#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACAN	176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	89395101	89395101	+	Silent	SNP	C	C	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr15:89395101C>A	ENST00000561243.1	+	10	2103	c.2103C>A	c.(2101-2103)atC>atA	p.I701I	ACAN_ENST00000559004.1_Silent_p.I701I|ACAN_ENST00000439576.2_Silent_p.I701I|ACAN_ENST00000352105.7_Silent_p.I701I			P16112	PGCA_HUMAN	aggrecan	700	KS.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AGGAGTGGATCGTGACCCAAG	0.567																																					p.I701I		.											.	ACAN	25	0			c.C2103A						.						52.0	68.0	63.0					15																	89395101		2080	4196	6276	SO:0001819	synonymous_variant	176	exon11			GTGGATCGTGACC	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.2103C>A	15.37:g.89395101C>A		184.0	0.0		130.0	23.0	NM_001135	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	ENST00000561243.1	37	CCDS53970.1																																																																																			.		0.567	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
ADRB2	154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	148206993	148206993	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr5:148206993C>T	ENST00000305988.4	+	1	838	c.599C>T	c.(598-600)gCc>gTc	p.A200V		NM_000024.5	NP_000015	P07550	ADRB2_HUMAN	adrenoceptor beta 2, surface	200	Agonist and antagonist binding.				activation of adenylate cyclase activity (GO:0007190)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|bone resorption (GO:0045453)|brown fat cell differentiation (GO:0050873)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway by arrestin (GO:0002032)|diet induced thermogenesis (GO:0002024)|endosome to lysosome transport (GO:0008333)|heat generation (GO:0031649)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of smooth muscle contraction (GO:0045986)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor-mediated endocytosis (GO:0006898)|regulation of sodium ion transport (GO:0002028)|regulation of vasodilation (GO:0042312)|response to cold (GO:0009409)|vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure (GO:0002025)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	beta2-adrenergic receptor activity (GO:0004941)|norepinephrine binding (GO:0051380)|potassium channel regulator activity (GO:0015459)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(3)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Acebutolol(DB01193)|Alprenolol(DB00866)|Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Arformoterol(DB01274)|Asenapine(DB06216)|Atenolol(DB00335)|Bambuterol(DB01408)|Betaxolol(DB00195)|Bethanidine(DB00217)|Bevantolol(DB01295)|Bisoprolol(DB00612)|Bopindolol(DB08807)|Bupranolol(DB08808)|Cabergoline(DB00248)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Dipivefrin(DB00449)|Dobutamine(DB00841)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Indacaterol(DB05039)|Isoetarine(DB00221)|Isoprenaline(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Mephentermine(DB01365)|Metipranolol(DB01214)|Metoprolol(DB00264)|Mirtazapine(DB00370)|Nadolol(DB01203)|Nebivolol(DB04861)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Phenoxybenzamine(DB00925)|Phenylpropanolamine(DB00397)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Sotalol(DB00489)|Terbutaline(DB00871)|Timolol(DB00373)|Trimipramine(DB00726)	CAAGCCTATGCCATTGCCTCT	0.532																																					p.A200V		.											.	ADRB2	523	0			c.C599T						.						