#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABAT	18	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	8866725	8866725	+	Missense_Mutation	SNP	A	A	G			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr16:8866725A>G	ENST00000396600.2	+	12	1843	c.905A>G	c.(904-906)aAc>aGc	p.N302S	ABAT_ENST00000569156.1_Missense_Mutation_p.N302S|ABAT_ENST00000567812.1_Missense_Mutation_p.N317S|ABAT_ENST00000268251.8_Missense_Mutation_p.N302S|ABAT_ENST00000425191.2_Missense_Mutation_p.N302S	NM_000663.4	NP_000654.2	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase	302					behavioral response to cocaine (GO:0048148)|copulation (GO:0007620)|gamma-aminobutyric acid catabolic process (GO:0009450)|locomotory behavior (GO:0007626)|negative regulation of blood pressure (GO:0045776)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	4-aminobutyrate transaminase complex (GO:0032144)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	(S)-3-amino-2-methylpropionate transaminase activity (GO:0047298)|4-aminobutyrate transaminase activity (GO:0003867)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|succinate-semialdehyde dehydrogenase binding (GO:0032145)			breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	26					L-Alanine(DB00160)|Phenelzine(DB00780)|Pyruvic acid(DB00119)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	GGTGGAGACAACCACGCATCC	0.542																																					p.N302S		.											.	ABAT	91	0			c.A905G						.						95.0	78.0	84.0					16																	8866725		2197	4300	6497	SO:0001583	missense	18	exon12			GAGACAACCACGC	L32961	CCDS10534.1	16p13.2	2011-01-10			ENSG00000183044	ENSG00000183044	2.6.1.19		23	protein-coding gene	gene with protein product	"""4-aminobutyrate transaminase"""	137150				7721088	Standard	NM_020686		Approved	GABAT	uc002czc.4	P80404	OTTHUMG00000048201	ENST00000396600.2:c.905A>G	16.37:g.8866725A>G	ENSP00000379845:p.Asn302Ser	94.0	0.0		96.0	21.0	NM_001127448	A8K386|Q16260|Q8N5W2|Q96BG2|Q99800	Missense_Mutation	SNP	ENST00000396600.2	37	CCDS10534.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.468739	0.84533	.	.	ENSG00000183044	ENST00000268251;ENST00000396600;ENST00000425191	T;T;T	0.76316	-1.01;-1.01;-1.01	5.05	5.05	0.67936	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.91243	0.7240	H	0.96720	3.87	0.80722	D	1	D	0.76494	0.999	D	0.66351	0.943	D	0.93943	0.7225	10	0.87932	D	0	-7.7274	13.9748	0.64265	1.0:0.0:0.0:0.0	.	302	P80404	GABT_HUMAN	S	302	ENSP00000268251:N302S;ENSP00000379845:N302S;ENSP00000411916:N302S	ENSP00000268251:N302S	N	+	2	0	ABAT	8774226	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	9.083000	0.94067	1.893000	0.54813	0.459000	0.35465	AAC	.		0.542	ABAT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433620.2	NM_020686	
ABCA13	154664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	48467381	48467381	+	Missense_Mutation	SNP	C	C	G			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr7:48467381C>G	ENST00000435803.1	+	42	12502	c.12478C>G	c.(12478-12480)Caa>Gaa	p.Q4160E		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4160					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GATGCTTTTGCAAGATTCCAA	0.408																																					p.Q4160E		.											.	ABCA13	521	0			c.C12478G						.						56.0	52.0	53.0					7																	48467381		1850	4114	5964	SO:0001583	missense	154664	exon42			CTTTTGCAAGATT	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.12478C>G	7.37:g.48467381C>G	ENSP00000411096:p.Gln4160Glu	64.0	0.0		67.0	24.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	7.101	0.574091	0.13623	.	.	ENSG00000179869	ENST00000435803	T	0.74421	-0.84	4.74	2.83	0.33086	.	0.144123	0.32041	N	0.006677	T	0.64034	0.2562	L	0.44542	1.39	0.80722	D	1	B;B	0.15473	0.002;0.013	B;B	0.12837	0.006;0.008	T	0.56098	-0.8035	10	0.27082	T	0.32	.	11.1741	0.48588	0.0:0.6397:0.3603:0.0	.	1862;4160	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	E	4160	ENSP00000411096:Q4160E	ENSP00000411096:Q4160E	Q	+	1	0	ABCA13	48437927	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	1.772000	0.38552	0.643000	0.30638	0.655000	0.94253	CAA	.		0.408	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
AFF1	4299	broad.mit.edu;ucsc.edu;mdanderson.org	37	4	88048838	88048838	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr4:88048838C>T	ENST00000307808.6	+	15	3346	c.2926C>T	c.(2926-2928)Cag>Tag	p.Q976*	AFF1_ENST00000544085.1_Nonsense_Mutation_p.Q614*|AFF1_ENST00000395146.4_Nonsense_Mutation_p.Q983*	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	976					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		AAAGATGAAGCAGAAAGCAGA	0.378																																					p.Q983X		.											.	AFF1	289	0			c.C2947T						.						140.0	128.0	132.0					4																	88048838		2203	4300	6503	SO:0001587	stop_gained	4299	exon16			ATGAAGCAGAAAG	L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.2926C>T	4.37:g.88048838C>T	ENSP00000305689:p.Gln976*	126.0	1.0		102.0	42.0	NM_001166693	B4DTU1|E9PBM3	Nonsense_Mutation	SNP	ENST00000307808.6	37	CCDS3616.1	.	.	.	.	.	.	.	.	.	.	C	40	8.190207	0.98699	.	.	ENSG00000172493	ENST00000395146;ENST00000307808;ENST00000544085	.	.	.	4.94	-5.11	0.02901	.	2.411390	0.01293	N	0.010089	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	8.1276	0.5795	0.00709	0.3344:0.1979:0.2699:0.1978	.	.	.	.	X	983;976;614	.	ENSP00000305689:Q976X	Q	+	1	0	AFF1	88267862	0.926000	0.31397	0.004000	0.12327	0.923000	0.55619	0.517000	0.22832	-1.578000	0.01648	0.655000	0.94253	CAG	.		0.378	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253053.3	NM_005935	
ANKLE2	23141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	133319812	133319812	+	Silent	SNP	T	T	G			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr12:133319812T>G	ENST00000357997.5	-	6	1370	c.1281A>C	c.(1279-1281)gtA>gtC	p.V427V	ANKLE2_ENST00000539605.1_Silent_p.V365V|ANKLE2_ENST00000337516.5_Silent_p.V427V	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	427					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		GCACGTTGACTACATCTGCAT	0.368																																					p.V427V		.											.	ANKLE2	68	0			c.A1281C						.						135.0	119.0	124.0					12																	133319812		1899	4113	6012	SO:0001819	synonymous_variant	23141	exon6			GTTGACTACATCT	AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.1281A>C	12.37:g.133319812T>G		89.0	0.0		84.0	18.0	NM_015114	A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Silent	SNP	ENST00000357997.5	37	CCDS41869.1																																																																																			.		0.368	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397712.1		
APOB	338	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	21232581	21232585	+	Frame_Shift_Del	DEL	TTATC	TTATC	-			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	TTATC	TTATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr2:21232581_21232585delTTATC	ENST00000233242.1	-	26	7282_7286	c.7155_7159delGATAA	c.(7153-7161)aagataaaafs	p.KIK2385fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2385					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAGTAATCTTTTATCTTAACTTGTT	0.312																																					p.2385_2387del		.											.	APOB	175	0			c.7155_7159del	GRCh37	CD930898	APOB	D		.																																			SO:0001589	frameshift_variant	338	exon26			AATCTTTTATCTT	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.7155_7159delGATAA	2.37:g.21232581_21232585delTTATC	ENSP00000233242:p.Lys2385fs	172.0	0.0		222.0	67.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Del	DEL	ENST00000233242.1	37	CCDS1703.1																																																																																			.		0.312	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ANTXR1	84168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	69379340	69379340	+	Missense_Mutation	SNP	T	T	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr2:69379340T>C	ENST00000303714.4	+	13	1313	c.991T>C	c.(991-993)Ttc>Ctc	p.F331L	ANTXR1_ENST00000409349.3_Missense_Mutation_p.F331L	NM_032208.2	NP_115584.1	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1	331					actin cytoskeleton reorganization (GO:0031532)|reproductive process (GO:0022414)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|lamellipodium membrane (GO:0031258)	actin filament binding (GO:0051015)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|transmembrane signaling receptor activity (GO:0004888)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						GCTGATCCTGTTCCTGCTCCT	0.612									Familial Infantile Hemangioma																												p.F331L		.											.	ANTXR1	94	0			c.T991C						.						227.0	162.0	184.0					2																	69379340		2203	4300	6503	SO:0001583	missense	84168	exon13	Familial Cancer Database	Infantile Capillary Hemangioma, HCI, Hereditary Capillary Hemangioma	ATCCTGTTCCTGC	AF421380	CCDS1892.1, CCDS46313.1, CCDS46314.1	2p13.1	2006-04-12			ENSG00000169604	ENSG00000169604			21014	protein-coding gene	gene with protein product	"""anthrax toxin receptor"", ""tumor endothelial marker 8 precursor"""	606410				10947988, 11559528	Standard	NM_032208		Approved	TEM8, FLJ21776, FLJ10601, ATR	uc002sfg.3	Q9H6X2	OTTHUMG00000129575	ENST00000303714.4:c.991T>C	2.37:g.69379340T>C	ENSP00000301945:p.Phe331Leu	70.0	0.0		71.0	14.0	NM_032208	A8K7U8|J7K7G4|J7KF88|Q4ZFV6|Q53QD8|Q96P02|Q9NVP3	Missense_Mutation	SNP	ENST00000303714.4	37	CCDS1892.1	.	.	.	.	.	.	.	.	.	.	T	7.991	0.753210	0.15778	.	.	ENSG00000169604	ENST00000303714;ENST00000409349	T;T	0.26957	1.7;2.14	5.85	5.85	0.93711	.	0.092384	0.85682	D	0.000000	T	0.14056	0.0340	N	0.12961	0.28	0.47737	D	0.999506	B;B	0.13145	0.007;0.002	B;B	0.13407	0.009;0.008	T	0.06481	-1.0824	10	0.02654	T	1	-23.9755	14.1824	0.65583	0.0:0.0:0.0:1.0	.	331;331	Q9H6X2;Q9H6X2-2	ANTR1_HUMAN;.	L	331	ENSP00000301945:F331L;ENSP00000386494:F331L	ENSP00000301945:F331L	F	+	1	0	ANTXR1	69232844	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.920000	0.48844	2.233000	0.73108	0.533000	0.62120	TTC	.		0.612	ANTXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251770.2	NM_032208	
ATCAY	85300	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3908298	3908298	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr19:3908298G>A	ENST00000450849.2	+	6	1044	c.577G>A	c.(577-579)Gtc>Atc	p.V193I	ATCAY_ENST00000398448.3_Missense_Mutation_p.V199I|ATCAY_ENST00000301260.6_Missense_Mutation_p.V193I|ATCAY_ENST00000600960.1_Missense_Mutation_p.V193I	NM_033064.4	NP_149053.1	Q86WG3	ATCAY_HUMAN	ataxia, cerebellar, Cayman type	193	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.|Mediates interaction with GLS.				apoptotic process (GO:0006915)|mitochondrion distribution (GO:0048311)|negative regulation of glutamate metabolic process (GO:2000212)|neuron projection development (GO:0031175)|regulation of protein localization (GO:0032880)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|synapse (GO:0045202)	kinesin binding (GO:0019894)			breast(1)|endometrium(2)|kidney(2)|lung(2)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		CGCCATCATCGTCTTCGCAGC	0.642																																					p.V193I		.											.	ATCAY	67	0			c.G577A						.						36.0	44.0	41.0					19																	3908298		2143	4248	6391	SO:0001583	missense	85300	exon6			ATCATCGTCTTCG		CCDS45923.1	19p13.3	2014-06-24	2008-07-18		ENSG00000167654	ENSG00000167654			779	protein-coding gene	gene with protein product	"""Cayman ataxia"", ""caytaxin"""	608179				8845847, 14556008	Standard	NM_033064		Approved		uc002lyy.4	Q86WG3	OTTHUMG00000181836	ENST00000450849.2:c.577G>A	19.37:g.3908298G>A	ENSP00000390941:p.Val193Ile	209.0	0.0		201.0	59.0	NM_033064	Q8NAQ2|Q8TAQ3|Q96HC6|Q96JF5	Missense_Mutation	SNP	ENST00000450849.2	37	CCDS45923.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.869593	0.91587	.	.	ENSG00000167654	ENST00000450849;ENST00000301260;ENST00000357694;ENST00000398448;ENST00000539301	T;T;T	0.63913	-0.07;-0.07;-0.07	5.14	5.14	0.70334	Cellular retinaldehyde-binding/triple function, C-terminal (2);	0.192296	0.44483	D	0.000448	T	0.79885	0.4523	M	0.83953	2.67	0.48762	D	0.9997	D;D	0.71674	0.998;0.99	D;D	0.65140	0.932;0.926	T	0.81947	-0.0700	10	0.51188	T	0.08	-52.2715	17.7669	0.88481	0.0:0.0:1.0:0.0	.	199;193	B4DS11;Q86WG3	.;ATCAY_HUMAN	I	193;193;193;199;171	ENSP00000390941:V193I;ENSP00000301260:V193I;ENSP00000381466:V199I	ENSP00000301260:V193I	V	+	1	0	ATCAY	3859298	1.000000	0.71417	0.998000	0.56505	0.821000	0.46438	9.164000	0.94755	2.438000	0.82558	0.644000	0.83932	GTC	.		0.642	ATCAY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457872.2		
ATP1A1	476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	116932324	116932324	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr1:116932324G>A	ENST00000295598.5	+	8	1270	c.1018G>A	c.(1018-1020)Gtc>Atc	p.V340I	ATP1A1_ENST00000537345.1_Missense_Mutation_p.V340I|ATP1A1_ENST00000369496.4_Missense_Mutation_p.V309I|ATP1A1_ENST00000491156.1_3'UTR	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	340					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	GCTGGCCACTGTCACGGTAAG	0.488																																					p.V340I		.											.	ATP1A1	91	0			c.G1018A						.						109.0	85.0	93.0					1																	116932324		2203	4300	6503	SO:0001583	missense	476	exon8			GCCACTGTCACGG	D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.1018G>A	1.37:g.116932324G>A	ENSP00000295598:p.Val340Ile	62.0	0.0		95.0	34.0	NM_001160233	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	ENST00000295598.5	37	CCDS887.1	.	.	.	.	.	.	.	.	.	.	G	35	5.498466	0.96355	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000339159;ENST00000369496	D;D;D	0.91792	-2.91;-2.91;-2.91	4.87	4.87	0.63330	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.95322	0.8482	M	0.72894	2.215	0.80722	D	1	D;D	0.65815	0.994;0.995	D;D	0.91635	0.998;0.999	D	0.95618	0.8678	10	0.87932	D	0	.	18.2082	0.89861	0.0:0.0:1.0:0.0	.	340;340	F5H3A1;P05023	.;AT1A1_HUMAN	I	340;340;339;309	ENSP00000295598:V340I;ENSP00000445306:V340I;ENSP00000358508:V309I	ENSP00000295598:V340I	V	+	1	0	ATP1A1	116733847	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.657000	0.98554	2.558000	0.86282	0.650000	0.86243	GTC	.		0.488	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5	NM_001160233	
BNC1	646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	83932609	83932609	+	Missense_Mutation	SNP	C	C	G	rs144958076		TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr15:83932609C>G	ENST00000345382.2	-	4	1479	c.1394G>C	c.(1393-1395)gGc>gCc	p.G465A	BNC1_ENST00000569704.1_Missense_Mutation_p.G458A|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	465					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						GGCTGGTTGGCCTTTGGAATC	0.552																																					p.G465A		.											.	BNC1	93	0			c.G1394C						.						88.0	80.0	83.0					15																	83932609		2203	4300	6503	SO:0001583	missense	646	exon4			GGTTGGCCTTTGG	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.1394G>C	15.37:g.83932609C>G	ENSP00000307041:p.Gly465Ala	151.0	0.0		142.0	43.0	NM_001717	Q15840	Missense_Mutation	SNP	ENST00000345382.2	37	CCDS10324.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.612797	0.00120	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.40476	1.03	5.51	4.51	0.55191	.	0.607917	0.18385	N	0.142845	T	0.35189	0.0923	L	0.57536	1.79	0.32099	N	0.590858	B;B	0.27068	0.167;0.104	B;B	0.20955	0.032;0.022	T	0.39542	-0.9609	10	0.02654	T	1	-16.8072	15.3486	0.74363	0.226:0.774:0.0:0.0	.	458;465	F5GY04;Q01954	.;BNC1_HUMAN	A	465;458	ENSP00000307041:G465A	ENSP00000307041:G465A	G	-	2	0	BNC1	81723613	1.000000	0.71417	0.907000	0.35723	0.024000	0.10985	3.412000	0.52679	2.589000	0.87451	0.655000	0.94253	GGC	C|1.000;A|0.000		0.552	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717	
BTC	685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	75675929	75675929	+	Splice_Site	SNP	G	G	T	rs146656652		TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr4:75675929G>T	ENST00000395743.3	-	4	642	c.282C>A	c.(280-282)gtC>gtA	p.V94V		NM_001729.2	NP_001720.1	P35070	BTC_HUMAN	betacellulin	94	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitosis (GO:0045840)|positive regulation of urine volume (GO:0035810)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	10			Lung(101;0.219)			CTTCATCACAGCTATAAAACA	0.368																																					p.V94V		.											.	BTC	523	0			c.C282A						.						156.0	166.0	163.0					4																	75675929		2203	4300	6503	SO:0001630	splice_region_variant	685	exon4			ATCACAGCTATAA	S55606	CCDS3566.1	4q13.3	2012-09-20			ENSG00000174808	ENSG00000174808			1121	protein-coding gene	gene with protein product		600345				8439318, 11522793	Standard	NM_001729		Approved		uc003hig.2	P35070	OTTHUMG00000130107	ENST00000395743.3:c.282-1C>A	4.37:g.75675929G>T		381.0	0.0		410.0	107.0	NM_001729	Q96F48	Silent	SNP	ENST00000395743.3	37	CCDS3566.1																																																																																			G|1.000;C|0.000		0.368	BTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252413.1		Silent
C14orf28	122525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	45373642	45373642	+	Missense_Mutation	SNP	G	G	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr14:45373642G>C	ENST00000325192.3	+	4	934	c.659G>C	c.(658-660)gGg>gCg	p.G220A	C14orf28_ENST00000553841.1_3'UTR|C14orf28_ENST00000557112.1_Missense_Mutation_p.G190A|RP11-857B24.5_ENST00000555157.1_RNA	NM_001017923.1	NP_001017923.1	Q4W4Y0	CN028_HUMAN	chromosome 14 open reading frame 28	220										endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(2)	11						TTCTGCCATGGGGCACCCCCT	0.398																																					p.G220A		.											.	C14orf28	91	0			c.G659C						.						187.0	182.0	184.0					14																	45373642		2203	4300	6503	SO:0001583	missense	122525	exon4			GCCATGGGGCACC	AA496212	CCDS32069.1	14q21.2	2012-08-16			ENSG00000179476	ENSG00000179476			19834	protein-coding gene	gene with protein product	"""dopamine receptor interacting protein 1"""						Standard	XM_005267316		Approved	DRIP-1	uc001wvo.3	Q4W4Y0	OTTHUMG00000170722	ENST00000325192.3:c.659G>C	14.37:g.45373642G>C	ENSP00000326846:p.Gly220Ala	104.0	0.0		93.0	28.0	NM_001017923		Missense_Mutation	SNP	ENST00000325192.3	37	CCDS32069.1	.	.	.	.	.	.	.	.	.	.	G	19.59	3.857032	0.71834	.	.	ENSG00000179476	ENST00000325192;ENST00000557112	T;T	0.30714	1.52;1.52	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.43211	0.1237	N	0.19112	0.55	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.39761	-0.9598	10	0.87932	D	0	.	17.9074	0.88923	0.0:0.0:1.0:0.0	.	220	Q4W4Y0	CN028_HUMAN	A	220;190	ENSP00000326846:G220A;ENSP00000451791:G190A	ENSP00000326846:G220A	G	+	2	0	C14orf28	44443392	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	7.714000	0.84703	2.835000	0.97688	0.591000	0.81541	GGG	.		0.398	C14orf28-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410086.1	NM_001017923	
C14orf183	196913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	50550627	50550627	+	Silent	SNP	T	T	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr14:50550627T>C	ENST00000305273.1	-	5	716	c.717A>G	c.(715-717)acA>acG	p.T239T	RP11-58E21.5_ENST00000603228.1_lincRNA|RP11-58E21.7_ENST00000556019.2_lincRNA	NM_001014830.1	NP_001014830.1	Q8WXQ3	CN183_HUMAN	chromosome 14 open reading frame 183	239										endometrium(2)|large_intestine(2)|lung(3)	7						CGCACCCACCTGTGGGGCCTC	0.667																																					p.T239T		.											.	C14orf183	90	0			c.A717G						.						11.0	13.0	13.0					14																	50550627		1861	4054	5915	SO:0001819	synonymous_variant	196913	exon5			CCCACCTGTGGGG	AF390030	CCDS45101.1	14q21.3	2012-09-26			ENSG00000168260	ENSG00000168260			27285	protein-coding gene	gene with protein product							Standard	NM_001014830		Approved		uc010tqk.2	Q8WXQ3	OTTHUMG00000170858	ENST00000305273.1:c.717A>G	14.37:g.50550627T>C		133.0	0.0		160.0	45.0	NM_001014830		Silent	SNP	ENST00000305273.1	37	CCDS45101.1																																																																																			.		0.667	C14orf183-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000410705.1	NM_001014830	
C1RL	51279	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	7244239	7244239	+	IGR	SNP	T	T	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr12:7244239T>C	ENST00000266542.4	-	0	3394				C1R_ENST00000542285.1_Missense_Mutation_p.R13G	NM_016546.2	NP_057630.2	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like						complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CCTCCTGCCCTGCAGAACAGG	0.547																																					.		.											.	.	.	0			.						.						35.0	36.0	36.0					12																	7244239		1936	4137	6073	SO:0001628	intergenic_variant	715	.			CTGCCCTGCAGAA	AF178985	CCDS8573.1, CCDS73431.1	12p13.31	2008-02-05				ENSG00000139178			21265	protein-coding gene	gene with protein product		608974				12838346	Standard	XM_005253385		Approved	C1r-LP, C1RL1	uc001qsn.3	Q9NZP8			12.37:g.7244239T>C		75.0	0.0		95.0	35.0	.	Q53GX9	Missense_Mutation	SNP	ENST00000266542.4	37	CCDS8573.1	.	.	.	.	.	.	.	.	.	.	T	8.418	0.845804	0.16963	.	.	ENSG00000159403	ENST00000542220;ENST00000536053;ENST00000535233;ENST00000290575;ENST00000542285;ENST00000543835;ENST00000540242	D;T;T	0.85773	-2.03;2.17;2.51	4.77	0.443	0.16587	CUB (1);	0.719170	0.13597	N	0.376113	T	0.70098	0.3185	.	.	.	0.09310	N	0.999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.52290	-0.8595	9	0.21540	T	0.41	.	5.2485	0.15510	0.0:0.3852:0.3251:0.2897	.	14;28;14	F5H2D0;B4DPQ0;P00736	.;.;C1R_HUMAN	G	14;28;14;28;13;14;14	ENSP00000438615:R13G;ENSP00000445285:R14G;ENSP00000442946:R14G	ENSP00000290575:R28G	R	-	1	2	C1R	7135380	0.000000	0.05858	0.021000	0.16686	0.010000	0.07245	-0.598000	0.05706	-0.067000	0.12976	-0.250000	0.11733	AGG	.		0.547	C1RL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398367.1	NM_016546	
