.	.|.	10.8653|10.8653	0.46851|0.46851	0.1405:0.0:0.0:0.8595|0.1405:0.0:0.0:0.8595	.|.	54|19	Q32M45|Q32M45-2	ANO4_HUMAN|.	K|E	220;54|19	ENSP00000443751:M220K;ENSP00000376703:M54K|ENSP00000376705:V19E	.|.	M|V	+|+	2|2	0|0	ANO4|ANO4	99857224|99857224	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.940000|0.940000	0.58332|0.58332	2.980000|2.980000	0.49321|0.49321	2.115000|2.115000	0.64714|0.64714	0.528000|0.528000	0.53228|0.53228	ATG|GTG	.		0.378	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	Missense_Mutation
BCL2	596	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	18	60795937	60795937	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr18:60795937C>T	ENST00000398117.1	-	2	2102	c.641G>A	c.(640-642)tGg>tAg	p.W214*	BCL2_ENST00000590515.1_5'UTR|BCL2_ENST00000333681.4_Nonsense_Mutation_p.W214*	NM_000633.2	NP_000624.2	P10415	BCL2_HUMAN	B-cell CLL/lymphoma 2	214					actin filament organization (GO:0007015)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|axonogenesis (GO:0007409)|B cell homeostasis (GO:0001782)|B cell lineage commitment (GO:0002326)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|behavioral fear response (GO:0001662)|branching involved in ureteric bud morphogenesis (GO:0001658)|CD8-positive, alpha-beta T cell lineage commitment (GO:0043375)|cell aging (GO:0007569)|cell growth (GO:0016049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to organic substance (GO:0071310)|cochlear nucleus development (GO:0021747)|defense response to virus (GO:0051607)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|ear development (GO:0043583)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|female pregnancy (GO:0007565)|focal adhesion assembly (GO:0048041)|gland morphogenesis (GO:0022612)|glomerulus development (GO:0032835)|hair follicle morphogenesis (GO:0031069)|homeostasis of number of cells within a tissue (GO:0048873)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|melanin metabolic process (GO:0006582)|melanocyte differentiation (GO:0030318)|mesenchymal cell development (GO:0014031)|metanephros development (GO:0001656)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of autophagy (GO:0010507)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cellular pH reduction (GO:0032848)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of retinal cell programmed cell death (GO:0046671)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|oocyte development (GO:0048599)|organ growth (GO:0035265)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pigment granule organization (GO:0048753)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell growth (GO:0030307)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron maturation (GO:0014042)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smooth muscle cell migration (GO:0014911)|post-embryonic development (GO:0009791)|protein dephosphorylation (GO:0006470)|protein polyubiquitination (GO:0000209)|reactive oxygen species metabolic process (GO:0072593)|regulation of calcium ion transport (GO:0051924)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glycoprotein biosynthetic process (GO:0010559)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of nitrogen utilization (GO:0006808)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|regulation of protein stability (GO:0031647)|regulation of transmembrane transporter activity (GO:0022898)|regulation of viral genome replication (GO:0045069)|release of cytochrome c from mitochondria (GO:0001836)|renal system process (GO:0003014)|response to acid chemical (GO:0001101)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to iron ion (GO:0010039)|response to ischemia (GO:0002931)|response to nicotine (GO:0035094)|response to radiation (GO:0009314)|response to toxic substance (GO:0009636)|response to UV-B (GO:0010224)|single organismal cell-cell adhesion (GO:0016337)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|pore complex (GO:0046930)	BH3 domain binding (GO:0051434)|channel activity (GO:0015267)|channel inhibitor activity (GO:0016248)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(106)|kidney(1)|large_intestine(1)|lung(3)	113		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Ibuprofen(DB01050)|Paclitaxel(DB01229)|Rasagiline(DB01367)	CAGAGACAGCCAGGAGAAATC	0.542			T	IGH@	"""NHL, CLL"""																																p.W214X		.		Dom	yes		18	18q21.3	596	B-cell CLL/lymphoma 2		L	.	BCL2	1271	0			c.G641A						.						51.0	48.0	49.0					18																	60795937		2203	4300	6503	SO:0001587	stop_gained	596	exon3			GACAGCCAGGAGA	M14745	CCDS11981.1, CCDS45882.1	18q21.3	2014-03-07			ENSG00000171791	ENSG00000171791		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	990	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 50"""	151430					Standard	XM_006722523		Approved	Bcl-2, PPP1R50	uc002lit.1	P10415	OTTHUMG00000132791	ENST00000398117.1:c.641G>A	18.37:g.60795937C>T	ENSP00000381185:p.Trp214*	76.0	0.0		96.0	36.0	NM_000633	C9JHD5|P10416|Q13842|Q16197	Nonsense_Mutation	SNP	ENST00000398117.1	37	CCDS11981.1	.	.	.	.	.	.	.	.	.	.	C	40	8.139537	0.98672	.	.	ENSG00000171791	ENST00000398117;ENST00000333681	.	.	.	5.15	5.15	0.70609	.	0.071604	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-5.6122	17.999	0.89193	0.0:1.0:0.0:0.0	.	.	.	.	X	214	.	ENSP00000329623:W214X	W	-	2	0	BCL2	58946917	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.050000	0.64251	2.550000	0.86006	0.655000	0.94253	TGG	.		0.542	BCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256199.1	NM_000633, NM_000657	
C16orf90	646174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3543984	3543984	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr16:3543984G>A	ENST00000437192.3	-	3	406	c.404C>T	c.(403-405)tCc>tTc	p.S135F	LA16c-306E5.3_ENST00000574423.2_RNA	NM_001080524.1	NP_001073993.1	A8MZG2	CP090_HUMAN	chromosome 16 open reading frame 90	125										large_intestine(1)	1						GCTGGAACTGGAAGCTGAGGA	0.612																																					p.S135F		.											.	.	.	0			c.C404T						.						21.0	21.0	21.0					16																	3543984		1906	4120	6026	SO:0001583	missense	646174	exon3			GAACTGGAAGCTG		CCDS45397.1	16p13.3	2009-01-29			ENSG00000215131	ENSG00000215131			34455	protein-coding gene	gene with protein product							Standard	NM_001080524		Approved	LOC646174	uc002cvi.3	A8MZG2	OTTHUMG00000154627	ENST00000437192.3:c.404C>T	16.37:g.3543984G>A	ENSP00000401335:p.Ser135Phe	22.0	0.0		21.0	8.0	NM_001080524		Missense_Mutation	SNP	ENST00000437192.3	37	CCDS45397.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.989072	0.74589	.	.	ENSG00000215131	ENST00000437192	.	.	.	5.55	5.55	0.83447	.	1.166210	0.06877	U	0.801728	T	0.79435	0.4445	M	0.67953	2.075	0.36210	D	0.85129	D	0.71674	0.998	D	0.70935	0.971	T	0.71484	-0.4579	8	.	.	.	-16.9115	15.0163	0.71588	0.0:0.0:1.0:0.0	.	135	A8MZG2-2	.	F	135	.	.	S	-	2	0	C16orf90	3483985	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.091000	0.50199	2.621000	0.88768	0.655000	0.94253	TCC	.		0.612	C16orf90-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346319.2	NM_001080524	
BRD7	29117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	50357553	50357553	+	Nonsense_Mutation	SNP	A	A	T			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr16:50357553A>T	ENST00000394688.3	-	12	1547	c.1388T>A	c.(1387-1389)tTa>tAa	p.L463*	BRD7_ENST00000394689.2_Nonsense_Mutation_p.L463*			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	463					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				AACATCCAGTAAACTATCTGC	0.418																																					p.L463X		.											.	BRD7	90	0			c.T1388A						.						130.0	109.0	116.0					16																	50357553		2198	4300	6498	SO:0001587	stop_gained	29117	exon12			TCCAGTAAACTAT	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.1388T>A	16.37:g.50357553A>T	ENSP00000378180:p.Leu463*	107.0	0.0		103.0	55.0	NM_013263	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Nonsense_Mutation	SNP	ENST00000394688.3	37	CCDS10742.1	.	.	.	.	.	.	.	.	.	.	A	38	6.977248	0.97975	.	.	ENSG00000166164	ENST00000394688;ENST00000394689	.	.	.	5.63	5.63	0.86233	.	0.244591	0.35646	N	0.003080	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.7803	15.8266	0.78711	1.0:0.0:0.0:0.0	.	.	.	.	X	463	.	ENSP00000378180:L463X	L	-	2	0	BRD7	48915054	1.000000	0.71417	0.951000	0.38953	0.718000	0.41266	8.678000	0.91211	2.141000	0.66446	0.533000	0.62120	TTA	.		0.418	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256874.3	NM_013263	
CEP290	80184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	88478474	88478474	+	Silent	SNP	A	A	C			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr12:88478474A>C	ENST00000552810.1	-	35	4936	c.4593T>G	c.(4591-4593)tcT>tcG	p.S1531S	CEP290_ENST00000397838.3_Silent_p.S591S|CEP290_ENST00000547691.2_Silent_p.S591S|CEP290_ENST00000309041.7_Silent_p.S1533S	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1531					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						ATGTGTGGTGAGATTTTGGTT	0.383																																					p.S1531S		.											.	CEP290	96	0			c.T4593G						.						214.0	202.0	206.0					12																	88478474		1876	4112	5988	SO:0001819	synonymous_variant	80184	exon35			GTGGTGAGATTTT	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.4593T>G	12.37:g.88478474A>C		151.0	0.0		178.0	62.0	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Silent	SNP	ENST00000552810.1	37	CCDS55858.1																																																																																			.		0.383	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
COL6A6	131873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	130354582	130354582	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr3:130354582C>A	ENST00000358511.6	+	27	5099	c.5068C>A	c.(5068-5070)Ctg>Atg	p.L1690M	COL6A6_ENST00000453409.2_Missense_Mutation_p.L1690M	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1690	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						AGAGACTGGGCTGAAGGGAGC	0.373																																					p.L1690M		.											.	COL6A6	76	0			c.C5068A						.						88.0	91.0	90.0					3																	130354582		1880	4093	5973	SO:0001583	missense	131873	exon27			ACTGGGCTGAAGG	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.5068C>A	3.37:g.130354582C>A	ENSP00000351310:p.Leu1690Met	53.0	0.0		58.0	25.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.300853	0.40694	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.83755	-1.76;-1.76	5.41	5.41	0.78517	.	.	.	.	.	T	0.71970	0.3403	N	0.21617	0.685	0.22500	N	0.999049	B	0.33379	0.41	B	0.25405	0.06	T	0.63373	-0.6652	9	0.34782	T	0.22	.	14.6899	0.69076	0.0:1.0:0.0:0.0	.	1690	A6NMZ7	CO6A6_HUMAN	M	1690	ENSP00000351310:L1690M;ENSP00000399236:L1690M	ENSP00000351310:L1690M	L	+	1	2	COL6A6	131837272	0.948000	0.32251	0.992000	0.48379	0.582000	0.36321	1.631000	0.37092	2.531000	0.85337	0.655000	0.94253	CTG	.		0.373	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
