#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACTN3	89	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66322635	66322635	+	RNA	SNP	C	C	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr11:66322635C>A	ENST00000502692.1	+	0	837				ACTN3_ENST00000513398.1_RNA	NM_001258371.1	NP_001245300.1	Q08043	ACTN3_HUMAN	actinin, alpha 3 (gene/pseudogene)						focal adhesion assembly (GO:0048041)|muscle filament sliding (GO:0030049)|regulation of apoptotic process (GO:0042981)	actin filament (GO:0005884)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(2)	10						TGCCCTCATCCACCGACACCG	0.657																																					.		.											.	ACTN3	90	0			.						.						58.0	64.0	62.0					11																	66322635		2197	4294	6491			89	.			CTCATCCACCGAC	M86407		11q13.2	2013-10-02	2012-10-05		ENSG00000248746	ENSG00000248746			165	protein-coding gene	gene with protein product		102574	"""actinin, alpha 3"""			1339456	Standard	NM_001104		Approved		uc031qbp.1	Q08043	OTTHUMG00000160815		11.37:g.66322635C>A		134.0	0.0		115.0	27.0	.	A6NP77|Q4KKV2	RNA	SNP	ENST00000502692.1	37																																																																																				.		0.657	ACTN3-003	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000362465.1	NM_001104	
ACVR2A	92	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	148680560	148680560	+	Missense_Mutation	SNP	A	A	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr2:148680560A>G	ENST00000241416.7	+	9	1732	c.1096A>G	c.(1096-1098)Atg>Gtg	p.M366V	ACVR2A_ENST00000404590.1_Missense_Mutation_p.M366V|ACVR2A_ENST00000535787.1_Missense_Mutation_p.M258V	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	366	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		CCGGAGGTACATGGCTCCAGA	0.383																																					p.M366V		.											.	ACVR2A	831	0			c.A1096G						.						172.0	176.0	174.0					2																	148680560		2203	4300	6503	SO:0001583	missense	92	exon9			AGGTACATGGCTC		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1096A>G	2.37:g.148680560A>G	ENSP00000241416:p.Met366Val	168.0	0.0		97.0	38.0	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Missense_Mutation	SNP	ENST00000241416.7	37	CCDS33301.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.432475	0.83776	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	D;D;D	0.94232	-3.38;-3.38;-3.38	5.65	5.65	0.86999	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96513	0.8862	M	0.79258	2.445	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.96984	0.9717	10	0.87932	D	0	.	16.0399	0.80667	1.0:0.0:0.0:0.0	.	366	P27037	AVR2A_HUMAN	V	366;258;366	ENSP00000241416:M366V;ENSP00000439988:M258V;ENSP00000384338:M366V	ENSP00000241416:M366V	M	+	1	0	ACVR2A	148397030	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.113000	0.94321	2.371000	0.80710	0.533000	0.62120	ATG	.		0.383	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
ADAM8	101	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	135082352	135082352	+	Missense_Mutation	SNP	G	G	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr10:135082352G>A	ENST00000445355.3	-	19	2013	c.1963C>T	c.(1963-1965)Ccc>Tcc	p.P655S	ADAM8_ENST00000415217.3_Intron|ADAM8_ENST00000485491.2_Missense_Mutation_p.P590S	NM_001109.4	NP_001100.3	P78325	ADAM8_HUMAN	ADAM metallopeptidase domain 8	655					activation of MAPK activity involved in innate immune response (GO:0035419)|angiogenesis (GO:0001525)|cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|leukocyte migration involved in inflammatory response (GO:0002523)|lymphocyte chemotaxis (GO:0048247)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell adhesion (GO:0045785)|positive regulation of eosinophil migration (GO:2000418)|positive regulation of fibronectin-dependent thymocyte migration (GO:2000415)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of neutrophil extravasation (GO:2000391)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein processing (GO:0010954)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|regulation of cell-cell adhesion (GO:0022407)|single organismal cell-cell adhesion (GO:0016337)	alpha9-beta1 integrin-ADAM8 complex (GO:0071133)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dense core granule membrane (GO:0032127)|integral component of plasma membrane (GO:0005887)|phagolysosome (GO:0032010)|plasma membrane (GO:0005886)|podosome (GO:0002102)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein self-association (GO:0043621)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)	17		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;7.72e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.23e-06)|Epithelial(32;1.02e-05)		ACGAAGACGGGGAGGCTCCCG	0.657																																					p.P655S		.											.	ADAM8	90	0			c.C1963T						.						68.0	54.0	59.0					10																	135082352		2201	4298	6499	SO:0001583	missense	101	exon19			AGACGGGGAGGCT	D26579	CCDS31319.2, CCDS58102.1, CCDS58103.1	10q26.3	2014-03-20	2005-08-18		ENSG00000151651	ENSG00000151651		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	215	protein-coding gene	gene with protein product		602267	"""a disintegrin and metalloproteinase domain 8"""			9126482	Standard	NM_001109		Approved	CD156, MS2, CD156a	uc021qbe.1	P78325	OTTHUMG00000019309	ENST00000445355.3:c.1963C>T	10.37:g.135082352G>A	ENSP00000453302:p.Pro655Ser	69.0	1.0		72.0	25.0	NM_001109	B4DVM6|H0YL36|H0YLR0|H0YN39	Missense_Mutation	SNP	ENST00000445355.3	37	CCDS31319.2																																																																																			.		0.657	ADAM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051118.4	NM_001109	
AIFM1	9131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	129264035	129264035	+	Silent	SNP	G	G	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chrX:129264035G>A	ENST00000287295.3	-	15	1910	c.1680C>T	c.(1678-1680)taC>taT	p.Y560Y	AIFM1_ENST00000319908.3_Silent_p.Y556Y|AIFM1_ENST00000535724.1_3'UTR|AIFM1_ENST00000346424.2_Silent_p.Y273Y|AIFM1_ENST00000460436.2_Silent_p.Y221Y|AIFM1_ENST00000440263.1_Silent_p.Y208Y	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	560					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	CACCTTTGCCGTAGTCCTCCC	0.537																																					p.Y560Y		.											.	AIFM1	586	0			c.C1680T						.						177.0	165.0	169.0					X																	129264035		2203	4300	6503	SO:0001819	synonymous_variant	9131	exon15			TTTGCCGTAGTCC	AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.1680C>T	X.37:g.129264035G>A		229.0	0.0		251.0	33.0	NM_004208	A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Silent	SNP	ENST00000287295.3	37	CCDS14618.1																																																																																			.		0.537	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058247.2		
ANKRD24	170961	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	4219685	4219685	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:4219685C>T	ENST00000600132.1	+	19	3377	c.3101C>T	c.(3100-3102)gCg>gTg	p.A1034V	ANKRD24_ENST00000318934.4_Missense_Mutation_p.A1034V|ANKRD24_ENST00000262970.5_Missense_Mutation_p.A1124V	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	1034										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		CGGACCGAGGCGGAAAGGGCT	0.662																																					p.A1034V		.											.	ANKRD24	68	0			c.C3101T						.						40.0	49.0	46.0					19																	4219685		2101	4229	6330	SO:0001583	missense	170961	exon19			CCGAGGCGGAAAG	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.3101C>T	19.37:g.4219685C>T	ENSP00000471252:p.Ala1034Val	148.0	0.0		122.0	38.0	NM_133475	O75268|O95781	Missense_Mutation	SNP	ENST00000600132.1	37	CCDS45925.1	.	.	.	.	.	.	.	.	.	.	c	13.45	2.240513	0.39598	.	.	ENSG00000089847	ENST00000318934;ENST00000262970	T;T	0.32753	1.45;1.44	3.79	3.79	0.43588	.	.	.	.	.	T	0.33614	0.0869	N	0.24115	0.695	0.29081	N	0.882692	D	0.76494	0.999	P	0.61003	0.882	T	0.05852	-1.0860	9	0.17369	T	0.5	.	11.8657	0.52493	0.0:1.0:0.0:0.0	.	1034	Q8TF21	ANR24_HUMAN	V	1034;1124	ENSP00000321731:A1034V;ENSP00000262970:A1124V	ENSP00000262970:A1124V	A	+	2	0	ANKRD24	4170685	0.996000	0.38824	0.889000	0.34880	0.412000	0.31113	3.435000	0.52849	2.080000	0.62538	0.313000	0.20887	GCG	.		0.662	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
ANO5	203859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	22272304	22272304	+	Missense_Mutation	SNP	C	C	A	rs541372136	byFrequency	TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr11:22272304C>A	ENST00000324559.8	+	11	1348	c.1031C>A	c.(1030-1032)cCt>cAt	p.P344H		NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	344					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ATCTGTGACCCTGAGATTGGT	0.398																																					p.P344H		.											.	ANO5	515	0			c.C1031A						.						229.0	184.0	199.0					11																	22272304		2203	4300	6503	SO:0001583	missense	203859	exon11			GTGACCCTGAGAT	AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.1031C>A	11.37:g.22272304C>A	ENSP00000315371:p.Pro344His	155.0	0.0		123.0	41.0	NM_213599		Missense_Mutation	SNP	ENST00000324559.8	37	CCDS31444.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.157899	0.57368	.	.	ENSG00000171714	ENST00000324559	T	0.71698	-0.59	5.49	3.48	0.39840	.	0.436137	0.25780	N	0.028351	T	0.79411	0.4441	M	0.64997	1.995	0.31533	N	0.660977	D	0.65815	0.995	D	0.67900	0.954	T	0.79072	-0.1953	10	0.45353	T	0.12	.	13.1544	0.59509	0.1302:0.7549:0.1149:0.0	.	344	Q75V66	ANO5_HUMAN	H	344	ENSP00000315371:P344H	ENSP00000315371:P344H	P	+	2	0	ANO5	22228880	0.742000	0.28228	0.996000	0.52242	0.932000	0.56968	1.685000	0.37659	2.565000	0.86533	0.557000	0.71058	CCT	.		0.398	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387615.1	NM_213599	
ARRB1	408	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	74980004	74980004	+	Splice_Site	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr11:74980004C>T	ENST00000420843.2	-	14	1120		c.e14-1		ARRB1_ENST00000393505.4_Missense_Mutation_p.S341N|ARRB1_ENST00000360025.3_Splice_Site	NM_004041.4	NP_004032.2	P49407	ARRB1_HUMAN	arrestin, beta 1						activation of MAPK activity (GO:0000187)|apoptotic DNA fragmentation (GO:0006309)|blood coagulation (GO:0007596)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor internalization (GO:0002031)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of GTPase activity (GO:0034260)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein ubiquitination (GO:0031397)|Notch signaling pathway (GO:0007219)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of GTPase activity (GO:0043547)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H4 acetylation (GO:0090240)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-Golgi vesicle-mediated transport (GO:0006892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)|transcription from RNA polymerase II promoter (GO:0006366)	basolateral plasma membrane (GO:0016323)|chromatin (GO:0000785)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|pseudopodium (GO:0031143)	angiotensin receptor binding (GO:0031701)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|enzyme inhibitor activity (GO:0004857)|GTPase activator activity (GO:0005096)|insulin-like growth factor receptor binding (GO:0005159)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|large_intestine(2)|lung(4)|prostate(1)	11						GGCCACGTCGCTGAAACAGAG	0.587																																					.		.											.	ARRB1	567	0			c.1023-1G>A						.						101.0	94.0	96.0					11																	74980004		2200	4293	6493	SO:0001630	splice_region_variant	408	exon15			ACGTCGCTGAAAC	BC003636	CCDS31640.1, CCDS44684.1	11q13	2008-12-11			ENSG00000137486	ENSG00000137486			711	protein-coding gene	gene with protein product	"""arrestin 2"""	107940		ARR1		8486659	Standard	NM_004041		Approved		uc001owe.2	P49407	OTTHUMG00000165444	ENST00000420843.2:c.1023-1G>A	11.37:g.74980004C>T		131.0	0.0		82.0	25.0	NM_004041	B6V9G8|O75625|O75630|Q2PP20|Q9BTK8	Splice_Site	SNP	ENST00000420843.2	37	CCDS44684.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.92|17.92	3.506193|3.506193	0.64410|0.64410	.|.	.|.	ENSG00000137486|ENSG00000137486	ENST00000420843;ENST00000360025;ENST00000532447|ENST00000393505	.|T	.|0.18016	.|2.24	4.36|4.36	4.36|4.36	0.52297|0.52297	.|.	.|59.833200	.|0.00397	.|U	.|0.000058	.|T	.|0.30166	.|0.0756	.|.	.|.	.|.	0.47276|0.47276	D|D	0.999374|0.999374	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.02546	.|-1.1143	.|6	.|.	.|.	.|.	.|.	14.4868|14.4868	0.67622|0.67622	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	.|N	-1|341	.|ENSP00000377141:S341N	.|.	.|S	-|-	.|2	.|0	ARRB1|ARRB1	74657652|74657652	1.000000|1.000000	0.71417|0.71417	0.925000|0.925000	0.36789|0.36789	0.648000|0.648000	0.38561|0.38561	6.975000|6.975000	0.76128|0.76128	2.281000|2.281000	0.76405|0.76405	0.555000|0.555000	0.69702|0.69702	.|AGC	.		0.587	ARRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384092.3	NM_004041	Intron
ASPM	259266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	197111554	197111554	+	Missense_Mutation	SNP	T	T	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:197111554T>C	ENST00000367409.4	-	3	2084	c.1828A>G	c.(1828-1830)Aaa>Gaa	p.K610E	ASPM_ENST00000294732.7_Missense_Mutation_p.K610E	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	610					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						GCTGATGTTTTAGGCTCTGAG	0.383																																					p.K610E		.											.	ASPM	615	0			c.A1828G						.						199.0	211.0	207.0					1																	197111554		2203	4300	6503	SO:0001583	missense	259266	exon3			ATGTTTTAGGCTC	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.1828A>G	1.37:g.197111554T>C	ENSP00000356379:p.Lys610Glu	92.0	0.0		93.0	27.0	NM_001206846	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	T	7.881	0.730257	0.15507	.	.	ENSG00000066279	ENST00000367409;ENST00000294732	T;T	0.57907	0.37;1.64	5.65	3.3	0.37823	.	0.601453	0.17303	N	0.179187	T	0.37865	0.1019	L	0.38175	1.15	0.09310	N	1	B;B	0.10296	0.003;0.0	B;B	0.08055	0.003;0.0	T	0.22556	-1.0213	10	0.33940	T	0.23	.	5.7189	0.17976	0.0:0.1416:0.2682:0.5903	.	610;610	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	E	610	ENSP00000356379:K610E;ENSP00000294732:K610E	ENSP00000294732:K610E	K	-	1	0	ASPM	195378177	0.004000	0.15560	0.160000	0.22671	0.131000	0.20780	0.374000	0.20501	0.483000	0.27608	0.523000	0.50628	AAA	.		0.383	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
ATP10B	23120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	160113232	160113232	+	Silent	SNP	G	G	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr5:160113232G>A	ENST00000327245.5	-	6	1170	c.324C>T	c.(322-324)ccC>ccT	p.P108P	CTC-529G1.1_ENST00000524198.1_RNA|ATP10B_ENST00000518411.1_5'UTR	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	108					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTTCCATGGAGGGCATCCAGT	0.458																																					p.P108P		.											.	ATP10B	72	0			c.C324T						.						77.0	74.0	75.0					5																	160113232		1904	4120	6024	SO:0001819	synonymous_variant	23120	exon6			CATGGAGGGCATC	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.324C>T	5.37:g.160113232G>A		154.0	0.0		145.0	40.0	NM_025153	Q9H725	Silent	SNP	ENST00000327245.5	37	CCDS43394.1																																																																																			.		0.458	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
ATXN1	6310	hgsc.bcm.edu;bcgsc.ca	37	6	16327891	16327891	+	Missense_Mutation	SNP	C	C	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr6:16327891C>A	ENST00000244769.4	-	8	1587	c.651G>T	c.(649-651)caG>caT	p.Q217H	ATXN1_ENST00000436367.1_Missense_Mutation_p.Q217H	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	217	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.Q217H(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgctgctgctgctgctgct	0.657																																					p.Q217H		.											.	ATXN1	93	1	Substitution - Missense(1)	lung(1)	c.G651T						.																																			SO:0001583	missense	6310	exon7			CTGCTGCTGCTGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.651G>T	6.37:g.16327891C>A	ENSP00000244769:p.Gln217His	78.0	0.0		99.0	12.0	NM_001128164	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	-	6.133	0.392825	0.11638	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.63913	-0.07;-0.07	0.753	-0.262	0.12958	.	.	.	.	.	T	0.14657	0.0354	N	0.08118	0	0.09310	N	1	B	0.28713	0.22	B	0.17979	0.02	T	0.12344	-1.0551	9	0.54805	T	0.06	.	3.1001	0.06323	0.0:0.6446:0.0:0.3554	.	217	P54253	ATX1_HUMAN	H	217	ENSP00000244769:Q217H;ENSP00000416360:Q217H	ENSP00000244769:Q217H	Q	-	3	2	ATXN1	16435870	0.069000	0.21087	0.004000	0.12327	0.137000	0.21094	0.232000	0.17891	-0.113000	0.11958	0.121000	0.15741	CAG	.		0.657	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
B4GALNT2	124872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	47246920	47246920	+	Missense_Mutation	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr17:47246920G>T	ENST00000300404.2	+	11	1590	c.1531G>T	c.(1531-1533)Ggg>Tgg	p.G511W	RP11-708H21.4_ENST00000575159.1_lincRNA|B4GALNT2_ENST00000504681.1_Missense_Mutation_p.G425W|B4GALNT2_ENST00000393354.2_Missense_Mutation_p.G451W	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	511					lipid glycosylation (GO:0030259)|negative regulation of cell-cell adhesion (GO:0022408)|protein glycosylation (GO:0006486)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)			endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)			CCTACTCGTGGGGTCATGCCC	0.522																																					p.G511W	GBM(124;244 1635 8663 18097 33175)	.											.	B4GALNT2	154	0			c.G1531T						.						87.0	88.0	88.0					17																	47246920		2203	4300	6503	SO:0001583	missense	124872	exon11			CTCGTGGGGTCAT	AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	2.4.1.-	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2		8782649, 12678917	Standard	NM_153446		Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000300404.2:c.1531G>T	17.37:g.47246920G>T	ENSP00000300404:p.Gly511Trp	53.0	0.0		69.0	26.0	NM_153446	B4DZE4|Q14CP1|Q86Y40	Missense_Mutation	SNP	ENST00000300404.2	37	CCDS11544.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.133884	0.77662	.	.	ENSG00000167080	ENST00000504681;ENST00000393354;ENST00000300404	T;T;T	0.25085	1.82;1.82;1.82	5.79	5.79	0.91817	.	0.069689	0.56097	D	0.000030	T	0.53302	0.1788	M	0.72894	2.215	0.58432	D	0.99999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.53114	-0.8484	10	0.87932	D	0	-24.8208	18.7973	0.91999	0.0:0.0:1.0:0.0	.	451;511	Q8NHY0-2;Q8NHY0	.;B4GN2_HUMAN	W	425;451;511	ENSP00000425510:G425W;ENSP00000377022:G451W;ENSP00000300404:G511W	ENSP00000300404:G511W	G	+	1	0	B4GALNT2	44601919	1.000000	0.71417	1.000000	0.80357	0.510000	0.34073	8.151000	0.89636	2.745000	0.94114	0.561000	0.74099	GGG	.		0.522	B4GALNT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364477.1	NM_153446	
BHLHE23	128408	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	20	61637464	61637464	+	Silent	SNP	G	G	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr20:61637464G>A	ENST00000370346.2	-	1	923	c.615C>T	c.(613-615)gaC>gaT	p.D205D		NM_080606.3	NP_542173	Q8NDY6	BHE23_HUMAN	basic helix-loop-helix family, member e23	205					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)	1						CGGCGCACTTGTCAGGGCAGG	0.746																																					p.D205D		.											.	BHLHE23	90	0			c.C615T						.						4.0	5.0	5.0					20																	61637464		2054	4053	6107	SO:0001819	synonymous_variant	128408	exon1			GCACTTGTCAGGG	AL121673	CCDS33507.1, CCDS33507.2	20q13.33	2009-01-12	2009-01-12	2009-01-12	ENSG00000125533	ENSG00000125533		"""Basic helix-loop-helix proteins"""	16093	protein-coding gene	gene with protein product		609331	"""basic helix-loop-helix domain containing, class B, 4"""	BHLHB4		11863370, 18557763	Standard	NM_080606		Approved	bA305P22.3, Beta4, bHLHe23	uc002yeb.2	Q8NDY6	OTTHUMG00000032948	ENST00000370346.2:c.615C>T	20.37:g.61637464G>A		20.0	0.0		23.0	9.0	NM_080606	B2RP69	Silent	SNP	ENST00000370346.2	37	CCDS33507.1																																																																																			.		0.746	BHLHE23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080095.2	NM_080606	
BPIFC	254240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	32829728	32829728	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr22:32829728C>T	ENST00000397452.1	-	10	1066	c.956G>A	c.(955-957)gGc>gAc	p.G319D	BPIFC_ENST00000534972.1_Missense_Mutation_p.G43D|BPIFC_ENST00000432451.2_Missense_Mutation_p.G133D|BPIFC_ENST00000300399.3_Missense_Mutation_p.G319D			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	319						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)										GTTGCCAAGGCCTTGAGAGTT	0.423																																					p.G319D		.											.	.	.	0			c.G956A						.						102.0	94.0	96.0					22																	32829728		2203	4300	6503	SO:0001583	missense	254240	exon9			CCAAGGCCTTGAG	AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.956G>A	22.37:g.32829728C>T	ENSP00000380594:p.Gly319Asp	159.0	0.0		115.0	33.0	NM_174932	A2RRF1	Missense_Mutation	SNP	ENST00000397452.1	37	CCDS13906.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624992	0.66901	.	.	ENSG00000184459	ENST00000397452;ENST00000300399;ENST00000534972;ENST00000432451	T;T;T;T	0.08546	3.08;3.08;3.08;3.08	5.75	3.66	0.41972	.	0.349682	0.31519	N	0.007517	T	0.16428	0.0395	M	0.80028	2.48	0.34587	D	0.715106	P;P	0.48589	0.912;0.89	P;P	0.49829	0.623;0.543	T	0.18681	-1.0329	10	0.33940	T	0.23	-9.9352	7.2304	0.26038	0.0:0.7386:0.1728:0.0886	.	133;319	A2RRF1;Q8NFQ6	.;BPIFC_HUMAN	D	319;319;43;133	ENSP00000380594:G319D;ENSP00000300399:G319D;ENSP00000439123:G43D;ENSP00000408920:G133D	ENSP00000300399:G319D	G	-	2	0	BPIFC	31159728	0.627000	0.27129	0.884000	0.34674	0.987000	0.75469	0.807000	0.27140	1.422000	0.47177	0.655000	0.94253	GGC	.		0.423	BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129029.2	NM_174932	
C15orf26	161502	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	81426689	81426689	+	Missense_Mutation	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr15:81426689G>T	ENST00000286732.4	+	1	102	c.19G>T	c.(19-21)Ggt>Tgt	p.G7C		NM_173528.2	NP_775799.2	Q6P656	CO026_HUMAN	chromosome 15 open reading frame 26	7										endometrium(1)|kidney(4)|large_intestine(5)|lung(6)|skin(1)	17						GAACGTGTATGGTCCGGGAGT	0.647																																					p.G7C		.											.	C15orf26	90	0			c.G19T						.						62.0	79.0	73.0					15																	81426689		2106	4230	6336	SO:0001583	missense	161502	exon1			GTGTATGGTCCGG	AK095934	CCDS42068.1	15q25.1	2012-09-10			ENSG00000156206	ENSG00000156206			26782	protein-coding gene	gene with protein product						14702039	Standard	NM_173528		Approved	FLJ38615	uc002bgb.3	Q6P656	OTTHUMG00000172263	ENST00000286732.4:c.19G>T	15.37:g.81426689G>T	ENSP00000286732:p.Gly7Cys	203.0	0.0		215.0	40.0	NM_173528	Q8N906	Missense_Mutation	SNP	ENST00000286732.4	37	CCDS42068.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.591664	0.46214	.	.	ENSG00000156206	ENST00000286732	T	0.43294	0.95	4.85	-2.1	0.07210	.	0.996921	0.08133	N	0.992829	T	0.30386	0.0763	L	0.50333	1.59	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.37865	-0.9687	10	0.49607	T	0.09	-1.2937	0.8554	0.01181	0.4126:0.1283:0.2204:0.2387	.	7	Q6P656	CO026_HUMAN	C	7	ENSP00000286732:G7C	ENSP00000286732:G7C	G	+	1	0	C15orf26	79213744	0.013000	0.17824	0.001000	0.08648	0.004000	0.04260	0.152000	0.16302	-0.217000	0.10033	-0.150000	0.13652	GGT	.		0.647	C15orf26-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417587.1	NM_173528	
C7orf55	154791	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	139026139	139026139	+	Silent	SNP	C	C	T	rs530614678		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr7:139026139C>T	ENST00000297534.6	+	1	262	c.9C>T	c.(7-9)gcC>gcT	p.A3A	C7orf55-LUC7L2_ENST00000541170.3_Intron|LUC7L2_ENST00000541515.3_Silent_p.A3A|C7orf55_ENST00000481123.1_Intron	NM_197964.4	NP_932068.2	Q96HJ9	CG055_HUMAN	chromosome 7 open reading frame 55	3						mitochondrion (GO:0005739)				breast(1)|lung(2)	3						CAATGGCGGCCTTAGGGTCCC	0.662											OREG0018357	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0	0.0	5008	,	,		15350	0.0		0.001	False		,,,				2504	0.0				p.A3A		.											.	.	.	0			c.C9T						.						53.0	62.0	59.0					7																	139026139		2203	4300	6503	SO:0001819	synonymous_variant	100996928	exon1			GGCGGCCTTAGGG	AF161386	CCDS5853.1	7q34	2009-01-22	2009-01-22	2009-01-22	ENSG00000164898	ENSG00000164898			26946	protein-coding gene	gene with protein product	"""formation of mitochondrial complexes 1 homolog (S. cerevisiae)"""					12477932	Standard	NM_197964		Approved	HSPC268, FMC1		Q96HJ9	OTTHUMG00000151719	ENST00000297534.6:c.9C>T	7.37:g.139026139C>T		61.0	0.0	1645	54.0	20.0	NM_001244584	B7Z4Q3|Q75M90|Q9P0B3	Silent	SNP	ENST00000297534.6	37	CCDS5853.1																																																																																			.		0.662	C7orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323626.1	NM_197964	
CACNG2	10369	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	36960750	36960750	+	Missense_Mutation	SNP	T	T	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr22:36960750T>A	ENST00000300105.6	-	4	1601	c.620A>T	c.(619-621)cAg>cTg	p.Q207L	RP5-1119A7.17_ENST00000562756.1_RNA	NM_006078.3	NP_006069.1	Q9Y698	CCG2_HUMAN	calcium channel, voltage-dependent, gamma subunit 2	207					membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|neuromuscular junction development (GO:0007528)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	18						GGCCCGCAGCTGTTTGTGCCG	0.657																																					p.Q207L		.											.	CACNG2	90	0			c.A620T						.						93.0	109.0	103.0					22																	36960750		2203	4300	6503	SO:0001583	missense	10369	exon4			CGCAGCTGTTTGT	AF096322	CCDS13931.1	22q13.1	2006-08-01			ENSG00000166862	ENSG00000166862		"""Calcium channel subunits"""	1406	protein-coding gene	gene with protein product		602911					Standard	NM_006078		Approved	stargazin, MGC138502, MGC138504	uc003aps.2	Q9Y698	OTTHUMG00000030612	ENST00000300105.6:c.620A>T	22.37:g.36960750T>A	ENSP00000300105:p.Gln207Leu	105.0	0.0		65.0	5.0	NM_006078	Q2M1M1|Q5TGT3|Q9UGZ7	Missense_Mutation	SNP	ENST00000300105.6	37	CCDS13931.1	.	.	.	.	.	.	.	.	.	.	T	17.76	3.468640	0.63625	.	.	ENSG00000166862	ENST00000300105	T	0.37752	1.18	5.62	5.62	0.85841	.	0.119730	0.64402	D	0.000017	T	0.35913	0.0948	L	0.46157	1.445	0.80722	D	1	B	0.23058	0.079	B	0.21546	0.035	T	0.16305	-1.0407	10	0.87932	D	0	-11.2082	15.799	0.78436	0.0:0.0:0.0:1.0	.	207	Q9Y698	CCG2_HUMAN	L	207	ENSP00000300105:Q207L	ENSP00000300105:Q207L	Q	-	2	0	CACNG2	35290696	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.662000	0.83803	2.145000	0.66743	0.533000	0.62120	CAG	.		0.657	CACNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075500.2		
CACNG2	10369	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	36960792	36960792	+	Missense_Mutation	SNP	A	A	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr22:36960792A>G	ENST00000300105.6	-	4	1559	c.578T>C	c.(577-579)gTc>gCc	p.V193A	RP5-1119A7.17_ENST00000562756.1_RNA	NM_006078.3	NP_006069.1	Q9Y698	CCG2_HUMAN	calcium channel, voltage-dependent, gamma subunit 2	193					membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|neuromuscular junction development (GO:0007528)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	18						CAGCACCCCGACCATCTCGGC	0.607																																					p.V193A		.											.	CACNG2	90	0			c.T578C						.						118.0	135.0	129.0					22																	36960792		2203	4300	6503	SO:0001583	missense	10369	exon4			ACCCCGACCATCT	AF096322	CCDS13931.1	22q13.1	2006-08-01			ENSG00000166862	ENSG00000166862		"""Calcium channel subunits"""	1406	protein-coding gene	gene with protein product		602911					Standard	NM_006078		Approved	stargazin, MGC138502, MGC138504	uc003aps.2	Q9Y698	OTTHUMG00000030612	ENST00000300105.6:c.578T>C	22.37:g.36960792A>G	ENSP00000300105:p.Val193Ala	123.0	0.0		80.0	7.0	NM_006078	Q2M1M1|Q5TGT3|Q9UGZ7	Missense_Mutation	SNP	ENST00000300105.6	37	CCDS13931.1	.	.	.	.	.	.	.	.	.	.	A	13.37	2.215750	0.39102	.	.	ENSG00000166862	ENST00000300105	D	0.88896	-2.44	5.62	3.48	0.39840	.	0.000000	0.85682	D	0.000000	D	0.84483	0.5482	L	0.48260	1.515	0.58432	D	0.999998	P	0.42757	0.789	B	0.44224	0.444	T	0.77138	-0.2698	10	0.19147	T	0.46	-31.4349	8.4167	0.32676	0.7992:0.1323:0.0685:0.0	.	193	Q9Y698	CCG2_HUMAN	A	193	ENSP00000300105:V193A	ENSP00000300105:V193A	V	-	2	0	CACNG2	35290738	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.919000	0.92770	0.409000	0.25649	-0.316000	0.08728	GTC	.		0.607	CACNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075500.2		
CALCR	799	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	93055779	93055779	+	Silent	SNP	G	G	A	rs145853724		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr7:93055779G>A	ENST00000394441.1	-	13	1629	c.1314C>T	c.(1312-1314)atC>atT	p.I438I	CALCR_ENST00000359558.2_Silent_p.I472I|CALCR_ENST00000421592.1_Silent_p.I454I|CALCR_ENST00000426151.1_Silent_p.I438I|CALCR_ENST00000360249.4_Silent_p.I454I	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	472					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	TGTAAATTGGGATGTCGCCAG	0.557																																					p.I472I		.											.	CALCR	664	0			c.C1416T						.	G	,,	0,4406		0,0,2203	125.0	123.0	124.0		1416,1314,1314	2.1	0.0	7	dbSNP_134	124	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	CALCR	NM_001164737.1,NM_001164738.1,NM_001742.3	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	472/509,438/475,438/475	93055779	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	799	exon16			AATTGGGATGTCG	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.1314C>T	7.37:g.93055779G>A		128.0	0.0		93.0	6.0	NM_001164737	A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Silent	SNP	ENST00000394441.1	37	CCDS5631.1																																																																																			G|1.000;A|0.000		0.557	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742	
CASZ1	54897	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	10713785	10713785	+	Missense_Mutation	SNP	G	G	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:10713785G>A	ENST00000377022.3	-	11	2646	c.2329C>T	c.(2329-2331)Ccc>Tcc	p.P777S	RP4-734G22.3_ENST00000606802.1_RNA|CASZ1_ENST00000344008.5_Missense_Mutation_p.P777S	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	777					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		AGGCCCTGGGGCAGCAGCCCC	0.706																																					p.P777S		.											.	CASZ1	113	0			c.C2329T						.						29.0	38.0	35.0					1																	10713785		2190	4296	6486	SO:0001583	missense	54897	exon11			CCTGGGGCAGCAG	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.2329C>T	1.37:g.10713785G>A	ENSP00000366221:p.Pro777Ser	86.0	0.0		56.0	14.0	NM_001079843	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	ENST00000377022.3	37	CCDS41246.1	.	.	.	.	.	.	.	.	.	.	G	2.369	-0.344827	0.05208	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	4.83	1.48	0.22813	.	0.388541	0.32273	N	0.006338	T	0.12050	0.0293	N	0.00347	-1.61	0.42382	D	0.992497	B;B;B	0.11235	0.004;0.0;0.0	B;B;B	0.09377	0.004;0.001;0.001	T	0.07790	-1.0754	9	0.12766	T	0.61	-13.782	7.5763	0.27937	0.1715:0.5908:0.2377:0.0	.	801;777;777	B7Z1S3;Q86V15-2;Q86V15	.;.;CASZ1_HUMAN	S	777	.	ENSP00000339445:P777S	P	-	1	0	CASZ1	10636372	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.719000	0.38011	0.065000	0.16485	0.655000	0.94253	CCC	.		0.706	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766	