CCDC80	151887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	112358134	112358134	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr3:112358134C>T	ENST00000206423.3	-	2	1572	c.619G>A	c.(619-621)Ggc>Agc	p.G207S	CCDC80_ENST00000475181.1_5'Flank|CCDC80_ENST00000439685.2_Missense_Mutation_p.G207S	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	207					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						AGGATCTGGCCCTCGCTGGTG	0.572																																					p.G207S		.											.	CCDC80	92	0			c.G619A						.						102.0	89.0	93.0					3																	112358134		2203	4300	6503	SO:0001583	missense	151887	exon2			TCTGGCCCTCGCT	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.619G>A	3.37:g.112358134C>T	ENSP00000206423:p.Gly207Ser	98.0	0.0		93.0	27.0	NM_199511	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	37	CCDS2968.1	.	.	.	.	.	.	.	.	.	.	C	34	5.310534	0.95629	.	.	ENSG00000091986	ENST00000206423;ENST00000439685	T;T	0.78003	-1.14;-1.14	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.88500	0.6453	M	0.76574	2.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89092	0.3483	10	0.72032	D	0.01	-23.7373	19.5067	0.95121	0.0:1.0:0.0:0.0	.	218;207;207	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	S	207	ENSP00000206423:G207S;ENSP00000411814:G207S	ENSP00000206423:G207S	G	-	1	0	CCDC80	113840824	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.786000	0.85741	2.609000	0.88269	0.650000	0.86243	GGC	.		0.572	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511	
CCDC8	83987	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	46915578	46915578	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr19:46915578G>A	ENST00000307522.3	-	1	1263	c.490C>T	c.(490-492)Ccc>Tcc	p.P164S		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	164					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		GGCGCGCTGGGCTGCTTCTCC	0.657																																					p.P164S		.											.	CCDC8	93	0			c.C490T						.						41.0	44.0	43.0					19																	46915578		2203	4300	6503	SO:0001583	missense	83987	exon1			CGCTGGGCTGCTT	BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.490C>T	19.37:g.46915578G>A	ENSP00000303158:p.Pro164Ser	24.0	0.0		31.0	8.0	NM_032040	Q8TB26	Missense_Mutation	SNP	ENST00000307522.3	37	CCDS12685.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.474820	0.43942	.	.	ENSG00000169515	ENST00000307522	T	0.21932	1.98	4.66	3.53	0.40419	.	0.000000	0.42053	D	0.000768	T	0.40094	0.1103	M	0.62723	1.935	0.22001	N	0.999424	D	0.76494	0.999	D	0.74023	0.982	T	0.05582	-1.0876	10	0.49607	T	0.09	-10.787	12.3863	0.55335	0.0:0.1716:0.8284:0.0	.	164	Q9H0W5	CCDC8_HUMAN	S	164	ENSP00000303158:P164S	ENSP00000303158:P164S	P	-	1	0	CCDC8	51607418	0.165000	0.22948	0.604000	0.28916	0.059000	0.15707	0.352000	0.20113	2.525000	0.85131	0.655000	0.94253	CCC	.		0.657	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368598.1	NM_032040	
CES2	8824	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	66976600	66976600	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr16:66976600G>A	ENST00000317091.4	+	10	2508	c.1524G>A	c.(1522-1524)tgG>tgA	p.W508*	RP11-361L15.4_ENST00000566869.1_RNA|CES2_ENST00000417689.1_Nonsense_Mutation_p.W508*	NM_003869.5	NP_003860.2	O00748	EST2_HUMAN	carboxylesterase 2	444					catabolic process (GO:0009056)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)			breast(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|urinary_tract(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0663)|Epithelial(162;0.166)	Dabigatran etexilate(DB06695)|Irinotecan(DB00762)|Mycophenolate mofetil(DB00688)|Prasugrel(DB06209)	AGCCCAGCTGGCTCAAGAACA	0.552																																					p.W508X	Ovarian(70;1230 1691 37888 38351)	.											.	CES2	90	0			c.G1524A						.						81.0	74.0	76.0					16																	66976600		2200	4300	6500	SO:0001587	stop_gained	8824	exon10			CAGCTGGCTCAAG	BC032095	CCDS10825.1, CCDS45507.1	16q22.1	2010-10-12	2010-10-12		ENSG00000172831	ENSG00000172831		"""Carboxylesterases"""	1864	protein-coding gene	gene with protein product		605278	"""carboxylesterase 2 (intestine, liver)"""			9169443, 9144407, 20931200	Standard	NM_198061		Approved	CE-2, iCE, CES2A1	uc002eqr.3	O00748	OTTHUMG00000137517	ENST00000317091.4:c.1524G>A	16.37:g.66976600G>A	ENSP00000317842:p.Trp508*	90.0	0.0		87.0	21.0	NM_003869	A8K367|Q16859|Q5MAB8|Q7Z366|Q8IUP4|Q8TCP8	Nonsense_Mutation	SNP	ENST00000317091.4	37	CCDS10825.1	.	.	.	.	.	.	.	.	.	.	G	10.76	1.442395	0.25987	.	.	ENSG00000172831	ENST00000417689;ENST00000317091	.	.	.	5.12	-0.345	0.12624	.	0.849215	0.10425	N	0.676178	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	0.8934	0.01259	0.277:0.2983:0.2498:0.1748	.	.	.	.	X	508	.	ENSP00000317842:W508X	W	+	3	0	CES2	65534101	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	-0.954000	0.03873	0.329000	0.23460	-0.171000	0.13296	TGG	.		0.552	CES2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268838.2	NM_003869	
CFH	3075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	196684870	196684870	+	Missense_Mutation	SNP	A	A	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr1:196684870A>T	ENST00000367429.4	+	11	1907	c.1667A>T	c.(1666-1668)aAt>aTt	p.N556I		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	556	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						TGTGGTTACAATGGTTGGTCT	0.333																																					p.N556I		.											.	CFH	566	0			c.A1667T						.						238.0	225.0	229.0					1																	196684870		2203	4300	6503	SO:0001583	missense	3075	exon11			GTTACAATGGTTG	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.1667A>T	1.37:g.196684870A>T	ENSP00000356399:p.Asn556Ile	149.0	0.0		176.0	83.0	NM_000186	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000367429.4	37	CCDS1385.1	.	.	.	.	.	.	.	.	.	.	A	12.62	1.993812	0.35131	.	.	ENSG00000000971	ENST00000367429	T	0.69040	-0.37	5.42	1.73	0.24493	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.64294	0.2585	M	0.64997	1.995	0.09310	N	1	B	0.31640	0.333	B	0.40741	0.339	T	0.53041	-0.8494	9	0.20519	T	0.43	.	7.3773	0.26835	0.74:0.0:0.26:0.0	.	556	P08603	CFAH_HUMAN	I	556	ENSP00000356399:N556I	ENSP00000356399:N556I	N	+	2	0	CFH	194951493	0.022000	0.18835	0.012000	0.15200	0.002000	0.02628	0.610000	0.24253	0.038000	0.15604	0.533000	0.62120	AAT	.		0.333	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186	
CLCN3	1182	hgsc.bcm.edu;broad.mit.edu	37	4	170618416	170618417	+	In_Frame_Ins	INS	-	-	CAT			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr4:170618416_170618417insCAT	ENST00000513761.1	+	9	1653_1654	c.1094_1095insCAT	c.(1093-1098)tccatc>tcCATcatc	p.366_367insI	CLCN3_ENST00000504131.2_In_Frame_Ins_p.349_350insI|CLCN3_ENST00000360642.3_In_Frame_Ins_p.339_340insI|CLCN3_ENST00000347613.4_In_Frame_Ins_p.366_367insI	NM_001829.3	NP_001820.2	P51790	CLCN3_HUMAN	chloride channel, voltage-sensitive 3	366					chloride transmembrane transport (GO:1902476)|endosomal lumen acidification (GO:0048388)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|voltage-gated chloride channel activity (GO:0005247)			breast(5)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	29		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		GTTTTGAGGTCCATCAATCCAT	0.351																																					p.S365delinsSI		.											.	CLCN3	136	0			c.1094_1095insCAT						.																																			SO:0001652	inframe_insertion	1182	exon9			TGAGGTCCATCAA	X78520	CCDS34100.1, CCDS34101.1, CCDS58932.1, CCDS75208.1	4q	2012-09-26	2012-02-23		ENSG00000109572	ENSG00000109572		"""Ion channels / Chloride channels : Voltage-sensitive"""	2021	protein-coding gene	gene with protein product		600580	"""chloride channel 3"""				Standard	NM_001243374		Approved	CLC3, ClC-3	uc003ish.3	P51790	OTTHUMG00000160973	ENST00000513761.1:c.1095_1097dupCAT	4.37:g.170618417_170618419dupCAT	ENSP00000424603:p.Ile366_Ile366dup	183.0	0.0		218.0	55.0	NM_173872	B7Z932|B9EGJ9|D3DP34|E9PB97|O14918|Q86Z21	In_Frame_Ins	INS	ENST00000513761.1	37	CCDS34101.1																																																																																			.		0.351	CLCN3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363210.2		
CLCN3	1182	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	170618424	170618424	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr4:170618424delC	ENST00000513761.1	+	9	1661	c.1102delC	c.(1102-1104)ccafs	p.P368fs	CLCN3_ENST00000504131.2_Frame_Shift_Del_p.P351fs|CLCN3_ENST00000360642.3_Frame_Shift_Del_p.P341fs|CLCN3_ENST00000347613.4_Frame_Shift_Del_p.P368fs	NM_001829.3	NP_001820.2	P51790	CLCN3_HUMAN	chloride channel, voltage-sensitive 3	368					chloride transmembrane transport (GO:1902476)|endosomal lumen acidification (GO:0048388)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|voltage-gated chloride channel activity (GO:0005247)	p.P368A(1)		breast(5)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	29		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		GTCCATCAATCCATTTGGTAA	0.363																																					p.P368fs		.											.	CLCN3	136	1	Substitution - Missense(1)	lung(1)	c.1102delC						.						108.0	107.0	107.0					4																	170618424		2203	4300	6503	SO:0001589	frameshift_variant	1182	exon9			ATCAATCCATTTG	X78520	CCDS34100.1, CCDS34101.1, CCDS58932.1, CCDS75208.1	4q	2012-09-26	2012-02-23		ENSG00000109572	ENSG00000109572		"""Ion channels / Chloride channels : Voltage-sensitive"""	2021	protein-coding gene	gene with protein product		600580	"""chloride channel 3"""				Standard	NM_001243374		Approved	CLC3, ClC-3	uc003ish.3	P51790	OTTHUMG00000160973	ENST00000513761.1:c.1102delC	4.37:g.170618424delC	ENSP00000424603:p.Pro368fs	183.0	0.0		226.0	62.0	NM_001829	B7Z932|B9EGJ9|D3DP34|E9PB97|O14918|Q86Z21	Frame_Shift_Del	DEL	ENST00000513761.1	37	CCDS34101.1																																																																																			.		0.363	CLCN3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363210.2		
CMPK2	129607	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	7003632	7003632	+	Missense_Mutation	SNP	C	C	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr2:7003632C>A	ENST00000256722.5	-	2	752	c.753G>T	c.(751-753)aaG>aaT	p.K251N	CMPK2_ENST00000404168.1_Missense_Mutation_p.K251N|CMPK2_ENST00000478738.1_5'UTR|CMPK2_ENST00000458098.1_Missense_Mutation_p.K251N	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	251					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CAACCTGGAACTTTCCTTTCT	0.448																																					p.K251N		.											.	CMPK2	68	0			c.G753T						.						134.0	132.0	133.0					2																	7003632		1900	4114	6014	SO:0001583	missense	129607	exon2			CTGGAACTTTCCT		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.753G>T	2.37:g.7003632C>A	ENSP00000256722:p.Lys251Asn	103.0	0.0		138.0	40.0	NM_001256478	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Missense_Mutation	SNP	ENST00000256722.5	37	CCDS42648.1	.	.	.	.	.	.	.	.	.	.	C	9.644	1.139675	0.21205	.	.	ENSG00000134326	ENST00000458098;ENST00000256722;ENST00000404168	T	0.50277	0.75	5.21	2.19	0.27852	.	0.722742	0.13832	N	0.359641	T	0.37210	0.0995	L	0.47716	1.5	0.30938	N	0.72609	B;B	0.18863	0.021;0.031	B;B	0.15484	0.013;0.009	T	0.39014	-0.9634	10	0.48119	T	0.1	-21.4232	6.5483	0.22418	0.2564:0.5791:0.0:0.1645	.	251;251	Q5EBM0-3;Q5EBM0	.;CMPK2_HUMAN	N	251	ENSP00000256722:K251N	ENSP00000256722:K251N	K	-	3	2	CMPK2	6921083	0.053000	0.20554	0.998000	0.56505	0.477000	0.33069	0.277000	0.18734	1.193000	0.43086	0.557000	0.71058	AAG	.		0.448	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
CNGA4	1262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6265537	6265537	+	Silent	SNP	C	C	T	rs560979109		TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr11:6265537C>T	ENST00000379936.2	+	6	1741	c.1626C>T	c.(1624-1626)ccC>ccT	p.P542P		NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	542					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.P542P(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCCAATGCCCGAGGACCTGG	0.607													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17683	0.0		0.0	False		,,,				2504	0.0				p.P542P		.											.	CNGA4	91	1	Substitution - coding silent(1)	lung(1)	c.C1626T						.						51.0	53.0	53.0					11																	6265537		2201	4296	6497	SO:0001819	synonymous_variant	1262	exon6			AATGCCCGAGGAC	AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.1626C>T	11.37:g.6265537C>T		64.0	0.0		57.0	20.0	NM_001037329		Silent	SNP	ENST00000379936.2	37	CCDS31408.1																																																																																			.		0.607	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383765.2	NM_001037329	
CNOT10	25904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	32774933	32774933	+	Missense_Mutation	SNP	A	A	G			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr3:32774933A>G	ENST00000328834.5	+	11	1550	c.1234A>G	c.(1234-1236)Aaa>Gaa	p.K412E	CNOT10_ENST00000538368.1_Missense_Mutation_p.K184E|CNOT10-AS1_ENST00000475395.2_RNA|CNOT10_ENST00000331889.6_Missense_Mutation_p.K412E|CNOT10_ENST00000454516.2_Missense_Mutation_p.K472E	NM_015442.2	NP_056257.1	Q9H9A5	CNO10_HUMAN	CCR4-NOT transcription complex, subunit 10	412					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(3)	23						ACAAGAAACTAAAGGCCTTCC	0.318																																					p.K472E		.											.	CNOT10	91	0			c.A1414G						.						73.0	76.0	75.0					3																	32774933		2203	4298	6501	SO:0001583	missense	25904	exon11			GAAACTAAAGGCC	BC002928	CCDS2655.1, CCDS58821.1, CCDS58822.1	3p23	2013-01-10			ENSG00000182973	ENSG00000182973		"""Tetratricopeptide (TTC) repeat domain containing"""	23817	protein-coding gene	gene with protein product							Standard	NR_046352		Approved	FLJ12890, FLJ13165	uc011axj.2	Q9H9A5	OTTHUMG00000130748	ENST00000328834.5:c.1234A>G	3.37:g.32774933A>G	ENSP00000330060:p.Lys412Glu	275.0	0.0		272.0	80.0	NM_001256742	B7Z7L1|F8WAF2|Q9BU30|Q9H5J7|Q9H8X1|Q9H9W0|Q9HAH3|Q9UFJ2	Missense_Mutation	SNP	ENST00000328834.5	37	CCDS2655.1	.	.	.	.	.	.	.	.	.	.	A	16.58	3.163325	0.57476	.	.	ENSG00000182973	ENST00000331889;ENST00000328834;ENST00000540405;ENST00000538368;ENST00000454516	T;T;T;T	0.44482	1.57;1.57;0.92;1.57	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.49184	0.1542	L	0.40543	1.245	0.80722	D	1	P;P;D;P	0.59767	0.774;0.885;0.986;0.817	B;P;P;B	0.58520	0.296;0.465;0.84;0.217	T	0.31998	-0.9923	10	0.11794	T	0.64	-28.9566	16.5885	0.84745	1.0:0.0:0.0:0.0	.	472;412;411;412	F8WAF2;Q9H9A5-3;Q9H9A5-2;Q9H9A5	.;.;.;CNOTA_HUMAN	E	412;412;312;184;472	ENSP00000329376:K412E;ENSP00000330060:K412E;ENSP00000442552:K184E;ENSP00000399862:K472E	ENSP00000330060:K412E	K	+	1	0	CNOT10	32749937	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	9.208000	0.95075	2.317000	0.78254	0.460000	0.39030	AAA	.		0.318	CNOT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253248.2	NM_015442	
CSHL1	1444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	61987600	61987600	+	Missense_Mutation	SNP	G	G	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr17:61987600G>T	ENST00000309894.5	-	4	392	c.393C>A	c.(391-393)aaC>aaA	p.N131K	CSHL1_ENST00000450719.3_Missense_Mutation_p.N37K|CSHL1_ENST00000438387.2_Missense_Mutation_p.N48K|CSHL1_ENST00000558099.1_5'UTR|CSHL1_ENST00000346606.6_Missense_Mutation_p.N37K|CSHL1_ENST00000392824.4_3'UTR|CSHL1_ENST00000259003.10_Missense_Mutation_p.N69K|CSHL1_ENST00000561003.1_Missense_Mutation_p.N48K	NM_022579.1	NP_072101.1	Q14406	CSHL_HUMAN	chorionic somatomammotropin hormone-like 1	131						extracellular region (GO:0005576)	hormone activity (GO:0005179)|metal ion binding (GO:0046872)			endometrium(3)|lung(6)	9						CATACACCAGGTTGTTGGTGA	0.582																																					p.N131K		.											.	CSHL1	90	0			c.C393A						.						81.0	70.0	73.0					17																	61987600		2203	4300	6503	SO:0001583	missense	1444	exon4			CACCAGGTTGTTG	BC029365	CCDS11652.1, CCDS42370.1, CCDS45759.1	17q22-q24	2012-10-02							2442	protein-coding gene	gene with protein product	"""chorionic somatomammotropin CS-5"""	603515		CSHP1		8083227	Standard	NM_001318		Approved	hCS-L, CSL, CS-5, MGC149868	uc002jda.1	Q14406		ENST00000309894.5:c.393C>A	17.37:g.61987600G>T	ENSP00000309524:p.Asn131Lys	137.0	0.0		141.0	19.0	NM_022579	D3DU26|D3DU27|Q0VDB2	Missense_Mutation	SNP	ENST00000309894.5	37	CCDS11652.1	.	.	.	.	.	.	.	.	.	.	g	6.762	0.509428	0.12883	.	.	ENSG00000204414	ENST00000309894;ENST00000438387;ENST00000259003;ENST00000346606;ENST00000450719	D;D;D	0.89270	-2.49;-2.49;-2.49	3.07	3.07	0.35406	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.521808	0.22290	N	0.062013	T	0.81460	0.4827	L	0.38175	1.15	0.80722	D	1	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.15870	0.001;0.003;0.014;0.008	T	0.78507	-0.2177	10	0.72032	D	0.01	.	6.1657	0.20388	0.1431:0.0:0.8569:0.0	.	37;48;131;108	Q14406-4;Q14406-3;Q14406;Q14406-2	.;.;CSHL_HUMAN;.	K	131;48;126;37;126	ENSP00000309524:N131K;ENSP00000402632:N48K;ENSP00000316360:N37K	ENSP00000259003:N126K	N	-	3	2	GH1	59341332	1.000000	0.71417	0.930000	0.37139	0.003000	0.03518	2.131000	0.42074	1.730000	0.51580	0.305000	0.20034	AAC	.		0.582	CSHL1-009	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444557.1	NM_022579	
CTDSPL	10217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38017293	38017293	+	Missense_Mutation	SNP	G	G	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr3:38017293G>T	ENST00000273179.5	+	7	639	c.613G>T	c.(613-615)Gtg>Ttg	p.V205L	CTDSPL_ENST00000443503.2_Missense_Mutation_p.V194L|CTDSPL_ENST00000310189.3_3'UTR	NM_001008392.1	NP_001008393.1	O15194	CTDSL_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like	205	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|large_intestine(4)|skin(1)	8		Melanoma(1037;0.0122)		KIRC - Kidney renal clear cell carcinoma(284;0.0729)|Kidney(284;0.0902)		TGGGAACTACGTGAAGGACCT	0.532																																					p.V205L		.											.	CTDSPL	90	0			c.G613T						.						117.0	119.0	118.0					3																	38017293		2203	4300	6503	SO:0001583	missense	10217	exon7			AACTACGTGAAGG	D88153	CCDS33734.1, CCDS33735.1	3p21.3	2010-06-21	2003-10-27	2003-10-29	ENSG00000144677	ENSG00000144677	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	16890	protein-coding gene	gene with protein product	"""small CTD phosphatase 3"", ""HYA22 protein"", ""RB protein serine phosphatase from chromosome 3"""	608592	"""chromosome 3 open reading frame 8"""	C3orf8		9179494, 12543795	Standard	NM_005808		Approved	HYA22, SCP3, PSR1, RBSP3	uc003chg.3	O15194	OTTHUMG00000155942	ENST00000273179.5:c.613G>T	3.37:g.38017293G>T	ENSP00000273179:p.Val205Leu	71.0	0.0		63.0	25.0	NM_001008392	Q3ZTU0|Q70KI4|Q7Z5Q2	Missense_Mutation	SNP	ENST00000273179.5	37	CCDS33734.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.936838	0.92458	.	.	ENSG00000144677	ENST00000443503;ENST00000273179;ENST00000447745	T;T;T	0.16743	2.32;2.32;2.32	4.79	4.79	0.61399	NLI interacting factor (3);Dullard phosphatase domain, eukaryotic (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.45054	0.1323	M	0.82132	2.575	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.67725	0.922;0.953	T	0.51655	-0.8678	10	0.87932	D	0	-2.4139	18.2041	0.89848	0.0:0.0:1.0:0.0	.	194;205	O15194-2;O15194	.;CTDSL_HUMAN	L	194;205;94	ENSP00000398288:V194L;ENSP00000273179:V205L;ENSP00000407443:V94L	ENSP00000273179:V205L	V	+	1	0	CTDSPL	37992297	1.000000	0.71417	0.983000	0.44433	0.941000	0.58515	9.667000	0.98616	2.386000	0.81285	0.561000	0.74099	GTG	.		0.532	CTDSPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342392.1	NM_005808	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266112	41266112	+	Missense_Mutation	SNP	T	T	G	rs121913416|rs121913228		TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr3:41266112T>G	ENST00000349496.5	+	3	389	c.109T>G	c.(109-111)Tct>Gct	p.S37A	CTNNB1_ENST00000405570.1_Missense_Mutation_p.S37A|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S30A|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S37A|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S37A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	37			S -> A (in MDB and hepatocellular carcinoma; enhances transactivation of target genes). {ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> C (in PTR, hepatoblastoma and ovarian cancer). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:9927029}.|S -> F (in PTR). {ECO:0000269|PubMed:10192393}.|S -> Y (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|SG -> W (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S37A(62)|p.A5_A80del(53)|p.S37P(21)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.I35_S37>T(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.S37T(1)|p.I35_K170del(1)|p.H24_G38del(1)|p.I35_T41del(1)|p.I35_G38del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.S37_G38>W(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGGAATCCATTCTGGTGCCAC	0.498	S37P(HEC108_ENDOMETRIUM)|S37P(SNGM_ENDOMETRIUM)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S37A	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,-1	CTNNB1	24361	214	Deletion - In frame(102)|Substitution - Missense(84)|Complex - deletion inframe(18)|Unknown(7)|Deletion - Frameshift(3)	liver(108)|large_intestine(33)|stomach(21)|endometrium(13)|small_intestine(10)|parathyroid(9)|central_nervous_system(8)|skin(3)|ovary(3)|pancreas(2)|adrenal_gland(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|pituitary(1)	c.T109G						.						94.0	79.0	84.0					3																	41266112		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ATCCATTCTGGTG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.109T>G	3.37:g.41266112T>G	ENSP00000344456:p.Ser37Ala	163.0	0.0		162.0	25.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.591559	0.86953	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.67468	0.2896	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72357	-0.4318	10	0.87932	D	0	-15.9763	16.0677	0.80897	0.0:0.0:0.0:1.0	.	37	P35222	CTNB1_HUMAN	A	30;37;37;37;37;30;37;37;37	ENSP00000400508:S30A;ENSP00000385604:S37A;ENSP00000412219:S37A;ENSP00000379486:S37A;ENSP00000344456:S37A;ENSP00000411226:S30A;ENSP00000379488:S37A;ENSP00000409302:S37A;ENSP00000401599:S37A	ENSP00000344456:S37A	S	+	1	0	CTNNB1	41241116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.201000	0.70794	0.533000	0.62120	TCT	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTPS1	1503	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	41457492	41457492	+	Missense_Mutation	SNP	T	T	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr1:41457492T>C	ENST00000372621.4	+	7	1203	c.695T>C	c.(694-696)aTg>aCg	p.M232T	CTPS1_ENST00000541520.1_Start_Codon_SNP_p.M1T|CTPS1_ENST00000543104.1_Missense_Mutation_p.M239T|CTPS1_ENST00000372616.1_Missense_Mutation_p.M232T	NM_001905.2	NP_001896.2			CTP synthase 1											endometrium(3)|lung(10)	13						AAAATATCAATGTTCTGCCAT	0.393																																					p.M232T		.											.	.	.	0			c.T695C						.						123.0	113.0	117.0					1																	41457492		2203	4300	6503	SO:0001583	missense	1503	exon7			TATCAATGTTCTG	BC009408	CCDS459.1	1p34.1	2012-05-02	2012-05-02	2012-05-02	ENSG00000171793	ENSG00000171793	6.3.4.2		2519	protein-coding gene	gene with protein product		123860	"""CTP synthase"""	CTPS		1783378	Standard	XM_005270536		Approved		uc001cgk.4	P17812	OTTHUMG00000005712	ENST00000372621.4:c.695T>C	1.37:g.41457492T>C	ENSP00000361704:p.Met232Thr	137.0	0.0		158.0	51.0	NM_001905		Missense_Mutation	SNP	ENST00000372621.4	37	CCDS459.1	.	.	.	.	.	.	.	.	.	.	T	18.70	3.679250	0.68042	.	.	ENSG00000171793	ENST00000372621;ENST00000541520;ENST00000543104;ENST00000372616	T;T;T	0.50277	0.99;0.75;0.99	6.17	6.17	0.99709	CTP synthase, N-terminal (1);	0.032670	0.85682	D	0.000000	T	0.49949	0.1587	M	0.64080	1.96	0.80722	D	1	B;B	0.19583	0.009;0.037	B;B	0.29077	0.021;0.098	T	0.41716	-0.9493	10	0.32370	T	0.25	.	15.6463	0.77055	0.0:0.0:0.0:1.0	.	239;232	B7Z9C4;P17812	.;PYRG1_HUMAN	T	232;1;239;232	ENSP00000361704:M232T;ENSP00000442646:M1T;ENSP00000361699:M232T	ENSP00000361699:M232T	M	+	2	0	CTPS	41230079	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	7.617000	0.83032	2.371000	0.80710	0.533000	0.62120	ATG	.		0.393	CTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015629.1	NM_001905	