CRIM1	51232	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	36739445	36739445	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr2:36739445G>A	ENST00000280527.2	+	10	2055	c.1688G>A	c.(1687-1689)cGc>cAc	p.R563H	RP11-78I14.1_ENST00000609765.1_RNA	NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	563	Antistasin-like 3. {ECO:0000255|PROSITE- ProRule:PRU00582}.				insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				GACATCTGTCGCTGTAAGAAA	0.463																																					p.R563H		.											.	CRIM1	118	0			c.G1688A						.						145.0	142.0	143.0					2																	36739445		2203	4300	6503	SO:0001583	missense	51232	exon10			TCTGTCGCTGTAA	AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.1688G>A	2.37:g.36739445G>A	ENSP00000280527:p.Arg563His	129.0	0.0		144.0	7.0	NM_016441	Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Missense_Mutation	SNP	ENST00000280527.2	37	CCDS1783.1	.	.	.	.	.	.	.	.	.	.	G	34	5.345885	0.95807	.	.	ENSG00000150938	ENST00000280527	T	0.04917	3.53	5.61	5.61	0.85477	Proteinase inhibitor I14/I15, hirudin/antistatin (1);Proteinase inhibitor I15, antistasin (1);Proteinase inhibitor I15, antistasin-like (2);	0.000000	0.85682	D	0.000000	T	0.27900	0.0687	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00164	-1.1968	10	0.42905	T	0.14	-37.1378	18.9896	0.92786	0.0:0.0:1.0:0.0	.	563	Q9NZV1	CRIM1_HUMAN	H	563	ENSP00000280527:R563H	ENSP00000280527:R563H	R	+	2	0	CRIM1	36592949	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.813000	0.99286	2.793000	0.96121	0.655000	0.94253	CGC	.		0.463	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216878.2	NM_016441	
DNAH1	25981	broad.mit.edu;bcgsc.ca	37	3	52383278	52383278	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr3:52383278A>G	ENST00000420323.2	+	14	2629	c.2368A>G	c.(2368-2370)Aag>Gag	p.K790E		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	790	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCTGCGGGAGAAGGAGATCCT	0.602																																					p.K790E		.											.	DNAH1	67	0			c.A2368G						.						60.0	66.0	64.0					3																	52383278		2094	4225	6319	SO:0001583	missense	25981	exon14			CGGGAGAAGGAGA	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.2368A>G	3.37:g.52383278A>G	ENSP00000401514:p.Lys790Glu	95.0	0.0		97.0	5.0	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	A	15.69	2.908644	0.52439	.	.	ENSG00000114841	ENST00000420323	T	0.23147	1.92	5.54	5.54	0.83059	.	0.000000	0.52532	D	0.000061	T	0.41213	0.1149	M	0.84846	2.72	0.43824	D	0.996391	B;B	0.33212	0.402;0.198	B;B	0.40901	0.074;0.343	T	0.31420	-0.9944	10	0.23302	T	0.38	.	15.6982	0.77517	1.0:0.0:0.0:0.0	.	790;790	C9JXH6;Q9P2D7-3	.;.	E	790	ENSP00000401514:K790E	ENSP00000401514:K790E	K	+	1	0	DNAH1	52358318	1.000000	0.71417	0.995000	0.50966	0.444000	0.32077	6.511000	0.73733	2.115000	0.64714	0.533000	0.62120	AAG	.		0.602	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
EXOC3	11336	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	462403	462403	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr5:462403A>G	ENST00000512944.1	+	9	1823	c.1634A>G	c.(1633-1635)gAg>gGg	p.E545G	EXOC3_ENST00000315013.5_Missense_Mutation_p.E545G	NM_007277.4	NP_009208.2	O60645	EXOC3_HUMAN	exocyst complex component 3	556					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|secretory granule membrane (GO:0030667)				breast(2)|cervix(1)|endometrium(4)|large_intestine(1)|lung(13)|ovary(1)|urinary_tract(1)	23		Ovarian(839;0.0563)	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			TTGCTGGAGGAGGTCTTCCTG	0.597																																					p.E545G		.											.	EXOC3	90	0			c.A1634G						.						137.0	146.0	143.0					5																	462403		2026	4171	6197	SO:0001583	missense	11336	exon9			TGGAGGAGGTCTT	BC034427	CCDS54830.1	5p15.33	2013-01-22	2005-11-01	2005-11-01	ENSG00000180104	ENSG00000180104			30378	protein-coding gene	gene with protein product		608186	"""SEC6-like 1 (S. cerevisiae)"""	SEC6L1		8619474	Standard	XM_005248238		Approved	Sec6p	uc003jba.3	O60645	OTTHUMG00000162205	ENST00000512944.1:c.1634A>G	5.37:g.462403A>G	ENSP00000425587:p.Glu545Gly	90.0	0.0		89.0	11.0	NM_007277	Q6P2E8|Q8TEN6|Q8WUW0|Q96DI4	Missense_Mutation	SNP	ENST00000512944.1	37	CCDS54830.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.461379	0.84317	.	.	ENSG00000180104	ENST00000512944;ENST00000315013;ENST00000340158	T;T	0.06768	3.26;3.26	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.28400	0.0702	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.05273	-1.0895	10	0.23302	T	0.38	-37.3477	13.2669	0.60139	1.0:0.0:0.0:0.0	.	556	O60645	EXOC3_HUMAN	G	545;545;440	ENSP00000425587:E545G;ENSP00000323377:E545G	ENSP00000323377:E545G	E	+	2	0	EXOC3	515403	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	8.272000	0.89885	2.026000	0.59711	0.460000	0.39030	GAG	.		0.597	EXOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367882.1	NM_007277	
EYS	346007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	65612308	65612308	+	Silent	SNP	G	G	A			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr6:65612308G>A	ENST00000370621.3	-	17	3253	c.2727C>T	c.(2725-2727)gtC>gtT	p.V909V	EYS_ENST00000370616.2_Silent_p.V909V|EYS_ENST00000503581.1_Silent_p.V909V			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	909	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TGAAATTGTTGACCATATCTT	0.333																																					p.V909V		.											.	EYS	660	0			c.C2727T						.						149.0	123.0	131.0					6																	65612308		692	1591	2283	SO:0001819	synonymous_variant	346007	exon17			ATTGTTGACCATA		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2727C>T	6.37:g.65612308G>A		103.0	0.0		109.0	43.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	ENST00000370621.3	37																																																																																				.		0.333	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
FBXL6	26233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145580146	145580146	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr8:145580146G>C	ENST00000331890.5	-	7	1103	c.1039C>G	c.(1039-1041)Cga>Gga	p.R347G	SLC52A2_ENST00000532887.1_5'Flank|SLC52A2_ENST00000526752.1_5'Flank|SLC52A2_ENST00000329994.2_5'Flank|SLC52A2_ENST00000540505.1_5'Flank|SLC52A2_ENST00000527078.1_5'Flank|TMEM249_ENST00000398633.3_5'Flank|SLC52A2_ENST00000402965.1_5'Flank|FBXL6_ENST00000526524.1_5'UTR|FBXL6_ENST00000455319.2_Missense_Mutation_p.R341G|SLC52A2_ENST00000530047.1_5'Flank|TMEM249_ENST00000531225.1_5'Flank	NM_012162.2	NP_036294.2	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6	347					protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)		ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|lung(3)|ovary(1)	5	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			GCCACCCCTCGTCCCGGAGGC	0.647																																					p.R347G		.											.	FBXL6	658	0			c.C1039G						.						33.0	39.0	37.0					8																	145580146		2202	4300	6502	SO:0001583	missense	26233	exon7			CCCCTCGTCCCGG	AF174592	CCDS6422.1, CCDS47942.1	8q24.3	2011-06-09			ENSG00000182325	ENSG00000182325		"""F-boxes / Leucine-rich repeats"""	13603	protein-coding gene	gene with protein product		609076				10531035, 10531037	Standard	NM_012162		Approved	FBL6	uc003zcb.3	Q8N531	OTTHUMG00000165169	ENST00000331890.5:c.1039C>G	8.37:g.145580146G>C	ENSP00000330098:p.Arg347Gly	70.0	0.0		75.0	25.0	NM_012162	Q53G43|Q9H5W9|Q9UKC7	Missense_Mutation	SNP	ENST00000331890.5	37	CCDS6422.1	.	.	.	.	.	.	.	.	.	.	G	2.895	-0.228891	0.06022	.	.	ENSG00000182325	ENST00000455319;ENST00000331890	T;T	0.16324	5.47;2.35	4.92	2.02	0.26589	.	0.247112	0.33610	N	0.004728	T	0.14098	0.0341	L	0.50333	1.59	0.09310	N	1	B;B	0.32396	0.253;0.369	B;B	0.32211	0.033;0.142	T	0.16364	-1.0405	10	0.59425	D	0.04	-7.1819	5.6088	0.17394	0.0943:0.0:0.5587:0.347	.	347;341	Q8N531;Q8N531-2	FBXL6_HUMAN;.	G	341;347	ENSP00000403873:R341G;ENSP00000330098:R347G	ENSP00000330098:R347G	R	-	1	2	FBXL6	145550954	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	0.305000	0.19254	0.092000	0.17331	0.563000	0.77884	CGA	.		0.647	FBXL6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382413.1	NM_024555	
FMR1	2332	broad.mit.edu;bcgsc.ca	37	X	147018119	147018119	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chrX:147018119T>C	ENST00000370475.4	+	10	1105	c.977T>C	c.(976-978)gTt>gCt	p.V326A	FMR1_ENST00000439526.2_Missense_Mutation_p.V324A|FMR1_ENST00000370470.1_Missense_Mutation_p.V326A|FMR1_ENST00000370477.1_Missense_Mutation_p.V326A|FMR1_ENST00000218200.8_Missense_Mutation_p.V326A|FMR1_ENST00000440235.2_5'UTR|FMR1_ENST00000370471.3_Missense_Mutation_p.V326A	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	326					central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					GAGAAAAATGTTCCACAAGAA	0.358									Fragile X syndrome																												p.V326A		.											.	FMR1	133	0			c.T977C						.						144.0	131.0	135.0					X																	147018119		2203	4300	6503	SO:0001583	missense	2332	exon10	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	AAAATGTTCCACA	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.977T>C	X.37:g.147018119T>C	ENSP00000359506:p.Val326Ala	109.0	0.0		142.0	6.0	NM_002024	A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Missense_Mutation	SNP	ENST00000370475.4	37	CCDS14682.1	.	.	.	.	.	.	.	.	.	.	T	9.843	1.191526	0.21954	.	.	ENSG00000102081	ENST00000218200;ENST00000370471;ENST00000370477;ENST00000370475;ENST00000439526;ENST00000370470	T;T;T;T;T;T	0.62232	1.25;0.04;1.26;0.04;1.27;0.04	5.53	5.53	0.82687	K Homology (1);K Homology, type 1 (1);	0.152324	0.64402	D	0.000016	T	0.36908	0.0984	N	0.03608	-0.345	0.80722	D	1	B;B;B;B	0.26902	0.009;0.008;0.163;0.038	B;B;B;B	0.26310	0.035;0.021;0.068;0.031	T	0.34576	-0.9823	10	0.10111	T	0.7	-18.9551	13.9761	0.64275	0.0:0.0:0.0:1.0	.	326;242;326;324	Q06787;Q59GC1;Q06787-8;G3V0J0	FMR1_HUMAN;.;.;.	A	326;326;326;326;324;326	ENSP00000218200:V326A;ENSP00000359502:V326A;ENSP00000359508:V326A;ENSP00000359506:V326A;ENSP00000395923:V324A;ENSP00000359501:V326A	ENSP00000218200:V326A	V	+	2	0	FMR1	146825811	1.000000	0.71417	0.998000	0.56505	0.902000	0.53008	2.073000	0.41519	1.966000	0.57179	0.430000	0.28490	GTT	.		0.358	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058655.1	NM_002024	
GAB1	2549	broad.mit.edu;bcgsc.ca	37	4	144359739	144359739	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr4:144359739A>G	ENST00000262994.4	+	4	1483	c.1181A>G	c.(1180-1182)aAc>aGc	p.N394S	GAB1_ENST00000505913.1_Missense_Mutation_p.N291S|GAB1_ENST00000262995.4_Missense_Mutation_p.N394S	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1	394					activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					GTGGATTTAAACAAATTGCGA	0.393																																					p.N394S		.											.	GAB1	1146	0			c.A1181G						.						97.0	91.0	93.0					4																	144359739		2203	4300	6503	SO:0001583	missense	2549	exon4			ATTTAAACAAATT	U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.1181A>G	4.37:g.144359739A>G	ENSP00000262994:p.Asn394Ser	71.0	0.0		83.0	4.0	NM_207123	A8K152|Q4W5G2|Q6P1W2	Missense_Mutation	SNP	ENST00000262994.4	37	CCDS3759.1	.	.	.	.	.	.	.	.	.	.	A	2.351	-0.348921	0.05208	.	.	ENSG00000109458	ENST00000262995;ENST00000262994;ENST00000505913	T;T;T	0.17054	2.3;2.3;2.3	5.49	5.49	0.81192	.	0.190440	0.56097	D	0.000028	T	0.06416	0.0165	N	0.03608	-0.345	0.36490	D	0.868368	B;B	0.20671	0.003;0.047	B;B	0.20767	0.003;0.031	T	0.19095	-1.0316	10	0.02654	T	1	-12.1765	10.0222	0.42051	0.9248:0.0:0.0752:0.0	.	394;394	Q13480;Q13480-2	GAB1_HUMAN;.	S	394;394;291	ENSP00000262995:N394S;ENSP00000262994:N394S;ENSP00000424554:N291S	ENSP00000262994:N394S	N	+	2	0	GAB1	144579189	1.000000	0.71417	0.995000	0.50966	0.947000	0.59692	3.692000	0.54727	2.085000	0.62840	0.533000	0.62120	AAC	.		0.393	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364998.1	NM_002039	