310.0	260.0	277.0					5																	148206993		2203	4300	6503	SO:0001583	missense	154	exon1			CCTATGCCATTGC	AF022953	CCDS4292.1	5q31-q32	2012-08-08	2012-05-09		ENSG00000169252	ENSG00000169252		"""GPCR / Class A : Adrenoceptors : beta"""	286	protein-coding gene	gene with protein product		109690	"""adrenergic, beta-2-, receptor, surface"""	ADRB2R			Standard	NM_000024		Approved	ADRBR, BAR, B2AR	uc003lpr.2	P07550	OTTHUMG00000129933	ENST00000305988.4:c.599C>T	5.37:g.148206993C>T	ENSP00000305372:p.Ala200Val	59.0	0.0		55.0	13.0	NM_000024	B0LPE4|B2R7X2|O14823|O14824|O14825|O14826|Q4JG18|Q53GA6|Q6GMT4|Q6P4D8|Q8NEQ9|Q96EC3|Q9UCZ0|Q9UCZ1|Q9UCZ2|Q9UCZ3|Q9UH95|Q9UHA1|Q9UMZ5	Missense_Mutation	SNP	ENST00000305988.4	37	CCDS4292.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.898614	0.91962	.	.	ENSG00000169252	ENST00000305988	T	0.35421	1.31	5.65	5.65	0.86999	GPCR, rhodopsin-like superfamily (1);	0.053029	0.85682	D	0.000000	T	0.51244	0.1663	L	0.35593	1.075	0.80722	D	1	D	0.89917	1.0	D	0.67900	0.954	T	0.49854	-0.8895	10	0.87932	D	0	.	19.9142	0.97043	0.0:1.0:0.0:0.0	.	200	P07550	ADRB2_HUMAN	V	200	ENSP00000305372:A200V	ENSP00000305372:A200V	A	+	2	0	ADRB2	148187186	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.904000	0.69886	2.941000	0.99782	0.655000	0.94253	GCC	.		0.532	ADRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252189.1	NM_000024	
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu	37	1	27106176	27106176	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr1:27106176delT	ENST00000324856.7	+	20	6158	c.5787delT	c.(5785-5787)agtfs	p.S1930fs	ARID1A_ENST00000374152.2_Frame_Shift_Del_p.S1547fs|ARID1A_ENST00000457599.2_Frame_Shift_Del_p.S1713fs|ARID1A_ENST00000540690.1_Frame_Shift_Del_p.S258fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1930					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GAGCTAAGAGTTCAGAGGCCA	0.532			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.S1929fs		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	584	0			c.5787delT						.						128.0	125.0	126.0					1																	27106176		2203	4300	6503	SO:0001589	frameshift_variant	8289	exon20			TAAGAGTTCAGAG	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5787delT	1.37:g.27106176delT	ENSP00000320485:p.Ser1930fs	115.0	0.0		111.0	10.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	ENST00000324856.7	37	CCDS285.1																																																																																			.		0.532	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
BAG6	7917	broad.mit.edu;mdanderson.org	37	6	31610118	31610118	+	Missense_Mutation	SNP	C	C	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr6:31610118C>A	ENST00000375964.6	-	15	2329	c.2016G>T	c.(2014-2016)caG>caT	p.Q672H	BAG6_ENST00000439687.2_Intron|BAG6_ENST00000375976.4_Missense_Mutation_p.Q666H|BAG6_ENST00000470875.1_5'UTR|BAG6_ENST00000404765.2_Missense_Mutation_p.Q702H|BAG6_ENST00000362049.6_Missense_Mutation_p.Q666H|BAG6_ENST00000211379.5_Missense_Mutation_p.Q666H	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	672	Pro-rich.				brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						GCATGGTCTGCTGCTCTGGGG	0.602																																					p.Q672H		.											.	BAG6	154	0			c.G2016T						.						3.0	3.0	3.0					6																	31610118		1318	2420	3738	SO:0001583	missense	7917	exon15			GGTCTGCTGCTCT	M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.2016G>T	6.37:g.31610118C>A	ENSP00000365131:p.Gln672His	28.0	0.0		47.0	6.0	NM_004639	A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Missense_Mutation	SNP	ENST00000375964.6	37	CCDS47403.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.457696	0.63401	.	.	ENSG00000204463	ENST00000375976;ENST00000375964;ENST00000211379;ENST00000404765;ENST00000362049;ENST00000437771	T;T;T;T;T;T	0.48836	1.42;1.42;1.42;1.43;1.43;0.8	5.93	4.17	0.49024	.	