CAMSAP2	23271	broad.mit.edu;ucsc.edu	37	1	200818517	200818517	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:200818517G>T	ENST00000236925.4	+	12	2702	c.2653G>T	c.(2653-2655)Gaa>Taa	p.E885*	CAMSAP2_ENST00000358823.2_Nonsense_Mutation_p.E874*|CAMSAP2_ENST00000413307.2_Nonsense_Mutation_p.E858*			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	885					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)	p.E874*(1)									AACTTTAAATGAAGGAGAGAT	0.403																																					p.E874X		.											.	.	.	1	Substitution - Nonsense(1)	NS(1)	c.G2620T						.						103.0	114.0	110.0					1																	200818517		2197	4298	6495	SO:0001587	stop_gained	23271	exon11			TTAAATGAAGGAG	AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.2653G>T	1.37:g.200818517G>T	ENSP00000236925:p.Glu885*	129.0	2.0		164.0	35.0	NM_203459	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Nonsense_Mutation	SNP	ENST00000236925.4	37		.	.	.	.	.	.	.	.	.	.	G	39	7.391827	0.98255	.	.	ENSG00000118200	ENST00000358823;ENST00000413307;ENST00000236925	.	.	.	5.63	5.63	0.86233	.	0.043260	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-18.7813	19.6779	0.95945	0.0:0.0:1.0:0.0	.	.	.	.	X	874;858;885	.	ENSP00000236925:E885X	E	+	1	0	CAMSAP1L1	199085140	1.000000	0.71417	0.141000	0.22245	0.990000	0.78478	9.840000	0.99478	2.650000	0.89964	0.467000	0.42956	GAA	.		0.403	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086956.2	NM_203459	
CD109	135228	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	74446154	74446154	+	Missense_Mutation	SNP	C	C	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr6:74446154C>G	ENST00000287097.5	+	5	668	c.556C>G	c.(556-558)Ctt>Gtt	p.L186V	CD109_ENST00000422508.2_Missense_Mutation_p.L109V|CD109_ENST00000437994.2_Missense_Mutation_p.L186V			Q6YHK3	CD109_HUMAN	CD109 molecule	186					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ACAAAGTGATCTTGGAGTCAT	0.378																																					p.L186V		.											.	CD109	155	0			c.C556G						.						185.0	185.0	185.0					6																	74446154		2203	4300	6503	SO:0001583	missense	135228	exon5			AGTGATCTTGGAG	AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.556C>G	6.37:g.74446154C>G	ENSP00000287097:p.Leu186Val	117.0	0.0		69.0	36.0	NM_133493	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	ENST00000287097.5	37	CCDS4982.1	.	.	.	.	.	.	.	.	.	.	C	15.89	2.967589	0.53507	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.73575	-0.76;-0.76;-0.76	4.74	4.74	0.60224	Alpha-2-macroglobulin, N-terminal (1);	0.405345	0.21740	N	0.069821	T	0.67599	0.2910	L	0.53249	1.67	0.35023	D	0.758072	P;D;B;B	0.56746	0.905;0.977;0.049;0.372	P;P;B;B	0.53266	0.544;0.722;0.061;0.309	T	0.66598	-0.5883	10	0.29301	T	0.29	.	10.5919	0.45314	0.0:0.9098:0.0:0.0902	.	109;186;186;186	Q6YHK3-2;Q6YHK3-3;Q6YHK3-4;Q6YHK3	.;.;.;CD109_HUMAN	V	186;109;186	ENSP00000388062:L186V;ENSP00000404475:L109V;ENSP00000287097:L186V	ENSP00000287097:L186V	L	+	1	0	CD109	74502875	0.960000	0.32886	0.951000	0.38953	0.847000	0.48162	1.200000	0.32247	2.601000	0.87937	0.655000	0.94253	CTT	.		0.378	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493	
CD244	51744	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160806007	160806007	+	Missense_Mutation	SNP	A	A	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:160806007A>G	ENST00000368033.3	-	6	969	c.887T>C	c.(886-888)aTc>aCc	p.I296T	CD244_ENST00000368034.4_Missense_Mutation_p.I291T|CD244_ENST00000322302.7_Missense_Mutation_p.I199T|CD244_ENST00000368032.2_Missense_Mutation_p.I291T|CD244_ENST00000481677.1_Intron			Q9BZW8	CD244_HUMAN	CD244 molecule, natural killer cell receptor 2B4	296					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	18	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CATAGAGTAGATGGTGCTCCC	0.502																																					p.I296T		.											.	CD244	91	0			c.T887C						.						117.0	103.0	108.0					1																	160806007		2203	4300	6503	SO:0001583	missense	51744	exon6			GAGTAGATGGTGC	AF105261	CCDS1210.1, CCDS53398.1, CCDS53399.1	1q23.1	2013-01-11	2006-03-29		ENSG00000122223	ENSG00000122223		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18171	protein-coding gene	gene with protein product		605554	"""natural killer cell receptor 2B4"", ""CD244 natural killer cell receptor 2B4"""			3772297, 10458320	Standard	NM_016382		Approved	2B4, NAIL, NKR2B4, Nmrk, SLAMF4	uc009wtq.3	Q9BZW8	OTTHUMG00000028606	ENST00000368033.3:c.887T>C	1.37:g.160806007A>G	ENSP00000357012:p.Ile296Thr	105.0	0.0		97.0	46.0	NM_001166663	Q5VYI2|Q5VYI6|Q5VYI7|Q96T47|Q9NQD2|Q9NQD3|Q9Y288	Missense_Mutation	SNP	ENST00000368033.3	37	CCDS53399.1	.	.	.	.	.	.	.	.	.	.	A	18.44	3.625010	0.66901	.	.	ENSG00000122223	ENST00000368034;ENST00000368033;ENST00000322302;ENST00000368032	T;T;T;T	0.56103	0.48;0.48;1.16;0.48	3.72	3.72	0.42706	.	4.060120	0.00879	N	0.002112	T	0.46889	0.1416	L	0.29908	0.895	0.28017	N	0.934669	D;P;P	0.65815	0.995;0.675;0.782	P;B;B	0.61592	0.891;0.158;0.3	T	0.45848	-0.9233	10	0.72032	D	0.01	-15.7478	9.1278	0.36826	1.0:0.0:0.0:0.0	.	199;296;291	Q9BZW8-4;Q9BZW8;Q9BZW8-2	.;CD244_HUMAN;.	T	291;296;199;291	ENSP00000357013:I291T;ENSP00000357012:I296T;ENSP00000313619:I199T;ENSP00000357011:I291T	ENSP00000313619:I199T	I	-	2	0	CD244	159072631	1.000000	0.71417	0.991000	0.47740	0.510000	0.34073	3.095000	0.50235	1.935000	0.56089	0.459000	0.35465	ATC	.		0.502	CD244-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071469.1	NM_016382	
CDH23	64072	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	73437280	73437280	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr10:73437280C>T	ENST00000224721.6	+	15	1602	c.1597C>T	c.(1597-1599)Cgc>Tgc	p.R533C	CDH23_ENST00000299366.7_Missense_Mutation_p.R573C	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	528	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GCTCATCCAGCGCTTCACCCT	0.597																																					p.R528C		.											.	CDH23	563	0			c.C1582T						.						40.0	42.0	41.0					10																	73437280		2098	4229	6327	SO:0001583	missense	64072	exon15			ATCCAGCGCTTCA	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.1597C>T	10.37:g.73437280C>T	ENSP00000224721:p.Arg533Cys	148.0	0.0		120.0	9.0	NM_001171931	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37		.	.	.	.	.	.	.	.	.	.	C	35	5.530094	0.96446	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000299366;ENST00000224721;ENST00000442677	.	.	.	5.51	5.51	0.81932	Cadherin (5);Cadherin-like (1);	0.069679	0.56097	D	0.000023	D	0.82651	0.5083	M	0.79614	2.46	0.80722	D	1	D;D;D	0.89917	0.995;1.0;0.989	P;D;P	0.87578	0.893;0.998;0.67	T	0.81540	-0.0886	9	0.39692	T	0.17	.	19.473	0.94971	0.0:1.0:0.0:0.0	.	528;531;528	Q6P152;G3XCN8;Q9H251	.;.;CAD23_HUMAN	C	533;528;528;531;531;45	.	ENSP00000224721:R533C	R	+	1	0	CDH23	73107286	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.893000	0.69798	2.594000	0.87642	0.650000	0.86243	CGC	.		0.597	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
CEACAM3	1084	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42300619	42300619	+	Missense_Mutation	SNP	C	C	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:42300619C>A	ENST00000357396.3	+	1	251	c.10C>A	c.(10-12)Ccc>Acc	p.P4T	CEACAM3_ENST00000344550.4_Missense_Mutation_p.P4T|CEACAM3_ENST00000221999.4_Missense_Mutation_p.P4T|CEACAM3_ENST00000595255.1_3'UTR	NM_001815.2	NP_001806.2	P40198	CEAM3_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 3	4						integral component of membrane (GO:0016021)				endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(3)|skin(4)|stomach(1)	19						CATGGGGCCCCCCTCAGCCTC	0.597																																					p.P4T		.											.	CEACAM3	91	0			c.C10A						.						42.0	43.0	43.0					19																	42300619		2203	4300	6503	SO:0001583	missense	1084	exon1			GGGCCCCCCTCAG	E03349	CCDS12586.2, CCDS62685.1	19q13.2	2013-01-11			ENSG00000170956	ENSG00000170956		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1815	protein-coding gene	gene with protein product		609142		CGM1			Standard	NM_001815		Approved	CD66d	uc002orn.2	P40198	OTTHUMG00000150142	ENST00000357396.3:c.10C>A	19.37:g.42300619C>A	ENSP00000349971:p.Pro4Thr	97.0	0.0		73.0	18.0	NM_001815	G5E978|Q3KPH9	Missense_Mutation	SNP	ENST00000357396.3	37	CCDS12586.2	.	.	.	.	.	.	.	.	.	.	C	11.58	1.680285	0.29872	.	.	ENSG00000170956	ENST00000357396;ENST00000389667;ENST00000221999;ENST00000344550	T;T;T	0.01197	5.19;5.23;5.23	3.09	0.709	0.18150	.	.	.	.	.	T	0.03178	0.0093	M	0.77313	2.365	0.09310	N	1	P;P	0.47677	0.887;0.899	P;P	0.52343	0.604;0.696	T	0.36625	-0.9740	9	0.62326	D	0.03	.	3.8124	0.08802	0.0:0.5644:0.277:0.1586	.	4;4	G5E978;P40198	.;CEAM3_HUMAN	T	4	ENSP00000349971:P4T;ENSP00000221999:P4T;ENSP00000341725:P4T	ENSP00000221999:P4T	P	+	1	0	CEACAM3	46992459	0.000000	0.05858	0.060000	0.19600	0.035000	0.12851	-0.257000	0.08745	0.374000	0.24650	0.508000	0.49915	CCC	.		0.597	CEACAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316509.2	NM_001815	
CEP164	22897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	117282631	117282631	+	Missense_Mutation	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr11:117282631G>T	ENST00000278935.3	+	32	4431	c.4284G>T	c.(4282-4284)agG>agT	p.R1428S	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	1428					cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		ATGACCCCAGGTTGTATCCTT	0.577																																					p.R1428S		.											.	CEP164	69	0			c.G4284T						.						47.0	48.0	48.0					11																	117282631		2201	4296	6497	SO:0001583	missense	22897	exon32			CCCCAGGTTGTAT	AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.4284G>T	11.37:g.117282631G>T	ENSP00000278935:p.Arg1428Ser	147.0	0.0		117.0	36.0	NM_014956	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	ENST00000278935.3	37	CCDS31683.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.753185	0.31046	.	.	ENSG00000110274	ENST00000278935	T	0.56611	0.45	5.27	1.37	0.22104	.	0.235815	0.29995	N	0.010672	T	0.29491	0.0735	N	0.08118	0	0.09310	N	1	B;B	0.15473	0.013;0.013	B;B	0.19391	0.025;0.025	T	0.25710	-1.0124	10	0.72032	D	0.01	-19.1551	7.9719	0.30132	0.4035:0.0:0.5965:0.0	.	1428;1423	Q9UPV0;Q9UPV0-2	CE164_HUMAN;.	S	1428	ENSP00000278935:R1428S	ENSP00000278935:R1428S	R	+	3	2	CEP164	116787841	0.743000	0.28239	0.292000	0.24919	0.845000	0.48019	0.248000	0.18198	0.249000	0.21456	0.655000	0.94253	AGG	.		0.577	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956	
CHRNA6	8973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	42611206	42611206	+	Missense_Mutation	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr8:42611206G>T	ENST00000276410.2	-	5	1491	c.1136C>A	c.(1135-1137)gCc>gAc	p.A379D	CHRNA6_ENST00000530869.1_5'Flank|CHRNA6_ENST00000534622.1_Missense_Mutation_p.A364D	NM_004198.3	NP_004189.1	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6 (neuronal)	379					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|membrane depolarization (GO:0051899)|regulation of dopamine secretion (GO:0014059)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)			endometrium(2)|large_intestine(3)|liver(1)|lung(15)|ovary(1)	22	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)|Varenicline(DB01273)	CTTGCCTTTGGCAGGCCTCCT	0.537																																					p.A379D		.											.	CHRNA6	90	0			c.C1136A						.						76.0	69.0	72.0					8																	42611206		2203	4300	6503	SO:0001583	missense	8973	exon5			CCTTTGGCAGGCC	U62435	CCDS6135.1, CCDS56536.1	8p22	2012-02-11	2012-02-07					"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	15963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 6 (neuronal)"""	606888	"""cholinergic receptor, nicotinic, alpha polypeptide 6"""			8906617	Standard	NM_004198		Approved		uc003xpj.3	Q15825		ENST00000276410.2:c.1136C>A	8.37:g.42611206G>T	ENSP00000276410:p.Ala379Asp	116.0	0.0		124.0	42.0	NM_004198	B2R8V4|B4DQH1	Missense_Mutation	SNP	ENST00000276410.2	37	CCDS6135.1	.	.	.	.	.	.	.	.	.	.	G	0.840	-0.742257	0.03088	.	.	ENSG00000147434	ENST00000276410;ENST00000534622	D;D	0.85411	-1.98;-1.98	6.07	3.35	0.38373	Neurotransmitter-gated ion-channel transmembrane domain (2);	1.918270	0.02392	N	0.079793	T	0.80737	0.4680	L	0.38733	1.17	0.20074	N	0.999937	B;B	0.20550	0.046;0.002	B;B	0.32583	0.148;0.005	T	0.61128	-0.7125	10	0.10377	T	0.69	.	6.3808	0.21533	0.2193:0.1668:0.6139:0.0	.	364;379	B4DQH1;Q15825	.;ACHA6_HUMAN	D	379;364	ENSP00000276410:A379D;ENSP00000433871:A364D	ENSP00000276410:A379D	A	-	2	0	CHRNA6	42730363	0.102000	0.21896	0.415000	0.26534	0.009000	0.06853	1.419000	0.34793	0.464000	0.27142	-0.140000	0.14226	GCC	.		0.537	CHRNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383156.1		
CHRNA7	1139	ucsc.edu;bcgsc.ca;mdanderson.org	37	15	32450652	32450652	+	Missense_Mutation	SNP	G	G	A	rs200236230		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr15:32450652G>A	ENST00000306901.3	+	7	735	c.638G>A	c.(637-639)tGc>tAc	p.C213Y	CHRNA7_ENST00000455693.2_Missense_Mutation_p.C32Y|CHRNA7_ENST00000454250.3_Missense_Mutation_p.C242Y	NM_000746.5	NP_000737.1	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7 (neuronal)	213					activation of MAPK activity (GO:0000187)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to ethanol (GO:0048149)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular calcium ion homeostasis (GO:0006874)|cognition (GO:0050890)|dopamine biosynthetic process (GO:0042416)|endocytosis (GO:0006897)|generation of ovulation cycle rhythm (GO:0060112)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|memory (GO:0007613)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of tumor necrosis factor production (GO:0032720)|neuronal action potential (GO:0019228)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate involved in baroreceptor response to decreased systemic arterial blood pressure (GO:0001988)|regulation of norepinephrine secretion (GO:0014061)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to food (GO:0032094)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|T cell activation (GO:0042110)	acetylcholine-gated channel complex (GO:0005892)|apical plasma membrane (GO:0016324)|asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|external side of plasma membrane (GO:0009897)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|acetylcholine-gated cation channel activity (GO:0022848)|beta-amyloid binding (GO:0001540)|chloride channel regulator activity (GO:0017081)|drug binding (GO:0008144)|protein homodimerization activity (GO:0042803)|toxic substance binding (GO:0015643)			endometrium(3)|large_intestine(1)|lung(6)|ovary(2)	12		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	TATGAGTGCTGCAAAGAGCCC	0.522													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19764	0.0		0.0	False		,,,				2504	0.0				p.C242Y	Esophageal Squamous(193;529 2900 40232 43193)	.											.	CHRNA7	91	0			c.G725A						.						169.0	144.0	152.0					15																	32450652		2200	4298	6498	SO:0001583	missense	1139	exon7			AGTGCTGCAAAGA	Z23141	CCDS10027.1, CCDS53924.1	15q13.3	2012-02-11	2012-02-07		ENSG00000175344	ENSG00000175344		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1960	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 7 (neuronal)"""	118511	"""cholinergic receptor, nicotinic, alpha polypeptide 7"""			8188270	Standard	NM_001190455		Approved		uc021sic.2	P36544	OTTHUMG00000129285	ENST00000306901.3:c.638G>A	15.37:g.32450652G>A	ENSP00000303727:p.Cys213Tyr	1045.0	2.0		947.0	184.0	NM_001190455	A8K7Q4|B4DFS0|Q15826|Q8IUZ4|Q96RH2|Q99555|Q9BXH0	Missense_Mutation	SNP	ENST00000306901.3	37	CCDS10027.1	.	.	.	.	.	.	.	.	.	.	g	22.0	4.226612	0.79576	.	.	ENSG00000175344	ENST00000437966;ENST00000454250;ENST00000306901;ENST00000455693;ENST00000454016	T;T;T	0.78126	-1.15;-1.15;-1.15	4.51	4.51	0.55191	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.90614	0.7057	M	0.94021	3.485	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.996	D	0.92875	0.6318	10	0.87932	D	0	.	15.1122	0.72368	0.0:0.0:1.0:0.0	.	242;109;213	B4DFS0;B1N7G6;P36544	.;.;ACHA7_HUMAN	Y	123;242;213;32;137	ENSP00000407546:C242Y;ENSP00000303727:C213Y;ENSP00000405989:C32Y	ENSP00000303727:C213Y	C	+	2	0	CHRNA7	30237944	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.135000	0.94478	2.502000	0.84385	0.484000	0.47621	TGC	.		0.522	CHRNA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251410.2		
CLCNKA	1187	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	16351300	16351300	+	Missense_Mutation	SNP	T	T	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:16351300T>G	ENST00000331433.4	+	4	291	c.272T>G	c.(271-273)cTc>cGc	p.L91R	CLCNKA_ENST00000464764.1_Intron|CLCNKA_ENST00000439316.2_Intron|CLCNKA_ENST00000375692.1_Missense_Mutation_p.L91R|CLCNKA_ENST00000420078.1_Missense_Mutation_p.L91R			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka	91					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	AGCCACCTGCTCCGGTATCTT	0.627																																					p.L91R		.											.	CLCNKA	91	0			c.T272G						.						128.0	96.0	107.0					1																	16351300		2203	4300	6503	SO:0001583	missense	1187	exon4			ACCTGCTCCGGTA		CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.272T>G	1.37:g.16351300T>G	ENSP00000332771:p.Leu91Arg	91.0	1.0		101.0	25.0	NM_004070	B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Missense_Mutation	SNP	ENST00000331433.4	37	CCDS167.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.120680	0.77323	.	.	ENSG00000186510	ENST00000375692;ENST00000420078;ENST00000331433	D;D;D	0.93859	-3.3;-3.3;-3.3	4.0	4.0	0.46444	Chloride channel, core (2);	0.000000	0.64402	D	0.000001	D	0.96275	0.8785	M	0.88310	2.945	0.80722	D	1	P;P	0.45715	0.865;0.865	P;P	0.59761	0.826;0.863	D	0.96587	0.9435	10	0.87932	D	0	.	10.647	0.45626	0.0:0.0:0.0:1.0	.	91;91	Q5T5Q4;P51800	.;CLCKA_HUMAN	R	91	ENSP00000364844:L91R;ENSP00000410353:L91R;ENSP00000332771:L91R	ENSP00000332771:L91R	L	+	2	0	CLCNKA	16223887	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.035000	0.76517	1.800000	0.52685	0.379000	0.24179	CTC	.		0.627	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026326.1		
CLEC1B	51266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	10147806	10147806	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr12:10147806C>A	ENST00000298527.6	-	5	657	c.478G>T	c.(478-480)Gga>Tga	p.G160*	CLEC1B_ENST00000348658.4_Nonsense_Mutation_p.G127*|CLEC1B_ENST00000428126.2_Nonsense_Mutation_p.G127*	NM_016509.3	NP_057593.3	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B	160	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|platelet formation (GO:0030220)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(12)|stomach(1)|urinary_tract(1)	19						CGAGATAATCCGACCCAACGA	0.428																																					p.G160X		.											.	CLEC1B	90	0			c.G478T						.						275.0	266.0	269.0					12																	10147806		1868	4092	5960	SO:0001587	stop_gained	51266	exon5			ATAATCCGACCCA	AF124841	CCDS41751.1, CCDS41752.1	12p13.31	2006-04-12				ENSG00000165682		"""C-type lectin domain containing"""	24356	protein-coding gene	gene with protein product		606783				10671229, 11745369	Standard	NM_016509		Approved	CLEC2	uc001qwu.3	Q9P126		ENST00000298527.6:c.478G>T	12.37:g.10147806C>A	ENSP00000298527:p.Gly160*	65.0	0.0		60.0	20.0	NM_016509	Q6UWX7|Q8NHR6	Nonsense_Mutation	SNP	ENST00000298527.6	37	CCDS41752.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.037910	0.93630	.	.	ENSG00000165682	ENST00000398937;ENST00000428126;ENST00000298527;ENST00000348658;ENST00000398939	.	.	.	3.83	3.83	0.44106	.	0.000000	0.47455	D	0.000228	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.1397	0.48396	0.0:1.0:0.0:0.0	.	.	.	.	X	67;127;160;127;67	.	ENSP00000298527:G160X	G	-	1	0	CLEC1B	10039073	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	3.454000	0.52986	1.954000	0.56735	0.298000	0.19748	GGA	.		0.428	CLEC1B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399922.1	NM_016509	
COL6A3	1293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	238280705	238280705	+	Missense_Mutation	SNP	C	C	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr2:238280705C>A	ENST00000295550.4	-	9	4407	c.3955G>T	c.(3955-3957)Gtg>Ttg	p.V1319L	COL6A3_ENST00000409809.1_Missense_Mutation_p.V1113L|COL6A3_ENST00000392004.3_Missense_Mutation_p.V1113L|COL6A3_ENST00000392003.2_Missense_Mutation_p.V912L|COL6A3_ENST00000353578.4_Missense_Mutation_p.V1113L|COL6A3_ENST00000472056.1_Missense_Mutation_p.V712L|COL6A3_ENST00000346358.4_Missense_Mutation_p.V1119L|COL6A3_ENST00000347401.3_Missense_Mutation_p.V1118L	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1319	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TTCCTGGACACGTACTCCAGG	0.607																																					p.V1319L		.											.	COL6A3	526	0			c.G3955T						.						48.0	45.0	46.0					2																	238280705		2203	4300	6503	SO:0001583	missense	1293	exon9			TGGACACGTACTC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.3955G>T	2.37:g.238280705C>A	ENSP00000295550:p.Val1319Leu	88.0	0.0		77.0	20.0	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188379	0.78789	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003	D;D;D;D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89;-1.89;-1.89;-1.89	5.84	5.84	0.93424	von Willebrand factor, type A (3);	0.000000	0.49305	D	0.000154	D	0.89880	0.6843	L	0.41824	1.3	0.58432	D	0.999999	D;D;D;D;P	0.89917	1.0;0.999;1.0;1.0;0.893	D;D;D;D;P	0.91635	0.999;0.986;0.999;0.999;0.644	D	0.88577	0.3134	10	0.42905	T	0.14	.	20.1346	0.98019	0.0:1.0:0.0:0.0	.	712;912;1113;1113;1319	E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;CO6A3_HUMAN	L	1319;1118;1113;712;1113;1119;1113;912	ENSP00000295550:V1319L;ENSP00000315609:V1118L;ENSP00000315873:V1113L;ENSP00000418285:V712L;ENSP00000386844:V1113L;ENSP00000295546:V1119L;ENSP00000375861:V1113L;ENSP00000375860:V912L	ENSP00000295550:V1319L	V	-	1	0	COL6A3	237945444	0.998000	0.40836	0.881000	0.34555	0.800000	0.45204	3.846000	0.55888	2.765000	0.95021	0.655000	0.94253	GTG	.		0.607	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
CRY1	1407	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	107395609	107395609	+	Silent	SNP	T	T	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr12:107395609T>C	ENST00000008527.5	-	4	1395	c.528A>G	c.(526-528)gaA>gaG	p.E176E		NM_004075.4	NP_004066.1	Q16526	CRY1_HUMAN	cryptochrome circadian clock 1	176					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|lipid storage (GO:0019915)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of glucocorticoid secretion (GO:2000850)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of DNA damage checkpoint (GO:2000001)|response to glucagon (GO:0033762)|response to insulin (GO:0032868)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|double-stranded DNA binding (GO:0003690)|nuclear hormone receptor binding (GO:0035257)|nucleotide binding (GO:0000166)|phosphatase binding (GO:0019902)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin binding (GO:0043130)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|skin(1)	29						TTGTGCACTTTTCTATCACTT	0.433																																					p.E176E		.											.	CRY1	93	0			c.A528G						.						203.0	187.0	192.0					12																	107395609		2203	4300	6503	SO:0001819	synonymous_variant	1407	exon4			GCACTTTTCTATC	BC030519	CCDS9112.1	12q23-q24.1	2014-01-17	2014-01-17		ENSG00000008405	ENSG00000008405			2384	protein-coding gene	gene with protein product		601933	"""cryptochrome 1 (photolyase-like)"""	PHLL1		8921389	Standard	NM_004075		Approved		uc001tmi.4	Q16526	OTTHUMG00000170005	ENST00000008527.5:c.528A>G	12.37:g.107395609T>C		102.0	2.0		94.0	33.0	NM_004075		Silent	SNP	ENST00000008527.5	37	CCDS9112.1																																																																																			.		0.433	CRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406827.1	NM_004075	
CSPG5	10675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47618646	47618646	+	Silent	SNP	T	T	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr3:47618646T>C	ENST00000383738.2	-	2	2968	c.870A>G	c.(868-870)ggA>ggG	p.G290G	CSPG5_ENST00000264723.4_Silent_p.G290G|CSPG5_ENST00000456150.1_Silent_p.G152G|CSPG5_ENST00000465441.1_5'Flank	NM_001206943.1|NM_001206945.1	NP_001193872.1|NP_001193874.1	O95196	CSPG5_HUMAN	chondroitin sulfate proteoglycan 5 (neuroglycan C)	290	Interaction with TNC and TNR. {ECO:0000250}.				axon regeneration (GO:0031103)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)|regulation of growth (GO:0040008)|regulation of synaptic transmission (GO:0050804)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	22				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GGTctccacctcctactgcat	0.542																																					p.G290G		.											.	CSPG5	91	0			c.A870G						.						23.0	23.0	23.0					3																	47618646		2203	4300	6503	SO:0001819	synonymous_variant	10675	exon2			TCCACCTCCTACT	AF059274	CCDS2757.1, CCDS56252.1, CCDS56253.1, CCDS74930.1	3p21.3	2008-07-18			ENSG00000114646	ENSG00000114646			2467	protein-coding gene	gene with protein product		606775				9950058	Standard	NM_006574		Approved	NGC	uc003crp.4	O95196	OTTHUMG00000133518	ENST00000383738.2:c.870A>G	3.37:g.47618646T>C		65.0	0.0		63.0	15.0	NM_006574	Q71M39|Q71M40	Silent	SNP	ENST00000383738.2	37	CCDS56253.1																																																																																			.		0.542	CSPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257489.1	NM_006574	
DCAF6	55827	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	167962525	167962525	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:167962525delT	ENST00000312263.6	+	7	954	c.750delT	c.(748-750)aatfs	p.N251fs	DCAF6_ENST00000367843.3_Frame_Shift_Del_p.N251fs|DCAF6_ENST00000432587.2_Frame_Shift_Del_p.N220fs|DCAF6_ENST00000367840.3_Frame_Shift_Del_p.N251fs	NM_001017977.2	NP_001017977.1	Q58WW2	DCAF6_HUMAN	DDB1 and CUL4 associated factor 6	251					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	36						CCCATCTTAATAATAAGTCCT	0.358																																					p.N250fs		.											.	DCAF6	516	0			c.750delT						.						98.0	95.0	96.0					1																	167962525		2203	4300	6503	SO:0001589	frameshift_variant	55827	exon7			TCTTAATAATAAG	AL136738	CCDS1267.2, CCDS30933.1, CCDS55657.1, CCDS55658.1	1q23.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000143164	ENSG00000143164		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30002	protein-coding gene	gene with protein product		610494	"""IQ motif and WD repeats 1"""	IQWD1		12032826	Standard	NM_018442		Approved	PC326	uc001gex.3	Q58WW2	OTTHUMG00000034572	ENST00000312263.6:c.750delT	1.37:g.167962525delT	ENSP00000311949:p.Asn251fs	153.0	0.0		154.0	37.0	NM_001198956	A2A295|B4DNB8|Q7L8I0|Q8IXH3|Q8TB19	Frame_Shift_Del	DEL	ENST00000312263.6	37	CCDS30933.1																																																																																			.		0.358	DCAF6-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083661.2	NM_018442	
DCHS2	54798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	155163818	155163818	+	Missense_Mutation	SNP	A	A	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr4:155163818A>T	ENST00000357232.4	-	22	5682	c.5683T>A	c.(5683-5685)Tct>Act	p.S1895T		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1895	Cadherin 17. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ACTGCTTCAGAGGGGAGAAAA	0.398																																					p.S1895T		.											.	DCHS2	94	0			c.T5683A						.						145.0	136.0	139.0					4																	155163818		2203	4300	6503	SO:0001583	missense	54798	exon22			CTTCAGAGGGGAG	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.5683T>A	4.37:g.155163818A>T	ENSP00000349768:p.Ser1895Thr	100.0	0.0		89.0	34.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	A	2.937	-0.219733	0.06061	.	.	ENSG00000197410	ENST00000357232	T	0.61510	0.1	5.15	2.59	0.31030	Cadherin (1);Cadherin-like (1);	0.523212	0.17626	N	0.167550	T	0.42698	0.1214	L	0.53780	1.695	0.09310	N	0.999999	B	0.26547	0.152	B	0.20384	0.029	T	0.24977	-1.0145	10	0.11794	T	0.64	.	4.2122	0.10517	0.5988:0.0:0.2605:0.1407	.	1895	Q6V1P9	PCD23_HUMAN	T	1895	ENSP00000349768:S1895T	ENSP00000349768:S1895T	S	-	1	0	DCHS2	155383268	0.043000	0.20138	0.032000	0.17829	0.321000	0.28281	0.406000	0.21032	0.326000	0.23384	0.482000	0.46254	TCT	.		0.398	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
DDX6	1656	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118627983	118627983	+	Missense_Mutation	SNP	T	T	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr11:118627983T>A	ENST00000526070.2	-	10	1367	c.1007A>T	c.(1006-1008)cAg>cTg	p.Q336L	DDX6_ENST00000264018.4_Missense_Mutation_p.Q336L|DDX6_ENST00000534980.1_Missense_Mutation_p.Q336L	NM_001257191.1	NP_001244120.1	P26196	DDX6_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 6	336	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cytoplasmic mRNA processing body assembly (GO:0033962)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	13	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)		AATGATCGACTGGTTTATCTG	0.348			T	IGH@	B-NHL																																p.Q336L		.		Dom	yes		11	11q23.3	1656	DEAD (Asp-Glu-Ala-Asp) box polypeptide 6		L	.	DDX6	659	0			c.A1007T						.						38.0	34.0	35.0					11																	118627983		1796	4076	5872	SO:0001583	missense	1656	exon10			ATCGACTGGTTTA	D17532	CCDS44751.1	11q23.3	2012-02-23	2012-02-23		ENSG00000110367	ENSG00000110367		"""DEAD-boxes"""	2747	protein-coding gene	gene with protein product		600326	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 6 (RNA helicase, 54kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 6"""	HLR2		1579499, 11839790	Standard	NM_004397		Approved	RCK	uc001pub.2	P26196	OTTHUMG00000166411	ENST00000526070.2:c.1007A>T	11.37:g.118627983T>A	ENSP00000433704:p.Gln336Leu	119.0	1.0		90.0	17.0	NM_004397	Q5D048	Missense_Mutation	SNP	ENST00000526070.2	37	CCDS44751.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.866699	0.91511	.	.	ENSG00000110367	ENST00000264018;ENST00000534980;ENST00000526070	T;T;T	0.05447	3.44;3.44;3.44	5.79	5.79	0.91817	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.20981	0.0505	L	0.50919	1.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00149	-1.1988	10	0.87932	D	0	.	15.7947	0.78401	0.0:0.0:0.0:1.0	.	336	P26196	DDX6_HUMAN	L	336	ENSP00000264018:Q336L;ENSP00000442266:Q336L;ENSP00000433704:Q336L	ENSP00000264018:Q336L	Q	-	2	0	DDX6	118133193	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.974000	0.88039	2.193000	0.70182	0.482000	0.46254	CAG	.		0.348	DDX6-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000389647.2	NM_004397	