GRIN1	2902	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	9	140057102	140057102	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr9:140057102A>G	ENST00000371561.3	+	14	3021	c.1924A>G	c.(1924-1926)Atc>Gtc	p.I642V	GRIN1_ENST00000371560.3_Missense_Mutation_p.I663V|GRIN1_ENST00000471122.1_3'UTR|GRIN1_ENST00000371559.4_Missense_Mutation_p.I642V|GRIN1_ENST00000371546.4_Missense_Mutation_p.I663V|GRIN1_ENST00000350902.5_Missense_Mutation_p.I642V|GRIN1_ENST00000371555.4_Missense_Mutation_p.I663V|GRIN1_ENST00000371550.4_Missense_Mutation_p.I642V|GRIN1_ENST00000315048.3_Missense_Mutation_p.I642V|GRIN1_ENST00000371553.3_Missense_Mutation_p.I663V	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	642					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CTTTGCCATGATCATCGTGGC	0.697																																					p.I663V	NSCLC(113;717 1653 2089 20474 37618)	.											.	GRIN1	187	0			c.A1987G						.						20.0	24.0	22.0					9																	140057102		2199	4297	6496	SO:0001583	missense	2902	exon15			GCCATGATCATCG		CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.1924A>G	9.37:g.140057102A>G	ENSP00000360616:p.Ile642Val	19.0	0.0		25.0	11.0	NM_001185091	A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Missense_Mutation	SNP	ENST00000371561.3	37	CCDS7031.1	.	.	.	.	.	.	.	.	.	.	a	21.3	4.125299	0.77436	.	.	ENSG00000176884	ENST00000371561;ENST00000315048;ENST00000350902;ENST00000371550;ENST00000371546;ENST00000371555;ENST00000371553;ENST00000371559;ENST00000371560	T;T;T;T;T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48;0.48;0.48;0.48;0.48	4.54	4.54	0.55810	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.66479	0.2793	L	0.53249	1.67	0.80722	D	1	D;D;D;D;D;D	0.67145	0.996;0.977;0.995;0.995;0.996;0.994	D;P;D;D;D;D	0.80764	0.994;0.836;0.99;0.99;0.994;0.953	T	0.69847	-0.5034	10	0.87932	D	0	.	12.7363	0.57225	1.0:0.0:0.0:0.0	.	663;663;642;642;642;642	Q5VSF4;Q5VSF5;Q05586-2;Q05586-3;Q05586;A2AVK2	.;.;.;.;NMDZ1_HUMAN;.	V	642;642;642;642;663;663;663;642;663	ENSP00000360616:I642V;ENSP00000316696:I642V;ENSP00000316915:I642V;ENSP00000360605:I642V;ENSP00000360601:I663V;ENSP00000360610:I663V;ENSP00000360608:I663V;ENSP00000360614:I642V;ENSP00000360615:I663V	ENSP00000316696:I642V	I	+	1	0	GRIN1	139176923	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.077000	0.76814	1.700000	0.51204	0.370000	0.22315	ATC	.		0.697	GRIN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055267.3	NM_007327	
HEATR5B	54497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	37306331	37306331	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr2:37306331C>A	ENST00000233099.5	-	3	365	c.270G>T	c.(268-270)caG>caT	p.Q90H	HEATR5B_ENST00000354531.2_Missense_Mutation_p.Q90H	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	90						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				TATCAAGTGTCTGAAAAACTG	0.373																																					p.Q90H		.											.	HEATR5B	142	0			c.G270T						.						81.0	76.0	78.0					2																	37306331		2201	4298	6499	SO:0001583	missense	54497	exon3			AAGTGTCTGAAAA	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.270G>T	2.37:g.37306331C>A	ENSP00000233099:p.Gln90His	139.0	0.0		155.0	51.0	NM_019024	B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	ENST00000233099.5	37	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.292860	0.60086	.	.	ENSG00000008869	ENST00000233099;ENST00000354531;ENST00000424416	T;T	0.08546	3.08;3.08	5.88	2.18	0.27775	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.16769	0.0403	L	0.47716	1.5	0.48395	D	0.999646	D	0.63880	0.993	P	0.62649	0.905	T	0.00350	-1.1797	10	0.72032	D	0.01	-17.0384	8.749	0.34605	0.0:0.4622:0.0:0.5378	.	90	Q9P2D3	HTR5B_HUMAN	H	90	ENSP00000233099:Q90H;ENSP00000346531:Q90H	ENSP00000233099:Q90H	Q	-	3	2	HEATR5B	37159835	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	0.949000	0.29109	0.129000	0.18514	-0.302000	0.09304	CAG	.		0.373	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
HIVEP1	3096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	12121666	12121666	+	Silent	SNP	G	G	A			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr6:12121666G>A	ENST00000379388.2	+	4	1970	c.1638G>A	c.(1636-1638)ttG>ttA	p.L546L		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	546					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				GTGACTTTTTGCTACAGGACA	0.438																																					p.L546L		.											.	HIVEP1	139	0			c.G1638A						.						55.0	52.0	53.0					6																	12121666		2001	4175	6176	SO:0001819	synonymous_variant	3096	exon4			CTTTTTGCTACAG	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.1638G>A	6.37:g.12121666G>A		62.0	0.0		65.0	21.0	NM_002114	B2RTU3|Q14122|Q5MPB1|Q5VW60	Silent	SNP	ENST00000379388.2	37	CCDS43426.1																																																																																			.		0.438	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114	
KIAA1683	80726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	18368567	18368567	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr19:18368567C>T	ENST00000600328.3	-	4	3159	c.2966G>A	c.(2965-2967)cGc>cAc	p.R989H	KIAA1683_ENST00000392413.4_Missense_Mutation_p.R1176H|PDE4C_ENST00000355502.3_5'Flank|KIAA1683_ENST00000600359.3_Missense_Mutation_p.R943H|PDE4C_ENST00000596647.1_5'Flank			Q9H0B3	K1683_HUMAN	KIAA1683	989	IQ 4. {ECO:0000255|PROSITE- ProRule:PRU00116}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						TTGGTCCCGGCGGGTGCTGTA	0.677																																					p.R1176H		.											.	KIAA1683	92	0			c.G3527A						.						21.0	26.0	24.0					19																	18368567		2079	4078	6157	SO:0001583	missense	80726	exon4			TCCCGGCGGGTGC	AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.2966G>A	19.37:g.18368567C>T	ENSP00000470780:p.Arg989His	40.0	0.0		11.0	4.0	NM_001145304	B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	ENST00000600328.3	37	CCDS32958.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.715173	0.68844	.	.	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000427634;ENST00000392412;ENST00000411671	T;T;T	0.65549	-0.16;-0.16;-0.16	3.54	3.54	0.40534	.	0.000000	0.33253	N	0.005102	T	0.81550	0.4846	M	0.92412	3.305	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.72937	-0.4140	10	0.54805	T	0.06	-22.7126	11.3138	0.49379	0.0:1.0:0.0:0.0	.	1176;989	E9PDE0;Q9H0B3	.;K1683_HUMAN	H	1176;989;943;253;603	ENSP00000376213:R1176H;ENSP00000352774:R989H;ENSP00000404501:R943H	ENSP00000352774:R989H	R	-	2	0	KIAA1683	18229567	0.503000	0.26115	0.048000	0.18961	0.170000	0.22686	1.663000	0.37429	1.935000	0.56089	0.313000	0.20887	CGC	.		0.677	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466312.3		
KPNA7	402569	ucsc.edu;bcgsc.ca	37	7	98790710	98790710	+	Missense_Mutation	SNP	A	A	G	rs188239934	byFrequency	TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr7:98790710A>G	ENST00000327442.6	-	5	607	c.568T>C	c.(568-570)Ttc>Ctc	p.F190L		NM_001145715.1	NP_001139187.1	A9QM74	IMA8_HUMAN	karyopherin alpha 7 (importin alpha 8)	190					cytokine-mediated signaling pathway (GO:0019221)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(3)|endometrium(2)|kidney(1)|prostate(1)|skin(1)	8						TTATCTCTGAACTCTGGGCCA	0.413																																					p.F190L		.											.	KPNA7	158	0			c.T568C						.						100.0	92.0	94.0					7																	98790710		692	1591	2283	SO:0001583	missense	402569	exon5			CTCTGAACTCTGG		CCDS47651.1	7q22.1	2013-02-14			ENSG00000185467	ENSG00000185467		"""Importins"", ""Armadillo repeat containing"""	21839	protein-coding gene	gene with protein product		614107					Standard	NM_001145715		Approved		uc010lft.2	A9QM74	OTTHUMG00000154412	ENST00000327442.6:c.568T>C	7.37:g.98790710A>G	ENSP00000330878:p.Phe190Leu	53.0	0.0		47.0	4.0	NM_001145715	A4D277	Missense_Mutation	SNP	ENST00000327442.6	37	CCDS47651.1	.	.	.	.	.	.	.	.	.	.	A	8.453	0.853473	0.17106	.	.	ENSG00000185467	ENST00000327442	T	0.67865	-0.29	5.2	2.61	0.31194	Armadillo-like helical (1);Armadillo-type fold (1);	0.272209	0.43260	N	0.000592	T	0.46814	0.1412	N	0.16478	0.41	0.27110	N	0.96241	B	0.20459	0.045	B	0.19666	0.026	T	0.38735	-0.9647	10	0.39692	T	0.17	-27.118	8.915	0.35576	0.8316:0.0:0.1684:0.0	.	190	A9QM74	IMA8_HUMAN	L	190	ENSP00000330878:F190L	ENSP00000330878:F190L	F	-	1	0	KPNA7	98628646	0.780000	0.28664	1.000000	0.80357	0.805000	0.45488	1.552000	0.36244	0.945000	0.37605	0.460000	0.39030	TTC	A|0.999;C|0.001		0.413	KPNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335118.1	NM_001145715	
KY	339855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	134366278	134366278	+	Splice_Site	SNP	G	G	A			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr3:134366278G>A	ENST00000423778.2	-	2	259	c.198C>T	c.(196-198)caC>caT	p.H66H	KY_ENST00000508956.1_Splice_Site_p.H66H|KY_ENST00000503669.1_Splice_Site_p.H66H	NM_178554.4	NP_848649.3	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	66					muscle organ development (GO:0007517)|neuromuscular junction development (GO:0007528)	cytoskeleton (GO:0005856)|Z disc (GO:0030018)	peptidase activity (GO:0008233)			central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21						AGAATTTACCGTGAAAGTCAT	0.388																																					p.H66H		.											.	KY	24	0			c.C198T						.						91.0	89.0	89.0					3																	134366278		1834	4084	5918	SO:0001630	splice_region_variant	339855	exon2			TTTACCGTGAAAG	AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611			26576	protein-coding gene	gene with protein product		605739					Standard	NM_178554		Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.199+1C>T	3.37:g.134366278G>A		76.0	0.0		62.0	16.0	NM_178554	B7Z1S4|Q6ZT15	Silent	SNP	ENST00000423778.2	37	CCDS46920.1																																																																																			.		0.388	KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357320.1	NM_178554	Silent
ZDHHC8	29801	bcgsc.ca;mdanderson.org	37	22	20138246	20138246	+	IGR	SNP	G	G	A			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr22:20138246G>A	ENST00000334554.7	+	0	5046				AC006547.14_ENST00000540078.1_Silent_p.D19D	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8						locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					GCCCCTCAGTGTCTCTCGCTC	0.692																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			CTCAGTGTCTCTC	AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499		22.37:g.20138246G>A		110.0	1.0		81.0	17.0	.	Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Silent	SNP	ENST00000334554.7	37	CCDS13776.1	.	.	.	.	.	.	.	.	.	.	g	2.923	-0.222746	0.06061	.	.	ENSG00000234409	ENST00000439765	.	.	.	3.12	-0.338	0.12651	.	.	.	.	.	T	0.20577	0.0495	.	.	.	.	.	.	.	.	.	.	.	.	T	0.26780	-1.0093	3	.	.	.	.	1.333	0.02138	0.1576:0.342:0.332:0.1683	.	.	.	.	Y	52	.	.	H	-	1	0	AC006547.14	18518246	0.000000	0.05858	0.012000	0.15200	0.013000	0.08279	-1.613000	0.02059	0.017000	0.15025	0.305000	0.20034	CAC	.		0.692	ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318564.1	NM_013373	