0.531592	0.18609	N	0.136216	T	0.29524	0.0736	N	0.08118	0	0.27162	N	0.961143	D;D;D	0.60575	0.987;0.984;0.988	P;P;D	0.74674	0.605;0.527;0.984	T	0.23547	-1.0185	10	0.42905	T	0.14	.	10.1308	0.42678	0.0:0.8435:0.0:0.1565	.	666;672;666	F8VXY4;P46379;P46379-2	.;BAG6_HUMAN;.	H	666;672;666;702;666;702	ENSP00000365143:Q666H;ENSP00000365131:Q672H;ENSP00000211379:Q666H;ENSP00000384494:Q702H;ENSP00000354875:Q666H;ENSP00000397978:Q702H	ENSP00000211379:Q666H	Q	-	3	2	BAG6	31718097	0.986000	0.35501	1.000000	0.80357	0.959000	0.62525	0.339000	0.19875	0.863000	0.35553	0.650000	0.86243	CAG	.		0.602	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_080703	
C19orf45	374877	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	7570453	7570453	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr19:7570453G>A	ENST00000361664.2	+	6	1087	c.946G>A	c.(946-948)Gga>Aga	p.G316R	CTD-2207O23.12_ENST00000599312.1_5'Flank	NM_198534.2	NP_940936.2	Q8NA69	CS045_HUMAN	chromosome 19 open reading frame 45	316										endometrium(1)|kidney(1)|liver(1)|lung(2)|ovary(2)|stomach(1)	8						CATCCTGAAAGGAAATTGGTG	0.597																																					p.G316R		.											.	C19orf45	90	0			c.G946A						.						46.0	52.0	50.0					19																	7570453		2203	4300	6503	SO:0001583	missense	374877	exon6			CTGAAAGGAAATT	BC029824	CCDS12179.2	19p13.2	2008-02-05			ENSG00000198723	ENSG00000198723			24745	protein-coding gene	gene with protein product						12477932	Standard	NM_198534		Approved	FLJ35784	uc002mgm.2	Q8NA69	OTTHUMG00000157183	ENST00000361664.2:c.946G>A	19.37:g.7570453G>A	ENSP00000355241:p.Gly316Arg	52.0	0.0		44.0	5.0	NM_198534	Q8N115	Missense_Mutation	SNP	ENST00000361664.2	37	CCDS12179.2	.	.	.	.	.	.	.	.	.	.	G	17.99	3.523882	0.64747	.	.	ENSG00000198723	ENST00000361664	T	0.18016	2.24	3.6	3.6	0.41247	.	0.155532	0.42053	D	0.000779	T	0.33904	0.0879	L	0.54323	1.7	0.36897	D	0.890223	D	0.89917	1.0	D	0.97110	1.0	T	0.30119	-0.9989	10	0.72032	D	0.01	-11.7371	11.1098	0.48226	0.0:0.0:1.0:0.0	.	316	Q8NA69	CS045_HUMAN	R	316	ENSP00000355241:G316R	ENSP00000355241:G316R	G	+	1	0	C19orf45	7476453	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	3.817000	0.55668	2.316000	0.78162	0.456000	0.33151	GGA	.		0.597	C19orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347808.1	NM_198534	
CCDC137	339230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	79638802	79638802	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr17:79638802C>T	ENST00000329214.8	+	4	929	c.526C>T	c.(526-528)Cga>Tga	p.R176*		NM_199287.2	NP_954981.1	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137	176							poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(2)	12	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			AGATAAAGTCCGACGGAAAAA	0.577																																					p.R176X		.											.	CCDC137	69	0			c.C526T						.						53.0	59.0	57.0					17																	79638802		1969	4158	6127	SO:0001587	stop_gained	339230	exon4			AAAGTCCGACGGA	BC009369	CCDS42400.1	17q25.3	2008-07-04				ENSG00000185298			33451	protein-coding gene	gene with protein product		614271					Standard	NM_199287		Approved	MGC16597	uc002kbc.4	Q6PK04		ENST00000329214.8:c.526C>T	17.37:g.79638802C>T	ENSP00000329360:p.Arg176*	95.0	0.0		124.0	26.0	NM_199287		Nonsense_Mutation	SNP	ENST00000329214.8	37	CCDS42400.1	.	.	.	.	.	.	.	.	.	.	C	35	5.584384	0.96578	.	.	ENSG00000185298	ENST00000329214	.	.	.	5.12	4.11	0.48088	.	0.401005	0.25820	N	0.028089	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.8525	14.0043	0.64453	0.1519:0.8481:0.0:0.0	.	.	.	.	X	176	.	ENSP00000329360:R176X	R	+	1	2	CCDC137	77249207	0.015000	0.18098	0.011000	0.14972	0.054000	0.15201	2.874000	0.48483	2.371000	0.80710	0.655000	0.94253	CGA	.		0.577	CCDC137-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440387.1		