DEGS1	8560	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	224371102	224371102	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:224371102C>T	ENST00000323699.4	+	1	230	c.64C>T	c.(64-66)Cgg>Tgg	p.R22W	DEGS1_ENST00000391877.3_Missense_Mutation_p.R22W	NM_003676.3	NP_003667.1	O15121	DEGS1_HUMAN	delta(4)-desaturase, sphingolipid 1	22					small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|unsaturated fatty acid biosynthetic process (GO:0006636)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|kidney(3)|large_intestine(2)|lung(4)	10	Breast(184;0.193)			GBM - Glioblastoma multiforme(131;0.00643)		GCACGCCGACCGGCGCCGGGA	0.741																																					p.R22W		.											.	DEGS1	90	0			c.C64T						.						10.0	11.0	11.0					1																	224371102		1603	2945	4548	SO:0001583	missense	8560	exon1			GCCGACCGGCGCC	AF002668	CCDS1540.1	1q42.11	2013-09-02	2011-12-09	2004-12-14	ENSG00000143753	ENSG00000143753		"""Fatty acid desaturases"""	13709	protein-coding gene	gene with protein product	"""sphingolipid delta(4)-desaturase 1"", ""dihydroceramide desaturase 1"""	615843	"""degenerative spermatocyte homolog 1, lipid desaturase (Drosophila)"""			9188692, 20105137	Standard	NM_003676		Approved	MLD, Des-1, DES1, FADS7, DEGS-1	uc001hoj.3	O15121	OTTHUMG00000037496	ENST00000323699.4:c.64C>T	1.37:g.224371102C>T	ENSP00000316476:p.Arg22Trp	73.0	0.0		90.0	22.0	NM_003676		Missense_Mutation	SNP	ENST00000323699.4	37	CCDS1540.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.613556	0.87359	.	.	ENSG00000143753	ENST00000323699;ENST00000391877	D;D	0.88741	-2.42;-2.42	4.01	4.01	0.46588	Sphingolipid delta4-desaturase, N-terminal (1);	0.000000	0.64402	D	0.000002	D	0.96109	0.8732	H	0.95504	3.68	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.97747	1.0212	10	0.87932	D	0	-13.795	16.502	0.84260	0.0:1.0:0.0:0.0	.	22	O15121	DEGS1_HUMAN	W	22	ENSP00000316476:R22W;ENSP00000375749:R22W	ENSP00000316476:R22W	R	+	1	2	DEGS1	222437725	0.876000	0.30132	0.832000	0.32986	0.962000	0.63368	1.687000	0.37680	1.935000	0.56089	0.491000	0.48974	CGG	.		0.741	DEGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091285.2		
DNAH1	25981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52393979	52393979	+	Silent	SNP	G	G	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr3:52393979G>A	ENST00000420323.2	+	27	4716	c.4455G>A	c.(4453-4455)caG>caA	p.Q1485Q		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1485	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCCGCATGCAGCGGGCAGTGC	0.577																																					p.Q1485Q		.											.	DNAH1	67	0			c.G4455A						.						162.0	170.0	168.0					3																	52393979		2154	4253	6407	SO:0001819	synonymous_variant	25981	exon27			CATGCAGCGGGCA	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.4455G>A	3.37:g.52393979G>A		203.0	0.0		176.0	69.0	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	ENST00000420323.2	37	CCDS46842.1																																																																																			.		0.577	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
DNAH9	1770	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	11593045	11593045	+	Silent	SNP	G	G	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr17:11593045G>A	ENST00000262442.4	+	20	3974	c.3906G>A	c.(3904-3906)ctG>ctA	p.L1302L	DNAH9_ENST00000454412.2_Silent_p.L1302L	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1302	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TCTGCCAGCTGAAGGAGCTCT	0.527																																					p.L1302L		.											.	DNAH9	168	0			c.G3906A						.						87.0	80.0	83.0					17																	11593045		2203	4300	6503	SO:0001819	synonymous_variant	1770	exon20			CCAGCTGAAGGAG	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.3906G>A	17.37:g.11593045G>A		204.0	1.0		140.0	57.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1																																																																																			.		0.527	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
DNAH9	1770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	11597228	11597228	+	Missense_Mutation	SNP	T	T	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr17:11597228T>G	ENST00000262442.4	+	21	4726	c.4658T>G	c.(4657-4659)cTa>cGa	p.L1553R	DNAH9_ENST00000454412.2_Missense_Mutation_p.L1553R	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1553	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TTTAAAGAGCTAGCTTATGAT	0.448																																					p.L1553R		.											.	DNAH9	168	0			c.T4658G						.						121.0	116.0	118.0					17																	11597228		2203	4300	6503	SO:0001583	missense	1770	exon21			AAGAGCTAGCTTA	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.4658T>G	17.37:g.11597228T>G	ENSP00000262442:p.Leu1553Arg	108.0	0.0		55.0	32.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	T	19.72	3.880588	0.72294	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.66460	-0.21;-0.21	4.72	4.72	0.59763	Dynein heavy chain, domain-2 (1);	0.091849	0.44285	D	0.000466	D	0.86247	0.5887	H	0.95224	3.64	0.80722	D	1	D	0.56521	0.976	D	0.71414	0.973	D	0.90345	0.4362	10	0.87932	D	0	.	14.3297	0.66548	0.0:0.0:0.0:1.0	.	1553	Q9NYC9	DYH9_HUMAN	R	1553;1553;135	ENSP00000262442:L1553R;ENSP00000414874:L1553R	ENSP00000262442:L1553R	L	+	2	0	DNAH9	11537953	1.000000	0.71417	0.997000	0.53966	0.831000	0.47069	7.307000	0.78920	2.122000	0.65172	0.533000	0.62120	CTA	.		0.448	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
DOK3	79930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176936802	176936802	+	Splice_Site	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr5:176936802C>T	ENST00000357198.4	-	1	56		c.e1+1		DOK3_ENST00000312943.6_Intron|DOK3_ENST00000377112.4_Intron|DOK3_ENST00000501403.2_Intron	NM_024872.2	NP_079148.2	Q7L591	DOK3_HUMAN	docking protein 3						Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|lung(7)	13	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			TTCTCACGCACCTGGTTCAGC	0.697																																					.		.											.	DOK3	226	0			c.51+1G>A						.						50.0	51.0	51.0					5																	176936802		2203	4300	6503	SO:0001630	splice_region_variant	79930	exon2			CACGCACCTGGTT	AK026223	CCDS4426.1, CCDS47349.1, CCDS47350.1	5q35	2008-02-05			ENSG00000146094	ENSG00000146094			24583	protein-coding gene	gene with protein product		611435				10733577, 12595900	Standard	NM_024872		Approved	FLJ22570	uc003mhk.3	Q7L591	OTTHUMG00000130850	ENST00000357198.4:c.51+1G>A	5.37:g.176936802C>T		158.0	0.0		125.0	30.0	NM_024872	E9PAT0|H7BXS0|Q8N864|Q9BQB3|Q9H666	Splice_Site	SNP	ENST00000357198.4	37	CCDS4426.1	.	.	.	.	.	.	.	.	.	.	C	0.625	-0.819677	0.02776	.	.	ENSG00000146094	ENST00000357198	.	.	.	3.26	0.473	0.16763	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.4785	0.16710	0.0:0.6173:0.0:0.3827	.	.	.	.	.	-1	.	.	.	-	.	.	DOK3	176869408	0.000000	0.05858	0.004000	0.12327	0.022000	0.10575	-0.074000	0.11450	0.078000	0.16900	0.491000	0.48974	.	.		0.697	DOK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253420.4	NM_024872	Intron
EBNA1BP2	10969	hgsc.bcm.edu;bcgsc.ca	37	1	43630464	43630464	+	Silent	SNP	T	T	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:43630464T>C	ENST00000236051.2	-	8	861	c.720A>G	c.(718-720)aaA>aaG	p.K240K	EBNA1BP2_ENST00000431635.2_Silent_p.K295K	NM_006824.2	NP_006815.2	Q99848	EBP2_HUMAN	EBNA1 binding protein 2	240					ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)	16	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TATACCGTCGTTTAGCACTGG	0.463																																					p.K295K		.											.	EBNA1BP2	90	0			c.A885G						.						71.0	68.0	69.0					1																	43630464		2203	4300	6503	SO:0001819	synonymous_variant	10969	exon9			CCGTCGTTTAGCA	U86602	CCDS478.1, CCDS53308.1	1p35-p33	2011-02-10	2001-11-28		ENSG00000117395	ENSG00000117395			15531	protein-coding gene	gene with protein product		614443	"""EBNA1-binding protein 2"""			10074103, 11438656	Standard	NM_001159936		Approved	NOBP, EBP2, P40	uc010ojx.2	Q99848	OTTHUMG00000007284	ENST00000236051.2:c.720A>G	1.37:g.43630464T>C		98.0	0.0		83.0	4.0	NM_001159936	Q96A66	Silent	SNP	ENST00000236051.2	37	CCDS478.1																																																																																			.		0.463	EBNA1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019015.1		
EDEM3	80267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	184702094	184702094	+	Silent	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:184702094G>T	ENST00000318130.8	-	6	755	c.489C>A	c.(487-489)atC>atA	p.I163I	EDEM3_ENST00000367512.3_Silent_p.I120I	NM_025191.3	NP_079467.3	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like 3	163					cellular protein metabolic process (GO:0044267)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CTTTCAGCATGATTGCCAGGG	0.388																																					p.I163I		.											.	EDEM3	91	0			c.C489A						.						118.0	115.0	116.0					1																	184702094		2203	4300	6503	SO:0001819	synonymous_variant	80267	exon6			CAGCATGATTGCC	AF288393	CCDS1363.2	1q25	2008-02-05	2006-03-31	2006-03-31	ENSG00000116406	ENSG00000116406			16787	protein-coding gene	gene with protein product		610214	"""chromosome 1 open reading frame 22"""	C1orf22		15537790, 15579471	Standard	NM_025191		Approved		uc010pok.2	Q9BZQ6	OTTHUMG00000035387	ENST00000318130.8:c.489C>A	1.37:g.184702094G>T		86.0	0.0		75.0	12.0	NM_025191	B2RCH6|B7ZLZ2|Q0VGM5|Q5TEZ0|Q9HCW1|Q9UFV7	Silent	SNP	ENST00000318130.8	37	CCDS1363.2																																																																																			.		0.388	EDEM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085785.3	NM_025191	
ESCO2	157570	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	27645507	27645507	+	Missense_Mutation	SNP	C	C	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr8:27645507C>G	ENST00000305188.8	+	6	1357	c.1119C>G	c.(1117-1119)gaC>gaG	p.D373E	ESCO2_ENST00000397418.2_Missense_Mutation_p.D21E	NM_001017420.2	NP_001017420.1	Q56NI9	ESCO2_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 2	373					chromosome segregation (GO:0007059)|double-strand break repair (GO:0006302)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|protein localization to chromatin (GO:0071168)|regulation of DNA replication (GO:0006275)	chromatin (GO:0000785)|chromocenter (GO:0010369)|Golgi apparatus (GO:0005794)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|XY body (GO:0001741)	lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|KIRC - Kidney renal clear cell carcinoma(542;0.0955)|Kidney(114;0.115)|Colorectal(74;0.132)		AAACAAAAGACCAGCTCATCA	0.383									SC Phocomelia syndrome																												p.D373E		.											.	ESCO2	90	0			c.C1119G						.						100.0	98.0	98.0					8																	27645507		2203	4300	6503	SO:0001583	missense	157570	exon6	Familial Cancer Database	SC-Pseudothalidomide s., incl.: Roberts s.	AAAAGACCAGCTC	AF306679	CCDS34872.1	8p21.1	2013-05-02	2013-05-02		ENSG00000171320	ENSG00000171320			27230	protein-coding gene	gene with protein product		609353	"""Roberts syndrome"", ""establishment of cohesion 1 homolog 2 (S. cerevisiae)"""	RBS		15958495, 16775838, 15821733, 16380922	Standard	XR_247122		Approved	EFO2	uc003xgg.3	Q56NI9	OTTHUMG00000163901	ENST00000305188.8:c.1119C>G	8.37:g.27645507C>G	ENSP00000306999:p.Asp373Glu	68.0	0.0		60.0	11.0	NM_001017420	B3KW59|Q49AP4	Missense_Mutation	SNP	ENST00000305188.8	37	CCDS34872.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.51|13.51	2.260090|2.260090	0.39995|0.39995	.|.	.|.	ENSG00000171320|ENSG00000171320	ENST00000305188;ENST00000397418|ENST00000518262	T;T|.	0.71103|.	-0.07;-0.54|.	5.79|5.79	3.98|3.98	0.46160|0.46160	.|.	0.424311|.	0.28376|.	N|.	0.015580|.	T|T	0.52273|0.52273	0.1724|0.1724	L|L	0.34521|0.34521	1.04|1.04	0.46927|0.46927	D|D	0.999253|0.999253	D|.	0.76494|.	0.999|.	D|.	0.85130|.	0.997|.	T|T	0.46965|0.46965	-0.9153|-0.9153	10|5	0.49607|.	T|.	0.09|.	-5.5893|-5.5893	11.2049|11.2049	0.48762|0.48762	0.0:0.8458:0.0:0.1542|0.0:0.8458:0.0:0.1542	.|.	373|.	Q56NI9|.	ESCO2_HUMAN|.	E|S	373;21|78	ENSP00000306999:D373E;ENSP00000380563:D21E|.	ENSP00000306999:D373E|.	D|T	+|+	3|2	2|0	ESCO2|ESCO2	27701426|27701426	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.739000|0.739000	0.42172|0.42172	1.332000|1.332000	0.33805|0.33805	1.451000|1.451000	0.47736|0.47736	0.561000|0.561000	0.74099|0.74099	GAC|ACC	.		0.383	ESCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376276.1	NM_001017420	
EXOSC5	56915	broad.mit.edu;mdanderson.org	37	19	41892629	41892629	+	Splice_Site	SNP	A	A	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:41892629A>G	ENST00000221233.4	-	6	767	c.617T>C	c.(616-618)cTc>cCc	p.L206P	CTC-435M10.3_ENST00000540732.1_Intron|EXOSC5_ENST00000596905.1_Splice_Site_p.L168P|CTC-435M10.3_ENST00000604424.1_Intron|BCKDHA_ENST00000595085.1_Intron	NM_020158.3	NP_064543.3	Q9NQT4	EXOS5_HUMAN	exosome component 5	206					defense response to virus (GO:0051607)|DNA deamination (GO:0045006)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|transcriptionally active chromatin (GO:0035327)	3'-5'-exoribonuclease activity (GO:0000175)|RNA binding (GO:0003723)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	7						GCACTGCTGGAGCTGCGGGGG	0.637																																					p.L206P		.											.	EXOSC5	90	0			c.T617C						.						19.0	18.0	19.0					19																	41892629		2197	4297	6494	SO:0001630	splice_region_variant	56915	exon6			TGCTGGAGCTGCG	AF285785	CCDS12580.1	19q13.1	2008-02-05				ENSG00000077348			24662	protein-coding gene	gene with protein product	"""exosome component Rrp46"""	606492				11110791, 11812149	Standard	NM_020158		Approved	hRrp46p, Rrp46p, RRP46, RRP41B, MGC12901, p12B	uc002oqo.3	Q9NQT4		ENST00000221233.4:c.616-1T>C	19.37:g.41892629A>G		35.0	0.0		37.0	6.0	NM_020158	Q32Q81|Q8NG16|Q96I89	Missense_Mutation	SNP	ENST00000221233.4	37	CCDS12580.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.177590	0.78564	.	.	ENSG00000077348	ENST00000221233	T	0.59906	0.23	5.08	5.08	0.68730	Exoribonuclease, phosphorolytic domain 2 (2);	0.133396	0.51477	D	0.000087	T	0.71451	0.3341	M	0.64997	1.995	0.80722	D	1	D	0.69078	0.997	D	0.70716	0.97	T	0.74523	-0.3637	10	0.72032	D	0.01	-14.6834	12.8435	0.57817	1.0:0.0:0.0:0.0	.	206	Q9NQT4	EXOS5_HUMAN	P	206	ENSP00000221233:L206P	ENSP00000221233:L206P	L	-	2	0	EXOSC5	46584469	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.433000	0.73404	2.120000	0.65058	0.533000	0.62120	CTC	.		0.637	EXOSC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463492.1	NM_020158	Missense_Mutation
EXTL1	2134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	26355761	26355761	+	Missense_Mutation	SNP	T	T	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:26355761T>C	ENST00000374280.3	+	2	1724	c.857T>C	c.(856-858)tTc>tCc	p.F286S	EXTL1_ENST00000484339.1_3'UTR	NM_004455.2	NP_004446.2	Q92935	EXTL1_HUMAN	exostosin-like glycosyltransferase 1	286					protein glycosylation (GO:0006486)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)	p.F286Y(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|stomach(1)|urinary_tract(1)	23		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)		GCCTCGCGCTTCCTCCAAGCC	0.622																																					p.F286S		.											.	EXTL1	90	1	Substitution - Missense(1)	kidney(1)	c.T857C						.						92.0	86.0	88.0					1																	26355761		2203	4300	6503	SO:0001583	missense	2134	exon2			CGCGCTTCCTCCA	U67191	CCDS271.1	1p36.1	2013-03-01	2013-03-01		ENSG00000158008	ENSG00000158008	2.4.1.224	"""Exostosin glycosyltransferase family"""	3515	protein-coding gene	gene with protein product	"""glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""alpha-N-acetylglucosaminyltransferase II"", ""glucuronyl-N-acetylglucosaminylproteoglycan alpha-1,4-N- acetylglucosaminyltransferase"", ""exostosin-L"""	601738	"""exostoses (multiple)-like 1"""			9037597	Standard	NM_004455		Approved	EXTL, MGC70794	uc001blf.3	Q92935	OTTHUMG00000007509	ENST00000374280.3:c.857T>C	1.37:g.26355761T>C	ENSP00000363398:p.Phe286Ser	148.0	0.0		142.0	50.0	NM_004455	Q6GSC1	Missense_Mutation	SNP	ENST00000374280.3	37	CCDS271.1	.	.	.	.	.	.	.	.	.	.	T	19.64	3.864795	0.71949	.	.	ENSG00000158008	ENST00000374280	D	0.97688	-4.49	3.91	3.91	0.45181	.	0.067410	0.64402	D	0.000013	D	0.98030	0.9351	M	0.86268	2.805	0.58432	D	0.999998	D	0.55385	0.971	P	0.56278	0.795	D	0.98202	1.0468	10	0.87932	D	0	-20.1562	9.3164	0.37937	0.0:0.0:0.0:1.0	.	286	Q92935	EXTL1_HUMAN	S	286	ENSP00000363398:F286S	ENSP00000363398:F286S	F	+	2	0	EXTL1	26228348	1.000000	0.71417	0.996000	0.52242	0.773000	0.43773	5.471000	0.66762	1.783000	0.52377	0.459000	0.35465	TTC	.		0.622	EXTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019749.1	NM_004455	
FAM122B	159090	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	133927919	133927919	+	Missense_Mutation	SNP	G	G	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chrX:133927919G>A	ENST00000370790.1	-	2	1031	c.103C>T	c.(103-105)Ctt>Ttt	p.L35F	FAM122B_ENST00000343004.5_Missense_Mutation_p.L35F|FAM122B_ENST00000298090.6_Missense_Mutation_p.L35F|FAM122B_ENST00000493333.1_5'UTR|FAM122B_ENST00000486347.1_Missense_Mutation_p.L35F|FAM122C_ENST00000414371.2_5'Flank	NM_001166599.2|NM_145284.5	NP_001160071.1|NP_660327.2	Q7Z309	F122B_HUMAN	family with sequence similarity 122B	35										breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|skin(1)	6	Acute lymphoblastic leukemia(192;0.000127)					ACCTGTGAAAGGTCACTGAAA	0.328																																					p.L35F		.											.	FAM122B	130	0			c.C103T						.						91.0	85.0	87.0					X																	133927919		2203	4300	6503	SO:0001583	missense	159090	exon2			GTGAAAGGTCACT	BX538218	CCDS14643.1, CCDS55497.1, CCDS55498.1	Xq26.3	2008-02-05			ENSG00000156504	ENSG00000156504			30490	protein-coding gene	gene with protein product						12477932	Standard	NM_145284		Approved	DKFZp686L20116, RP11-308B5.5	uc004exq.3	Q7Z309	OTTHUMG00000022461	ENST00000370790.1:c.103C>T	X.37:g.133927919G>A	ENSP00000359826:p.Leu35Phe	43.0	0.0		47.0	7.0	NM_001170756	A8K902|Q6PIM2|Q6ZU47|Q6ZV64|Q6ZVE4|Q8TB75	Missense_Mutation	SNP	ENST00000370790.1	37	CCDS55497.1	.	.	.	.	.	.	.	.	.	.	G	7.356	0.623892	0.14193	.	.	ENSG00000156504	ENST00000370790;ENST00000298090;ENST00000343004;ENST00000394270;ENST00000486347;ENST00000370787	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	5.47	1.26	0.21427	.	0.680988	0.13649	N	0.372414	T	0.41581	0.1165	L	0.51422	1.61	0.25269	N	0.98953	B;B;B;B	0.12630	0.006;0.001;0.001;0.003	B;B;B;B	0.13407	0.009;0.004;0.004;0.006	T	0.39333	-0.9619	10	0.62326	D	0.03	.	3.8695	0.09030	0.3101:0.0:0.3565:0.3334	.	35;35;35;35	G1UD80;Q7Z309-2;Q7Z309;Q7Z309-3	.;.;F122B_HUMAN;.	F	35	ENSP00000359826:L35F;ENSP00000298090:L35F;ENSP00000339207:L35F;ENSP00000419592:L35F	ENSP00000298090:L35F	L	-	1	0	FAM122B	133755585	0.967000	0.33354	0.961000	0.40146	0.401000	0.30781	0.670000	0.25157	0.154000	0.19237	0.506000	0.49869	CTT	.		0.328	FAM122B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058382.1	NM_145284	
FAM160A1	729830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	152571045	152571045	+	Missense_Mutation	SNP	C	C	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr4:152571045C>G	ENST00000505231.1	+	9	2011	c.1852C>G	c.(1852-1854)Cag>Gag	p.Q618E	FAM160A1_ENST00000435205.1_Missense_Mutation_p.Q618E			Q05DH4	F16A1_HUMAN	family with sequence similarity 160, member A1	618										endometrium(2)|kidney(1)	3						CAAACACATCCAGGAGATGAA	0.542																																					p.Q618E		.											.	.	.	0			c.C1852G						.						57.0	65.0	63.0					4																	152571045		692	1591	2283	SO:0001583	missense	729830	exon11			CACATCCAGGAGA		CCDS47146.1	4q31.3	2012-11-30			ENSG00000164142	ENSG00000164142			34237	protein-coding gene	gene with protein product							Standard	NM_001109977		Approved	FLJ43373	uc003imj.2	Q05DH4	OTTHUMG00000161675	ENST00000505231.1:c.1852C>G	4.37:g.152571045C>G	ENSP00000421580:p.Gln618Glu	147.0	0.0		101.0	15.0	NM_001109977	Q6ZUS2	Missense_Mutation	SNP	ENST00000505231.1	37	CCDS47146.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.539979	0.85917	.	.	ENSG00000164142	ENST00000435205;ENST00000505231	T;T	0.15603	2.41;2.41	5.37	5.37	0.77165	.	.	.	.	.	T	0.40694	0.1127	M	0.66939	2.045	0.47407	D	0.999411	D	0.64830	0.994	D	0.70716	0.97	T	0.04565	-1.0942	9	0.25751	T	0.34	.	19.1588	0.93522	0.0:1.0:0.0:0.0	.	618	Q05DH4	F16A1_HUMAN	E	618	ENSP00000413196:Q618E;ENSP00000421580:Q618E	ENSP00000413196:Q618E	Q	+	1	0	FAM160A1	152790495	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.487000	0.81328	2.533000	0.85409	0.585000	0.79938	CAG	.		0.542	FAM160A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365691.1	NM_001109977	
FAM171A1	221061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	15326009	15326009	+	Missense_Mutation	SNP	A	A	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr10:15326009A>G	ENST00000378116.4	-	2	199	c.193T>C	c.(193-195)Tct>Cct	p.S65P		NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	65						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						GAGGTGCCAGAGGCTATGGAG	0.567																																					p.S65P		.											.	FAM171A1	138	0			c.T193C						.						79.0	71.0	74.0					10																	15326009		2203	4300	6503	SO:0001583	missense	221061	exon2			TGCCAGAGGCTAT	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.193T>C	10.37:g.15326009A>G	ENSP00000367356:p.Ser65Pro	143.0	0.0		97.0	35.0	NM_001010924	D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	ENST00000378116.4	37	CCDS31154.1	.	.	.	.	.	.	.	.	.	.	A	18.63	3.665484	0.67700	.	.	ENSG00000148468	ENST00000378116;ENST00000378114;ENST00000396781;ENST00000455654	T;T	0.40476	1.03;1.03	5.25	5.25	0.73442	.	0.165668	0.56097	D	0.000036	T	0.55986	0.1955	M	0.74881	2.28	0.51482	D	0.999923	P	0.46512	0.879	P	0.50314	0.637	T	0.62666	-0.6806	10	0.87932	D	0	-13.882	15.4481	0.75248	1.0:0.0:0.0:0.0	.	65	Q5VUB5	F1711_HUMAN	P	65;65;66;65	ENSP00000367356:S65P;ENSP00000407796:S65P	ENSP00000367354:S65P	S	-	1	0	FAM171A1	15366015	1.000000	0.71417	0.991000	0.47740	0.688000	0.40055	2.921000	0.48852	2.111000	0.64477	0.482000	0.46254	TCT	.		0.567	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709	
FAM47A	158724	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	34149907	34149907	+	Missense_Mutation	SNP	C	C	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chrX:34149907C>A	ENST00000346193.3	-	1	540	c.489G>T	c.(487-489)tgG>tgT	p.W163C		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	163										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						CACAACAAGCCCAAGCGTCCT	0.557																																					p.W163C		.											.	FAM47A	134	0			c.G489T						.						68.0	65.0	66.0					X																	34149907		2202	4300	6502	SO:0001583	missense	158724	exon1			ACAAGCCCAAGCG	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.489G>T	X.37:g.34149907C>A	ENSP00000345029:p.Trp163Cys	224.0	0.0		152.0	12.0	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	C	2.401	-0.337539	0.05278	.	.	ENSG00000185448	ENST00000346193	T	0.15256	2.44	1.1	0.107	0.14544	.	.	.	.	.	T	0.24084	0.0583	L	0.38953	1.18	0.09310	N	0.999999	D	0.89917	1.0	D	0.78314	0.991	T	0.12630	-1.0540	9	0.41790	T	0.15	.	4.001	0.09580	0.4092:0.5908:0.0:0.0	.	163	Q5JRC9	FA47A_HUMAN	C	163	ENSP00000345029:W163C	ENSP00000345029:W163C	W	-	3	0	FAM47A	34059828	0.004000	0.15560	0.010000	0.14722	0.024000	0.10985	0.441000	0.21611	-0.027000	0.13873	0.499000	0.49734	TGG	.		0.557	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
BRINP3	339479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	190195248	190195248	+	Missense_Mutation	SNP	T	T	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:190195248T>G	ENST00000367462.3	-	6	1156	c.925A>C	c.(925-927)Acc>Ccc	p.T309P	BRINP3_ENST00000463404.1_5'UTR|BRINP3_ENST00000534846.1_Missense_Mutation_p.T207P	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	309					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											GCTTTCCAGGTTTCAGTTATT	0.363																																					p.T309P		.											.	FAM5C	228	0			c.A925C						.						70.0	68.0	69.0					1																	190195248		2203	4299	6502	SO:0001583	missense	339479	exon6			TCCAGGTTTCAGT	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.925A>C	1.37:g.190195248T>G	ENSP00000356432:p.Thr309Pro	72.0	0.0		57.0	29.0	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.965554	0.74131	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.18657	2.47;2.2	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.31796	0.0808	L	0.46157	1.445	0.53005	D	0.99996	D;P	0.55385	0.971;0.917	P;B	0.52343	0.696;0.348	T	0.02037	-1.1225	10	0.72032	D	0.01	.	14.5927	0.68378	0.0:0.0:0.0:1.0	.	207;309	B7Z260;Q76B58	.;FAM5C_HUMAN	P	309;207	ENSP00000356432:T309P;ENSP00000438022:T207P	ENSP00000356432:T309P	T	-	1	0	FAM5C	188461871	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.944000	0.49034	2.326000	0.78906	0.533000	0.62120	ACC	.		0.363	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
FLNC	2318	broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	128482322	128482322	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr7:128482322C>T	ENST00000325888.8	+	14	2420	c.2159C>T	c.(2158-2160)cCc>cTc	p.P720L	FLNC_ENST00000346177.6_Missense_Mutation_p.P720L	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	720					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						AAGGTGATCCCCAACGGCGAC	0.622											OREG0018297	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P720L		.											.	FLNC	141	0			c.C2159T						.						53.0	65.0	61.0					7																	128482322		2151	4240	6391	SO:0001583	missense	2318	exon14			TGATCCCCAACGG	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.2159C>T	7.37:g.128482322C>T	ENSP00000327145:p.Pro720Leu	166.0	1.0	1565	144.0	10.0	NM_001127487	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	C	19.47	3.834236	0.71373	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.84730	-1.89;-1.89	5.54	5.54	0.83059	Immunoglobulin E-set (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.353337	0.28104	N	0.016599	T	0.77054	0.4074	L	0.37697	1.125	0.49687	D	0.999819	B;B	0.33345	0.409;0.04	B;B	0.30251	0.113;0.103	T	0.77678	-0.2498	10	0.87932	D	0	.	9.2122	0.37326	0.251:0.6045:0.1445:0.0	.	720;720	Q14315-2;Q14315	.;FLNC_HUMAN	L	720	ENSP00000327145:P720L;ENSP00000344002:P720L	ENSP00000327145:P720L	P	+	2	0	FLNC	128269558	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.126000	0.50477	2.607000	0.88179	0.650000	0.86243	CCC	.		0.622	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
FRMPD1	22844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	37746731	37746731	+	Missense_Mutation	SNP	T	T	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr9:37746731T>G	ENST00000539465.1	+	16	5295	c.4702T>G	c.(4702-4704)Ttg>Gtg	p.L1568V	FRMPD1_ENST00000377765.3_Missense_Mutation_p.L1568V|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1568						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		CGTGTTCTGTTTGACCCAGAA	0.607																																					p.L1568V		.											.	FRMPD1	159	0			c.T4702G						.						73.0	80.0	78.0					9																	37746731		2203	4299	6502	SO:0001583	missense	22844	exon16			TTCTGTTTGACCC	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.4702T>G	9.37:g.37746731T>G	ENSP00000444411:p.Leu1568Val	131.0	0.0		116.0	18.0	NM_014907	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.947019	0.73672	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.25414	1.8;1.8	5.71	4.38	0.52667	.	0.000000	0.64402	D	0.000002	T	0.44850	0.1313	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.41233	-0.9520	10	0.87932	D	0	-4.6909	9.9902	0.41865	0.0:0.0922:0.0:0.9078	.	1568	Q5SYB0	FRPD1_HUMAN	V	1568	ENSP00000366995:L1568V;ENSP00000444411:L1568V	ENSP00000366995:L1568V	L	+	1	2	FRMPD1	37736731	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.449000	0.52950	2.183000	0.69458	0.533000	0.62120	TTG	.		0.607	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
FNBP1	23048	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	132691907	132691907	+	Missense_Mutation	SNP	A	A	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr9:132691907A>G	ENST00000446176.2	-	7	767	c.581T>C	c.(580-582)cTc>cCc	p.L194P	FNBP1_ENST00000420781.1_Missense_Mutation_p.L194P|FNBP1_ENST00000478129.1_5'Flank|FNBP1_ENST00000355681.3_Missense_Mutation_p.L194P	NM_015033.2	NP_055848.1	Q96RU3	FNBP1_HUMAN	formin binding protein 1	194	F-BAR domain.|Interaction with microtubules. {ECO:0000250}.				endocytosis (GO:0006897)	coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)						Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		GAATTTCTGGAGAATGGATGA	0.418			T	MLL	AML																																p.L194P		.		Dom	yes		9	9q23	23048	formin binding protein 1 (FBP17)		L	.	.	.	0			c.T581C						.						232.0	226.0	228.0					9																	132691907		1962	4149	6111	SO:0001583	missense	23048	exon7			TTCTGGAGAATGG	AB011126	CCDS48040.1	9q34	2008-02-05			ENSG00000187239	ENSG00000187239			17069	protein-coding gene	gene with protein product		606191				9628581, 11438682	Standard	XM_005251815		Approved	FBP17, KIAA0554	uc004byw.1	Q96RU3	OTTHUMG00000020800	ENST00000446176.2:c.581T>C	9.37:g.132691907A>G	ENSP00000413625:p.Leu194Pro	211.0	0.0		201.0	49.0	NM_015033	O60301|Q3MIN8|Q5TC87|Q5TC88|Q6P658|Q7LGG2|Q9H8H8|Q9NWD1	Missense_Mutation	SNP	ENST00000446176.2	37	CCDS48040.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.11|18.11	3.551006|3.551006	0.65311|0.65311	.|.	.|.	ENSG00000187239|ENSG00000187239	ENST00000372416;ENST00000446176;ENST00000420781;ENST00000372415;ENST00000355681|ENST00000449089	T;T;T|.	0.55052|.	0.54;0.54;0.54|.	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77425|0.77425	0.4128|0.4128	M|M	0.84219|0.84219	2.685|2.685	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D|.	0.97110|.	0.994;0.999;0.998;1.0;0.999;0.998;0.999|.	T|T	0.79964|0.79964	-0.1581|-0.1581	10|5	0.87932|.	D|.	0|.	-19.4964|-19.4964	14.387|14.387	0.66953|0.66953	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	194;194;194;194;155;194;194|.	B7ZL12;B7ZL13;B7ZL14;Q96RU3-3;Q5QP69;Q96RU3-2;Q96RU3|.	.;.;.;.;.;.;FNBP1_HUMAN|.	P|P	194|156	ENSP00000413625:L194P;ENSP00000407548:L194P;ENSP00000347907:L194P|.	ENSP00000347907:L194P|.	L|S	-|-	2|1	0|0	FNBP1|FNBP1	131731728|131731728	1.000000|1.000000	0.71417|0.71417	0.355000|0.355000	0.25773|0.25773	0.532000|0.532000	0.34746|0.34746	8.962000|8.962000	0.93254|0.93254	1.977000|1.977000	0.57605|0.57605	0.528000|0.528000	0.53228|0.53228	CTC|TCC	.		0.418	FNBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054630.2		