LPAR4	2846	hgsc.bcm.edu;broad.mit.edu	37	X	78010878	78010878	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chrX:78010878T>C	ENST00000435339.3	+	2	898	c.512T>C	c.(511-513)aTt>aCt	p.I171T		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	171					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						AGTGGCGGTATTTCAGCCTCT	0.458																																					p.I171T		.											.	LPAR4	133	0			c.T512C						.						120.0	85.0	97.0					X																	78010878		2203	4300	6503	SO:0001583	missense	2846	exon2			GCGGTATTTCAGC	U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.512T>C	X.37:g.78010878T>C	ENSP00000408205:p.Ile171Thr	75.0	0.0		88.0	4.0	NM_005296	B2RAC7|O15132|Q502U9|Q6NSP5	Missense_Mutation	SNP	ENST00000435339.3	37	CCDS14441.1	.	.	.	.	.	.	.	.	.	.	T	10.90	1.482326	0.26598	.	.	ENSG00000147145	ENST00000435339;ENST00000373301	T;T	0.72835	-0.69;-0.69	4.2	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	0.117281	0.56097	D	0.000027	T	0.55257	0.1909	N	0.25031	0.7	0.49582	D	0.999807	B	0.25007	0.116	B	0.24006	0.05	T	0.53408	-0.8443	10	0.36615	T	0.2	.	11.3699	0.49694	0.0:0.0:0.0:1.0	.	171	Q99677	LPAR4_HUMAN	T	171	ENSP00000408205:I171T;ENSP00000362398:I171T	ENSP00000362398:I171T	I	+	2	0	LPAR4	77897534	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	5.721000	0.68477	1.558000	0.49541	0.339000	0.21740	ATT	.		0.458	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057322.2	NM_005296	
LRRC14B	389257	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	192439	192439	+	Silent	SNP	C	C	T	rs369014987	byFrequency	TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr5:192439C>T	ENST00000328278.3	+	1	814	c.786C>T	c.(784-786)gaC>gaT	p.D262D		NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	262										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						CCACTCCCGACGGCGAGGACC	0.682													C|||	10	0.00199681	0.0076	0.0	5008	,	,		15181	0.0		0.0	False		,,,				2504	0.0				p.D262D		.											.	LRRC14B	69	0			c.C786T						.	C		8,4182		0,8,2087	11.0	14.0	13.0		786	-2.1	0.0	5		13	1,8433		0,1,4216	no	coding-synonymous	LRRC14B	NM_001080478.1		0,9,6303	TT,TC,CC		0.0119,0.1909,0.0713		262/515	192439	9,12615	2095	4217	6312	SO:0001819	synonymous_variant	389257	exon1			TCCCGACGGCGAG		CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.786C>T	5.37:g.192439C>T		76.0	0.0		69.0	21.0	NM_001080478		Silent	SNP	ENST00000328278.3	37	CCDS47184.1																																																																																			.		0.682	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365393.2	NM_001080478	
LYST	1130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	235937265	235937265	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr1:235937265T>A	ENST00000389794.3	-	19	5835	c.5661A>T	c.(5659-5661)gaA>gaT	p.E1887D	LYST_ENST00000389793.2_Missense_Mutation_p.E1887D|LYST_ENST00000536965.1_3'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	1887					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AAATAATATCTTCACCACAGC	0.323																																					p.E1887D		.											.	LYST	143	0			c.A5661T						.						89.0	90.0	90.0					1																	235937265		2202	4298	6500	SO:0001583	missense	1130	exon19			AATATCTTCACCA	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.5661A>T	1.37:g.235937265T>A	ENSP00000374444:p.Glu1887Asp	216.0	0.0		277.0	87.0	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	T	12.48	1.950107	0.34377	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.62639	0.01;0.01	5.32	1.82	0.25136	.	0.207580	0.49305	D	0.000147	T	0.49321	0.1550	L	0.57536	1.79	0.80722	D	1	B	0.16166	0.016	B	0.13407	0.009	T	0.28106	-1.0054	10	0.22109	T	0.4	.	4.2983	0.10913	0.1767:0.4044:0.0:0.4189	.	1887	Q99698	LYST_HUMAN	D	1887	ENSP00000374444:E1887D;ENSP00000374443:E1887D	ENSP00000374443:E1887D	E	-	3	2	LYST	234003888	1.000000	0.71417	0.982000	0.44146	0.702000	0.40608	0.615000	0.24329	0.356000	0.24157	0.477000	0.44152	GAA	.		0.323	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
LYVE1	10894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	10580711	10580711	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr11:10580711C>T	ENST00000256178.3	-	6	1074	c.916G>A	c.(916-918)Gag>Aag	p.E306K	MRVI1-AS1_ENST00000529829.1_RNA|LYVE1_ENST00000529598.1_Missense_Mutation_p.E202K|MRVI1-AS1_ENST00000529979.1_RNA|LYVE1_ENST00000531706.1_5'Flank	NM_006691.3	NP_006682.2	Q9Y5Y7	LYVE1_HUMAN	lymphatic vessel endothelial hyaluronan receptor 1	306					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8				all cancers(16;7.22e-08)|Epithelial(150;1.03e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0609)		CTCTTGGACTCTTCTGGGTTT	0.438																																					p.E306K		.											.	LYVE1	515	0			c.G916A						.						307.0	282.0	291.0					11																	10580711		2201	4294	6495	SO:0001583	missense	10894	exon6			TGGACTCTTCTGG	AF118108	CCDS7804.1	11p15	2008-02-05	2007-06-26	2007-06-26		ENSG00000133800			14687	protein-coding gene	gene with protein product		605702	"""extracellular link domain containing 1"""	XLKD1		10037799, 12554094	Standard	NM_006691		Approved	LYVE-1	uc001miv.2	Q9Y5Y7		ENST00000256178.3:c.916G>A	11.37:g.10580711C>T	ENSP00000256178:p.Glu306Lys	327.0	0.0		344.0	104.0	NM_006691	Q8TC18|Q9UNF4	Missense_Mutation	SNP	ENST00000256178.3	37	CCDS7804.1	.	.	.	.	.	.	.	.	.	.	C	33	5.275007	0.95459	.	.	ENSG00000133800	ENST00000256178;ENST00000529598	T;T	0.37752	2.88;1.18	6.02	6.02	0.97574	.	0.134638	0.51477	D	0.000097	T	0.58337	0.2115	M	0.71581	2.175	0.52099	D	0.999942	D;D	0.63046	0.992;0.986	P;P	0.61592	0.891;0.78	T	0.58618	-0.7605	10	0.72032	D	0.01	-10.1708	17.4575	0.87611	0.0:1.0:0.0:0.0	.	202;306	F2Z296;Q9Y5Y7	.;LYVE1_HUMAN	K	306;202	ENSP00000256178:E306K;ENSP00000436016:E202K	ENSP00000256178:E306K	E	-	1	0	LYVE1	10537287	1.000000	0.71417	0.993000	0.49108	0.942000	0.58702	4.151000	0.58105	2.865000	0.98341	0.655000	0.94253	GAG	.		0.438	LYVE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385893.1	NM_016164	
MDC1	9656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	30673414	30673414	+	Silent	SNP	G	G	A			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr6:30673414G>A	ENST00000376406.3	-	10	4193	c.3546C>T	c.(3544-3546)ccC>ccT	p.P1182P	MDC1_ENST00000376405.2_Silent_p.P918P|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1182	Interaction with the PRKDC complex.|Pro-rich.			Missing (in Ref. 2; CAH18685). {ECO:0000305}.	DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						CCTGAGATGTGGGCTCAGAGG	0.567								Other conserved DNA damage response genes																													p.P1182P		.											.	MDC1	273	0			c.C3546T						.						156.0	172.0	167.0					6																	30673414		2203	4300	6503	SO:0001819	synonymous_variant	9656	exon10			AGATGTGGGCTCA	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.3546C>T	6.37:g.30673414G>A		240.0	0.0		265.0	82.0	NM_014641	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Silent	SNP	ENST00000376406.3	37	CCDS34384.1	.	.	.	.	.	.	.	.	.	.	G	4.863	0.160387	0.09287	.	.	ENSG00000137337	ENST00000417033	.	.	.	3.62	3.62	0.41486	.	.	.	.	.	T	0.47857	0.1468	.	.	.	0.35888	D	0.829475	.	.	.	.	.	.	T	0.47995	-0.9073	4	.	.	.	-0.4572	11.0187	0.47705	0.0:0.0:1.0:0.0	.	.	.	.	Y	243	.	.	H	-	1	0	MDC1	30781393	0.000000	0.05858	0.015000	0.15790	0.150000	0.21749	-0.049000	0.11924	2.061000	0.61500	0.478000	0.44815	CAC	.		0.567	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	
MFSD8	256471	broad.mit.edu;bcgsc.ca	37	4	128842751	128842751	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr4:128842751T>C	ENST00000296468.3	-	12	1405	c.1278A>G	c.(1276-1278)atA>atG	p.I426M	MFSD8_ENST00000515130.1_5'UTR|MFSD8_ENST00000513559.1_Missense_Mutation_p.I381M	NM_152778.2	NP_689991.1	Q8NHS3	MFSD8_HUMAN	major facilitator superfamily domain containing 8	426					cell death (GO:0008219)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)				cervix(2)|endometrium(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)	23						AGCCTAATCCTATTAGCACAG	0.443																																					p.I426M		.											.	MFSD8	92	0			c.A1278G						.						104.0	107.0	106.0					4																	128842751		2203	4300	6503	SO:0001583	missense	256471	exon12			TAATCCTATTAGC	AK074564	CCDS3736.1	4q28.2	2014-09-17			ENSG00000164073	ENSG00000164073			28486	protein-coding gene	gene with protein product		611124	"""ceroid-lipofuscinosis, neuronal 7, late infantile, variant"""	CLN7		17564970	Standard	NM_152778		Approved	MGC33302	uc003ifp.3	Q8NHS3	OTTHUMG00000133303	ENST00000296468.3:c.1278A>G	4.37:g.128842751T>C	ENSP00000296468:p.Ile426Met	149.0	0.0		122.0	6.0	NM_152778	B2RDM1|B7Z205|Q8N2P3	Missense_Mutation	SNP	ENST00000296468.3	37	CCDS3736.1	.	.	.	.	.	.	.	.	.	.	T	16.18	3.051408	0.55218	.	.	ENSG00000164073	ENST00000296468;ENST00000513559	T;T	0.73469	-0.75;-0.75	5.17	-5.77	0.02369	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.229663	0.42548	N	0.000686	T	0.64271	0.2583	M	0.73962	2.25	0.80722	D	1	P	0.44776	0.843	P	0.46110	0.504	T	0.60449	-0.7261	10	0.27785	T	0.31	-6.7621	0.1292	0.00072	0.2892:0.1804:0.2442:0.2863	.	426	Q8NHS3	MFSD8_HUMAN	M	426;381	ENSP00000296468:I426M;ENSP00000425000:I381M	ENSP00000296468:I426M	I	-	3	3	MFSD8	129062201	0.861000	0.29849	0.060000	0.19600	0.816000	0.46133	-0.173000	0.09854	-0.506000	0.06558	-1.312000	0.01307	ATA	.		0.443	MFSD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257097.1	NM_152778	
MOSPD3	64598	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100211234	100211234	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr7:100211234C>T	ENST00000393950.2	+	3	698	c.416C>T	c.(415-417)gCg>gTg	p.A139V	MOSPD3_ENST00000424091.2_Missense_Mutation_p.A129V|MOSPD3_ENST00000223054.4_Missense_Mutation_p.A139V|MOSPD3_ENST00000379527.2_Missense_Mutation_p.A139V	NM_023948.4	NP_076438.1	O75425	MSPD3_HUMAN	motile sperm domain containing 3	139	MSP. {ECO:0000255|PROSITE- ProRule:PRU00132}.				heart development (GO:0007507)	integral component of membrane (GO:0016021)	structural molecule activity (GO:0005198)	p.A139V(1)		breast(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					AGAGCCCCAGCGTACCCCCTT	0.627																																					p.A139V		.											.	MOSPD3	92	1	Substitution - Missense(1)	prostate(1)	c.C416T						.						64.0	59.0	61.0					7																	100211234		2203	4300	6503	SO:0001583	missense	64598	exon4			CCCCAGCGTACCC	BC011653	CCDS5701.1, CCDS47662.1	7q22	2009-11-06			ENSG00000106330	ENSG00000106330			25078	protein-coding gene	gene with protein product		609125				15533722	Standard	XM_005250531		Approved	CDS3, NET30	uc003uvs.3	O75425	OTTHUMG00000159599	ENST00000393950.2:c.416C>T	7.37:g.100211234C>T	ENSP00000377522:p.Ala139Val	54.0	0.0		66.0	25.0	NM_001040098	A4D2D1|A6NG17|C9JE89|D6W5W1|O75423|O75424	Missense_Mutation	SNP	ENST00000393950.2	37	CCDS5701.1	.	.	.	.	.	.	.	.	.	.	C	12.65	2.002850	0.35320	.	.	ENSG00000106330	ENST00000223054;ENST00000493970;ENST00000379527;ENST00000393950;ENST00000424091;ENST00000393953	.	.	.	4.28	3.4	0.38934	.	0.157917	0.30269	N	0.010008	T	0.19127	0.0459	N	0.22421	0.69	0.09310	N	0.99999	B;B	0.27971	0.059;0.196	B;B	0.17098	0.005;0.017	T	0.11227	-1.0596	9	0.22109	T	0.4	-8.9796	6.7813	0.23648	0.0:0.7963:0.0:0.2037	.	129;139	C9JE89;O75425	.;MSPD3_HUMAN	V	139;139;139;139;129;125	.	ENSP00000223054:A139V	A	+	2	0	MOSPD3	100049170	0.847000	0.29606	0.326000	0.25389	0.694000	0.40290	3.232000	0.51302	1.400000	0.46741	0.563000	0.77884	GCG	.		0.627	MOSPD3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356395.1	NM_023948	