CHCHD4	131474	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	14158003	14158003	+	Missense_Mutation	SNP	A	A	G			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr3:14158003A>G	ENST00000396914.3	-	2	225	c.44T>C	c.(43-45)gTa>gCa	p.V15A	CHCHD4_ENST00000295767.5_Missense_Mutation_p.V28A	NM_001098502.1	NP_001091972.1	Q8N4Q1	MIA40_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 4	15					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein import into mitochondrial intermembrane space (GO:0045041)|protein maturation by protein folding (GO:0022417)|protein targeting to mitochondrion (GO:0006626)	mitochondrial intermembrane space (GO:0005758)	protein disulfide oxidoreductase activity (GO:0015035)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5						TTCTTTGGTTACAAATATGAT	0.463																																					p.V28A		.											.	CHCHD4	90	0			c.T83C						.						204.0	182.0	189.0					3																	14158003		2203	4300	6503	SO:0001583	missense	131474	exon3			TTGGTTACAAATA	BC017082	CCDS2617.1, CCDS43054.1	3p25.1	2012-10-15			ENSG00000163528	ENSG00000163528		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	26467	protein-coding gene	gene with protein product	"""translocase of inner mitochondrial membrane 40 homolog (S. cerevisiae)"", ""mitochondrial intermembrane space import and assembly 40 homolog (S. cerevisiae)"""	611077				22214851	Standard	NM_001098502		Approved	FLJ31709, TIMM40, MIA40	uc003byj.4	Q8N4Q1	OTTHUMG00000129805	ENST00000396914.3:c.44T>C	3.37:g.14158003A>G	ENSP00000380122:p.Val15Ala	107.0	0.0		75.0	17.0	NM_144636	A8K3Z9|Q96AI2|Q96MY6	Missense_Mutation	SNP	ENST00000396914.3	37	CCDS43054.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.956202	0.73902	.	.	ENSG00000163528	ENST00000295767;ENST00000396914	.	.	.	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.54143	0.1840	L	0.39397	1.21	0.80722	D	1	P;D	0.61697	0.952;0.99	P;P	0.57371	0.607;0.819	T	0.48246	-0.9052	9	0.19590	T	0.45	-34.5288	10.604	0.45384	0.9215:0.0:0.0785:0.0	.	15;28	Q8N4Q1;Q8N4Q1-2	MIA40_HUMAN;.	A	28;15	.	ENSP00000295767:V28A	V	-	2	0	CHCHD4	14133004	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	6.193000	0.72075	1.826000	0.53198	0.402000	0.26972	GTA	.		0.463	CHCHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340423.1	NM_144636	
CCDC50	152137	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	191107379	191107379	+	Missense_Mutation	SNP	T	T	G			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr3:191107379T>G	ENST00000392455.3	+	10	1487	c.889T>G	c.(889-891)Tcc>Gcc	p.S297A	CCDC50_ENST00000392456.3_Missense_Mutation_p.S473A	NM_174908.3	NP_777568.1	Q8IVM0	CCD50_HUMAN	coiled-coil domain containing 50	297						cytoplasm (GO:0005737)	ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|stomach(1)	23	all_cancers(143;8.88e-09)|Ovarian(172;0.103)|Breast(254;0.221)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000136)		AAAATCAGAGTCCTCTCATAA	0.388																																					p.S473A		.											.	CCDC50	90	0			c.T1417G						.						162.0	162.0	162.0					3																	191107379		2203	4300	6503	SO:0001583	missense	152137	exon11			TCAGAGTCCTCTC	AJ416916	CCDS33912.1, CCDS33913.1	3q28	2010-12-24		2005-12-23	ENSG00000152492	ENSG00000152492			18111	protein-coding gene	gene with protein product		611051	"""deafness, autosomal dominant 44"""	C3orf6, DFNA44		16803894, 17503326	Standard	NM_178335		Approved	Ymer	uc003fsv.3	Q8IVM0	OTTHUMG00000156177	ENST00000392455.3:c.889T>G	3.37:g.191107379T>G	ENSP00000376249:p.Ser297Ala	152.0	0.0		173.0	12.0	NM_178335	Q86VH7	Missense_Mutation	SNP	ENST00000392455.3	37	CCDS33913.1	.	.	.	.	.	.	.	.	.	.	T	6.897	0.535063	0.13188	.	.	