GABRA1	2554	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	161324184	161324184	+	Missense_Mutation	SNP	C	C	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr5:161324184C>A	ENST00000428797.2	+	11	1482	c.1127C>A	c.(1126-1128)aCc>aAc	p.T376N	GABRA1_ENST00000393943.4_Missense_Mutation_p.T376N|GABRA1_ENST00000437025.2_Missense_Mutation_p.T376N|GABRA1_ENST00000420560.1_Missense_Mutation_p.T376N|GABRA1_ENST00000444819.1_Missense_Mutation_p.T376N|GABRA1_ENST00000023897.6_Missense_Mutation_p.T376N	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	376					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.T376N(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	ACCAGCTACACCCCTAATTTG	0.453																																					p.T376N		.											GABRA1,NS,NS,0	GABRA1	93	1	Substitution - Missense(1)	pancreas(1)	c.C1127A						.						104.0	116.0	112.0					5																	161324184		2203	4300	6503	SO:0001583	missense	2554	exon11			GCTACACCCCTAA		CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.1127C>A	5.37:g.161324184C>A	ENSP00000393097:p.Thr376Asn	125.0	0.0		120.0	7.0	NM_001127643	D3DQK6|Q8N629	Missense_Mutation	SNP	ENST00000428797.2	37	CCDS4357.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.769225	0.49680	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000420560;ENST00000444819	D;D;D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5;-1.5;-1.5	5.32	5.32	0.75619	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.174985	0.38663	U	0.001613	T	0.77928	0.4204	L	0.36672	1.1	0.49582	D	0.9998	P	0.37594	0.601	B	0.42959	0.403	T	0.73541	-0.3950	10	0.21540	T	0.41	.	19.3564	0.94416	0.0:1.0:0.0:0.0	.	376	P14867	GBRA1_HUMAN	N	376	ENSP00000023897:T376N;ENSP00000393097:T376N;ENSP00000377517:T376N;ENSP00000415441:T376N;ENSP00000408041:T376N;ENSP00000414232:T376N	ENSP00000023897:T376N	T	+	2	0	GABRA1	161256762	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.395000	0.79876	2.642000	0.89623	0.563000	0.77884	ACC	.		0.453	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252702.2	NM_000806.5	
GALNTL6	442117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	173942670	173942670	+	Missense_Mutation	SNP	C	C	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr4:173942670C>G	ENST00000506823.1	+	12	2189	c.1532C>G	c.(1531-1533)cCa>cGa	p.P511R	GALNTL6_ENST00000508122.1_Missense_Mutation_p.P494R	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	511	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.?(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						CCCGGTGAGCCACTGCATACC	0.483																																					p.P511R		.											.	GALNTL6	137	1	Unknown(1)	breast(1)	c.C1532G						.						149.0	139.0	143.0					4																	173942670		2203	4300	6503	SO:0001583	missense	442117	exon12			GTGAGCCACTGCA		CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.1532C>G	4.37:g.173942670C>G	ENSP00000423313:p.Pro511Arg	168.0	0.0		113.0	44.0	NM_001034845	Q2L4S6	Missense_Mutation	SNP	ENST00000506823.1	37	CCDS34104.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.278701	0.59758	.	.	ENSG00000174473	ENST00000506823;ENST00000508122	T;T	0.25749	1.78;1.78	5.81	5.81	0.92471	Ricin B-related lectin (1);Ricin B lectin (3);	0.075225	0.56097	D	0.000025	T	0.50803	0.1637	M	0.65320	2	0.80722	D	1	D	0.76494	0.999	D	0.71656	0.974	T	0.40869	-0.9540	10	0.52906	T	0.07	.	20.0817	0.97778	0.0:1.0:0.0:0.0	.	511	Q49A17	GLTL6_HUMAN	R	511;494	ENSP00000423313:P511R;ENSP00000423827:P494R	ENSP00000423313:P511R	P	+	2	0	GALNTL6	174179245	1.000000	0.71417	0.969000	0.41365	0.084000	0.17831	7.458000	0.80787	2.743000	0.94032	0.650000	0.86243	CCA	.		0.483	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362395.1	NM_001034845	
GPR31	2853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	167571101	167571101	+	Silent	SNP	G	G	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr6:167571101G>A	ENST00000366834.1	-	1	716	c.219C>T	c.(217-219)ttC>ttT	p.F73F		NM_005299.2	NP_005290.2	O00270	GPR31_HUMAN	G protein-coupled receptor 31	73				F -> L (in Ref. 5; AAH95537). {ECO:0000305}.	G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(4)|large_intestine(4)|lung(7)|prostate(1)	17		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)		GGCTCAGGTAGAAGGCGGCCA	0.667																																					p.F73F		.											.	GPR31	90	0			c.C219T						.						37.0	32.0	34.0					6																	167571101		2201	4298	6499	SO:0001819	synonymous_variant	2853	exon1			CAGGTAGAAGGCG	U65402	CCDS5299.1	6q27	2012-08-21				ENSG00000120436		"""GPCR / Class A : Orphans"""	4486	protein-coding gene	gene with protein product	"""hydroxyeicosatetraenoic (HETE) acid receptor 1"", ""12-(S)-HETE acid receptor"""	602043				9205127, 21712392	Standard	NM_005299		Approved	HETER1, 12-HETER	uc011egq.2	O00270		ENST00000366834.1:c.219C>T	6.37:g.167571101G>A		265.0	0.0		170.0	47.0	NM_005299	B0M0K2|Q4VBL3|Q9NQ20	Silent	SNP	ENST00000366834.1	37	CCDS5299.1																																																																																			.		0.667	GPR31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043111.1	NM_005299	
GPR34	2857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	41555817	41555817	+	Missense_Mutation	SNP	A	A	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chrX:41555817A>T	ENST00000378142.4	+	3	1215	c.931A>T	c.(931-933)Atc>Ttc	p.I311F	CASK_ENST00000378166.4_Intron|CASK_ENST00000378154.1_Intron|CASK_ENST00000378158.1_Intron|CASK_ENST00000421587.2_Intron|CASK_ENST00000361962.4_Intron|GPR34_ENST00000378138.5_Missense_Mutation_p.I311F|CASK_ENST00000378163.1_Intron|CASK_ENST00000442742.2_Intron|CASK_ENST00000318588.9_Intron	NM_001097579.1|NM_005300.3	NP_001091048.1|NP_005291.1	Q9UPC5	GPR34_HUMAN	G protein-coupled receptor 34	311					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	14						AACCAATGAGATCATGCTGGT	0.358																																					p.I311F		.											.	GPR34	131	0			c.A931T						.						136.0	111.0	120.0					X																	41555817		2203	4300	6503	SO:0001583	missense	2857	exon3			AATGAGATCATGC	AF039686	CCDS14258.1	Xp11.4	2012-08-21			ENSG00000171659	ENSG00000171659		"""GPCR / Class A : Orphans"""	4490	protein-coding gene	gene with protein product		300241				10395919, 10036181	Standard	NM_005300		Approved		uc004dfq.4	Q9UPC5	OTTHUMG00000021375	ENST00000378142.4:c.931A>T	X.37:g.41555817A>T	ENSP00000367384:p.Ile311Phe	143.0	0.0		103.0	36.0	NM_001097579	O95853	Missense_Mutation	SNP	ENST00000378142.4	37	CCDS14258.1	.	.	.	.	.	.	.	.	.	.	A	15.60	2.880484	0.51801	.	.	ENSG00000171659	ENST00000378142;ENST00000378138;ENST00000535368	T;T	0.27104	1.69;1.69	5.73	5.73	0.89815	GPCR, rhodopsin-like superfamily (1);	0.242157	0.42294	D	0.000735	T	0.37812	0.1017	L	0.40543	1.245	0.51012	D	0.999907	D	0.63880	0.993	D	0.70487	0.969	T	0.28138	-1.0053	10	0.87932	D	0	-12.6891	7.5581	0.27835	0.8626:0.0:0.1374:0.0	.	311	Q9UPC5	GPR34_HUMAN	F	311;311;264	ENSP00000367384:I311F;ENSP00000367378:I311F	ENSP00000367378:I311F	I	+	1	0	GPR34	41440761	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.255000	0.43222	1.922000	0.55676	0.481000	0.45027	ATC	.		0.358	GPR34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056264.1	NM_005300	
GPRASP2	114928	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	101970175	101970185	+	Frame_Shift_Del	DEL	CCAGGCATGGG	CCAGGCATGGG	-	rs61097741|rs538885190		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	CCAGGCATGGG	CCAGGCATGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chrX:101970175_101970185delCCAGGCATGGG	ENST00000535209.1	+	4	1209_1219	c.378_388delCCAGGCATGGG	c.(376-390)gcccaggcatgggccfs	p.AQAWA126fs	GPRASP2_ENST00000332262.5_Frame_Shift_Del_p.AQAWA126fs|GPRASP2_ENST00000543253.1_Frame_Shift_Del_p.AQAWA126fs			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	126						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						AGGATGAGGCCCAGGCATGGGCCCAGAGTGA	0.583																																					p.126_130del		.											.	GPRASP2	131	0			c.378_388del						.																																			SO:0001589	frameshift_variant	114928	exon4			TGAGGCCCAGGCA	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.378_388delCCAGGCATGGG	X.37:g.101970175_101970185delCCAGGCATGGG	ENSP00000437394:p.Ala126fs	146.0	0.0		125.0	29.0	NM_138437	D3DXA0|Q8NAB4	Frame_Shift_Del	DEL	ENST00000535209.1	37	CCDS14501.1																																																																																			.		0.583	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437	
GRM7	2917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	7494474	7494474	+	Missense_Mutation	SNP	T	T	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr3:7494474T>C	ENST00000357716.4	+	6	1629	c.1355T>C	c.(1354-1356)aTa>aCa	p.I452T	GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000486284.1_Missense_Mutation_p.I452T|GRM7_ENST00000389336.4_Missense_Mutation_p.I452T|GRM7_ENST00000403881.1_Missense_Mutation_p.I452T|GRM7_ENST00000402647.2_Missense_Mutation_p.I452T	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	452					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						CTGAAGTATATACGCAATGTT	0.423																																					p.I452T		.											.	GRM7	526	0			c.T1355C						.						67.0	59.0	62.0					3																	7494474		2203	4300	6503	SO:0001583	missense	2917	exon6			AGTATATACGCAA	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.1355T>C	3.37:g.7494474T>C	ENSP00000350348:p.Ile452Thr	159.0	0.0		124.0	43.0	NM_000844	Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.368242	0.82463	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492;ENST00000445087	D;D;D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27;-2.27;-2.27	5.88	5.88	0.94601	Extracellular ligand-binding receptor (1);	0.051654	0.85682	D	0.000000	D	0.92714	0.7684	M	0.87547	2.89	0.58432	D	0.999999	P;P;P;D	0.56035	0.728;0.896;0.77;0.974	B;B;B;P	0.55785	0.272;0.393;0.393;0.784	D	0.93829	0.7126	10	0.87932	D	0	.	15.1249	0.72475	0.0:0.0:0.0:1.0	.	452;207;452;452	Q14831-5;Q59G95;Q14831;Q14831-2	.;.;GRM7_HUMAN;.	T	452;452;452;452;452;452;452;109	ENSP00000350348:I452T;ENSP00000417536:I452T;ENSP00000373987:I452T;ENSP00000385664:I452T;ENSP00000384585:I452T;ENSP00000395035:I109T	ENSP00000350348:I452T	I	+	2	0	GRM7	7469474	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	8.040000	0.89188	2.246000	0.74042	0.533000	0.62120	ATA	.		0.423	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844	
GZMM	3004	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	549779	549779	+	Silent	SNP	C	C	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:549779C>G	ENST00000264553.3	+	5	800	c.762C>G	c.(760-762)ggC>ggG	p.G254G		NM_001258351.1|NM_005317.3	NP_001245280.1|NP_005308	P51124	GRAM_HUMAN	granzyme M (lymphocyte met-ase 1)	254	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|membrane (GO:0016020)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|large_intestine(1)|prostate(1)	3		all_cancers(10;1.94e-35)|all_epithelial(18;5.94e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGTCACCGGCCGATCGGCCT	0.662																																					p.G254G		.											.	GZMM	90	0			c.C762G						.						72.0	58.0	63.0					19																	549779		2203	4300	6503	SO:0001819	synonymous_variant	3004	exon5			CACCGGCCGATCG		CCDS12031.1, CCDS74240.1	19p13.3	2008-07-16				ENSG00000197540			4712	protein-coding gene	gene with protein product	"""lymphocyte met-ase 1"""	600311				8119738	Standard	NM_005317		Approved	MET1, LMET1	uc002low.2	P51124		ENST00000264553.3:c.762C>G	19.37:g.549779C>G		72.0	0.0		45.0	18.0	NM_005317		Silent	SNP	ENST00000264553.3	37	CCDS12031.1																																																																																			.		0.662	GZMM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451895.2	NM_005317	
GYS1	2997	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49472819	49472819	+	Missense_Mutation	SNP	G	G	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:49472819G>A	ENST00000323798.3	-	16	2136	c.1940C>T	c.(1939-1941)tCg>tTg	p.S647L	GYS1_ENST00000544287.1_Missense_Mutation_p.S280L|GYS1_ENST00000541188.1_Missense_Mutation_p.S567L|GYS1_ENST00000263276.6_Missense_Mutation_p.S583L	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	647					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		TCGTGACAGCGAGGGCGACGG	0.672																																					p.S647L		.											.	GYS1	524	0			c.C1940T						.						31.0	16.0	21.0					19																	49472819		2013	3907	5920	SO:0001583	missense	2997	exon16			GACAGCGAGGGCG		CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.1940C>T	19.37:g.49472819G>A	ENSP00000317904:p.Ser647Leu	41.0	0.0		31.0	12.0	NM_002103	Q9BTT9	Missense_Mutation	SNP	ENST00000323798.3	37	CCDS12747.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.596090	0.86953	.	.	ENSG00000104812	ENST00000323798;ENST00000263276;ENST00000541188;ENST00000544287	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	5.71	5.71	0.89125	.	0.122704	0.56097	D	0.000036	T	0.67795	0.2931	M	0.75777	2.31	0.80722	D	1	P;P;P	0.43750	0.816;0.816;0.816	B;B;B	0.38106	0.265;0.265;0.265	T	0.71852	-0.4467	10	0.48119	T	0.1	-13.9468	17.7236	0.88359	0.0:0.0:1.0:0.0	.	567;583;647	B7Z806;Q9BTT9;P13807	.;.;GYS1_HUMAN	L	647;583;567;280	ENSP00000317904:S647L;ENSP00000263276:S583L;ENSP00000437922:S567L;ENSP00000444004:S280L	ENSP00000263276:S583L	S	-	2	0	GYS1	54164631	1.000000	0.71417	0.976000	0.42696	0.985000	0.73830	9.139000	0.94554	2.854000	0.98071	0.655000	0.94253	TCG	.		0.672	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1	NM_002103	
HECW2	57520	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	197189763	197189763	+	Missense_Mutation	SNP	C	C	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr2:197189763C>A	ENST00000260983.3	-	6	864	c.682G>T	c.(682-684)Ggg>Tgg	p.G228W	HECW2_ENST00000409111.1_5'UTR	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	228	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.G228W(1)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						CTCTCCTGCCCGTGGTGGGCA	0.493																																					p.G228W		.											.	HECW2	668	1	Substitution - Missense(1)	lung(1)	c.G682T						.						268.0	242.0	250.0					2																	197189763		2203	4300	6503	SO:0001583	missense	57520	exon6			CCTGCCCGTGGTG	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.682G>T	2.37:g.197189763C>A	ENSP00000260983:p.Gly228Trp	266.0	1.0		228.0	77.0	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.156371	0.78114	.	.	ENSG00000138411	ENST00000260983	T	0.44083	0.93	5.2	5.2	0.72013	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.054518	0.64402	D	0.000001	T	0.67599	0.2910	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71196	-0.4664	10	0.87932	D	0	.	18.9309	0.92564	0.0:1.0:0.0:0.0	.	228	Q9P2P5	HECW2_HUMAN	W	228	ENSP00000260983:G228W	ENSP00000260983:G228W	G	-	1	0	HECW2	196898008	1.000000	0.71417	0.986000	0.45419	0.550000	0.35303	7.228000	0.78079	2.699000	0.92147	0.655000	0.94253	GGG	.		0.493	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
HNRNPH1	3187	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	179047996	179047996	+	Missense_Mutation	SNP	C	C	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr5:179047996C>A	ENST00000356731.5	-	3	1829	c.294G>T	c.(292-294)aaG>aaT	p.K98N	HNRNPH1_ENST00000393432.4_Missense_Mutation_p.K98N|HNRNPH1_ENST00000524180.1_5'UTR|HNRNPH1_ENST00000442819.2_Missense_Mutation_p.K98N|HNRNPH1_ENST00000510411.1_Missense_Mutation_p.K98N|HNRNPH1_ENST00000329433.6_Missense_Mutation_p.K98N			P31943	HNRH1_HUMAN	heterogeneous nuclear ribonucleoprotein H1 (H)	98					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|skin(1)	14						GACCAGTATGCTTCAACACCC	0.398																																					p.K98N		.											.	HNRNPH1	22	0			c.G294T						.						144.0	135.0	138.0					5																	179047996		2203	4300	6503	SO:0001583	missense	3187	exon4			AGTATGCTTCAAC	BC001348	CCDS4446.1	5q35.3	2013-02-12		2008-04-18	ENSG00000169045	ENSG00000169045		"""RNA binding motif (RRM) containing"""	5041	protein-coding gene	gene with protein product		601035		HNRPH1		7499401	Standard	NM_005520		Approved	hnRNPH	uc003mkf.5	P31943	OTTHUMG00000130908	ENST00000356731.5:c.294G>T	5.37:g.179047996C>A	ENSP00000349168:p.Lys98Asn	254.0	1.0		250.0	61.0	NM_001257293	B3KW86|D3DWQ2|Q6IBM4	Missense_Mutation	SNP	ENST00000356731.5	37	CCDS4446.1	.	.	.	.	.	.	.	.	.	.	c	18.27	3.585887	0.66105	.	.	ENSG00000169045	ENST00000393432;ENST00000442819;ENST00000356731;ENST00000329433;ENST00000510411;ENST00000503105;ENST00000508103;ENST00000506721;ENST00000505811;ENST00000510431;ENST00000519056;ENST00000521790;ENST00000504348;ENST00000513225;ENST00000515158;ENST00000521116	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.67;2.18;3.37;1.6;1.6;1.6	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.49012	0.1532	L	0.52905	1.665	0.80722	D	1	D	0.53885	0.963	P	0.59761	0.863	T	0.41875	-0.9484	10	0.48119	T	0.1	-6.945	18.8018	0.92021	0.0:1.0:0.0:0.0	.	98	P31943	HNRH1_HUMAN	N	98;98;98;98;98;98;98;98;98;98;46;21;98;98;98;98	ENSP00000377082:K98N;ENSP00000397797:K98N;ENSP00000349168:K98N;ENSP00000327539:K98N;ENSP00000426275:K98N;ENSP00000427408:K98N;ENSP00000425732:K98N;ENSP00000420850:K98N;ENSP00000424087:K98N;ENSP00000423140:K98N;ENSP00000430970:K46N;ENSP00000430156:K21N;ENSP00000427388:K98N;ENSP00000426518:K98N;ENSP00000421695:K98N;ENSP00000429661:K98N	ENSP00000327539:K98N	K	-	3	2	HNRNPH1	178980602	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.859000	0.62954	2.526000	0.85167	0.491000	0.48974	AAG	.		0.398	HNRNPH1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253497.3	NM_005520	
HOXA6	3203	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	27186959	27186959	+	Missense_Mutation	SNP	T	T	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr7:27186959T>A	ENST00000222728.3	-	1	434	c.410A>T	c.(409-411)tAc>tTc	p.Y137F	HOXA-AS3_ENST00000518947.2_RNA|HOXA-AS3_ENST00000521231.1_RNA|RP1-170O19.23_ENST00000498652.1_RNA|HOXA-AS3_ENST00000521197.1_RNA|HOXA6_ENST00000521478.1_5'UTR|HOXA-AS3_ENST00000524304.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000518848.1_RNA	NM_024014.3	NP_076919.1	P31267	HXA6_HUMAN	homeobox A6	137					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(5)|lung(3)|ovary(1)	10						CATCCAAGGGTAAACCGGGCT	0.572																																					p.Y137F		.											.	HOXA6	91	0			c.A410T						.						89.0	85.0	87.0					7																	27186959		2203	4300	6503	SO:0001583	missense	3203	exon1			CAAGGGTAAACCG		CCDS5407.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106006	ENSG00000106006		"""Homeoboxes / ANTP class : HOXL subclass"""	5107	protein-coding gene	gene with protein product		142951	"""homeo box A6"""	HOX1B, HOX1		1973146, 1358459	Standard	NM_024014		Approved		uc003syo.2	P31267	OTTHUMG00000023216	ENST00000222728.3:c.410A>T	7.37:g.27186959T>A	ENSP00000222728:p.Tyr137Phe	88.0	1.0		90.0	28.0	NM_024014	A4D192|Q2M3G3|Q9UPM0	Missense_Mutation	SNP	ENST00000222728.3	37	CCDS5407.1	.	.	.	.	.	.	.	.	.	.	t	21.7	4.185359	0.78677	.	.	ENSG00000106006	ENST00000222728	D	0.95554	-3.74	5.07	5.07	0.68467	Homeodomain-like (1);Homeobox protein, antennapedia type, conserved site (1);	0.000000	0.64402	D	0.000001	D	0.95124	0.8420	N	0.20574	0.59	0.58432	D	0.999999	D	0.63880	0.993	D	0.70227	0.968	D	0.95730	0.8774	10	0.52906	T	0.07	.	14.8572	0.70347	0.0:0.0:0.0:1.0	.	137	P31267	HXA6_HUMAN	F	137	ENSP00000222728:Y137F	ENSP00000222728:Y137F	Y	-	2	0	HOXA6	27153484	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	5.752000	0.68728	1.903000	0.55091	0.529000	0.55759	TAC	.		0.572	HOXA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358697.1		
HSPA14	51182	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	14890638	14890638	+	Silent	SNP	C	C	T	rs375004850		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr10:14890638C>T	ENST00000378372.3	+	4	491	c.252C>T	c.(250-252)atC>atT	p.I84I		NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14	84					'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)			breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						AGAAATACATCGCGGAAAGTA	0.328																																					p.I84I		.											.	HSPA14	291	0			c.C252T						.						108.0	95.0	99.0					10																	14890638		2203	4299	6502	SO:0001819	synonymous_variant	51182	exon4			ATACATCGCGGAA	AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.252C>T	10.37:g.14890638C>T		76.0	0.0		45.0	12.0	NM_016299	A8K8F8|B0YIY9|Q9P0X2|Q9UI07	Silent	SNP	ENST00000378372.3	37	CCDS7103.1	.	.	.	.	.	.	.	.	.	.	C	8.509	0.866065	0.17250	.	.	ENSG00000187522	ENST00000441647	.	.	.	5.89	4.97	0.65823	.	.	.	.	.	T	0.55909	0.1950	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54912	-0.8222	4	.	.	.	-6.1368	6.1276	0.20187	0.1413:0.6466:0.1364:0.0758	.	.	.	.	L	73	.	.	S	+	2	0	HSPA14	14930644	0.334000	0.24739	0.891000	0.34965	0.990000	0.78478	0.680000	0.25306	1.441000	0.47550	0.655000	0.94253	TCG	.		0.328	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046910.1	NM_016299	
HTT	3064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	3237426	3237426	+	Silent	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr4:3237426G>T	ENST00000355072.5	+	63	8851	c.8706G>T	c.(8704-8706)ctG>ctT	p.L2902L		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2902					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TGGTCAAGCTGAGTGTGGACA	0.627																																					p.L2902L		.											.	HTT	281	0			c.G8706T						.						41.0	46.0	44.0					4																	3237426		2137	4251	6388	SO:0001819	synonymous_variant	3064	exon63			CAAGCTGAGTGTG	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.8706G>T	4.37:g.3237426G>T		97.0	0.0		56.0	27.0	NM_002111	Q9UQB7	Silent	SNP	ENST00000355072.5	37	CCDS43206.1																																																																																			.		0.627	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
IGF2R	3482	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	160494391	160494391	+	Missense_Mutation	SNP	G	G	A	rs375863720		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr6:160494391G>A	ENST00000356956.1	+	34	4985	c.4837G>A	c.(4837-4839)Gtg>Atg	p.V1613M		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1613					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	GATCAGTTTCGTGTGCAGGCC	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		20337	0.001		0.0	False		,,,				2504	0.0				p.V1613M		.											.	IGF2R	118	0			c.G4837A						.	G	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	168.0	127.0	141.0		4837	5.3	1.0	6		141	0,8600		0,0,4300	no	missense	IGF2R	NM_000876.2	21	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1613/2492	160494391	1,13005	2203	4300	6503	SO:0001583	missense	3482	exon34			AGTTTCGTGTGCA	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.4837G>A	6.37:g.160494391G>A	ENSP00000349437:p.Val1613Met	233.0	0.0		164.0	7.0	NM_000876	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.058852	0.76074	2.27E-4	0.0	ENSG00000197081	ENST00000356956	T	0.12984	2.63	5.3	5.3	0.74995	Mannose-6-phosphate receptor, binding (1);	0.138533	0.50627	D	0.000118	T	0.35335	0.0928	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.19844	-1.0293	10	0.72032	D	0.01	-11.0221	19.3023	0.94148	0.0:0.0:1.0:0.0	.	1613	P11717	MPRI_HUMAN	M	1613	ENSP00000349437:V1613M	ENSP00000349437:V1613M	V	+	1	0	IGF2R	160414381	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	5.163000	0.64948	2.639000	0.89480	0.561000	0.74099	GTG	.		0.582	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
JMY	133746	broad.mit.edu;bcgsc.ca	37	5	78533507	78533522	+	Splice_Site	DEL	TGAGTGAGTGAGCTCC	TGAGTGAGTGAGCTCC	-	rs373550284		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	TGAGTGAGTGAGCTCC	TGAGTGAGTGAGCTCC	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr5:78533507_78533522delTGAGTGAGTGAGCTCC	ENST00000396137.4	+	1	1494		c.e1+2		DMGDH_ENST00000520388.1_5'Flank	NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor						'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		ATCCAGGAGGTGAGTGAGTGAGCTCCTAGTCTGGGC	0.569																																					.		.											.	JMY	227	0			.						.																																			SO:0001630	splice_region_variant	133746	.			AGGAGGTGAGTGA	AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.1032+2TGAGTGAGTGAGCTCC>-	5.37:g.78533507_78533522delTGAGTGAGTGAGCTCC		149.0	0.0		109.0	8.0	.	A1L4P5|B5MDS2|B5MDT0	Splice_Site	DEL	ENST00000396137.4	37	CCDS4047.3																																																																																			.		0.569	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254070.4	NM_152405	Intron
KCNA2	3737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	111147065	111147065	+	Missense_Mutation	SNP	G	G	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:111147065G>A	ENST00000485317.1	-	3	1013	c.340C>T	c.(340-342)Cgg>Tgg	p.R114W	KCNA2_ENST00000440270.1_Missense_Mutation_p.R114W|KCNA2_ENST00000525120.1_Intron|KCNA2_ENST00000369770.3_Missense_Mutation_p.R114W|KCNA2_ENST00000316361.4_Missense_Mutation_p.R114W			P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 2	114					optic nerve structural organization (GO:0021633)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)	Dalfampridine(DB06637)	TCATAAAACCGAATTTCTTCA	0.478																																					p.R114W	Pancreas(18;568 735 10587 23710 36357)	.											.	KCNA2	91	0			c.C340T						.						41.0	43.0	42.0					1																	111147065		2203	4300	6503	SO:0001583	missense	3737	exon3			AAAACCGAATTTC	L02752	CCDS827.1, CCDS55625.1	1p13	2012-07-05			ENSG00000177301	ENSG00000177301		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6220	protein-coding gene	gene with protein product		176262				16382104	Standard	NM_004974		Approved	Kv1.2, HK4	uc009wfw.3	P16389	OTTHUMG00000011567	ENST00000485317.1:c.340C>T	1.37:g.111147065G>A	ENSP00000433109:p.Arg114Trp	76.0	0.0		46.0	15.0	NM_001204269	Q86XG6	Missense_Mutation	SNP	ENST00000485317.1	37	CCDS827.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.243998	0.58995	.	.	ENSG00000177301	ENST00000369770;ENST00000485317;ENST00000440270;ENST00000316361	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	6.02	6.02	0.97574	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.057269	0.64402	D	0.000001	D	0.86847	0.6031	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.975	D	0.87668	0.2539	10	0.87932	D	0	.	16.0721	0.80941	0.0:0.0:0.8655:0.1345	.	114;114	Q86XG6;P16389	.;KCNA2_HUMAN	W	114	ENSP00000358785:R114W;ENSP00000433109:R114W;ENSP00000415257:R114W;ENSP00000314520:R114W	ENSP00000314520:R114W	R	-	1	2	KCNA2	110948588	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.442000	0.66575	2.865000	0.98341	0.655000	0.94253	CGG	.		0.478	KCNA2-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128001.2	NM_004974	
KIF25	3834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	168443256	168443256	+	Missense_Mutation	SNP	C	C	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr6:168443256C>G	ENST00000443060.2	+	9	1236	c.845C>G	c.(844-846)aCc>aGc	p.T282S	KIF25_ENST00000351261.3_Intron|KIF25_ENST00000354419.2_Missense_Mutation_p.T282S			Q9UIL4	KIF25_HUMAN	kinesin family member 25	282	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		TCTGGAGTGACCGGGTTGGCC	0.647																																					p.T282S		.											.	KIF25	92	0			c.C845G						.						127.0	118.0	121.0					6																	168443256		2203	4300	6503	SO:0001583	missense	3834	exon8			GAGTGACCGGGTT	AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.845C>G	6.37:g.168443256C>G	ENSP00000388878:p.Thr282Ser	105.0	0.0		56.0	31.0	NM_030615	O94775|Q5SZU9	Missense_Mutation	SNP	ENST00000443060.2	37	CCDS5305.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.674115	0.47781	.	.	ENSG00000125337	ENST00000443060;ENST00000354419	T;T	0.74315	-0.83;-0.83	4.27	2.41	0.29592	Kinesin, motor domain (4);	0.142741	0.46145	D	0.000309	T	0.45935	0.1367	L	0.39020	1.185	0.80722	D	1	P	0.38565	0.637	B	0.37091	0.241	T	0.43893	-0.9363	10	0.51188	T	0.08	-13.93	7.4262	0.27100	0.0:0.7363:0.1674:0.0963	.	282	Q9UIL4	KIF25_HUMAN	S	282	ENSP00000388878:T282S;ENSP00000346401:T282S	ENSP00000346401:T282S	T	+	2	0	KIF25	168186105	0.966000	0.33281	0.015000	0.15790	0.012000	0.07955	2.235000	0.43044	0.341000	0.23771	0.543000	0.68304	ACC	.		0.647	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362509.1		
KLHL15	80311	ucsc.edu;bcgsc.ca	37	X	24006091	24006091	+	Missense_Mutation	SNP	A	A	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chrX:24006091A>C	ENST00000328046.8	-	4	2017	c.1762T>G	c.(1762-1764)Tgc>Ggc	p.C588G		NM_030624.2	NP_085127.2	Q96M94	KLH15_HUMAN	kelch-like family member 15	588					protein ubiquitination (GO:0016567)					autonomic_ganglia(1)|breast(1)|endometrium(8)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	22						TGCAGGTTGCATACTTGTAAA	0.448																																					p.C588G		.											.	KLHL15	131	0			c.T1762G						.						116.0	93.0	101.0					X																	24006091		2203	4300	6503	SO:0001583	missense	80311	exon4			GGTTGCATACTTG	AB051464	CCDS35217.1	Xp22.1-p21	2013-01-30	2013-01-30		ENSG00000174010	ENSG00000174010		"""Kelch-like"", ""BTB/POZ domain containing"""	29347	protein-coding gene	gene with protein product			"""kelch-like 15 (Drosophila)"""			11214970, 14702039	Standard	NM_030624		Approved	KIAA1677	uc004dba.4	Q96M94	OTTHUMG00000021261	ENST00000328046.8:c.1762T>G	X.37:g.24006091A>C	ENSP00000332791:p.Cys588Gly	529.0	2.0		537.0	176.0	NM_030624	Q32MN3|Q8NDA3|Q96BM6|Q9C0I6	Missense_Mutation	SNP	ENST00000328046.8	37	CCDS35217.1	.	.	.	.	.	.	.	.	.	.	A	15.88	2.963416	0.53507	.	.	ENSG00000174010	ENST00000328046	T	0.67171	-0.25	5.94	5.94	0.96194	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.71600	0.3359	L	0.37466	1.105	0.80722	D	1	P	0.50156	0.932	P	0.60789	0.879	T	0.68179	-0.5477	10	0.25106	T	0.35	.	15.2777	0.73753	1.0:0.0:0.0:0.0	.	588	Q96M94	KLH15_HUMAN	G	588	ENSP00000332791:C588G	ENSP00000332791:C588G	C	-	1	0	KLHL15	23916012	1.000000	0.71417	0.963000	0.40424	0.997000	0.91878	8.962000	0.93254	1.991000	0.58162	0.412000	0.27726	TGC	.		0.448	KLHL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056078.1	XM_040383	