OR1I1	126370	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15198366	15198366	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr19:15198366G>A	ENST00000209540.2	+	1	576	c.490G>A	c.(490-492)Gct>Act	p.A164T		NM_001004713.1	NP_001004713.1	O60431	OR1I1_HUMAN	olfactory receptor, family 1, subfamily I, member 1	164						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(3)|ovary(2)|stomach(2)	20						CTGCCTCATGGCTCAACTGAC	0.567																																					p.A164T		.											.	OR1I1	71	0			c.G490A						.						108.0	101.0	103.0					19																	15198366		2203	4300	6503	SO:0001583	missense	126370	exon1			CTCATGGCTCAAC	AC004794	CCDS32937.1	19p13.1	2012-08-09				ENSG00000094661		"""GPCR / Class A : Olfactory receptors"""	8207	protein-coding gene	gene with protein product							Standard	NM_001004713		Approved	OR1I1P, OR19-20, OR1I1Q	uc010xoe.2	O60431		ENST00000209540.2:c.490G>A	19.37:g.15198366G>A	ENSP00000209540:p.Ala164Thr	88.0	0.0		69.0	9.0	NM_001004713	Q96R92	Missense_Mutation	SNP	ENST00000209540.2	37	CCDS32937.1	.	.	.	.	.	.	.	.	.	.	G	6.270	0.417960	0.11870	.	.	ENSG00000094661	ENST00000209540	T	0.00076	8.76	4.79	2.6	0.31112	GPCR, rhodopsin-like superfamily (1);	0.268945	0.19455	U	0.113848	T	0.00109	0.0003	N	0.14661	0.345	0.09310	N	1	B	0.24258	0.1	B	0.28991	0.097	T	0.06463	-1.0825	10	0.37606	T	0.19	.	7.3758	0.26827	0.0901:0.0:0.7427:0.1672	.	164	O60431	OR1I1_HUMAN	T	164	ENSP00000209540:A164T	ENSP00000209540:A164T	A	+	1	0	OR1I1	15059366	0.000000	0.05858	0.596000	0.28811	0.437000	0.31866	-0.126000	0.10563	0.597000	0.29811	0.555000	0.69702	GCT	.		0.567	OR1I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465665.1		
OR51I1	390063	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	5462320	5462320	+	Missense_Mutation	SNP	C	C	T	rs138548705		TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr11:5462320C>T	ENST00000380211.1	-	1	424	c.425G>A	c.(424-426)cGt>cAt	p.R142H	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001005288.2	NP_001005288.1	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I, member 1	142					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCCAATATACGGTTGTGAGT	0.478													C|||	1	0.000199681	0.0	0.0014	5008	,	,		24090	0.0		0.0	False		,,,				2504	0.0				p.R142H		.											.	OR51I1	69	0			c.G425A						.	C	HIS/ARG	1,4401	2.1+/-5.4	0,1,2200	137.0	107.0	117.0		425	3.7	0.3	11	dbSNP_134	117	0,8594		0,0,4297	no	missense	OR51I1	NM_001005288.2	29	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	142/315	5462320	1,12995	2201	4297	6498	SO:0001583	missense	390063	exon1			AATATACGGTTGT	BK004429	CCDS31382.1	11p15.4	2012-08-09			ENSG00000167359	ENSG00000167359		"""GPCR / Class A : Olfactory receptors"""	15200	protein-coding gene	gene with protein product							Standard	NM_001005288		Approved		uc010qze.2	Q9H343	OTTHUMG00000066908	ENST00000380211.1:c.425G>A	11.37:g.5462320C>T	ENSP00000369559:p.Arg142His	83.0	1.0		92.0	36.0	NM_001005288	B9EKW2|Q6IF33	Missense_Mutation	SNP	ENST00000380211.1	37	CCDS31382.1	.	.	.	.	.	.	.	.	.	.	C	11.85	1.760391	0.31137	2.27E-4	0.0	ENSG00000167359	ENST00000317283;ENST00000321307;ENST00000380211	T	0.39592	1.07	5.74	3.69	0.42338	GPCR, rhodopsin-like superfamily (1);	0.243881	0.29059	N	0.013271	T	0.56202	0.1969	M	0.81614	2.55	0.09310	N	1	D	0.63880	0.993	P	0.55087	0.768	T	0.50180	-0.8858	10	0.40728	T	0.16	.	12.1837	0.54226	0.2579:0.7421:0.0:0.0	.	142	Q9H343	O51I1_HUMAN	H	127;139;142	ENSP00000369559:R142H	ENSP00000348350:R127H	R	-	2	0	OR51I1	5418896	0.000000	0.05858	0.339000	0.25562	0.128000	0.20619	-1.648000	0.01995	2.742000	0.94016	0.551000	0.68910	CGT	C|1.000;T|0.000		0.478	OR51I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143399.1	NM_001005288	
PAPPA2	60676	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	176564726	176564726	+	Silent	SNP	C	C	T			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr1:176564726C>T	ENST00000367662.3	+	3	3150	c.1986C>T	c.(1984-1986)ccC>ccT	p.P662P	PAPPA2_ENST00000367661.3_Silent_p.P662P	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	662	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CTGACTCACCCAAGAGGTAAG	0.498																																					p.P662P		.											.	PAPPA2	548	0			c.C1986T						.						40.0	44.0	43.0					1																	176564726		2135	4241	6376	SO:0001819	synonymous_variant	60676	exon3			CTCACCCAAGAGG	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1986C>T	1.37:g.176564726C>T		39.0	0.0		39.0	14.0	NM_021936	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	ENST00000367662.3	37	CCDS41438.1																																																																																			.		0.498	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
OR6F1	343169	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	247875185	247875185	+	Silent	SNP	C	C	T			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr1:247875185C>T	ENST00000302084.2	-	1	920	c.873G>A	c.(871-873)acG>acA	p.T291T	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	291						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			TATTACGAAGCGTATAGATGA	0.438																																					p.T291T		.											.	OR6F1	68	0			c.G873A						.						126.0	125.0	125.0					1																	247875185		2203	4300	6503	SO:0001819	synonymous_variant	343169	exon1			ACGAAGCGTATAG	BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.873G>A	1.37:g.247875185C>T		55.0	0.0		61.0	19.0	NM_001005286	B2RNV6|Q6IF02|Q96R39	Silent	SNP	ENST00000302084.2	37	CCDS31095.1																																																																																			.		0.438	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286	
PHYHIPL	84457	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	61005153	61005174	+	Frame_Shift_Del	DEL	GACCTGTACAGAAGAAGATGGG	GACCTGTACAGAAGAAGATGGG	-	rs200012194		TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	GACCTGTACAGAAGAAGATGGG	GACCTGTACAGAAGAAGATGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr10:61005153_61005174delGACCTGTACAGAAGAAGATGGG	ENST00000373880.4	+	5	1197_1218	c.933_954delGACCTGTACAGAAGAAGATGGG	c.(931-954)ttgacctgtacagaagaagatgggfs	p.LTCTEEDG311fs	PHYHIPL_ENST00000373878.3_Frame_Shift_Del_p.LTCTEEDG285fs	NM_032439.3	NP_115815.2	Q96FC7	PHIPL_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein-like	311						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(3)|skin(1)|urinary_tract(1)	18						ATAAATTTTTGACCTGTACAGAAGAAGATGGGGTGCTGGTTT	0.428																																					p.311_318del		.											.	PHYHIPL	90	0			c.933_954del						.																																			SO:0001589	frameshift_variant	84457	exon5			ATTTTTGACCTGT	AL834339	CCDS7254.1, CCDS44405.1	10q21.1	2013-02-11	2006-01-09		ENSG00000165443	ENSG00000165443		"""Fibronectin type III domain containing"""	29378	protein-coding gene	gene with protein product			"""phytanoyl-CoA hydroxylase interacting protein-like"""			11347906	Standard	NM_032439		Approved	KIAA1796, Em:AC025038.1	uc001jkk.4	Q96FC7	OTTHUMG00000018276	ENST00000373880.4:c.933_954delGACCTGTACAGAAGAAGATGGG	10.37:g.61005153_61005174delGACCTGTACAGAAGAAGATGGG	ENSP00000362987:p.Leu311fs	130.0	0.0		90.0	12.0	NM_032439	B7WP61|Q68DF3|Q6UXY3|Q8N3W3|Q96JM9|Q96NP7	Frame_Shift_Del	DEL	ENST00000373880.4	37	CCDS7254.1																																																																																			.		0.428	PHYHIPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048156.1	NM_032439	
PPT2	9374	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32130607	32130607	+	Silent	SNP	G	G	A			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr6:32130607G>A	ENST00000324816.6	+	9	1357	c.789G>A	c.(787-789)ggG>ggA	p.G263G	PPT2-EGFL8_ENST00000422437.1_Intron|PPT2_ENST00000375137.2_Silent_p.G263G|PPT2-EGFL8_ENST00000453656.2_Intron|PPT2_ENST00000375143.2_Silent_p.G263G|EGFL8_ENST00000395512.1_5'Flank|PPT2_ENST00000445576.2_Intron|PPT2_ENST00000437001.2_Intron|PPT2_ENST00000395523.1_Silent_p.G263G|EGFL8_ENST00000333845.6_5'Flank|PPT2_ENST00000361568.2_Silent_p.G269G			Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2	263					cellular protein modification process (GO:0006464)|macromolecule depalmitoylation (GO:0098734)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	palmitoyl hydrolase activity (GO:0098599)|palmitoyl-(protein) hydrolase activity (GO:0008474)|thiolester hydrolase activity (GO:0016790)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	17						ATTCTTTTGGGTTGAAGACTC	0.542																																					p.G269G		.											.	PPT2	44	0			c.G807A						.						113.0	123.0	120.0					6																	32130607		2203	4300	6503	SO:0001819	synonymous_variant	9374	exon9			TTTTGGGTTGAAG	AF020543	CCDS4740.1, CCDS4742.1	6p21.3	2012-07-02			ENSG00000221988	ENSG00000221988	3.1.2.22		9326	protein-coding gene	gene with protein product		603298				9341199, 10051407	Standard	NM_138717		Approved		uc003nzw.3	Q9UMR5	OTTHUMG00000031257	ENST00000324816.6:c.789G>A	6.37:g.32130607G>A		140.0	0.0		142.0	37.0	NM_138717	A2ABC9|A2ABD1|A2ARM7|A2BFH7|A2BFH9|A2BFI2|A8K9L4|B0S868|G8JLE1|O14799|Q0P6K0|Q5JP13|Q5JP14|Q5JQF0|Q5SSX4|Q5SSX5|Q5SSX6|Q5STJ4|Q5STJ5|Q5STJ6|Q6FI80|Q99945	Silent	SNP	ENST00000324816.6	37	CCDS4742.1																																																																																			.		0.542	PPT2-207	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076552.4	NM_138717	