ENSG00000152492	ENST00000392455;ENST00000392456	T;T	0.34472	1.46;1.36	5.44	1.68	0.24146	.	0.503668	0.20997	N	0.081924	T	0.26048	0.0635	L	0.46741	1.465	0.23920	N	0.996462	B;B	0.25272	0.001;0.122	B;B	0.28305	0.003;0.088	T	0.15607	-1.0431	10	0.32370	T	0.25	.	3.3875	0.07277	0.1676:0.1806:0.0:0.6518	.	297;473	Q8IVM0;Q8IVM0-2	CCD50_HUMAN;.	A	297;473	ENSP00000376249:S297A;ENSP00000376250:S473A	ENSP00000376249:S297A	S	+	1	0	CCDC50	192590073	0.995000	0.38212	1.000000	0.80357	0.305000	0.27757	0.313000	0.19415	0.337000	0.23665	-0.503000	0.04515	TCC	.		0.388	CCDC50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343315.1	NM_174908	
CLEC1A	51267	hgsc.bcm.edu;broad.mit.edu	37	12	10228256	10228256	+	Splice_Site	SNP	T	T	C			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr12:10228256T>C	ENST00000315330.4	-	4	454		c.e4-2		CLEC1A_ENST00000420265.2_Splice_Site|CLEC1A_ENST00000457018.2_Splice_Site	NM_016511.2	NP_057595.2	Q8NC01	CLC1A_HUMAN	C-type lectin domain family 1, member A						cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	23						ACCTGTGTGCTTGGAAAAAAG	0.363																																					.		.											.	CLEC1A	91	0			c.392-2A>G						.						102.0	96.0	98.0					12																	10228256		2203	4300	6503	SO:0001630	splice_region_variant	51267	exon5			GTGTGCTTGGAAA	AY358587	CCDS8612.1, CCDS73443.1	12p13.31	2005-02-09				ENSG00000150048		"""C-type lectin domain containing"""	24355	protein-coding gene	gene with protein product		606782				10671229, 11745369	Standard	XM_005253383		Approved	CLEC1, MGC34328	uc001qxb.3	Q8NC01		ENST00000315330.4:c.392-2A>G	12.37:g.10228256T>C		99.0	0.0		117.0	7.0	NM_016511	Q8IUW7|Q9NZH3	Splice_Site	SNP	ENST00000315330.4	37	CCDS8612.1	.	.	.	.	.	.	.	.	.	.	T	9.591	1.126268	0.20959	.	.	ENSG00000150048	ENST00000315330;ENST00000457018;ENST00000420265	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5034	0.50451	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CLEC1A	10119523	0.944000	0.32072	0.882000	0.34594	0.086000	0.17979	3.752000	0.55172	2.040000	0.60383	0.533000	0.62120	.	.		0.363	CLEC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399924.1	NM_016511	Intron
CT45A5	441521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	134947978	134947978	+	Missense_Mutation	SNP	G	G	C			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chrX:134947978G>C	ENST00000463085.2	-	3	436	c.347C>G	c.(346-348)cCc>cGc	p.P116R	CT45A4_ENST00000420087.2_Intron|CT45A5_ENST00000491480.1_Missense_Mutation_p.P116R|CT45A5_ENST00000370724.3_Missense_Mutation_p.P116R			Q6NSH3	CT455_HUMAN	cancer/testis antigen family 45, member A5	116										endometrium(1)|large_intestine(2)|lung(6)	9						TTGGCTTTTGGGAGAGGAGGC	0.423																																					p.P116R		.											.	CT45A5	44	0			c.C347G						.						218.0	188.0	199.0					X																	134947978		2189	4274	6463	SO:0001583	missense	441521	exon3			CTTTTGGGAGAGG	AY743713	CCDS35406.1	Xq26.3	2009-03-12				ENSG00000269586			33270	protein-coding gene	gene with protein product	"""cancer/testis antigen CT45-5"""	300796				15905330	Standard	XM_006724759		Approved	CT45-5, CT45.5	uc022ces.1	Q6NSH3		ENST00000463085.2:c.347C>G	X.37:g.134947978G>C	ENSP00000424778:p.Pro116Arg	68.0	0.0		79.0	30.0	NM_001007551	A8K842|B7ZMC5	Missense_Mutation	SNP	ENST00000463085.2	37	CCDS35406.1	.	.	.	.	.	.	.	.	.	.	G	11.56	1.673820	0.29693	.	.	ENSG00000242284	ENST00000370724;ENST00000491480	T;T	0.50813	0.73;0.73	2.19	-3.9	0.04181	.	1.140670	0.06592	U	0.752189	T	0.35711	0.0941	L	0.36672	1.1	0.09310	N	1	D	0.53745	0.962	P	0.45099	0.469	T	0.33266	-0.9875	10	0.66056	D	0.02	-17.3663	3.8122	0.08801	0.0:0.1746:0.3242:0.5012	.	116	Q6NSH3	CT455_HUMAN	R	116	ENSP00000359759:P116R;ENSP00000425997:P116R	ENSP00000359759:P116R	P	-	2	0	CT45A5	134775644	0.005000	0.15991	0.000000	0.03702	0.004000	0.04260	1.590000	0.36654	-1.016000	0.03371	0.365000	0.22127	CCC	.		0.423	CT45A5-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472589.1	NM_001007551	
