#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ANKRD12	23253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	9208758	9208758	+	Missense_Mutation	SNP	G	G	C			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr18:9208758G>C	ENST00000262126.4	+	5	648	c.408G>C	c.(406-408)caG>caC	p.Q136H	ANKRD12_ENST00000540578.2_3'UTR|ANKRD12_ENST00000383440.2_Missense_Mutation_p.Q113H|ANKRD12_ENST00000400020.3_Missense_Mutation_p.Q113H	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	136						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AGCGAAAACAGATGGCACTTC	0.408																																					p.Q136H		.											.	ANKRD12	92	0			c.G408C						.						213.0	187.0	196.0					18																	9208758		2203	4300	6503	SO:0001583	missense	23253	exon5			AAAACAGATGGCA	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.408G>C	18.37:g.9208758G>C	ENSP00000262126:p.Gln136His	174.0	0.0		169.0	49.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	37	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	G	13.74	2.326098	0.41197	.	.	ENSG00000101745	ENST00000383440;ENST00000546007;ENST00000262126;ENST00000540578	T;T;T	0.52295	3.38;0.67;3.43	5.82	4.04	0.47022	.	0.000000	0.85682	D	0.000000	T	0.57417	0.2052	L	0.36672	1.1	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.998	D;D;D	0.85130	0.99;0.997;0.993	T	0.59010	-0.7534	10	0.87932	D	0	-21.6665	12.0274	0.53380	0.1385:0.0:0.8615:0.0	.	136;113;136	Q6PG48;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	H	113;113;136;136	ENSP00000372932:Q113H;ENSP00000441510:Q113H;ENSP00000262126:Q136H	ENSP00000262126:Q136H	Q	+	3	2	ANKRD12	9198758	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.946000	0.63576	0.807000	0.34208	0.467000	0.42956	CAG	.		0.408	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
ADNP2	22850	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	77896211	77896211	+	Missense_Mutation	SNP	C	C	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr18:77896211C>A	ENST00000262198.4	+	4	3370	c.2915C>A	c.(2914-2916)tCc>tAc	p.S972Y		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	972					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		ATGCATGATTCCAGTTTTTCT	0.542																																					p.S972Y		.											.	ADNP2	140	0			c.C2915A						.						71.0	77.0	75.0					18																	77896211		2203	4300	6503	SO:0001583	missense	22850	exon4			ATGATTCCAGTTT	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.2915C>A	18.37:g.77896211C>A	ENSP00000262198:p.Ser972Tyr	49.0	0.0		52.0	18.0	NM_014913	A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	ENST00000262198.4	37	CCDS32853.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.746738	0.00669	.	.	ENSG00000101544	ENST00000262198	.	.	.	5.03	5.03	0.67393	.	0.996198	0.08135	N	0.992473	T	0.45074	0.1324	L	0.44542	1.39	0.09310	N	1	P	0.48016	0.904	P	0.44946	0.465	T	0.40496	-0.9560	8	.	.	.	-6.3646	15.3834	0.74679	0.0:1.0:0.0:0.0	.	972	Q6IQ32	ADNP2_HUMAN	Y	972	.	.	S	+	2	0	ADNP2	75997202	0.002000	0.14202	0.005000	0.12908	0.001000	0.01503	1.657000	0.37366	2.612000	0.88384	0.655000	0.94253	TCC	.		0.542	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913	
APC	324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	112174286	112174286	+	Nonsense_Mutation	SNP	C	C	T	rs75239284		TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr5:112174286C>T	ENST00000457016.1	+	16	3375	c.2995C>T	c.(2995-2997)Caa>Taa	p.Q999*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q999*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.Q999*			P25054	APC_HUMAN	adenomatous polyposis coli	999	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CAGTTATGGTCAATACCCAGC	0.348		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q999X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	APC	12026	1	Unknown(1)	skin(1)	c.C2995T	GRCh37	CM994279	APC	M	rs75239284	.						87.0	83.0	84.0					5																	112174286		2202	4300	6502	SO:0001587	stop_gained	324	exon17	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	TATGGTCAATACC	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2995C>T	5.37:g.112174286C>T	ENSP00000413133:p.Gln999*	96.0	0.0		104.0	48.0	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	38	6.647106	0.97730	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.76	5.76	0.90799	.	0.106709	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-13.0393	16.9398	0.86215	0.0:0.8726:0.1274:0.0	.	.	.	.	X	999;981;999;999;999	.	ENSP00000257430:Q999X	Q	+	1	0	APC	112202185	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.594000	0.54008	2.726000	0.93360	0.655000	0.94253	CAA	.		0.348	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
ARHGAP39	80728	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	145755886	145755886	+	Missense_Mutation	SNP	C	C	G			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr8:145755886C>G	ENST00000276826.5	-	10	3373	c.3172G>C	c.(3172-3174)Gag>Cag	p.E1058Q	C8orf82_ENST00000313465.5_5'Flank|C8orf82_ENST00000524821.1_5'Flank|ARHGAP39_ENST00000540274.1_Missense_Mutation_p.E1058Q|ARHGAP39_ENST00000377307.2_Missense_Mutation_p.E1089Q			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	1058	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						CGGGTGTTCTCGAAGATGACG	0.647																																					p.E1089Q		.											.	ARHGAP39	90	0			c.G3265C						.						38.0	33.0	35.0					8																	145755886		2194	4295	6489	SO:0001583	missense	80728	exon13			TGTTCTCGAAGAT		CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.3172G>C	8.37:g.145755886C>G	ENSP00000276826:p.Glu1058Gln	99.0	0.0		203.0	28.0	NM_025251	B4E1I1	Missense_Mutation	SNP	ENST00000276826.5	37		.	.	.	.	.	.	.	.	.	.	C	29.7	5.029724	0.93518	.	.	ENSG00000147799	ENST00000276826;ENST00000377307;ENST00000540274	T;T;T	0.60424	0.19;0.19;0.19	4.79	4.79	0.61399	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.70605	0.3243	L	0.49350	1.555	0.58432	D	0.999997	D;D	0.89917	1.0;0.999	D;D	0.85130	0.967;0.997	T	0.72730	-0.4205	10	0.56958	D	0.05	-35.7706	15.3199	0.74112	0.0:1.0:0.0:0.0	.	1058;1089	Q9C0H5;Q9C0H5-2	RHG39_HUMAN;.	Q	1058;1089;1058	ENSP00000276826:E1058Q;ENSP00000366522:E1089Q;ENSP00000445075:E1058Q	ENSP00000276826:E1058Q	E	-	1	0	ARHGAP39	145726694	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.265000	0.78442	2.197000	0.70478	0.561000	0.74099	GAG	.		0.647	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382509.1		
BSN	8927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49693730	49693730	+	Missense_Mutation	SNP	T	T	G			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr3:49693730T>G	ENST00000296452.4	+	5	6855	c.6741T>G	c.(6739-6741)atT>atG	p.I2247M		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	2247					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TGCCCATGATTGCCCCCCGGG	0.592																																					p.I2247M		.											.	BSN	97	0			c.T6741G						.						83.0	79.0	80.0					3																	49693730		2203	4300	6503	SO:0001583	missense	8927	exon5			CATGATTGCCCCC	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.6741T>G	3.37:g.49693730T>G	ENSP00000296452:p.Ile2247Met	104.0	0.0		61.0	22.0	NM_003458	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	T	11.40	1.626460	0.28978	.	.	ENSG00000164061	ENST00000296452	T	0.19938	2.11	5.53	3.02	0.34903	.	0.132337	0.51477	D	0.000086	T	0.12732	0.0309	N	0.11427	0.14	0.29390	N	0.862707	P	0.49961	0.93	P	0.48030	0.564	T	0.03695	-1.1012	10	0.41790	T	0.15	-7.132	5.7893	0.18351	0.0:0.1611:0.144:0.6949	.	2247	Q9UPA5	BSN_HUMAN	M	2247	ENSP00000296452:I2247M	ENSP00000296452:I2247M	I	+	3	3	BSN	49668734	0.974000	0.33945	1.000000	0.80357	0.994000	0.84299	0.098000	0.15189	0.946000	0.37632	0.533000	0.62120	ATT	.		0.592	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
BZRAP1	9256	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	56400053	56400053	+	Silent	SNP	G	G	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr17:56400053G>A	ENST00000343736.4	-	9	1442	c.1279C>T	c.(1279-1281)Ctg>Ttg	p.L427L	BZRAP1_ENST00000355701.3_Silent_p.L427L|BZRAP1_ENST00000268893.6_Silent_p.L367L|BZRAP1-AS1_ENST00000579527.1_RNA			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	427						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TTGCTCTGCAGGCCCTGGCTC	0.657																																					p.L427L		.											.	BZRAP1	229	0			c.C1279T						.						78.0	68.0	72.0					17																	56400053		2203	4300	6503	SO:0001819	synonymous_variant	9256	exon9			TCTGCAGGCCCTG	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.1279C>T	17.37:g.56400053G>A		53.0	0.0		52.0	7.0	NM_004758	O75111|Q8N5W3	Silent	SNP	ENST00000343736.4	37	CCDS11605.1																																																																																			.		0.657	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758	
CAV1	857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	116165144	116165144	+	Missense_Mutation	SNP	G	G	A	rs370105972		TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr7:116165144G>A	ENST00000341049.2	+	1	306	c.28G>A	c.(28-30)Gag>Aag	p.E10K	CAV1_ENST00000393468.1_5'Flank|CAV1_ENST00000393470.1_Missense_Mutation_p.E10K|CAV1_ENST00000393467.1_5'Flank|CAV1_ENST00000405348.1_5'Flank	NM_001753.4	NP_001744.2	Q03135	CAV1_HUMAN	caveolin 1, caveolae protein, 22kDa	10					angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion transport (GO:0006816)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cellular calcium ion homeostasis (GO:0006874)|cellular response to hyperoxia (GO:0071455)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol transport (GO:0030301)|cytosolic calcium ion homeostasis (GO:0051480)|inactivation of MAPK activity (GO:0000188)|lactation (GO:0007595)|leukocyte migration (GO:0050900)|lipid storage (GO:0019915)|maintenance of protein location in cell (GO:0032507)|mammary gland development (GO:0030879)|mammary gland involution (GO:0060056)|MAPK cascade (GO:0000165)|membrane depolarization (GO:0051899)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of pinocytosis (GO:0048550)|negative regulation of protein binding (GO:0032091)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|nitric oxide homeostasis (GO:0033484)|nitric oxide metabolic process (GO:0046209)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of vasoconstriction (GO:0045907)|protein homooligomerization (GO:0051260)|protein localization (GO:0008104)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)|regulation of blood coagulation (GO:0030193)|regulation of fatty acid metabolic process (GO:0019217)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidase activity (GO:0052547)|regulation of smooth muscle contraction (GO:0006940)|regulation of the force of heart contraction by chemical signal (GO:0003057)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to ischemia (GO:0002931)|response to progesterone (GO:0032570)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|vasculogenesis (GO:0001570)|vasoconstriction (GO:0042310)|vesicle organization (GO:0016050)|viral process (GO:0016032)	acrosomal membrane (GO:0002080)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell cortex (GO:0005938)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lipid particle (GO:0005811)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cholesterol binding (GO:0015485)|enzyme binding (GO:0019899)|nitric-oxide synthase binding (GO:0050998)|patched binding (GO:0005113)|peptidase activator activity (GO:0016504)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)			CGTAGACTCGGAGGTAGGCAT	0.622																																					p.E10K		.											.	CAV1	946	0			c.G28A						.						84.0	97.0	92.0					7																	116165144		2203	4300	6503	SO:0001583	missense	857	exon1			GACTCGGAGGTAG	AF125348	CCDS5767.1, CCDS55156.1	7q31	2006-02-09	2002-08-29		ENSG00000105974	ENSG00000105974			1527	protein-coding gene	gene with protein product		601047	"""caveolin 1, caveolae protein, 22kD"""	CAV		10087206	Standard	NM_001753		Approved		uc003vif.2	Q03135	OTTHUMG00000023413	ENST00000341049.2:c.28G>A	7.37:g.116165144G>A	ENSP00000339191:p.Glu10Lys	105.0	0.0		104.0	22.0	NM_001753	Q9UGP1|Q9UNG1|Q9UQH6	Missense_Mutation	SNP	ENST00000341049.2	37	CCDS5767.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.258727	0.80246	.	.	ENSG00000105974	ENST00000341049;ENST00000393470	D;D	0.93189	-3.18;-3.1	4.71	4.71	0.59529	.	0.499327	0.21587	N	0.072152	D	0.90988	0.7166	L	0.47716	1.5	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	D	0.87983	0.2744	10	0.59425	D	0.04	-11.0741	16.9495	0.86240	0.0:0.0:1.0:0.0	.	10	Q03135	CAV1_HUMAN	K	10	ENSP00000339191:E10K;ENSP00000377113:E10K	ENSP00000339191:E10K	E	+	1	0	CAV1	115952380	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.802000	0.69122	2.583000	0.87209	0.650000	0.86243	GAG	.		0.622	CAV1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000059734.4	NM_001753	
PSORS1C1	170679	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31084730	31084730	+	Intron	SNP	T	T	C			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr6:31084730T>C	ENST00000259881.9	+	1	61				CDSN_ENST00000376288.2_Missense_Mutation_p.D221G|PSORS1C1_ENST00000467107.1_3'UTR	NM_014068.2	NP_054787.2	Q9UIG5	PS1C1_HUMAN	psoriasis susceptibility 1 candidate 1											kidney(1)|ovary(2)|prostate(1)|skin(1)	5						GTCGGGGATGTCCGAACTACA	0.622																																					p.D221G		.											.	CDSN	92	0			c.A662G						.						69.0	75.0	73.0					6																	31084730		2203	4300	6503	SO:0001627	intron_variant	1041	exon2			GGGATGTCCGAAC	AB031479	CCDS34390.1	6p21.3	2014-01-28	2003-06-12		ENSG00000204540	ENSG00000204540			17202	protein-coding gene	gene with protein product		613525	"""chromosome 6 open reading frame 16"""	C6orf16			Standard	NM_014068		Approved	SEEK1	uc003nsl.2	Q9UIG5	OTTHUMG00000031077	ENST00000259881.9:c.-229+2062T>C	6.37:g.31084730T>C		96.0	0.0		125.0	66.0	NM_001264	B0V083|Q5ST21|Q86WJ8|Q86WJ9|Q96QC3	Missense_Mutation	SNP	ENST00000259881.9	37	CCDS34390.1	.	.	.	.	.	.	.	.	.	.	T	12.88	2.071726	0.36566	.	.	ENSG00000204539	ENST00000376288	T	0.07114	3.22	4.63	3.47	0.39725	.	0.406771	0.20659	N	0.088043	T	0.01976	0.0062	L	0.32530	0.975	0.09310	N	1	B	0.15930	0.015	B	0.14023	0.01	T	0.41627	-0.9498	10	0.30854	T	0.27	-8.5713	6.1252	0.20176	0.0:0.115:0.0:0.885	.	221	Q15517	CDSN_HUMAN	G	221	ENSP00000365465:D221G	ENSP00000365465:D221G	D	-	2	0	CDSN	31192709	0.014000	0.17966	0.040000	0.18447	0.044000	0.14063	1.456000	0.35201	1.723000	0.51488	0.368000	0.22195	GAC	.		0.622	PSORS1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076110.3	NM_014068	
CELF1	10658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	47510522	47510522	+	Silent	SNP	A	A	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr11:47510522A>T	ENST00000358597.3	-	1	44	c.45T>A	c.(43-45)gcT>gcA	p.A15A	CELF1_ENST00000395290.2_Silent_p.A15A|CELF1_ENST00000310513.5_Silent_p.A15A|CELF1_ENST00000361904.3_Silent_p.A15A|CELF1_ENST00000531165.1_Silent_p.A42A|CELF1_ENST00000395292.2_Silent_p.A15A|CELF1_ENST00000532048.1_Silent_p.A42A			Q92879	CELF1_HUMAN	CUGBP, Elav-like family member 1	15					embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of translation (GO:0017148)|positive regulation of multicellular organism growth (GO:0040018)|regulation of RNA splicing (GO:0043484)|RNA interference (GO:0016246)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation repressor activity, nucleic acid binding (GO:0000900)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)	18						ACATCTTGATAGCATCAAGAT	0.433																																					p.A42A	Pancreas(163;1949 1966 9906 43218 43785)	.											.	CELF1	92	0			c.T126A						.						104.0	104.0	104.0					11																	47510522		2201	4298	6499	SO:0001819	synonymous_variant	10658	exon4			CTTGATAGCATCA	U63289	CCDS7938.1, CCDS7939.1, CCDS31482.1, CCDS53622.1, CCDS53623.1	11p11	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	2549	protein-coding gene	gene with protein product	"""CUG RNA-binding protein"", ""nuclear polyadenylated RNA-binding protein, 50-kD"", ""bruno-like 2"", ""embryo deadenylation element binding protein"""	601074	"""CUG triplet repeat, RNA-binding protein 1"", ""CUG triplet repeat, RNA binding protein 1"""	CUGBP1		8948631, 9371827	Standard	NM_006560		Approved	CUG-BP, hNab50, BRUNOL2, NAB50, CUGBP, NAPOR, EDEN-BP	uc001nfl.3	Q92879		ENST00000358597.3:c.45T>A	11.37:g.47510522A>T		143.0	0.0		143.0	31.0	NM_001172639	B4E2U5|D3DQS0|F8W940|Q4LE52|Q9NP83|Q9NR06	Silent	SNP	ENST00000358597.3	37	CCDS31482.1																																																																																			.		0.433	CELF1-024	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398352.1	NM_006560	