DEPDC1B	55789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	59940645	59940645	+	Silent	SNP	G	G	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr5:59940645G>T	ENST00000265036.5	-	5	703	c.636C>A	c.(634-636)gtC>gtA	p.V212V	DEPDC1B_ENST00000453022.2_Silent_p.V212V|DEPDC1B_ENST00000545085.1_Silent_p.V185V	NM_018369.2	NP_060839.2	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B	212	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(2)|skin(2)	17		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				ACTTCGAATTGACAAGTTTGA	0.299																																					p.V212V		.											.	DEPDC1B	91	0			c.C636A						.						91.0	89.0	90.0					5																	59940645		2203	4300	6503	SO:0001819	synonymous_variant	55789	exon5			CGAATTGACAAGT	AF303178	CCDS3977.1, CCDS47214.1	5q12	2008-02-05			ENSG00000035499	ENSG00000035499			24902	protein-coding gene	gene with protein product	"""breast cancer cell 3"""					12477932	Standard	NM_001145208		Approved	XTP1, BRCC3	uc003jsh.3	Q8WUY9	OTTHUMG00000097083	ENST00000265036.5:c.636C>A	5.37:g.59940645G>T		137.0	0.0		158.0	53.0	NM_001145208	A8K3R9|B4DUT4|Q86WJ3|Q8IZY6|Q9NUN3|Q9NW57	Silent	SNP	ENST00000265036.5	37	CCDS3977.1																																																																																			.		0.299	DEPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214207.1	NM_018369	
DNAH14	127602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	225446907	225446907	+	Intron	SNP	G	G	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr1:225446907G>T	ENST00000445597.2	+	32	5584				DNAH14_ENST00000439375.2_Missense_Mutation_p.G2364V|DNAH14_ENST00000430092.1_Missense_Mutation_p.G2364V			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						ATAAAACATGGTTCAATTTTA	0.328																																					p.G2364V		.											.	DNAH14	23	0			c.G7091T						.						63.0	56.0	58.0					1																	225446907		692	1591	2283	SO:0001627	intron_variant	127602	exon46			AACATGGTTCAAT	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.5585-5977G>T	1.37:g.225446907G>T		414.0	0.0		636.0	126.0	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.71|13.71	2.319417|2.319417	0.41096|0.41096	.|.	.|.	ENSG00000185842|ENSG00000185842	ENST00000430092;ENST00000439375|ENST00000450490	T;T|.	0.44482|.	0.92;0.92|.	4.86|4.86	3.94|3.94	0.45596|0.45596	.|.	.|.	.|.	.|.	.|.	T|T	0.38427|0.38427	0.1040|0.1040	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.78314|.	0.991|.	T|T	0.13710|0.13710	-1.0499|-1.0499	9|5	0.29301|.	T|.	0.29|.	.|.	10.4522|10.4522	0.44528|0.44528	0.0937:0.0:0.9063:0.0|0.0937:0.0:0.9063:0.0	.|.	2364|.	Q0VDD8-4|.	.|.	V|F	2364|136	ENSP00000414402:G2364V;ENSP00000392061:G2364V|.	ENSP00000414402:G2364V|.	G|V	+|+	2|1	0|0	DNAH14|DNAH14	223513530|223513530	0.884000|0.884000	0.30299|0.30299	0.976000|0.976000	0.42696|0.42696	0.821000|0.821000	0.46438|0.46438	2.091000|2.091000	0.41691|0.41691	1.164000|1.164000	0.42652|0.42652	0.603000|0.603000	0.83216|0.83216	GGT|GTT	.		0.328	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
DNAH2	146754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7636408	7636408	+	Missense_Mutation	SNP	C	C	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr17:7636408C>A	ENST00000572933.1	+	5	1863	c.403C>A	c.(403-405)Cag>Aag	p.Q135K	DNAH2_ENST00000389173.2_Missense_Mutation_p.Q135K|DNAH2_ENST00000082259.3_Missense_Mutation_p.Q135K|DNAH2_ENST00000570791.1_Missense_Mutation_p.Q135K			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	135	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CATGCAGACCCAGAACCAGCT	0.562																																					p.Q135K		.											.	DNAH2	102	0			c.C403A						.						75.0	68.0	71.0					17																	7636408		2203	4300	6503	SO:0001583	missense	146754	exon4			CAGACCCAGAACC	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.403C>A	17.37:g.7636408C>A	ENSP00000458355:p.Gln135Lys	71.0	0.0		67.0	26.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.604300	0.28534	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	T;T	0.41065	1.01;1.01	4.67	4.67	0.58626	.	0.778438	0.11639	N	0.544033	T	0.30665	0.0772	L	0.27053	0.805	0.46874	D	0.999231	B;P	0.36660	0.329;0.564	B;B	0.40101	0.038;0.319	T	0.03130	-1.1069	10	0.02654	T	1	.	12.6852	0.56944	0.0:0.8333:0.1667:0.0	.	135;135	Q9P225;Q9P225-3	DYH2_HUMAN;.	K	135	ENSP00000373825:Q135K;ENSP00000082259:Q135K	ENSP00000082259:Q135K	Q	+	1	0	DNAH2	7577133	0.962000	0.33011	1.000000	0.80357	0.823000	0.46562	1.993000	0.40747	2.596000	0.87737	0.655000	0.94253	CAG	.		0.562	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
DOCK2	1794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	169186741	169186741	+	Silent	SNP	G	G	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr5:169186741G>T	ENST00000256935.8	+	24	2489	c.2409G>T	c.(2407-2409)ctG>ctT	p.L803L	DOCK2_ENST00000540750.1_5'UTR|DOCK2_ENST00000520908.1_Silent_p.L295L	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	803					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CATCTGTCCTGCATGATGTAG	0.463																																					p.L803L		.											.	DOCK2	97	0			c.G2409T						.						259.0	235.0	243.0					5																	169186741		2203	4300	6503	SO:0001819	synonymous_variant	1794	exon24			TGTCCTGCATGAT	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2409G>T	5.37:g.169186741G>T		83.0	0.0		81.0	23.0	NM_004946	Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	37	CCDS4371.1																																																																																			.		0.463	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
ENDOD1	23052	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	94823277	94823277	+	Silent	SNP	T	T	G			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr11:94823277T>G	ENST00000278505.4	+	1	304	c.186T>G	c.(184-186)gcT>gcG	p.A62A		NM_015036.2	NP_055851.1	O94919	ENDD1_HUMAN	endonuclease domain containing 1	62						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.00824)				CGGAGGGTGCTGAGCGCTTCG	0.716																																					p.A62A		.											.	ENDOD1	68	0			c.T186G						.						12.0	16.0	15.0					11																	94823277		1882	4104	5986	SO:0001819	synonymous_variant	23052	exon1			GGGTGCTGAGCGC	BC026191	CCDS41699.1	11q21	2010-03-19			ENSG00000149218	ENSG00000149218			29129	protein-coding gene	gene with protein product						10048485	Standard	NM_015036		Approved	KIAA0830	uc001pfh.3	O94919	OTTHUMG00000167835	ENST00000278505.4:c.186T>G	11.37:g.94823277T>G		76.0	0.0		100.0	29.0	NM_015036	A8K6K8|Q6GQY5|Q8TAQ8	Silent	SNP	ENST00000278505.4	37	CCDS41699.1																																																																																			.		0.716	ENDOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396545.1	NM_015036	
EPHA5	2044	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	66467891	66467891	+	Silent	SNP	G	G	T	rs55882537		TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr4:66467891G>T	ENST00000273854.3	-	3	978	c.378C>A	c.(376-378)atC>atA	p.I126I	EPHA5_ENST00000511294.1_Silent_p.I126I|EPHA5_ENST00000354839.4_Silent_p.I126I|EPHA5_ENST00000432638.2_Silent_p.I126I	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	126	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						GTTCTATGAAGATTCTGGAAG	0.438										TSP Lung(17;0.13)																											p.I126I		.											.	EPHA5	1430	0			c.C378A						.						95.0	100.0	98.0					4																	66467891		2203	4300	6503	SO:0001819	synonymous_variant	2044	exon3			TATGAAGATTCTG	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.378C>A	4.37:g.66467891G>T		56.0	0.0		55.0	17.0	NM_004439	Q7Z3F2	Silent	SNP	ENST00000273854.3	37	CCDS3513.1																																																																																			.		0.438	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
EPHX2	2053	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	27382882	27382882	+	Silent	SNP	G	G	T	rs200523278	byFrequency	TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr8:27382882G>T	ENST00000521400.1	+	12	1492	c.1062G>T	c.(1060-1062)gcG>gcT	p.A354A	EPHX2_ENST00000521780.1_Silent_p.A288A|EPHX2_ENST00000518379.1_Silent_p.A322A|EPHX2_ENST00000380476.3_Silent_p.A301A|EPHX2_ENST00000517536.1_Silent_p.A171A	NM_001979.5	NP_001970.2	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	354	Epoxide hydrolase.				arachidonic acid metabolic process (GO:0019369)|cellular calcium ion homeostasis (GO:0006874)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|inflammatory response (GO:0006954)|phospholipid dephosphorylation (GO:0046839)|positive regulation of gene expression (GO:0010628)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|regulation of blood pressure (GO:0008217)|regulation of cholesterol metabolic process (GO:0090181)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|stilbene catabolic process (GO:0046272)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	10-hydroxy-9-(phosphonooxy)octadecanoate phosphatase activity (GO:0033885)|epoxide hydrolase activity (GO:0004301)|lipid phosphatase activity (GO:0042577)|magnesium ion binding (GO:0000287)|phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxic substance binding (GO:0015643)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	27		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)		TCTGTAGGGCGGTGGCCAGTT	0.463																																					p.A354A		.											.	EPHX2	91	0			c.G1062T						.						121.0	112.0	115.0					8																	27382882		2203	4300	6503	SO:0001819	synonymous_variant	2053	exon12			TAGGGCGGTGGCC	L05779	CCDS6060.1, CCDS59097.1, CCDS59098.1	8p21	2010-04-23			ENSG00000120915	ENSG00000120915	3.3.2.10		3402	protein-coding gene	gene with protein product		132811					Standard	NM_001979		Approved		uc003xfu.4	P34913	OTTHUMG00000102115	ENST00000521400.1:c.1062G>T	8.37:g.27382882G>T		159.0	1.0		141.0	46.0	NM_001979	B2Z3B1|B3KTU8|B3KUA0|G3V134|J3KPH7|Q16764|Q9HBJ1|Q9HBJ2	Silent	SNP	ENST00000521400.1	37	CCDS6060.1																																																																																			G|0.999;A|0.001		0.463	EPHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219954.4		
ERCC2	2068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	45856053	45856053	+	Missense_Mutation	SNP	A	A	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr19:45856053A>C	ENST00000391945.4	-	20	1930	c.1853T>G	c.(1852-1854)gTc>gGc	p.V618G	ERCC2_ENST00000391944.3_Missense_Mutation_p.V540G	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	618	Mediates interaction with MMS19.				7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AAACATGATGACGGCCCGCCC	0.617			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.V618G		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	ERCC2,NS,carcinoma,-1	ERCC2	848	0			c.T1853G						.						67.0	61.0	63.0					19																	45856053		2203	4300	6503	SO:0001583	missense	2068	exon20	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	ATGATGACGGCCC		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.1853T>G	19.37:g.45856053A>C	ENSP00000375809:p.Val618Gly	80.0	0.0		67.0	18.0	NM_000400	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.801712	0.90538	.	.	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944	D;D	0.83591	-1.74;-1.74	5.13	5.13	0.70059	Helicase, ATP-dependent, c2 type (1);	0.000000	0.85682	D	0.000000	D	0.95114	0.8417	H	0.99626	4.665	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.77557	0.99;0.986;0.988	D	0.96671	0.9496	10	0.87932	D	0	-64.0864	12.9281	0.58272	1.0:0.0:0.0:0.0	.	540;618;311	E7EVE9;P18074;Q6ZNQ5	.;ERCC2_HUMAN;.	G	568;594;618;540	ENSP00000375809:V618G;ENSP00000375808:V540G	ENSP00000375805:V568G	V	-	2	0	ERCC2	50547893	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.988000	0.63863	2.154000	0.67381	0.459000	0.35465	GTC	.		0.617	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
EVC	2121	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	5798959	5798959	+	Splice_Site	SNP	G	G	T	rs201083145		TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr4:5798959G>T	ENST00000264956.6	+	14	2281	c.2097G>T	c.(2095-2097)ctG>ctT	p.L699L	EVC_ENST00000382674.2_Splice_Site_p.L699L|EVC_ENST00000515113.1_3'UTR	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	699					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				TCAGGGCCCTGGTAAGACCAG	0.647																																					p.L699L		.											.	EVC	92	0			c.G2097T						.						17.0	17.0	17.0					4																	5798959		2203	4298	6501	SO:0001630	splice_region_variant	2121	exon14			GGCCCTGGTAAGA	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.2097+1G>T	4.37:g.5798959G>T		109.0	0.0		109.0	38.0	NM_153717		Silent	SNP	ENST00000264956.6	37	CCDS3383.1																																																																																			G|0.999;A|0.000		0.647	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1		Silent
FOCAD	54914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	20926369	20926369	+	Missense_Mutation	SNP	G	G	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr9:20926369G>T	ENST00000380249.1	+	28	3395	c.3031G>T	c.(3031-3033)Gat>Tat	p.D1011Y	FOCAD_ENST00000605086.1_Missense_Mutation_p.D447Y|FOCAD_ENST00000338382.6_Missense_Mutation_p.D1011Y	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1011						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											GGTCATTGTGGATAGCCATTA	0.348																																					p.D1011Y		.											.	.	.	0			c.G3031T						.						121.0	112.0	115.0					9																	20926369		2203	4300	6503	SO:0001583	missense	54914	exon28			ATTGTGGATAGCC	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.3031G>T	9.37:g.20926369G>T	ENSP00000369599:p.Asp1011Tyr	105.0	0.0		106.0	27.0	NM_017794	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	37	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.641896	0.67244	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.11385	2.78;2.78	5.84	5.84	0.93424	Armadillo-type fold (1);	0.139822	0.64402	D	0.000004	T	0.29620	0.0739	M	0.62723	1.935	0.40454	D	0.980178	D	0.89917	1.0	D	0.68192	0.956	T	0.00544	-1.1679	10	0.87932	D	0	-6.1902	14.3704	0.66836	0.0725:0.0:0.9275:0.0	.	1011	Q5VW36	K1797_HUMAN	Y	1011	ENSP00000369599:D1011Y;ENSP00000344307:D1011Y	ENSP00000344307:D1011Y	D	+	1	0	KIAA1797	20916369	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.268000	0.58883	2.776000	0.95493	0.586000	0.80456	GAT	.		0.348	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794	
FRMD1	79981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	168464373	168464373	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr6:168464373G>A	ENST00000283309.6	-	6	776	c.712C>T	c.(712-714)Cag>Tag	p.Q238*	FRMD1_ENST00000440994.2_Nonsense_Mutation_p.Q170*|FRMD1_ENST00000432403.1_5'UTR|FRMD1_ENST00000537786.1_Nonsense_Mutation_p.Q9*	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	238	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		CTCAGGCCCTGGCGCTCACGG	0.642																																					p.Q238X	GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)	.											.	FRMD1	91	0			c.C712T						.						91.0	77.0	81.0					6																	168464373		2203	4300	6503	SO:0001587	stop_gained	79981	exon6			GGCCCTGGCGCTC		CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.712C>T	6.37:g.168464373G>A	ENSP00000283309:p.Gln238*	120.0	0.0		109.0	21.0	NM_024919	B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Nonsense_Mutation	SNP	ENST00000283309.6	37	CCDS5306.1	.	.	.	.	.	.	.	.	.	.	G	19.50	3.839819	0.71488	.	.	ENSG00000153303	ENST00000283309;ENST00000440994;ENST00000537786	.	.	.	2.83	2.83	0.33086	.	0.493026	0.18335	U	0.144344	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	7.9508	0.30014	0.1171:0.0:0.8829:0.0	.	.	.	.	X	238;170;9	.	ENSP00000283309:Q238X	Q	-	1	0	FRMD1	168207222	0.309000	0.24518	0.367000	0.25926	0.234000	0.25298	1.415000	0.34748	1.425000	0.47237	0.305000	0.20034	CAG	.		0.642	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362513.2	NM_024919	
FRRS1	391059	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	100214255	100214256	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr1:100214255_100214256insA	ENST00000414213.1	-	3	670_671	c.69_70insT	c.(67-72)tatcccfs	p.P24fs	FRRS1_ENST00000287474.5_Frame_Shift_Ins_p.P24fs			Q6ZNA5	FRRS1_HUMAN	ferric-chelate reductase 1	24	Reelin. {ECO:0000255|PROSITE- ProRule:PRU00363}.					integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	26		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)		TTTCCATTGGGATAATTAGCCA	0.406																																					p.P24fs		.											.	FRRS1	91	0			c.70_71insT						.																																			SO:0001589	frameshift_variant	391059	exon3			CATTGGGATAATT	AK131302	CCDS30780.1	1p21.3	2009-11-30	2006-02-22	2006-02-22	ENSG00000156869	ENSG00000156869			27622	protein-coding gene	gene with protein product		611578	"""stromal cell derived factor receptor 2 homolog (mouse)"""	SDFR2			Standard	NM_001013660		Approved	SDR2	uc001dsh.1	Q6ZNA5	OTTHUMG00000010768	ENST00000414213.1:c.70dupT	1.37:g.100214256_100214256dupA	ENSP00000393884:p.Pro24fs	215.0	0.0		265.0	72.0	NM_001013660	A6NLN7	Frame_Shift_Ins	INS	ENST00000414213.1	37																																																																																				.		0.406	FRRS1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001013660	
FUT8	2530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	66082780	66082780	+	Silent	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr14:66082780G>A	ENST00000360689.5	+	4	2015	c.288G>A	c.(286-288)caG>caA	p.Q96Q	FUT8_ENST00000394586.2_Silent_p.Q96Q|FUT8_ENST00000358307.2_5'UTR|FUT8_ENST00000557164.1_5'UTR|FUT8_ENST00000394585.1_Silent_p.Q96Q	NM_004480.4|NM_178155.2	NP_004471.4|NP_835368.1	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 (alpha (1,6) fucosyltransferase)	96					cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|GDP-L-fucose metabolic process (GO:0046368)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|L-fucose catabolic process (GO:0042355)|N-glycan fucosylation (GO:0036071)|N-glycan processing (GO:0006491)|oligosaccharide biosynthetic process (GO:0009312)|post-translational protein modification (GO:0043687)|protein glycosylation in Golgi (GO:0033578)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|receptor metabolic process (GO:0043112)|respiratory gaseous exchange (GO:0007585)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycoprotein 6-alpha-L-fucosyltransferase activity (GO:0008424)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		CCAAAGAACAGATTGAAAATT	0.418																																					p.Q96Q		.											.	FUT8	91	0			c.G288A						.						91.0	91.0	91.0					14																	66082780		2203	4300	6503	SO:0001819	synonymous_variant	2530	exon4			AGAACAGATTGAA	AB049740	CCDS9775.1, CCDS9776.1, CCDS9776.2	14q24.3	2013-02-26			ENSG00000033170	ENSG00000033170		"""Fucosyltransferases"""	4019	protein-coding gene	gene with protein product		602589				9368041	Standard	NM_178155		Approved		uc001xio.3	Q9BYC5	OTTHUMG00000142818	ENST00000360689.5:c.288G>A	14.37:g.66082780G>A		141.0	0.0		139.0	43.0	NM_178155	B4DFS7|G3V5N0|O00235|Q8IUA5|Q9BYC6|Q9P2U5|Q9P2U6	Silent	SNP	ENST00000360689.5	37	CCDS9775.1																																																																																			.		0.418	FUT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286406.1	NM_004480	