PSMD2	5708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	184020202	184020202	+	Missense_Mutation	SNP	G	G	A	rs11545182		TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr3:184020202G>A	ENST00000310118.4	+	6	1307	c.749G>A	c.(748-750)cGt>cAt	p.R250H	EIF2B5_ENST00000444495.1_Intron|PSMD2_ENST00000435761.1_Missense_Mutation_p.R91H|PSMD2_ENST00000439383.1_Missense_Mutation_p.R120H	NM_002808.3	NP_002799.3	Q13200	PSMD2_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 2	250					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|liver(1)|lung(12)|prostate(3)|upper_aerodigestive_tract(2)	27	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	GCCCTACTGCGTTGTGCCCTG	0.468																																					p.R250H	Colon(24;313 636 6917 9932 15554)	.											.	PSMD2	90	0			c.G749A						.						137.0	124.0	128.0					3																	184020202		2203	4300	6503	SO:0001583	missense	5708	exon6			TACTGCGTTGTGC	AK095245	CCDS3258.1, CCDS63853.1, CCDS63854.1	3q27.3	2008-05-22			ENSG00000175166	ENSG00000175166		"""Proteasome (prosome, macropain) subunits"""	9559	protein-coding gene	gene with protein product		606223				8774743	Standard	NM_002808		Approved	S2, P97, TRAP2, MGC14274, Rpn1	uc003fnn.1	Q13200	OTTHUMG00000156796	ENST00000310118.4:c.749G>A	3.37:g.184020202G>A	ENSP00000310129:p.Arg250His	111.0	0.0		111.0	31.0	NM_002808	B4DX07|B4DXY1|E7EW34|E9PCS3|Q12932|Q15321|Q53XQ4|Q96I12	Missense_Mutation	SNP	ENST00000310118.4	37	CCDS3258.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035150	0.54896	.	.	ENSG00000175166	ENST00000310118;ENST00000417952;ENST00000538096;ENST00000435761;ENST00000439383	T;T;T	0.22336	1.96;1.96;1.96	5.46	5.46	0.80206	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.17916	0.0430	L	0.39085	1.19	0.58432	D	0.999999	B;P	0.37708	0.004;0.606	B;B	0.32289	0.002;0.143	T	0.01786	-1.1274	10	0.46703	T	0.11	-12.0332	16.5504	0.84471	0.0:0.13:0.87:0.0	.	91;250	E9PCS3;Q13200	.;PSMD2_HUMAN	H	250;175;242;91;120	ENSP00000310129:R250H;ENSP00000402618:R91H;ENSP00000416028:R120H	ENSP00000310129:R250H	R	+	2	0	PSMD2	185502896	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	4.672000	0.61597	2.845000	0.97973	0.603000	0.83216	CGT	G|1.000;|0.000		0.468	PSMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345843.1	NM_002808	
RB1	5925	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	48954378	48954378	+	Splice_Site	DEL	G	G	-			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr13:48954378delG	ENST00000267163.4	+	16	1636		c.e16+1			NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(9)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ACATATAGCAGTAAGTTAAAT	0.338		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											.		.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	RB1,NS,carcinoma,0	RB1	3784	24	Whole gene deletion(15)|Unknown(9)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|lung(1)	c.1498+1G>-						.						43.0	46.0	45.0					13																	48954378		2201	4299	6500	SO:0001630	splice_region_variant	5925	exon16	Familial Cancer Database		ATAGCAGTAAGTT	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1498+1G>-	13.37:g.48954378delG		117.0	0.0		107.0	55.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	DEL	ENST00000267163.4	37	CCDS31973.1																																																																																			.		0.338	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		Intron
DST	667	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	56469970	56469970	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr6:56469970G>C	ENST00000361203.3	-	36	8830	c.8823C>G	c.(8821-8823)gaC>gaG	p.D2941E	DST_ENST00000312431.6_Missense_Mutation_p.D2941E|DST_ENST00000370769.4_Missense_Mutation_p.D2941E|DST_ENST00000370754.5_Missense_Mutation_p.D3119E|DST_ENST00000370788.2_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000446842.2_Missense_Mutation_p.D2615E|DST_ENST00000244364.6_Intron			Q03001	DYST_HUMAN	dystonin	2941					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CTGAAGTAATGTCATCACTAA	0.338																																					.		.											.	.	.	0			.						.						44.0	42.0	43.0					6																	56469970		1853	4090	5943	SO:0001583	missense	100873774	.			AGTAATGTCATCA	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.8823C>G	6.37:g.56469970G>C	ENSP00000354508:p.Asp2941Glu	178.0	0.0		164.0	12.0	.	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	RNA	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	G	12.98	2.101527	0.37048	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000446842;ENST00000312431;ENST00000361203;ENST00000439203	T;T;T;D;T;T	0.81908	-0.1;-0.11;0.83;-1.55;-0.1;-0.32	6.03	-0.672	0.11377	.	1.044460	0.07590	N	0.921883	T	0.33469	0.0864	.	.	.	0.26241	N	0.978867	B	0.30361	0.277	B	0.26770	0.073	T	0.12578	-1.0542	8	0.02654	T	1	.	5.4177	0.16384	0.5689:0.0:0.2949:0.1362	.	2615	Q03001-9	.	E	3119;2941;2615;2941;2941;2615	ENSP00000359790:D3119E;ENSP00000359805:D2941E;ENSP00000393645:D2615E;ENSP00000307959:D2941E;ENSP00000354508:D2941E;ENSP00000404924:D2615E	ENSP00000307959:D2941E	D	-	3	2	DST	56577929	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.199000	0.17237	-0.124000	0.11724	-0.137000	0.14449	GAC	.		0.338	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
SHQ1	55164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	72890225	72890225	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr3:72890225A>T	ENST00000325599.8	-	4	596	c.457T>A	c.(457-459)Tta>Ata	p.L153I	SHQ1_ENST00000463369.1_Missense_Mutation_p.L125I	NM_018130.2	NP_060600.2	Q6PI26	SHQ1_HUMAN	SHQ1, H/ACA ribonucleoprotein assembly factor	153					negative regulation of rRNA processing (GO:2000233)|positive regulation of apoptotic process (GO:0043065)|ribonucleoprotein complex assembly (GO:0022618)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		CCTGATCGTAAGTTTCCAAAT	0.393																																					p.L153I		.											.	SHQ1	137	0			c.T457A						.						181.0	171.0	175.0					3																	72890225		2203	4300	6503	SO:0001583	missense	55164	exon4			ATCGTAAGTTTCC	BC025270	CCDS33788.1	3p13	2013-01-08	2013-01-08		ENSG00000144736	ENSG00000144736			25543	protein-coding gene	gene with protein product		613663	"""SHQ1 homolog (S. cerevisiae)"""			12477932	Standard	NM_018130		Approved	FLJ10539, Shq1p	uc003dpf.3	Q6PI26	OTTHUMG00000158814	ENST00000325599.8:c.457T>A	3.37:g.72890225A>T	ENSP00000315182:p.Leu153Ile	132.0	0.0		153.0	59.0	NM_018130	B4DL05|Q6MZJ4|Q7Z748|Q9H7E5|Q9NVS8	Missense_Mutation	SNP	ENST00000325599.8	37	CCDS33788.1	.	.	.	.	.	.	.	.	.	.	A	17.51	3.406835	0.62399	.	.	ENSG00000144736	ENST00000325599;ENST00000463369;ENST00000482785	T;T;T	0.47869	0.83;0.83;0.83	5.27	1.01	0.19927	.	0.350898	0.25753	N	0.028527	T	0.57681	0.2070	M	0.72894	2.215	0.24490	N	0.994305	D	0.69078	0.997	P	0.62560	0.904	T	0.49652	-0.8917	10	0.30854	T	0.27	-2.5829	8.937	0.35706	0.6128:0.0:0.3872:0.0	.	153	Q6PI26	SHQ1_HUMAN	I	153;125;64	ENSP00000315182:L153I;ENSP00000417452:L125I;ENSP00000418398:L64I	ENSP00000315182:L153I	L	-	1	2	SHQ1	72972915	0.987000	0.35691	0.312000	0.25196	0.868000	0.49771	1.615000	0.36922	0.267000	0.21916	0.477000	0.44152	TTA	.		0.393	SHQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352310.1	NM_018130	
SNTG2	54221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	1241722	1241722	+	Missense_Mutation	SNP	C	C	G	rs530642242		TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr2:1241722C>G	ENST00000308624.5	+	10	911	c.782C>G	c.(781-783)aCa>aGa	p.T261R	SNTG2_ENST00000407292.1_Missense_Mutation_p.T134R	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	261					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CGGTTTTACACAGCCCAGGAT	0.622																																					p.T261R		.											.	SNTG2	136	0			c.C782G						.						40.0	45.0	43.0					2																	1241722		2195	4297	6492	SO:0001583	missense	54221	exon10			TTTACACAGCCCA	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.782C>G	2.37:g.1241722C>G	ENSP00000311837:p.Thr261Arg	30.0	0.0		37.0	10.0	NM_018968	Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	37	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	C	13.86	2.361665	0.41801	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.55588	0.51;0.51	4.68	4.68	0.58851	.	0.052895	0.85682	D	0.000000	T	0.69396	0.3106	M	0.70595	2.14	0.53688	D	0.999973	D;D	0.76494	0.999;0.998	D;P	0.65987	0.94;0.873	T	0.71938	-0.4441	10	0.51188	T	0.08	.	15.457	0.75325	0.0:1.0:0.0:0.0	.	134;261	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	R	261;134	ENSP00000311837:T261R;ENSP00000385020:T134R	ENSP00000311837:T261R	T	+	2	0	SNTG2	1224273	0.999000	0.42202	0.009000	0.14445	0.051000	0.14879	5.719000	0.68462	2.298000	0.77334	0.655000	0.94253	ACA	.		0.622	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968	
SLC9A2	6549	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	103317675	103317675	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr2:103317675C>T	ENST00000233969.2	+	8	1875	c.1733C>T	c.(1732-1734)aCa>aTa	p.T578I	SLC9A2_ENST00000469286.1_3'UTR	NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	578					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						ACTGTCCCTACATTTGCATCT	0.294																																					p.T578I		.											.	SLC9A2	157	0			c.C1733T						.						68.0	66.0	67.0					2																	103317675		2203	4300	6503	SO:0001583	missense	6549	exon8			TCCCTACATTTGC		CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.1733C>T	2.37:g.103317675C>T	ENSP00000233969:p.Thr578Ile	147.0	0.0		180.0	23.0	NM_003048	B2RMS2	Missense_Mutation	SNP	ENST00000233969.2	37	CCDS2062.1	.	.	.	.	.	.	.	.	.	.	C	10.18	1.278569	0.23307	.	.	ENSG00000115616	ENST00000233969	T	0.43294	0.95	5.72	5.72	0.89469	.	0.054131	0.85682	D	0.000000	T	0.27832	0.0685	N	0.11560	0.145	0.26930	N	0.966493	B	0.22346	0.068	B	0.22601	0.04	T	0.29305	-1.0016	10	0.72032	D	0.01	.	14.6909	0.69085	0.1451:0.8549:0.0:0.0	.	578	Q9UBY0	SL9A2_HUMAN	I	578	ENSP00000233969:T578I	ENSP00000233969:T578I	T	+	2	0	SLC9A2	102684107	1.000000	0.71417	0.770000	0.31555	0.121000	0.20230	6.264000	0.72527	2.706000	0.92434	0.467000	0.42956	ACA	.		0.294	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253292.2		
NPR2	4882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	35810300	35810300	+	IGR	SNP	C	C	G			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr9:35810300C>G	ENST00000342694.2	+	0	3686				HINT2_ENST00000474908.1_5'Flank|SPAG8_ENST00000396638.2_Missense_Mutation_p.D403H|SPAG8_ENST00000479751.1_5'UTR|AL133410.1_ENST00000582432.1_RNA|SPAG8_ENST00000484764.1_Intron|SPAG8_ENST00000340291.2_Missense_Mutation_p.D403H	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2						bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	TGGCGGTAGTCGTGAGGCTGT	0.612																																					p.D403H		.											.	SPAG8	91	0			c.G1207C						.						156.0	153.0	154.0					9																	35810300		2203	4300	6503	SO:0001628	intergenic_variant	26206	exon6			GGTAGTCGTGAGG	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871		9.37:g.35810300C>G		86.0	0.0		67.0	21.0	NM_001039592	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	ENST00000342694.2	37	CCDS6590.1	.	.	.	.	.	.	.	.	.	.	C	15.44	2.834243	0.50951	.	.	ENSG00000137098	ENST00000340291;ENST00000396638	T;T	0.36878	1.23;1.26	5.42	3.31	0.37934	.	0.268766	0.31051	N	0.008350	T	0.45013	0.1321	L	0.47716	1.5	0.34920	D	0.748328	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.56147	-0.8027	10	0.66056	D	0.02	-24.3527	3.6592	0.08232	0.2407:0.6096:0.0:0.1497	.	403;403	E9PDV6;Q99932-2	.;.	H	403	ENSP00000340982:D403H;ENSP00000379878:D403H	ENSP00000340982:D403H	D	-	1	0	SPAG8	35800300	0.306000	0.24490	0.996000	0.52242	0.814000	0.46013	0.504000	0.22626	2.542000	0.85734	0.655000	0.94253	GAC	.		0.612	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