KLK11	11012	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51528911	51528911	+	Missense_Mutation	SNP	C	C	A	rs532923427		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:51528911C>A	ENST00000594768.1	-	2	258	c.73G>T	c.(73-75)Gcc>Tcc	p.A25S	KLK11_ENST00000319720.7_5'UTR|KLK11_ENST00000600362.1_5'UTR|KLK11_ENST00000594458.1_5'UTR|KLK11_ENST00000391804.3_5'UTR|KLK11_ENST00000453757.3_5'UTR	NM_144947.1	NP_659196.1	Q9UBX7	KLK11_HUMAN	kallikrein-related peptidase 11	25						extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		GAGGAGCGGGCCCCAGGTTCC	0.642																																					p.A25S		.											.	KLK11	650	0			c.G73T						.						14.0	14.0	14.0					19																	51528911		2199	4292	6491	SO:0001583	missense	11012	exon2			AGCGGGCCCCAGG	AB012917	CCDS12818.1, CCDS12819.1, CCDS54297.1	19q13.33	2011-09-07	2006-10-27			ENSG00000167757		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6359	protein-coding gene	gene with protein product		604434	"""kallikrein 11"""	PRSS20		9765601, 10662548, 16800724, 16800723	Standard	NM_006853		Approved	TLSP	uc002pvb.2	Q9UBX7		ENST00000594768.1:c.73G>T	19.37:g.51528911C>A	ENSP00000473047:p.Ala25Ser	108.0	1.0		91.0	26.0	NM_144947	O75837|Q0WXX5|Q8IXD7|Q9NS65	Missense_Mutation	SNP	ENST00000594768.1	37	CCDS12818.1	.	.	.	.	.	.	.	.	.	.	c	16.93	3.259294	0.59321	.	.	ENSG00000167757	ENST00000319756	D	0.87650	-2.28	2.67	1.6	0.23607	.	.	.	.	.	T	0.78566	0.4303	L	0.34521	1.04	0.80722	D	1	P	0.46987	0.888	B	0.41374	0.355	T	0.75396	-0.3332	9	0.62326	D	0.03	.	7.4239	0.27088	0.0:0.7294:0.2706:0.0	.	25	Q9UBX7	KLK11_HUMAN	S	25	ENSP00000324414:A25S	ENSP00000324414:A25S	A	-	1	0	KLK11	56220723	0.999000	0.42202	1.000000	0.80357	0.982000	0.71751	0.718000	0.25866	0.674000	0.31244	0.655000	0.94253	GCC	.		0.642	KLK11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464314.2	NM_006853	
KRT85	3891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	52760929	52760929	+	Silent	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr12:52760929C>T	ENST00000257901.3	-	1	336	c.261G>A	c.(259-261)gtG>gtA	p.V87V	KRT85_ENST00000544265.1_5'Flank	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	87	Head.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TGGGTCCGCACACGCCCCCGG	0.682																																					p.V87V		.											.	KRT85	91	0			c.G261A						.						60.0	65.0	63.0					12																	52760929		2203	4300	6503	SO:0001819	synonymous_variant	3891	exon1			TCCGCACACGCCC	X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.261G>A	12.37:g.52760929C>T		378.0	0.0		351.0	69.0	NM_002283	Q9NSB1	Silent	SNP	ENST00000257901.3	37	CCDS8824.1																																																																																			.		0.682	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283	
KRTAP1-1	81851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39197352	39197352	+	Missense_Mutation	SNP	C	C	T	rs370724456		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr17:39197352C>T	ENST00000306271.4	-	1	361	c.298G>A	c.(298-300)Ggc>Agc	p.G100S		NM_030967.2	NP_112229.1	Q07627	KRA11_HUMAN	keratin associated protein 1-1	100			Missing (in allele KAP1.7). {ECO:0000269|PubMed:11841537}.			keratin filament (GO:0045095)				NS(2)|endometrium(2)|kidney(5)|lung(4)|prostate(1)	14		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TAGCCAATGCCACCACCAATG	0.632																																					p.G100S		.											.	.	.	0			c.G298A						.						30.0	34.0	32.0					17																	39197352		1987	4161	6148	SO:0001583	missense	81851	exon1			CAATGCCACCACC	AJ406926	CCDS42324.1	17q21.2	2014-06-05			ENSG00000188581	ENSG00000188581		"""Keratin associated proteins"""	16772	protein-coding gene	gene with protein product		608819				11279113	Standard	NM_030967		Approved	KAP1.1B, HB2A, KAP1.1, KAP1.1A	uc002hvw.1	Q07627	OTTHUMG00000133592	ENST00000306271.4:c.298G>A	17.37:g.39197352C>T	ENSP00000305975:p.Gly100Ser	172.0	0.0		154.0	39.0	NM_030967	A6NC32|Q96S60|Q96S67	Missense_Mutation	SNP	ENST00000306271.4	37	CCDS42324.1	.	.	.	.	.	.	.	.	.	.	C	8.751	0.921274	0.17982	.	.	ENSG00000188581	ENST00000306271;ENST00000543328	T	0.29397	1.57	3.79	2.83	0.33086	.	.	.	.	.	T	0.21841	0.0526	L	0.38649	1.16	0.30133	N	0.804616	P	0.36162	0.54	B	0.36666	0.23	T	0.10870	-1.0611	9	0.20519	T	0.43	.	7.6537	0.28363	0.0:0.8839:0.0:0.1161	.	100	Q07627	KRA11_HUMAN	S	100;90	ENSP00000305975:G100S	ENSP00000305975:G100S	G	-	1	0	KRTAP1-1	36450878	0.025000	0.19082	0.724000	0.30704	0.028000	0.11728	1.202000	0.32271	1.203000	0.43233	-0.464000	0.05259	GGC	.		0.632	KRTAP1-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257696.1	NM_030967	
LILRA4	23547	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54850148	54850148	+	Missense_Mutation	SNP	C	C	A	rs181991337		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:54850148C>A	ENST00000291759.4	-	2	115	c.59G>T	c.(58-60)cGg>cTg	p.R20L	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	20					immune system process (GO:0002376)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		TGCCTGCACCCGGGTCCTGGG	0.627											OREG0003656	type=REGULATORY REGION|Gene=LILRA4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.R20L		.											.	LILRA4	91	0			c.G59T						.						58.0	63.0	62.0					19																	54850148		2203	4300	6503	SO:0001583	missense	23547	exon2			TGCACCCGGGTCC	AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.59G>T	19.37:g.54850148C>A	ENSP00000291759:p.Arg20Leu	135.0	0.0	1003	108.0	31.0	NM_012276	Q32MC4	Missense_Mutation	SNP	ENST00000291759.4	37	CCDS12890.1	.	.	.	.	.	.	.	.	.	.	.	0.025	-1.375492	0.01214	.	.	ENSG00000239961	ENST00000291759	T	0.00507	6.92	2.5	-5.01	0.02991	.	4.720850	0.00633	N	0.000483	T	0.00552	0.0018	L	0.53561	1.675	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42599	-0.9442	10	0.51188	T	0.08	.	7.3356	0.26607	0.0:0.3981:0.4095:0.1924	.	20	P59901	LIRA4_HUMAN	L	20	ENSP00000291759:R20L	ENSP00000291759:R20L	R	-	2	0	LILRA4	59541960	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.432000	0.00235	-3.358000	0.00179	-1.283000	0.01379	CGG	C|0.999;T|0.000		0.627	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140229.2	NM_012276	
LMBRD2	92255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	36124328	36124328	+	Missense_Mutation	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr5:36124328G>T	ENST00000296603.4	-	7	1249	c.787C>A	c.(787-789)Cca>Aca	p.P263T		NM_001007527.1	NP_001007528.1	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	263						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTTCTCAATGGGTGATTATAC	0.259																																					p.P263T		.											.	LMBRD2	90	0			c.C787A						.						59.0	57.0	57.0					5																	36124328		2195	4281	6476	SO:0001583	missense	92255	exon7			TCAATGGGTGATT		CCDS34145.1	5p13.2	2008-02-05			ENSG00000164187	ENSG00000164187			25287	protein-coding gene	gene with protein product							Standard	NM_001007527		Approved	DKFZp434H2226	uc003jkb.1	Q68DH5	OTTHUMG00000162150	ENST00000296603.4:c.787C>A	5.37:g.36124328G>T	ENSP00000296603:p.Pro263Thr	246.0	0.0		174.0	41.0	NM_001007527	B3KRB6|Q9NTC7	Missense_Mutation	SNP	ENST00000296603.4	37	CCDS34145.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.873167	0.91664	.	.	ENSG00000164187	ENST00000296603;ENST00000546130	T	0.28255	1.62	5.61	5.61	0.85477	LMBR1-like membrane protein (1);	0.000000	0.85682	D	0.000000	T	0.46386	0.1390	M	0.69823	2.125	0.80722	D	1	P	0.49185	0.92	P	0.50860	0.652	T	0.23084	-1.0198	10	0.23302	T	0.38	-13.0866	19.6306	0.95700	0.0:0.0:1.0:0.0	.	263	Q68DH5	LMBD2_HUMAN	T	263;157	ENSP00000296603:P263T	ENSP00000296603:P263T	P	-	1	0	LMBRD2	36160085	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.175000	0.77632	2.646000	0.89796	0.585000	0.79938	CCA	.		0.259	LMBRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367552.1	NM_001007527	
LMTK2	22853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	97821009	97821009	+	Missense_Mutation	SNP	G	G	A	rs531778656		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr7:97821009G>A	ENST00000297293.5	+	11	1525	c.1232G>A	c.(1231-1233)cGg>cAg	p.R411Q		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	411					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					ACTTACCTGCGGCTGCAGAGC	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		15350	0.0		0.0	False		,,,				2504	0.001				p.R411Q		.											.	LMTK2	1381	0			c.G1232A						.						65.0	60.0	62.0					7																	97821009		2203	4300	6503	SO:0001583	missense	22853	exon11			ACCTGCGGCTGCA	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.1232G>A	7.37:g.97821009G>A	ENSP00000297293:p.Arg411Gln	127.0	0.0		86.0	23.0	NM_014916	A4D272|Q75MG7|Q9UPS3	Missense_Mutation	SNP	ENST00000297293.5	37	CCDS5654.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.299652	0.81136	.	.	ENSG00000164715	ENST00000297293	T	0.62105	0.05	5.41	5.41	0.78517	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.78729	0.4329	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	T	0.76782	-0.2832	10	0.37606	T	0.19	.	18.551	0.91065	0.0:0.0:1.0:0.0	.	411	Q8IWU2	LMTK2_HUMAN	Q	411	ENSP00000297293:R411Q	ENSP00000297293:R411Q	R	+	2	0	LMTK2	97658945	1.000000	0.71417	0.829000	0.32907	0.786000	0.44442	9.420000	0.97426	2.710000	0.92621	0.655000	0.94253	CGG	.		0.542	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916	
LRRIQ1	84125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	85450892	85450892	+	Missense_Mutation	SNP	C	C	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr12:85450892C>A	ENST00000393217.2	+	8	2382	c.2321C>A	c.(2320-2322)cCa>cAa	p.P774Q		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	774										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		GTGAAATGCCCAGCCAACATG	0.358																																					p.P774Q		.											.	LRRIQ1	95	0			c.C2321A						.						110.0	126.0	120.0					12																	85450892		2203	4300	6503	SO:0001583	missense	84125	exon8			AATGCCCAGCCAA	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.2321C>A	12.37:g.85450892C>A	ENSP00000376910:p.Pro774Gln	88.0	0.0		40.0	11.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.560180	0.45590	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.55234	0.53	5.56	4.68	0.58851	.	0.654660	0.13852	N	0.358317	T	0.55816	0.1944	L	0.34521	1.04	0.33335	D	0.569101	D;P	0.57899	0.981;0.481	P;B	0.55161	0.77;0.185	T	0.65257	-0.6212	10	0.54805	T	0.06	.	12.6917	0.56978	0.0:0.9238:0.0:0.0762	.	774;749	Q96JM4;C9JI57	LRIQ1_HUMAN;.	Q	774;749;774	ENSP00000376910:P774Q	ENSP00000256007:P774Q	P	+	2	0	LRRIQ1	83975023	0.973000	0.33851	0.871000	0.34182	0.167000	0.22549	3.077000	0.50089	1.354000	0.45846	0.591000	0.81541	CCA	.		0.358	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
LRWD1	222229	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	102108549	102108549	+	Missense_Mutation	SNP	T	T	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr7:102108549T>G	ENST00000292616.5	+	6	871	c.719T>G	c.(718-720)cTc>cGc	p.L240R	MIR5090_ENST00000582533.1_RNA	NM_152892.1	NP_690852.1	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain containing 1	240					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA replication initiation (GO:0006270)|establishment of protein localization to chromatin (GO:0071169)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|telomeric heterochromatin (GO:0031933)	chromatin binding (GO:0003682)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|stomach(2)	20						GACGTCCCACTCAGCCTCTCT	0.687																																					p.L240R		.											.	LRWD1	69	0			c.T719G						.						46.0	49.0	48.0					7																	102108549		2201	4299	6500	SO:0001583	missense	222229	exon6			TCCCACTCAGCCT	AL133057	CCDS34715.1	7q22.1	2013-01-10			ENSG00000161036	ENSG00000161036		"""WD repeat domain containing"""	21769	protein-coding gene	gene with protein product	"""origin recognition complex associated"", ""centromere protein 33"""	615167				20932478, 20850016, 20180869	Standard	NM_152892		Approved	DKFZp434K1815, ORCA, CENP-33	uc003uzn.3	Q9UFC0	OTTHUMG00000157718	ENST00000292616.5:c.719T>G	7.37:g.102108549T>G	ENSP00000292616:p.Leu240Arg	111.0	0.0		86.0	21.0	NM_152892	A8K4K2|B2R9G2|Q8N0T9|Q8WV43|Q96GJ2	Missense_Mutation	SNP	ENST00000292616.5	37	CCDS34715.1	.	.	.	.	.	.	.	.	.	.	T	10.79	1.451106	0.26074	.	.	ENSG00000161036	ENST00000292616	T	0.61859	0.07	4.89	1.14	0.20703	.	0.695571	0.14825	N	0.296183	T	0.40171	0.1106	L	0.50333	1.59	0.09310	N	1	P	0.43169	0.8	B	0.37833	0.259	T	0.17806	-1.0357	10	0.12766	T	0.61	-3.6758	3.6134	0.08069	0.0:0.203:0.1959:0.6011	.	240	Q9UFC0	LRWD1_HUMAN	R	240	ENSP00000292616:L240R	ENSP00000292616:L240R	L	+	2	0	LRWD1	101895554	0.000000	0.05858	0.006000	0.13384	0.470000	0.32858	0.017000	0.13399	0.890000	0.36211	0.379000	0.24179	CTC	.		0.687	LRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349493.1	NM_152892	
MCF2	4168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	138728988	138728988	+	Missense_Mutation	SNP	C	C	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chrX:138728988C>A	ENST00000519895.1	-	3	265	c.100G>T	c.(100-102)Gta>Tta	p.V34L	MCF2_ENST00000370578.4_Missense_Mutation_p.V119L|MCF2_ENST00000520602.1_Missense_Mutation_p.V34L|MCF2_ENST00000414978.1_Missense_Mutation_p.V34L	NM_001171876.1	NP_001165347.1	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	0	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					TTTGCTATTACTTCCTCTGGT	0.333																																					p.V34L		.											.	MCF2	227	0			c.G100T						.						58.0	52.0	54.0					X																	138728988		1852	4084	5936	SO:0001583	missense	4168	exon3			CTATTACTTCCTC		CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000519895.1:c.100G>T	X.37:g.138728988C>A	ENSP00000430276:p.Val34Leu	551.0	0.0		596.0	107.0	NM_001171876	B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	ENST00000519895.1	37	CCDS55517.1	.	.	.	.	.	.	.	.	.	.	C	13.31	2.198536	0.38806	.	.	ENSG00000101977	ENST00000520602;ENST00000370578;ENST00000414978;ENST00000519895	T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04	5.7	3.93	0.45458	.	0.064020	0.64402	D	0.000008	T	0.51058	0.1652	L	0.44542	1.39	0.09310	N	1	B;P;B	0.38617	0.05;0.64;0.221	B;B;B	0.36567	0.1;0.228;0.14	T	0.38845	-0.9642	10	0.39692	T	0.17	.	9.7869	0.40681	0.0:0.8276:0.0:0.1724	.	34;119;119	E9PH77;B7Z3Z2;Q5JYJ7	.;.;.	L	34;119;34;34	ENSP00000427745:V34L;ENSP00000359610:V119L;ENSP00000397055:V34L;ENSP00000430276:V34L	ENSP00000359610:V119L	V	-	1	0	MCF2	138556654	0.051000	0.20477	0.160000	0.22671	0.992000	0.81027	0.972000	0.29409	0.562000	0.29204	0.600000	0.82982	GTA	.		0.333	MCF2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377602.1	NM_005369	
MEGF8	1954	hgsc.bcm.edu;broad.mit.edu	37	19	42858165	42858165	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:42858165delA	ENST00000251268.6	+	22	4000	c.4000delA	c.(4000-4002)accfs	p.T1334fs	MEGF8_ENST00000334370.4_Frame_Shift_Del_p.T1267fs	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	1334	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CGACAGCAGCACCCCCTGCAC	0.632																																					p.T1334fs		.											.	MEGF8	23	0			c.4000delA						.						33.0	28.0	30.0					19																	42858165		2200	4289	6489	SO:0001589	frameshift_variant	1954	exon22			AGCAGCACCCCCT	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.4000delA	19.37:g.42858165delA	ENSP00000251268:p.Thr1334fs	45.0	0.0		59.0	10.0	NM_001271938	A8KAY0|O75097	Frame_Shift_Del	DEL	ENST00000251268.6	37																																																																																				.		0.632	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
MIR371B	100616185	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	54291196	54291196	+	lincRNA	SNP	A	A	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:54291196A>C	ENST00000595160.1	-	0	227				AC008753.4_ENST00000597420.1_lincRNA|MIR371A_ENST00000362161.1_RNA|MIR373_ENST00000362273.1_RNA|MIR372_ENST00000362225.1_RNA	NR_029864.1|NR_029865.1|NR_039909.1				microRNA 371b																		AAGTGCTGCGACATTTGAGCG	0.537																																					.		.											.	.	.	0			.						.						48.0	45.0	46.0					19																	54291196		1568	3582	5150			442917	.			GCTGCGACATTTG			19	2011-09-12				ENSG00000269877		"""ncRNAs / Micro RNAs"""	41863	non-coding RNA	RNA, micro							Standard	NR_039909		Approved	hsa-mir-371b	uc021vba.1				19.37:g.54291196A>C		57.0	0.0		57.0	21.0	.		RNA	SNP	ENST00000595160.1	37																																																																																				.		0.537	MIR371B-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000465677.1	NR_039909	
KMT2A	4297	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	118362558	118362558	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr11:118362558delA	ENST00000389506.5	+	15	4910	c.4910delA	c.(4909-4911)gaafs	p.E1637fs	KMT2A_ENST00000354520.4_Frame_Shift_Del_p.E1599fs|KMT2A_ENST00000534358.1_Frame_Shift_Del_p.E1640fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1637					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CTGGCCCTTGAAAAAGAGCTG	0.493																																					p.E1640fs		.											.	MLL	1255	0			c.4919delA						.						73.0	72.0	72.0					11																	118362558		2200	4296	6496	SO:0001589	frameshift_variant	4297	exon15			CCCTTGAAAAAGA	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.4910delA	11.37:g.118362558delA	ENSP00000374157:p.Glu1637fs	101.0	0.0		76.0	12.0	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Del	DEL	ENST00000389506.5	37	CCDS31686.1																																																																																			.		0.493	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
MTO1	25821	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	74183325	74183325	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr6:74183325C>T	ENST00000370300.4	+	4	863	c.773C>T	c.(772-774)cCg>cTg	p.P258L	MTO1_ENST00000498286.1_Missense_Mutation_p.P258L|MTO1_ENST00000415954.2_Missense_Mutation_p.P258L|MTO1_ENST00000370305.1_Missense_Mutation_p.P184L	NM_012123.3|NM_133645.2	NP_036255.2|NP_598400.1	Q9Y2Z2	MTO1_HUMAN	mitochondrial tRNA translation optimization 1	258					mitochondrial tRNA wobble uridine modification (GO:0070899)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)	27						AAGCATATACCGGACAATCCA	0.423																																					p.P258L		.											.	MTO1	96	0			c.C773T						.						87.0	83.0	84.0					6																	74183325		2203	4300	6503	SO:0001583	missense	25821	exon4			ATATACCGGACAA	AF132937	CCDS4979.1, CCDS34485.1, CCDS47452.1	6q14.1	2013-05-07	2013-05-07		ENSG00000135297	ENSG00000135297			19261	protein-coding gene	gene with protein product		614667	"""mitochondrial translation optimization 1 homolog (S. cerevisiae)"""			12011058, 22608499	Standard	NM_012123		Approved		uc003pgy.4	Q9Y2Z2	OTTHUMG00000015032	ENST00000370300.4:c.773C>T	6.37:g.74183325C>T	ENSP00000359323:p.Pro258Leu	157.0	0.0		96.0	8.0	NM_133645	B3KQB5|Q5SWL2|Q5SWL3|Q5SWL4|Q8NDN7|Q8WZ57|Q96FE6|Q9BS06	Missense_Mutation	SNP	ENST00000370300.4	37	CCDS4979.1	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395329	0.62066	.	.	ENSG00000135297	ENST00000415954;ENST00000498286;ENST00000370305;ENST00000370300	T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0	5.7	5.7	0.88788	.	0.054502	0.85682	D	0.000000	T	0.77844	0.4191	L	0.42686	1.345	0.80722	D	1	D;D;D	0.61697	0.99;0.969;0.986	P;P;D	0.63033	0.855;0.855;0.91	T	0.79881	-0.1616	10	0.87932	D	0	-11.4426	17.9905	0.89168	0.0:1.0:0.0:0.0	.	258;258;258	Q9Y2Z2-6;Q9Y2Z2-4;Q9Y2Z2	.;.;MTO1_HUMAN	L	258;258;184;258	ENSP00000402038:P258L;ENSP00000419561:P258L;ENSP00000359328:P184L;ENSP00000359323:P258L	ENSP00000359323:P258L	P	+	2	0	MTO1	74240046	1.000000	0.71417	0.997000	0.53966	0.032000	0.12392	7.094000	0.76944	2.682000	0.91365	0.609000	0.83330	CCG	.		0.423	MTO1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041215.2	NM_012123	
MXRA5	25878	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	3238423	3238423	+	Missense_Mutation	SNP	G	G	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chrX:3238423G>C	ENST00000217939.6	-	5	5457	c.5303C>G	c.(5302-5304)tCc>tGc	p.S1768C		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1768						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CCTGTTGTAGGAACCTGGAAT	0.522																																					p.S1768C		.											.	MXRA5	136	0			c.C5303G						.						88.0	80.0	83.0					X																	3238423		2203	4300	6503	SO:0001583	missense	25878	exon5			TTGTAGGAACCTG	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.5303C>G	X.37:g.3238423G>C	ENSP00000217939:p.Ser1768Cys	154.0	0.0		112.0	33.0	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	G	7.708	0.694503	0.15039	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.64260	-0.09	3.35	2.48	0.30137	.	0.407810	0.17792	U	0.161860	T	0.37265	0.0997	N	0.08118	0	0.09310	N	1	B	0.31519	0.327	B	0.28232	0.087	T	0.20538	-1.0272	10	0.48119	T	0.1	.	8.0364	0.30495	0.234:0.0:0.766:0.0	.	1768	Q9NR99	MXRA5_HUMAN	C	1768	ENSP00000217939:S1768C	ENSP00000217939:S1768C	S	-	2	0	MXRA5	3248423	0.001000	0.12720	0.001000	0.08648	0.039000	0.13416	0.681000	0.25320	0.317000	0.23160	-0.475000	0.04921	TCC	.		0.522	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
MYH15	22989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	108133086	108133086	+	Missense_Mutation	SNP	C	C	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr3:108133086C>G	ENST00000273353.3	-	31	4254	c.4198G>C	c.(4198-4200)Gat>Cat	p.D1400H		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1400						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						CACTTGGCATCCTCCAAGTCT	0.463																																					p.D1400H		.											.	MYH15	73	0			c.G4198C						.						156.0	151.0	152.0					3																	108133086		1977	4158	6135	SO:0001583	missense	22989	exon31			TGGCATCCTCCAA	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.4198G>C	3.37:g.108133086C>G	ENSP00000273353:p.Asp1400His	130.0	0.0		142.0	27.0	NM_014981		Missense_Mutation	SNP	ENST00000273353.3	37	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	C	19.84	3.901987	0.72754	.	.	ENSG00000144821	ENST00000273353	T	0.80480	-1.38	5.17	3.38	0.38709	Myosin tail (1);	.	.	.	.	D	0.85314	0.5668	M	0.69523	2.12	0.36664	D	0.878096	P	0.48834	0.916	P	0.55455	0.776	D	0.87952	0.2724	9	0.87932	D	0	.	11.7857	0.52041	0.0:0.861:0.0:0.139	.	1400	Q9Y2K3	MYH15_HUMAN	H	1400	ENSP00000273353:D1400H	ENSP00000273353:D1400H	D	-	1	0	MYH15	109615776	1.000000	0.71417	0.155000	0.22561	0.897000	0.52465	3.917000	0.56424	0.679000	0.31345	0.655000	0.94253	GAT	.		0.463	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
NCOA6	23054	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	33345295	33345295	+	Missense_Mutation	SNP	T	T	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr20:33345295T>A	ENST00000374796.2	-	8	3826	c.1256A>T	c.(1255-1257)cAg>cTg	p.Q419L	NCOA6_ENST00000359003.2_Missense_Mutation_p.Q419L			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	419	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						GTGGGGCTGCTGCAAGGGAGT	0.587																																					p.Q419L		.											.	NCOA6	292	0			c.A1256T						.						51.0	54.0	53.0					20																	33345295		2203	4300	6503	SO:0001583	missense	23054	exon7			GGCTGCTGCAAGG	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.1256A>T	20.37:g.33345295T>A	ENSP00000363929:p.Gln419Leu	128.0	0.0		105.0	22.0	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	37	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	T	17.20	3.329521	0.60743	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.33438	1.41;1.41	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000005	T	0.38506	0.1043	L	0.29908	0.895	0.51767	D	0.999931	D;D	0.63880	0.969;0.993	P;P	0.55824	0.785;0.777	T	0.14392	-1.0474	10	0.51188	T	0.08	-3.0414	15.9979	0.80265	0.0:0.0:0.0:1.0	.	419;419	F6M2K2;Q14686	.;NCOA6_HUMAN	L	419	ENSP00000363929:Q419L;ENSP00000351894:Q419L	ENSP00000351894:Q419L	Q	-	2	0	NCOA6	32808956	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.748000	0.55142	2.183000	0.69458	0.383000	0.25322	CAG	.		0.587	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
NEB	4703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	152528994	152528994	+	Silent	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr2:152528994G>T	ENST00000172853.10	-	37	4335	c.4188C>A	c.(4186-4188)gcC>gcA	p.A1396A	NEB_ENST00000409198.1_Silent_p.A1396A|NEB_ENST00000427231.2_Silent_p.A1396A|NEB_ENST00000603639.1_Silent_p.A1396A|NEB_ENST00000604864.1_Silent_p.A1396A|NEB_ENST00000397345.3_Silent_p.A1396A			P20929	NEBU_HUMAN	nebulin	1396					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CGACATCCTGGGCCATCTTTG	0.463																																					p.A1396A		.											.	NEB	145	0			c.C4188A						.						181.0	171.0	175.0					2																	152528994		2054	4216	6270	SO:0001819	synonymous_variant	4703	exon37			ATCCTGGGCCATC	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.4188C>A	2.37:g.152528994G>T		344.0	0.0		210.0	91.0	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																				.		0.463	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
NES	10763	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	156641173	156641173	+	Missense_Mutation	SNP	T	T	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:156641173T>A	ENST00000368223.3	-	4	2939	c.2807A>T	c.(2806-2808)gAg>gTg	p.E936V		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	936	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCCCTCCTCCTCCAGAGACCT	0.542																																					p.E936V		.											.	NES	520	0			c.A2807T						.						145.0	160.0	155.0					1																	156641173		2203	4300	6503	SO:0001583	missense	10763	exon4			TCCTCCTCCAGAG	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.2807A>T	1.37:g.156641173T>A	ENSP00000357206:p.Glu936Val	73.0	0.0		113.0	6.0	NM_006617	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	CCDS1151.1	.	.	.	.	.	.	.	.	.	.	T	16.39	3.109586	0.56398	.	.	ENSG00000132688	ENST00000368223	D	0.90261	-2.64	5.14	-1.44	0.08856	.	0.836085	0.09754	N	0.760216	T	0.74427	0.3715	L	0.54323	1.7	0.09310	N	0.999993	P	0.44877	0.845	B	0.36719	0.231	T	0.66862	-0.5816	10	0.72032	D	0.01	.	5.0384	0.14447	0.0:0.333:0.1556:0.5114	.	936	P48681	NEST_HUMAN	V	936	ENSP00000357206:E936V	ENSP00000357206:E936V	E	-	2	0	NES	154907797	0.000000	0.05858	0.001000	0.08648	0.125000	0.20455	0.165000	0.16564	-0.545000	0.06224	0.379000	0.24179	GAG	.		0.542	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617	
NLRP9	338321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	56241199	56241199	+	Silent	SNP	G	G	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:56241199G>A	ENST00000332836.2	-	3	2019	c.1992C>T	c.(1990-1992)ctC>ctT	p.L664L		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	664						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		AAACTTACATGAGTTTTCGGA	0.438																																					p.L664L		.											.	NLRP9	294	0			c.C1992T						.						68.0	67.0	67.0					19																	56241199		2203	4300	6503	SO:0001819	synonymous_variant	338321	exon3			TTACATGAGTTTT	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1992C>T	19.37:g.56241199G>A		88.0	0.0		69.0	19.0	NM_176820	B2RN12|Q86W27	Silent	SNP	ENST00000332836.2	37	CCDS12934.1																																																																																			.		0.438	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
NLRP13	126204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	56416366	56416366	+	Missense_Mutation	SNP	C	C	A	rs201367180		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:56416366C>A	ENST00000342929.3	-	8	2559	c.2560G>T	c.(2560-2562)Ggc>Tgc	p.G854C	NLRP13_ENST00000588751.1_Missense_Mutation_p.G854C	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	854							ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		AGCTTTATGCCATCATCTTGG	0.493																																					p.G854C		.											.	NLRP13	211	0			c.G2560T						.						147.0	115.0	126.0					19																	56416366		2203	4300	6503	SO:0001583	missense	126204	exon8			TTATGCCATCATC	AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.2560G>T	19.37:g.56416366C>A	ENSP00000343891:p.Gly854Cys	187.0	0.0		154.0	38.0	NM_176810	Q7RTR5	Missense_Mutation	SNP	ENST00000342929.3	37	CCDS33119.1	.	.	.	.	.	.	.	.	.	.	C	11.29	1.594277	0.28445	.	.	ENSG00000173572	ENST00000342929	T	0.62498	0.02	2.28	1.23	0.21249	.	.	.	.	.	T	0.76054	0.3934	M	0.91196	3.185	0.09310	N	1	P	0.49862	0.929	P	0.57960	0.83	T	0.63550	-0.6612	9	0.56958	D	0.05	.	4.9121	0.13827	0.0:0.8222:0.0:0.1778	.	854	Q86W25	NAL13_HUMAN	C	854	ENSP00000343891:G854C	ENSP00000343891:G854C	G	-	1	0	NLRP13	61108178	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	1.449000	0.35123	0.541000	0.28827	0.655000	0.94253	GGC	C|0.999;T|0.001		0.493	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810	
NOD2	64127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	50750836	50750836	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr16:50750836C>T	ENST00000300589.2	+	6	2686	c.2581C>T	c.(2581-2583)Cac>Tac	p.H861Y		NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	861					activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				CGGCTGTGCACACTCCATGGC	0.473																																					p.H861Y		.											.	NOD2	231	0			c.C2581T						.						194.0	183.0	187.0					16																	50750836		2198	4300	6498	SO:0001583	missense	64127	exon6			TGTGCACACTCCA	AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.2581C>T	16.37:g.50750836C>T	ENSP00000300589:p.His861Tyr	182.0	0.0		146.0	43.0	NM_022162	E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Missense_Mutation	SNP	ENST00000300589.2	37	CCDS10746.1	.	.	.	.	.	.	.	.	.	.	C	8.577	0.881362	0.17467	.	.	ENSG00000167207	ENST00000526417;ENST00000300589	T	0.52295	0.67	5.76	3.77	0.43336	.	0.434813	0.24172	N	0.040897	T	0.43478	0.1249	M	0.65975	2.015	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.44590	-0.9318	10	0.66056	D	0.02	.	7.1981	0.25864	0.0:0.7348:0.1728:0.0924	.	861	Q9HC29	NOD2_HUMAN	Y	834;861	ENSP00000300589:H861Y	ENSP00000300589:H861Y	H	+	1	0	NOD2	49308337	0.017000	0.18338	0.005000	0.12908	0.138000	0.21146	1.695000	0.37763	0.735000	0.32537	0.555000	0.69702	CAC	.		0.473	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256876.2	NM_022162	
NWD1	284434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	16918939	16918939	+	Missense_Mutation	SNP	A	A	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:16918939A>G	ENST00000552788.1	+	16	4279	c.4279A>G	c.(4279-4281)Agc>Ggc	p.S1427G	NWD1_ENST00000339803.6_Missense_Mutation_p.S1292G|NWD1_ENST00000524140.2_Missense_Mutation_p.S1427G|NWD1_ENST00000549814.1_Missense_Mutation_p.S1385G|NWD1_ENST00000523826.1_Missense_Mutation_p.S1221G|NWD1_ENST00000379808.3_Missense_Mutation_p.S1427G			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	1427							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ATTCGAGATGAGCTACACGGT	0.562																																					p.S1427G		.											.	NWD1	7	0			c.A4279G						.						66.0	65.0	65.0					19																	16918939		2203	4300	6503	SO:0001583	missense	284434	exon18			GAGATGAGCTACA	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.4279A>G	19.37:g.16918939A>G	ENSP00000447224:p.Ser1427Gly	103.0	0.0		94.0	29.0	NM_001007525	C9J021|Q68CT3	Missense_Mutation	SNP	ENST00000552788.1	37		.	.	.	.	.	.	.	.	.	.	A	7.761	0.705488	0.15172	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.57436	0.4;0.93;0.4;2.19;1.42;2.19	4.46	3.44	0.39384	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.462517	0.23817	N	0.044276	T	0.41050	0.1142	L	0.58354	1.805	0.28693	N	0.904492	B;B;B	0.27229	0.172;0.122;0.075	B;B;B	0.25291	0.039;0.059;0.027	T	0.28299	-1.0048	10	0.20046	T	0.44	-11.0881	3.9765	0.09476	0.7144:0.0:0.1023:0.1833	.	1427;1427;1292	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	G	1292;1427;1385;1427;1221;1427;1292	ENSP00000428579:S1427G;ENSP00000447548:S1385G;ENSP00000369136:S1427G;ENSP00000428955:S1221G;ENSP00000447224:S1427G;ENSP00000340159:S1292G	ENSP00000340159:S1292G	S	+	1	0	NWD1	16779939	1.000000	0.71417	0.977000	0.42913	0.257000	0.26127	0.763000	0.26517	0.673000	0.31224	0.533000	0.62120	AGC	.		0.562	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525	