GON4L	54856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155736387	155736387	+	Silent	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr1:155736387G>A	ENST00000368331.1	-	21	2925	c.2877C>T	c.(2875-2877)gaC>gaT	p.D959D	GON4L_ENST00000437809.1_Silent_p.D959D|GON4L_ENST00000271883.5_Silent_p.D959D|GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000361040.5_Silent_p.D959D	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	959					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					ACTCCAAATTGTCTTTTTCTA	0.502																																					p.D959D		.											.	GON4L	93	0			c.C2877T						.						137.0	130.0	132.0					1																	155736387		2203	4300	6503	SO:0001819	synonymous_variant	54856	exon21			CAAATTGTCTTTT	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.2877C>T	1.37:g.155736387G>A		117.0	0.0		186.0	39.0	NM_001037533	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																				.		0.502	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
GPR132	29933	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105518034	105518034	+	Missense_Mutation	SNP	G	G	A	rs376299075		TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr14:105518034G>A	ENST00000329797.3	-	4	1351	c.440C>T	c.(439-441)gCg>gTg	p.A147V	GPR132_ENST00000539291.2_Missense_Mutation_p.A147V|GPR132_ENST00000546679.1_5'UTR|GPR132_ENST00000392585.2_Missense_Mutation_p.A138V	NM_001278694.1|NM_001278696.1|NM_013345.2	NP_001265623.1|NP_001265625.1|NP_037477.1	Q9UNW8	GP132_HUMAN	G protein-coupled receptor 132	147					G1/S transition of mitotic cell cycle (GO:0000082)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	18		all_cancers(154;0.0953)|Melanoma(154;0.155)|all_epithelial(191;0.219)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.02)|all cancers(159;0.0419)|OV - Ovarian serous cystadenocarcinoma(161;0.0521)		ACTCTCCAGCGCGTACACCAC	0.627																																					p.A147V		.											.	GPR132	92	0			c.C440T						.	G	VAL/ALA	0,4406		0,0,2203	82.0	76.0	78.0		440	5.0	0.1	14		78	1,8599	1.2+/-3.3	0,1,4299	no	missense	GPR132	NM_013345.2	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	147/381	105518034	1,13005	2203	4300	6503	SO:0001583	missense	29933	exon4			TCCAGCGCGTACA	AF083955	CCDS9997.1, CCDS61567.1	14q32.3	2012-08-21			ENSG00000183484	ENSG00000183484		"""GPCR / Class A : Orphans"""	17482	protein-coding gene	gene with protein product	"""G2 accumulation"""	606167				12086852	Standard	NM_013345		Approved	G2A	uc001yqd.3	Q9UNW8	OTTHUMG00000140173	ENST00000329797.3:c.440C>T	14.37:g.105518034G>A	ENSP00000328818:p.Ala147Val	108.0	0.0		123.0	33.0	NM_013345	A8K7X7|B4E144|Q9BSU2	Missense_Mutation	SNP	ENST00000329797.3	37	CCDS9997.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212011	0.58452	0.0	1.16E-4	ENSG00000183484	ENST00000329797;ENST00000392585;ENST00000539291	T;T;T	0.37915	1.17;1.17;1.17	4.97	4.97	0.65823	GPCR, rhodopsin-like superfamily (1);	0.224717	0.36972	N	0.002304	T	0.65460	0.2693	M	0.86953	2.85	0.27577	N	0.949692	D;D	0.89917	0.999;1.0	D;D	0.71414	0.953;0.973	T	0.65249	-0.6214	10	0.87932	D	0	.	17.2051	0.86915	0.0:0.0:1.0:0.0	.	138;147	B4E144;Q9UNW8	.;GP132_HUMAN	V	147;138;147	ENSP00000328818:A147V;ENSP00000376364:A138V;ENSP00000438094:A147V	ENSP00000328818:A147V	A	-	2	0	GPR132	104589079	0.981000	0.34729	0.105000	0.21289	0.019000	0.09904	6.191000	0.72063	2.283000	0.76528	0.563000	0.77884	GCG	.		0.627	GPR132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409278.1	NM_013345	
GTPBP10	85865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	89982211	89982211	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr7:89982211G>A	ENST00000222511.6	+	2	181	c.115G>A	c.(115-117)Ggt>Agt	p.G39S	GTPBP10_ENST00000257659.8_Missense_Mutation_p.G39S	NM_033107.3	NP_149098.2	A4D1E9	GTPBA_HUMAN	GTP-binding protein 10 (putative)	39					ribosome biogenesis (GO:0042254)	chromosome (GO:0005694)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|lung(4)	10						AGGTGGAGAAGGTGGAAAAGG	0.433																																					p.G39S		.											.	GTPBP10	68	0			c.G115A						.						186.0	181.0	182.0					7																	89982211		2203	4300	6503	SO:0001583	missense	85865	exon2			GGAGAAGGTGGAA		CCDS5617.1, CCDS43614.1	7q21.13	2006-08-15			ENSG00000105793	ENSG00000105793			25106	protein-coding gene	gene with protein product		610920				12477932	Standard	NM_001042717		Approved	DKFZP686A10121, FLJ38242	uc003ukm.2	A4D1E9	OTTHUMG00000023655	ENST00000222511.6:c.115G>A	7.37:g.89982211G>A	ENSP00000222511:p.Gly39Ser	144.0	0.0		164.0	48.0	NM_001042717	B4DFY6|Q3B7A6|Q5H9V2|Q8IXG8|Q8N982|Q8WU16|Q9BSP1|Q9Y6T6	Missense_Mutation	SNP	ENST00000222511.6	37	CCDS5617.1	.	.	.	.	.	.	.	.	.	.	G	36	5.798025	0.96952	.	.	ENSG00000105793	ENST00000426366;ENST00000450619;ENST00000257659;ENST00000222511;ENST00000417207	T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12	6.07	6.07	0.98685	GTP1/OBG subdomain (3);	0.049416	0.85682	N	0.000000	D	0.87261	0.6133	H	0.98936	4.375	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;1.0;1.0	D	0.91409	0.5149	9	.	.	.	-8.5243	20.6525	0.99598	0.0:0.0:1.0:0.0	.	39;39;30;56	A4D1E9-2;A4D1E9;C9J8R7;C9JNI1	.;GTPBA_HUMAN;.;.	S	30;56;39;39;39	ENSP00000405697:G30S;ENSP00000389510:G56S;ENSP00000257659:G39S;ENSP00000222511:G39S;ENSP00000416596:G39S	.	G	+	1	0	GTPBP10	89820147	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.145000	0.94634	2.890000	0.99128	0.585000	0.79938	GGT	.		0.433	GTPBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059976.3	NM_033107	
HELZ	9931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	65116628	65116628	+	Missense_Mutation	SNP	C	C	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr17:65116628C>A	ENST00000358691.5	-	27	3897	c.3731G>T	c.(3730-3732)gGa>gTa	p.G1244V	HELZ_ENST00000580168.1_Missense_Mutation_p.G1245V	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1244						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					AGATCCTCGTCCATGTGTCTG	0.463																																					p.G1244V		.											.	HELZ	92	0			c.G3731T						.						247.0	221.0	229.0					17																	65116628		1976	4174	6150	SO:0001583	missense	9931	exon27			CCTCGTCCATGTG	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.3731G>T	17.37:g.65116628C>A	ENSP00000351524:p.Gly1244Val	147.0	0.0		197.0	45.0	NM_014877	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.120896	0.37436	.	.	ENSG00000198265	ENST00000358691	D	0.83914	-1.78	5.78	5.78	0.91487	.	0.140104	0.64402	D	0.000004	D	0.86543	0.5958	L	0.29908	0.895	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.63597	0.916;0.916	D	0.87651	0.2528	10	0.87932	D	0	-17.6146	20.0203	0.97492	0.0:1.0:0.0:0.0	.	1245;1244	B7ZLW2;P42694	.;HELZ_HUMAN	V	1244	ENSP00000351524:G1244V	ENSP00000351524:G1244V	G	-	2	0	HELZ	62547090	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	4.267000	0.58877	2.730000	0.93505	0.655000	0.94253	GGA	.		0.463	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	185985310	185985310	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr1:185985310C>A	ENST00000271588.4	+	32	5359	c.5130C>A	c.(5128-5130)taC>taA	p.Y1710*	HMCN1_ENST00000367492.2_Nonsense_Mutation_p.Y1710*	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1710	Ig-like C2-type 14.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GAGGACAGTACATATGCGTGG	0.433																																					p.Y1710X		.											.	HMCN1	113	0			c.C5130A						.						118.0	109.0	112.0					1																	185985310		2203	4300	6503	SO:0001587	stop_gained	83872	exon32			ACAGTACATATGC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.5130C>A	1.37:g.185985310C>A	ENSP00000271588:p.Tyr1710*	138.0	0.0		205.0	111.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Nonsense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	45	11.801259	0.99604	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.87	-1.26	0.09376	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.6458	0.62281	0.0:0.5833:0.0:0.4167	.	.	.	.	X	1710	.	ENSP00000271588:Y1710X	Y	+	3	2	HMCN1	184251933	0.031000	0.19500	0.528000	0.27938	0.755000	0.42902	-0.013000	0.12678	-0.368000	0.08040	-0.345000	0.07892	TAC	.		0.433	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HYDIN	54768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	70902688	70902688	+	Missense_Mutation	SNP	C	C	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr16:70902688C>A	ENST00000393567.2	-	66	11245	c.11095G>T	c.(11095-11097)Ggc>Tgc	p.G3699C	SNORD112_ENST00000515891.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3699					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGGAGGTGGCCCATCTAGGAA	0.483																																					p.G3699C		.											.	HYDIN	92	0			c.G11095T						.						48.0	40.0	42.0					16																	70902688		1935	4109	6044	SO:0001583	missense	54768	exon66			GGTGGCCCATCTA	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.11095G>T	16.37:g.70902688C>A	ENSP00000377197:p.Gly3699Cys	47.0	0.0		40.0	14.0	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.287363	0.80803	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.04454	3.62	5.03	5.03	0.67393	.	0.000000	0.33382	U	0.004963	T	0.25269	0.0614	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.01869	-1.1257	10	0.56958	D	0.05	.	17.9383	0.89019	0.0:1.0:0.0:0.0	.	3698	F8WD23	.	C	3699;3698	ENSP00000377197:G3699C	ENSP00000313052:G3698C	G	-	1	0	HYDIN	69460189	1.000000	0.71417	0.988000	0.46212	0.896000	0.52359	6.392000	0.73213	2.327000	0.79052	0.511000	0.50034	GGC	.		0.483	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
IBSP	3381	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	88732574	88732609	+	In_Frame_Del	DEL	GAAGAGGAAGGAAATGAAAACGAAGAAAGCGAAGCA	GAAGAGGAAGGAAATGAAAACGAAGAAAGCGAAGCA	-	rs200405481		TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	GAAGAGGAAGGAAATGAAAACGAAGAAAGCGAAGCA	GAAGAGGAAGGAAATGAAAACGAAGAAAGCGAAGCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr4:88732574_88732609delGAAGAGGAAGGAAATGAAAACGAAGAAAGCGAAGCA	ENST00000226284.5	+	7	533_568	c.466_501delGAAGAGGAAGGAAATGAAAACGAAGAAAGCGAAGCA	c.(466-501)gaagaggaaggaaatgaaaacgaagaaagcgaagcadel	p.EEEGNENEESEA156del		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	156	Asp/Glu-rich (acidic).|Poly-Glu.				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)		p.E163K(1)|p.S165S(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		agaagaggaggaagaggaaggaaatgaaaacgaagaaagcgaagcagaagTGGATG	0.449																																					p.156_167del		.											.	IBSP	90	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.466_501del						.																																			SO:0001651	inframe_deletion	3381	exon7			GAGGAGGAAGAGG		CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.466_501delGAAGAGGAAGGAAATGAAAACGAAGAAAGCGAAGCA	4.37:g.88732574_88732609delGAAGAGGAAGGAAATGAAAACGAAGAAAGCGAAGCA	ENSP00000226284:p.Glu156_Ala167del	134.0	0.0		108.0	18.0	NM_004967		In_Frame_Del	DEL	ENST00000226284.5	37	CCDS3624.1																																																																																			.		0.449	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253050.2		
KIAA0355	9710	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	34791601	34791601	+	Missense_Mutation	SNP	G	G	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr19:34791601G>T	ENST00000299505.6	+	2	1096	c.223G>T	c.(223-225)Gac>Tac	p.D75Y		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	75										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					TCCTATCGCCGACATCCAGCA	0.602																																					p.D75Y		.											.	KIAA0355	91	0			c.G223T						.						71.0	61.0	65.0					19																	34791601		2203	4300	6503	SO:0001583	missense	9710	exon2			ATCGCCGACATCC		CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.223G>T	19.37:g.34791601G>T	ENSP00000299505:p.Asp75Tyr	70.0	1.0		68.0	19.0	NM_014686	Q2M3W4	Missense_Mutation	SNP	ENST00000299505.6	37	CCDS12436.1	.	.	.	.	.	.	.	.	.	.	G	17.50	3.404860	0.62288	.	.	ENSG00000166398	ENST00000299505	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.67069	0.2854	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71550	-0.4559	9	0.87932	D	0	-24.9044	18.8851	0.92375	0.0:0.0:1.0:0.0	.	75	O15063	K0355_HUMAN	Y	75	.	ENSP00000299505:D75Y	D	+	1	0	KIAA0355	39483441	1.000000	0.71417	0.979000	0.43373	0.594000	0.36715	9.165000	0.94761	2.526000	0.85167	0.561000	0.74099	GAC	.		0.602	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686	
KRT7	3855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	52635403	52635403	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr12:52635403G>A	ENST00000331817.5	+	5	1024	c.841G>A	c.(841-843)Gcc>Acc	p.A281T		NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	281	Coil 2.|Rod.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	TGAGGCTGAAGCCTGGTACCA	0.592																																					p.A281T		.											.	KRT7	90	0			c.G841A						.						73.0	67.0	69.0					12																	52635403		2203	4300	6503	SO:0001583	missense	3855	exon5			GCTGAAGCCTGGT		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.841G>A	12.37:g.52635403G>A	ENSP00000329243:p.Ala281Thr	61.0	0.0		57.0	12.0	NM_005556	Q92676|Q9BUD8|Q9Y3R7	Missense_Mutation	SNP	ENST00000331817.5	37	CCDS8822.1	.	.	.	.	.	.	.	.	.	.	G	9.058	0.993758	0.19043	.	.	ENSG00000135480	ENST00000331817;ENST00000422319;ENST00000551537	T	0.77877	-1.13	4.88	-7.1	0.01547	Prefoldin (1);Filament (1);	0.424132	0.17542	N	0.170505	T	0.60170	0.2248	L	0.37850	1.14	0.09310	N	0.999996	B;B	0.22080	0.0;0.064	B;B	0.24006	0.008;0.05	T	0.46373	-0.9196	10	0.54805	T	0.06	.	7.293	0.26376	0.4708:0.0:0.3269:0.2023	.	281;281	F8VZY5;P08729	.;K2C7_HUMAN	T	281;257;281	ENSP00000329243:A281T	ENSP00000329243:A281T	A	+	1	0	KRT7	50921670	0.000000	0.05858	0.000000	0.03702	0.556000	0.35491	-0.730000	0.04915	-1.328000	0.02261	-0.181000	0.13052	GCC	.		0.592	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556	
LAT2	7462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	73631176	73631176	+	Missense_Mutation	SNP	T	T	G			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr7:73631176T>G	ENST00000460943.1	+	4	1005	c.116T>G	c.(115-117)aTc>aGc	p.I39S	LAT2_ENST00000275635.7_Missense_Mutation_p.I39S|LAT2_ENST00000398475.1_Missense_Mutation_p.I39S|LAT2_ENST00000344995.5_Missense_Mutation_p.I39S	NM_032464.2	NP_115853.2	Q9UHI5	LAT2_HUMAN	linker for activation of T cells family, member 2	0					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6					L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	TCAGAGAAAATCTACCAGCAG	0.547																																					p.I39S		.											.	LAT2	90	0			c.T116G						.						94.0	102.0	99.0					7																	73631176		1965	4156	6121	SO:0001583	missense	7462	exon4			AGAAAATCTACCA	AF257135	CCDS5566.2	7q11.23	2011-11-01	2005-04-26	2005-04-26	ENSG00000086730	ENSG00000086730			12749	protein-coding gene	gene with protein product	"""linker for activation of B cells"", ""non-T cell activation linker"", ""linker for activation of T cells, transmembrane adaptor 2"""	605719	"""Williams-Beuren syndrome chromosome region 5"""	WBSCR15, WBSCR5		8812460, 12514734	Standard	NM_032464		Approved	WSCR5, HSPC046, LAB, NTAL	uc003uai.3	Q9GZY6	OTTHUMG00000130151	ENST00000460943.1:c.116T>G	7.37:g.73631176T>G	ENSP00000420494:p.Ile39Ser	86.0	0.0		98.0	27.0	NM_032464	B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation	SNP	ENST00000460943.1	37	CCDS5566.2	.	.	.	.	.	.	.	.	.	.	T	16.62	3.173245	0.57584	.	.	ENSG00000086730	ENST00000465116;ENST00000344995;ENST00000460943;ENST00000475494;ENST00000398475;ENST00000361082;ENST00000275635	T;T;T;T;T;T;T	0.07021	3.23;3.23;3.23;3.23;3.23;3.23;3.23	3.84	3.84	0.44239	.	0.000000	0.38272	N	0.001746	T	0.16428	0.0395	L	0.34521	1.04	0.37639	D	0.921989	D	0.76494	0.999	D	0.83275	0.996	T	0.02950	-1.1090	10	0.72032	D	0.01	-26.2421	9.3054	0.37872	0.0:0.0:0.0:1.0	.	39	Q9GZY6	NTAL_HUMAN	S	39	ENSP00000420549:I39S;ENSP00000344881:I39S;ENSP00000420494:I39S;ENSP00000417533:I39S;ENSP00000381492:I39S;ENSP00000354374:I39S;ENSP00000275635:I39S	ENSP00000275635:I39S	I	+	2	0	LAT2	73269112	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	2.857000	0.48349	1.970000	0.57323	0.459000	0.35465	ATC	.		0.547	LAT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277062.1		
LBH	81606	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	30480370	30480370	+	Silent	SNP	A	A	G			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr2:30480370A>G	ENST00000395323.3	+	3	409	c.201A>G	c.(199-201)gaA>gaG	p.E67E	LBH_ENST00000407930.2_Silent_p.E50E|LBH_ENST00000406087.1_3'UTR|LBH_ENST00000404397.1_Intron|LBH_ENST00000401506.1_Silent_p.E73E|LBH_ENST00000467242.1_3'UTR	NM_030915.3	NP_112177.2	Q53QV2	LBH_HUMAN	limb bud and heart development	67					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(2)	5	Acute lymphoblastic leukemia(172;0.155)					TAGTGGTGGAACCCACAGAAG	0.577																																					p.E67E		.											.	LBH	90	0			c.A201G						.						57.0	63.0	61.0					2																	30480370		2203	4300	6503	SO:0001819	synonymous_variant	81606	exon3			GGTGGAACCCACA	AF110224	CCDS33173.1	2p23.1	2012-12-07	2012-12-07		ENSG00000213626	ENSG00000213626			29532	protein-coding gene	gene with protein product		611763	"""limb bud and heart development homolog (mouse)"""			11230166, 11336496	Standard	NM_030915		Approved		uc002rne.2	Q53QV2	OTTHUMG00000152051	ENST00000395323.3:c.201A>G	2.37:g.30480370A>G		93.0	1.0		87.0	27.0	NM_030915	B2RBC2|Q9H0Q1	Silent	SNP	ENST00000395323.3	37	CCDS33173.1																																																																																			.		0.577	LBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325091.1	NM_030915	
LPHN1	22859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14271099	14271099	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr19:14271099C>T	ENST00000340736.6	-	9	1937	c.1640G>A	c.(1639-1641)gGg>gAg	p.G547E	CTB-55O6.12_ENST00000588387.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.G542E|CTB-55O6.12_ENST00000592086.1_RNA|LPHN1_ENST00000591528.1_5'Flank	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	547					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CGCGTTCTCCCCACTCTTGAT	0.667																																					p.G547E		.											.	LPHN1	523	0			c.G1640A						.						37.0	48.0	44.0					19																	14271099		2202	4300	6502	SO:0001583	missense	22859	exon9			TTCTCCCCACTCT	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.1640G>A	19.37:g.14271099C>T	ENSP00000340688:p.Gly547Glu	80.0	0.0		64.0	22.0	NM_001008701	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	37	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	C	18.66	3.672480	0.67928	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.12147	2.71;2.71	5.17	5.17	0.71159	Domain of unknown function DUF3497 (1);	0.000000	0.85682	D	0.000000	T	0.39911	0.1096	M	0.79475	2.455	0.80722	D	1	D;D	0.67145	0.989;0.996	D;D	0.76071	0.962;0.987	T	0.26916	-1.0089	10	0.87932	D	0	.	16.52	0.84311	0.0:1.0:0.0:0.0	.	542;547	O94910-2;O94910	.;LPHN1_HUMAN	E	547;542	ENSP00000340688:G547E;ENSP00000355328:G542E	ENSP00000340688:G547E	G	-	2	0	LPHN1	14132099	1.000000	0.71417	0.948000	0.38648	0.092000	0.18411	7.776000	0.85560	2.571000	0.86741	0.491000	0.48974	GGG	.		0.667	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
LRFN2	57497	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	40360309	40360309	+	Silent	SNP	G	G	A	rs147506870	byFrequency	TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr6:40360309G>A	ENST00000338305.6	-	3	2285	c.1743C>T	c.(1741-1743)ggC>ggT	p.G581G		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	581						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					GTGGCTGGGCGCCGTTGGTCT	0.677																																					p.G581G		.											.	LRFN2	93	0			c.C1743T						.			6,4398		0,6,2196	19.0	19.0	19.0		1743	1.6	0.2	6	dbSNP_134	19	0,8592		0,0,4296	no	coding-synonymous	LRFN2	NM_020737.1		0,6,6492	AA,AG,GG		0.0,0.1362,0.0462		581/790	40360309	6,12990	2202	4296	6498	SO:0001819	synonymous_variant	57497	exon3			CTGGGCGCCGTTG	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1743C>T	6.37:g.40360309G>A		26.0	0.0		26.0	9.0	NM_020737	A5PKU3|Q5SYP9	Silent	SNP	ENST00000338305.6	37	CCDS34443.1																																																																																			G|1.000;A|0.000		0.677	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372	
LRFN3	79414	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36431219	36431219	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr19:36431219G>A	ENST00000588831.1	+	3	1946	c.892G>A	c.(892-894)Gtg>Atg	p.V298M	LRFN3_ENST00000246529.3_Missense_Mutation_p.V298M			Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III domain containing 3	298	Ig-like.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	12	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GCCGCCCGTGGTGACTCACCG	0.731																																					p.V298M		.											.	LRFN3	90	0			c.G892A						.						8.0	9.0	9.0					19																	36431219		2044	4014	6058	SO:0001583	missense	79414	exon2			CCCGTGGTGACTC	BC003578	CCDS12483.1	19q13.13	2013-02-11				ENSG00000126243		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28370	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 1"""	612809				12975309, 16495444, 16828986	Standard	NM_024509		Approved	MGC2656, SALM4, FIGLER1	uc002oco.3	Q9BTN0		ENST00000588831.1:c.892G>A	19.37:g.36431219G>A	ENSP00000466989:p.Val298Met	28.0	0.0		25.0	7.0	NM_024509	Q6UY10	Missense_Mutation	SNP	ENST00000588831.1	37	CCDS12483.1	.	.	.	.	.	.	.	.	.	.	G	16.46	3.129974	0.56721	.	.	ENSG00000126243	ENST00000246529	T	0.68765	-0.35	4.97	3.93	0.45458	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.33290	N	0.005076	T	0.64875	0.2638	N	0.21097	0.63	0.39690	D	0.971038	D	0.54207	0.965	D	0.64321	0.924	T	0.67669	-0.5611	10	0.66056	D	0.02	.	6.6904	0.23167	0.1979:0.0:0.8021:0.0	.	298	Q9BTN0	LRFN3_HUMAN	M	298	ENSP00000246529:V298M	ENSP00000246529:V298M	V	+	1	0	LRFN3	41123059	1.000000	0.71417	1.000000	0.80357	0.623000	0.37688	6.949000	0.75971	2.299000	0.77371	0.460000	0.39030	GTG	.		0.731	LRFN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457403.2	NM_024509	