COL19A1	1310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	70894595	70894595	+	Splice_Site	SNP	G	G	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr6:70894595G>A	ENST00000322773.4	+	45	2878	c.2776G>A	c.(2776-2778)Gga>Aga	p.G926R	COL19A1_ENST00000393344.1_Splice_Site_p.G548R	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	926	Collagen-like 10.|Triple-helical region 5 (COL5).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						TTCTTTATAGGGAATAAATGG	0.308																																					p.G926R		.											.	COL19A1	156	0			c.G2776A						.						83.0	91.0	88.0					6																	70894595		2203	4300	6503	SO:0001630	splice_region_variant	1310	exon45			TTATAGGGAATAA		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.2776-1G>A	6.37:g.70894595G>A		88.0	0.0		97.0	31.0	NM_001858	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	ENST00000322773.4	37	CCDS4970.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.142801	0.57044	.	.	ENSG00000082293	ENST00000322773;ENST00000393344;ENST00000393333	D;D	0.97161	-4.27;-4.27	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.99211	0.9726	H	0.98089	4.145	0.53688	D	0.999973	D	0.89917	1.0	D	0.91635	0.999	D	0.99063	1.0831	9	.	.	.	.	18.5553	0.91081	0.0:0.0:1.0:0.0	.	926	Q14993	COJA1_HUMAN	R	926;548;1	ENSP00000316030:G926R;ENSP00000377013:G548R	.	G	+	1	0	COL19A1	70951316	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	5.303000	0.65738	2.817000	0.96982	0.563000	0.77884	GGA	.		0.308	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1		Missense_Mutation
COL4A6	1288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	107422545	107422545	+	Missense_Mutation	SNP	A	A	C			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chrX:107422545A>C	ENST00000372216.4	-	26	2358	c.2258T>G	c.(2257-2259)aTc>aGc	p.I753S	COL4A6_ENST00000545689.1_Missense_Mutation_p.I752S|COL4A6_ENST00000334504.7_Missense_Mutation_p.I752S|COL4A6_ENST00000394872.2_Missense_Mutation_p.I753S|COL4A6_ENST00000538570.1_Missense_Mutation_p.I752S	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	753	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						AGCACCAAAGATGTCACCAGT	0.547									Alport syndrome with Diffuse Leiomyomatosis																												p.I753S	Melanoma(87;1895 1945 2589 7165)	.											.	COL4A6	199	0			c.T2258G						.						96.0	76.0	83.0					X																	107422545		2203	4300	6503	SO:0001583	missense	1288	exon26	Familial Cancer Database		CCAAAGATGTCAC	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.2258T>G	X.37:g.107422545A>C	ENSP00000361290:p.Ile753Ser	349.0	0.0		363.0	165.0	NM_001847	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	A	15.34	2.803421	0.50315	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.96396	-4.0;-4.0;-4.0;-3.2;-3.2	4.59	4.59	0.56863	.	0.172537	0.27871	N	0.017518	D	0.95529	0.8547	N	0.25825	0.765	0.40204	D	0.977556	D;D;D;D	0.76494	0.995;0.999;0.999;0.999	P;D;D;D	0.83275	0.835;0.996;0.988;0.979	D	0.93048	0.6463	10	0.09338	T	0.73	.	13.7531	0.62919	1.0:0.0:0.0:0.0	.	752;752;753;752	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	S	753;752;753;752;752;752	ENSP00000361290:I753S;ENSP00000334733:I752S;ENSP00000378340:I753S;ENSP00000443707:I752S;ENSP00000445236:I752S	ENSP00000334733:I752S	I	-	2	0	COL4A6	107309201	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.281000	0.72632	1.780000	0.52325	0.425000	0.28330	ATC	.		0.547	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
COL5A3	50509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10080566	10080566	+	Missense_Mutation	SNP	T	T	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr19:10080566T>A	ENST00000264828.3	-	55	4054	c.3969A>T	c.(3967-3969)agA>agT	p.R1323S		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1323	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TCTCCCCTTCTCTGCCTTCTC	0.612																																					p.R1323S		.											.	COL5A3	99	0			c.A3969T						.						126.0	100.0	109.0					19																	10080566		2203	4300	6503	SO:0001583	missense	50509	exon55			CCCTTCTCTGCCT	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.3969A>T	19.37:g.10080566T>A	ENSP00000264828:p.Arg1323Ser	110.0	0.0		95.0	41.0	NM_015719	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	T	15.05	2.718942	0.48622	.	.	ENSG00000080573	ENST00000264828	D	0.94000	-3.33	4.16	4.16	0.48862	.	0.209970	0.39834	N	0.001243	D	0.84129	0.5404	N	0.17922	0.545	0.27075	N	0.963235	B	0.30482	0.281	B	0.25405	0.06	T	0.71111	-0.4687	10	0.07482	T	0.82	.	11.2176	0.48835	0.0:0.0:0.0:1.0	.	1323	P25940	CO5A3_HUMAN	S	1323	ENSP00000264828:R1323S	ENSP00000264828:R1323S	R	-	3	2	COL5A3	9941566	0.915000	0.31059	1.000000	0.80357	0.839000	0.47603	0.795000	0.26972	1.743000	0.51761	0.402000	0.26972	AGA	.		0.612	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
CPD	1362	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	28772780	28772780	+	Missense_Mutation	SNP	G	G	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr17:28772780G>T	ENST00000225719.4	+	12	2691	c.2615G>T	c.(2614-2616)cGa>cTa	p.R872L	CPD_ENST00000543464.2_Missense_Mutation_p.R625L	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D	872	Carboxypeptidase-like 2.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						ACACTTGTTCGATCCTCAACA	0.408																																					p.R872L		.											.	CPD	92	0			c.G2615T						.						45.0	42.0	43.0					17																	28772780		2203	4300	6503	SO:0001583	missense	1362	exon12			TTGTTCGATCCTC	U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.2615G>T	17.37:g.28772780G>T	ENSP00000225719:p.Arg872Leu	236.0	1.0		199.0	54.0	NM_001304	B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Missense_Mutation	SNP	ENST00000225719.4	37	CCDS11257.1	.	.	.	.	.	.	.	.	.	.	G	14.40	2.522716	0.44866	.	.	ENSG00000108582	ENST00000225719;ENST00000543464	T;T	0.22336	1.96;3.04	5.28	4.24	0.50183	Peptidase M14, carboxypeptidase A (1);Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	0.129696	0.52532	D	0.000061	T	0.14270	0.0345	L	0.32530	0.975	0.58432	D	0.999995	B;P	0.40931	0.014;0.733	B;B	0.31686	0.002;0.134	T	0.04481	-1.0948	10	0.48119	T	0.1	.	13.4013	0.60885	0.0:0.1589:0.8411:0.0	.	625;872	F5GZH6;O75976	.;CBPD_HUMAN	L	872;625	ENSP00000225719:R872L;ENSP00000444443:R625L	ENSP00000225719:R872L	R	+	2	0	CPD	25796906	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	4.217000	0.58547	2.636000	0.89361	0.655000	0.94253	CGA	.		0.408	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256214.3	NM_001304	
CRIP3	401262	hgsc.bcm.edu;bcgsc.ca	37	6	43274193	43274193	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr6:43274193C>T	ENST00000274990.4	-	5	395	c.391G>A	c.(391-393)Gtc>Atc	p.V131I	CRIP3_ENST00000372569.3_Missense_Mutation_p.V131I|ZNF318_ENST00000607252.1_5'Flank			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	131	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			CCAAAATAGACGGGCTCCCCA	0.577																																					p.V131I		.											.	CRIP3	91	0			c.G391A						.						66.0	65.0	65.0					6																	43274193		2203	4300	6503	SO:0001583	missense	401262	exon5			AATAGACGGGCTC	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.391G>A	6.37:g.43274193C>T	ENSP00000274990:p.Val131Ile	89.0	0.0		90.0	5.0	NM_206922	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Missense_Mutation	SNP	ENST00000274990.4	37		.	.	.	.	.	.	.	.	.	.	C	24.9	4.584821	0.86748	.	.	ENSG00000146215	ENST00000372569;ENST00000451294;ENST00000274990	D;D;D	0.84298	-1.83;-1.83;-1.83	4.75	4.75	0.60458	Zinc finger, LIM-type (5);	0.171388	0.36444	N	0.002583	D	0.87795	0.6267	L	0.46885	1.475	0.51233	D	0.999912	D;D	0.76494	0.999;0.999	D;D	0.79108	0.992;0.991	D	0.89414	0.3705	10	0.87932	D	0	-35.3784	15.6048	0.76658	0.0:1.0:0.0:0.0	.	131;131	Q6Q6R5;Q6Q6R5-3	CRIP3_HUMAN;.	I	131;3;131	ENSP00000361650:V131I;ENSP00000397775:V3I;ENSP00000274990:V131I	ENSP00000274990:V131I	V	-	1	0	CRIP3	43382171	0.999000	0.42202	0.976000	0.42696	0.916000	0.54674	4.501000	0.60393	2.343000	0.79666	0.561000	0.74099	GTC	.		0.577	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1		
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	113347573	113347574	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr8:113347573_113347574insA	ENST00000297405.5	-	45	7393_7394	c.7149_7150insT	c.(7147-7152)tttgtgfs	p.V2384fs	CSMD3_ENST00000343508.3_Frame_Shift_Ins_p.V2344fs|CSMD3_ENST00000455883.2_Frame_Shift_Ins_p.V2280fs|CSMD3_ENST00000352409.3_Frame_Shift_Ins_p.V2314fs	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2384	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TAACTGAGCACAAAAAAGCCAC	0.351										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.V2384fs		.											.	CSMD3	1132	0			c.7150_7151insT						.																																			SO:0001589	frameshift_variant	114788	exon45			TGAGCACAAAAAA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7150dupT	8.37:g.113347579_113347579dupA	ENSP00000297405:p.Val2384fs	96.0	0.0		197.0	21.0	NM_198123	Q96PZ3	Frame_Shift_Ins	INS	ENST00000297405.5	37	CCDS6315.1																																																																																			.		0.351	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
DECR2	26063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	461547	461547	+	Missense_Mutation	SNP	C	C	T	rs150303478	byFrequency	TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr16:461547C>T	ENST00000219481.5	+	8	986	c.848C>T	c.(847-849)cCg>cTg	p.P283L	DECR2_ENST00000424398.2_Missense_Mutation_p.P271L|DECR2_ENST00000461947.1_Intron	NM_020664.3	NP_065715.1	Q9NUI1	DECR2_HUMAN	2,4-dienoyl CoA reductase 2, peroxisomal	283					unsaturated fatty acid biosynthetic process (GO:0006636)	peroxisomal membrane (GO:0005778)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)	9		Hepatocellular(16;0.00015)				AAAGGGCTGCCGGATTTCGCA	0.612													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18385	0.0		0.0	False		,,,				2504	0.0				p.P283L		.											.	DECR2	90	0			c.C848T						.	C	LEU/PRO	11,4393	17.9+/-39.9	0,11,2191	156.0	126.0	136.0		848	-2.2	0.0	16	dbSNP_134	136	0,8600	1.2+/-3.3	0,0,4300	yes	missense	DECR2	NM_020664.3	98	0,11,6491	TT,TC,CC		0.0,0.2498,0.0846	benign	283/293	461547	11,12993	2202	4300	6502	SO:0001583	missense	26063	exon8			GGCTGCCGGATTT	AJ293009	CCDS10409.1	16p13.3	2011-09-14			ENSG00000242612	ENSG00000242612	1.3.1.34	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2754	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 17C, member 1"""	615839				11514237, 19027726	Standard	NM_020664		Approved	PDCR, SDR17C1	uc002chb.3	Q9NUI1	OTTHUMG00000047846	ENST00000219481.5:c.848C>T	16.37:g.461547C>T	ENSP00000219481:p.Pro283Leu	92.0	0.0		55.0	17.0	NM_020664	Q6ZRS7|Q96ET0	Missense_Mutation	SNP	ENST00000219481.5	37	CCDS10409.1	.	.	.	.	.	.	.	.	.	.	C	9.932	1.215049	0.22373	0.002498	0.0	ENSG00000242612	ENST00000219481;ENST00000424398	T;T	0.81078	-1.45;-1.08	5.34	-2.15	0.07102	.	0.777423	0.12611	N	0.453858	T	0.62600	0.2441	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48843	-0.8999	10	0.35671	T	0.21	.	11.0306	0.47769	0.0:0.3331:0.0:0.6669	.	283	Q9NUI1	DECR2_HUMAN	L	283;271	ENSP00000219481:P283L;ENSP00000400374:P271L	ENSP00000219481:P283L	P	+	2	0	DECR2	401548	0.026000	0.19158	0.000000	0.03702	0.001000	0.01503	0.257000	0.18369	-0.218000	0.10018	-0.258000	0.10820	CCG	C|0.999;T|0.001		0.612	DECR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109069.4	NM_020664	
CTU2	348180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	88776364	88776364	+	Missense_Mutation	SNP	C	C	G			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr16:88776364C>G	ENST00000453996.2	+	3	230	c.162C>G	c.(160-162)ttC>ttG	p.F54L	CTU2_ENST00000312060.5_Missense_Mutation_p.F54L|CTU2_ENST00000567949.1_Missense_Mutation_p.F54L|CTU2_ENST00000378384.3_Intron	NM_001012759.1	NP_001012777.1			cytosolic thiouridylase subunit 2 homolog (S. pombe)											NS(1)|breast(1)|endometrium(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11						TCAAGGCCTTCTACGTCCACA	0.607																																					p.F54L		.											.	CTU2	23	0			c.C162G						.						169.0	164.0	166.0					16																	88776364		2198	4300	6498	SO:0001583	missense	348180	exon3			GGCCTTCTACGTC	BC021056	CCDS32506.1, CCDS45545.1	16q24.3	2013-10-11	2009-08-19	2009-08-19		ENSG00000174177			28005	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 84"""	C16orf84		19017811	Standard	NM_001012759		Approved	NCS2	uc002flm.3	Q2VPK5		ENST00000453996.2:c.162C>G	16.37:g.88776364C>G	ENSP00000388320:p.Phe54Leu	66.0	0.0		39.0	11.0	NM_001012759		Missense_Mutation	SNP	ENST00000453996.2	37	CCDS45545.1	.	.	.	.	.	.	.	.	.	.	C	13.28	2.190379	0.38707	.	.	ENSG00000174177	ENST00000312060;ENST00000453996	T;T	0.38722	1.12;1.12	3.88	-1.97	0.07503	.	0.268590	0.37623	N	0.002017	T	0.24661	0.0598	L	0.38175	1.15	0.80722	D	1	B;B	0.13145	0.006;0.007	B;B	0.13407	0.009;0.004	T	0.02829	-1.1105	10	0.30854	T	0.27	.	5.2425	0.15479	0.0:0.4496:0.1587:0.3918	.	54;54	Q2VPK5-5;Q2VPK5	.;CTU2_HUMAN	L	54	ENSP00000308617:F54L;ENSP00000388320:F54L	ENSP00000308617:F54L	F	+	3	2	CTU2	87303865	0.993000	0.37304	0.022000	0.16811	0.902000	0.53008	0.245000	0.18142	-0.160000	0.11002	0.297000	0.19635	TTC	.		0.607	CTU2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423025.1	NM_001012762	
DPP7	29952	broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	140008803	140008803	+	Missense_Mutation	SNP	G	G	C			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr9:140008803G>C	ENST00000371579.2	-	3	217	c.213C>G	c.(211-213)atC>atG	p.I71M		NM_013379.2	NP_037511.2	Q9UHL4	DPP2_HUMAN	dipeptidyl-peptidase 7	71				I -> T (in Ref. 1; AAF12747). {ECO:0000305}.		cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;4.25e-05)|Epithelial(140;0.000633)		TGTAGAAGAAGATGGGCCCCT	0.741																																					p.I71M		.											.	DPP7	90	0			c.C213G						.						8.0	10.0	10.0					9																	140008803		2107	4144	6251	SO:0001583	missense	29952	exon3			GAAGAAGATGGGC	AF154502	CCDS7030.1	9q34.3	2008-02-05	2006-01-12		ENSG00000176978	ENSG00000176978			14892	protein-coding gene	gene with protein product		610537	"""dipeptidylpeptidase 7"""			10477574, 11139392	Standard	XM_005266075		Approved	DPPII	uc004clh.3	Q9UHL4	OTTHUMG00000020977	ENST00000371579.2:c.213C>G	9.37:g.140008803G>C	ENSP00000360635:p.Ile71Met	80.0	1.0		62.0	13.0	NM_013379	A8K7U7|Q5VSF1|Q969X4	Missense_Mutation	SNP	ENST00000371579.2	37	CCDS7030.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.33|14.33	2.504022|2.504022	0.44558|0.44558	.|.	.|.	ENSG00000176978|ENSG00000176978	ENST00000371579|ENST00000443858	T|.	0.16597|.	2.33|.	4.25|4.25	-7.0|-7.0	0.01599|0.01599	.|.	0.128904|.	0.49305|.	D|.	0.000154|.	T|T	0.45337|0.45337	0.1337|0.1337	M|M	0.86740|0.86740	2.835|2.835	0.25381|0.25381	N|N	0.988614|0.988614	P|P	0.47677|0.37955	0.899|0.612	D|B	0.69142|0.33750	0.962|0.169	T|T	0.49707|0.49707	-0.8911|-0.8911	10|8	0.59425|0.87932	D|D	0.04|0	-32.3712|-32.3712	8.7392|8.7392	0.34547|0.34547	0.0875:0.0:0.1882:0.7243|0.0875:0.0:0.1882:0.7243	.|.	71|95	Q9UHL4|E7EQS4	DPP2_HUMAN|.	M|V	71|95	ENSP00000360635:I71M|.	ENSP00000360635:I71M|ENSP00000413492:L95V	I|L	-|-	3|1	3|0	DPP7|DPP7	139128624|139128624	0.130000|0.130000	0.22417|0.22417	0.752000|0.752000	0.31206|0.31206	0.355000|0.355000	0.29361|0.29361	-1.074000|-1.074000	0.03427|0.03427	-1.186000|-1.186000	0.02713|0.02713	0.555000|0.555000	0.69702|0.69702	ATC|CTT	.		0.741	DPP7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055279.1	NM_013379	