KDELR3	11015	broad.mit.edu;ucsc.edu	37	22	38882316	38882316	+	IGR	SNP	C	C	G			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr22:38882316C>G	ENST00000216014.4	+	0	1728				DDX17_ENST00000381633.3_Missense_Mutation_p.R528P|DDX17_ENST00000444597.1_Missense_Mutation_p.R57P|DDX17_ENST00000396821.3_Missense_Mutation_p.R607P	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					GGTTTCACTACGATCCCGATA	0.507																																					p.R607P	Ovarian(11;103 529 24120 28493 32980)	.											.	DDX17	229	0			c.G1820C						.						74.0	64.0	67.0					22																	38882316		2203	4300	6503	SO:0001628	intergenic_variant	10521	exon13			TCACTACGATCCC	AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520		22.37:g.38882316C>G		90.0	0.0		101.0	5.0	NM_001098504	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Missense_Mutation	SNP	ENST00000216014.4	37	CCDS13972.1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.501890	0.44455	.	.	ENSG00000100201	ENST00000396821;ENST00000381633;ENST00000415748;ENST00000444597;ENST00000403230;ENST00000404499	T;T;T	0.30448	1.53;1.55;1.54	5.53	5.53	0.82687	.	0.376558	0.28921	N	0.013705	T	0.40015	0.1100	L	0.46157	1.445	0.80722	D	1	P;D;D	0.57899	0.895;0.974;0.981	B;P;P	0.49047	0.181;0.525;0.599	T	0.16988	-1.0384	10	0.54805	T	0.06	-8.5192	19.4787	0.95000	0.0:1.0:0.0:0.0	.	609;605;59	Q59F66;Q92841-4;Q9UQL5	.;.;.	P	607;528;59;57;605;609	ENSP00000380033:R607P;ENSP00000371046:R528P;ENSP00000385536:R605P	ENSP00000371046:R528P	R	-	2	0	DDX17	37212262	0.992000	0.36948	0.986000	0.45419	0.992000	0.81027	2.793000	0.47845	2.583000	0.87209	0.655000	0.94253	CGT	.		0.507	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331474.1		
DGKD	8527	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	234299114	234299114	+	Silent	SNP	C	C	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr2:234299114C>A	ENST00000264057.2	+	3	345	c.333C>A	c.(331-333)gtC>gtA	p.V111V	DGKD_ENST00000409813.3_Silent_p.V67V|AC019221.4_ENST00000442524.1_RNA	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	111	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	CCAAAAACGTCAACAACAGTT	0.413																																					p.V111V		.											.	DGKD	676	0			c.C333A						.						201.0	179.0	186.0					2																	234299114		2203	4300	6503	SO:0001819	synonymous_variant	8527	exon3			AAACGTCAACAAC	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.333C>A	2.37:g.234299114C>A		91.0	0.0		85.0	7.0	NM_152879	Q14158|Q6PK55|Q8NG53	Silent	SNP	ENST00000264057.2	37	CCDS2504.1																																																																																			.		0.413	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648	
DNAH5	1767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	13776635	13776635	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr5:13776635G>A	ENST00000265104.4	-	55	9390	c.9286C>T	c.(9286-9288)Cga>Tga	p.R3096*		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3096	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCTCTGTTTCGAAATTTCTCC	0.483									Kartagener syndrome																												p.R3096X		.											.	DNAH5	182	0			c.C9286T						.						97.0	91.0	93.0					5																	13776635		2203	4300	6503	SO:0001587	stop_gained	1767	exon55	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	TGTTTCGAAATTT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9286C>T	5.37:g.13776635G>A	ENSP00000265104:p.Arg3096*	231.0	0.0		244.0	25.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Nonsense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	52	18.969832	0.99913	.	.	ENSG00000039139	ENST00000265104	.	.	.	5.97	4.12	0.48240	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.937	0.64032	0.0:0.0:0.6006:0.3994	.	.	.	.	X	3096	.	ENSP00000265104:R3096X	R	-	1	2	DNAH5	13829635	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	3.116000	0.50399	0.791000	0.33826	0.655000	0.94253	CGA	.		0.483	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