OR10Z1	128368	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158576234	158576234	+	Silent	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:158576234G>T	ENST00000361284.1	+	1	6	c.6G>T	c.(4-6)ggG>ggT	p.G2G		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					TCAGAATGGGGCAGACCAACG	0.453																																					p.G2G		.											.	OR10Z1	70	0			c.G6T						.						105.0	106.0	106.0					1																	158576234		2203	4300	6503	SO:0001819	synonymous_variant	128368	exon1			AATGGGGCAGACC	AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.6G>T	1.37:g.158576234G>T		93.0	0.0		72.0	39.0	NM_001004478	Q5VYL0|Q6IFR7	Silent	SNP	ENST00000361284.1	37	CCDS30901.1																																																																																			.		0.453	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051853.1	NM_001004478	
OR2A14	135941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	143826880	143826880	+	Missense_Mutation	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr7:143826880G>T	ENST00000408899.2	+	1	730	c.675G>T	c.(673-675)ttG>ttT	p.L225F		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					CCGCCATCTTGAGGATCCAGT	0.607																																					p.L225F		.											.	OR2A14	90	0			c.G675T						.						113.0	116.0	115.0					7																	143826880		2050	4202	6252	SO:0001583	missense	135941	exon1			CATCTTGAGGATC		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.675G>T	7.37:g.143826880G>T	ENSP00000386137:p.Leu225Phe	166.0	0.0		175.0	19.0	NM_001001659	Q6IF41|Q8NGT8	Missense_Mutation	SNP	ENST00000408899.2	37	CCDS43672.1	.	.	.	.	.	.	.	.	.	.	G	11.52	1.661764	0.29515	.	.	ENSG00000221938	ENST00000408899	T	0.00296	8.24	4.18	0.0235	0.14137	GPCR, rhodopsin-like superfamily (1);	0.000000	0.26804	U	0.022415	T	0.00496	0.0016	M	0.71581	2.175	0.30546	N	0.765944	D	0.89917	1.0	D	0.85130	0.997	T	0.40515	-0.9559	10	0.72032	D	0.01	-10.1967	8.5074	0.33195	0.0886:0.4458:0.4655:0.0	.	225	Q96R47	O2A14_HUMAN	F	225	ENSP00000386137:L225F	ENSP00000386137:L225F	L	+	3	2	OR2A14	143457813	0.008000	0.16893	0.981000	0.43875	0.009000	0.06853	-0.048000	0.11944	-0.109000	0.12044	-0.304000	0.09214	TTG	.		0.607	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1		
OR52D1	390066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5510297	5510297	+	Missense_Mutation	SNP	A	A	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr11:5510297A>T	ENST00000322641.5	+	1	383	c.361A>T	c.(361-363)Atg>Ttg	p.M121L	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001005163.2	NP_001005163.1	Q9H346	O52D1_HUMAN	olfactory receptor, family 52, subfamily D, member 1	121					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.46e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTACTTGCCATGGCCTTTGA	0.463																																					p.M121L		.											.	OR52D1	68	0			c.A361T						.						173.0	159.0	164.0					11																	5510297		2201	4297	6498	SO:0001583	missense	390066	exon1			CTTGCCATGGCCT	BK004276	CCDS31384.1	11p15.4	2012-08-09			ENSG00000181609	ENSG00000181609		"""GPCR / Class A : Olfactory receptors"""	15212	protein-coding gene	gene with protein product							Standard	NM_001005163		Approved		uc010qzg.2	Q9H346	OTTHUMG00000066895	ENST00000322641.5:c.361A>T	11.37:g.5510297A>T	ENSP00000326232:p.Met121Leu	181.0	0.0		174.0	49.0	NM_001005163	B9EGY9|Q6IFI6	Missense_Mutation	SNP	ENST00000322641.5	37	CCDS31384.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.154485	0.78114	.	.	ENSG00000181609	ENST00000322641	T	0.00420	7.47	5.57	5.57	0.84162	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.01976	0.0062	H	0.95151	3.63	0.46631	D	0.999135	D	0.56035	0.974	D	0.69307	0.963	T	0.15435	-1.0437	10	0.72032	D	0.01	.	14.7065	0.69194	1.0:0.0:0.0:0.0	.	121	Q9H346	O52D1_HUMAN	L	121	ENSP00000326232:M121L	ENSP00000326232:M121L	M	+	1	0	OR52D1	5466873	1.000000	0.71417	1.000000	0.80357	0.679000	0.39708	7.269000	0.78482	2.340000	0.79590	0.528000	0.53228	ATG	.		0.463	OR52D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143372.1	NM_001005163	
OSCAR	126014	hgsc.bcm.edu;bcgsc.ca	37	19	54598520	54598530	+	3'UTR	DEL	CTGCGCCAGTC	CTGCGCCAGTC	-	rs148850642		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	CTGCGCCAGTC	CTGCGCCAGTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:54598520_54598530delCTGCGCCAGTC	ENST00000284648.6	-	0	1459_1469				OSCAR_ENST00000358375.4_Frame_Shift_Del_p.DWRS250fs|OSCAR_ENST00000359649.4_3'UTR|OSCAR_ENST00000351806.4_Frame_Shift_Del_p.DWRS239fs|OSCAR_ENST00000356532.3_Frame_Shift_Del_p.DWRS254fs|OSCAR_ENST00000391761.1_3'UTR			Q8IYS5	OSCAR_HUMAN	osteoclast associated, immunoglobulin-like receptor							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				large_intestine(1)|skin(1)	2	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)					GCGGTTCTGACTGCGCCAGTCAAAAGTGACC	0.682																																					p.254_257del		.											.	OSCAR	68	0			c.760_770del						.																																			SO:0001624	3_prime_UTR_variant	126014	exon6			TTCTGACTGCGCC	AK130199	CCDS12873.1, CCDS12874.1, CCDS12875.1, CCDS12876.1, CCDS62789.1, CCDS74444.1	19q13.42	2013-01-29			ENSG00000170909	ENSG00000170909		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29960	protein-coding gene	gene with protein product		606862				11805147	Standard	NM_206818		Approved		uc002qda.3	Q8IYS5	OTTHUMG00000064966	ENST00000284648.6:c.*423GACTGGCGCAG>-	19.37:g.54598520_54598530delCTGCGCCAGTC		344.0	0.0		247.0	34.0	NM_130771	B7WNS2|Q5GRG5|Q8N763|Q8NHL4|Q8WXQ0|Q8WXQ1|Q8WXQ2	Frame_Shift_Del	DEL	ENST00000284648.6	37																																																																																				.		0.682	OSCAR-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000139493.4	NM_133169	
PAPPA	5069	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	118950193	118950193	+	Silent	SNP	C	C	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr9:118950193C>G	ENST00000328252.3	+	2	1545	c.1176C>G	c.(1174-1176)tcC>tcG	p.S392S	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	392	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						ACAACATCTCCTGGGAGCTGG	0.567																																					p.S392S		.											.	PAPPA	77	0			c.C1176G						.						66.0	58.0	61.0					9																	118950193		2203	4300	6503	SO:0001819	synonymous_variant	5069	exon2			CATCTCCTGGGAG		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1176C>G	9.37:g.118950193C>G		130.0	0.0		150.0	43.0	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Silent	SNP	ENST00000328252.3	37	CCDS6813.1																																																																																			.		0.567	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
PCDHGC3	5098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140857854	140857854	+	Missense_Mutation	SNP	G	G	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr5:140857854G>C	ENST00000308177.3	+	1	2275	c.2171G>C	c.(2170-2172)aGa>aCa	p.R724T	PCDHGA9_ENST00000573521.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGA6_ENST00000517434.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	724					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGCAGTCTAGAGACCTATAC	0.527											OREG0016865	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R724T		.											.	PCDHGC3	24	0			c.G2171C						.						169.0	199.0	189.0					5																	140857854		2203	4300	6503	SO:0001583	missense	5098	exon1			AGTCTAGAGACCT	AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.2171G>C	5.37:g.140857854G>C	ENSP00000312070:p.Arg724Thr	68.0	0.0	1659	68.0	7.0	NM_032402	O60622|Q08192|Q9Y5C4	Missense_Mutation	SNP	ENST00000308177.3	37	CCDS4261.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.255106	0.39896	.	.	ENSG00000240184	ENST00000308177	T	0.49139	0.79	5.46	3.66	0.41972	.	.	.	.	.	T	0.36026	0.0952	N	0.16656	0.425	0.22156	N	0.999325	B;B	0.34290	0.155;0.447	B;B	0.40602	0.071;0.334	T	0.28202	-1.0051	9	0.51188	T	0.08	.	9.1498	0.36955	0.227:0.0:0.773:0.0	.	724;724	Q9UN70;Q9UN70-2	PCDGK_HUMAN;.	T	724	ENSP00000312070:R724T	ENSP00000312070:R724T	R	+	2	0	PCDHGC3	140838038	0.012000	0.17670	1.000000	0.80357	0.949000	0.60115	0.679000	0.25291	1.540000	0.49301	0.655000	0.94253	AGA	.		0.527	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251808.2	NM_002588	
PHF8	23133	ucsc.edu;bcgsc.ca	37	X	54011484	54011484	+	Missense_Mutation	SNP	G	G	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chrX:54011484G>A	ENST00000357988.5	-	18	2772	c.2414C>T	c.(2413-2415)cCt>cTt	p.P805L	PHF8_ENST00000338154.6_Missense_Mutation_p.P769L|PHF8_ENST00000338946.6_Missense_Mutation_p.P668L|PHF8_ENST00000322659.8_Missense_Mutation_p.P752L	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	805	Ser-rich.				brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						CTGGGAAGCAGGACTGTTAGA	0.632																																					p.P805L		.											.	PHF8	133	0			c.C2414T						.						69.0	56.0	60.0					X																	54011484		2203	4300	6503	SO:0001583	missense	23133	exon18			GAAGCAGGACTGT	AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.2414C>T	X.37:g.54011484G>A	ENSP00000350676:p.Pro805Leu	162.0	2.0		139.0	45.0	NM_001184896	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	ENST00000357988.5	37	CCDS55420.1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.348068	0.41599	.	.	ENSG00000172943	ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000322659	T;T;T;T	0.23147	2.53;2.27;2.25;1.92	5.61	4.74	0.60224	.	0.338569	0.30800	N	0.008845	T	0.16599	0.0399	N	0.24115	0.695	0.32423	N	0.549145	B;B;B;B;B	0.24426	0.019;0.103;0.028;0.103;0.063	B;B;B;B;B	0.24269	0.039;0.052;0.01;0.052;0.023	T	0.09122	-1.0689	10	0.42905	T	0.14	-11.2116	8.7275	0.34478	0.0853:0.1471:0.7676:0.0	.	291;769;668;704;805	B3KMV4;Q9UPP1-2;B7Z911;Q9UPP1-3;Q9UPP1	.;.;.;.;PHF8_HUMAN	L	805;769;668;698;752	ENSP00000350676:P805L;ENSP00000338868:P769L;ENSP00000340051:P668L;ENSP00000319473:P752L	ENSP00000319473:P752L	P	-	2	0	PHF8	54028209	0.236000	0.23804	1.000000	0.80357	0.988000	0.76386	1.962000	0.40442	2.361000	0.80049	0.529000	0.55759	CCT	.		0.632	PHF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056784.2	NM_015107	
PIK3CA	5290	hgsc.bcm.edu;broad.mit.edu	37	3	178928226	178928226	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr3:178928226C>T	ENST00000263967.3	+	9	1569	c.1412C>T	c.(1411-1413)cCa>cTa	p.P471L		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	471	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.P471L(6)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TAGGAAACTCCATGCTTAGAG	0.368		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.P471L	Colon(199;1504 1750 3362 26421 31210 32040)	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,NS,carcinoma,+1	PIK3CA	27752	6	Substitution - Missense(6)	large_intestine(2)|endometrium(2)|skin(2)	c.C1412T						.						99.0	93.0	95.0					3																	178928226		1846	4090	5936	SO:0001583	missense	5290	exon9			AAACTCCATGCTT		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1412C>T	3.37:g.178928226C>T	ENSP00000263967:p.Pro471Leu	114.0	0.0		99.0	4.0	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756128	0.89843	.	.	ENSG00000121879	ENST00000263967	T	0.75821	-0.97	5.64	5.64	0.86602	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.107853	0.64402	D	0.000005	D	0.83769	0.5326	M	0.74258	2.255	0.80722	D	1	D	0.56968	0.978	P	0.57620	0.824	T	0.81326	-0.0983	10	0.30854	T	0.27	-14.0418	19.6973	0.96031	0.0:1.0:0.0:0.0	.	471	P42336	PK3CA_HUMAN	L	471	ENSP00000263967:P471L	ENSP00000263967:P471L	P	+	2	0	PIK3CA	180410920	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.466000	0.80914	2.674000	0.91012	0.655000	0.94253	CCA	.		0.368	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
PIK3CG	5294	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	106508977	106508977	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr7:106508977C>T	ENST00000359195.3	+	2	1281	c.971C>T	c.(970-972)cCa>cTa	p.P324L	PIK3CG_ENST00000496166.1_Missense_Mutation_p.P324L|PIK3CG_ENST00000440650.2_Missense_Mutation_p.P324L	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	324					adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						GAAGAGTGGCCACTGGTGGAT	0.602																																					p.P324L		.											.	PIK3CG	1316	0			c.C971T						.						70.0	63.0	65.0					7																	106508977		2203	4300	6503	SO:0001583	missense	5294	exon2			AGTGGCCACTGGT		CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.971C>T	7.37:g.106508977C>T	ENSP00000352121:p.Pro324Leu	167.0	0.0		156.0	44.0	NM_002649	A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	ENST00000359195.3	37	CCDS5739.1	.	.	.	.	.	.	.	.	.	.	C	14.21	2.465987	0.43839	.	.	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000359195	T;T;T	0.70631	-0.5;-0.5;-0.5	5.6	5.6	0.85130	.	0.098021	0.64402	D	0.000001	T	0.68824	0.3043	L	0.53249	1.67	0.80722	D	1	B	0.23316	0.083	B	0.17979	0.02	T	0.64132	-0.6479	10	0.41790	T	0.15	-25.5935	19.6034	0.95572	0.0:1.0:0.0:0.0	.	324	P48736	PK3CG_HUMAN	L	324	ENSP00000392258:P324L;ENSP00000419260:P324L;ENSP00000352121:P324L	ENSP00000352121:P324L	P	+	2	0	PIK3CG	106296213	1.000000	0.71417	0.961000	0.40146	0.533000	0.34776	7.770000	0.85390	2.637000	0.89404	0.561000	0.74099	CCA	.		0.602	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1		
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	110539193	110539193	+	Missense_Mutation	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr8:110539193G>T	ENST00000378402.5	+	77	12769	c.12665G>T	c.(12664-12666)aGa>aTa	p.R4222I		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	4222					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CTGGTTGGAAGAATGTGGCTC	0.398										HNSCC(38;0.096)																											p.R4222I		.											.	PKHD1L1	145	0			c.G12665T						.						87.0	93.0	91.0					8																	110539193		1986	4185	6171	SO:0001583	missense	93035	exon77			TTGGAAGAATGTG	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.12665G>T	8.37:g.110539193G>T	ENSP00000367655:p.Arg4222Ile	132.0	0.0		109.0	14.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	10.93	1.489194	0.26686	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.86432	-2.12;-1.95	5.64	1.74	0.24563	.	0.586744	0.16067	N	0.231211	T	0.74891	0.3776	L	0.27053	0.805	0.22888	N	0.998608	B	0.34015	0.435	B	0.29440	0.102	T	0.65796	-0.6081	10	0.66056	D	0.02	.	5.2328	0.15432	0.2484:0.1474:0.6042:0.0	.	4222	Q86WI1	PKHL1_HUMAN	I	4222;1150	ENSP00000367655:R4222I;ENSP00000437376:R1150I	ENSP00000367655:R4222I	R	+	2	0	PKHD1L1	110608369	0.995000	0.38212	0.286000	0.24833	0.326000	0.28443	1.734000	0.38166	0.334000	0.23590	-0.157000	0.13467	AGA	.		0.398	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
PLK4	10733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	128816239	128816239	+	Missense_Mutation	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr4:128816239G>T	ENST00000270861.5	+	14	2968	c.2694G>T	c.(2692-2694)tgG>tgT	p.W898C	PLK4_ENST00000513090.1_Missense_Mutation_p.W866C|PLK4_ENST00000507249.1_Missense_Mutation_p.W837C|PLK4_ENST00000514379.1_Missense_Mutation_p.W857C|PLK4_ENST00000515069.1_Missense_Mutation_p.W820C	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	898	POLO box. {ECO:0000255|PROSITE- ProRule:PRU00154}.				centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						ATGTTGGTTGGGCTACACAGG	0.323																																					p.W898C	Colon(135;508 1718 19061 31832 42879)	.											.	PLK4	333	0			c.G2694T						.						111.0	114.0	113.0					4																	128816239		2203	4300	6503	SO:0001583	missense	10733	exon14			TGGTTGGGCTACA	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.2694G>T	4.37:g.128816239G>T	ENSP00000270861:p.Trp898Cys	79.0	0.0		37.0	13.0	NM_014264	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Missense_Mutation	SNP	ENST00000270861.5	37	CCDS3735.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.609263	0.46527	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000513090;ENST00000507249;ENST00000514379;ENST00000508113	T;T;T;T;T;T	0.11712	2.75;2.75;2.75;2.75;2.75;2.75	5.25	4.37	0.52481	POLO box duplicated domain (2);	0.056561	0.85682	D	0.000000	T	0.12475	0.0303	L	0.35723	1.085	0.80722	D	1	B;B	0.33494	0.01;0.414	B;B	0.38378	0.034;0.272	T	0.06232	-1.0838	10	0.52906	T	0.07	-1.8738	15.0412	0.71793	0.0:0.0:0.8575:0.1425	.	866;898	O00444-2;O00444	.;PLK4_HUMAN	C	898;820;866;837;857;144	ENSP00000270861:W898C;ENSP00000421774:W820C;ENSP00000427554:W866C;ENSP00000423412:W837C;ENSP00000423582:W857C;ENSP00000427568:W144C	ENSP00000270861:W898C	W	+	3	0	PLK4	129035689	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.950000	0.70265	2.730000	0.93505	0.479000	0.44913	TGG	.		0.323	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
PODNL1	79883	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	14043535	14043538	+	Frame_Shift_Del	DEL	TGTT	TGTT	-			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	TGTT	TGTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:14043535_14043538delTGTT	ENST00000339560.5	-	8	1792_1795	c.1519_1522delAACA	c.(1519-1524)aacattfs	p.NI507fs	PODNL1_ENST00000538517.2_Frame_Shift_Del_p.NI416fs|PODNL1_ENST00000538371.2_Frame_Shift_Del_p.NI505fs|PODNL1_ENST00000254320.3_Frame_Shift_Del_p.NI425fs	NM_024825.3	NP_079101.3	Q6PEZ8	PONL1_HUMAN	podocan-like 1	507						proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			CTAACTAGAATGTTTGGGACGTGG	0.564																																					p.507_508del		.											.	PODNL1	90	0			c.1519_1522del						.																																			SO:0001589	frameshift_variant	79883	exon8			CTAGAATGTTTGG	AK027100	CCDS12300.1, CCDS54225.1, CCDS54226.1	19p13.12	2008-02-05							26275	protein-coding gene	gene with protein product						12477932	Standard	NM_024825		Approved	FLJ23447, SLRR5B	uc010xnj.2	Q6PEZ8		ENST00000339560.5:c.1519_1522delAACA	19.37:g.14043535_14043538delTGTT	ENSP00000345175:p.Asn507fs	132.0	0.0		127.0	25.0	NM_024825	B7Z564|Q9H5G9	Frame_Shift_Del	DEL	ENST00000339560.5	37	CCDS12300.1																																																																																			.		0.564	PODNL1-003	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457967.1	NM_024825	
PRF1	5551	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	72357968	72357968	+	Silent	SNP	A	A	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr10:72357968A>G	ENST00000441259.1	-	3	1669	c.1509T>C	c.(1507-1509)tcT>tcC	p.S503S	PRF1_ENST00000373209.2_Silent_p.S503S	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	503					apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						CATGGGAACCAGACTTGGGAG	0.602			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																												p.S503S		.	yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	.	PRF1	578	0			c.T1509C						.						134.0	131.0	132.0					10																	72357968		2203	4300	6503	SO:0001819	synonymous_variant	5551	exon3	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	GGAACCAGACTTG	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.1509T>C	10.37:g.72357968A>G		143.0	1.0		80.0	43.0	NM_001083116	B2R6X4|Q59F57|Q86WX7	Silent	SNP	ENST00000441259.1	37	CCDS7305.1																																																																																			.		0.602	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048517.2	NM_005041	
PPRC1	23082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	103909723	103909723	+	Silent	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr10:103909723C>T	ENST00000278070.2	+	14	4971	c.4932C>T	c.(4930-4932)agC>agT	p.S1644S	PPRC1_ENST00000413464.2_Silent_p.S1380S|PPRC1_ENST00000370012.1_Silent_p.S611S|NOLC1_ENST00000605788.1_5'Flank|NOLC1_ENST00000405356.1_5'Flank|NOLC1_ENST00000603742.1_5'Flank|NOLC1_ENST00000488254.2_5'Flank	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1644					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CTGTAAAGAGCAAATTTGATT	0.473																																					p.S1644S		.											.	PPRC1	227	0			c.C4932T						.						149.0	160.0	156.0					10																	103909723		2203	4300	6503	SO:0001819	synonymous_variant	23082	exon14			AAAGAGCAAATTT	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.4932C>T	10.37:g.103909723C>T		146.0	0.0		68.0	26.0	NM_015062	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Silent	SNP	ENST00000278070.2	37	CCDS7529.1																																																																																			.		0.473	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
PSG11	5680	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	43523032	43523032	+	Missense_Mutation	SNP	C	C	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:43523032C>A	ENST00000401740.1	-	3	702	c.599G>T	c.(598-600)aGg>aTg	p.R200M	PSG11_ENST00000306322.7_Missense_Mutation_p.R78M|PSG11_ENST00000595312.1_5'UTR|PSG11_ENST00000403486.1_Missense_Mutation_p.R78M|PSG11_ENST00000320078.7_Missense_Mutation_p.R200M			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	200	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				AAAGAGGGTCCTGTTGGTTTC	0.502																																					p.R200M		.											.	.	.	0			c.G599T						.						261.0	270.0	267.0					19																	43523032		2200	4298	6498	SO:0001583	missense	5680	exon3			AGGGTCCTGTTGG	U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.599G>T	19.37:g.43523032C>A	ENSP00000384995:p.Arg200Met	172.0	0.0		161.0	49.0	NM_002785	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000401740.1	37	CCDS12614.2	.	.	.	.	.	.	.	.	.	.	c	10.27	1.304756	0.23736	.	.	ENSG00000243130	ENST00000320078;ENST00000403486;ENST00000306322;ENST00000401740	T;T;T;T	0.00730	5.77;5.77;5.77;5.77	1.13	-0.0155	0.13976	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.04543	0.0124	M	0.93241	3.395	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.26744	-1.0094	9	0.66056	D	0.02	.	2.9657	0.05907	0.0:0.6454:0.0:0.3546	.	78;200	Q9UQ72-2;Q9UQ72	.;PSG11_HUMAN	M	200;78;78;200	ENSP00000319140:R200M;ENSP00000385427:R78M;ENSP00000304913:R78M;ENSP00000384995:R200M	ENSP00000304913:R78M	R	-	2	0	PSG11	48214872	0.995000	0.38212	0.104000	0.21259	0.023000	0.10783	0.615000	0.24329	0.567000	0.29293	0.184000	0.17185	AGG	.		0.502	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323079.1	NM_002785	
PTCHD1	139411	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	23411941	23411941	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chrX:23411941C>T	ENST00000379361.4	+	3	3166	c.2306C>T	c.(2305-2307)gCt>gTt	p.A769V		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	769					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						GACAATTGTGCTCCAATGTTA	0.368																																					p.A769V		.											.	PTCHD1	135	0			c.C2306T						.						136.0	118.0	124.0					X																	23411941		2203	4300	6503	SO:0001583	missense	139411	exon3			ATTGTGCTCCAAT	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.2306C>T	X.37:g.23411941C>T	ENSP00000368666:p.Ala769Val	126.0	0.0		107.0	11.0	NM_173495	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	ENST00000379361.4	37	CCDS35215.2	.	.	.	.	.	.	.	.	.	.	C	17.95	3.514919	0.64634	.	.	ENSG00000165186	ENST00000379361	D	0.93426	-3.22	5.18	5.18	0.71444	.	0.056326	0.64402	D	0.000001	D	0.94978	0.8375	L	0.55213	1.73	0.51767	D	0.999934	D	0.55605	0.972	P	0.59761	0.863	D	0.94409	0.7630	10	0.39692	T	0.17	.	17.8203	0.88648	0.0:1.0:0.0:0.0	.	769	Q96NR3	PTHD1_HUMAN	V	769	ENSP00000368666:A769V	ENSP00000368666:A769V	A	+	2	0	PTCHD1	23321862	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.933000	0.70130	2.140000	0.66376	0.523000	0.50628	GCT	.		0.368	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
RAPGEF2	9693	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	160253698	160253698	+	Missense_Mutation	SNP	T	T	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr4:160253698T>C	ENST00000264431.4	+	11	1920	c.1501T>C	c.(1501-1503)Tcc>Ccc	p.S501P		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	501					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		CAGTCGCTACTCCATTCCAGA	0.393																																					p.S501P		.											.	RAPGEF2	637	0			c.T1501C						.						88.0	84.0	85.0					4																	160253698		1882	4106	5988	SO:0001583	missense	9693	exon11			CGCTACTCCATTC	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.1501T>C	4.37:g.160253698T>C	ENSP00000264431:p.Ser501Pro	231.0	0.0		169.0	43.0	NM_014247	D3DP27	Missense_Mutation	SNP	ENST00000264431.4	37	CCDS43277.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.2|27.2	4.814180|4.814180	0.90790|0.90790	.|.	.|.	ENSG00000109756|ENSG00000109756	ENST00000512056|ENST00000264431	.|T	.|0.42513	.|0.97	5.63|5.63	5.63|5.63	0.86233|0.86233	.|Ras guanine nucleotide exchange factor, domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.62344|0.62344	0.2420|0.2420	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	.|D	.|0.64830	.|0.994	.|D	.|0.66847	.|0.947	T|T	0.65117|0.65117	-0.6246|-0.6246	5|10	.|0.62326	.|D	.|0.03	.|.	15.8417|15.8417	0.78852|0.78852	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|501	.|Q9Y4G8	.|RPGF2_HUMAN	P|P	138|501	.|ENSP00000264431:S501P	.|ENSP00000264431:S501P	L|S	+|+	2|1	0|0	RAPGEF2|RAPGEF2	160473148|160473148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.950000|7.950000	0.87804|0.87804	2.141000|2.141000	0.66446|0.66446	0.533000|0.533000	0.62120|0.62120	CTC|TCC	.		0.393	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	NM_014247	
RELN	5649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	103179712	103179712	+	Silent	SNP	A	A	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr7:103179712A>G	ENST00000428762.1	-	45	7152	c.6993T>C	c.(6991-6993)gaT>gaC	p.D2331D	RELN_ENST00000424685.2_Silent_p.D2331D|RELN_ENST00000343529.5_Silent_p.D2331D	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2331					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ATTTCCTACTATCAAGGGTTG	0.428																																					p.D2331D	NSCLC(146;835 1944 15585 22231 52158)	.											.	RELN	574	0			c.T6993C						.						64.0	66.0	66.0					7																	103179712		2203	4300	6503	SO:0001819	synonymous_variant	5649	exon45			CCTACTATCAAGG		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6993T>C	7.37:g.103179712A>G		119.0	0.0		120.0	41.0	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	CCDS47680.1																																																																																			.		0.428	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
RNF130	55819	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	179393926	179393926	+	Missense_Mutation	SNP	C	C	T	rs138960112	byFrequency	TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr5:179393926C>T	ENST00000261947.4	-	7	1428	c.1030G>A	c.(1030-1032)Ggc>Agc	p.G344S	RNF130_ENST00000522208.2_Missense_Mutation_p.G344S|RNF130_ENST00000521389.1_Missense_Mutation_p.G344S|CTC-563A5.2_ENST00000510240.1_RNA	NM_001280801.1	NP_001267730.1			ring finger protein 130											breast(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	17	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCGAGGTCGCCGAGGGCTGAT	0.532													C|||	5	0.000998403	0.0038	0.0	5008	,	,		18147	0.0		0.0	False		,,,				2504	0.0				p.G344S	GBM(24;432 554 38471 39699 51728)	.											.	RNF130	227	0			c.G1030A						.	C	SER/GLY	14,4392	21.2+/-45.6	0,14,2189	113.0	104.0	107.0		1030	4.4	0.8	5	dbSNP_134	107	0,8600		0,0,4300	yes	missense	RNF130	NM_018434.4	56	0,14,6489	TT,TC,CC		0.0,0.3177,0.1076	benign	344/420	179393926	14,12992	2203	4300	6503	SO:0001583	missense	55819	exon7			GGTCGCCGAGGGC	AF155650	CCDS4451.1, CCDS64340.1	5q35.3	2013-01-09			ENSG00000113269	ENSG00000113269		"""RING-type (C3HC4) zinc fingers"""	18280	protein-coding gene	gene with protein product						10806348	Standard	NM_018434		Approved	GP, G1RZFP, GOLIATH	uc003mll.1	Q86XS8	OTTHUMG00000130909	ENST00000261947.4:c.1030G>A	5.37:g.179393926C>T	ENSP00000261947:p.Gly344Ser	220.0	0.0		191.0	69.0	NM_018434		Missense_Mutation	SNP	ENST00000261947.4	37		2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	3.214	-0.161006	0.06502	0.003177	0.0	ENSG00000113269	ENST00000522208;ENST00000521389;ENST00000261947	T;T;T	0.04234	3.7;3.67;3.71	5.26	4.4	0.53042	.	0.203950	0.41396	D	0.000891	T	0.02494	0.0076	N	0.12182	0.205	0.39197	D	0.963071	B;B	0.24618	0.107;0.023	B;B	0.17722	0.019;0.004	T	0.31280	-0.9949	10	0.02654	T	1	.	10.3601	0.43989	0.0:0.8485:0.0:0.1515	.	361;344	Q59EL1;Q86XS8	.;GOLI_HUMAN	S	344	ENSP00000429509:G344S;ENSP00000430237:G344S;ENSP00000261947:G344S	ENSP00000261947:G344S	G	-	1	0	RNF130	179326532	0.991000	0.36638	0.813000	0.32504	0.054000	0.15201	3.695000	0.54749	1.196000	0.43129	0.491000	0.48974	GGC	C|0.999;T|0.001		0.532	RNF130-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374205.1	NM_018434	
RNF213	57674	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	78319696	78319696	+	Missense_Mutation	SNP	A	A	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr17:78319696A>G	ENST00000582970.1	+	29	7704	c.7561A>G	c.(7561-7563)Ata>Gta	p.I2521V	RNF213_ENST00000508628.2_Missense_Mutation_p.I2570V|RNF213_ENST00000336301.6_Missense_Mutation_p.I594V	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	2521					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CCTGCATATTATAGCTGCCTG	0.517																																					p.I2521V		.											.	RNF213	577	0			c.A7561G						.						95.0	89.0	91.0					17																	78319696		2203	4300	6503	SO:0001583	missense	57674	exon29			CATATTATAGCTG	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.7561A>G	17.37:g.78319696A>G	ENSP00000464087:p.Ile2521Val	192.0	1.0		147.0	40.0	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	A	5.722	0.317743	0.10845	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.58652	0.32	5.13	5.13	0.70059	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.47967	0.1474	L	0.52206	1.635	0.32416	N	0.549942	B	0.27910	0.193	B	0.23574	0.047	T	0.55630	-0.8111	10	0.24483	T	0.36	.	10.3165	0.43740	0.9232:0.0:0.0768:0.0	.	594	Q63HN8	RN213_HUMAN	V	2521;2570;594	ENSP00000338218:I594V	ENSP00000338218:I594V	I	+	1	0	RNF213	75934291	1.000000	0.71417	0.817000	0.32601	0.119000	0.20118	7.202000	0.77856	2.137000	0.66172	0.533000	0.62120	ATA	.		0.517	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