EFCAB3	146779	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	60464748	60464748	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr17:60464748delA	ENST00000305286.3	+	3	200	c.122delA	c.(121-123)gaafs	p.E41fs	EFCAB3_ENST00000450662.2_Frame_Shift_Del_p.E93fs	NM_173503.3	NP_775774.1	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3	41							calcium ion binding (GO:0005509)			cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)	17			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			CAACACAAAGAAAAGAAGCTA	0.363																																					p.E93fs		.											.	EFCAB3	227	0			c.278delA						.						94.0	86.0	89.0					17																	60464748		2203	4300	6503	SO:0001589	frameshift_variant	146779	exon5			ACAAAGAAAAGAA	AK098684	CCDS11632.1, CCDS45751.1	17q23.3	2013-01-10			ENSG00000172421	ENSG00000172421		"""EF-hand domain containing"""	26379	protein-coding gene	gene with protein product						12477932	Standard	NM_173503		Approved	FLJ25818	uc010wpc.2	Q8N7B9	OTTHUMG00000179175	ENST00000305286.3:c.122delA	17.37:g.60464748delA	ENSP00000302649:p.Glu41fs	64.0	0.0		92.0	39.0	NM_001144933	J3KQM8	Frame_Shift_Del	DEL	ENST00000305286.3	37	CCDS11632.1																																																																																			.		0.363	EFCAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379114.1	NM_173503	
ERF	2077	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42754547	42754547	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr19:42754547G>A	ENST00000222329.4	-	2	350	c.193C>T	c.(193-195)Cgg>Tgg	p.R65W	ERF_ENST00000440177.2_5'UTR|ERF_ENST00000595941.1_5'Flank|AC006486.9_ENST00000594664.1_Intron	NM_006494.2	NP_006485.2	P50548	ERF_HUMAN	Ets2 repressor factor	65			R -> Q (in CRS4). {ECO:0000269|PubMed:23354439}.		cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chorio-allantoic fusion (GO:0060710)|ectodermal cell differentiation (GO:0010668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	17		Prostate(69;0.00682)				CCCCACAGCCGGGCCACCTCA	0.622																																					p.R65W		.											.	ERF	658	0			c.C193T						.						47.0	47.0	47.0					19																	42754547		2203	4300	6503	SO:0001583	missense	2077	exon2			ACAGCCGGGCCAC	U58535	CCDS12600.1	19q13	2008-07-16				ENSG00000105722			3444	protein-coding gene	gene with protein product	"""Ets2 repressor factor"""	611888				7588608, 9192842	Standard	XM_005258644		Approved	PE-2, PE2	uc002ote.4	P50548		ENST00000222329.4:c.193C>T	19.37:g.42754547G>A	ENSP00000222329:p.Arg65Trp	86.0	0.0		82.0	41.0	NM_006494	B2RAP1|B7Z4R0|Q59G38|Q9UPI7	Missense_Mutation	SNP	ENST00000222329.4	37	CCDS12600.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.753389	0.89753	.	.	ENSG00000105722	ENST00000222329	T	0.29397	1.57	5.55	4.52	0.55395	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.63307	0.2500	M	0.92738	3.34	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72808	-0.4181	10	0.87932	D	0	.	12.5983	0.56483	0.0808:0.0:0.9192:0.0	.	65	P50548	ERF_HUMAN	W	65	ENSP00000222329:R65W	ENSP00000222329:R65W	R	-	1	2	ERF	47446387	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.790000	0.99075	1.505000	0.48720	0.655000	0.94253	CGG	.		0.622	ERF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463684.1	NM_006494	
FBXO43	286151	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	101153180	101153180	+	Silent	SNP	T	T	C			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr8:101153180T>C	ENST00000428847.2	-	2	1618	c.1302A>G	c.(1300-1302)ttA>ttG	p.L434L		NM_001029860.3	NP_001025031.2	Q4G163	FBX43_HUMAN	F-box protein 43	434					meiotic nuclear division (GO:0007126)|negative regulation of meiosis (GO:0045835)|negative regulation of protein catabolic process (GO:0042177)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(5)|lung(14)|prostate(1)|skin(5)|urinary_tract(1)	31	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			ATAAATTCTTTAAGCTAAAGG	0.428																																					p.L434L		.											.	FBXO43	226	0			c.A1302G						.						118.0	113.0	114.0					8																	101153180		1890	4127	6017	SO:0001819	synonymous_variant	286151	exon2			ATTCTTTAAGCTA	BC028709	CCDS47904.1	8q22.3	2004-08-24			ENSG00000156509	ENSG00000156509		"""F-boxes /  ""other"""""	28521	protein-coding gene	gene with protein product		609110					Standard	NR_036491		Approved	Fbx43	uc003yjd.3	Q4G163	OTTHUMG00000164803	ENST00000428847.2:c.1302A>G	8.37:g.101153180T>C		151.0	0.0		354.0	38.0	NM_001029860		Silent	SNP	ENST00000428847.2	37	CCDS47904.1																																																																																			.		0.428	FBXO43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380380.1	XM_209918	
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	13	39264296	39264296	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr13:39264296G>T	ENST00000280481.7	+	1	3031	c.2815G>T	c.(2815-2817)Gaa>Taa	p.E939*		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	939					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		AGTGGATGATGAAGTGCCCAT	0.493																																					p.E939X		.											.	FREM2	100	0			c.G2815T						.						69.0	60.0	63.0					13																	39264296		2203	4300	6503	SO:0001587	stop_gained	341640	exon1			GATGATGAAGTGC	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.2815G>T	13.37:g.39264296G>T	ENSP00000280481:p.Glu939*	68.0	0.0		72.0	15.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Nonsense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	41	8.871636	0.98984	.	.	ENSG00000150893	ENST00000280481	.	.	.	5.59	5.59	0.84812	.	0.049447	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	.	19.6034	0.95572	0.0:0.0:1.0:0.0	.	.	.	.	X	939	.	ENSP00000280481:E939X	E	+	1	0	FREM2	38162296	1.000000	0.71417	0.012000	0.15200	0.012000	0.07955	7.988000	0.88194	2.645000	0.89757	0.655000	0.94253	GAA	.		0.493	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
HDDC3	374659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	91475134	91475134	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr15:91475134G>A	ENST00000394272.3	-	3	237	c.209C>T	c.(208-210)aCc>aTc	p.T70I	UNC45A_ENST00000394275.2_Intron|HDDC3_ENST00000330334.3_Missense_Mutation_p.T70I|HDDC3_ENST00000559898.1_Missense_Mutation_p.T70I|AC068831.3_ENST00000438890.1_RNA|AC068831.3_ENST00000448987.1_RNA			Q8N4P3	MESH1_HUMAN	HD domain containing 3	70	HD.						guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity (GO:0008893)|metal ion binding (GO:0046872)			NS(1)|ovary(1)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			CTCATCCAGGGTGGTGTCTGT	0.592											OREG0023475	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T70I		.											.	HDDC3	91	0			c.C209T						.						81.0	74.0	77.0					15																	91475134		2198	4298	6496	SO:0001583	missense	374659	exon3			TCCAGGGTGGTGT	AK057584	CCDS10366.1, CCDS66866.1	15q26.1	2005-08-22			ENSG00000184508	ENSG00000184508			30522	protein-coding gene	gene with protein product						12477932	Standard	NM_001286451		Approved	MGC45386	uc002bqe.4	Q8N4P3	OTTHUMG00000141260	ENST00000394272.3:c.209C>T	15.37:g.91475134G>A	ENSP00000377814:p.Thr70Ile	36.0	0.0	1282	23.0	8.0	NM_198527		Missense_Mutation	SNP	ENST00000394272.3	37		.	.	.	.	.	.	.	.	.	.	G	29.6	5.022380	0.93462	.	.	ENSG00000184508	ENST00000394272;ENST00000330334	.	.	.	4.97	4.97	0.65823	Metal-dependent phosphohydrolase, HD domain (1);Metal-dependent phosphohydrolase, HD subdomain (1);	0.102055	0.64402	D	0.000004	D	0.89784	0.6815	H	0.97659	4.05	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.79108	0.992;0.975	D	0.93277	0.6657	9	0.87932	D	0	-6.9392	17.0399	0.86486	0.0:0.0:1.0:0.0	.	70;70	Q8N4P3;Q8N4P3-2	MESH1_HUMAN;.	I	70	.	ENSP00000330721:T70I	T	-	2	0	HDDC3	89276138	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.725000	0.61979	2.585000	0.87301	0.555000	0.69702	ACC	.		0.592	HDDC3-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000280403.2	NM_198527	
HEG1	57493	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	124731574	124731574	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr3:124731574G>A	ENST00000311127.4	-	6	2916	c.2849C>T	c.(2848-2850)cCc>cTc	p.P950L	HEG1_ENST00000477536.1_5'Flank	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	950					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						TGTGGTTTGGGGAGAAGGAGA	0.507																																					p.P950L		.											.	HEG1	70	0			c.C2849T						.						144.0	162.0	156.0					3																	124731574		2061	4199	6260	SO:0001583	missense	57493	exon6			GTTTGGGGAGAAG	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.2849C>T	3.37:g.124731574G>A	ENSP00000311502:p.Pro950Leu	74.0	0.0		45.0	15.0	NM_020733	Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	ENST00000311127.4	37	CCDS46898.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990566	0.74589	.	.	ENSG00000173706	ENST00000311127	D	0.89123	-2.47	4.09	3.21	0.36854	.	0.457587	0.16144	U	0.227570	D	0.85431	0.5695	M	0.66939	2.045	0.09310	N	0.999999	P;P	0.42908	0.793;0.689	B;B	0.40940	0.344;0.186	T	0.78099	-0.2336	10	0.51188	T	0.08	.	4.4008	0.11385	0.2045:0.1885:0.6069:0.0	.	950;950	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	L	950	ENSP00000311502:P950L	ENSP00000311502:P950L	P	-	2	0	HEG1	126214264	0.000000	0.05858	0.010000	0.14722	0.929000	0.56500	-0.113000	0.10774	1.062000	0.40625	0.655000	0.94253	CCC	.		0.507	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386	
HIPK1	204851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	114483116	114483116	+	Missense_Mutation	SNP	T	T	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr1:114483116T>A	ENST00000369558.1	+	2	343	c.111T>A	c.(109-111)agT>agA	p.S37R	HIPK1_ENST00000426820.2_Missense_Mutation_p.S37R|HIPK1_ENST00000369561.4_Missense_Mutation_p.S37R|HIPK1_ENST00000369555.2_Missense_Mutation_p.S37R|HIPK1_ENST00000369559.4_Missense_Mutation_p.S37R|HIPK1_ENST00000369554.2_Missense_Mutation_p.S37R			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	37					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAGGACAGAGTAGCAACGACA	0.507																																					p.S37R		.											.	HIPK1	361	0			c.T111A						.						221.0	237.0	231.0					1																	114483116		2203	4300	6503	SO:0001583	missense	204851	exon2			ACAGAGTAGCAAC	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.111T>A	1.37:g.114483116T>A	ENSP00000358571:p.Ser37Arg	121.0	0.0		69.0	17.0	NM_198268	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	ENST00000369558.1	37	CCDS867.1	.	.	.	.	.	.	.	.	.	.	T	13.83	2.353273	0.41700	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000514621;ENST00000503968	T;T;T;T;T;T;T;T;T	0.49139	0.84;0.86;0.89;0.9;0.9;0.89;0.91;0.8;0.79	4.92	4.0	0.46444	.	0.204155	0.43919	D	0.000502	T	0.14830	0.0358	N	0.19112	0.55	0.80722	D	1	P;P	0.44195	0.61;0.828	B;P	0.45232	0.207;0.474	T	0.06006	-1.0851	10	0.07175	T	0.84	.	7.6757	0.28484	0.0:0.74:0.0:0.26	.	37;37	Q86Z02;Q86Z02-2	HIPK1_HUMAN;.	R	108;37;37;37;37;37;37;37;37	ENSP00000407442:S108R;ENSP00000358572:S37R;ENSP00000409673:S37R;ENSP00000358567:S37R;ENSP00000358568:S37R;ENSP00000358571:S37R;ENSP00000358574:S37R;ENSP00000422322:S37R;ENSP00000426695:S37R	ENSP00000358567:S37R	S	+	3	2	HIPK1	114284639	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.324000	0.43831	1.037000	0.40024	-0.248000	0.11899	AGT	.		0.507	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
IRX6	79190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	55362664	55362664	+	Missense_Mutation	SNP	C	C	G	rs143272826		TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr16:55362664C>G	ENST00000290552.7	+	5	2106	c.774C>G	c.(772-774)gaC>gaG	p.D258E	RP11-26L20.3_ENST00000558730.2_RNA	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	258					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						ACCTGGAAGACCTggaggaag	0.617																																					p.D258E		.											.	IRX6	174	0			c.C774G						.						33.0	40.0	38.0					16																	55362664		2191	4286	6477	SO:0001583	missense	79190	exon5			GGAAGACCTGGAG	AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.774C>G	16.37:g.55362664C>G	ENSP00000290552:p.Asp258Glu	46.0	0.0		30.0	11.0	NM_024335	B2RN06|Q7Z2K0	Missense_Mutation	SNP	ENST00000290552.7	37	CCDS32449.1	.	.	.	.	.	.	.	.	.	.	C	16.69	3.192126	0.58017	.	.	ENSG00000159387	ENST00000290552	D	0.91295	-2.82	5.27	3.29	0.37713	.	0.833479	0.10461	N	0.671932	D	0.90703	0.7083	L	0.27053	0.805	0.43814	D	0.996374	D	0.76494	0.999	D	0.83275	0.996	D	0.84033	0.0360	10	0.36615	T	0.2	-36.4803	7.5295	0.27674	0.0:0.7312:0.0:0.2688	.	258	P78412	IRX6_HUMAN	E	258	ENSP00000290552:D258E	ENSP00000290552:D258E	D	+	3	2	IRX6	53920165	0.904000	0.30761	1.000000	0.80357	0.844000	0.47949	1.470000	0.35354	0.588000	0.29660	0.462000	0.41574	GAC	C|1.000;A|0.000		0.617	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4	NM_024335	
KCNMA1	3778	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	79397093	79397093	+	Missense_Mutation	SNP	A	A	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr10:79397093A>T	ENST00000286628.8	-	1	307	c.308T>A	c.(307-309)tTc>tAc	p.F103Y	KCNMA1_ENST00000404857.1_Missense_Mutation_p.F103Y|KCNMA1_ENST00000481070.1_Missense_Mutation_p.F103Y|KCNMA1_ENST00000286627.5_Missense_Mutation_p.F103Y|KCNMA1_ENST00000372440.1_Missense_Mutation_p.F103Y|KCNMA1_ENST00000372443.1_Missense_Mutation_p.F103Y|KCNMA1_ENST00000404771.3_Missense_Mutation_p.F103Y|KCNMA1_ENST00000480683.1_Missense_Mutation_p.F103Y|KCNMA1_ENST00000406533.3_Missense_Mutation_p.F103Y|KCNMA1_ENST00000354353.5_Missense_Mutation_p.F103Y	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	103					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	CAAGATGATGAAGAGGCCCCC	0.657																																					p.F103Y		.											.	KCNMA1	93	0			c.T308A						.						64.0	62.0	63.0					10																	79397093		2203	4300	6503	SO:0001583	missense	3778	exon1			ATGATGAAGAGGC	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.308T>A	10.37:g.79397093A>T	ENSP00000286628:p.Phe103Tyr	113.0	0.0		60.0	22.0	NM_002247	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	ENST00000286628.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	27.1|27.1	4.803963|4.803963	0.90623|0.90623	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857|ENST00000372403	T;T;T;T;T;T;T;T;T|.	0.47869|.	0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83|.	4.08|4.08	2.93|2.93	0.34026|0.34026	.|.	0.137185|.	0.48767|.	D|.	0.000168|.	T|T	0.52980|0.52980	0.1768|0.1768	L|L	0.39898|0.39898	1.24|1.24	0.44677|0.44677	D|D	0.997665|0.997665	B;P;D;P;P;D;P|.	0.56521|.	0.329;0.831;0.959;0.951;0.918;0.976;0.918|.	B;P;B;P;P;P;P|.	0.57679|.	0.191;0.825;0.424;0.628;0.544;0.732;0.544|.	T|T	0.47548|0.47548	-0.9109|-0.9109	10|5	0.87932|.	D|.	0|.	-3.6688|-3.6688	9.0031|9.0031	0.36094|0.36094	0.91:0.0:0.09:0.0|0.91:0.0:0.09:0.0	.|.	103;103;103;103;103;103;103|.	D5MRH1;Q12791-6;B7ZMF5;Q12791-2;Q12791;Q12791-5;Q5SVJ7|.	.;.;.;.;KCMA1_HUMAN;.;.|.	Y|T	103;40;38;77;40;103;103;77;103;103;103|54	ENSP00000361517:F103Y;ENSP00000361485:F40Y;ENSP00000361514:F38Y;ENSP00000396608:F77Y;ENSP00000361520:F103Y;ENSP00000286627:F103Y;ENSP00000385552:F103Y;ENSP00000346321:F103Y;ENSP00000385806:F103Y|.	ENSP00000286627:F103Y|.	F|S	-|-	2|1	0|0	KCNMA1|KCNMA1	79067099|79067099	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	5.551000|5.551000	0.67274|0.67274	1.617000|1.617000	0.50277|0.50277	0.374000|0.374000	0.22700|0.22700	TTC|TCA	.		0.657	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