LRRC4C	57689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	40136207	40136207	+	Missense_Mutation	SNP	T	T	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr11:40136207T>C	ENST00000278198.2	-	2	3599	c.1636A>G	c.(1636-1638)Att>Gtt	p.I546V	LRRC4C_ENST00000528697.1_Missense_Mutation_p.I546V|LRRC4C_ENST00000527150.1_Missense_Mutation_p.I546V|LRRC4C_ENST00000530763.1_Missense_Mutation_p.I546V			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	546					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				TTGTAGAAAATGACCAGCATC	0.453																																					p.I546V		.											.	LRRC4C	521	0			c.A1636G						.						149.0	134.0	139.0					11																	40136207		2203	4300	6503	SO:0001583	missense	57689	exon7			AGAAAATGACCAG	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1636A>G	11.37:g.40136207T>C	ENSP00000278198:p.Ile546Val	99.0	0.0		93.0	24.0	NM_001258419	A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	37	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	T	0.644	-0.812120	0.02798	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.15349	0.0370	N	0.16307	0.4	0.58432	D	0.999999	B	0.11235	0.004	B	0.12156	0.007	T	0.06391	-1.0829	10	0.02654	T	1	.	15.6754	0.77316	0.0:0.0:0.0:1.0	.	546	Q9HCJ2	LRC4C_HUMAN	V	546	ENSP00000278198:I546V;ENSP00000436976:I546V;ENSP00000437132:I546V;ENSP00000434761:I546V	ENSP00000278198:I546V	I	-	1	0	LRRC4C	40092783	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.040000	0.89188	2.291000	0.77112	0.533000	0.62120	ATT	.		0.453	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929	
MANSC1	54682	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	12483617	12483617	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr12:12483617C>A	ENST00000535902.1	-	4	1203	c.640G>T	c.(640-642)Gaa>Taa	p.E214*	MANSC1_ENST00000545735.1_Nonsense_Mutation_p.E133*|MANSC1_ENST00000396349.3_Nonsense_Mutation_p.E180*			Q9H8J5	MANS1_HUMAN	MANSC domain containing 1	214						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|stomach(4)	23		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		TGAGCTATTTCTTGATCAGAG	0.483																																					p.E214X		.											.	MANSC1	90	0			c.G640T						.						94.0	98.0	96.0					12																	12483617		2203	4300	6503	SO:0001587	stop_gained	54682	exon4			CTATTTCTTGATC	AK001160	CCDS8648.1	12p13.2	2006-04-12				ENSG00000111261			25505	protein-coding gene	gene with protein product						12975309	Standard	NM_018050		Approved	FLJ10298, LOH12CR3	uc001rai.1	Q9H8J5		ENST00000535902.1:c.640G>T	12.37:g.12483617C>A	ENSP00000438205:p.Glu214*	90.0	0.0		94.0	32.0	NM_018050	Q8NEC1|Q9NW60	Nonsense_Mutation	SNP	ENST00000535902.1	37	CCDS8648.1	.	.	.	.	.	.	.	.	.	.	C	37	6.407185	0.97542	.	.	ENSG00000111261	ENST00000535902;ENST00000396349;ENST00000355566;ENST00000545735	.	.	.	5.03	-2.99	0.05497	.	1.727610	0.03237	N	0.179831	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-0.8017	5.7843	0.18324	0.0:0.3877:0.1432:0.469	.	.	.	.	X	214;180;133;133	.	ENSP00000347765:E133X	E	-	1	0	MANSC1	12374884	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.052000	0.11865	-0.566000	0.06054	0.491000	0.48974	GAA	.		0.483	MANSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400144.1	NM_018050	
MAP2	4133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	210594614	210594614	+	Silent	SNP	C	C	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr2:210594614C>T	ENST00000360351.4	+	14	5702	c.5196C>T	c.(5194-5196)ttC>ttT	p.F1732F	MAP2_ENST00000392194.1_Silent_p.F376F|MAP2_ENST00000447185.1_Silent_p.F1728F|MAP2_ENST00000199940.6_Silent_p.F464F|MAP2_ENST00000361559.4_Silent_p.F376F	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1732					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AACTAGATTTCAAAGAAAAGG	0.388																																					p.F1732F	Pancreas(27;423 979 28787 29963)	.											.	MAP2	591	0			c.C5196T						.						115.0	109.0	111.0					2																	210594614		2203	4300	6503	SO:0001819	synonymous_variant	4133	exon14			AGATTTCAAAGAA		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.5196C>T	2.37:g.210594614C>T		123.0	0.0		133.0	25.0	NM_002374	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	ENST00000360351.4	37	CCDS2384.1																																																																																			.		0.388	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
MTMR6	9107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	25842077	25842077	+	Missense_Mutation	SNP	T	T	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr13:25842077T>C	ENST00000381801.5	-	3	905	c.144A>G	c.(142-144)atA>atG	p.I48M	MTMR6_ENST00000540661.1_Missense_Mutation_p.I48M	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	48					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		GGTGGTGTAATATCTACAGCA	0.373																																					p.I48M		.											.	MTMR6	94	0			c.A144G						.						115.0	106.0	109.0					13																	25842077		2203	4300	6503	SO:0001583	missense	9107	exon3			GTGTAATATCTAC	AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.144A>G	13.37:g.25842077T>C	ENSP00000371221:p.Ile48Met	63.0	0.0		86.0	18.0	NM_004685	B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Missense_Mutation	SNP	ENST00000381801.5	37	CCDS9313.1	.	.	.	.	.	.	.	.	.	.	T	16.10	3.028241	0.54790	.	.	ENSG00000139505	ENST00000540661;ENST00000541021;ENST00000381801	D;D	0.84660	-1.88;-1.88	5.56	-0.333	0.12671	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.92041	0.7478	M	0.93283	3.4	0.54753	D	0.999984	D;D	0.76494	0.992;0.999	D;D	0.76071	0.983;0.987	D	0.89324	0.3642	10	0.87932	D	0	.	6.6463	0.22936	0.3425:0.0:0.2327:0.4248	.	48;48	Q9Y217;Q9Y217-2	MTMR6_HUMAN;.	M	48	ENSP00000443161:I48M;ENSP00000371221:I48M	ENSP00000371221:I48M	I	-	3	3	MTMR6	24740077	0.785000	0.28726	0.782000	0.31804	0.966000	0.64601	0.032000	0.13732	0.029000	0.15352	-0.480000	0.04831	ATA	.		0.373	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044225.1	NM_004685	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9074794	9074794	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr19:9074794G>A	ENST00000397910.4	-	3	12855	c.12652C>T	c.(12652-12654)Cct>Tct	p.P4218S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4220	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AAATTGGGAGGTAAACTTGTG	0.493																																					p.P4218S		.											.	MUC16	566	0			c.C12652T						.						78.0	74.0	75.0					19																	9074794		1942	4163	6105	SO:0001583	missense	94025	exon3			TGGGAGGTAAACT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.12652C>T	19.37:g.9074794G>A	ENSP00000381008:p.Pro4218Ser	141.0	0.0		128.0	31.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.003	-0.428953	0.04701	.	.	ENSG00000181143	ENST00000397910	T	0.18338	2.22	1.31	0.243	0.15503	.	.	.	.	.	T	0.11623	0.0283	L	0.36672	1.1	.	.	.	B	0.12013	0.005	B	0.09377	0.004	T	0.22173	-1.0224	8	0.87932	D	0	.	3.4538	0.07507	0.272:0.0:0.728:0.0	.	4218	B5ME49	.	S	4218	ENSP00000381008:P4218S	ENSP00000381008:P4218S	P	-	1	0	MUC16	8935794	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.814000	0.04486	0.118000	0.18165	0.313000	0.20887	CCT	.		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYOM1	8736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	3067314	3067314	+	Silent	SNP	C	C	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr18:3067314C>T	ENST00000356443.4	-	38	5337	c.5004G>A	c.(5002-5004)gaG>gaA	p.E1668E	MYOM1_ENST00000400569.3_Silent_p.E1668E|MYOM1_ENST00000261606.7_Silent_p.E1572E	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1668					muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TCCTCGCCTCCTCCTCTGGGA	0.612																																					p.E1668E		.											.	MYOM1	94	0			c.G5004A						.						32.0	38.0	36.0					18																	3067314		2200	4300	6500	SO:0001819	synonymous_variant	8736	exon38			CGCCTCCTCCTCT	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.5004G>A	18.37:g.3067314C>T		106.0	0.0		110.0	25.0	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Silent	SNP	ENST00000356443.4	37	CCDS45824.1																																																																																			.		0.612	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
NAA25	80018	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	112481516	112481516	+	Silent	SNP	G	G	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr12:112481516G>C	ENST00000261745.4	-	18	2411	c.2163C>G	c.(2161-2163)tcC>tcG	p.S721S		NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	721						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						CAATCCGGGAGGATACCCCAT	0.478																																					p.S721S		.											.	NAA25	155	0			c.C2163G						.						86.0	88.0	87.0					12																	112481516		2203	4300	6503	SO:0001819	synonymous_variant	80018	exon18			CCGGGAGGATACC	AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.2163C>G	12.37:g.112481516G>C		91.0	0.0		72.0	26.0	NM_024953	A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Silent	SNP	ENST00000261745.4	37	CCDS9159.1																																																																																			.		0.478	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405205.1	NM_024953	
NWD1	284434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	16918475	16918475	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr19:16918475C>T	ENST00000552788.1	+	16	3815	c.3815C>T	c.(3814-3816)aCg>aTg	p.T1272M	NWD1_ENST00000549814.1_Missense_Mutation_p.T1230M|NWD1_ENST00000523826.1_Missense_Mutation_p.T1066M|NWD1_ENST00000339803.6_Missense_Mutation_p.T1137M|NWD1_ENST00000379808.3_Missense_Mutation_p.T1272M|NWD1_ENST00000524140.2_Missense_Mutation_p.T1272M			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	1272							ATP binding (GO:0005524)	p.T1272M(1)|p.T1137M(1)		NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CTCCTATTTACGGGCCTCGTG	0.567																																					p.T1272M		.											.	NWD1	7	2	Substitution - Missense(2)	endometrium(2)	c.C3815T						.						81.0	84.0	83.0					19																	16918475		2203	4300	6503	SO:0001583	missense	284434	exon18			TATTTACGGGCCT	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.3815C>T	19.37:g.16918475C>T	ENSP00000447224:p.Thr1272Met	100.0	0.0		142.0	34.0	NM_001007525	C9J021|Q68CT3	Missense_Mutation	SNP	ENST00000552788.1	37		.	.	.	.	.	.	.	.	.	.	C	10.56	1.385067	0.25031	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.74002	-0.45;-0.8;-0.45;1.9;1.3;1.9	5.27	5.27	0.74061	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.411545	0.25964	N	0.027180	T	0.78444	0.4284	L	0.43152	1.355	0.09310	N	1	D;D;D	0.76494	0.998;0.999;0.998	P;D;P	0.63703	0.732;0.917;0.828	T	0.70741	-0.4789	10	0.72032	D	0.01	-10.5953	9.9171	0.41442	0.0:0.906:0.0:0.094	.	1272;1272;1137	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	M	1137;1272;1230;1272;1066;1272;1137	ENSP00000428579:T1272M;ENSP00000447548:T1230M;ENSP00000369136:T1272M;ENSP00000428955:T1066M;ENSP00000447224:T1272M;ENSP00000340159:T1137M	ENSP00000340159:T1137M	T	+	2	0	NWD1	16779475	0.047000	0.20315	0.014000	0.15608	0.005000	0.04900	2.135000	0.42112	2.457000	0.83068	0.655000	0.94253	ACG	.		0.567	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228560355	228560355	+	Silent	SNP	C	C	T	rs372263588		TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr1:228560355C>T	ENST00000422127.1	+	94	21920	c.21876C>T	c.(21874-21876)gcC>gcT	p.A7292A	OBSCN_ENST00000570156.2_Silent_p.A8249A|OBSCN_ENST00000366707.4_Silent_p.A4926A	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	7292					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CGGAGGCGGCCGACACAATAT	0.592																																					p.A8249A		.											.	OBSCN	403	0			c.C24747T						.	C		0,4028		0,0,2014	25.0	29.0	27.0		21876	-10.6	0.0	1		27	1,8331		0,1,4165	no	coding-synonymous	OBSCN	NM_001098623.1		0,1,6179	TT,TC,CC		0.012,0.0,0.0081		7292/7969	228560355	1,12359	2014	4166	6180	SO:0001819	synonymous_variant	84033	exon105			GGCGGCCGACACA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.21876C>T	1.37:g.228560355C>T		296.0	0.0		382.0	176.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	8.089	0.774173	0.16051	0.0	1.2E-4	ENSG00000154358	ENST00000441106	.	.	.	5.31	-10.6	0.00265	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.2076	0.15299	0.3201:0.4181:0.1221:0.1397	.	.	.	.	X	1909	.	.	R	+	1	2	OBSCN	226626978	0.000000	0.05858	0.002000	0.10522	0.129000	0.20672	-5.329000	0.00131	-5.289000	0.00017	-1.579000	0.00862	CGA	.		0.592	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR51E2	81285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4703454	4703454	+	Missense_Mutation	SNP	T	T	G			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr11:4703454T>G	ENST00000396950.3	-	2	727	c.488A>C	c.(487-489)aAg>aCg	p.K163T		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	163					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		GGCCAGCCGCTTGATCAGCAG	0.532																																					p.K163T		.											.	OR51E2	502	0			c.A488C						.						74.0	72.0	73.0					11																	4703454		2201	4298	6499	SO:0001583	missense	81285	exon2			AGCCGCTTGATCA	AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.488A>C	11.37:g.4703454T>G	ENSP00000380153:p.Lys163Thr	70.0	0.0		97.0	24.0	NM_030774	B2RA63|Q6IF94	Missense_Mutation	SNP	ENST00000396950.3	37	CCDS7751.1	.	.	.	.	.	.	.	.	.	.	T	14.28	2.488814	0.44249	.	.	ENSG00000167332	ENST00000396950	T	0.00058	8.79	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.134424	0.33610	N	0.004723	T	0.00300	0.0009	M	0.81112	2.525	0.28552	N	0.911585	P	0.41546	0.754	P	0.48141	0.568	T	0.18524	-1.0334	10	0.52906	T	0.07	.	11.0275	0.47753	0.0:0.0:0.0:1.0	.	163	Q9H255	O51E2_HUMAN	T	163	ENSP00000380153:K163T	ENSP00000380153:K163T	K	-	2	0	OR51E2	4660030	0.000000	0.05858	0.932000	0.37286	0.475000	0.33008	-0.327000	0.07955	2.112000	0.64535	0.533000	0.62120	AAG	.		0.532	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774	
PAX1	5075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	21687274	21687274	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr20:21687274C>T	ENST00000398485.2	+	2	539	c.485C>T	c.(484-486)cCc>cTc	p.P162L	PAX1_ENST00000460221.1_Intron|PAX1_ENST00000444366.2_Missense_Mutation_p.P138L	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	162	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						TCCATTCTGCCCGGGGCCATC	0.647																																					p.P162L		.											.	PAX1	227	0			c.C485T						.						49.0	53.0	51.0					20																	21687274		2203	4299	6502	SO:0001583	missense	5075	exon2			TTCTGCCCGGGGC		CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.485C>T	20.37:g.21687274C>T	ENSP00000381499:p.Pro162Leu	42.0	0.0		52.0	20.0	NM_006192	B4E0D6|Q642X9|Q6NTC0|Q9Y558	Missense_Mutation	SNP	ENST00000398485.2	37	CCDS13146.2	.	.	.	.	.	.	.	.	.	.	C	16.08	3.021041	0.54576	.	.	ENSG00000125813	ENST00000398485;ENST00000444366	D;D	0.99709	-6.48;-6.48	5.39	3.43	0.39272	Paired box protein, N-terminal (4);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99732	0.9895	H	0.94925	3.6	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.956	D	0.98276	1.0506	10	0.87932	D	0	.	10.031	0.42101	0.1378:0.7901:0.0:0.0721	.	138;68;162	P15863-2;C9J775;P15863	.;.;PAX1_HUMAN	L	162;138	ENSP00000381499:P162L;ENSP00000410355:P138L	ENSP00000381499:P162L	P	+	2	0	PAX1	21635274	1.000000	0.71417	0.987000	0.45799	0.016000	0.09150	7.653000	0.83643	0.642000	0.30620	0.655000	0.94253	CCC	.		0.647	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078282.3		
PBX2	5089	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32156140	32156140	+	Missense_Mutation	SNP	G	G	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr6:32156140G>C	ENST00000375050.4	-	3	707	c.437C>G	c.(436-438)tCt>tGt	p.S146C	XXbac-BPG300A18.13_ENST00000559458.1_RNA	NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	146					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						ACCACCACCAGAGGCTGCAGC	0.597																																					p.S146C		.											.	PBX2	91	0			c.C437G						.						47.0	53.0	51.0					6																	32156140		2203	4300	6503	SO:0001583	missense	5089	exon3			CCACCAGAGGCTG		CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.437C>G	6.37:g.32156140G>C	ENSP00000364190:p.Ser146Cys	59.0	0.0		57.0	16.0	NM_002586	A2BFJ2	Missense_Mutation	SNP	ENST00000375050.4	37	CCDS4748.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.776810	0.70107	.	.	ENSG00000204304	ENST00000375050	D	0.89552	-2.53	5.02	5.02	0.67125	PBX (1);	0.000000	0.64402	D	0.000013	D	0.90696	0.7081	L	0.50333	1.59	0.80722	D	1	D;D	0.62365	0.984;0.991	P;D	0.64506	0.886;0.926	D	0.91871	0.5507	10	0.72032	D	0.01	-1.7648	15.8313	0.78752	0.0:0.0:1.0:0.0	.	146;146	Q7KZE5;P40425	.;PBX2_HUMAN	C	146	ENSP00000364190:S146C	ENSP00000364190:S146C	S	-	2	0	PBX2	32264118	1.000000	0.71417	0.978000	0.43139	0.504000	0.33889	5.878000	0.69682	2.327000	0.79052	0.561000	0.74099	TCT	.		0.597	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076194.4		
PDHA2	5161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	96761797	96761797	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr4:96761797G>A	ENST00000295266.4	+	1	559	c.496G>A	c.(496-498)Ggt>Agt	p.G166S		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	166					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		TGGCATCGTCGGTGCACAGGG	0.507																																					p.G166S		.											.	PDHA2	90	0			c.G496A						.						67.0	70.0	69.0					4																	96761797		2203	4300	6503	SO:0001583	missense	5161	exon1			ATCGTCGGTGCAC		CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.496G>A	4.37:g.96761797G>A	ENSP00000295266:p.Gly166Ser	71.0	0.0		75.0	22.0	NM_005390	B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	ENST00000295266.4	37	CCDS3644.1	.	.	.	.	.	.	.	.	.	.	G	16.81	3.226337	0.58668	.	.	ENSG00000163114	ENST00000295266	D	0.98381	-4.9	4.67	4.67	0.58626	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.99111	0.9694	M	0.92970	3.365	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.99091	1.0840	10	0.87932	D	0	-13.8878	15.4624	0.75369	0.0:0.0:1.0:0.0	.	166	P29803	ODPAT_HUMAN	S	166	ENSP00000295266:G166S	ENSP00000295266:G166S	G	+	1	0	PDHA2	96980820	1.000000	0.71417	0.170000	0.22879	0.038000	0.13279	6.965000	0.76067	2.587000	0.87381	0.467000	0.42956	GGT	.		0.507	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253608.1		
PDZD2	23037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	32089543	32089543	+	Missense_Mutation	SNP	A	A	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr5:32089543A>T	ENST00000438447.1	+	20	6377	c.5989A>T	c.(5989-5991)Atg>Ttg	p.M1997L	PDZD2_ENST00000282493.3_Missense_Mutation_p.M1997L			O15018	PDZD2_HUMAN	PDZ domain containing 2	1997					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TGAGCAAGGCATGTGGAGCAG	0.587																																					p.M1997L		.											.	PDZD2	563	0			c.A5989T						.						113.0	111.0	112.0					5																	32089543		2203	4300	6503	SO:0001583	missense	23037	exon19			CAAGGCATGTGGA	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.5989A>T	5.37:g.32089543A>T	ENSP00000402033:p.Met1997Leu	43.0	0.0		48.0	13.0	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	A	7.550	0.662443	0.14645	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.05382	3.45;3.45	3.86	-2.28	0.06826	.	1.089650	0.07116	N	0.843028	T	0.02929	0.0087	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46275	-0.9203	10	0.07482	T	0.82	.	4.2959	0.10901	0.5079:0.0:0.3255:0.1666	.	1997	O15018	PDZD2_HUMAN	L	1997;1798;1997	ENSP00000402033:M1997L;ENSP00000282493:M1997L	ENSP00000282493:M1997L	M	+	1	0	PDZD2	32125300	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.405000	0.07196	-0.560000	0.06102	-0.802000	0.03209	ATG	.		0.587	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
JADE1	79960	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	129792900	129792900	+	Missense_Mutation	SNP	G	G	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr4:129792900G>C	ENST00000226319.6	+	11	2292	c.2012G>C	c.(2011-2013)gGa>gCa	p.G671A	PHF17_ENST00000452328.2_Missense_Mutation_p.G659A|PHF17_ENST00000512960.1_Missense_Mutation_p.G671A	NM_199320.2	NP_955352.1														NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CTCATTAAAGGAGACTTAAAG	0.458																																					p.G671A		.											.	PHF17	90	0			c.G2012C						.						66.0	65.0	65.0					4																	129792900		2203	4300	6503	SO:0001583	missense	79960	exon11			TTAAAGGAGACTT																												ENST00000226319.6:c.2012G>C	4.37:g.129792900G>C	ENSP00000226319:p.Gly671Ala	171.0	1.0		186.0	65.0	NM_199320		Missense_Mutation	SNP	ENST00000226319.6	37	CCDS34062.1	.	.	.	.	.	.	.	.	.	.	G	6.444	0.449998	0.12223	.	.	ENSG00000077684	ENST00000226319;ENST00000452328;ENST00000512960;ENST00000535321	T;T;T	0.37058	1.22;1.22;1.22	4.59	4.59	0.56863	.	0.336121	0.31624	N	0.007328	T	0.21103	0.0508	N	0.24115	0.695	0.80722	D	1	B;B	0.25667	0.114;0.131	B;B	0.22386	0.033;0.039	T	0.07065	-1.0792	9	.	.	.	.	7.8733	0.29578	0.0:0.1612:0.5631:0.2756	.	659;671	Q6IE81-2;Q6IE81	.;JADE1_HUMAN	A	671;659;671;671	ENSP00000226319:G671A;ENSP00000388015:G659A;ENSP00000425730:G671A	.	G	+	2	0	PHF17	130012350	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.544000	0.36158	2.542000	0.85734	0.655000	0.94253	GGA	.		0.458	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1		