ROS1	6098	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	117638330	117638330	+	Silent	SNP	A	A	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr6:117638330A>G	ENST00000368508.3	-	38	6309	c.6111T>C	c.(6109-6111)taT>taC	p.Y2037Y	GOPC_ENST00000467125.1_5'Flank|ROS1_ENST00000368507.3_Silent_p.Y2031Y	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	2037	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CTTTACGCAAATAAGTAAGAA	0.398			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.Y2037Y		.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	ROS1	1353	0			c.T6111C						.						134.0	124.0	127.0					6																	117638330		2203	4300	6503	SO:0001819	synonymous_variant	6098	exon38			ACGCAAATAAGTA	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.6111T>C	6.37:g.117638330A>G		214.0	0.0		126.0	6.0	NM_002944	Q15368|Q5TDB5	Silent	SNP	ENST00000368508.3	37	CCDS5116.1																																																																																			.		0.398	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
SAFB2	9667	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	5621381	5621381	+	Silent	SNP	A	A	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:5621381A>G	ENST00000252542.4	-	2	477	c.213T>C	c.(211-213)ccT>ccC	p.P71P	SAFB_ENST00000588852.1_5'Flank|SAFB_ENST00000292123.5_5'Flank|SAFB_ENST00000538656.1_5'Flank|SAFB_ENST00000454510.1_5'Flank|SAFB_ENST00000433404.1_5'Flank|SAFB_ENST00000592224.1_5'Flank	NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	71					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		CAATTTCATCAGGATCTTGCC	0.448																																					p.P71P	Ovarian(127;888 1728 23957 44128 52668)	.											.	SAFB2	90	0			c.T213C						.						305.0	280.0	288.0					19																	5621381		2203	4300	6503	SO:0001819	synonymous_variant	9667	exon2			TTCATCAGGATCT	D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.213T>C	19.37:g.5621381A>G		113.0	0.0		95.0	5.0	NM_014649	B4DKG3|Q8TB13	Silent	SNP	ENST00000252542.4	37	CCDS32879.1																																																																																			.		0.448	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451016.1	NM_014649	
SALL2	6297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	21992350	21992350	+	Silent	SNP	T	T	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr14:21992350T>A	ENST00000327430.3	-	2	1806	c.1512A>T	c.(1510-1512)ggA>ggT	p.G504G	SALL2_ENST00000317492.5_Intron|AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000450879.2_Silent_p.G367G|SALL2_ENST00000538754.1_Intron	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	504					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		AAGCAGGGAGTCCTGGAGCCG	0.567																																					p.G504G		.											.	SALL2	92	0			c.A1512T						.						40.0	39.0	39.0					14																	21992350		2203	4300	6503	SO:0001819	synonymous_variant	6297	exon2			AGGGAGTCCTGGA	AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.1512A>T	14.37:g.21992350T>A		66.0	0.0		63.0	21.0	NM_005407	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Silent	SNP	ENST00000327430.3	37	CCDS32045.1	.	.	.	.	.	.	.	.	.	.	T	0.028	-1.355502	0.01256	.	.	ENSG00000165821	ENST00000546363	.	.	.	4.46	-1.66	0.08265	.	.	.	.	.	T	0.39226	0.1070	.	.	.	0.48901	D	0.999725	.	.	.	.	.	.	T	0.29150	-1.0021	4	.	.	.	-8.9817	1.1556	0.01795	0.1499:0.3012:0.1472:0.4016	.	.	.	.	V	363	.	.	D	-	2	0	SALL2	21062190	0.012000	0.17670	0.939000	0.37840	0.168000	0.22595	-0.521000	0.06245	-0.168000	0.10853	0.379000	0.24179	GAC	.		0.567	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407	
SDPR	8436	hgsc.bcm.edu;broad.mit.edu	37	2	192700908	192700908	+	Missense_Mutation	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr2:192700908G>T	ENST00000304141.4	-	2	1348	c.1019C>A	c.(1018-1020)gCg>gAg	p.A340E		NM_004657.5	NP_004648.1			serum deprivation response											NS(1)|central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(3)	23			OV - Ovarian serous cystadenocarcinoma(117;0.0647)			GGCGAGGGACGCTTCGGAATG	0.567																																					p.A340E		.											.	SDPR	92	0			c.C1019A						.						105.0	105.0	105.0					2																	192700908		2203	4300	6503	SO:0001583	missense	8436	exon2			AGGGACGCTTCGG	AF085481	CCDS2313.1	2q32-q33	2011-04-20	2009-09-18		ENSG00000168497	ENSG00000168497			10690	protein-coding gene	gene with protein product	"""phosphatidylserine binding protein"""	606728	"""serum deprivation response (phosphatidylserine-binding protein)"", ""serum deprivation response (phosphatidylserine binding protein)"""			10191091, 8241023	Standard	NM_004657		Approved	SDR, PS-p68, cavin-2, CAVIN2	uc002utb.3	O95810	OTTHUMG00000154309	ENST00000304141.4:c.1019C>A	2.37:g.192700908G>T	ENSP00000305675:p.Ala340Glu	120.0	0.0		84.0	4.0	NM_004657		Missense_Mutation	SNP	ENST00000304141.4	37	CCDS2313.1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.446819	0.43429	.	.	ENSG00000168497	ENST00000304141	T	0.64438	-0.1	5.01	4.11	0.48088	.	0.633297	0.16592	N	0.207720	T	0.46502	0.1396	L	0.44542	1.39	0.09310	N	1	B	0.26483	0.15	B	0.22601	0.04	T	0.25813	-1.0121	10	0.20519	T	0.43	-15.7112	3.9134	0.09213	0.1993:0.2237:0.577:0.0	.	340	O95810	SDPR_HUMAN	E	340	ENSP00000305675:A340E	ENSP00000305675:A340E	A	-	2	0	SDPR	192409153	0.275000	0.24201	0.043000	0.18650	0.007000	0.05969	2.139000	0.42149	1.299000	0.44798	0.563000	0.77884	GCG	.		0.567	SDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334791.2	NM_004657	
SHROOM2	357	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	9841727	9841727	+	Silent	SNP	G	G	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chrX:9841727G>A	ENST00000380913.3	+	2	291	c.201G>A	c.(199-201)aaG>aaA	p.K67K	Y_RNA_ENST00000384117.1_RNA	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	67	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				CGGTCGACAAGTTACTGGCTG	0.532											OREG0019659	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K67K		.											.	SHROOM2	198	0			c.G201A						.						101.0	89.0	93.0					X																	9841727		2203	4300	6503	SO:0001819	synonymous_variant	357	exon2			CGACAAGTTACTG	X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.201G>A	X.37:g.9841727G>A		262.0	2.0	660	194.0	56.0	NM_001649	B9EIQ7	Silent	SNP	ENST00000380913.3	37	CCDS14135.1																																																																																			.		0.532	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055721.1	NM_001649	
SIDT2	51092	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	117056884	117056884	+	Missense_Mutation	SNP	A	A	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr11:117056884A>G	ENST00000324225.4	+	9	1438	c.907A>G	c.(907-909)Ata>Gta	p.I303V	SIDT2_ENST00000431081.2_Missense_Mutation_p.I303V	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	303					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		TTGCCTGGGTATATTTCTCTC	0.557																																					p.I303V		.											.	SIDT2	90	0			c.A907G						.						173.0	155.0	161.0					11																	117056884		2201	4296	6497	SO:0001583	missense	51092	exon9			CTGGGTATATTTC	AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.907A>G	11.37:g.117056884A>G	ENSP00000314023:p.Ile303Val	172.0	1.0		146.0	45.0	NM_001040455	Q8NBY7|Q9Y357	Missense_Mutation	SNP	ENST00000324225.4	37	CCDS31682.1	.	.	.	.	.	.	.	.	.	.	A	12.81	2.048422	0.36181	.	.	ENSG00000149577	ENST00000324225;ENST00000278951;ENST00000431081;ENST00000524842	T;T;T;T	0.20463	2.07;2.07;2.07;2.07	5.16	5.16	0.70880	.	0.057470	0.64402	D	0.000002	T	0.12860	0.0312	N	0.20986	0.625	0.48762	D	0.999708	B;B;B;B	0.14012	0.007;0.009;0.005;0.008	B;B;B;B	0.23150	0.026;0.011;0.02;0.044	T	0.15780	-1.0425	10	0.17832	T	0.49	-14.4825	7.5247	0.27647	0.8361:0.0:0.1639:0.0	.	303;303;303;303	Q8NBJ9-2;F5H8L4;Q8NBJ9;C9JBG5	.;.;SIDT2_HUMAN;.	V	303;303;303;153	ENSP00000314023:I303V;ENSP00000278951:I303V;ENSP00000399635:I303V;ENSP00000436983:I153V	ENSP00000278951:I303V	I	+	1	0	SIDT2	116562094	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	5.832000	0.69337	1.964000	0.57103	0.383000	0.25322	ATA	.		0.557	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392836.1	NM_015996	
SLC16A14	151473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	230914503	230914503	+	Missense_Mutation	SNP	A	A	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr2:230914503A>C	ENST00000295190.4	-	3	835	c.377T>G	c.(376-378)cTc>cGc	p.L126R		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		AGTAATGAAGAGATAATGCAC	0.448																																					p.L126R		.											.	SLC16A14	96	0			c.T377G						.						93.0	91.0	92.0					2																	230914503		2203	4300	6503	SO:0001583	missense	151473	exon3			ATGAAGAGATAAT	BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.377T>G	2.37:g.230914503A>C	ENSP00000295190:p.Leu126Arg	252.0	0.0		248.0	43.0	NM_152527	A8KA08|Q53R92|Q96NI7	Missense_Mutation	SNP	ENST00000295190.4	37	CCDS2473.1	.	.	.	.	.	.	.	.	.	.	A	19.47	3.833629	0.71258	.	.	ENSG00000163053	ENST00000295190;ENST00000457406;ENST00000412034	D;D;D	0.86097	-2.07;-2.07;-2.07	4.8	4.8	0.61643	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.50627	D	0.000107	D	0.92430	0.7597	M	0.91140	3.18	0.49915	D	0.999839	P;D	0.64830	0.953;0.994	P;P	0.60012	0.84;0.867	D	0.93688	0.7004	10	0.62326	D	0.03	.	13.1076	0.59255	1.0:0.0:0.0:0.0	.	126;126	E7EMG7;Q7RTX9	.;MOT14_HUMAN	R	126	ENSP00000295190:L126R;ENSP00000400352:L126R;ENSP00000395775:L126R	ENSP00000295190:L126R	L	-	2	0	SLC16A14	230622747	1.000000	0.71417	0.983000	0.44433	0.930000	0.56654	6.002000	0.70693	2.017000	0.59298	0.533000	0.62120	CTC	.		0.448	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2	NM_152527	
SLC28A3	64078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	86905113	86905113	+	Missense_Mutation	SNP	A	A	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr9:86905113A>G	ENST00000376238.4	-	11	1154	c.1105T>C	c.(1105-1107)Tct>Cct	p.S369P	SLC28A3_ENST00000537648.1_Missense_Mutation_p.S300P|RP11-380F14.2_ENST00000419815.1_RNA	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	369					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)			endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	GCAATGGTAGAGAACCCGGCG	0.448																																					p.S369P	Ovarian(106;425 1539 34835 42413 43572)	.											.	SLC28A3	94	0			c.T1105C						.						114.0	108.0	110.0					9																	86905113		2203	4300	6503	SO:0001583	missense	64078	exon11			TGGTAGAGAACCC	AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.1105T>C	9.37:g.86905113A>G	ENSP00000365413:p.Ser369Pro	152.0	0.0		125.0	25.0	NM_001199633	A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Missense_Mutation	SNP	ENST00000376238.4	37	CCDS6670.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.432896	0.83776	.	.	ENSG00000197506	ENST00000376238;ENST00000537648	T;T	0.30714	1.52;1.52	5.82	-0.775	0.10988	Nucleoside recognition (1);	0.410917	0.26355	N	0.024852	T	0.55033	0.1895	M	0.80183	2.485	0.38193	D	0.939974	P	0.49307	0.922	P	0.60609	0.877	T	0.71397	-0.4605	10	0.87932	D	0	-5.7197	20.1898	0.98228	0.2856:0.7143:0.0:0.0	.	369	Q9HAS3	S28A3_HUMAN	P	369;300	ENSP00000365413:S369P;ENSP00000446438:S300P	ENSP00000365413:S369P	S	-	1	0	SLC28A3	86094933	0.991000	0.36638	0.966000	0.40874	0.809000	0.45718	0.500000	0.22562	-0.089000	0.12484	0.460000	0.39030	TCT	.		0.448	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052874.1	NM_022127	
SLC34A2	10568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	25671316	25671316	+	Missense_Mutation	SNP	T	T	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr4:25671316T>A	ENST00000382051.3	+	7	733	c.683T>A	c.(682-684)gTg>gAg	p.V228E	SLC34A2_ENST00000504570.1_Missense_Mutation_p.V227E|SLC34A2_ENST00000503434.1_Missense_Mutation_p.V227E	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	228				V -> L (in Ref. 2; AAF31328 and 5; AAL55657). {ECO:0000305}.	aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				TGGCTGTCCGTGTTGGTGCTC	0.532			T	ROS1	NSCLC																																p.V228E		.		Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	.	SLC34A2	95	0			c.T683A						.						206.0	198.0	201.0					4																	25671316		2203	4300	6503	SO:0001583	missense	10568	exon7			TGTCCGTGTTGGT	AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.683T>A	4.37:g.25671316T>A	ENSP00000371483:p.Val228Glu	186.0	0.0		171.0	57.0	NM_006424	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	ENST00000382051.3	37	CCDS3435.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.705879	0.89018	.	.	ENSG00000157765	ENST00000504570;ENST00000382051;ENST00000503434	D;D;D	0.88277	-2.36;-2.36;-2.36	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.96778	0.8948	H	0.98426	4.23	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.76071	0.983;0.987	D	0.98429	1.0581	10	0.87932	D	0	-29.2286	15.5276	0.75923	0.0:0.0:0.0:1.0	.	227;228	O95436-2;O95436	.;NPT2B_HUMAN	E	227;228;227	ENSP00000425501:V227E;ENSP00000371483:V228E;ENSP00000423021:V227E	ENSP00000371483:V228E	V	+	2	0	SLC34A2	25280414	1.000000	0.71417	0.268000	0.24571	0.846000	0.48090	7.948000	0.87774	2.136000	0.66102	0.459000	0.35465	GTG	.		0.532	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424	
SLC36A4	120103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	92918881	92918881	+	Missense_Mutation	SNP	T	T	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr11:92918881T>C	ENST00000326402.4	-	2	285	c.155A>G	c.(154-156)cAa>cGa	p.Q52R	SLC36A4_ENST00000529184.1_5'UTR	NM_152313.2	NP_689526.2	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 4	52					L-alanine transport (GO:0015808)|proline transport (GO:0015824)|tryptophan transport (GO:0015827)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	25		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				ATCATCAAGTTGGTAATGCTT	0.373																																					p.Q52R		.											.	SLC36A4	93	0			c.A155G						.						125.0	115.0	119.0					11																	92918881		2201	4298	6499	SO:0001583	missense	120103	exon2			TCAAGTTGGTAAT	AY162216	CCDS8291.1, CCDS66202.1	11q21	2013-05-22			ENSG00000180773	ENSG00000180773		"""Solute carriers"""	19660	protein-coding gene	gene with protein product		613760					Standard	XM_005273758		Approved	PAT4, FLJ38932	uc001pdn.3	Q6YBV0	OTTHUMG00000167368	ENST00000326402.4:c.155A>G	11.37:g.92918881T>C	ENSP00000317382:p.Gln52Arg	90.0	0.0		66.0	15.0	NM_152313	Q86X30|Q8IVM5|Q8N8S6	Missense_Mutation	SNP	ENST00000326402.4	37	CCDS8291.1	.	.	.	.	.	.	.	.	.	.	T	3.785	-0.044776	0.07452	.	.	ENSG00000180773	ENST00000326402	T	0.03889	3.77	5.62	5.62	0.85841	.	0.092368	0.48767	D	0.000167	T	0.04092	0.0114	L	0.27053	0.805	0.80722	D	1	B	0.11235	0.004	B	0.09377	0.004	T	0.34477	-0.9827	10	0.07813	T	0.8	-7.6902	14.0451	0.64700	0.0:0.0:0.0:1.0	.	52	Q6YBV0	S36A4_HUMAN	R	52	ENSP00000317382:Q52R	ENSP00000317382:Q52R	Q	-	2	0	SLC36A4	92558529	1.000000	0.71417	0.979000	0.43373	0.507000	0.33981	3.589000	0.53972	2.134000	0.65973	0.528000	0.53228	CAA	.		0.373	SLC36A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394329.2		
SLIT3	6586	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	168233531	168233531	+	Silent	SNP	C	C	A	rs367972639		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr5:168233531C>A	ENST00000519560.1	-	9	1274	c.855G>T	c.(853-855)acG>acT	p.T285T	SLIT3_ENST00000404867.3_Silent_p.T285T|SLIT3_ENST00000332966.8_Silent_p.T285T	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	285	LRRNT 2.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TATTGCTGCACGTGCAGGGCG	0.562																																					p.T285T	Ovarian(29;311 847 10864 17279 24903)	.											.	SLIT3	95	0			c.G855T						.						90.0	82.0	85.0					5																	168233531		2203	4300	6503	SO:0001819	synonymous_variant	6586	exon9			GCTGCACGTGCAG	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.855G>T	5.37:g.168233531C>A		248.0	0.0		214.0	50.0	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Silent	SNP	ENST00000519560.1	37	CCDS4369.1																																																																																			.		0.562	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
SMEK1	55671	broad.mit.edu;ucsc.edu	37	14	91927921	91927921	+	Missense_Mutation	SNP	A	A	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr14:91927921A>T	ENST00000554943.1	-	14	2310	c.2195T>A	c.(2194-2196)cTg>cAg	p.L732Q	SMEK1_ENST00000555462.1_Missense_Mutation_p.L493Q|SMEK1_ENST00000337238.4_Missense_Mutation_p.L719Q|SMEK1_ENST00000554684.1_Missense_Mutation_p.L719Q|SMEK1_ENST00000428424.2_Missense_Mutation_p.L493Q|SMEK1_ENST00000555718.1_5'UTR			Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1 (Dictyostelium)	732					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				NS(1)|endometrium(1)|kidney(1)|liver(1)|lung(1)|stomach(1)	6		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		GTTTGTTTTCAGAAGCACTTC	0.413																																					p.L719Q		.											.	SMEK1	226	0			c.T2156A						.						112.0	118.0	116.0					14																	91927921		2203	4300	6503	SO:0001583	missense	55671	exon15			GTTTTCAGAAGCA	AK000714	CCDS9895.1, CCDS61532.1	14q32.12	2008-09-15	2006-10-12	2006-10-12		ENSG00000100796			20219	protein-coding gene	gene with protein product		610351	"""KIAA2010"""	KIAA2010		16085932, 18487071	Standard	XM_005267842		Approved	FLJ20707, MSTP033, FLFL1, smk-1, smk1	uc001xzm.3	Q6IN85		ENST00000554943.1:c.2195T>A	14.37:g.91927921A>T	ENSP00000450883:p.Leu732Gln	144.0	2.0		88.0	16.0	NM_032560	Q69YK6|Q86U23|Q86YI7|Q8IVG1|Q9H3F1|Q9H7U8|Q9NV01|Q9NWP1	Missense_Mutation	SNP	ENST00000554943.1	37		.	.	.	.	.	.	.	.	.	.	A	11.54	1.669247	0.29604	.	.	ENSG00000100796	ENST00000554684;ENST00000337238;ENST00000428424;ENST00000554943;ENST00000555462	T;T;T	0.41758	0.99;0.99;1.0	5.79	5.79	0.91817	.	0.194678	0.44483	D	0.000449	T	0.35307	0.0927	N	0.14661	0.345	0.46113	D	0.998876	P;B;B	0.51537	0.946;0.203;0.147	P;B;B	0.50708	0.648;0.105;0.212	T	0.09907	-1.0653	10	0.11794	T	0.64	-5.981	16.1299	0.81422	1.0:0.0:0.0:0.0	.	493;732;719	Q6IN85-4;Q6IN85;Q6IN85-2	.;P4R3A_HUMAN;.	Q	719;719;493;732;493	ENSP00000450864:L719Q;ENSP00000337125:L719Q;ENSP00000450883:L732Q	ENSP00000337125:L719Q	L	-	2	0	SMEK1	90997674	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.940000	0.56599	2.215000	0.71742	0.528000	0.53228	CTG	.		0.413	SMEK1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000411665.1	NM_032560	
SNAI1	6615	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	48600475	48600475	+	Missense_Mutation	SNP	C	C	G	rs34261470	byFrequency	TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr20:48600475C>G	ENST00000244050.2	+	2	258	c.197C>G	c.(196-198)gCg>gGg	p.A66G		NM_005985.3	NP_005976.2	O95863	SNAI1_HUMAN	snail family zinc finger 1	66			A -> V (in dbSNP:rs34261470).		cartilage morphogenesis (GO:0060536)|cell migration (GO:0016477)|epithelial to mesenchymal transition (GO:0001837)|hair follicle morphogenesis (GO:0031069)|left/right pattern formation (GO:0060972)|mesoderm formation (GO:0001707)|negative regulation of cell differentiation involved in embryonic placenta development (GO:0060806)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|Notch signaling involved in heart development (GO:0061314)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of tight junction assembly (GO:2000810)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	kinase binding (GO:0019900)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)	17			BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			TCTGTCCTGGCGCCCCAAGCC	0.657																																					p.A66G		.											.	SNAI1	227	0			c.C197G						.						45.0	50.0	48.0					20																	48600475		2203	4300	6503	SO:0001583	missense	6615	exon2			TCCTGGCGCCCCA	AF125377	CCDS13423.1	20q13.2	2013-05-23	2013-05-23		ENSG00000124216	ENSG00000124216		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11128	protein-coding gene	gene with protein product		604238	"""snail 1 (drosophila homolog), zinc finger protein"", ""snail homolog 1 (Drosophila)"""			10585766	Standard	NM_005985		Approved	SNA, SLUGH2, SNAH, SNAIL1, SNAIL	uc002xuz.3	O95863	OTTHUMG00000033048	ENST00000244050.2:c.197C>G	20.37:g.48600475C>G	ENSP00000244050:p.Ala66Gly	21.0	0.0		31.0	8.0	NM_005985	B2R842|Q9P113|Q9UBP7|Q9UHH7	Missense_Mutation	SNP	ENST00000244050.2	37	CCDS13423.1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.133396	0.37630	.	.	ENSG00000124216	ENST00000244050	T	0.23950	1.88	4.94	1.81	0.25067	.	1.159810	0.06133	N	0.670998	T	0.19685	0.0473	L	0.43152	1.355	0.23406	N	0.997747	B	0.32203	0.36	B	0.25506	0.061	T	0.25882	-1.0119	10	0.20519	T	0.43	-4.3384	7.28	0.26306	0.0:0.6314:0.0:0.3686	.	66	O95863	SNAI1_HUMAN	G	66	ENSP00000244050:A66G	ENSP00000244050:A66G	A	+	2	0	SNAI1	48033882	0.003000	0.15002	0.936000	0.37596	0.943000	0.58893	1.315000	0.33608	0.429000	0.26202	0.557000	0.71058	GCG	C|0.979;T|0.021		0.657	SNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080350.1		
SORBS2	8470	hgsc.bcm.edu;bcgsc.ca	37	4	186544299	186544299	+	Missense_Mutation	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr4:186544299G>T	ENST00000284776.7	-	13	2781	c.2272C>A	c.(2272-2274)Cac>Aac	p.H758N	SORBS2_ENST00000418609.1_Missense_Mutation_p.H662N|SORBS2_ENST00000355634.5_Missense_Mutation_p.H858N|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000431808.1_Missense_Mutation_p.H758N	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	758					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		ATGAGGCGGTGCAGGATGCTG	0.562																																					p.H858N	Esophageal Squamous(153;41 2433 9491 36028)	.											.	SORBS2	91	0			c.C2572A						.						135.0	154.0	148.0					4																	186544299		2203	4300	6503	SO:0001583	missense	8470	exon16			GGCGGTGCAGGAT		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.2272C>A	4.37:g.186544299G>T	ENSP00000284776:p.His758Asn	68.0	0.0		55.0	4.0	NM_001270771	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	ENST00000284776.7	37	CCDS3845.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.664954	0.47572	.	.	ENSG00000154556	ENST00000284776;ENST00000431808;ENST00000418609;ENST00000355634	T;T;T;T	0.36878	1.31;1.31;1.23;1.3	5.77	5.77	0.91146	.	0.054833	0.64402	D	0.000001	T	0.59183	0.2175	L	0.56769	1.78	0.50632	D	0.999889	D;D;D	0.64830	0.994;0.993;0.994	D;D;D	0.72338	0.977;0.968;0.977	T	0.56347	-0.7994	10	0.54805	T	0.06	-28.33	19.982	0.97329	0.0:0.0:1.0:0.0	.	662;858;758	B7Z3X6;B3KPQ7;O94875	.;.;SRBS2_HUMAN	N	758;758;662;858	ENSP00000284776:H758N;ENSP00000411764:H758N;ENSP00000397482:H662N;ENSP00000347852:H858N	ENSP00000284776:H758N	H	-	1	0	SORBS2	186781293	1.000000	0.71417	1.000000	0.80357	0.266000	0.26442	7.654000	0.83653	2.737000	0.93849	0.561000	0.74099	CAC	.		0.562	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603	
SOS2	6655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	50655388	50655388	+	Missense_Mutation	SNP	T	T	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr14:50655388T>A	ENST00000216373.5	-	5	815	c.541A>T	c.(541-543)Ata>Tta	p.I181L	SOS2_ENST00000543680.1_Missense_Mutation_p.I181L	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	181					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					ACCAAACCTATGTCATCCTGA	0.323																																					p.I181L		.											.	SOS2	849	0			c.A541T						.						80.0	74.0	76.0					14																	50655388		2203	4300	6503	SO:0001583	missense	6655	exon5			AACCTATGTCATC	L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.541A>T	14.37:g.50655388T>A	ENSP00000216373:p.Ile181Leu	71.0	0.0		57.0	13.0	NM_006939	B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	ENST00000216373.5	37	CCDS9697.1	.	.	.	.	.	.	.	.	.	.	T	12.74	2.028637	0.35797	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	T;T	0.78595	-1.19;-1.03	5.43	5.43	0.79202	Histone-fold (1);	0.443755	0.27064	N	0.021116	T	0.65004	0.2650	L	0.27053	0.805	0.44908	D	0.997926	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.60419	-0.7267	10	0.09590	T	0.72	.	15.4668	0.75406	0.0:0.0:0.0:1.0	.	181;181	B7ZKT6;Q07890	.;SOS2_HUMAN	L	181	ENSP00000216373:I181L;ENSP00000445328:I181L	ENSP00000216373:I181L	I	-	1	0	SOS2	49725138	1.000000	0.71417	0.998000	0.56505	0.783000	0.44284	4.960000	0.63673	2.046000	0.60703	0.533000	0.62120	ATA	.		0.323	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2		
SPAG16	79582	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	215274960	215274960	+	Missense_Mutation	SNP	C	C	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr2:215274960C>A	ENST00000331683.5	+	16	1912	c.1817C>A	c.(1816-1818)gCa>gAa	p.A606E	SPAG16_ENST00000374309.3_Missense_Mutation_p.A512E|AC107218.3_ENST00000437883.1_RNA|AC107218.3_ENST00000412896.1_RNA|VWC2L_ENST00000312504.5_5'Flank|VWC2L_ENST00000427124.1_5'Flank	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	606					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GAAAACGAGGCACACACGGTT	0.502																																					p.A606E		.											.	SPAG16	188	0			c.C1817A						.						136.0	130.0	132.0					2																	215274960		2203	4300	6503	SO:0001583	missense	79582	exon16			ACGAGGCACACAC	AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.1817C>A	2.37:g.215274960C>A	ENSP00000332592:p.Ala606Glu	216.0	0.0		186.0	47.0	NM_024532	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Missense_Mutation	SNP	ENST00000331683.5	37	CCDS2396.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.436431	0.43224	.	.	ENSG00000144451	ENST00000331683;ENST00000374309;ENST00000451561	T;T;T	0.60171	0.21;0.21;0.21	5.48	0.291	0.15732	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.802457	0.10745	N	0.638995	T	0.59824	0.2222	L	0.46670	1.46	0.21256	N	0.999742	D;P;D	0.58970	0.97;0.757;0.984	P;B;P	0.54815	0.761;0.433;0.761	T	0.52003	-0.8633	10	0.87932	D	0	.	8.4277	0.32739	0.0:0.3662:0.0:0.6338	.	512;546;606	B4DYB5;Q4G1A2;Q8N0X2	.;.;SPG16_HUMAN	E	606;512;230	ENSP00000332592:A606E;ENSP00000363428:A512E;ENSP00000416600:A230E	ENSP00000332592:A606E	A	+	2	0	SPAG16	214983205	0.527000	0.26306	0.746000	0.31095	0.165000	0.22458	0.128000	0.15810	0.051000	0.15978	-0.217000	0.12591	GCA	.		0.502	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256601.2	NM_024532	
SPTB	6710	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	65260468	65260468	+	Missense_Mutation	SNP	C	C	G	rs371216825		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr14:65260468C>G	ENST00000389721.5	-	13	1945	c.1913G>C	c.(1912-1914)cGa>cCa	p.R638P	SPTB_ENST00000556626.1_Missense_Mutation_p.R638P|SPTB_ENST00000542895.1_Missense_Mutation_p.R638P|SPTB_ENST00000389720.3_Missense_Mutation_p.R638P|SPTB_ENST00000389722.3_Missense_Mutation_p.R638P	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	638					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CTTCCAGAGTCGTTTGGACTG	0.557																																					p.R638P		.											.	SPTB	100	0			c.G1913C						.						75.0	64.0	68.0					14																	65260468		2203	4300	6503	SO:0001583	missense	6710	exon13			CAGAGTCGTTTGG		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.1913G>C	14.37:g.65260468C>G	ENSP00000374371:p.Arg638Pro	101.0	1.0		81.0	28.0	NM_001024858	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.447774	0.43429	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25	5.32	4.43	0.53597	.	0.126301	0.53938	D	0.000045	T	0.46308	0.1386	M	0.77486	2.375	0.51767	D	0.999935	B;B	0.18968	0.032;0.031	B;B	0.33690	0.168;0.054	T	0.50171	-0.8859	10	0.87932	D	0	.	12.9528	0.58411	0.0:0.9198:0.0:0.0802	.	638;642	P11277;Q59FP5	SPTB1_HUMAN;.	P	642;638;638;638;638;638	ENSP00000374372:R638P;ENSP00000451752:R638P;ENSP00000374371:R638P;ENSP00000443882:R638P;ENSP00000374370:R638P	ENSP00000374370:R638P	R	-	2	0	SPTB	64330221	0.043000	0.20138	1.000000	0.80357	0.871000	0.50021	1.437000	0.34991	1.249000	0.43950	0.561000	0.74099	CGA	.		0.557	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
TAS2R16	50833	broad.mit.edu;bcgsc.ca	37	7	122635089	122635089	+	Missense_Mutation	SNP	C	C	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr7:122635089C>A	ENST00000249284.2	-	1	665	c.600G>T	c.(598-600)atG>atT	p.M200I		NM_016945.2	NP_058641.1	Q9NYV7	T2R16_HUMAN	taste receptor, type 2, member 16	200					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	bitter taste receptor activity (GO:0033038)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TCAGTGATGCCATGAGAAAGA	0.458																																					p.M200I		.											.	TAS2R16	92	0			c.G600T						.						147.0	125.0	133.0					7																	122635089		2203	4300	6503	SO:0001583	missense	50833	exon1			TGATGCCATGAGA	AF227139	CCDS5785.1	7q31.1-q31.3	2012-08-22			ENSG00000128519	ENSG00000128519		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14921	protein-coding gene	gene with protein product		604867				10761934	Standard	NM_016945		Approved	T2R16	uc003vkl.1	Q9NYV7	OTTHUMG00000157090	ENST00000249284.2:c.600G>T	7.37:g.122635089C>A	ENSP00000249284:p.Met200Ile	204.0	1.0		217.0	15.0	NM_016945	A4D0X2|Q502V3|Q549U8|Q645W1	Missense_Mutation	SNP	ENST00000249284.2	37	CCDS5785.1	.	.	.	.	.	.	.	.	.	.	C	1.840	-0.467604	0.04476	.	.	ENSG00000128519	ENST00000249284	T	0.00580	6.43	4.45	-2.37	0.06643	.	0.644304	0.15177	N	0.276316	T	0.00271	0.0008	N	0.11313	0.125	0.09310	N	1	B	0.25169	0.119	B	0.24541	0.054	T	0.42799	-0.9430	10	0.02654	T	1	.	4.3661	0.11225	0.1671:0.2904:0.0:0.5426	.	200	Q9NYV7	T2R16_HUMAN	I	200	ENSP00000249284:M200I	ENSP00000249284:M200I	M	-	3	0	TAS2R16	122422325	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.750000	0.04808	-0.223000	0.09943	-0.140000	0.14226	ATG	.		0.458	TAS2R16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347409.1	NM_016945	
TAS2R41	259287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	143175239	143175239	+	Missense_Mutation	SNP	C	C	G			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr7:143175239C>G	ENST00000408916.1	+	1	274	c.274C>G	c.(274-276)Ctg>Gtg	p.L92V	EPHA1-AS1_ENST00000429289.1_RNA	NM_176883.2	NP_795364.2	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	92					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(2)|skin(1)	18	Melanoma(164;0.15)					CTGGCACTTCCTGAACTCAGC	0.537																																					p.L92V		.											.	TAS2R41	92	0			c.C274G						.						101.0	100.0	101.0					7																	143175239		1998	4180	6178	SO:0001583	missense	259287	exon1			CACTTCCTGAACT	AF494232	CCDS43663.1	7q34	2012-08-22			ENSG00000221855	ENSG00000221855		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18883	protein-coding gene	gene with protein product		613965				12379855	Standard	NM_176883		Approved	T2R59	uc003wdc.1	P59536	OTTHUMG00000155892	ENST00000408916.1:c.274C>G	7.37:g.143175239C>G	ENSP00000386201:p.Leu92Val	138.0	0.0		126.0	19.0	NM_176883	P59550|Q495I2|Q50KJ5|Q50KJ6|Q50KJ7|Q645W7	Missense_Mutation	SNP	ENST00000408916.1	37	CCDS43663.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.120206	0.37436	.	.	ENSG00000221855	ENST00000408916	T	0.39406	1.08	6.0	2.61	0.31194	.	0.242058	0.26883	U	0.022002	T	0.43456	0.1248	L	0.48986	1.54	0.28844	N	0.896432	P	0.42123	0.771	P	0.51550	0.673	T	0.29058	-1.0024	10	0.27082	T	0.32	.	6.5006	0.22166	0.2905:0.6053:0.0:0.1042	.	92	P59536	T2R41_HUMAN	V	92	ENSP00000386201:L92V	ENSP00000386201:L92V	L	+	1	2	TAS2R41	142885361	0.010000	0.17322	0.986000	0.45419	0.104000	0.19210	-0.450000	0.06803	0.202000	0.20498	0.655000	0.94253	CTG	.		0.537	TAS2R41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342149.1		