KCNV1	27012	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	110980791	110980791	+	Silent	SNP	G	G	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr8:110980791G>A	ENST00000524391.1	-	4	2061	c.1029C>T	c.(1027-1029)taC>taT	p.Y343Y	KCNV1_ENST00000297404.1_Silent_p.Y343Y			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	343					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			CGACTTCTTCGTAACACTGGG	0.463																																					p.Y343Y		.											.	KCNV1	226	0			c.C1029T						.						73.0	62.0	66.0					8																	110980791		2203	4300	6503	SO:0001819	synonymous_variant	27012	exon3			TTCTTCGTAACAC	AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.1029C>T	8.37:g.110980791G>A		55.0	0.0		109.0	21.0	NM_014379	Q9UHJ4	Silent	SNP	ENST00000524391.1	37	CCDS6314.1																																																																																			.		0.463	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385525.1	NM_014379	
KSR2	283455	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	118199277	118199277	+	Silent	SNP	C	C	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr12:118199277C>T	ENST00000339824.5	-	4	1252	c.525G>A	c.(523-525)acG>acA	p.T175T	KSR2_ENST00000425217.1_Silent_p.T146T			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	175					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.T207T(2)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCTCCTTCCCCGTCTCTGTCG	0.602																																					p.T146T		.											.	KSR2	1449	2	Substitution - coding silent(2)	lung(1)|endometrium(1)	c.G438A						.						70.0	72.0	71.0					12																	118199277		1955	4138	6093	SO:0001819	synonymous_variant	283455	exon4			CTTCCCCGTCTCT	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.525G>A	12.37:g.118199277C>T		82.0	0.0		70.0	29.0	NM_173598	A0PJT2|Q3B828|Q8N775	Silent	SNP	ENST00000339824.5	37																																																																																				.		0.602	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	NM_173598	
MAP4	4134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47958322	47958322	+	Missense_Mutation	SNP	T	T	G			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr3:47958322T>G	ENST00000360240.6	-	7	1513	c.995A>C	c.(994-996)aAg>aCg	p.K332T	MAP4_ENST00000426837.2_Missense_Mutation_p.K349T|MAP4_ENST00000383737.4_Intron|MAP4_ENST00000395734.3_Missense_Mutation_p.K332T	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	332	17 X 14 AA tandem repeats.				cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	TACCACATTCTTGGCTGAAGA	0.478																																					p.K332T		.											.	MAP4	93	0			c.A995C						.						260.0	243.0	249.0					3																	47958322		2203	4300	6503	SO:0001583	missense	4134	exon7			ACATTCTTGGCTG		CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.995A>C	3.37:g.47958322T>G	ENSP00000353375:p.Lys332Thr	98.0	0.0		70.0	17.0	NM_001134364	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	ENST00000360240.6	37	CCDS33750.1	.	.	.	.	.	.	.	.	.	.	T	13.44	2.237820	0.39598	.	.	ENSG00000047849	ENST00000395734;ENST00000426837;ENST00000360240	T;T;T	0.08984	3.05;3.05;3.03	4.92	3.69	0.42338	.	.	.	.	.	T	0.17746	0.0426	M	0.67397	2.05	0.09310	N	0.999999	B;D;B	0.56968	0.41;0.978;0.102	B;P;B	0.55303	0.164;0.773;0.045	T	0.06499	-1.0823	9	0.54805	T	0.06	-1.9123	7.0975	0.25317	0.2151:0.0:0.0:0.7849	.	309;332;332	C9JFC3;P27816-6;P27816	.;.;MAP4_HUMAN	T	332;349;332	ENSP00000379083:K332T;ENSP00000407602:K349T;ENSP00000353375:K332T	ENSP00000353375:K332T	K	-	2	0	MAP4	47933326	0.001000	0.12720	0.042000	0.18584	0.021000	0.10359	1.014000	0.29950	2.044000	0.60594	0.533000	0.62120	AAG	.		0.478	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375	
MAP7D1	55700	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	36638161	36638161	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr1:36638161G>A	ENST00000373151.2	+	4	773	c.557G>A	c.(556-558)cGt>cAt	p.R186H	MAP7D1_ENST00000316156.4_Missense_Mutation_p.R186H|MAP7D1_ENST00000474796.1_3'UTR|MAP7D1_ENST00000373150.4_Missense_Mutation_p.R186H	NM_018067.3	NP_060537.3	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	186					microtubule cytoskeleton organization (GO:0000226)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)				breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	19		Myeloproliferative disorder(586;0.0393)				GAGGAGCAACGTCTTAAAGCC	0.632																																					p.R186H		.											.	MAP7D1	138	0			c.G557A						.						21.0	21.0	21.0					1																	36638161		2202	4299	6501	SO:0001583	missense	55700	exon4			AGCAACGTCTTAA	AK096341	CCDS30673.1, CCDS65492.1, CCDS65493.1	1p34.3	2008-02-05	2007-02-08	2007-02-08	ENSG00000116871	ENSG00000116871			25514	protein-coding gene	gene with protein product			"""proline arginine rich coiled coil 1"", ""arginine/proline rich coiled-coil 1"""	PARCC1, RPRC1		10574461	Standard	XM_005271024		Approved	FLJ10350, FLJ39022	uc001bzz.3	Q3KQU3	OTTHUMG00000007714	ENST00000373151.2:c.557G>A	1.37:g.36638161G>A	ENSP00000362244:p.Arg186His	326.0	0.0		213.0	17.0	NM_018067	D3DPS4|Q7L8J5|Q8N905|Q8TAK0|Q9HBQ2|Q9NW29|Q9ULN3	Missense_Mutation	SNP	ENST00000373151.2	37	CCDS30673.1	.	.	.	.	.	.	.	.	.	.	G	36	5.662200	0.96734	.	.	ENSG00000116871	ENST00000429533;ENST00000316156;ENST00000373150;ENST00000373151	T;T;T;T	0.12569	2.67;2.67;2.67;2.67	5.41	5.41	0.78517	.	0.000000	0.37348	N	0.002128	T	0.39118	0.1066	M	0.70595	2.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.998	T	0.15492	-1.0435	10	0.87932	D	0	-19.004	17.7518	0.88436	0.0:0.0:1.0:0.0	.	186;186;186	Q3KQU3-2;Q3KQU3-4;Q3KQU3	.;.;MA7D1_HUMAN	H	147;186;186;186	ENSP00000390091:R147H;ENSP00000320228:R186H;ENSP00000362243:R186H;ENSP00000362244:R186H	ENSP00000320228:R186H	R	+	2	0	MAP7D1	36410748	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	8.620000	0.90943	2.532000	0.85374	0.655000	0.94253	CGT	.		0.632	MAP7D1-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382095.1	NM_018067	
MAPK10	5602	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	86988958	86988958	+	Missense_Mutation	SNP	A	A	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr4:86988958A>T	ENST00000359221.3	-	10	1479	c.953T>A	c.(952-954)tTc>tAc	p.F318Y	MAPK10_ENST00000361569.2_Missense_Mutation_p.F318Y|MAPK10_ENST00000395169.3_Missense_Mutation_p.F280Y|MAPK10_ENST00000395166.1_Missense_Mutation_p.F280Y|MAPK10_ENST00000395157.3_Missense_Mutation_p.F173Y|MAPK10_ENST00000395160.3_Missense_Mutation_p.F173Y|MAPK10_ENST00000395161.2_Missense_Mutation_p.F318Y|MAPK10_ENST00000449047.2_Missense_Mutation_p.F173Y			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	318	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)			breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		GTCCGCTGGGAAGAGGGAATC	0.483																																					p.F318Y		.											.	MAPK10	1402	0			c.T953A						.						133.0	119.0	124.0					4																	86988958		2203	4300	6503	SO:0001583	missense	5602	exon10			GCTGGGAAGAGGG	U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.953T>A	4.37:g.86988958A>T	ENSP00000352157:p.Phe318Tyr	197.0	1.0		154.0	52.0	NM_002753	A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Missense_Mutation	SNP	ENST00000359221.3	37	CCDS34026.1	.	.	.	.	.	.	.	.	.	.	A	34	5.396526	0.96009	.	.	ENSG00000109339	ENST00000395169;ENST00000359221;ENST00000395157;ENST00000361569;ENST00000395166;ENST00000395160;ENST00000449047;ENST00000395161	D;D;D;D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63;-1.63;-1.63;-1.63	5.28	5.28	0.74379	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.84991	0.5595	N	0.17901	0.54	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.87641	0.2522	10	0.87932	D	0	-19.4389	15.5104	0.75776	1.0:0.0:0.0:0.0	.	204;173;280;318;318	B7Z1Z1;Q499Y8;P53779-3;P53779-2;P53779	.;.;.;.;MK10_HUMAN	Y	280;318;173;318;280;173;173;318	ENSP00000378598:F280Y;ENSP00000352157:F318Y;ENSP00000378586:F173Y;ENSP00000355297:F318Y;ENSP00000378595:F280Y;ENSP00000378589:F173Y;ENSP00000414469:F173Y;ENSP00000378590:F318Y	ENSP00000352157:F318Y	F	-	2	0	MAPK10	87207982	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.279000	0.95777	2.111000	0.64477	0.533000	0.62120	TTC	.		0.483	MAPK10-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000361363.2		
MAVS	57506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	3845079	3845079	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr20:3845079G>T	ENST00000428216.2	+	6	930	c.802G>T	c.(802-804)Gag>Tag	p.E268*	MAVS_ENST00000358134.6_3'UTR|MAVS_ENST00000416600.2_Nonsense_Mutation_p.E127*	NM_020746.4	NP_065797.2	Q7Z434	MAVS_HUMAN	mitochondrial antiviral signaling protein	268					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of IP-10 production (GO:0071660)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of peroxisome organization (GO:1900063)|RIG-I signaling pathway (GO:0039529)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	CARD domain binding (GO:0050700)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						AGGGGCTGCAGAGGGTAAACA	0.622																																					p.E268X		.											.	MAVS	90	0			c.G802T						.						55.0	50.0	51.0					20																	3845079		2203	4300	6503	SO:0001587	stop_gained	57506	exon6			GCTGCAGAGGGTA	DQ174270	CCDS33437.1, CCDS56176.1	20p13	2009-04-02			ENSG00000088888	ENSG00000088888			29233	protein-coding gene	gene with protein product	"""virus-induced signaling adaptor"", ""IFN-B promoter stimulator 1"", ""CARD adaptor inducing IFN-beta"""	609676				16125763, 16153868	Standard	NM_020746		Approved	VISA, KIAA1271, IPS-1, Cardif	uc002wjw.4	Q7Z434	OTTHUMG00000031765	ENST00000428216.2:c.802G>T	20.37:g.3845079G>T	ENSP00000401980:p.Glu268*	55.0	0.0		53.0	21.0	NM_020746	A8K6X0|B2BD33|B2BD34|F5H6C8|Q2HWT5|Q3I0Y2|Q5T7I6|Q86VY7|Q9H1H3|Q9H4Y1|Q9H8D3|Q9ULE9	Nonsense_Mutation	SNP	ENST00000428216.2	37	CCDS33437.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.965305	0.92855	.	.	ENSG00000088888	ENST00000416600;ENST00000428216	.	.	.	4.3	2.34	0.29019	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	6.6829	0.23129	0.2193:0.0:0.7807:0.0	.	.	.	.	X	127;268	.	ENSP00000413749:E127X	E	+	1	0	MAVS	3793079	0.207000	0.23482	0.010000	0.14722	0.014000	0.08584	1.591000	0.36665	0.567000	0.29293	0.467000	0.42956	GAG	.		0.622	MAVS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077784.3	NM_020746	
MBOAT1	154141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	20124766	20124766	+	Missense_Mutation	SNP	C	C	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr6:20124766C>A	ENST00000324607.7	-	8	944	c.780G>T	c.(778-780)aaG>aaT	p.K260N	MBOAT1_ENST00000541730.1_Missense_Mutation_p.K111N	NM_001080480.1	NP_001073949.1	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain containing 1	260					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(5)	20	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)			CAGGAAAGGTCTTCGTTAGCG	0.473																																					p.K260N		.											.	MBOAT1	68	0			c.G780T						.						179.0	154.0	163.0					6																	20124766		2203	4300	6503	SO:0001583	missense	154141	exon8			AAAGGTCTTCGTT	AK093994	CCDS34346.1	6p22.3	2013-10-11	2006-06-29	2006-06-29	ENSG00000172197	ENSG00000172197			21579	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 1"""	611732	"""O-acyltransferase (membrane bound) domain containing 1"""	OACT1		18287005	Standard	NM_001080480		Approved	MGC44669, dJ434O11.1, LPEAT1	uc003ncx.2	Q6ZNC8	OTTHUMG00000014334	ENST00000324607.7:c.780G>T	6.37:g.20124766C>A	ENSP00000324944:p.Lys260Asn	148.0	0.0		172.0	75.0	NM_001080480	A9EDQ5|B4DL59|B4E3J4|Q86XC2|Q8N9R5	Missense_Mutation	SNP	ENST00000324607.7	37	CCDS34346.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.945034	0.53079	.	.	ENSG00000172197	ENST00000541730;ENST00000324607	T;T	0.72725	-0.68;-0.68	5.48	4.6	0.57074	.	0.150507	0.64402	D	0.000015	T	0.58075	0.2097	L	0.48218	1.51	0.80722	D	1	B;P	0.43885	0.1;0.82	B;P	0.47786	0.049;0.557	T	0.53982	-0.8361	10	0.15499	T	0.54	-14.2729	14.0304	0.64613	0.0:0.9272:0.0:0.0728	.	111;260	Q6ZNC8-2;Q6ZNC8	.;MBOA1_HUMAN	N	111;260	ENSP00000441568:K111N;ENSP00000324944:K260N	ENSP00000324944:K260N	K	-	3	2	MBOAT1	20232745	1.000000	0.71417	0.999000	0.59377	0.699000	0.40488	2.991000	0.49409	2.739000	0.93911	0.561000	0.74099	AAG	.		0.473	MBOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039980.1		
MGAT2	4247	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	14	50089030	50089030	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr14:50089030G>A	ENST00000305386.2	+	1	1542	c.1044G>A	c.(1042-1044)tgG>tgA	p.W348*	RPL36AL_ENST00000298289.6_5'Flank|RP11-649E7.5_ENST00000555043.1_RNA	NM_002408.3	NP_002399.1	Q10469	MGAT2_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase	348					cellular protein metabolic process (GO:0044267)|oligosaccharide biosynthetic process (GO:0009312)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-1,6-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity (GO:0008455)|carbohydrate binding (GO:0030246)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)	11	all_epithelial(31;0.0021)|Breast(41;0.0124)					ACTGGGACTGGACTCTTCAAT	0.438																																					p.W348X		.											.	MGAT2	90	0			c.G1044A						.						143.0	136.0	138.0					14																	50089030		2203	4300	6503	SO:0001587	stop_gained	4247	exon1			GGACTGGACTCTT	U15128	CCDS9690.1	14q21	2013-02-25			ENSG00000168282	ENSG00000168282	2.4.1.143	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7045	protein-coding gene	gene with protein product		602616				7635144	Standard	NM_002408		Approved	GNT-II	uc001wwr.3	Q10469	OTTHUMG00000140271	ENST00000305386.2:c.1044G>A	14.37:g.50089030G>A	ENSP00000307423:p.Trp348*	92.0	0.0		90.0	22.0	NM_002408	B3KPC5|B3KQM0	Nonsense_Mutation	SNP	ENST00000305386.2	37	CCDS9690.1	.	.	.	.	.	.	.	.	.	.	G	40	8.467835	0.98825	.	.	ENSG00000168282	ENST00000305386;ENST00000504161	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.3904	19.7004	0.96050	0.0:0.0:1.0:0.0	.	.	.	.	X	348;354	.	ENSP00000307423:W348X	W	+	3	0	MGAT2	49158780	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.029000	0.88807	2.657000	0.90304	0.555000	0.69702	TGG	.		0.438	MGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276807.1	NM_002408	
MLLT3	4300	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	20414373	20414373	+	Silent	SNP	G	G	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr9:20414373G>A	ENST00000380338.4	-	5	757	c.471C>T	c.(469-471)agC>agT	p.S157S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S154S	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	157	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S157S(5)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctgctactgctgc	0.527			T	MLL	ALL																																p.S157S		.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	.	MLLT3	660	5	Substitution - coding silent(5)	endometrium(3)|urinary_tract(1)|prostate(1)	c.C471T						.						9.0	14.0	12.0					9																	20414373		1757	3647	5404	SO:0001819	synonymous_variant	4300	exon5			GCTGCTGCTACTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.471C>T	9.37:g.20414373G>A		32.0	0.0		33.0	5.0	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