SPATA31D1	389763	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	84606921	84606921	+	Silent	SNP	C	C	T			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr9:84606921C>T	ENST00000344803.2	+	4	1583	c.1536C>T	c.(1534-1536)agC>agT	p.S512S		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	512					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTTTGCACAGCGAGTCTCTGC	0.458																																					p.S512S		.											.	.	.	0			c.C1536T						.						85.0	78.0	80.0					9																	84606921		1959	4165	6124	SO:0001819	synonymous_variant	389763	exon4			GCACAGCGAGTCT		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.1536C>T	9.37:g.84606921C>T		203.0	1.0		204.0	42.0	NM_001001670		Silent	SNP	ENST00000344803.2	37	CCDS47986.1																																																																																			.		0.458	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
SPHKAP	80309	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	228884827	228884827	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr2:228884827T>A	ENST00000392056.3	-	7	789	c.743A>T	c.(742-744)cAg>cTg	p.Q248L	SPHKAP_ENST00000344657.5_Missense_Mutation_p.Q248L	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	248						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TCCCTTTAGCTGTTTACTTTC	0.378																																					p.Q248L		.											.	SPHKAP	167	0			c.A743T						.						118.0	126.0	123.0					2																	228884827		2203	4300	6503	SO:0001583	missense	80309	exon7			TTTAGCTGTTTAC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.743A>T	2.37:g.228884827T>A	ENSP00000375909:p.Gln248Leu	134.0	0.0		177.0	52.0	NM_030623	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	T	9.850	1.193385	0.22037	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.12255	2.7;2.7	5.72	3.21	0.36854	.	0.358525	0.31347	N	0.007815	T	0.08223	0.0205	N	0.22421	0.69	0.24619	N	0.993687	B;P	0.35226	0.081;0.491	B;B	0.32465	0.021;0.146	T	0.22208	-1.0223	10	0.56958	D	0.05	.	6.2306	0.20732	0.141:0.0762:0.0:0.7828	.	248;248	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	L	248	ENSP00000375909:Q248L;ENSP00000339886:Q248L	ENSP00000339886:Q248L	Q	-	2	0	SPHKAP	228593071	0.474000	0.25886	0.640000	0.29408	0.167000	0.22549	0.339000	0.19875	0.379000	0.24794	0.533000	0.62120	CAG	.		0.378	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
TCIRG1	10312	broad.mit.edu;mdanderson.org	37	11	67811701	67811701	+	Silent	SNP	C	C	T			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr11:67811701C>T	ENST00000265686.3	+	9	1018	c.910C>T	c.(910-912)Ctg>Ttg	p.L304L	TCIRG1_ENST00000532635.1_Silent_p.L88L	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	304					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						GGCCGTGTACCTGGCCCTGAA	0.677																																					p.L304L		.											.	TCIRG1	227	0			c.C910T						.						34.0	32.0	33.0					11																	67811701		2193	4285	6478	SO:0001819	synonymous_variant	10312	exon9			GTGTACCTGGCCC	AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.910C>T	11.37:g.67811701C>T		15.0	0.0		8.0	2.0	NM_006019	O75877|Q8WVC5	Silent	SNP	ENST00000265686.3	37	CCDS8177.1	.	.	.	.	.	.	.	.	.	.	C	9.762	1.170378	0.21621	.	.	ENSG00000110719	ENST00000529364	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	T	0.73806	0.3634	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72626	-0.4236	4	.	.	.	-21.6558	17.5931	0.88003	0.0:1.0:0.0:0.0	.	.	.	.	L	137	.	.	P	+	2	0	TCIRG1	67568277	0.032000	0.19561	1.000000	0.80357	0.722000	0.41435	0.695000	0.25527	2.498000	0.84270	0.462000	0.41574	CCT	.		0.677	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394305.1	NM_006019	
TIAL1	7073	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	121342007	121342008	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr10:121342007_121342008delTG	ENST00000436547.2	-	3	235_236	c.191_192delCA	c.(190-192)gcafs	p.A64fs	TIAL1_ENST00000369093.2_Frame_Shift_Del_p.A81fs|TIAL1_ENST00000369092.4_5'UTR	NM_003252.3	NP_003243.1	Q01085	TIAR_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein-like 1	64	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|defense response (GO:0006952)|germ cell development (GO:0007281)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell division (GO:0017145)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	13		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)		TAGCAGCTAATGCAGCAGCTGC	0.371																																					p.81_81del		.											.	TIAL1	91	0			c.242_243del						.																																			SO:0001589	frameshift_variant	7073	exon3			AGCTAATGCAGCA	AL833106	CCDS7613.1, CCDS31295.1	10q	2013-02-12	2001-11-28		ENSG00000151923	ENSG00000151923		"""RNA binding motif (RRM) containing"""	11804	protein-coding gene	gene with protein product		603413	"""TIA1 cytotoxic granule-associated RNA-binding protein-like 1"""			1326761	Standard	XM_005270108		Approved	TIAR	uc001lej.1	Q01085	OTTHUMG00000019156	ENST00000436547.2:c.191_192delCA	10.37:g.121342007_121342008delTG	ENSP00000394902:p.Ala64fs	163.0	0.0		152.0	46.0	NM_001033925	A8K3T0|A8K4L9	Frame_Shift_Del	DEL	ENST00000436547.2	37	CCDS7613.1																																																																																			.		0.371	TIAL1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050672.2	NM_022333, NM_003252	
TIAL1	7073	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	121342010	121342010	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr10:121342010delA	ENST00000436547.2	-	3	233	c.189delT	c.(187-189)gctfs	p.A64fs	TIAL1_ENST00000369093.2_Frame_Shift_Del_p.A81fs|TIAL1_ENST00000369092.4_5'UTR	NM_003252.3	NP_003243.1	Q01085	TIAR_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein-like 1	64	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|defense response (GO:0006952)|germ cell development (GO:0007281)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell division (GO:0017145)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	13		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)		CAGCTAATGCAGCAGCTGCAT	0.383																																					p.A80fs		.											.	TIAL1	91	0			c.240delT						.						118.0	127.0	124.0					10																	121342010		2203	4300	6503	SO:0001589	frameshift_variant	7073	exon3			TAATGCAGCAGCT	AL833106	CCDS7613.1, CCDS31295.1	10q	2013-02-12	2001-11-28		ENSG00000151923	ENSG00000151923		"""RNA binding motif (RRM) containing"""	11804	protein-coding gene	gene with protein product		603413	"""TIA1 cytotoxic granule-associated RNA-binding protein-like 1"""			1326761	Standard	XM_005270108		Approved	TIAR	uc001lej.1	Q01085	OTTHUMG00000019156	ENST00000436547.2:c.189delT	10.37:g.121342010delA	ENSP00000394902:p.Ala64fs	163.0	0.0		153.0	46.0	NM_001033925	A8K3T0|A8K4L9	Frame_Shift_Del	DEL	ENST00000436547.2	37	CCDS7613.1																																																																																			.		0.383	TIAL1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050672.2	NM_022333, NM_003252	
TMEM132C	92293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	129190073	129190073	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr12:129190073C>T	ENST00000435159.2	+	9	2560	c.2560C>T	c.(2560-2562)Cga>Tga	p.R854*	TMEM132C_ENST00000537538.1_Nonsense_Mutation_p.R239*|TMEM132C_ENST00000315208.8_Nonsense_Mutation_p.R470*	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	854						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						AGGGGCTCTCCGAAGAGCCAC	0.657																																					p.R854X		.											.	TMEM132C	68	0			c.C2560T						.						17.0	23.0	21.0					12																	129190073		692	1591	2283	SO:0001587	stop_gained	92293	exon9			GCTCTCCGAAGAG	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2560C>T	12.37:g.129190073C>T	ENSP00000410852:p.Arg854*	37.0	0.0		27.0	9.0	NM_001136103	Q69YX8	Nonsense_Mutation	SNP	ENST00000435159.2	37		.	.	.	.	.	.	.	.	.	.	C	19.46	3.830941	0.71258	.	.	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	.	.	.	4.78	-0.697	0.11284	.	0.629156	0.13233	N	0.403485	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	1.0429	0.01563	0.163:0.3723:0.2164:0.2483	.	.	.	.	X	854;470;239	.	ENSP00000324458:R470X	R	+	1	2	TMEM132C	127756026	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.076000	0.14712	-0.508000	0.06540	-0.165000	0.13383	CGA	.		0.657	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_044062	
TMEM51	55092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	15541828	15541828	+	Missense_Mutation	SNP	G	G	A	rs529430855		TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr1:15541828G>A	ENST00000428417.1	+	2	691	c.245G>A	c.(244-246)tGc>tAc	p.C82Y	TMEM51_ENST00000434578.2_Missense_Mutation_p.C82Y|TMEM51_ENST00000376014.3_Missense_Mutation_p.C82Y|TMEM51_ENST00000400796.3_Missense_Mutation_p.C82Y|TMEM51_ENST00000376008.2_Missense_Mutation_p.C82Y	NM_001136217.1	NP_001129689.1	Q9NW97	TMM51_HUMAN	transmembrane protein 51	82						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(3)|large_intestine(2)|lung(5)|prostate(2)	14		Renal(390;0.00145)|Breast(348;0.00186)|Colorectal(325;0.00215)|all_lung(284;0.00459)|Lung NSC(340;0.0104)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;2.07e-06)|COAD - Colon adenocarcinoma(227;7.14e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000175)|KIRC - Kidney renal clear cell carcinoma(229;0.00141)|STAD - Stomach adenocarcinoma(313;0.00644)|READ - Rectum adenocarcinoma(331;0.0751)		CTTTCTATCTGCCTGAGTATC	0.632																																					p.C82Y		.											.	TMEM51	90	0			c.G245A						.						77.0	69.0	72.0					1																	15541828		2203	4300	6503	SO:0001583	missense	55092	exon2			CTATCTGCCTGAG	AK098467	CCDS154.1	1p36.21	2008-02-05	2005-05-22	2005-05-22	ENSG00000171729	ENSG00000171729			25488	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 72"""	C1orf72		12477932	Standard	NM_018022		Approved	FLJ10199	uc001avx.3	Q9NW97	OTTHUMG00000002046	ENST00000428417.1:c.245G>A	1.37:g.15541828G>A	ENSP00000394899:p.Cys82Tyr	41.0	0.0		36.0	11.0	NM_018022	A8K819	Missense_Mutation	SNP	ENST00000428417.1	37	CCDS154.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.163419	0.78226	.	.	ENSG00000171729	ENST00000428417;ENST00000376014;ENST00000451326;ENST00000434578;ENST00000400796;ENST00000376008;ENST00000303840	T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02	5.43	5.43	0.79202	.	0.042207	0.85682	D	0.000000	T	0.65491	0.2696	M	0.70275	2.135	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.987	T	0.68398	-0.5419	10	0.87932	D	0	-9.7527	18.2265	0.89918	0.0:0.0:1.0:0.0	.	82;82	Q9BSA0;Q9NW97	.;TMM51_HUMAN	Y	82	ENSP00000394899:C82Y;ENSP00000365182:C82Y;ENSP00000412298:C82Y;ENSP00000409665:C82Y;ENSP00000383600:C82Y;ENSP00000365176:C82Y	ENSP00000303666:C82Y	C	+	2	0	TMEM51	15414415	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.696000	0.68287	2.564000	0.86499	0.655000	0.94253	TGC	.		0.632	TMEM51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005699.3	NM_018022	