TMEM145	284339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42827878	42827878	+	Silent	SNP	G	G	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr19:42827878G>C	ENST00000301204.3	+	14	1379	c.1338G>C	c.(1336-1338)acG>acC	p.T446T	MEGF8_ENST00000334370.4_5'Flank|MEGF8_ENST00000251268.6_5'Flank	NM_173633.2	NP_775904.2	Q8NBT3	TM145_HUMAN	transmembrane protein 145	446					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	27		Prostate(69;0.00682)				GGAACGTGACGTTTATCAGCG	0.672																																					p.T446T		.											.	TMEM145	90	0			c.G1338C						.						109.0	90.0	96.0					19																	42827878		2203	4300	6503	SO:0001819	synonymous_variant	284339	exon14			CGTGACGTTTATC	AK075286	CCDS12603.1	19q13.2	2008-02-05				ENSG00000167619			26912	protein-coding gene	gene with protein product							Standard	NM_173633		Approved	FLJ90805	uc002otk.1	Q8NBT3		ENST00000301204.3:c.1338G>C	19.37:g.42827878G>C		206.0	0.0		194.0	30.0	NM_173633		Silent	SNP	ENST00000301204.3	37	CCDS12603.1																																																																																			.		0.672	TMEM145-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463737.1	NM_173633	
TMEM5	10329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	64174920	64174920	+	Missense_Mutation	SNP	T	T	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr12:64174920T>A	ENST00000261234.6	+	2	449	c.291T>A	c.(289-291)gaT>gaA	p.D97E	TMEM5_ENST00000537373.1_5'UTR|RP11-415I12.3_ENST00000509615.2_RNA|TMEM5_ENST00000537982.1_3'UTR	NM_014254.1	NP_055069.1	Q9Y2B1	TMEM5_HUMAN	transmembrane protein 5	97						integral component of plasma membrane (GO:0005887)				breast(1)|large_intestine(3)|liver(2)|lung(7)|prostate(1)|skin(1)	15		Myeloproliferative disorder(1001;0.0255)	BRCA - Breast invasive adenocarcinoma(9;0.0985)	GBM - Glioblastoma multiforme(28;9e-08)|BRCA - Breast invasive adenocarcinoma(357;0.000175)		GAAAAACAGATCTCAGTGTAC	0.323																																					p.D97E		.											.	TMEM5	90	0			c.T291A						.						76.0	84.0	81.0					12																	64174920		2203	4300	6503	SO:0001583	missense	10329	exon2			AACAGATCTCAGT	AB015633	CCDS8966.1, CCDS61179.1	12q14.1	2013-05-07			ENSG00000118600	ENSG00000118600			13530	protein-coding gene	gene with protein product		605862				10072769, 23217329	Standard	NM_014254		Approved	HP10481	uc001srq.2	Q9Y2B1	OTTHUMG00000168730	ENST00000261234.6:c.291T>A	12.37:g.64174920T>A	ENSP00000261234:p.Asp97Glu	107.0	0.0		55.0	13.0	NM_014254	A8K017|Q6PKD6	Missense_Mutation	SNP	ENST00000261234.6	37	CCDS8966.1	.	.	.	.	.	.	.	.	.	.	T	0.023	-1.399927	0.01165	.	.	ENSG00000118600	ENST00000261234	T	0.28454	1.61	4.34	1.4	0.22301	.	0.679416	0.15610	N	0.253407	T	0.12944	0.0314	N	0.05124	-0.11	0.21527	N	0.999653	B	0.02656	0.0	B	0.09377	0.004	T	0.31696	-0.9934	9	.	.	.	-26.0342	8.4151	0.32666	0.0:0.7387:0.1614:0.0999	.	97	Q9Y2B1	TMEM5_HUMAN	E	97	ENSP00000261234:D97E	.	D	+	3	2	TMEM5	62461187	0.955000	0.32602	0.035000	0.18076	0.133000	0.20885	0.370000	0.20433	0.160000	0.19432	-1.277000	0.01392	GAT	.		0.323	TMEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400821.1	NM_014254	
TMEM71	137835	ucsc.edu;bcgsc.ca|broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	133734357	133734358	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown|.	Untested	Somatic	.|Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr8:133734357_133734358GG>TT	ENST00000356838.3	-	7	765_766	c.623_624CC>AA	c.(622-624)aCC>aAA	p.T208K	TMEM71_ENST00000377901.4_Missense_Mutation_p.T164K|TMEM71_ENST00000523829.1_Missense_Mutation_p.T227K	NM_144649.2	NP_653250.2	Q6P5X7	TMM71_HUMAN	transmembrane protein 71	227						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			GCAACAACCTGGTTTCTAATAG	0.371																																					p.T208T|p.T208N		.											.	TMEM71	92	0			c.C624A|c.C623A						.																																			SO:0001583	missense	137835	exon7			CAACCTGGTTTCT|AACCTGGTTTCTA	AK057631	CCDS6366.1, CCDS47921.1	8q24.22	2005-09-02				ENSG00000165071			26572	protein-coding gene	gene with protein product						12477932	Standard	NM_144649		Approved	FLJ33069	uc003ytn.3	Q6P5X7		ENST00000356838.3:c.623_624delinsTT	8.37:g.133734357_133734358delinsTT	ENSP00000349296:p.Thr208Lys	304.0|301.0	2.0|1.0		223.0|218.0	42.0|41.0	NM_144649	Q3KRC2|Q8WVZ4|Q96LX9	Silent|Missense_Mutation	SNP	ENST00000356838.3	37	CCDS6366.1																																																																																			.		0.371	TMEM71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379591.1	NM_144649	
TMPRSS11D	9407	broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	68725292	68725292	+	Missense_Mutation	SNP	A	A	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr4:68725292A>T	ENST00000283916.6	-	2	211	c.113T>A	c.(112-114)gTt>gAt	p.V38D	UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11D_ENST00000545541.1_Intron|TMPRSS11D_ENST00000509584.1_Intron	NM_004262.2	NP_004253.1	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	38					proteolysis (GO:0006508)|respiratory gaseous exchange (GO:0007585)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						TAAAAAGTAAACAAGTAGAGC	0.363																																					p.V38D		.											.	TMPRSS11D	91	0			c.T113A						.						92.0	89.0	90.0					4																	68725292		2203	4300	6503	SO:0001583	missense	9407	exon2			AAGTAAACAAGTA	AB002134	CCDS3518.1	4q13.2	2010-04-13			ENSG00000153802	ENSG00000153802		"""Serine peptidases / Transmembrane"""	24059	protein-coding gene	gene with protein product	"""airway trypsin like protease"""	605369				9565616, 9070615	Standard	XM_005265710		Approved		uc003hdq.3	O60235	OTTHUMG00000129300	ENST00000283916.6:c.113T>A	4.37:g.68725292A>T	ENSP00000283916:p.Val38Asp	266.0	1.0		206.0	18.0	NM_004262	Q08AF6	Missense_Mutation	SNP	ENST00000283916.6	37	CCDS3518.1	.	.	.	.	.	.	.	.	.	.	A	18.05	3.537186	0.65085	.	.	ENSG00000153802	ENST00000283916	T	0.36699	1.24	5.19	5.19	0.71726	.	0.599739	0.14341	N	0.325697	T	0.52386	0.1731	M	0.80183	2.485	0.48395	D	0.999641	D	0.58970	0.984	P	0.52267	0.694	T	0.57596	-0.7784	10	0.72032	D	0.01	.	11.3687	0.49687	1.0:0.0:0.0:0.0	.	38	O60235	TM11D_HUMAN	D	38	ENSP00000283916:V38D	ENSP00000283916:V38D	V	-	2	0	TMPRSS11D	68407887	0.094000	0.21725	0.209000	0.23619	0.976000	0.68499	4.007000	0.57093	2.184000	0.69523	0.460000	0.39030	GTT	.		0.363	TMPRSS11D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251430.3	NM_004262	
TNKS2	80351	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	93558624	93558624	+	Silent	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr10:93558624C>T	ENST00000371627.4	+	1	556	c.177C>T	c.(175-177)tcC>tcT	p.S59S	TNKS2-AS1_ENST00000432938.1_RNA|TNKS2-AS1_ENST00000432246.1_RNA	NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	59					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				GCAGGAAATCCACCCCGCTGC	0.682																																					p.S59S		.											.	TNKS2	541	0			c.C177T						.						11.0	13.0	12.0					10																	93558624		2126	4214	6340	SO:0001819	synonymous_variant	80351	exon1			GAAATCCACCCCG	AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.177C>T	10.37:g.93558624C>T		69.0	0.0		62.0	28.0	NM_025235	B2RBD3|Q9H8F2|Q9HAS4	Silent	SNP	ENST00000371627.4	37	CCDS7417.1																																																																																			.		0.682	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049374.1	NM_025235	
TNR	7143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	175299224	175299224	+	Missense_Mutation	SNP	T	T	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:175299224T>C	ENST00000367674.2	-	21	4487	c.3779A>G	c.(3778-3780)tAc>tGc	p.Y1260C	RP3-518E13.2_ENST00000569593.1_RNA|TNR_ENST00000263525.2_Missense_Mutation_p.Y1260C			Q92752	TENR_HUMAN	tenascin R	1260	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.Y1260C(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					AGTGCCGTTGTAGCTTCCTAT	0.597																																					p.Y1260C		.											.	TNR	324	1	Substitution - Missense(1)	endometrium(1)	c.A3779G						.						96.0	78.0	84.0					1																	175299224		2203	4300	6503	SO:0001583	missense	7143	exon21			CCGTTGTAGCTTC	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.3779A>G	1.37:g.175299224T>C	ENSP00000356646:p.Tyr1260Cys	91.0	0.0		106.0	27.0	NM_003285	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	T	14.33	2.503794	0.44558	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	D;D	0.84589	-1.87;-1.87	5.64	5.64	0.86602	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.94228	0.8147	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.95210	0.8324	10	0.87932	D	0	.	10.7341	0.46115	0.1421:0.0:0.0:0.8579	.	1260	Q92752	TENR_HUMAN	C	1260;1260;1170	ENSP00000356646:Y1260C;ENSP00000263525:Y1260C	ENSP00000263525:Y1260C	Y	-	2	0	TNR	173565847	1.000000	0.71417	0.995000	0.50966	0.046000	0.14306	3.689000	0.54706	2.144000	0.66660	0.533000	0.62120	TAC	.		0.597	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
TRIM37	4591	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	57093047	57093047	+	Missense_Mutation	SNP	C	C	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr17:57093047C>A	ENST00000262294.7	-	21	2759	c.2500G>T	c.(2500-2502)Gat>Tat	p.D834Y	TRIM37_ENST00000393065.2_Missense_Mutation_p.D800Y|TRIM37_ENST00000393066.3_Missense_Mutation_p.D834Y|TRIM37_ENST00000376149.3_Missense_Mutation_p.D712Y	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	834					aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					GCATCTGAATCCAAAGCTTTA	0.468									Mulibrey Nanism																												p.D834Y		.											.	TRIM37	660	0			c.G2500T						.						144.0	148.0	147.0					17																	57093047		2203	4300	6503	SO:0001583	missense	4591	exon21	Familial Cancer Database	Perheentupa syndrome	CTGAATCCAAAGC	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.2500G>T	17.37:g.57093047C>A	ENSP00000262294:p.Asp834Tyr	203.0	2.0		185.0	65.0	NM_015294	Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000262294.7	37	CCDS32694.1	.	.	.	.	.	.	.	.	.	.	C	19.45	3.830733	0.71258	.	.	ENSG00000108395	ENST00000393066;ENST00000262294;ENST00000376149;ENST00000393065	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	4.93	4.93	0.64822	.	0.150663	0.46442	D	0.000299	T	0.40498	0.1119	L	0.27053	0.805	0.47621	D	0.999474	D;D;D	0.63880	0.993;0.983;0.971	D;P;P	0.63113	0.911;0.874;0.751	T	0.36065	-0.9763	10	0.87932	D	0	-20.2913	15.0476	0.71838	0.0:1.0:0.0:0.0	.	800;712;834	F8WEE6;O94972-2;O94972	.;.;TRI37_HUMAN	Y	834;834;712;800	ENSP00000376785:D834Y;ENSP00000262294:D834Y;ENSP00000365319:D712Y;ENSP00000376784:D800Y	ENSP00000262294:D834Y	D	-	1	0	TRIM37	54447829	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.384000	0.59607	2.289000	0.77006	0.313000	0.20887	GAT	.		0.468	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445930.1	NM_015294	
TRPA1	8989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	72975703	72975703	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr8:72975703C>T	ENST00000262209.4	-	5	863	c.656G>A	c.(655-657)aGg>aAg	p.R219K		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	219					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	CTCACCAAACCTTAGTATTAT	0.318																																					p.R219K		.											.	TRPA1	230	0			c.G656A						.						77.0	74.0	75.0					8																	72975703		2203	4300	6503	SO:0001583	missense	8989	exon5			CCAAACCTTAGTA	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.656G>A	8.37:g.72975703C>T	ENSP00000262209:p.Arg219Lys	75.0	0.0		46.0	15.0	NM_007332	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	C	1.753	-0.488836	0.04352	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.49432	0.78;2.45	5.62	3.23	0.37069	Ankyrin repeat-containing domain (3);	0.434041	0.29133	N	0.013060	T	0.11024	0.0269	N	0.00289	-1.7	0.25494	N	0.987619	B	0.02656	0.0	B	0.01281	0.0	T	0.36696	-0.9737	10	0.02654	T	1	-9.6898	7.7386	0.28829	0.0:0.0754:0.1449:0.7797	.	219	O75762	TRPA1_HUMAN	K	71;219	ENSP00000428151:R71K;ENSP00000262209:R219K	ENSP00000262209:R219K	R	-	2	0	TRPA1	73138257	1.000000	0.71417	0.389000	0.26208	0.548000	0.35241	2.535000	0.45685	0.485000	0.27652	-0.312000	0.09012	AGG	.		0.318	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
TRPM6	140803	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	77354337	77354337	+	Missense_Mutation	SNP	T	T	A	rs201318772		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr9:77354337T>A	ENST00000360774.1	-	35	5753	c.5516A>T	c.(5515-5517)aAa>aTa	p.K1839I	TRPM6_ENST00000449912.2_Missense_Mutation_p.K1834I|TRPM6_ENST00000376872.3_Missense_Mutation_p.K794I|TRPM6_ENST00000376864.4_Missense_Mutation_p.K1843I|TRPM6_ENST00000451710.3_Missense_Mutation_p.K1843I|TRPM6_ENST00000376871.3_Missense_Mutation_p.K676I|TRPM6_ENST00000361255.3_Missense_Mutation_p.K1834I	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1839	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						ATAGATCAATTTTTGAGCAGC	0.363																																					p.K1839I		.											.	TRPM6	335	0			c.A5516T						.						359.0	317.0	331.0					9																	77354337		2203	4300	6503	SO:0001583	missense	140803	exon35			ATCAATTTTTGAG	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.5516A>T	9.37:g.77354337T>A	ENSP00000354006:p.Lys1839Ile	259.0	1.0		198.0	20.0	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.649818	0.87958	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376870;ENST00000376864	T;T;T;T;T;T;T	0.15139	2.45;2.45;2.45;2.45;2.45;2.45;2.45	5.81	5.81	0.92471	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.043698	0.85682	D	0.000000	T	0.45155	0.1328	M	0.77313	2.365	0.54753	D	0.999984	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.998;1.0	D;D;D;D;D;D	0.97110	0.999;1.0;1.0;0.998;0.989;0.996	T	0.45760	-0.9239	10	0.87932	D	0	.	16.1678	0.81782	0.0:0.0:0.0:1.0	.	386;672;790;1839;1834;1834	Q9BX84-7;Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3;Q9BX84-2	.;.;.;TRPM6_HUMAN;.;.	I	1839;1843;794;676;1834;1834;385;1843	ENSP00000354006:K1839I;ENSP00000407341:K1843I;ENSP00000366068:K794I;ENSP00000366067:K676I;ENSP00000396672:K1834I;ENSP00000354962:K1834I;ENSP00000366060:K1843I	ENSP00000354006:K1839I	K	-	2	0	TRPM6	76544157	1.000000	0.71417	0.987000	0.45799	0.719000	0.41307	7.494000	0.81503	2.218000	0.71995	0.528000	0.53228	AAA	T|0.999;C|0.001		0.363	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
UBXN10	127733	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	20517817	20517817	+	Missense_Mutation	SNP	A	A	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:20517817A>C	ENST00000375099.3	+	2	847	c.763A>C	c.(763-765)Acc>Ccc	p.T255P		NM_152376.3	NP_689589.1	Q96LJ8	UBX10_HUMAN	UBX domain protein 10	255	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.									endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|skin(2)	14						TTCTGACCTCACCAAATCTCT	0.537																																					p.T255P		.											.	UBXN10	91	0			c.A763C						.						71.0	73.0	73.0					1																	20517817		2203	4300	6503	SO:0001583	missense	127733	exon2			GACCTCACCAAAT	AK058158	CCDS205.1	1p36.13	2008-07-25	2008-07-25	2008-07-25	ENSG00000162543	ENSG00000162543		"""UBX domain containing"""	26354	protein-coding gene	gene with protein product			"""UBX domain containing 3"""	UBXD3		12477932	Standard	NM_152376		Approved	FLJ25429	uc001bdb.3	Q96LJ8	OTTHUMG00000002708	ENST00000375099.3:c.763A>C	1.37:g.20517817A>C	ENSP00000364240:p.Thr255Pro	123.0	1.0		63.0	17.0	NM_152376	Q5R386	Missense_Mutation	SNP	ENST00000375099.3	37	CCDS205.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.353230	0.82132	.	.	ENSG00000162543	ENST00000375099	.	.	.	5.98	5.98	0.97165	UBX (3);	0.491635	0.17552	N	0.170127	T	0.69637	0.3133	L	0.47716	1.5	0.42017	D	0.990967	D	0.62365	0.991	D	0.64877	0.93	T	0.71144	-0.4678	9	0.72032	D	0.01	-22.4794	15.2818	0.73790	1.0:0.0:0.0:0.0	.	255	Q96LJ8	UBX10_HUMAN	P	255	.	ENSP00000364240:T255P	T	+	1	0	UBXN10	20390404	0.835000	0.29415	1.000000	0.80357	0.994000	0.84299	3.031000	0.49728	2.288000	0.76882	0.482000	0.46254	ACC	.		0.537	UBXN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007693.1	NM_152376	
TTC13	79573	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	231060591	231060591	+	Missense_Mutation	SNP	T	T	C			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr1:231060591T>C	ENST00000366661.4	-	14	1724	c.1717A>G	c.(1717-1719)Aga>Gga	p.R573G	TTC13_ENST00000414259.1_Missense_Mutation_p.R520G|TTC13_ENST00000366662.4_Missense_Mutation_p.R520G	NM_024525.4	NP_078801.3	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13	573										central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	39	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		AGTTACCTTCTCCATTTAACT	0.408																																					p.R573G		.											.	TTC13	92	0			c.A1717G						.						213.0	176.0	189.0					1																	231060591		2203	4300	6503	SO:0001583	missense	79573	exon14			ACCTTCTCCATTT		CCDS1588.1, CCDS44332.1, CCDS44332.2	1q42.2	2013-01-10			ENSG00000143643	ENSG00000143643		"""Tetratricopeptide (TTC) repeat domain containing"""	26204	protein-coding gene	gene with protein product							Standard	NM_024525		Approved	FLJ22584	uc001huf.4	Q8NBP0	OTTHUMG00000037788	ENST00000366661.4:c.1717A>G	1.37:g.231060591T>C	ENSP00000355621:p.Arg573Gly	120.0	0.0		136.0	26.0	NM_024525	B1AQI1|B1AQI2|Q8IVP8|Q8NBI0|Q8ND20	Missense_Mutation	SNP	ENST00000366661.4	37	CCDS1588.1	.	.	.	.	.	.	.	.	.	.	T	19.38	3.817492	0.70912	.	.	ENSG00000143643	ENST00000366661;ENST00000366662;ENST00000414259;ENST00000486879	T;T;T	0.33438	1.41;1.41;1.41	5.47	4.26	0.50523	.	0.000000	0.85682	D	0.000000	T	0.53850	0.1822	M	0.75615	2.305	0.80722	D	1	D;D;D;D	0.89917	1.0;0.993;1.0;0.999	D;D;D;D	0.85130	0.975;0.977;0.997;0.961	T	0.58244	-0.7670	10	0.66056	D	0.02	.	12.6453	0.56731	0.0:0.0:0.2148:0.7852	.	498;520;520;573	Q69YR0;E9PGV4;Q8NBP0-2;Q8NBP0	.;.;.;TTC13_HUMAN	G	573;520;520;7	ENSP00000355621:R573G;ENSP00000355622:R520G;ENSP00000416631:R520G	ENSP00000355621:R573G	R	-	1	2	TTC13	229127214	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	2.851000	0.48302	2.200000	0.70718	0.533000	0.62120	AGA	.		0.408	TTC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092229.2	NM_024525	
UCP1	7350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	141484571	141484571	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr4:141484571C>T	ENST00000262999.3	-	3	502	c.427G>A	c.(427-429)Gca>Aca	p.A143T		NM_021833.4	NP_068605.1	P25874	UCP1_HUMAN	uncoupling protein 1 (mitochondrial, proton carrier)	143					brown fat cell differentiation (GO:0050873)|cellular metabolic process (GO:0044237)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|stomach(1)	16	all_hematologic(180;0.162)					TGGCTCTGTGCTTGAAGTCTG	0.483																																					p.A143T		.											.	UCP1	91	0			c.G427A						.						155.0	135.0	142.0					4																	141484571		2203	4300	6503	SO:0001583	missense	7350	exon3			TCTGTGCTTGAAG	X51955	CCDS3753.1	4q28-q31	2013-05-22			ENSG00000109424	ENSG00000109424		"""Solute carriers"""	12517	protein-coding gene	gene with protein product		113730		UCP		2380264	Standard	NM_021833		Approved	SLC25A7	uc011chj.2	P25874	OTTHUMG00000133415	ENST00000262999.3:c.427G>A	4.37:g.141484571C>T	ENSP00000262999:p.Ala143Thr	134.0	0.0		118.0	24.0	NM_021833	Q13218|Q4KMZ3|Q68G66	Missense_Mutation	SNP	ENST00000262999.3	37	CCDS3753.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.058183	0.76074	.	.	ENSG00000109424	ENST00000262999	T	0.78595	-1.19	5.44	5.44	0.79542	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.86573	0.5965	M	0.64567	1.98	0.58432	D	0.999997	D;D	0.60160	0.987;0.987	D;D	0.79784	0.993;0.993	D	0.87617	0.2507	10	0.87932	D	0	.	16.744	0.85467	0.0:1.0:0.0:0.0	.	142;143	Q4KMT7;P25874	.;UCP1_HUMAN	T	143	ENSP00000262999:A143T	ENSP00000262999:A143T	A	-	1	0	UCP1	141704021	1.000000	0.71417	0.588000	0.28705	0.119000	0.20118	6.963000	0.76055	2.560000	0.86352	0.650000	0.86243	GCA	.		0.483	UCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257273.1		
VIPR2	7434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	158851225	158851225	+	Silent	SNP	G	G	A	rs547418694		TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr7:158851225G>A	ENST00000262178.2	-	5	587	c.402C>T	c.(400-402)taC>taT	p.Y134Y	VIPR2_ENST00000402066.1_Silent_p.Y275Y|VIPR2_ENST00000377633.3_Silent_p.Y118Y	NM_003382.4	NP_003373.2	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2	134					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		GAGAGACACTGTAGCCCAGTG	0.413													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19344	0.0		0.0	False		,,,				2504	0.0				p.Y134Y	Pancreas(154;1876 1931 2329 17914 20079)	.											.	VIPR2	91	0			c.C402T						.						165.0	157.0	159.0					7																	158851225		2203	4300	6503	SO:0001819	synonymous_variant	7434	exon5			GACACTGTAGCCC	CA449700, X95097	CCDS5950.1	7q36.3	2012-08-10			ENSG00000106018	ENSG00000106018		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12695	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 2"""	601970				7811244	Standard	NM_003382		Approved	VPAC2, VPAC2R	uc003woh.3	P41587	OTTHUMG00000151446	ENST00000262178.2:c.402C>T	7.37:g.158851225G>A		80.0	0.0		54.0	15.0	NM_003382	Q13053|Q15870|Q53Y09|Q6ZN22|Q9UCW0	Silent	SNP	ENST00000262178.2	37	CCDS5950.1																																																																																			.		0.413	VIPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322675.1	NM_003382	
ZMAT4	79698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	40554844	40554844	+	Missense_Mutation	SNP	G	G	A			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr8:40554844G>A	ENST00000297737.6	-	4	415	c.269C>T	c.(268-270)gCc>gTc	p.A90V	ZMAT4_ENST00000315769.7_Missense_Mutation_p.A90V	NM_024645.2	NP_078921.1	Q9H898	ZMAT4_HUMAN	zinc finger, matrin-type 4	90						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.A90V(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			ATGGGAATCGGCCACCACCGC	0.498																																					p.A90V		.											.	ZMAT4	92	1	Substitution - Missense(1)	large_intestine(1)	c.C269T						.						151.0	136.0	141.0					8																	40554844		2203	4300	6503	SO:0001583	missense	79698	exon4			GAATCGGCCACCA	AK023904	CCDS34885.1, CCDS47848.1	8p11.21	2012-10-05	2010-09-15		ENSG00000165061	ENSG00000165061		"""Zinc fingers, matrin-type"""	25844	protein-coding gene	gene with protein product						12477932	Standard	NM_024645		Approved	FLJ13842	uc003xnr.3	Q9H898	OTTHUMG00000164049	ENST00000297737.6:c.269C>T	8.37:g.40554844G>A	ENSP00000297737:p.Ala90Val	122.0	0.0		122.0	34.0	NM_024645	Q8WUT8	Missense_Mutation	SNP	ENST00000297737.6	37	CCDS34885.1	.	.	.	.	.	.	.	.	.	.	G	36	5.608570	0.96626	.	.	ENSG00000165061	ENST00000315769;ENST00000297737;ENST00000519406	T;T;T	0.23348	1.91;1.91;1.91	6.17	6.17	0.99709	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.58264	0.2110	M	0.82630	2.6	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.59573	-0.7429	10	0.87932	D	0	-18.2353	19.8676	0.96824	0.0:0.0:1.0:0.0	.	90;90	Q9H898-2;Q9H898	.;ZMAT4_HUMAN	V	90	ENSP00000319785:A90V;ENSP00000297737:A90V;ENSP00000428423:A90V	ENSP00000297737:A90V	A	-	2	0	ZMAT4	40674001	1.000000	0.71417	0.999000	0.59377	0.944000	0.59088	9.258000	0.95555	2.941000	0.99782	0.655000	0.94253	GCC	.		0.498	ZMAT4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376950.1	NM_024645	
ZNF250	58500	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	146107239	146107239	+	Silent	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr8:146107239C>T	ENST00000292579.7	-	6	1460	c.1344G>A	c.(1342-1344)gaG>gaA	p.E448E	ZNF250_ENST00000543949.1_Intron|ZNF250_ENST00000342660.6_Intron|ZNF250_ENST00000417550.2_Silent_p.E443E	NM_001109689.3|NM_021061.4	NP_001103159.1|NP_066405.1	P15622	ZN250_HUMAN	zinc finger protein 250	448					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(2)|lung(8)|skin(1)	15	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)		CATAGGGCTTCTCCCCAGTGT	0.557																																					p.E448E	NSCLC(16;520 556 24096 40084 43446)	.											.	.	.	0			c.G1344A						.						127.0	119.0	122.0					8																	146107239		2203	4300	6503	SO:0001819	synonymous_variant	58500	exon6			GGGCTTCTCCCCA	AK095705	CCDS34972.1, CCDS55282.1	8q24.3	2013-01-08	2004-11-08			ENSG00000196150		"""Zinc fingers, C2H2-type"", ""-"""	13044	protein-coding gene	gene with protein product			"""zinc finger protein 647"""	ZNF647		12477932	Standard	NM_021061		Approved	MGC9718, ZFP647	uc003zer.4	P15622		ENST00000292579.7:c.1344G>A	8.37:g.146107239C>T		196.0	0.0		168.0	54.0	NM_021061	D3DWP1|Q59HE9|Q8N942|Q96AH9	Silent	SNP	ENST00000292579.7	37	CCDS34972.1																																																																																			.		0.557	ZNF250-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382968.1	NM_021061	
ZNF286A	57335	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	15619991	15619991	+	Missense_Mutation	SNP	G	G	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr17:15619991G>T	ENST00000464847.2	+	5	1506	c.953G>T	c.(952-954)aGa>aTa	p.R318I	ZNF286A_ENST00000593105.1_Missense_Mutation_p.R308I|ZNF286A_ENST00000583566.1_Missense_Mutation_p.R318I|ZNF286A_ENST00000413242.2_Missense_Mutation_p.R318I|ZNF286A_ENST00000585171.1_Intron|ZNF286A_ENST00000421016.1_Missense_Mutation_p.R318I|ZNF286A_ENST00000395894.2_3'UTR			Q9HBT8	Z286A_HUMAN	zinc finger protein 286A	318					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		ACACATCAGAGAATTCACGTT	0.388																																					p.R318I		.											.	ZNF286A	90	0			c.G953T						.						46.0	46.0	46.0					17																	15619991		2202	4297	6499	SO:0001583	missense	57335	exon6			ATCAGAGAATTCA	AF217226	CCDS11172.1, CCDS73997.1	17p11.2	2013-02-14	2007-01-05	2007-01-05		ENSG00000187607		"""Zinc fingers, C2H2-type"", ""-"""	13501	protein-coding gene	gene with protein product			"""zinc finger protein 286"""	ZNF286		11347906	Standard	NM_020652		Approved	KIAA1874	uc010cot.3	Q9HBT8	OTTHUMG00000166448	ENST00000464847.2:c.953G>T	17.37:g.15619991G>T	ENSP00000464218:p.Arg318Ile	283.0	0.0		146.0	59.0	NM_020652	B4DKF9|Q96JF3	Missense_Mutation	SNP	ENST00000464847.2	37	CCDS11172.1	.	.	.	.	.	.	.	.	.	.	g	14.42	2.531113	0.45073	.	.	ENSG00000187607	ENST00000421016;ENST00000412988;ENST00000395894	T;T	0.24908	1.83;1.83	4.2	3.23	0.37069	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42821	D	0.000643	T	0.29423	0.0733	M	0.77103	2.36	0.48511	D	0.999664	B	0.25235	0.121	B	0.21708	0.036	T	0.16305	-1.0407	10	0.59425	D	0.04	-19.3153	10.0158	0.42014	0.1007:0.0:0.8993:0.0	.	318	Q9HBT8	Z286A_HUMAN	I	318;308;318	ENSP00000397163:R318I;ENSP00000408168:R308I	ENSP00000435872:R318I	R	+	2	0	ZNF286A	15560716	0.973000	0.33851	1.000000	0.80357	0.934000	0.57294	2.996000	0.49449	1.122000	0.41944	-0.142000	0.14014	AGA	.		0.388	ZNF286A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130696.4	NM_020652	
ZNF469	84627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	88500768	88500768	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr16:88500768C>T	ENST00000437464.1	+	2	6806	c.6806C>T	c.(6805-6807)gCa>gTa	p.A2269V	ZNF469_ENST00000565624.1_Missense_Mutation_p.A2297V	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2269					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						GGAGATGAGGCACAGGCAGGC	0.697																																					p.A2269V		.											.	.	.	0			c.C6806T						.						8.0	13.0	12.0					16																	88500768		689	1584	2273	SO:0001583	missense	84627	exon2			ATGAGGCACAGGC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.6806C>T	16.37:g.88500768C>T	ENSP00000402343:p.Ala2269Val	91.0	0.0		88.0	10.0	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	c	10.15	1.270591	0.23221	.	.	ENSG00000225614	ENST00000437464	T	0.37915	1.17	4.62	-2.31	0.06765	.	.	.	.	.	T	0.15046	0.0363	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.18713	-1.0328	9	0.38643	T	0.18	.	3.9993	0.09572	0.1666:0.3279:0.0:0.5056	.	2269	Q96JG9	ZN469_HUMAN	V	2269	ENSP00000402343:A2269V	ENSP00000402343:A2269V	A	+	2	0	ZNF469	87028269	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.541000	0.00936	-0.269000	0.09298	-0.355000	0.07637	GCA	.		0.697	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
ATP10A	57194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	25924784	25924785	+	Missense_Mutation	DNP	CA	CA	AC			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr15:25924784_25924785CA>AC	ENST00000356865.6	-	21	4314_4315	c.4203_4204TG>GT	c.(4201-4206)gcTGtc>gcGTtc	p.V1402F		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1402					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CTCCTCAGGACAGCCTCCCCTG	0.663																																					p.V1402F		.											.	.	.	0			.						.																																			SO:0001583	missense	57194	.			TCAGGACAGCCTC	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.4203_4204delinsAC	15.37:g.25924784_25924785delinsAC	ENSP00000349325:p.Val1402Phe	65.0	0.0		46.0	19.0	.	Q4G0S9|Q969I4	Missense_Mutation	DNP	ENST00000356865.6	37	CCDS32178.1																																																																																			.		0.663	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
CACNG2	10369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	36983573	36983574	+	Missense_Mutation	DNP	CT	CT	AA			TCGA-HP-A5N0-01A-11D-A28X-10	TCGA-HP-A5N0-10A-01D-A28X-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ed152c64-923a-45a2-a5e1-d8a649063561	06f66113-568b-43cd-a4f5-a6b4356cd508	g.chr22:36983573_36983574CT>AA	ENST00000300105.6	-	2	1214_1215	c.233_234AG>TT	c.(232-234)aAG>aTT	p.K78I	CACNG2_ENST00000480002.1_5'Flank	NM_006078.3	NP_006069.1	Q9Y698	CCG2_HUMAN	calcium channel, voltage-dependent, gamma subunit 2	78					membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|neuromuscular junction development (GO:0007528)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	18						GATCAATTTGCTTGCACAGACC	0.485																																					p.K78I		.											.	.	.	0			.						.																																			SO:0001583	missense	10369	.			AATTTGCTTGCAC	AF096322	CCDS13931.1	22q13.1	2006-08-01			ENSG00000166862	ENSG00000166862		"""Calcium channel subunits"""	1406	protein-coding gene	gene with protein product		602911					Standard	NM_006078		Approved	stargazin, MGC138502, MGC138504	uc003aps.2	Q9Y698	OTTHUMG00000030612	ENST00000300105.6:c.233_234delinsAA	22.37:g.36983573_36983574delinsAA	ENSP00000300105:p.Lys78Ile	154.0	0.0		184.0	39.0	.	Q2M1M1|Q5TGT3|Q9UGZ7	Missense_Mutation	DNP	ENST00000300105.6	37	CCDS13931.1																																																																																			.		0.485	CACNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075500.2		