MYO1A	4640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57432386	57432386	+	Missense_Mutation	SNP	T	T	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr12:57432386T>A	ENST00000442789.2	-	18	1857	c.1570A>T	c.(1570-1572)Aat>Tat	p.N524Y	MYO1A_ENST00000300119.3_Missense_Mutation_p.N524Y|MYO1A_ENST00000544473.1_Missense_Mutation_p.N362Y|MYO1A_ENST00000476795.1_5'UTR	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	524	Myosin motor.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						AGTAGGTCATTATTCTTGTCA	0.532																																					p.N524Y		.											.	MYO1A	231	0			c.A1570T						.						93.0	84.0	87.0					12																	57432386		2203	4300	6503	SO:0001583	missense	4640	exon17			GGTCATTATTCTT	L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.1570A>T	12.37:g.57432386T>A	ENSP00000393392:p.Asn524Tyr	89.0	0.0		83.0	13.0	NM_005379	Q9UQD7	Missense_Mutation	SNP	ENST00000442789.2	37	CCDS8929.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.395588	0.83011	.	.	ENSG00000166866	ENST00000300119;ENST00000442789;ENST00000544473	D;D;D	0.87809	-2.3;-2.3;-2.3	4.94	4.94	0.65067	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.93926	0.8056	M	0.88450	2.955	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.94816	0.7983	10	0.87932	D	0	.	12.8538	0.57873	0.0:0.0:0.0:1.0	.	524	Q9UBC5	MYO1A_HUMAN	Y	524;524;362	ENSP00000300119:N524Y;ENSP00000393392:N524Y;ENSP00000440514:N362Y	ENSP00000300119:N524Y	N	-	1	0	MYO1A	55718653	1.000000	0.71417	0.989000	0.46669	0.995000	0.86356	8.040000	0.89188	2.004000	0.58718	0.459000	0.35465	AAT	.		0.532	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313833.2	NM_005379	
MTERF2	80298	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	107372216	107372216	+	Missense_Mutation	SNP	C	C	G			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr12:107372216C>G	ENST00000552029.1	-	2	2345	c.277G>C	c.(277-279)Gct>Cct	p.A93P	MTERFD3_ENST00000392830.2_Missense_Mutation_p.A93P|MTERFD3_ENST00000240050.4_Missense_Mutation_p.A93P|C12orf23_ENST00000551237.1_3'UTR			Q49AM1	MTEF2_HUMAN		93					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	transcription regulatory region DNA binding (GO:0044212)			breast(1)|kidney(1)|large_intestine(2)|lung(3)	7						CTGGCTACAGCAGTCTCATCG	0.418																																					p.A93P		.											.	MTERFD3	68	0			c.G277C						.						125.0	133.0	131.0					12																	107372216		2203	4300	6503	SO:0001583	missense	80298	exon3			CTACAGCAGTCTC																												ENST00000552029.1:c.277G>C	12.37:g.107372216C>G	ENSP00000447651:p.Ala93Pro	75.0	0.0		80.0	43.0	NM_001033050	Q53HM2|Q9H4L6|Q9H7Y9	Missense_Mutation	SNP	ENST00000552029.1	37	CCDS9111.1	.	.	.	.	.	.	.	.	.	.	C	15.83	2.949348	0.53186	.	.	ENSG00000120832	ENST00000392830;ENST00000240050;ENST00000552029;ENST00000548101	T;T;T;T	0.11712	2.75;2.75;2.75;2.75	5.82	1.89	0.25635	.	0.587930	0.18669	N	0.134515	T	0.09992	0.0245	L	0.54323	1.7	0.09310	N	1	P	0.47484	0.896	B	0.42827	0.399	T	0.18618	-1.0331	10	0.31617	T	0.26	0.387	4.1989	0.10457	0.3743:0.3815:0.0:0.2442	.	93	Q49AM1	MTER3_HUMAN	P	93	ENSP00000376575:A93P;ENSP00000240050:A93P;ENSP00000447651:A93P;ENSP00000448343:A93P	ENSP00000240050:A93P	A	-	1	0	MTERFD3	105896346	0.000000	0.05858	0.001000	0.08648	0.989000	0.77384	-0.185000	0.09684	0.349000	0.23975	0.557000	0.71058	GCT	.		0.418	MTERFD3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406835.1		
NCOA5	57727	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	44695721	44695721	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr20:44695721delG	ENST00000290231.6	-	5	766	c.602delC	c.(601-603)tctfs	p.S201fs		NM_020967.2	NP_066018.1	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5	201					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				CACAATCACAGAACAATCAAC	0.443																																					p.S201fs		.											.	NCOA5	226	0			c.602delC						.						105.0	101.0	102.0					20																	44695721		2203	4300	6503	SO:0001589	frameshift_variant	57727	exon5			ATCACAGAACAAT		CCDS13392.1	20q12-q13.12	2008-07-02			ENSG00000124160	ENSG00000124160			15909	protein-coding gene	gene with protein product	"""coactivator independent of AF-2"""					11780052, 11113208	Standard	XM_005260474		Approved	bA465L10.6, CIA	uc002xre.3	Q9HCD5	OTTHUMG00000032639	ENST00000290231.6:c.602delC	20.37:g.44695721delG	ENSP00000290231:p.Ser201fs	139.0	0.0		164.0	71.0	NM_020967	B2RTV9|E1P5R0|Q6HA99|Q9H1F2|Q9H2T2|Q9H4Y9	Frame_Shift_Del	DEL	ENST00000290231.6	37	CCDS13392.1																																																																																			.		0.443	NCOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079559.1	NM_020967	
NEU3	10825	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	74716816	74716816	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr11:74716816G>A	ENST00000544263.1	+	4	736	c.566G>A	c.(565-567)tGc>tAc	p.C189Y	NEU3_ENST00000294064.4_Missense_Mutation_p.C222Y|NEU3_ENST00000545272.1_Missense_Mutation_p.C113Y|NEU3_ENST00000529024.1_Intron|NEU3_ENST00000532963.1_3'UTR|NEU3_ENST00000531509.1_Missense_Mutation_p.C222Y			Q9UQ49	NEUR3_HUMAN	sialidase 3 (membrane sialidase)	189					carbohydrate metabolic process (GO:0005975)|ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha-sialidase activity (GO:0016997)|exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			kidney(2)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	11						TGGTTCTTTTGCTTCCAGCTA	0.522																																					p.C222Y		.											.	NEU3	24	0			c.G665A						.						117.0	113.0	115.0					11																	74716816		2004	4181	6185	SO:0001583	missense	10825	exon3			TCTTTTGCTTCCA	AB008185	CCDS44682.1	11q13.5	2008-02-05				ENSG00000162139			7760	protein-coding gene	gene with protein product		604617				10405317	Standard	NM_006656		Approved		uc001ovw.3	Q9UQ49		ENST00000544263.1:c.566G>A	11.37:g.74716816G>A	ENSP00000445591:p.Cys189Tyr	46.0	0.0		44.0	15.0	NM_006656	A8K327|Q9NQE1	Missense_Mutation	SNP	ENST00000544263.1	37		.	.	.	.	.	.	.	.	.	.	G	11.75	1.732755	0.30684	.	.	ENSG00000162139	ENST00000294064;ENST00000531509;ENST00000544263;ENST00000545272	D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72	5.44	4.51	0.55191	Neuraminidase (2);	0.250108	0.48286	D	0.000184	D	0.90170	0.6928	M	0.82323	2.585	0.32312	N	0.563545	D;D	0.61697	0.98;0.99	P;D	0.63877	0.816;0.919	D	0.92456	0.5974	10	0.59425	D	0.04	-8.5172	13.2135	0.59839	0.0:0.0:0.84:0.16	.	189;222	Q9UQ49;A8K327	NEUR3_HUMAN;.	Y	222;222;189;113	ENSP00000294064:C222Y;ENSP00000432097:C222Y;ENSP00000445591:C189Y;ENSP00000439908:C113Y	ENSP00000294064:C222Y	C	+	2	0	NEU3	74394464	0.000000	0.05858	0.804000	0.32291	0.079000	0.17450	0.299000	0.19138	1.481000	0.48307	0.655000	0.94253	TGC	.		0.522	NEU3-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_006656	
NEU3	10825	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	74717089	74717089	+	Missense_Mutation	SNP	A	A	G			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr11:74717089A>G	ENST00000544263.1	+	4	1009	c.839A>G	c.(838-840)cAa>cGa	p.Q280R	NEU3_ENST00000294064.4_Missense_Mutation_p.Q313R|NEU3_ENST00000545272.1_Missense_Mutation_p.Q204R|NEU3_ENST00000529024.1_Intron|NEU3_ENST00000532963.1_3'UTR|NEU3_ENST00000531509.1_Missense_Mutation_p.Q313R			Q9UQ49	NEUR3_HUMAN	sialidase 3 (membrane sialidase)	280					carbohydrate metabolic process (GO:0005975)|ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha-sialidase activity (GO:0016997)|exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			kidney(2)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	11						CATGGTTGCCAAGGGAGTGTG	0.592																																					p.Q313R		.											.	NEU3	24	0			c.A938G						.						42.0	45.0	44.0					11																	74717089		1982	4153	6135	SO:0001583	missense	10825	exon3			GTTGCCAAGGGAG	AB008185	CCDS44682.1	11q13.5	2008-02-05				ENSG00000162139			7760	protein-coding gene	gene with protein product		604617				10405317	Standard	NM_006656		Approved		uc001ovw.3	Q9UQ49		ENST00000544263.1:c.839A>G	11.37:g.74717089A>G	ENSP00000445591:p.Gln280Arg	37.0	0.0		31.0	6.0	NM_006656	A8K327|Q9NQE1	Missense_Mutation	SNP	ENST00000544263.1	37		.	.	.	.	.	.	.	.	.	.	A	20.3	3.968491	0.74131	.	.	ENSG00000162139	ENST00000294064;ENST00000531509;ENST00000544263;ENST00000545272	D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04	5.35	5.35	0.76521	Neuraminidase (2);	0.105769	0.64402	D	0.000003	D	0.92919	0.7747	M	0.88979	2.995	0.49299	D	0.99977	D;D	0.76494	0.999;0.999	D;D	0.79108	0.992;0.992	D	0.93778	0.7081	10	0.62326	D	0.03	-16.2685	13.3289	0.60475	1.0:0.0:0.0:0.0	.	280;313	Q9UQ49;A8K327	NEUR3_HUMAN;.	R	313;313;280;204	ENSP00000294064:Q313R;ENSP00000432097:Q313R;ENSP00000445591:Q280R;ENSP00000439908:Q204R	ENSP00000294064:Q313R	Q	+	2	0	NEU3	74394737	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.761000	0.91691	2.247000	0.74100	0.482000	0.46254	CAA	.		0.592	NEU3-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_006656	
OR10J1	26476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	159410510	159410510	+	Silent	SNP	G	G	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr1:159410510G>A	ENST00000423932.3	+	1	999	c.962G>A	c.(961-963)tGa>tAa	p.*321*	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	0					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					AAGTTTTCCTGACCATGTAGG	0.488																																					p.X321X		.											.	OR10J1	69	0			c.G962A						.						63.0	64.0	63.0					1																	159410510		2203	4300	6503	SO:0001819	synonymous_variant	26476	exon1			TTTCCTGACCATG	X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.962G>A	1.37:g.159410510G>A		40.0	0.0		42.0	25.0	NM_012351	Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Silent	SNP	ENST00000423932.3	37	CCDS1185.1																																																																																			.		0.488	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059020.1	NM_012351	
OR51G2	81282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4936112	4936112	+	Missense_Mutation	SNP	A	A	G			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr11:4936112A>G	ENST00000322013.3	-	1	810	c.782T>C	c.(781-783)aTt>aCt	p.I261T	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005238.1	NP_001005238.1	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G, member 2	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|large_intestine(9)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGAGAGGCCAATCATGGGAGT	0.542																																					p.I261T		.											.	OR51G2	70	0			c.T782C						.						147.0	127.0	134.0					11																	4936112		2201	4298	6499	SO:0001583	missense	81282	exon1			AGGCCAATCATGG	AB065794	CCDS31365.1	11p15.4	2012-08-09			ENSG00000176893	ENSG00000176893		"""GPCR / Class A : Olfactory receptors"""	15198	protein-coding gene	gene with protein product							Standard	NM_001005238		Approved		uc001lzr.1	Q8NGK0	OTTHUMG00000066501	ENST00000322013.3:c.782T>C	11.37:g.4936112A>G	ENSP00000322593:p.Ile261Thr	118.0	0.0		110.0	23.0	NM_001005238	Q6IFH7	Missense_Mutation	SNP	ENST00000322013.3	37	CCDS31365.1	.	.	.	.	.	.	.	.	.	.	A	16.97	3.269426	0.59540	.	.	ENSG00000176893	ENST00000322013	T	0.00152	8.66	5.48	5.48	0.80851	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000099	T	0.00695	0.0023	M	0.93375	3.41	0.37194	D	0.90405	D	0.89917	1.0	D	0.91635	0.999	T	0.59451	-0.7452	10	0.72032	D	0.01	.	14.5252	0.67884	1.0:0.0:0.0:0.0	.	261	Q8NGK0	O51G2_HUMAN	T	261	ENSP00000322593:I261T	ENSP00000322593:I261T	I	-	2	0	OR51G2	4892688	0.182000	0.23173	1.000000	0.80357	0.896000	0.52359	4.338000	0.59316	2.297000	0.77311	0.533000	0.62120	ATT	.		0.542	OR51G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142174.1	NM_001005238	
PCDHGA5	56110	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140745479	140745479	+	Missense_Mutation	SNP	C	C	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr5:140745479C>A	ENST00000518069.1	+	1	1582	c.1582C>A	c.(1582-1584)Cta>Ata	p.L528I	PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	528	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTGAGAGACCTACAGTTGTG	0.537																																					p.L528I		.											.	PCDHGA5	35	0			c.C1582A						.						189.0	207.0	201.0					5																	140745479		2200	4298	6498	SO:0001583	missense	56110	exon1			AGAGACCTACAGT	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.1582C>A	5.37:g.140745479C>A	ENSP00000429834:p.Leu528Ile	81.0	0.0		82.0	16.0	NM_032054	Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	37	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	5.391	0.257373	0.10239	.	.	ENSG00000253485	ENST00000518069	T	0.51325	0.71	4.84	-0.0812	0.13703	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.29716	0.0742	N	0.10645	0.015	0.09310	N	1	B;P	0.38440	0.242;0.631	B;P	0.44811	0.331;0.461	T	0.21314	-1.0249	9	0.42905	T	0.14	.	5.47	0.16664	0.1268:0.4324:0.0:0.4408	.	528;528	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	I	528	ENSP00000429834:L528I	ENSP00000429834:L528I	L	+	1	2	PCDHGA5	140725663	0.000000	0.05858	0.353000	0.25747	0.524000	0.34500	-1.327000	0.02682	-0.261000	0.09405	-0.471000	0.05019	CTA	.		0.537	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918	
PHRF1	57661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	610529	610529	+	Missense_Mutation	SNP	C	C	T	rs201225978		TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr11:610529C>T	ENST00000264555.5	+	16	4573	c.4445C>T	c.(4444-4446)cCg>cTg	p.P1482L	PHRF1_ENST00000413872.2_Missense_Mutation_p.P1480L|PHRF1_ENST00000416188.2_Missense_Mutation_p.P1481L|PHRF1_ENST00000533464.1_Missense_Mutation_p.P1478L	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	1482					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						CCGCCTGCCCCGGCCCAGCCC	0.687													C|||	1	0.000199681	0.0	0.0	5008	,	,		15432	0.0		0.0	False		,,,				2504	0.001				p.P1481L		.											.	PHRF1	22	0			c.C4442T						.		LEU/PRO	2,3954		0,2,1976	14.0	18.0	17.0		4442	-5.4	0.0	11		17	3,8263		0,3,4130	no	missense	PHRF1	NM_020901.2	98	0,5,6106	TT,TC,CC		0.0363,0.0506,0.0409	benign	1481/1649	610529	5,12217	1978	4133	6111	SO:0001583	missense	57661	exon16			CTGCCCCGGCCCA	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.4445C>T	11.37:g.610529C>T	ENSP00000264555:p.Pro1482Leu	23.0	0.0		15.0	7.0	NM_020901	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	37		.	.	.	.	.	.	.	.	.	.	c	5.063	0.197280	0.09599	5.06E-4	3.63E-4	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38	3.77	-5.37	0.02681	.	1.440870	0.05223	N	0.508816	T	0.63534	0.2519	N	0.12746	0.255	0.09310	N	1	B;B;B;B	0.09022	0.002;0.0;0.0;0.0	B;B;B;B	0.06405	0.002;0.001;0.0;0.0	T	0.50030	-0.8875	10	0.33141	T	0.24	-0.3714	11.4847	0.50346	0.0:0.3298:0.0:0.6702	.	1478;1480;1481;1482	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	L	1482;1480;1481;1478	ENSP00000264555:P1482L;ENSP00000388589:P1480L;ENSP00000410626:P1481L;ENSP00000431870:P1478L	ENSP00000264555:P1482L	P	+	2	0	PHRF1	600529	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.001000	0.12947	-1.143000	0.02866	-0.452000	0.05504	CCG	.		0.687	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