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	51523772	51523772	+	Missense_Mutation	SNP	A	A	G			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr6:51523772A>G	ENST00000371117.3	-	61	11427	c.11152T>C	c.(11152-11154)Tca>Cca	p.S3718P		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3718					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					ACTCCCTTTGACTGAGTAACT	0.393																																					p.S3718P		.											.	PKHD1	603	0			c.T11152C						.						113.0	112.0	113.0					6																	51523772		2203	4300	6503	SO:0001583	missense	5314	exon61			CCTTTGACTGAGT	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.11152T>C	6.37:g.51523772A>G	ENSP00000360158:p.Ser3718Pro	81.0	0.0		74.0	13.0	NM_138694	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	A	8.722	0.914653	0.17907	.	.	ENSG00000170927	ENST00000371117	D	0.85702	-2.02	5.56	-1.23	0.09465	.	0.530450	0.18404	N	0.142280	T	0.53012	0.1770	L	0.33485	1.01	0.58432	D	0.999999	B	0.10296	0.003	B	0.06405	0.002	T	0.52711	-0.8539	10	0.02654	T	1	.	11.2078	0.48780	0.3946:0.0:0.6054:0.0	.	3718	P08F94	PKHD1_HUMAN	P	3718	ENSP00000360158:S3718P	ENSP00000360158:S3718P	S	-	1	0	PKHD1	51631731	0.116000	0.22171	0.161000	0.22692	0.930000	0.56654	-0.085000	0.11250	-0.190000	0.10465	-0.408000	0.06270	TCA	.		0.393	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
PLEKHA5	54477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	19285332	19285332	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr12:19285332C>T	ENST00000299275.6	+	3	181	c.175C>T	c.(175-177)Cct>Tct	p.P59S	PLEKHA5_ENST00000540972.1_Missense_Mutation_p.P59S|PLEKHA5_ENST00000359180.3_Missense_Mutation_p.P59S|PLEKHA5_ENST00000317589.4_Missense_Mutation_p.P59S|PLEKHA5_ENST00000539256.1_5'UTR|PLEKHA5_ENST00000429027.2_Missense_Mutation_p.P59S|PLEKHA5_ENST00000309364.4_Missense_Mutation_p.P59S|PLEKHA5_ENST00000538714.1_Missense_Mutation_p.P59S|PLEKHA5_ENST00000355397.3_Missense_Mutation_p.P59S	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	59	WW 2. {ECO:0000255|PROSITE- ProRule:PRU00224}.				reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					TTTAGATTTGCCTACTGGCTG	0.284																																					p.P59S	Pancreas(196;329 2193 11246 14234 19524)	.											.	PLEKHA5	227	0			c.C175T						.						105.0	107.0	106.0					12																	19285332		2203	4298	6501	SO:0001583	missense	54477	exon3			GATTTGCCTACTG	AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.175C>T	12.37:g.19285332C>T	ENSP00000299275:p.Pro59Ser	98.0	0.0		99.0	24.0	NM_001143821	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Missense_Mutation	SNP	ENST00000299275.6	37	CCDS8682.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.321850	0.81580	.	.	ENSG00000052126	ENST00000317589;ENST00000355397;ENST00000359180;ENST00000542828;ENST00000309364;ENST00000412219;ENST00000540972;ENST00000429027;ENST00000299275;ENST00000538714	D;D;D;D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36	4.8	4.8	0.61643	WW/Rsp5/WWP (3);	0.354218	0.20979	N	0.082251	D	0.94905	0.8353	M	0.87038	2.855	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.95324	0.8423	10	0.87932	D	0	-8.9638	15.0659	0.71996	0.0:1.0:0.0:0.0	.	59;59;59	B4DHK5;Q9HAU0;Q9HAU0-2	.;PKHA5_HUMAN;.	S	59	ENSP00000325155:P59S;ENSP00000347560:P59S;ENSP00000352104:P59S;ENSP00000311239:P59S;ENSP00000404296:P59S;ENSP00000299275:P59S;ENSP00000439673:P59S	ENSP00000299275:P59S	P	+	1	0	PLEKHA5	19176599	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.407000	0.73280	2.656000	0.90262	0.557000	0.71058	CCT	.		0.284	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	
PLXNB2	23654	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	50728375	50728379	+	Frame_Shift_Del	DEL	GGTGG	GGTGG	-			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	GGTGG	GGTGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr22:50728375_50728379delGGTGG	ENST00000449103.1	-	3	775_779	c.635_639delCCACC	c.(634-639)tccaccfs	p.ST212fs	PLXNB2_ENST00000359337.4_Frame_Shift_Del_p.ST212fs			O15031	PLXB2_HUMAN	plexin B2	212	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GCTGTGTGTTGGTGGACAGGTAGCC	0.624																																					p.212_213del		.											.	PLXNB2	211	0			c.635_639del						.																																			SO:0001589	frameshift_variant	23654	exon3			TGTGTTGGTGGAC		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.635_639delCCACC	22.37:g.50728375_50728379delGGTGG	ENSP00000409171:p.Ser212fs	106.0	0.0		71.0	16.0	NM_012401	A6QRH0|Q7KZU3|Q9BSU7	Frame_Shift_Del	DEL	ENST00000449103.1	37	CCDS43035.1																																																																																			.		0.624	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
PLXNB2	23654	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	50728381	50728387	+	Frame_Shift_Del	DEL	CAGGTAG	CAGGTAG	-			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	CAGGTAG	CAGGTAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr22:50728381_50728387delCAGGTAG	ENST00000449103.1	-	3	767_773	c.627_633delCTACCTG	c.(625-633)ggctacctgfs	p.GYL209fs	PLXNB2_ENST00000359337.4_Frame_Shift_Del_p.GYL209fs			O15031	PLXB2_HUMAN	plexin B2	209	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGTTGGTGGACAGGTAGCCGGCCTTGT	0.623																																					p.209_211del		.											.	PLXNB2	211	0			c.627_633del						.																																			SO:0001589	frameshift_variant	23654	exon3			GGTGGACAGGTAG		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.627_633delCTACCTG	22.37:g.50728381_50728387delCAGGTAG	ENSP00000409171:p.Gly209fs	109.0	0.0		66.0	15.0	NM_012401	A6QRH0|Q7KZU3|Q9BSU7	Frame_Shift_Del	DEL	ENST00000449103.1	37	CCDS43035.1																																																																																			.		0.623	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
POU3F2	5454	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	99283906	99283906	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr6:99283906delC	ENST00000328345.5	+	1	1327	c.1157delC	c.(1156-1158)tccfs	p.S386fs		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	386					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		GAGATCACCTCCCTCGCGGAC	0.577																																					p.S386fs		.											.	POU3F2	90	0			c.1157delC						.						53.0	61.0	58.0					6																	99283906		2203	4300	6503	SO:0001589	frameshift_variant	5454	exon1			TCACCTCCCTCGC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.1157delC	6.37:g.99283906delC	ENSP00000329170:p.Ser386fs	81.0	0.0		110.0	29.0	NM_005604	Q14960|Q86V54|Q9UJL0	Frame_Shift_Del	DEL	ENST00000328345.5	37	CCDS5040.1																																																																																			.		0.577	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
PPP2R1B	5519	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	111636082	111636082	+	Silent	SNP	T	T	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr11:111636082T>C	ENST00000527614.1	-	2	206	c.141A>G	c.(139-141)ttA>ttG	p.L47L	PPP2R1B_ENST00000393055.2_Silent_p.L47L|PPP2R1B_ENST00000311129.5_Silent_p.L47L|PPP2R1B_ENST00000426998.2_Intron|PPP2R1B_ENST00000341980.6_Silent_p.L47L|PPP2R1B_ENST00000427203.2_5'UTR	NM_001177562.1|NM_002716.4	NP_001171033.1|NP_002707.3	P30154	2AAB_HUMAN	protein phosphatase 2, regulatory subunit A, beta	47					apoptotic process involved in morphogenesis (GO:0060561)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)	extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|liver(1)|lung(10)|prostate(1)|urinary_tract(2)	22		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		CAATTGTTGATAACTTCTTAA	0.368																																					p.L47L		.											.	PPP2R1B	658	0			c.A141G						.						110.0	110.0	110.0					11																	111636082		2201	4297	6498	SO:0001819	synonymous_variant	5519	exon2			TGTTGATAACTTC	AF087438	CCDS8348.1, CCDS8349.1, CCDS53706.1, CCDS53707.1, CCDS53708.1	11q23.1	2010-06-18	2010-04-14		ENSG00000137713	ENSG00000137713	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9303	protein-coding gene	gene with protein product	"""PP2A-A-beta"", ""protein phosphatase 2A, regulatory subunit A, beta isoform"""	603113	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform"""			2159327, 9795170	Standard	NM_181699		Approved	PR65B, PP2A-Abeta	uc001plw.1	P30154	OTTHUMG00000166741	ENST00000527614.1:c.141A>G	11.37:g.111636082T>C		111.0	0.0		101.0	17.0	NM_001177562	A8MY67|B0YJ69|B4DGQ6|B4DK91|B4DWW5|F8W8G1|O75620|Q8NHV8	Silent	SNP	ENST00000527614.1	37	CCDS8349.1																																																																																			.		0.368	PPP2R1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391298.1	NM_002716	
PPT1	5538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	40539787	40539787	+	Silent	SNP	A	A	G			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr1:40539787A>G	ENST00000433473.3	-	9	1331	c.867T>C	c.(865-867)caT>caC	p.H289H	PPT1_ENST00000372775.2_5'UTR|PPT1_ENST00000530076.1_Silent_p.H70H|PPT1_ENST00000449045.2_Silent_p.H186H	NM_000310.3	NP_000301.1	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1	289					adult locomotory behavior (GO:0008344)|associative learning (GO:0008306)|brain development (GO:0007420)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cofactor metabolic process (GO:0051186)|cofactor transport (GO:0051181)|grooming behavior (GO:0007625)|lipid catabolic process (GO:0016042)|lysosomal lumen acidification (GO:0007042)|membrane raft organization (GO:0031579)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neuron development (GO:0048666)|neurotransmitter secretion (GO:0007269)|pinocytosis (GO:0006907)|positive regulation of pinocytosis (GO:0048549)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein catabolic process (GO:0030163)|protein depalmitoylation (GO:0002084)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|regulation of phospholipase A2 activity (GO:0032429)|regulation of synapse structure and activity (GO:0050803)|sphingolipid catabolic process (GO:0030149)|visual perception (GO:0007601)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	palmitoyl-(protein) hydrolase activity (GO:0008474)|palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(5)|large_intestine(1)|lung(3)|ovary(1)|stomach(1)	11	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACAACTGAAGATGGTCCCCTT	0.458																																					p.H289H		.											.	PPT1	91	0			c.T867C						.						154.0	144.0	148.0					1																	40539787		2203	4300	6503	SO:0001819	synonymous_variant	5538	exon9			CTGAAGATGGTCC	U44772	CCDS447.1, CCDS44119.1	1p32	2014-09-17	2008-07-31		ENSG00000131238	ENSG00000131238	3.1.2.22		9325	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 1, infantile"""	600722		PPT		7637805, 8325646	Standard	NM_000310		Approved	CLN1, INCL	uc001cfb.2	P50897	OTTHUMG00000004495	ENST00000433473.3:c.867T>C	1.37:g.40539787A>G		83.0	0.0		78.0	16.0	NM_000310	B4DY24|Q6FGQ4	Silent	SNP	ENST00000433473.3	37	CCDS447.1																																																																																			.		0.458	PPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013126.2	NM_000310	
PRKAA1	5562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	40762932	40762932	+	Missense_Mutation	SNP	G	G	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr5:40762932G>T	ENST00000397128.2	-	9	1636	c.1628C>A	c.(1627-1629)aCa>aAa	p.T543K	PRKAA1_ENST00000354209.3_Missense_Mutation_p.T558K	NM_006251.5|NM_206907.3	NP_006242.5|NP_996790.3	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic subunit	543					activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to glucose starvation (GO:0042149)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|cold acclimation (GO:0009631)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|fatty acid oxidation (GO:0019395)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of glucosylceramide biosynthetic process (GO:0046318)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of gene expression (GO:0010628)|positive regulation of glycolytic process (GO:0045821)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of transcription, DNA-templated (GO:0006355)|regulation of vesicle-mediated transport (GO:0060627)|response to activity (GO:0014823)|response to caffeine (GO:0031000)|response to camptothecin (GO:1901563)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	AMP-activated protein kinase complex (GO:0031588)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|tau-protein kinase activity (GO:0050321)			breast(1)	1					Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	AAATTCTATTGTGTGACTTCC	0.368																																					p.T558K		.											.	PRKAA1	792	0			c.C1673A						.						69.0	67.0	67.0					5																	40762932		1836	4095	5931	SO:0001583	missense	5562	exon10			TCTATTGTGTGAC		CCDS3932.2, CCDS3933.2	5p13.1	2012-10-03			ENSG00000132356	ENSG00000132356			9376	protein-coding gene	gene with protein product	"""AMPK, alpha, 1"""	602739				8557660	Standard	XM_006714481		Approved	AMPKa1	uc003jmb.3	Q13131	OTTHUMG00000162269	ENST00000397128.2:c.1628C>A	5.37:g.40762932G>T	ENSP00000380317:p.Thr543Lys	153.0	0.0		116.0	25.0	NM_206907	A8MTQ6|B2R7E1|O00286|Q5D0E1|Q86VS1|Q9UNQ4	Missense_Mutation	SNP	ENST00000397128.2	37	CCDS3932.2	.	.	.	.	.	.	.	.	.	.	G	28.9	4.961707	0.92791	.	.	ENSG00000132356	ENST00000397128;ENST00000354209	T;T	0.76060	-0.89;-0.99	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.85826	0.5787	L	0.61218	1.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.85873	0.1417	10	0.87932	D	0	-20.0768	20.3465	0.98790	0.0:0.0:1.0:0.0	.	543;558	Q13131;Q13131-2	AAPK1_HUMAN;.	K	543;558	ENSP00000380317:T543K;ENSP00000346148:T558K	ENSP00000346148:T558K	T	-	2	0	AC008810.1	40798689	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.660000	0.83776	2.798000	0.96311	0.655000	0.94253	ACA	.		0.368	PRKAA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253833.2	NM_006251	
PRELID1	27166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176732936	176732936	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr5:176732936G>A	ENST00000303204.4	+	3	595	c.383G>A	c.(382-384)cGg>cAg	p.R128Q	RAB24_ENST00000393611.2_5'Flank|RAB24_ENST00000303270.6_5'Flank|PRELID1_ENST00000503216.1_Missense_Mutation_p.R128Q|RAB24_ENST00000303251.6_5'Flank|MXD3_ENST00000427908.2_3'UTR			Q9Y255	PRLD1_HUMAN	PRELI domain containing 1	128	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				apoptotic process (GO:0006915)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mitochondrial membrane potential (GO:0010917)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of cellular respiration (GO:1901857)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of T cell apoptotic process (GO:0070234)|regulation of membrane lipid distribution (GO:0097035)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of T cell differentiation (GO:0045580)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(1)|kidney(2)|lung(2)|prostate(1)|stomach(1)	7	all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAAATCCGCCGGGAAGCCTGG	0.552																																					p.R128Q		.											.	PRELID1	90	0			c.G383A						.						85.0	80.0	81.0					5																	176732936		2203	4300	6503	SO:0001583	missense	27166	exon3			TCCGCCGGGAAGC	BC013748	CCDS4415.1, CCDS64328.1	5q35.3	2010-01-18			ENSG00000169230	ENSG00000169230			30255	protein-coding gene	gene with protein product	"""protein of relevant evolutionary and lymphoid interest"", ""px19-like protein"""	605733				10784606, 14640972	Standard	NM_013237		Approved	CGI-106, PX19, PRELI	uc003mfx.4	Q9Y255	OTTHUMG00000130847	ENST00000303204.4:c.383G>A	5.37:g.176732936G>A	ENSP00000302114:p.Arg128Gln	70.0	0.0		53.0	12.0	NM_013237	B2R5F7|D6RD25|Q549N2|Q9UI13|Q9UJS9	Missense_Mutation	SNP	ENST00000303204.4	37	CCDS4415.1	.	.	.	.	.	.	.	.	.	.	G	35	5.496477	0.96355	.	.	ENSG00000169230	ENST00000303204;ENST00000503216	T;T	0.12147	2.71;2.71	4.48	4.48	0.54585	PRELI/MSF1 (2);	0.056777	0.64402	D	0.000001	T	0.24431	0.0592	L	0.39245	1.2	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.985;0.989	T	0.01781	-1.1275	10	0.02654	T	1	-11.7669	17.3571	0.87340	0.0:0.0:1.0:0.0	.	128;128	D6RD25;Q9Y255	.;PRLD1_HUMAN	Q	128	ENSP00000302114:R128Q;ENSP00000427097:R128Q	ENSP00000302114:R128Q	R	+	2	0	PRELID1	176665542	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.257000	0.78362	2.332000	0.79248	0.561000	0.74099	CGG	.		0.552	PRELID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253414.1	NM_013237	
PRPF4B	8899	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	4032471	4032471	+	Silent	SNP	A	A	G			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr6:4032471A>G	ENST00000337659.6	+	2	820	c.720A>G	c.(718-720)aaA>aaG	p.K240K	PRPF4B_ENST00000538861.1_Silent_p.K226K	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	240	Arg/Lys-rich (basic).				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				GGAAATCAAAATCCCCTACCC	0.358																																					p.K240K		.											.	PRPF4B	1308	0			c.A720G						.						132.0	144.0	140.0					6																	4032471		2203	4300	6503	SO:0001819	synonymous_variant	8899	exon2			ATCAAAATCCCCT	U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.720A>G	6.37:g.4032471A>G		152.0	0.0		178.0	47.0	NM_003913	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Silent	SNP	ENST00000337659.6	37	CCDS4488.1																																																																																			.		0.358	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314018.2		
PSD	5662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	104173644	104173644	+	Missense_Mutation	SNP	T	T	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr10:104173644T>C	ENST00000020673.5	-	5	1961	c.1435A>G	c.(1435-1437)Aca>Gca	p.T479A	PSD_ENST00000406432.1_Missense_Mutation_p.T479A|PSD_ENST00000492902.2_5'Flank	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	479					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		CCTCTCTGTGTCCAAGGACCA	0.677																																					p.T479A		.											.	PSD	272	0			c.A1435G						.						32.0	37.0	36.0					10																	104173644		2203	4300	6503	SO:0001583	missense	5662	exon6			TCTGTGTCCAAGG	X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.1435A>G	10.37:g.104173644T>C	ENSP00000020673:p.Thr479Ala	172.0	0.0		160.0	19.0	NM_001270965	B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	ENST00000020673.5	37	CCDS31272.1	.	.	.	.	.	.	.	.	.	.	T	14.68	2.607718	0.46527	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.19394	2.15;2.15	4.65	4.65	0.58169	.	.	.	.	.	T	0.14184	0.0343	N	0.24115	0.695	0.24261	N	0.995286	B	0.19817	0.039	B	0.16722	0.016	T	0.17961	-1.0352	9	0.08179	T	0.78	.	14.1315	0.65257	0.0:0.0:0.0:1.0	.	479	A5PKW4	PSD1_HUMAN	A	479;382;479	ENSP00000020673:T479A;ENSP00000384830:T479A	ENSP00000020673:T479A	T	-	1	0	PSD	104163634	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.511000	0.53400	1.749000	0.51849	0.374000	0.22700	ACA	.		0.677	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050041.2		
PXK	54899	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	58383369	58383369	+	Nonsense_Mutation	SNP	T	T	G			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr3:58383369T>G	ENST00000356151.2	+	11	1131	c.1022T>G	c.(1021-1023)tTa>tGa	p.L341*	PXK_ENST00000484288.1_Nonsense_Mutation_p.L341*|PXK_ENST00000383715.4_Nonsense_Mutation_p.L324*|PXK_ENST00000536660.1_Nonsense_Mutation_p.L204*|PXK_ENST00000463280.1_Nonsense_Mutation_p.L308*|PXK_ENST00000383716.3_Nonsense_Mutation_p.L308*|PXK_ENST00000479241.1_Nonsense_Mutation_p.L324*|PXK_ENST00000302779.5_Nonsense_Mutation_p.L324*	NM_017771.3	NP_060241.2			PX domain containing serine/threonine kinase											cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000249)|KIRC - Kidney renal clear cell carcinoma(10;0.00346)|Kidney(10;0.00368)|OV - Ovarian serous cystadenocarcinoma(275;0.22)		TTTGGCCACTTACTGTATGAA	0.552																																					p.L341X		.											.	PXK	334	0			c.T1022G						.						228.0	207.0	214.0					3																	58383369		2203	4300	6503	SO:0001587	stop_gained	54899	exon11			GCCACTTACTGTA	AY274811	CCDS2889.1, CCDS74952.1, CCDS74954.1, CCDS74955.1	3p21.2	2008-02-05			ENSG00000168297	ENSG00000168297			23326	protein-coding gene	gene with protein product		611450					Standard	XM_005265255		Approved	FLJ20335	uc003djz.1	Q7Z7A4	OTTHUMG00000159149	ENST00000356151.2:c.1022T>G	3.37:g.58383369T>G	ENSP00000348472:p.Leu341*	124.0	0.0		98.0	28.0	NM_017771		Nonsense_Mutation	SNP	ENST00000356151.2	37	CCDS2889.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	38|38	6.889215|6.889215	0.97912|0.97912	.|.	.|.	ENSG00000168297|ENSG00000168297	ENST00000356151;ENST00000302779;ENST00000383716;ENST00000463280;ENST00000383715;ENST00000484288;ENST00000479241;ENST00000536660;ENST00000536750|ENST00000479134	.|.	.|.	.|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.068230|.	0.64402|.	D|.	0.000009|.	.|T	.|0.71567	.|0.3355	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73786	.|-0.3873	.|3	0.02654|.	T|.	1|.	-10.2912|-10.2912	15.8062|15.8062	0.78513|0.78513	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	X|D	341;324;308;308;324;341;324;204;204|96	.|.	ENSP00000305045:L324X|.	L|Y	+|+	2|1	0|0	PXK|PXK	58358409|58358409	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.960000|0.960000	0.62799|0.62799	5.472000|5.472000	0.66768|0.66768	2.317000|2.317000	0.78254|0.78254	0.460000|0.460000	0.39030|0.39030	TTA|TAC	.		0.552	PXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353499.1	NM_017771	
RAG1	5896	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	36597509	36597509	+	Silent	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr11:36597509G>A	ENST00000299440.5	+	2	2767	c.2655G>A	c.(2653-2655)ctG>ctA	p.L885L		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	885			L -> R (in OS; dbSNP:rs199474691). {ECO:0000269|PubMed:10606976}.		adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				TGAGGGAGCTGATGGATCTTT	0.488									Familial Hemophagocytic Lymphohistiocytosis																												p.L885L	Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	.											.	RAG1	230	0			c.G2655A						.						151.0	143.0	146.0					11																	36597509		2202	4298	6500	SO:0001819	synonymous_variant	5896	exon2	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	GGAGCTGATGGAT	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.2655G>A	11.37:g.36597509G>A		60.0	0.0		74.0	29.0	NM_000448	E9PPC4|Q8IY72|Q8NER2	Silent	SNP	ENST00000299440.5	37	CCDS7902.1																																																																																			.		0.488	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389535.1	NM_000448	