TUFT1	7286	broad.mit.edu;bcgsc.ca	37	1	151546769	151546769	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr1:151546769G>C	ENST00000368849.3	+	8	680	c.618G>C	c.(616-618)agG>agC	p.R206S	TUFT1_ENST00000353024.3_Missense_Mutation_p.R147S|TUFT1_ENST00000392712.3_Missense_Mutation_p.R151S|TUFT1_ENST00000368848.2_Missense_Mutation_p.R181S|TUFT1_ENST00000538902.1_Missense_Mutation_p.R225S	NM_020127.2	NP_064512.1	Q9NNX1	TUFT1_HUMAN	tuftelin 1	206					bone mineralization (GO:0030282)|odontogenesis (GO:0042476)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	structural constituent of tooth enamel (GO:0030345)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			GGTACCAGAGGGAAGCAGAAC	0.488											OREG0003906	type=REGULATORY REGION|Gene=TUFT1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.R206S		.											.	TUFT1	90	0			c.G618C						.						100.0	95.0	97.0					1																	151546769		2203	4300	6503	SO:0001583	missense	7286	exon8			CCAGAGGGAAGCA	AF254260	CCDS1000.1, CCDS44223.1	1q21	2008-02-05			ENSG00000143367	ENSG00000143367			12422	protein-coding gene	gene with protein product		600087				7919663	Standard	NM_020127		Approved		uc001eyl.3	Q9NNX1	OTTHUMG00000012536	ENST00000368849.3:c.618G>C	1.37:g.151546769G>C	ENSP00000357842:p.Arg206Ser	131.0	0.0	1741	143.0	9.0	NM_020127	B2RD57|D3DV21|D3DV22|Q5T384|Q5T385|Q9BU28|Q9H5L1	Missense_Mutation	SNP	ENST00000368849.3	37	CCDS1000.1	.	.	.	.	.	.	.	.	.	.	A	12.86	2.065220	0.36470	.	.	ENSG00000143367	ENST00000368849;ENST00000392712;ENST00000353024;ENST00000368848;ENST00000538902;ENST00000507671	T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09	5.01	1.37	0.22104	.	0.577475	0.19168	N	0.121005	T	0.59376	0.2189	L	0.57536	1.79	0.19575	N	0.999967	P;P;B	0.52061	0.95;0.76;0.438	P;P;B	0.45610	0.487;0.46;0.272	T	0.54050	-0.8351	10	0.41790	T	0.15	-3.125	8.3339	0.32202	0.5496:0.0:0.4504:0.0	.	225;181;206	F5H607;Q9NNX1-2;Q9NNX1	.;.;TUFT1_HUMAN	S	206;151;147;181;225;181	ENSP00000357842:R206S;ENSP00000376476:R151S;ENSP00000343781:R147S;ENSP00000357841:R181S;ENSP00000437997:R225S	ENSP00000343781:R147S	R	+	3	2	TUFT1	149813393	1.000000	0.71417	0.990000	0.47175	0.327000	0.28475	0.700000	0.25601	0.030000	0.15379	-0.254000	0.11334	AGG	.		0.488	TUFT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035022.1	NM_020127	
UMODL1	89766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	43529725	43529725	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr21:43529725T>A	ENST00000408910.2	+	10	1573	c.1573T>A	c.(1573-1575)Tgc>Agc	p.C525S	UMODL1_ENST00000408989.2_Missense_Mutation_p.C525S|C21orf128_ENST00000329015.2_5'Flank|UMODL1_ENST00000400427.1_Missense_Mutation_p.C453S|UMODL1_ENST00000400424.2_Missense_Mutation_p.C453S	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	525	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						GGCTGCCTGGTGCATCAACCT	0.642																																					p.C525S	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	.											.	UMODL1	93	0			c.T1573A						.						59.0	72.0	68.0					21																	43529725		2050	4178	6228	SO:0001583	missense	89766	exon10			GCCTGGTGCATCA		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1573T>A	21.37:g.43529725T>A	ENSP00000386147:p.Cys525Ser	24.0	0.0		14.0	8.0	NM_173568	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	T	14.00	2.403961	0.42613	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	D;D;D;D	0.99429	-5.75;-5.89;-5.75;-5.89	3.23	3.23	0.37069	EGF-like calcium-binding, conserved site (1);Epidermal growth factor-like (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.45126	D	0.000400	D	0.99582	0.9849	H	0.96430	3.82	0.51482	D	0.999929	D;D	0.89917	0.999;1.0	D;D	0.97110	0.999;1.0	D	0.98490	1.0609	10	0.87932	D	0	-25.068	8.2316	0.31601	0.0:0.0:0.0:1.0	.	525;525	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	S	453;453;525;525	ENSP00000383279:C453S;ENSP00000383276:C453S;ENSP00000386126:C525S;ENSP00000386147:C525S	ENSP00000383276:C453S	C	+	1	0	UMODL1	42402794	1.000000	0.71417	0.858000	0.33744	0.253000	0.25986	3.453000	0.52978	1.722000	0.51474	0.533000	0.62120	TGC	.		0.642	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		
USP38	84640	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	144135683	144135683	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr4:144135683T>C	ENST00000307017.4	+	9	3060	c.2554T>C	c.(2554-2556)Tcc>Ccc	p.S852P	USP38_ENST00000510377.1_Missense_Mutation_p.S852P	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	852	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					CTCTGGTATATCCTCTGAAAG	0.423																																					p.S852P		.											.	USP38	660	0			c.T2554C						.						100.0	93.0	96.0					4																	144135683		2203	4300	6503	SO:0001583	missense	84640	exon9			GGTATATCCTCTG	AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.2554T>C	4.37:g.144135683T>C	ENSP00000303434:p.Ser852Pro	103.0	0.0		133.0	6.0	NM_032557	B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Missense_Mutation	SNP	ENST00000307017.4	37	CCDS3758.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.070254	0.76301	.	.	ENSG00000170185	ENST00000510377;ENST00000307017	T;T	0.77750	-1.12;-1.12	5.48	5.48	0.80851	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.90106	0.6909	M	0.90483	3.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.92163	0.5737	10	0.87932	D	0	-9.3991	15.8623	0.79035	0.0:0.0:0.0:1.0	.	852;852	Q8NB14;Q3ZCV1	UBP38_HUMAN;.	P	852	ENSP00000427647:S852P;ENSP00000303434:S852P	ENSP00000303434:S852P	S	+	1	0	USP38	144355133	1.000000	0.71417	0.947000	0.38551	0.993000	0.82548	7.798000	0.85924	2.205000	0.71048	0.482000	0.46254	TCC	.		0.423	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364869.1	NM_032557	
USP38	84640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	144135888	144135888	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr4:144135888G>T	ENST00000307017.4	+	9	3265	c.2759G>T	c.(2758-2760)aGa>aTa	p.R920I	USP38_ENST00000510377.1_Missense_Mutation_p.R920I	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	920	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					AATGACAGTAGAGTGACATTT	0.348																																					p.R920I		.											.	USP38	660	0			c.G2759T						.						71.0	74.0	73.0					4																	144135888		2203	4300	6503	SO:0001583	missense	84640	exon9			ACAGTAGAGTGAC	AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.2759G>T	4.37:g.144135888G>T	ENSP00000303434:p.Arg920Ile	172.0	0.0		217.0	76.0	NM_032557	B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Missense_Mutation	SNP	ENST00000307017.4	37	CCDS3758.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.622055	0.87460	.	.	ENSG00000170185	ENST00000510377;ENST00000307017	T;T	0.32515	1.45;1.45	5.88	5.88	0.94601	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.53594	0.1806	L	0.50847	1.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.49790	-0.8902	10	0.66056	D	0.02	-10.7871	20.2187	0.98312	0.0:0.0:1.0:0.0	.	920;920	Q8NB14;Q3ZCV1	UBP38_HUMAN;.	I	920	ENSP00000427647:R920I;ENSP00000303434:R920I	ENSP00000303434:R920I	R	+	2	0	USP38	144355338	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.780000	0.95670	0.655000	0.94253	AGA	.		0.348	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364869.1	NM_032557	
ZNF234	10780	broad.mit.edu;bcgsc.ca	37	19	44660620	44660620	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr19:44660620G>T	ENST00000426739.2	+	6	709	c.451G>T	c.(451-453)Gat>Tat	p.D151Y	ZNF234_ENST00000592437.1_Missense_Mutation_p.D151Y	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	151					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				TTACCAATGTGATGAGTACAA	0.398																																					p.D151Y		.											.	.	.	0			c.G451T						.						60.0	64.0	63.0					19																	44660620		2187	4289	6476	SO:0001583	missense	10780	exon6			CAATGTGATGAGT	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.451G>T	19.37:g.44660620G>T	ENSP00000400878:p.Asp151Tyr	224.0	1.0		214.0	12.0	NM_006630	A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Missense_Mutation	SNP	ENST00000426739.2	37	CCDS46101.1	.	.	.	.	.	.	.	.	.	.	G	8.502	0.864451	0.17250	.	.	ENSG00000167380	ENST00000426739	T	0.30714	1.52	3.77	0.045	0.14228	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11110	0.0271	N	0.08118	0	0.09310	N	1	P	0.40875	0.731	B	0.34138	0.176	T	0.16012	-1.0417	9	0.72032	D	0.01	.	0.5408	0.00645	0.4409:0.1765:0.2109:0.1717	.	151	Q14588	ZN234_HUMAN	Y	151	ENSP00000400878:D151Y	ENSP00000400878:D151Y	D	+	1	0	ZNF226	49352460	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.120000	0.03273	-0.136000	0.11475	-1.512000	0.00943	GAT	.		0.398	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460586.2		
ZSWIM5	57643	broad.mit.edu;bcgsc.ca	37	1	45553672	45553672	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr1:45553672T>C	ENST00000359600.5	-	2	1038	c.833A>G	c.(832-834)gAc>gGc	p.D278G	ZSWIM5_ENST00000464588.1_5'Flank	NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5	278						extracellular space (GO:0005615)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					TTGTAGCTGGTCCCTATTCAT	0.443																																					p.D278G		.											.	ZSWIM5	22	0			c.A833G						.						165.0	153.0	157.0					1																	45553672		1877	4112	5989	SO:0001583	missense	57643	exon2			AGCTGGTCCCTAT	AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.833A>G	1.37:g.45553672T>C	ENSP00000352614:p.Asp278Gly	137.0	0.0		142.0	6.0	NM_020883	Q5SXQ9	Missense_Mutation	SNP	ENST00000359600.5	37	CCDS41319.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.631009	0.87660	.	.	ENSG00000162415	ENST00000359600	T	0.24538	1.85	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.52837	0.1759	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.60434	-0.7264	10	0.87932	D	0	-15.0615	14.7201	0.69300	0.0:0.0:0.0:1.0	.	278	Q9P217	ZSWM5_HUMAN	G	278	ENSP00000352614:D278G	ENSP00000352614:D278G	D	-	2	0	ZSWIM5	45326259	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.025000	0.59659	0.460000	0.39030	GAC	.		0.443	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024823.2	XM_046581	
MEX3B	84206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	82336764	82336765	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-G3-A3CH-01A-11D-A22F-10	TCGA-G3-A3CH-11A-11D-A22F-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f57d294a-3b16-45e5-a1ff-1eaae9229aee	cd23964a-9449-49ed-a1db-32a3dfb922bb	g.chr15:82336764_82336765GC>TT	ENST00000329713.4	-	2	881_882	c.446_447GC>AA	c.(445-447)gGC>gAA	p.G149E	AC026956.1_ENST00000410589.1_RNA|MEX3B_ENST00000558133.1_3'UTR	NM_032246.4	NP_115622.2	Q6ZN04	MEX3B_HUMAN	mex-3 RNA binding family member B	149					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)	19						CAGGCACCGCGCCGTTGAGTGC	0.658																																					p.G149E		.											.	.	.	0			.						.																																			SO:0001583	missense	84206	.			CACCGCGCCGTTG	AK131424	CCDS10319.1	15q25.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000183496	ENSG00000183496		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	25297	protein-coding gene	gene with protein product		611008	"""ring finger and KH domain containing 3"", ""mex-3 homolog B (C. elegans)"""	RKHD3		11230166, 17267406	Standard	NM_032246		Approved	DKFZp434J0617, RNF195	uc002bgq.2	Q6ZN04	OTTHUMG00000147356	ENST00000329713.4:c.446_447delinsTT	15.37:g.82336764_82336765delinsTT	ENSP00000329918:p.Gly149Glu	60.0	0.0		30.0	17.0	.	Q4G0W1|Q8IVG2|Q9H0J0	Missense_Mutation	DNP	ENST00000329713.4	37	CCDS10319.1																																																																																			.		0.658	MEX3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304000.1	XM_290645	