P2RY11	5032	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10225190	10225190	+	Missense_Mutation	SNP	G	G	A	rs368706939		TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr19:10225190G>A	ENST00000321826.4	+	2	1085	c.901G>A	c.(901-903)Gtg>Atg	p.V301M	PPAN-P2RY11_ENST00000393796.4_Missense_Mutation_p.V721M|PPAN-P2RY11_ENST00000428358.1_3'UTR|PPAN_ENST00000556468.1_Missense_Mutation_p.V721M	NM_002566.4	NP_002557.2	Q96G91	P2Y11_HUMAN	purinergic receptor P2Y, G-protein coupled, 11	301					activation of adenylate cyclase activity (GO:0007190)|adenosine receptor signaling pathway (GO:0001973)|calcium-mediated signaling (GO:0019722)|cellular response to ATP (GO:0071318)|defense response (GO:0006952)|G-protein coupled receptor signaling pathway (GO:0007186)|neuronal signal transduction (GO:0023041)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|neurotransmitter receptor activity (GO:0030594)|receptor activity (GO:0004872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)	16			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			GGGGCCCTACGTGGGCTACCA	0.682																																					p.V721M		.											.	PPAN-P2RY11	24	0			c.G2161A						.	G	,MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	34.0	39.0	37.0		,901,2161	-6.0	0.0	19		37	0,8594		0,0,4297	no	utr-3,missense,missense	P2RY11,PPAN-P2RY11	NM_001198690.1,NM_002566.4,NM_001040664.2	,21,21	0,1,6499	AA,AG,GG		0.0,0.0227,0.0077	,benign,benign	,301/375,721/795	10225190	1,12999	2203	4297	6500	SO:0001583	missense	692312	exon13			CCCTACGTGGGCT	AF030335	CCDS12226.1	19p13.2	2012-08-08			ENSG00000244165	ENSG00000244165		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8540	protein-coding gene	gene with protein product		602697				9405388	Standard	NM_002566		Approved	P2Y11		Q96G91	OTTHUMG00000150166	ENST00000321826.4:c.901G>A	19.37:g.10225190G>A	ENSP00000323872:p.Val301Met	38.0	0.0		43.0	23.0	NM_001040664	B2R8X9|O43190|Q9BYU4|Q9H170	Missense_Mutation	SNP	ENST00000321826.4	37	CCDS12226.1	.	.	.	.	.	.	.	.	.	.	g	11.09	1.537842	0.27475	2.27E-4	0.0	ENSG00000243207;ENSG00000130810;ENSG00000244165	ENST00000393796;ENST00000556468;ENST00000321826	T;T;T	0.38560	1.13;1.13;1.13	3.9	-5.96	0.02234	GPCR, rhodopsin-like superfamily (1);	2.978600	0.01887	N	0.038306	T	0.29061	0.0722	L	0.50333	1.59	0.09310	N	1	B	0.27732	0.187	B	0.19148	0.024	T	0.07558	-1.0766	10	0.41790	T	0.15	-3.5446	0.4229	0.00459	0.2271:0.1813:0.2997:0.292	.	301	Q96G91	P2Y11_HUMAN	M	721;721;301	ENSP00000377385:V721M;ENSP00000450710:V721M;ENSP00000323872:V301M	ENSP00000323872:V301M	V	+	1	0	PPAN;P2RY11;PPAN-P2RY11	10086190	0.000000	0.05858	0.002000	0.10522	0.928000	0.56348	-0.681000	0.05191	-1.261000	0.02462	-0.319000	0.08680	GTG	.		0.682	P2RY11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316664.2	NM_002566	
PRDM2	7799	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	14105088	14105088	+	Missense_Mutation	SNP	G	G	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr1:14105088G>T	ENST00000235372.7	+	8	1654	c.798G>T	c.(796-798)ttG>ttT	p.L266F	PRDM2_ENST00000311066.5_Missense_Mutation_p.L266F|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000413440.1_Missense_Mutation_p.L65F|PRDM2_ENST00000343137.4_Missense_Mutation_p.L65F	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	266					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		TGAATGATTTgggggaagagg	0.547																																					p.L266F		.											.	PRDM2	116	0			c.G798T						.						43.0	45.0	45.0					1																	14105088		2203	4300	6503	SO:0001583	missense	7799	exon8			TGATTTGGGGGAA	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.798G>T	1.37:g.14105088G>T	ENSP00000235372:p.Leu266Phe	174.0	0.0		131.0	8.0	NM_015866	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	G	11.18	1.562032	0.27915	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137;ENST00000407521	T;T;T;T	0.01787	4.78;4.64;4.68;4.68	5.66	5.66	0.87406	.	0.816321	0.11400	N	0.567889	T	0.02047	0.0064	L	0.46157	1.445	0.36063	D	0.841608	P;P;P	0.37636	0.468;0.468;0.603	B;B;B	0.30495	0.086;0.054;0.116	T	0.55237	-0.8172	10	0.10902	T	0.67	.	11.7344	0.51757	0.0807:0.0:0.9193:0.0	.	124;266;266	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	F	266;266;266;65;65;65	ENSP00000235372:L266F;ENSP00000312352:L266F;ENSP00000411103:L65F;ENSP00000341621:L65F	ENSP00000235372:L266F	L	+	3	2	PRDM2	13977675	0.981000	0.34729	0.996000	0.52242	0.853000	0.48598	0.977000	0.29475	2.662000	0.90505	0.555000	0.69702	TTG	.		0.547	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
PRKDC	5591	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	48701573	48701573	+	Missense_Mutation	SNP	G	G	A	rs147753989	byFrequency	TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr8:48701573G>A	ENST00000314191.2	-	77	10849	c.10793C>T	c.(10792-10794)aCc>aTc	p.T3598I	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Missense_Mutation_p.T3598I	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3599					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	ATTTACAGGGGTTTTTGCTAG	0.383								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	.											.	PRKDC	1515	0			.						.						80.0	73.0	75.0					8																	48701573		1791	4062	5853	SO:0001583	missense	5591	.			ACAGGGGTTTTTG		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.10793C>T	8.37:g.48701573G>A	ENSP00000313420:p.Thr3598Ile	127.0	1.0		272.0	193.0	.	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		.	.	.	.	.	.	.	.	.	.	G	12.59	1.982943	0.34942	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.02606	4.3;4.23	5.79	-7.36	0.01417	.	0.738737	0.13678	N	0.370398	T	0.03434	0.0099	L	0.56769	1.78	0.09310	N	1	B;B	0.27732	0.187;0.022	B;B	0.31337	0.128;0.036	T	0.11494	-1.0585	10	0.46703	T	0.11	.	10.7803	0.46374	0.059:0.063:0.6962:0.1819	.	3598;3599	E7EUY0;P78527	.;PRKDC_HUMAN	I	3598	ENSP00000313420:T3598I;ENSP00000345182:T3598I	ENSP00000313420:T3598I	T	-	2	0	PRKDC	48864126	0.013000	0.17824	0.000000	0.03702	0.617000	0.37484	0.362000	0.20284	-1.675000	0.01459	0.655000	0.94253	ACC	G|0.999;C|0.001		0.383	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
R3HDM2	22864	bcgsc.ca;mdanderson.org	37	12	57662147	57662147	+	Missense_Mutation	SNP	G	G	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr12:57662147G>T	ENST00000347140.3	-	18	2317	c.1927C>A	c.(1927-1929)Cca>Aca	p.P643T	R3HDM2_ENST00000546843.1_5'UTR|R3HDM2_ENST00000413953.2_Missense_Mutation_p.P370T|R3HDM2_ENST00000403821.2_Missense_Mutation_p.P677T|RP11-123K3.4_ENST00000548184.1_3'UTR|R3HDM2_ENST00000402412.1_Missense_Mutation_p.P657T|R3HDM2_ENST00000441731.2_Missense_Mutation_p.P338T|R3HDM2_ENST00000358907.2_Missense_Mutation_p.P643T			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	643	Gln-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						CCCGCTGCTGGGAGGCCTCCT	0.592																																					p.P643T		.											.	R3HDM2	92	0			c.C1927A						.						94.0	79.0	84.0					12																	57662147		2203	4300	6503	SO:0001583	missense	22864	exon16			CTGCTGGGAGGCC	AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.1927C>A	12.37:g.57662147G>T	ENSP00000317903:p.Pro643Thr	40.0	1.0		59.0	30.0	NM_014925	Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	ENST00000347140.3	37	CCDS8937.2	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224254	0.79576	.	.	ENSG00000179912	ENST00000413953;ENST00000393811;ENST00000347140;ENST00000402412;ENST00000358907;ENST00000441731;ENST00000429355;ENST00000403821;ENST00000548161	T;T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69	5.42	5.42	0.78866	.	0.090096	0.47093	D	0.000244	T	0.45617	0.1351	L	0.55481	1.735	0.38964	D	0.958615	P;B;B;P	0.40731	0.455;0.319;0.319;0.728	B;B;B;B	0.35770	0.127;0.127;0.127;0.21	T	0.53858	-0.8379	10	0.54805	T	0.06	-7.1563	18.3892	0.90477	0.0:0.0:1.0:0.0	.	677;657;643;370	B5MCG9;B5MCU0;Q9Y2K5;E9PAL1	.;.;R3HD2_HUMAN;.	T	370;370;643;657;643;338;408;677;32	ENSP00000409146:P370T;ENSP00000377400:P370T;ENSP00000317903:P643T;ENSP00000385839:P657T;ENSP00000351784:P643T;ENSP00000408536:P338T;ENSP00000394676:P408T;ENSP00000385169:P677T	ENSP00000317903:P643T	P	-	1	0	R3HDM2	55948414	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	4.480000	0.60243	2.713000	0.92767	0.650000	0.86243	CCA	.		0.592	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2	NM_014925	
RARS2	57038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	88227931	88227931	+	Silent	SNP	A	A	G			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr6:88227931A>G	ENST00000369536.5	-	17	1512	c.1467T>C	c.(1465-1467)tgT>tgC	p.C489C	RARS2_ENST00000497828.1_5'Flank	NM_020320.3	NP_064716.2	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	489					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		GCTCTTGTAAACAAGCAGTGT	0.353																																					p.C489C		.											.	RARS2	92	0			c.T1467C						.						168.0	167.0	167.0					6																	88227931		2203	4300	6503	SO:0001819	synonymous_variant	57038	exon17			TTGTAAACAAGCA	AK093934	CCDS5011.1	6q16.1	2011-07-01	2007-09-27	2007-02-23	ENSG00000146282	ENSG00000146282	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	21406	protein-coding gene	gene with protein product	"""arginine tRNA ligase 2, mitochondrial (putative)"""	611524	"""arginyl-tRNA synthetase-like"""	RARSL		17847012	Standard	NM_020320		Approved	MGC14993, MGC23778, PRO1992, dJ382I10.6, DALRD2	uc003pme.3	Q5T160	OTTHUMG00000015178	ENST00000369536.5:c.1467T>C	6.37:g.88227931A>G		106.0	0.0		123.0	20.0	NM_020320	B2RDT7|Q96FU5|Q9H8K8	Silent	SNP	ENST00000369536.5	37	CCDS5011.1																																																																																			.		0.353	RARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041448.1	NM_020320	
RBP3	5949	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	48389261	48389261	+	Silent	SNP	C	C	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr10:48389261C>T	ENST00000224600.4	-	1	1730	c.1617G>A	c.(1615-1617)ctG>ctA	p.L539L	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	539	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	GGCTGGTGAGCAGATACACCC	0.642																																					p.L539L		.											.	RBP3	153	0			c.G1617A						.						39.0	40.0	40.0					10																	48389261		2202	4300	6502	SO:0001819	synonymous_variant	5949	exon1			GGTGAGCAGATAC	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.1617G>A	10.37:g.48389261C>T		44.0	0.0		34.0	4.0	NM_002900	Q0QD34|Q5VSR0|Q8IXN0	Silent	SNP	ENST00000224600.4	37	CCDS7218.1																																																																																			.		0.642	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900	
SCN7A	6332	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	167273323	167273323	+	Missense_Mutation	SNP	T	T	G			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr2:167273323T>G	ENST00000409855.1	-	20	3434	c.3308A>C	c.(3307-3309)aAt>aCt	p.N1103T		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1103					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	CCGACTCTTATTCATGACTTC	0.378																																					p.N1103T		.											.	SCN7A	67	0			c.A3308C						.						108.0	96.0	99.0					2																	167273323		1871	4101	5972	SO:0001583	missense	6332	exon20			CTCTTATTCATGA	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.3308A>C	2.37:g.167273323T>G	ENSP00000386796:p.Asn1103Thr	298.0	2.0		306.0	124.0	NM_002976		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	T	12.06	1.824028	0.32237	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.97256	-4.31	4.87	4.87	0.63330	Ion transport (1);	0.000000	0.56097	D	0.000033	D	0.96250	0.8777	L	0.53617	1.68	0.47584	D	0.999461	P	0.35493	0.505	B	0.43990	0.438	D	0.96377	0.9278	10	0.72032	D	0.01	.	12.4816	0.55847	0.0:0.0:0.0:1.0	.	1103	Q01118	SCN7A_HUMAN	T	1103	ENSP00000386796:N1103T	ENSP00000259060:N1103T	N	-	2	0	SCN7A	166981569	1.000000	0.71417	0.586000	0.28679	0.015000	0.08874	5.865000	0.69583	2.060000	0.61445	0.528000	0.53228	AAT	.		0.378	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
SETBP1	26040	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	42643643	42643643	+	Missense_Mutation	SNP	G	G	C			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr18:42643643G>C	ENST00000282030.5	+	6	5067	c.4771G>C	c.(4771-4773)Gag>Cag	p.E1591Q		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1591						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CCGAGGGAGTGAGAGCGAGGT	0.692									Schinzel-Giedion syndrome																												p.E1591Q		.											.	SETBP1	155	0			c.G4771C						.						13.0	18.0	17.0					18																	42643643		2134	4112	6246	SO:0001583	missense	26040	exon6	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	GGGAGTGAGAGCG	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.4771G>C	18.37:g.42643643G>C	ENSP00000282030:p.Glu1591Gln	280.0	0.0		206.0	55.0	NM_015559	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	G	24.7	4.564599	0.86439	.	.	ENSG00000152217	ENST00000282030	T	0.71817	-0.6	4.97	4.97	0.65823	.	0.000000	0.56097	D	0.000037	T	0.75474	0.3854	N	0.24115	0.695	0.36753	D	0.882857	D	0.67145	0.996	D	0.78314	0.991	T	0.82068	-0.0640	10	0.87932	D	0	.	16.778	0.85556	0.0:0.0:1.0:0.0	.	1591	Q9Y6X0	SETBP_HUMAN	Q	1591	ENSP00000282030:E1591Q	ENSP00000282030:E1591Q	E	+	1	0	SETBP1	40897641	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.139000	0.71728	2.443000	0.82685	0.655000	0.94253	GAG	.		0.692	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110	
SFXN5	94097	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	73195621	73195621	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr2:73195621C>T	ENST00000272433.2	-	12	913	c.783G>A	c.(781-783)atG>atA	p.M261I	SFXN5_ENST00000474528.1_5'UTR|SFXN5_ENST00000410065.1_Intron	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5	261					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						CCAGGATGGGCATGGGCAGGA	0.652																																					p.M261I		.											.	SFXN5	91	0			c.G783A						.						54.0	47.0	50.0					2																	73195621		2203	4300	6503	SO:0001583	missense	94097	exon12			GATGGGCATGGGC	AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.783G>A	2.37:g.73195621C>T	ENSP00000272433:p.Met261Ile	273.0	1.0		248.0	68.0	NM_144579	A8K116|Q494Y3|Q53T29	Missense_Mutation	SNP	ENST00000272433.2	37	CCDS1922.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.75|15.75	2.926149|2.926149	0.52759|0.52759	.|.	.|.	ENSG00000144040|ENSG00000144040	ENST00000411783|ENST00000272433	.|T	.|0.27104	.|1.69	5.23|5.23	5.23|5.23	0.72850|0.72850	.|.	.|0.040430	.|0.85682	.|D	.|0.000000	T|T	0.14399|0.14399	0.0348|0.0348	N|N	0.11789|0.11789	0.175|0.175	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.19935	.|0.04;0.002;0.007	.|B;B;B	.|0.23419	.|0.046;0.005;0.009	T|T	0.04976|0.04976	-1.0914|-1.0914	5|10	.|0.02654	.|T	.|1	-25.8857|-25.8857	16.3047|16.3047	0.82843|0.82843	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|110;157;261	.|B4DIJ8;B4DGS9;Q8TD22	.|.;.;SFXN5_HUMAN	Y|I	212|261	.|ENSP00000272433:M261I	.|ENSP00000272433:M261I	C|M	-|-	2|3	0|0	SFXN5|SFXN5	73049129|73049129	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.342000|7.342000	0.79310|0.79310	2.456000|2.456000	0.83038|0.83038	0.655000|0.655000	0.94253|0.94253	TGC|ATG	.		0.652	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251991.1	NM_144579	
SH3KBP1	30011	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	19560151	19560151	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chrX:19560151C>T	ENST00000397821.3	-	16	2074	c.1784G>A	c.(1783-1785)gGa>gAa	p.G595E	SH3KBP1_ENST00000379698.4_Missense_Mutation_p.G558E|SH3KBP1_ENST00000379716.1_Missense_Mutation_p.G357E|SH3KBP1_ENST00000541422.1_Missense_Mutation_p.G334E	NM_031892.2	NP_114098.1	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1	595					apoptotic process (GO:0006915)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|regulation of cell shape (GO:0008360)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(4)	29						CTTTGGTTTTCCTTCCGTGCC	0.637																																					p.G595E		.											.	SH3KBP1	130	0			c.G1784A						.						86.0	83.0	84.0					X																	19560151		2203	4300	6503	SO:0001583	missense	30011	exon16			GGTTTTCCTTCCG	AF230904	CCDS14193.1, CCDS35213.1, CCDS55383.1	Xp22.1-p21.3	2008-02-05			ENSG00000147010	ENSG00000147010			13867	protein-coding gene	gene with protein product		300374				8889549, 7566098	Standard	NM_031892		Approved	CIN85	uc004czm.3	Q96B97	OTTHUMG00000021227	ENST00000397821.3:c.1784G>A	X.37:g.19560151C>T	ENSP00000380921:p.Gly595Glu	276.0	1.0		227.0	46.0	NM_031892	B7Z1D5|Q5JPT4|Q5JPT5|Q8IWX6|Q8IX98|Q96RN4|Q9NYR0	Missense_Mutation	SNP	ENST00000397821.3	37	CCDS14193.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.597057	0.46318	.	.	ENSG00000147010	ENST00000379702;ENST00000397821;ENST00000379716;ENST00000379698;ENST00000541422;ENST00000379726	T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5	5.5	4.65	0.58169	.	0.913233	0.09687	N	0.769014	T	0.49660	0.1570	M	0.62723	1.935	0.33281	D	0.562327	D;D;D	0.76494	0.999;0.995;0.998	D;P;P	0.66084	0.941;0.843;0.904	T	0.52518	-0.8565	10	0.49607	T	0.09	-14.5975	8.4207	0.32698	0.0:0.7663:0.1504:0.0833	.	357;595;558	Q5JPT4;Q96B97;Q5JPT5	.;SH3K1_HUMAN;.	E	580;595;357;558;334;575	ENSP00000380921:G595E;ENSP00000369039:G357E;ENSP00000369020:G558E;ENSP00000442499:G334E;ENSP00000369049:G575E	ENSP00000369020:G558E	G	-	2	0	SH3KBP1	19470072	1.000000	0.71417	0.990000	0.47175	0.949000	0.60115	2.554000	0.45845	1.120000	0.41904	0.525000	0.51046	GGA	.		0.637	SH3KBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055992.1	NM_031892	