RIMBP2	23504	broad.mit.edu;bcgsc.ca	37	12	130935855	130935855	+	Missense_Mutation	SNP	G	G	A	rs113895223	byFrequency	TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr12:130935855G>A	ENST00000261655.4	-	5	501	c.338C>T	c.(337-339)gCg>gTg	p.A113V	RIMBP2_ENST00000535703.1_Missense_Mutation_p.A21V|RIMBP2_ENST00000536002.1_Missense_Mutation_p.A21V	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	113					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TTCACCGATCGCAGAGCTGCC	0.552																																					p.A113V		.											.	RIMBP2	142	0			c.C338T						.						50.0	47.0	48.0					12																	130935855		2203	4300	6503	SO:0001583	missense	23504	exon5			CCGATCGCAGAGC	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.338C>T	12.37:g.130935855G>A	ENSP00000261655:p.Ala113Val	100.0	1.0		77.0	25.0	NM_015347	Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.643462	0.00792	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.18960	2.18;3.05;3.05	3.95	1.44	0.22558	.	0.694331	0.12931	N	0.427382	T	0.04497	0.0123	N	0.00648	-1.295	0.20196	N	0.999929	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.0	T	0.41161	-0.9524	10	0.02654	T	1	-4.6275	6.2131	0.20640	0.7681:0.0:0.2319:0.0	.	21;113	O15034-2;O15034	.;RIMB2_HUMAN	V	113;21;21;21	ENSP00000261655:A113V;ENSP00000440347:A21V;ENSP00000439159:A21V	ENSP00000261655:A113V	A	-	2	0	RIMBP2	129501808	0.916000	0.31088	0.009000	0.14445	0.005000	0.04900	0.918000	0.28678	-0.007000	0.14345	0.561000	0.74099	GCG	G|0.500;A|0.500		0.552	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
RUSC1	23623	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	1	155292686	155292686	+	Silent	SNP	C	C	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr1:155292686C>A	ENST00000368352.5	+	2	1273	c.1122C>A	c.(1120-1122)ctC>ctA	p.L374L	RUSC1_ENST00000368347.4_5'Flank|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1_ENST00000368349.4_5'Flank|RUSC1-AS1_ENST00000543656.1_RNA|RUSC1_ENST00000292254.4_5'Flank|RUSC1-AS1_ENST00000446880.1_RNA|RUSC1_ENST00000368354.3_Silent_p.L374L|RUSC1-AS1_ENST00000450199.1_RNA	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1	374					positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			TCAAGGAACTCCGGTCCCGAA	0.731																																					p.L374L		.											.	RUSC1	92	0			c.C1122A						.						9.0	11.0	10.0					1																	155292686		1765	3994	5759	SO:0001819	synonymous_variant	23623	exon2			GGAACTCCGGTCC	AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.1122C>A	1.37:g.155292686C>A		99.0	0.0		131.0	38.0	NM_001105203	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Silent	SNP	ENST00000368352.5	37	CCDS41410.1																																																																																			.		0.731	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039071.1		
SCN7A	6332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	167298065	167298065	+	Silent	SNP	G	G	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr2:167298065G>T	ENST00000409855.1	-	14	2124	c.1998C>A	c.(1996-1998)ctC>ctA	p.L666L		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	666					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	GCCAGCGTGGGAGTTGACAGT	0.448																																					p.L666L		.											.	SCN7A	67	0			c.C1998A						.						119.0	124.0	122.0					2																	167298065		2203	4300	6503	SO:0001819	synonymous_variant	6332	exon14			GCGTGGGAGTTGA	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1998C>A	2.37:g.167298065G>T		204.0	0.0		247.0	82.0	NM_002976		Silent	SNP	ENST00000409855.1	37	CCDS46442.1																																																																																			.		0.448	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
SPNS1	83985	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	16	28995279	28995279	+	Splice_Site	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr16:28995279G>A	ENST00000311008.11	+	11	1869		c.e11+1		LAT_ENST00000354453.4_5'Flank|LAT_ENST00000395456.2_5'Flank|SPNS1_ENST00000323081.8_Splice_Site|SPNS1_ENST00000352260.7_Splice_Site|SPNS1_ENST00000334536.8_Splice_Site|LAT_ENST00000564277.1_5'Flank|LAT_ENST00000454369.2_5'Flank|LAT_ENST00000360872.5_5'Flank|LAT_ENST00000395461.3_5'Flank|LAT_ENST00000566177.1_5'Flank|RP11-264B17.3_ENST00000569969.1_RNA|SPNS1_ENST00000565975.1_Splice_Site	NM_032038.2	NP_114427.1	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 (Drosophila)						lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrial inner membrane (GO:0005743)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)|urinary_tract(1)	21						CACGTGCAGGGTCAGTTAGGA	0.647																																					.		.											.	SPNS1	90	0			c.1492+1G>A						.						23.0	25.0	24.0					16																	28995279		2192	4292	6484	SO:0001630	splice_region_variant	83985	exon11			TGCAGGGTCAGTT	BC006156	CCDS10646.1, CCDS45452.1, CCDS45453.1, CCDS45454.1	16p11.2	2007-04-12			ENSG00000169682	ENSG00000169682			30621	protein-coding gene	gene with protein product		612583				11340170, 12815463	Standard	NM_032038		Approved	HSpin1, nrs, SPINL, PP2030, SPIN1, LAT	uc010vdi.1	Q9H2V7	OTTHUMG00000131762	ENST00000311008.11:c.1492+1G>A	16.37:g.28995279G>A		11.0	0.0		18.0	6.0	NM_032038	B5MDM9|Q6P182|Q71RB5|Q7L541|Q86VU7|Q8N953|Q8TCS5|Q9BRN5	Splice_Site	SNP	ENST00000311008.11	37	CCDS10646.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.698045	0.48307	.	.	ENSG00000169682	ENST00000311008;ENST00000334536;ENST00000352260;ENST00000323081	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3031	0.73969	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SPNS1	28902780	1.000000	0.71417	1.000000	0.80357	0.519000	0.34347	5.893000	0.69798	2.470000	0.83445	0.655000	0.94253	.	.		0.647	SPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254690.2	NM_032038	Intron
ST6GALNAC1	55808	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	74625607	74625607	+	Missense_Mutation	SNP	C	C	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr17:74625607C>A	ENST00000156626.7	-	2	517	c.318G>T	c.(316-318)caG>caT	p.Q106H	ST6GALNAC1_ENST00000590878.1_5'UTR	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	106					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						CCGGCGGTGCCTGGTTGGCCT	0.577																																					p.Q106H		.											.	ST6GALNAC1	90	0			c.G318T						.						133.0	121.0	125.0					17																	74625607		2203	4300	6503	SO:0001583	missense	55808	exon2			CGGTGCCTGGTTG	Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.318G>T	17.37:g.74625607C>A	ENSP00000156626:p.Gln106His	167.0	0.0		170.0	47.0	NM_018414	Q6UW90|Q9NSC6	Missense_Mutation	SNP	ENST00000156626.7	37	CCDS11748.1	.	.	.	.	.	.	.	.	.	.	C	9.919	1.211733	0.22289	.	.	ENSG00000070526	ENST00000156626;ENST00000359088	T;T	0.25085	1.86;1.82	4.04	1.98	0.26296	.	3.353760	0.00792	N	0.001352	T	0.18964	0.0455	N	0.22421	0.69	0.09310	N	1	P	0.36944	0.574	B	0.31751	0.135	T	0.24693	-1.0153	10	0.59425	D	0.04	-0.0411	7.1483	0.25595	0.0:0.7762:0.0:0.2238	.	106	Q9NSC7	SIA7A_HUMAN	H	106	ENSP00000156626:Q106H;ENSP00000351991:Q106H	ENSP00000156626:Q106H	Q	-	3	2	ST6GALNAC1	72137202	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.736000	0.26130	0.421000	0.25980	0.491000	0.48974	CAG	.		0.577	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450974.1	NM_018414	
ST8SIA4	7903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	100147642	100147642	+	Missense_Mutation	SNP	G	G	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr5:100147642G>T	ENST00000231461.5	-	5	1299	c.989C>A	c.(988-990)cCt>cAt	p.P330H		NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	330					axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		CATTCTGTGAGGGCTTGCATT	0.348																																					p.P330H		.											.	ST8SIA4	153	0			c.C989A						.						126.0	115.0	119.0					5																	100147642		2203	4300	6503	SO:0001583	missense	7903	exon5			CTGTGAGGGCTTG	L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.989C>A	5.37:g.100147642G>T	ENSP00000231461:p.Pro330His	108.0	0.0		88.0	21.0	NM_005668	A8KA07|G3V104|Q8N1F4|Q92693	Missense_Mutation	SNP	ENST00000231461.5	37	CCDS4091.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.316374	0.81469	.	.	ENSG00000113532	ENST00000231461	T	0.29397	1.57	5.62	5.62	0.85841	.	0.126814	0.53938	D	0.000057	T	0.34890	0.0913	L	0.61036	1.89	0.80722	D	1	B	0.33103	0.397	B	0.35240	0.198	T	0.09143	-1.0688	10	0.15499	T	0.54	-4.8664	18.6327	0.91366	0.0:0.0:1.0:0.0	.	330	Q92187	SIA8D_HUMAN	H	330	ENSP00000231461:P330H	ENSP00000231461:P330H	P	-	2	0	ST8SIA4	100175541	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.827000	0.99397	2.646000	0.89796	0.655000	0.94253	CCT	.		0.348	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250632.3	NM_005668	
STK32A	202374	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	146752851	146752851	+	Silent	SNP	T	T	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr5:146752851T>C	ENST00000397936.3	+	10	1230	c.897T>C	c.(895-897)atT>atC	p.I299I	STK32A_ENST00000398523.3_Silent_p.I299I	NM_001112724.1	NP_001106195.1	Q8WU08	ST32A_HUMAN	serine/threonine kinase 32A	299							ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGTTTCATTCCTAATGTGA	0.408																																					p.I299I		.											.	STK32A	521	0			c.T897C						.						78.0	70.0	73.0					5																	146752851		1568	3582	5150	SO:0001819	synonymous_variant	202374	exon10			TTTCATTCCTAAT		CCDS47299.1, CCDS75351.1	5q32	2008-02-05			ENSG00000169302	ENSG00000169302			28317	protein-coding gene	gene with protein product						12477932	Standard	NM_001112724		Approved	MGC22688, YANK1	uc010jgn.1	Q8WU08	OTTHUMG00000163411	ENST00000397936.3:c.897T>C	5.37:g.146752851T>C		72.0	0.0		95.0	38.0	NM_001112724	B3KSY0	Silent	SNP	ENST00000397936.3	37	CCDS47299.1																																																																																			.		0.408	STK32A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373306.1	NM_145001	
SYT7	9066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	61323666	61323666	+	Silent	SNP	G	G	A	rs547867914		TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr11:61323666G>A	ENST00000263846.4	-	2	372	c.45C>T	c.(43-45)cgC>cgT	p.R15R	SYT7_ENST00000539008.1_Silent_p.R15R|SYT7_ENST00000542670.1_Silent_p.R15R|SYT7_ENST00000540677.1_Silent_p.R15R|SYT7_ENST00000535826.1_Silent_p.R15R|SYT7_ENST00000542836.1_Silent_p.R15R	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	15					exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GCAGGACGTCGCGCGAGGGCG	0.657													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18141	0.0		0.0	False		,,,				2504	0.0				p.R15R		.											.	SYT7	94	0			c.C45T						.						67.0	58.0	61.0					11																	61323666		2202	4299	6501	SO:0001819	synonymous_variant	9066	exon2			GACGTCGCGCGAG	AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.45C>T	11.37:g.61323666G>A		78.0	0.0		85.0	20.0	NM_001252065	F5GZU9|Q08AH6	Silent	SNP	ENST00000263846.4	37	CCDS31577.1																																																																																			.		0.657	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398733.1	NM_004200	
TEX15	56154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	30694575	30694575	+	Silent	SNP	C	C	A	rs547808449		TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr8:30694575C>A	ENST00000256246.2	-	3	8150	c.8076G>T	c.(8074-8076)ggG>ggT	p.G2692G		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	2692					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TGGTCAACAGCCCAGAAGGAG	0.453													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21606	0.0		0.0	False		,,,				2504	0.0				p.G2692G		.											.	TEX15	97	0			c.G8076T						.						133.0	128.0	129.0					8																	30694575		2203	4300	6503	SO:0001819	synonymous_variant	56154	exon3			CAACAGCCCAGAA	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.8076G>T	8.37:g.30694575C>A		109.0	0.0		121.0	40.0	NM_031271		Silent	SNP	ENST00000256246.2	37	CCDS6080.1																																																																																			.		0.453	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
TGS1	96764	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	56698309	56698309	+	Silent	SNP	T	T	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr8:56698309T>C	ENST00000260129.5	+	3	675	c.198T>C	c.(196-198)ggT>ggC	p.G66G		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	66					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			AGGAAGGTGGTTATTCCTGTG	0.413																																					p.G66G	Esophageal Squamous(34;275 823 4842 34837 48447)	.											.	TGS1	227	0			c.T198C						.						132.0	120.0	124.0					8																	56698309		2203	4300	6503	SO:0001819	synonymous_variant	96764	exon3			AGGTGGTTATTCC	AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.198T>C	8.37:g.56698309T>C		161.0	0.0		209.0	57.0	NM_024831	A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Silent	SNP	ENST00000260129.5	37	CCDS34894.1																																																																																			.		0.413	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378152.1	NM_024831	
TLK1	9874	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	171853223	171853223	+	Silent	SNP	T	T	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr2:171853223T>C	ENST00000431350.2	-	20	2468	c.2064A>G	c.(2062-2064)acA>acG	p.T688T	TLK1_ENST00000521943.1_Silent_p.T640T|TLK1_ENST00000434911.2_Silent_p.T592T|TLK1_ENST00000442919.2_Silent_p.T640T|TLK1_ENST00000360843.3_Silent_p.T709T			Q9UKI8	TLK1_HUMAN	tousled-like kinase 1	688	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|intracellular protein transport (GO:0006886)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|liver(3)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						CTTTTAATATTGTATTTTCTT	0.299																																					p.T688T		.											.	TLK1	439	0			c.A2064G						.						95.0	99.0	98.0					2																	171853223		2203	4300	6503	SO:0001819	synonymous_variant	9874	exon20			TAATATTGTATTT	AB004885	CCDS2241.1, CCDS46447.1, CCDS46448.1	2q31.1	2010-04-19			ENSG00000198586	ENSG00000198586			11841	protein-coding gene	gene with protein product		608438				9427565, 12660173	Standard	NM_012290		Approved	KIAA0137, PKU-BETA	uc002ugp.2	Q9UKI8	OTTHUMG00000132243	ENST00000431350.2:c.2064A>G	2.37:g.171853223T>C		59.0	0.0		65.0	12.0	NM_012290	B3KR15|B4DX87|Q14150|Q8N591|Q9NYH2|Q9Y4F6	Silent	SNP	ENST00000431350.2	37	CCDS2241.1																																																																																			.		0.299	TLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255314.1	NM_012290	
TLK2	11011	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	60637386	60637386	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr17:60637386G>A	ENST00000326270.9	+	10	998	c.730G>A	c.(730-732)Gat>Aat	p.D244N	TLK2_ENST00000582809.1_Missense_Mutation_p.D95N|TLK2_ENST00000346027.5_Missense_Mutation_p.D244N|TLK2_ENST00000542523.1_Missense_Mutation_p.D212N|TLK2_ENST00000343388.7_Missense_Mutation_p.D212N	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	244					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						GGCCAACTGTGATTTGAGACG	0.328																																					p.D244N		.											.	TLK2	464	0			c.G730A						.						42.0	43.0	43.0					17																	60637386		2203	4297	6500	SO:0001583	missense	11011	exon10			AACTGTGATTTGA	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.730G>A	17.37:g.60637386G>A	ENSP00000316512:p.Asp244Asn	442.0	0.0		450.0	116.0	NM_006852	D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	ENST00000326270.9	37		.	.	.	.	.	.	.	.	.	.	G	16.56	3.158107	0.57368	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.67599	0.2910	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.89917	1.0;0.984;0.967;0.998	D;P;P;D	0.91635	0.999;0.879;0.879;0.954	T	0.71265	-0.4644	10	0.87932	D	0	.	17.1608	0.86803	0.0:0.0:1.0:0.0	.	244;212;244;244	Q86UE8;Q86UE8-3;Q86UE8-2;D3DU05	TLK2_HUMAN;.;.;.	N	244;212;244;212	ENSP00000275780:D244N;ENSP00000340800:D212N;ENSP00000316512:D244N;ENSP00000442311:D212N	ENSP00000316512:D244N	D	+	1	0	TLK2	57991118	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.504000	0.97986	2.593000	0.87608	0.655000	0.94253	GAT	.		0.328	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1	NM_006852	
TMPRSS11D	9407	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	68693206	68693206	+	Missense_Mutation	SNP	G	G	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr4:68693206G>T	ENST00000283916.6	-	8	823	c.725C>A	c.(724-726)tCt>tAt	p.S242Y	TMPRSS11D_ENST00000545541.1_Missense_Mutation_p.S125Y|UBA6-AS1_ENST00000500538.2_RNA	NM_004262.2	NP_004253.1	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	242	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)|respiratory gaseous exchange (GO:0007585)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						GGAAATACCAGACGTGGCAAT	0.308																																					p.S242Y		.											.	TMPRSS11D	91	0			c.C725A						.						42.0	41.0	41.0					4																	68693206		2203	4299	6502	SO:0001583	missense	9407	exon8			ATACCAGACGTGG	AB002134	CCDS3518.1	4q13.2	2010-04-13			ENSG00000153802	ENSG00000153802		"""Serine peptidases / Transmembrane"""	24059	protein-coding gene	gene with protein product	"""airway trypsin like protease"""	605369				9565616, 9070615	Standard	XM_005265710		Approved		uc003hdq.3	O60235	OTTHUMG00000129300	ENST00000283916.6:c.725C>A	4.37:g.68693206G>T	ENSP00000283916:p.Ser242Tyr	107.0	1.0		131.0	44.0	NM_004262	Q08AF6	Missense_Mutation	SNP	ENST00000283916.6	37	CCDS3518.1	.	.	.	.	.	.	.	.	.	.	G	8.170	0.791473	0.16258	.	.	ENSG00000153802	ENST00000283916;ENST00000545541	D;D	0.88741	-2.42;-2.42	5.58	4.4	0.53042	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.102760	0.43919	D	0.000512	T	0.75406	0.3845	N	0.05078	-0.115	0.21416	N	0.999696	B	0.02656	0.0	B	0.01281	0.0	T	0.64292	-0.6442	10	0.41790	T	0.15	.	8.8098	0.34961	0.9138:0.0:0.0862:0.0	.	242	O60235	TM11D_HUMAN	Y	242;125	ENSP00000283916:S242Y;ENSP00000442045:S125Y	ENSP00000283916:S242Y	S	-	2	0	TMPRSS11D	68375801	1.000000	0.71417	0.998000	0.56505	0.060000	0.15804	3.641000	0.54360	1.032000	0.39892	-0.294000	0.09567	TCT	.		0.308	TMPRSS11D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251430.3	NM_004262	
TMEM192	201931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	166000907	166000907	+	Missense_Mutation	SNP	T	T	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr4:166000907T>A	ENST00000306480.6	-	6	864	c.719A>T	c.(718-720)gAc>gTc	p.D240V	TMEM192_ENST00000506087.1_Missense_Mutation_p.D236V	NM_001100389.1	NP_001093859.1	Q8IY95	TM192_HUMAN	transmembrane protein 192	240						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0926)		TTCAATGGTGTCTCCTTGCTT	0.423																																					p.D240V		.											.	TMEM192	69	0			c.A719T						.						122.0	113.0	116.0					4																	166000907		1902	4127	6029	SO:0001583	missense	201931	exon6			ATGGTGTCTCCTT	BC036301	CCDS43279.1	4q32.3	2008-04-22			ENSG00000170088	ENSG00000170088			26775	protein-coding gene	gene with protein product						12477932	Standard	NM_001100389		Approved	FLJ38482	uc003iqz.4	Q8IY95	OTTHUMG00000161254	ENST00000306480.6:c.719A>T	4.37:g.166000907T>A	ENSP00000305069:p.Asp240Val	73.0	0.0		97.0	37.0	NM_001100389	Q7Z3A1|Q8N928	Missense_Mutation	SNP	ENST00000306480.6	37	CCDS43279.1	.	.	.	.	.	.	.	.	.	.	T	18.90	3.722608	0.68959	.	.	ENSG00000170088	ENST00000306480;ENST00000506087	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.80232	0.4585	M	0.83012	2.62	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81595	-0.0861	9	0.48119	T	0.1	-31.8821	14.3903	0.66973	0.0:0.0:0.0:1.0	.	240	Q8IY95	TM192_HUMAN	V	240;236	.	ENSP00000305069:D240V	D	-	2	0	TMEM192	166220357	1.000000	0.71417	0.999000	0.59377	0.620000	0.37586	5.164000	0.64954	2.287000	0.76781	0.482000	0.46254	GAC	.		0.423	TMEM192-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364310.3	NM_152681	
TRAPPC9	83696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	141370238	141370238	+	Missense_Mutation	SNP	T	T	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr8:141370238T>C	ENST00000438773.2	-	9	1539	c.1406A>G	c.(1405-1407)tAc>tGc	p.Y469C	TRAPPC9_ENST00000389328.4_Missense_Mutation_p.Y567C|TRAPPC9_ENST00000389327.3_Missense_Mutation_p.Y460C	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	469					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						TCGGGAGGCGTAGACCAATTC	0.547																																					p.Y567C		.											.	TRAPPC9	228	0			c.A1700G						.						90.0	80.0	83.0					8																	141370238		2203	4300	6503	SO:0001583	missense	83696	exon9			GAGGCGTAGACCA	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.1406A>G	8.37:g.141370238T>C	ENSP00000405060:p.Tyr469Cys	92.0	0.0		116.0	13.0	NM_031466	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	ENST00000438773.2	37	CCDS55278.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.158619	0.78226	.	.	ENSG00000167632	ENST00000389328;ENST00000389327;ENST00000438773	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.69940	0.3167	L	0.47716	1.5	0.58432	D	0.999991	D;D;D	0.89917	1.0;0.996;0.999	D;D;D	0.75484	0.986;0.918;0.951	T	0.71364	-0.4615	9	0.52906	T	0.07	.	15.4136	0.74945	0.0:0.0:0.0:1.0	.	469;460;567	Q96Q05;Q96Q05-3;Q96Q05-2	TPPC9_HUMAN;.;.	C	567;460;469	.	ENSP00000373978:Y460C	Y	-	2	0	TRAPPC9	141439420	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.803000	0.85983	2.054000	0.61138	0.533000	0.62120	TAC	.		0.547	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466	