SLC2A10	81031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	45354604	45354604	+	Missense_Mutation	SNP	C	C	G			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr20:45354604C>G	ENST00000359271.2	+	2	1179	c.929C>G	c.(928-930)tCc>tGc	p.S310C		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	310					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				ATGGCCCTGTCCGTCAGTGGC	0.667																																					p.S310C		.											.	SLC2A10	91	0			c.C929G						.						72.0	64.0	66.0					20																	45354604		2203	4300	6503	SO:0001583	missense	81031	exon2			CCCTGTCCGTCAG	AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.929C>G	20.37:g.45354604C>G	ENSP00000352216:p.Ser310Cys	43.0	0.0		59.0	24.0	NM_030777	A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	ENST00000359271.2	37	CCDS13402.1	.	.	.	.	.	.	.	.	.	.	C	12.15	1.850299	0.32699	.	.	ENSG00000197496	ENST00000359271	T	0.70869	-0.52	5.76	4.82	0.62117	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.334814	0.31624	N	0.007338	T	0.63486	0.2515	L	0.41632	1.29	0.38279	D	0.942386	B	0.20052	0.041	B	0.26770	0.073	T	0.62348	-0.6873	10	0.37606	T	0.19	-1.0384	14.2173	0.65802	0.0:0.9287:0.0:0.0713	.	310	O95528	GTR10_HUMAN	C	310	ENSP00000352216:S310C	ENSP00000352216:S310C	S	+	2	0	SLC2A10	44788011	0.525000	0.26290	0.919000	0.36401	0.333000	0.28666	1.948000	0.40303	2.728000	0.93425	0.655000	0.94253	TCC	.		0.667	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079578.2		
SLC6A19	340024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	1221849	1221849	+	Missense_Mutation	SNP	C	C	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr5:1221849C>A	ENST00000304460.10	+	12	1791	c.1735C>A	c.(1735-1737)Ccg>Acg	p.P579T		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	579					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GATCTCCTACCCGAACTGGGT	0.567																																					p.P579T		.											.	SLC6A19	90	0			c.C1735A						.						114.0	103.0	107.0					5																	1221849		2203	4300	6503	SO:0001583	missense	340024	exon12			TCCTACCCGAACT	AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.1735C>A	5.37:g.1221849C>A	ENSP00000305302:p.Pro579Thr	142.0	0.0		127.0	61.0	NM_001003841	A8K446	Missense_Mutation	SNP	ENST00000304460.10	37	CCDS34130.1	.	.	.	.	.	.	.	.	.	.	C	15.10	2.733358	0.48939	.	.	ENSG00000174358	ENST00000304460	D	0.86769	-2.17	4.73	4.73	0.59995	.	0.158475	0.56097	D	0.000024	D	0.95554	0.8555	H	0.95079	3.62	0.58432	D	0.999999	D	0.89917	1.0	D	0.77004	0.989	D	0.97151	0.9831	10	0.87932	D	0	.	17.6827	0.88248	0.0:1.0:0.0:0.0	.	579	Q695T7	S6A19_HUMAN	T	579	ENSP00000305302:P579T	ENSP00000305302:P579T	P	+	1	0	SLC6A19	1274849	1.000000	0.71417	0.780000	0.31762	0.010000	0.07245	6.480000	0.73604	2.197000	0.70478	0.561000	0.74099	CCG	.		0.567	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365557.1	XM_291120	
SMYD1	150572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	88383836	88383836	+	Splice_Site	SNP	C	C	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr2:88383836C>T	ENST00000419482.2	+	2	224	c.139C>T	c.(139-141)Ctt>Ttt	p.L47F	MIR4780_ENST00000584268.1_RNA|SMYD1_ENST00000438570.1_Splice_Site_p.L47F|SMYD1_ENST00000468008.1_3'UTR|SMYD1_ENST00000444564.2_Splice_Site_p.L47F	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	47	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						CATTTCCAGCCTTGTTAATTT	0.542																																					p.L47F		.											.	SMYD1	229	0			c.C139T						.						86.0	77.0	80.0					2																	88383836		2203	4300	6503	SO:0001630	splice_region_variant	150572	exon2			TCCAGCCTTGTTA	AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.138-1C>T	2.37:g.88383836C>T		109.0	0.0		119.0	54.0	NM_198274	A0AV30|A6NE13	Missense_Mutation	SNP	ENST00000419482.2	37	CCDS33240.1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.133213	0.37630	.	.	ENSG00000115593	ENST00000419482;ENST00000444564;ENST00000438570	T;T;T	0.81078	-1.45;-1.45;2.44	5.78	4.72	0.59763	SET domain (2);	0.132566	0.52532	D	0.000074	T	0.73156	0.3551	L	0.46157	1.445	0.54753	D	0.999983	B;B	0.21225	0.053;0.005	B;B	0.22601	0.04;0.004	T	0.66031	-0.6024	10	0.10636	T	0.68	-16.8945	14.8066	0.69962	0.0:0.919:0.0:0.081	.	47;47	Q8NB12;C9JUP3	SMYD1_HUMAN;.	F	47	ENSP00000393453:L47F;ENSP00000407888:L47F;ENSP00000387482:L47F	ENSP00000393453:L47F	L	+	1	0	SMYD1	88164951	1.000000	0.71417	0.997000	0.53966	0.832000	0.47134	3.488000	0.53229	2.736000	0.93811	0.555000	0.69702	CTT	.		0.542	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338229.2	XM_097915	Missense_Mutation
SORCS3	22986	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	106849559	106849559	+	Missense_Mutation	SNP	C	C	T	rs550554404	byFrequency	TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr10:106849559C>T	ENST00000369701.3	+	6	1282	c.1055C>T	c.(1054-1056)gCg>gTg	p.A352V		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	352					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GATAAGGAGGCGGACCTGGTG	0.597													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		18789	0.0		0.0	False		,,,				2504	0.0				p.A352V	NSCLC(116;1497 1690 7108 13108 14106)	.											.	SORCS3	99	0			c.C1055T						.						106.0	91.0	96.0					10																	106849559		2203	4300	6503	SO:0001583	missense	22986	exon6			AGGAGGCGGACCT	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.1055C>T	10.37:g.106849559C>T	ENSP00000358715:p.Ala352Val	117.0	0.0		117.0	40.0	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	C	17.92	3.506937	0.64410	.	.	ENSG00000156395	ENST00000369701	T	0.32023	1.47	6.17	5.26	0.73747	VPS10 (1);	0.312497	0.35936	N	0.002894	T	0.20536	0.0494	N	0.22421	0.69	0.30867	N	0.732918	P	0.38250	0.624	B	0.31812	0.136	T	0.17623	-1.0363	10	0.72032	D	0.01	.	12.9709	0.58511	0.1616:0.8384:0.0:0.0	.	352	Q9UPU3	SORC3_HUMAN	V	352	ENSP00000358715:A352V	ENSP00000358715:A352V	A	+	2	0	SORCS3	106839549	0.967000	0.33354	0.984000	0.44739	0.971000	0.66376	2.275000	0.43399	1.606000	0.50161	-0.182000	0.12963	GCG	.		0.597	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
SP9	100131390	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	175200837	175200837	+	Missense_Mutation	SNP	A	A	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr2:175200837A>T	ENST00000394967.2	+	2	171	c.24A>T	c.(22-24)gaA>gaT	p.E8D	AC018470.1_ENST00000595354.1_Missense_Mutation_p.F439I	NM_001145250.1	NP_001138722.1	P0CG40	SP9_HUMAN	Sp9 transcription factor	8					embryonic limb morphogenesis (GO:0030326)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(1)	1						CACTCTAGGAAGAGCCGCGCT	0.647																																					p.E8D		.											.	.	.	0			c.A24T						.						72.0	71.0	71.0					2																	175200837		692	1591	2283	SO:0001583	missense	100131390	exon2			CTAGGAAGAGCCG		CCDS46453.1	2q31.1	2013-01-08	2012-12-07		ENSG00000217236	ENSG00000217236		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	30690	protein-coding gene	gene with protein product	"""zinc finger protein 990"""		"""Sp9 transcription factor homolog (mouse)"""				Standard	NM_001145250		Approved	ZNF990	uc010zem.1	P0CG40	OTTHUMG00000150371	ENST00000394967.2:c.24A>T	2.37:g.175200837A>T	ENSP00000378418:p.Glu8Asp	188.0	0.0		230.0	113.0	NM_001145250		Missense_Mutation	SNP	ENST00000394967.2	37	CCDS46453.1	.	.	.	.	.	.	.	.	.	.	A	15.94	2.981317	0.53827	.	.	ENSG00000217236	ENST00000394967	T	0.13420	2.59	4.14	2.98	0.34508	.	.	.	.	.	T	0.21550	0.0519	L	0.38953	1.18	0.45733	D	0.998632	D	0.58970	0.984	D	0.68192	0.956	T	0.01561	-1.1324	9	0.29301	T	0.29	.	8.8472	0.35177	0.9075:0.0:0.0925:0.0	.	8	P0CG40	SP9_HUMAN	D	8	ENSP00000378418:E8D	ENSP00000378418:E8D	E	+	3	2	SP9	174909083	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	3.724000	0.54962	1.647000	0.50633	0.482000	0.46254	GAA	.		0.647	SP9-001	NOVEL	not_organism_supported|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000317878.1	NM_001145250	
SREBF1	6720	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	17723609	17723613	+	Frame_Shift_Del	DEL	TGGAG	TGGAG	-	rs368174566		TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	TGGAG	TGGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr17:17723609_17723613delTGGAG	ENST00000261646.5	-	2	498_502	c.314_318delCTCCA	c.(313-318)actccafs	p.TP105fs	SREBF1_ENST00000435530.2_Frame_Shift_Del_p.TP105fs|SREBF1_ENST00000355815.4_Frame_Shift_Del_p.TP135fs|SREBF1_ENST00000395757.1_5'Flank|SREBF1_ENST00000583732.1_Intron|SREBF1_ENST00000338854.5_Frame_Shift_Del_p.TP105fs	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	105	Pro/Ser-rich.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						ACATCTTCAATGGAGTGGGTGCAGG	0.634																																					p.135_136del		.											.	SREBF1	91	0			c.404_408del						.																																			SO:0001589	frameshift_variant	6720	exon3			CTTCAATGGAGTG	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.314_318delCTCCA	17.37:g.17723609_17723613delTGGAG	ENSP00000261646:p.Thr105fs	48.0	0.0		54.0	24.0	NM_001005291	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Frame_Shift_Del	DEL	ENST00000261646.5	37	CCDS11189.1																																																																																			.		0.634	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131771.1	NM_004176	
TIMELESS	8914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56822710	56822710	+	Missense_Mutation	SNP	T	T	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr12:56822710T>A	ENST00000553532.1	-	11	1411	c.1261A>T	c.(1261-1263)Atg>Ttg	p.M421L	TIMELESS_ENST00000229201.4_Missense_Mutation_p.M420L|TIMELESS_ENST00000554616.1_Intron					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						GTCAGCATCATCTCATAGTAG	0.542																																					p.M421L		.											.	TIMELESS	159	0			c.A1261T						.						127.0	110.0	116.0					12																	56822710		2203	4300	6503	SO:0001583	missense	8914	exon11			GCATCATCTCATA	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.1261A>T	12.37:g.56822710T>A	ENSP00000450607:p.Met421Leu	83.0	0.0		91.0	37.0	NM_003920		Missense_Mutation	SNP	ENST00000553532.1	37	CCDS8918.1	.	.	.	.	.	.	.	.	.	.	T	33	5.244422	0.95272	.	.	ENSG00000111602	ENST00000229201;ENST00000553532	T;T	0.06608	3.28;3.28	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.18173	0.0436	M	0.77820	2.39	0.80722	D	1	P;P	0.51933	0.949;0.915	P;P	0.51895	0.683;0.485	T	0.00516	-1.1694	10	0.46703	T	0.11	-22.9615	14.8632	0.70397	0.0:0.0:0.0:1.0	.	420;421	Q9UNS1-2;Q9UNS1	.;TIM_HUMAN	L	420;421	ENSP00000229201:M420L;ENSP00000450607:M421L	ENSP00000229201:M421L	M	-	1	0	TIMELESS	55108977	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.982000	0.70532	2.214000	0.71695	0.459000	0.35465	ATG	.		0.542	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920	
TLN1	7094	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	35703656	35703656	+	Silent	SNP	C	C	G			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr9:35703656C>G	ENST00000314888.9	-	48	6728	c.6375G>C	c.(6373-6375)gtG>gtC	p.V2125V	TLN1_ENST00000464379.1_5'UTR|TLN1_ENST00000540444.1_Silent_p.V2019V	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2125					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GCAATGATGTCACATTGGTCA	0.512																																					p.V2125V		.											.	TLN1	609	0			c.G6375C						.						123.0	110.0	114.0					9																	35703656		2203	4300	6503	SO:0001819	synonymous_variant	7094	exon48			TGATGTCACATTG	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.6375G>C	9.37:g.35703656C>G		72.0	1.0		78.0	32.0	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Silent	SNP	ENST00000314888.9	37	CCDS35009.1																																																																																			.		0.512	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
TNFRSF11A	8792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	60036567	60036567	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr18:60036567G>A	ENST00000586569.1	+	9	1455	c.1417G>A	c.(1417-1419)Gcc>Acc	p.A473T	TNFRSF11A_ENST00000269485.7_Intron	NM_001270949.1|NM_003839.3	NP_001257878.1|NP_003830.1	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily, member 11a, NFKB activator	473					adaptive immune response (GO:0002250)|cell-cell signaling (GO:0007267)|circadian temperature homeostasis (GO:0060086)|lymph node development (GO:0048535)|mammary gland alveolus development (GO:0060749)|monocyte chemotaxis (GO:0002548)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|response to cytokine (GO:0034097)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to radiation (GO:0009314)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(13)|skin(3)|upper_aerodigestive_tract(1)	29		Colorectal(73;0.188)				GCCCCAGTGCGCCTATGGCAT	0.652																																					p.A473T		.											.	TNFRSF11A	659	0			c.G1417A						.																																			SO:0001583	missense	8792	exon9			CAGTGCGCCTATG	AF018253	CCDS11980.1, CCDS59324.1, CCDS74227.1, CCDS74228.1	18q22.1	2014-09-17			ENSG00000141655	ENSG00000141655		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11908	protein-coding gene	gene with protein product		603499	"""tumor necrosis factor receptor superfamily, member 11a, activator of NFKB"", ""Paget disease of bone 2"", ""loss of heterozygosity, 18, chromosomal region 1"""	PDB2, LOH18CR1		9367155, 10615125	Standard	NM_001270951		Approved	RANK, CD265, FEO	uc002lin.4	Q9Y6Q6	OTTHUMG00000132779	ENST00000586569.1:c.1417G>A	18.37:g.60036567G>A	ENSP00000465500:p.Ala473Thr	35.0	0.0		26.0	7.0	NM_003839	I4EC36|I4EC38|I4EC39|I7JE63|N0GVH0|Q59EP9	Missense_Mutation	SNP	ENST00000586569.1	37	CCDS11980.1	.	.	.	.	.	.	.	.	.	.	G	6.414	0.444590	0.12164	.	.	ENSG00000141655	ENST00000269485	.	.	.	5.03	1.67	0.24075	.	4.700340	0.00481	N	0.000137	T	0.28433	0.0703	N	0.21448	0.665	0.22796	N	0.998722	B	0.24823	0.112	B	0.15484	0.013	T	0.11446	-1.0587	8	.	.	.	-8.869	4.468	0.11698	0.2877:0.1863:0.5261:0.0	.	473	Q9Y6Q6	TNR11_HUMAN	T	473	.	.	A	+	1	0	TNFRSF11A	58187547	0.605000	0.26941	0.159000	0.22649	0.622000	0.37654	0.996000	0.29719	0.492000	0.27815	-0.244000	0.11960	GCC	.		0.652	TNFRSF11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256186.2		
TNRC18	84629	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	5416611	5416611	+	Silent	SNP	T	T	C			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr7:5416611T>C	ENST00000430969.1	-	8	2823	c.2475A>G	c.(2473-2475)ccA>ccG	p.P825P	TNRC18_ENST00000399537.4_Silent_p.P825P	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	825							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGTGCAGAGATGGGGGACCCA	0.687																																					p.P825P		.											.	TNRC18	46	0			c.A2475G						.						18.0	24.0	22.0					7																	5416611		1952	4133	6085	SO:0001819	synonymous_variant	84629	exon8			CAGAGATGGGGGA	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.2475A>G	7.37:g.5416611T>C		141.0	1.0		114.0	12.0	NM_001080495	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1																																																																																			.		0.687	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
AC005013.5	0	broad.mit.edu;mdanderson.org	37	7	28997603	28997603	+	lincRNA	SNP	C	C	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr7:28997603C>T	ENST00000436594.1	+	0	192				TRIL_ENST00000322982.3_RNA																							TCGGCAGCGGCGGGAGCGCGA	0.726																																					.		.											.	.	.	0			.						.						11.0	13.0	12.0					7																	28997603		1908	4094	6002			9865	.			CAGCGGCGGGAGC																													7.37:g.28997603C>T		9.0	0.0		12.0	6.0	.		RNA	SNP	ENST00000436594.1	37																																																																																				.		0.726	AC005013.5-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000327953.3		
TRIP12	9320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	230668295	230668295	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr2:230668295C>T	ENST00000283943.5	-	19	2943	c.2765G>A	c.(2764-2766)aGa>aAa	p.R922K	TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389045.3_Missense_Mutation_p.R652K|TRIP12_ENST00000389044.4_Missense_Mutation_p.R970K	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	922					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		ACCTTCTCTTCTGAAGTAAAC	0.338																																					p.R922K		.											.	TRIP12	572	0			c.G2765A						.						44.0	45.0	45.0					2																	230668295		2203	4300	6503	SO:0001583	missense	9320	exon19			TCTCTTCTGAAGT	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.2765G>A	2.37:g.230668295C>T	ENSP00000283943:p.Arg922Lys	150.0	0.0		158.0	67.0	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.876613	0.91664	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.34072	1.38;1.38;1.38	5.88	5.88	0.94601	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.47451	0.1446	L	0.35723	1.085	0.80722	D	1	P;P;P	0.44690	0.841;0.841;0.841	P;P;P	0.57204	0.815;0.815;0.815	T	0.06110	-1.0845	10	0.17832	T	0.49	.	20.2314	0.98350	0.0:1.0:0.0:0.0	.	652;970;922	Q14CF1;Q14CA3;Q14669	.;.;TRIPC_HUMAN	K	922;652;970	ENSP00000283943:R922K;ENSP00000373697:R652K;ENSP00000373696:R970K	ENSP00000283943:R922K	R	-	2	0	TRIP12	230376539	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.461000	0.80834	2.789000	0.95967	0.591000	0.81541	AGA	.		0.338	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
UBQLN1	29979	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	9	86297921	86297921	+	Silent	SNP	T	T	C			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr9:86297921T>C	ENST00000376395.4	-	3	916	c.393A>G	c.(391-393)tcA>tcG	p.S131S	UBQLN1_ENST00000257468.7_Silent_p.S131S	NM_013438.4|NM_053067.2	NP_038466.2|NP_444295.1	Q9UMX0	UBQL1_HUMAN	ubiquilin 1	131					cellular response to hypoxia (GO:0071456)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|regulation of protein ubiquitination (GO:0031396)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|protein complex (GO:0043234)	kinase binding (GO:0019900)			breast(4)|endometrium(2)|kidney(4)|large_intestine(6)|lung(10)|prostate(1)	27						TATTAGGAGTTGATGATGTAG	0.403																																					p.S131S	Melanoma(186;1284 2073 12755 14558 18426)	.											.	UBQLN1	90	0			c.A393G						.						183.0	166.0	172.0					9																	86297921		2203	4300	6503	SO:0001819	synonymous_variant	29979	exon3			AGGAGTTGATGAT	AF176069	CCDS6663.1, CCDS6664.1	9q22	2013-02-12			ENSG00000135018	ENSG00000135018		"""Ubiquilin family"""	12508	protein-coding gene	gene with protein product		605046				9303440, 10807547	Standard	NM_013438		Approved	DSK2, PLIC-1, XDRP1, DA41	uc004amv.3	Q9UMX0	OTTHUMG00000020104	ENST00000376395.4:c.393A>G	9.37:g.86297921T>C		92.0	0.0		64.0	6.0	NM_053067	Q5T6J5|Q5T6J9|Q8IXS9|Q8N2Q3|Q9H0T8|Q9H3R4|Q9HAZ5	Silent	SNP	ENST00000376395.4	37	CCDS6663.1																																																																																			.		0.403	UBQLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000052834.1	NM_013438	
UBR2	23304	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	42610159	42610159	+	Nonsense_Mutation	SNP	T	T	G			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr6:42610159T>G	ENST00000372899.1	+	18	2295	c.2037T>G	c.(2035-2037)taT>taG	p.Y679*	UBR2_ENST00000372883.3_Nonsense_Mutation_p.Y183*|UBR2_ENST00000372901.1_Nonsense_Mutation_p.Y679*	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	679					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TTTAGATTTATTACTACCATA	0.328																																					p.Y679X		.											.	UBR2	94	0			c.T2037G						.						53.0	56.0	55.0					6																	42610159		2202	4300	6502	SO:0001587	stop_gained	23304	exon18			GATTTATTACTAC	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.2037T>G	6.37:g.42610159T>G	ENSP00000361990:p.Tyr679*	56.0	0.0		56.0	27.0	NM_015255	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Nonsense_Mutation	SNP	ENST00000372899.1	37	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	T	41	9.092070	0.99062	.	.	ENSG00000024048	ENST00000372899;ENST00000372901;ENST00000372883	.	.	.	5.77	3.38	0.38709	.	0.057993	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0098	9.0257	0.36227	0.0:0.2089:0.0:0.7911	.	.	.	.	X	679;679;183	.	ENSP00000361974:Y183X	Y	+	3	2	UBR2	42718137	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.866000	0.39489	0.450000	0.26774	0.533000	0.62120	TAT	.		0.328	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255	
WSCD1	23302	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	6023676	6023676	+	Missense_Mutation	SNP	G	G	A	rs191802540		TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr17:6023676G>A	ENST00000574946.1	+	9	1813	c.1423G>A	c.(1423-1425)Gtc>Atc	p.V475I	WSCD1_ENST00000317744.5_Missense_Mutation_p.V475I|WSCD1_ENST00000539421.1_Missense_Mutation_p.V475I|WSCD1_ENST00000573634.1_Missense_Mutation_p.V359I|WSCD1_ENST00000574232.1_Missense_Mutation_p.V475I			Q658N2	WSCD1_HUMAN	WSC domain containing 1	475						integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						GTCCTCGCACGTCCTGGACTG	0.647													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17659	0.0		0.0	False		,,,				2504	0.0				p.V475I		.											.	WSCD1	90	0			c.G1423A						.						137.0	130.0	132.0					17																	6023676		2203	4300	6503	SO:0001583	missense	23302	exon9			TCGCACGTCCTGG		CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.1423G>A	17.37:g.6023676G>A	ENSP00000460825:p.Val475Ile	72.0	0.0		74.0	37.0	NM_015253	A8K0N8|D3DTM3|O60276|Q96G45	Missense_Mutation	SNP	ENST00000574946.1	37	CCDS32538.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	17.29	3.351287	0.61183	.	.	ENSG00000179314	ENST00000317744;ENST00000539421	D;D	0.83163	-1.69;-1.69	5.54	5.54	0.83059	Sulfotransferase domain (1);	0.117528	0.56097	D	0.000021	T	0.80869	0.4706	L	0.35593	1.075	0.40864	D	0.98385	D	0.67145	0.996	P	0.50570	0.644	T	0.78242	-0.2280	10	0.21540	T	0.41	-41.0907	16.9738	0.86308	0.0:0.0:1.0:0.0	.	475	Q658N2	WSCD1_HUMAN	I	475	ENSP00000323087:V475I;ENSP00000446032:V475I	ENSP00000323087:V475I	V	+	1	0	WSCD1	5964400	1.000000	0.71417	0.980000	0.43619	0.360000	0.29518	7.564000	0.82326	2.606000	0.88127	0.655000	0.94253	GTC	G|0.999;A|0.000		0.647	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438965.4	NM_015253	
ZBTB20	26137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	114070355	114070355	+	Silent	SNP	C	C	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr3:114070355C>T	ENST00000474710.1	-	4	748	c.570G>A	c.(568-570)acG>acA	p.T190T	ZBTB20_ENST00000462705.1_Silent_p.T117T|ZBTB20_ENST00000393785.2_Silent_p.T117T|ZBTB20_ENST00000357258.3_Silent_p.T117T|ZBTB20_ENST00000464560.1_Silent_p.T117T|ZBTB20_ENST00000481632.1_Silent_p.T117T|ZBTB20-AS1_ENST00000467304.1_RNA|ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20-AS1_ENST00000496219.1_RNA|ZBTB20_ENST00000471418.1_Silent_p.T117T	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	190						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.T117T(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		ACACGATGCGCGTGCACTCGT	0.637																																					p.T190T	NSCLC(69;748 1344 9802 11203 30933)	.											.	ZBTB20	95	1	Substitution - coding silent(1)	lung(1)	c.G570A						.						74.0	60.0	65.0					3																	114070355		2203	4300	6503	SO:0001819	synonymous_variant	26137	exon4			GATGCGCGTGCAC	AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.570G>A	3.37:g.114070355C>T		36.0	0.0		41.0	7.0	NM_001164342	Q63HP6|Q8N6R5|Q9Y410	Silent	SNP	ENST00000474710.1	37	CCDS54626.1																																																																																			.		0.637	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642	
ZFP28	140612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	57058902	57058902	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr19:57058902C>T	ENST00000301318.3	+	3	397	c.326C>T	c.(325-327)gCt>gTt	p.A109V	ZFP28_ENST00000591844.1_Missense_Mutation_p.A109V|AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	109	KRAB 1. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		GGGGATGTGGCTGTAGATTTC	0.493																																					p.A109V	Ovarian(124;554 1662 19430 21141 52494)	.											.	ZFP28	91	0			c.C326T						.						155.0	132.0	139.0					19																	57058902		2203	4300	6503	SO:0001583	missense	140612	exon3			ATGTGGCTGTAGA		CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.326C>T	19.37:g.57058902C>T	ENSP00000301318:p.Ala109Val	160.0	0.0		175.0	35.0	NM_020828	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	ENST00000301318.3	37	CCDS12946.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344857	0.61073	.	.	ENSG00000196867	ENST00000301318	T	0.03301	3.98	3.58	1.36	0.22044	Krueppel-associated box (4);	0.219701	0.23254	N	0.050205	T	0.16642	0.0400	M	0.88181	2.935	0.28655	N	0.906432	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.02115	-1.1211	10	0.48119	T	0.1	.	6.6417	0.22913	0.1782:0.722:0.0:0.0999	.	109;109	Q8NHY6;A8K0L8	ZFP28_HUMAN;.	V	109	ENSP00000301318:A109V	ENSP00000301318:A109V	A	+	2	0	ZFP28	61750714	0.259000	0.24043	0.408000	0.26446	0.932000	0.56968	0.560000	0.23500	0.293000	0.22520	0.563000	0.77884	GCT	.		0.493	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828	
ZNF844	284391	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	12187711	12187711	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr19:12187711delA	ENST00000439326.3	+	4	1951	c.1776delA	c.(1774-1776)acafs	p.T592fs	ZNF844_ENST00000441304.2_3'UTR	NM_001136501.1	NP_001129973.1	Q08AG5	ZN844_HUMAN	zinc finger protein 844	592					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(1)|prostate(1)	10						AGAGTGTGACAAAGCATTCAT	0.383																																					p.T592fs		.											.	.	.	0			c.1776delA						.						122.0	109.0	113.0					19																	12187711		692	1591	2283	SO:0001589	frameshift_variant	284391	exon4			TGTGACAAAGCAT	AL832297	CCDS45985.1	19p13.2	2013-01-08			ENSG00000223547	ENSG00000223547		"""Zinc fingers, C2H2-type"", ""-"""	25932	protein-coding gene	gene with protein product							Standard	NM_001136501		Approved	FLJ14959	uc002mtb.2	Q08AG5	OTTHUMG00000156405	ENST00000439326.3:c.1776delA	19.37:g.12187711delA	ENSP00000392024:p.Thr592fs	104.0	0.0		111.0	28.0	NM_001136501	Q5JPI8	Frame_Shift_Del	DEL	ENST00000439326.3	37	CCDS45985.1																																																																																			.		0.383	ZNF844-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344086.2		
ZNF567	163081	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	37203683	37203683	+	Splice_Site	SNP	G	G	A			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr19:37203683G>A	ENST00000536254.2	+	5	359	c.137G>A	c.(136-138)gGg>gAg	p.G46E	ZNF567_ENST00000392163.2_Splice_Site_p.G15E|ZNF567_ENST00000585696.1_Splice_Site_p.G15E|ZNF567_ENST00000588311.1_Splice_Site_p.G15E|ZNF567_ENST00000360729.4_Splice_Site_p.G15E			Q8N184	ZN567_HUMAN	zinc finger protein 567	46	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CACTTTTCAGGGTGTCACATG	0.428																																					p.G15E		.											.	ZNF567	90	0			c.G44A						.						134.0	116.0	122.0					19																	37203683		2203	4300	6503	SO:0001630	splice_region_variant	163081	exon3			TTTCAGGGTGTCA	AK093034	CCDS12495.1, CCDS74349.1	19q13.12	2013-10-08				ENSG00000189042		"""Zinc fingers, C2H2-type"", ""-"""	28696	protein-coding gene	gene with protein product						12477932	Standard	XM_006723064		Approved	MGC45586	uc002oep.4	Q8N184		ENST00000536254.2:c.137-1G>A	19.37:g.37203683G>A		103.0	0.0		89.0	50.0	NM_152603	B3KX49|Q6N044	Missense_Mutation	SNP	ENST00000536254.2	37		.	.	.	.	.	.	.	.	.	.	G	17.21	3.330426	0.60743	.	.	ENSG00000189042	ENST00000536254;ENST00000378686;ENST00000360729;ENST00000423498;ENST00000392163	T;T;T	0.02552	4.25;5.31;5.31	4.42	3.38	0.38709	Krueppel-associated box (4);	0.164522	0.29139	N	0.013032	T	0.13543	0.0328	M	0.84585	2.705	0.28026	N	0.934321	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.00934	-1.1509	9	.	.	.	.	7.3491	0.26680	0.1174:0.0:0.8826:0.0	.	46;15	Q8N184;F8WEL6	ZN567_HUMAN;.	E	46;46;15;45;15	ENSP00000441838:G46E;ENSP00000353957:G15E;ENSP00000376003:G15E	.	G	+	2	0	ZNF567	41895523	0.816000	0.29132	0.996000	0.52242	0.834000	0.47266	2.002000	0.40835	2.382000	0.81193	0.462000	0.41574	GGG	.		0.428	ZNF567-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000453549.1	NM_152603	Missense_Mutation
ZNF470	388566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	57086027	57086027	+	Missense_Mutation	SNP	G	G	T			TCGA-KR-A7K7-01A-11D-A33K-10	TCGA-KR-A7K7-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c81cbc1f-0de9-4578-a35e-014fb80c54a4	9edcdb8d-6a27-4c45-a22e-30466a7e13cd	g.chr19:57086027G>T	ENST00000330619.8	+	5	894	c.208G>T	c.(208-210)Gat>Tat	p.D70Y	ZNF470_ENST00000601902.1_Missense_Mutation_p.D70Y|ZNF470_ENST00000391709.3_Missense_Mutation_p.D70Y	NM_001001668.3	NP_001001668.3	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	70	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|large_intestine(12)|lung(11)|ovary(1)|pancreas(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	41		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		TTCTAAACCAGATGTGATCTC	0.408																																					p.D70Y		.											.	ZNF470	92	0			c.G208T						.						82.0	80.0	81.0					19																	57086027		2203	4300	6503	SO:0001583	missense	388566	exon5			AAACCAGATGTGA	AK129686	CCDS33122.1	19q13.43	2013-01-08				ENSG00000197016		"""Zinc fingers, C2H2-type"", ""-"""	22220	protein-coding gene	gene with protein product						15302581	Standard	NM_001001668		Approved	CZF-1, FLJ26175	uc002qnl.4	Q6ECI4		ENST00000330619.8:c.208G>T	19.37:g.57086027G>T	ENSP00000333223:p.Asp70Tyr	92.0	0.0		83.0	45.0	NM_001001668	A8MTW0|B9EGU1|Q6ZPA1|Q9Y2N9	Missense_Mutation	SNP	ENST00000330619.8	37	CCDS33122.1	.	.	.	.	.	.	.	.	.	.	G	4.264	0.048051	0.08243	.	.	ENSG00000197016	ENST00000391709;ENST00000330619	T;T	0.00976	5.48;5.48	3.73	2.67	0.31697	Krueppel-associated box (3);	.	.	.	.	T	0.01353	0.0044	L	0.58969	1.84	0.22489	N	0.99906	P	0.36733	0.567	B	0.33521	0.165	T	0.46428	-0.9192	9	0.48119	T	0.1	.	9.1886	0.37184	0.0:0.2231:0.7769:0.0	.	70	Q6ECI4	ZN470_HUMAN	Y	70	ENSP00000375590:D70Y;ENSP00000333223:D70Y	ENSP00000333223:D70Y	D	+	1	0	ZNF470	61777839	0.255000	0.24002	0.976000	0.42696	0.036000	0.12997	1.291000	0.33330	0.893000	0.36288	-0.175000	0.13238	GAT	.		0.408	ZNF470-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459707.2	NM_001001668	