TSPAN8	7103	broad.mit.edu;ucsc.edu	37	12	71537963	71537963	+	Missense_Mutation	SNP	T	T	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr12:71537963T>C	ENST00000393330.2	-	6	643	c.91A>G	c.(91-93)Ata>Gta	p.I31V	TSPAN8_ENST00000546561.1_Missense_Mutation_p.I31V|TSPAN8_ENST00000247829.3_Missense_Mutation_p.I31V|TSPAN8_ENST00000552786.1_5'UTR			P19075	TSN8_HUMAN	tetraspanin 8	31					negative regulation of blood coagulation (GO:0030195)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(2)|kidney(1)|large_intestine(3)|lung(7)|skin(3)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(43;0.24)|OV - Ovarian serous cystadenocarcinoma(12;0.244)			CGTACCCATATTGCTAATGCT	0.338																																					p.I31V		.											.	TSPAN8	93	0			c.A91G						.						131.0	118.0	122.0					12																	71537963		2203	4300	6503	SO:0001583	missense	7103	exon3			CCCATATTGCTAA	M35252	CCDS8999.1	12q14.1-q21.1	2013-02-14	2005-03-21	2005-03-21		ENSG00000127324		"""Tetraspanins"""	11855	protein-coding gene	gene with protein product		600769	"""transmembrane 4 superfamily member 3"""	TM4SF3		2395876	Standard	NM_004616		Approved	CO-029	uc001swj.1	P19075		ENST00000393330.2:c.91A>G	12.37:g.71537963T>C	ENSP00000377003:p.Ile31Val	39.0	0.0		33.0	4.0	NM_004616	B2R7T7|Q9BS78	Missense_Mutation	SNP	ENST00000393330.2	37	CCDS8999.1	.	.	.	.	.	.	.	.	.	.	T	13.89	2.371444	0.42003	.	.	ENSG00000127324	ENST00000393330;ENST00000247829;ENST00000546561	T;T;T	0.78924	-1.22;-1.22;-1.22	5.37	4.22	0.49857	.	0.047884	0.85682	D	0.000000	T	0.79879	0.4522	L	0.60455	1.87	0.80722	D	1	D	0.57571	0.98	P	0.59889	0.865	T	0.75249	-0.3384	10	0.14656	T	0.56	.	8.9627	0.35856	0.0:0.0872:0.0:0.9128	.	31	P19075	TSN8_HUMAN	V	31	ENSP00000377003:I31V;ENSP00000247829:I31V;ENSP00000447160:I31V	ENSP00000247829:I31V	I	-	1	0	TSPAN8	69824230	0.999000	0.42202	0.874000	0.34290	0.124000	0.20399	2.188000	0.42612	2.164000	0.68074	0.533000	0.62120	ATA	.		0.338	TSPAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404737.1	NM_004616	
TTC16	158248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	130489325	130489325	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr9:130489325C>T	ENST00000373289.3	+	11	1582	c.1502C>T	c.(1501-1503)gCc>gTc	p.A501V	TTC16_ENST00000489226.1_3'UTR|PTRH1_ENST00000419060.1_5'Flank|PTRH1_ENST00000429848.1_5'Flank	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	501										central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						GCCCACCTGGCCAGGCTGCAG	0.652																																					p.A501V		.											.	TTC16	90	0			c.C1502T						.						39.0	40.0	40.0					9																	130489325		2203	4300	6503	SO:0001583	missense	158248	exon11			ACCTGGCCAGGCT	AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.1502C>T	9.37:g.130489325C>T	ENSP00000362386:p.Ala501Val	43.0	0.0		49.0	18.0	NM_144965	B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	ENST00000373289.3	37	CCDS6875.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.049540	0.75846	.	.	ENSG00000167094	ENST00000373289;ENST00000373288	T	0.19394	2.15	5.9	5.9	0.94986	.	0.208186	0.33854	N	0.004482	T	0.37019	0.0988	L	0.54323	1.7	0.80722	D	1	D;D	0.69078	0.997;0.997	P;P	0.56751	0.805;0.805	T	0.00681	-1.1612	10	0.32370	T	0.25	-24.4927	17.8179	0.88640	0.0:1.0:0.0:0.0	.	488;501	B4DZ42;Q8NEE8	.;TTC16_HUMAN	V	501;279	ENSP00000362386:A501V	ENSP00000362385:A279V	A	+	2	0	TTC16	129529146	0.999000	0.42202	0.960000	0.40013	0.212000	0.24457	4.444000	0.60001	2.811000	0.96726	0.555000	0.69702	GCC	.		0.652	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054224.1	NM_144965	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179438088	179438088	+	Silent	SNP	A	A	G			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr2:179438088A>G	ENST00000591111.1	-	276	68072	c.67848T>C	c.(67846-67848)taT>taC	p.Y22616Y	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Silent_p.Y15384Y|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Silent_p.Y15317Y|TTN_ENST00000460472.2_Silent_p.Y15192Y|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Silent_p.Y24257Y|TTN_ENST00000342992.6_Silent_p.Y21689Y|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22616	Fibronectin type-III 64. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTCCACAATATAATTGATGA	0.408																																					p.Y24257Y		.											.	TTN	636	0			c.T72771C						.						73.0	72.0	72.0					2																	179438088		1918	4136	6054	SO:0001819	synonymous_variant	7273	exon326			CACAATATAATTG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.67848T>C	2.37:g.179438088A>G		65.0	0.0		63.0	17.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				.		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TULP1	7287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	35471363	35471363	+	Silent	SNP	G	G	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr6:35471363G>A	ENST00000229771.6	-	13	1375	c.1296C>T	c.(1294-1296)aaC>aaT	p.N432N	TULP1_ENST00000322263.4_Silent_p.N379N	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	432					dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						GGACCCTCTCGTTCTCCGCAC	0.622																																					p.N432N	GBM(55;1027 1091 11115 23439)	.											.	TULP1	92	0			c.C1296T						.						20.0	20.0	20.0					6																	35471363		2200	4296	6496	SO:0001819	synonymous_variant	7287	exon13			CCTCTCGTTCTCC	U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.1296C>T	6.37:g.35471363G>A		81.0	0.0		73.0	10.0	NM_003322	O43536|Q5TGM5|Q8N571	Silent	SNP	ENST00000229771.6	37	CCDS4807.1																																																																																			.		0.622	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040307.2		
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	215932021	215932021	+	Missense_Mutation	SNP	T	T	A			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr1:215932021T>A	ENST00000307340.3	-	58	11691	c.11305A>T	c.(11305-11307)Atg>Ttg	p.M3769L	USH2A_ENST00000366943.2_Missense_Mutation_p.M3769L	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3769	Fibronectin type-III 22. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGTGTTGACATAGGTGTTTGA	0.333										HNSCC(13;0.011)																											p.M3769L		.											.	USH2A	115	0			c.A11305T						.						174.0	173.0	173.0					1																	215932021		2203	4300	6503	SO:0001583	missense	7399	exon58			TTGACATAGGTGT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11305A>T	1.37:g.215932021T>A	ENSP00000305941:p.Met3769Leu	81.0	0.0		125.0	18.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	5.979	0.364568	0.11296	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.52057	0.68;0.68	5.9	-8.63	0.00878	Fibronectin, type III (1);Immunoglobulin-like fold (1);	2.808690	0.01404	N	0.013724	T	0.17109	0.0411	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21930	-1.0231	10	0.09843	T	0.71	.	1.637	0.02744	0.1762:0.1496:0.257:0.4172	.	3769	O75445	USH2A_HUMAN	L	3769	ENSP00000305941:M3769L;ENSP00000355910:M3769L	ENSP00000305941:M3769L	M	-	1	0	USH2A	213998644	0.000000	0.05858	0.000000	0.03702	0.181000	0.23173	-2.366000	0.01078	-2.241000	0.00709	-0.480000	0.04831	ATG	.		0.333	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
USP20	10868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	132632793	132632793	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr9:132632793C>T	ENST00000315480.4	+	15	1785	c.1627C>T	c.(1627-1629)Ctt>Ttt	p.L543F	USP20_ENST00000358355.1_Missense_Mutation_p.L543F|USP20_ENST00000372429.3_Missense_Mutation_p.L543F			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	543	USP.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				GGAAGACTGCCTTGCTGCCTT	0.617																																					p.L543F		.											.	USP20	658	0			c.C1627T						.						93.0	95.0	94.0					9																	132632793		2004	4165	6169	SO:0001583	missense	10868	exon15			GACTGCCTTGCTG	AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.1627C>T	9.37:g.132632793C>T	ENSP00000313811:p.Leu543Phe	88.0	0.0		90.0	21.0	NM_001008563	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Missense_Mutation	SNP	ENST00000315480.4	37	CCDS43892.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.288985	0.59976	.	.	ENSG00000136878	ENST00000372429;ENST00000315480;ENST00000358355	T;T;T	0.09350	2.99;2.99;2.99	5.36	5.36	0.76844	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.21307	0.0513	M	0.63428	1.95	0.80722	D	1	P	0.36199	0.543	B	0.43658	0.426	T	0.00518	-1.1693	10	0.46703	T	0.11	.	18.4511	0.90704	0.0:1.0:0.0:0.0	.	543	Q9Y2K6	UBP20_HUMAN	F	543	ENSP00000361506:L543F;ENSP00000313811:L543F;ENSP00000351122:L543F	ENSP00000313811:L543F	L	+	1	0	USP20	131672614	1.000000	0.71417	0.993000	0.49108	0.288000	0.27193	5.736000	0.68597	2.666000	0.90696	0.655000	0.94253	CTT	.		0.617	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054604.2		
VARS2	57176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	30893707	30893707	+	Silent	SNP	C	C	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr6:30893707C>T	ENST00000321897.5	+	28	3644	c.3012C>T	c.(3010-3012)taC>taT	p.Y1004Y	VARS2_ENST00000542001.1_Silent_p.Y864Y|VARS2_ENST00000416670.2_Silent_p.Y1004Y|VARS2_ENST00000476162.1_3'UTR|VARS2_ENST00000541562.1_Silent_p.Y1034Y			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	1004					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						CCCGAAGGTACAAGTTGCAGA	0.612																																					p.Y1034Y		.											.	VARS2	26	0			c.C3102T						.						76.0	75.0	75.0					6																	30893707		1509	2709	4218	SO:0001819	synonymous_variant	57176	exon29			AAGGTACAAGTTG	AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.3012C>T	6.37:g.30893707C>T		151.0	0.0		147.0	59.0	NM_001167734	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Silent	SNP	ENST00000321897.5	37	CCDS34387.1																																																																																			.		0.612	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442	
WFDC1	58189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	84358060	84358060	+	Missense_Mutation	SNP	T	T	C			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr16:84358060T>C	ENST00000219454.5	+	5	924	c.598T>C	c.(598-600)Tat>Cat	p.Y200H	WFDC1_ENST00000568638.1_Missense_Mutation_p.Y200H	NM_001282466.1|NM_001282467.1	NP_001269395.1|NP_001269396.1	Q9HC57	WFDC1_HUMAN	WAP four-disulfide core domain 1	200					negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|response to drug (GO:0042493)|response to estradiol (GO:0032355)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)	9						TTACAAAGAATATCCAGGTAA	0.368																																					p.Y200H		.											.	WFDC1	153	0			c.T598C						.						100.0	99.0	99.0					16																	84358060		2200	4300	6500	SO:0001583	missense	58189	exon5			AAAGAATATCCAG	AF302109	CCDS10946.1	16q24.1	2013-01-21			ENSG00000103175	ENSG00000103175		"""WAP four-disulfide core domain containing"""	15466	protein-coding gene	gene with protein product		605322				10967136	Standard	NM_021197		Approved	PS20	uc002fhw.3	Q9HC57	OTTHUMG00000137641	ENST00000219454.5:c.598T>C	16.37:g.84358060T>C	ENSP00000219454:p.Tyr200His	83.0	0.0		79.0	23.0	NM_021197	D3DUL7|Q8NC27|Q9HAU1	Missense_Mutation	SNP	ENST00000219454.5	37	CCDS10946.1	.	.	.	.	.	.	.	.	.	.	T	10.34	1.324302	0.24080	.	.	ENSG00000103175	ENST00000219454	T	0.33654	1.4	4.55	2.12	0.27331	.	0.151761	0.45606	N	0.000347	T	0.20941	0.0504	L	0.29908	0.895	0.44492	D	0.99743	B	0.12013	0.005	B	0.12156	0.007	T	0.09930	-1.0652	10	0.49607	T	0.09	-8.9944	2.49	0.04607	0.1478:0.0893:0.1521:0.6108	.	200	Q9HC57	WFDC1_HUMAN	H	200	ENSP00000219454:Y200H	ENSP00000219454:Y200H	Y	+	1	0	WFDC1	82915561	0.980000	0.34600	0.955000	0.39395	0.448000	0.32197	1.051000	0.30417	0.883000	0.36040	0.528000	0.53228	TAT	.		0.368	WFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269083.2		
XPNPEP3	63929	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	41320402	41320416	+	In_Frame_Del	DEL	TACCTCGGGATGGAT	TACCTCGGGATGGAT	-			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	TACCTCGGGATGGAT	TACCTCGGGATGGAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr22:41320402_41320416delTACCTCGGGATGGAT	ENST00000357137.4	+	9	1357_1371	c.1273_1287delTACCTCGGGATGGAT	c.(1273-1287)tacctcgggatggatdel	p.YLGMD425del	XPNPEP3_ENST00000544094.1_In_Frame_Del_p.YLGMD402del	NM_022098.3	NP_071381.1	Q9NQH7	XPP3_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 3, putative	425					glomerular filtration (GO:0003094)|protein processing (GO:0016485)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metallopeptidase activity (GO:0008237)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	17						TGTTGGCCACTACCTCGGGATGGATGTCCATGACA	0.488																																					p.425_429del	Ovarian(145;306 1841 7037 21878 30110)	.											.	XPNPEP3	68	0			c.1273_1287del						.																																			SO:0001651	inframe_deletion	63929	exon9			GGCCACTACCTCG		CCDS14007.1, CCDS74869.1	22q13.2	2010-07-20			ENSG00000196236	ENSG00000196236			28052	protein-coding gene	gene with protein product		613553				15708373, 20179356	Standard	NM_022098		Approved	APP3, NPHPL1	uc003azh.3	Q9NQH7	OTTHUMG00000151312	ENST00000357137.4:c.1273_1287delTACCTCGGGATGGAT	22.37:g.41320402_41320416delTACCTCGGGATGGAT	ENSP00000349658:p.Tyr425_Asp429del	131.0	0.0		102.0	20.0	NM_022098	B2R9G1|B7Z790|B7Z7B2|Q6I9V9|Q8NDA6|Q9BV27|Q9BVH0	In_Frame_Del	DEL	ENST00000357137.4	37	CCDS14007.1																																																																																			.		0.488	XPNPEP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322201.2	NM_022098	
ZFR	51663	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	32404160	32404160	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr5:32404160C>T	ENST00000265069.8	-	7	1177	c.1075G>A	c.(1075-1077)Gaa>Aaa	p.E359K		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	359					multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		AATGCAGCTTCTTTTTTTTTA	0.353																																					p.E359K		.											.	ZFR	90	0			c.G1075A						.						148.0	146.0	147.0					5																	32404160		2203	4300	6503	SO:0001583	missense	51663	exon7			CAGCTTCTTTTTT	AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.1075G>A	5.37:g.32404160C>T	ENSP00000265069:p.Glu359Lys	100.0	2.0		88.0	13.0	NM_016107	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Missense_Mutation	SNP	ENST00000265069.8	37	CCDS34139.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284022	0.80803	.	.	ENSG00000056097	ENST00000265069;ENST00000382126	T	0.44083	0.93	5.73	5.73	0.89815	Zinc finger, U1-type (1);	0.176085	0.64402	D	0.000010	T	0.57431	0.2053	M	0.91459	3.21	0.80722	D	1	B	0.27498	0.18	B	0.29353	0.101	T	0.63220	-0.6686	10	0.87932	D	0	.	18.0665	0.89392	0.0:1.0:0.0:0.0	.	359	Q96KR1	ZFR_HUMAN	K	359;337	ENSP00000265069:E359K	ENSP00000265069:E359K	E	-	1	0	ZFR	32439917	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.707000	0.92482	0.555000	0.69702	GAA	.		0.353	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1		
ZNF469	84627	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	88495698	88495698	+	Missense_Mutation	SNP	C	C	G			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr16:88495698C>G	ENST00000437464.1	+	1	1820	c.1820C>G	c.(1819-1821)tCc>tGc	p.S607C	ZNF469_ENST00000565624.1_Missense_Mutation_p.S607C	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	607	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						ACCTGCTCTTCCCTGTCGCCG	0.711																																					p.S607C		.											.	.	.	0			c.C1820G						.						10.0	16.0	14.0					16																	88495698		688	1586	2274	SO:0001583	missense	84627	exon1			GCTCTTCCCTGTC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.1820C>G	16.37:g.88495698C>G	ENSP00000402343:p.Ser607Cys	90.0	0.0		84.0	28.0	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	C	12.42	1.933055	0.34096	.	.	ENSG00000225614	ENST00000437464	T	0.22945	1.93	4.47	4.47	0.54385	.	.	.	.	.	T	0.35998	0.0951	N	0.24115	0.695	0.35119	D	0.766847	D	0.89917	1.0	D	0.74023	0.982	T	0.45366	-0.9266	9	0.36615	T	0.2	.	15.6944	0.77484	0.0:1.0:0.0:0.0	.	607	Q96JG9	ZN469_HUMAN	C	607	ENSP00000402343:S607C	ENSP00000402343:S607C	S	+	2	0	ZNF469	87023199	1.000000	0.71417	0.766000	0.31476	0.093000	0.18481	7.181000	0.77682	2.047000	0.60756	0.313000	0.20887	TCC	.		0.711	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
ZNF804B	219578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	88965181	88965181	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr7:88965181C>T	ENST00000333190.4	+	4	3494	c.2885C>T	c.(2884-2886)cCa>cTa	p.P962L		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	962							metal ion binding (GO:0046872)	p.P962L(1)|p.P962Q(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TCGCAAGTCCCATGCACAATT	0.388										HNSCC(36;0.09)																											p.P962L		.											.	ZNF804B	101	2	Substitution - Missense(2)	lung(2)	c.C2885T						.						114.0	115.0	115.0					7																	88965181		2203	4300	6503	SO:0001583	missense	219578	exon4			AAGTCCCATGCAC	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2885C>T	7.37:g.88965181C>T	ENSP00000329638:p.Pro962Leu	283.0	0.0		299.0	100.0	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.658293	0.00779	.	.	ENSG00000182348	ENST00000333190	T	0.04809	3.55	5.34	0.244	0.15507	.	0.393600	0.24476	N	0.038181	T	0.01870	0.0059	N	0.08118	0	0.09310	N	1	B	0.23185	0.081	B	0.16289	0.015	T	0.47787	-0.9090	10	0.11182	T	0.66	-0.299	4.835	0.13460	0.3735:0.4483:0.0681:0.1101	.	962	A4D1E1	Z804B_HUMAN	L	962	ENSP00000329638:P962L	ENSP00000329638:P962L	P	+	2	0	ZNF804B	88803117	0.131000	0.22433	0.000000	0.03702	0.070000	0.16714	1.579000	0.36536	-0.098000	0.12285	-0.274000	0.10170	CCA	.		0.388	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
ZSCAN5A	79149	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	56735000	56735000	+	Splice_Site	SNP	C	C	G			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr19:56735000C>G	ENST00000587340.1	-	5	1283	c.588G>C	c.(586-588)caG>caC	p.Q196H	ZSCAN5A_ENST00000254165.3_Splice_Site_p.Q79H|ZSCAN5A_ENST00000391713.1_Splice_Site_p.Q196H|ZSCAN5A_ENST00000587492.1_Splice_Site_p.Q50H|ZSCAN5A_ENST00000592355.1_Splice_Site_p.Q196H			Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	196					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						ACACACTCACCTGCCTCCTGG	0.612																																					p.Q196H		.											.	ZSCAN5A	155	0			c.G588C						.						43.0	40.0	41.0					19																	56735000		2203	4300	6503	SO:0001630	splice_region_variant	79149	exon3			ACTCACCTGCCTC	AK098700	CCDS12941.1	19q13.43	2013-01-08	2008-06-10	2008-06-10	ENSG00000131848	ENSG00000131848		"""-"", ""Zinc fingers, C2H2-type"""	23710	protein-coding gene	gene with protein product			"""zinc finger protein 495"", ""zinc finger and SCAN domain containing 5"""	ZNF495, ZSCAN5			Standard	NM_024303		Approved	MGC4161	uc002qmq.3	Q9BUG6		ENST00000587340.1:c.588+1G>C	19.37:g.56735000C>G		48.0	0.0		48.0	8.0	NM_024303	B4DX98|Q49A73|Q53F04|Q8N7B3	Missense_Mutation	SNP	ENST00000587340.1	37	CCDS12941.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.058187	0.55325	.	.	ENSG00000131848	ENST00000391713;ENST00000254165	T;T	0.10573	3.1;2.86	2.81	2.81	0.32909	.	.	.	.	.	T	0.32793	0.0841	M	0.82517	2.595	0.36476	D	0.867554	D;D	0.71674	0.998;0.996	D;D	0.79784	0.993;0.986	T	0.44390	-0.9331	8	.	.	.	.	11.7916	0.52073	0.0:1.0:0.0:0.0	.	79;196	B4DX98;Q9BUG6	.;ZSA5A_HUMAN	H	196;79	ENSP00000375593:Q196H;ENSP00000254165:Q79H	.	Q	-	3	2	ZSCAN5A	61426812	0.907000	0.30839	0.788000	0.31933	0.050000	0.14768	1.206000	0.32321	1.888000	0.54679	0.655000	0.94253	CAG	.		0.612	ZSCAN5A-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458110.1	NM_024303	Missense_Mutation
PIEZO1	9780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	88802619	88802620	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr16:88802619_88802620GG>TT	ENST00000301015.9	-	12	1739_1740	c.1493_1494CC>AA	c.(1492-1494)cCC>cAA	p.P498Q	RP5-1142A6.2_ENST00000567968.1_RNA|RP5-1142A6.2_ENST00000440406.2_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	498					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						GCAGGCTGACGGGGCCCAGGGT	0.678																																					p.P498Q		.											.	.	.	0			.						.																																			SO:0001583	missense	9780	.			GCTGACGGGGCCC	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.1493_1494delinsTT	16.37:g.88802619_88802620delinsTT	ENSP00000301015:p.Pro498Gln	82.0	0.0		79.0	19.0	.	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	DNP	ENST00000301015.9	37	CCDS54058.1																																																																																			.		0.678	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	
EEF1A1	1915	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	74227627	74227628	+	Missense_Mutation	DNP	GT	GT	AA			TCGA-KR-A7K0-01A-12D-A33Q-10	TCGA-KR-A7K0-10A-01D-A33Q-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	683468d5-b681-43be-9025-724ad958d4f7	7266f903-8881-4952-9391-525e33241f67	g.chr6:74227627_74227628GT>AA	ENST00000316292.9	-	7	2285_2286	c.1294_1295AC>TT	c.(1294-1296)ACa>TTa	p.T432L	EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000309268.6_Missense_Mutation_p.T432L|EEF1A1_ENST00000331523.2_Missense_Mutation_p.T432L	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	432					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						CACCGCAACTGTCTGTCTCATA	0.401											OREG0003893	type=REGULATORY REGION|Gene=BC038897|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.T432L		.											.	.	.	0			.						.																																			SO:0001583	missense	1915	.			GCAACTGTCTGTC	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1294_1295delinsAA	6.37:g.74227627_74227628delinsAA	ENSP00000339063:p.Thr432Leu	380.0	0.0	1151	358.0	115.0	.	P04719|P04720|Q6IQ15	Missense_Mutation	DNP	ENST00000316292.9	37	CCDS4980.1																																																																																			.		0.401	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