DNAH7	56171	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	196891538	196891538	+	Missense_Mutation	SNP	T	T	C			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr2:196891538T>C	ENST00000312428.6	-	7	713	c.613A>G	c.(613-615)Aca>Gca	p.T205A	DNAH7_ENST00000410072.1_Missense_Mutation_p.T205A	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	205	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TCAGATAATGTAACTATGCTG	0.348																																					p.T205A		.											.	DNAH7	102	0			c.A613G						.						124.0	117.0	119.0					2																	196891538		1870	4102	5972	SO:0001583	missense	56171	exon7			ATAATGTAACTAT	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.613A>G	2.37:g.196891538T>C	ENSP00000311273:p.Thr205Ala	84.0	1.0		105.0	8.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	T	0.014	-1.576301	0.00887	.	.	ENSG00000118997	ENST00000312428;ENST00000410072;ENST00000312446	T;T	0.20738	2.05;3.02	5.92	-0.979	0.10276	.	2.323500	0.01540	N	0.019178	T	0.09335	0.0230	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21518	-1.0243	10	0.08381	T	0.77	.	5.4	0.16291	0.1827:0.3834:0.0:0.4339	.	205	Q8WXX0	DYH7_HUMAN	A	205	ENSP00000311273:T205A;ENSP00000386260:T205A	ENSP00000311273:T205A	T	-	1	0	DNAH7	196599783	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	-0.307000	0.08167	-0.168000	0.10853	-0.248000	0.11899	ACA	.		0.348	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
ERG	2078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	39755511	39755511	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr21:39755511C>T	ENST00000417133.2	-	12	1460	c.1275G>A	c.(1273-1275)atG>atA	p.M425I	ERG_ENST00000398905.1_Missense_Mutation_p.M394I|ERG_ENST00000442448.1_Missense_Mutation_p.M401I|ERG_ENST00000398911.1_Missense_Mutation_p.M401I|ERG_ENST00000398919.2_Missense_Mutation_p.M425I|ERG_ENST00000398897.1_Missense_Mutation_p.M302I|ERG_ENST00000288319.7_Missense_Mutation_p.M418I|ERG_ENST00000398907.1_Missense_Mutation_p.M395I|ERG_ENST00000398910.1_Missense_Mutation_p.M402I|ERG_ENST00000453032.2_Missense_Mutation_p.M326I	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog	0					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)		EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GATAGGAGCCCATGTACGGGA	0.602			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""																																p.M425I	Esophageal Squamous(130;336 1700 3010 3083 40589)	.		Dom	yes		21	21q22.3	2078	v-ets erythroblastosis virus E26 oncogene like (avian)		"""M, E, L"""	.	ERG	848	0			c.G1275A						.						69.0	68.0	69.0					21																	39755511		2203	4300	6503	SO:0001583	missense	2078	exon12			GGAGCCCATGTAC		CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.1275G>A	21.37:g.39755511C>T	ENSP00000414150:p.Met425Ile	102.0	0.0		81.0	12.0	NM_001136154	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000417133.2	37	CCDS46648.1	.	.	.	.	.	.	.	.	.	.	C	15.36	2.811913	0.50527	.	.	ENSG00000157554	ENST00000398905;ENST00000398907;ENST00000288319;ENST00000398897;ENST00000398911;ENST00000417133;ENST00000398910;ENST00000442448;ENST00000453032;ENST00000398919	T;T;T;T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63	5.2	5.2	0.72013	.	0.144787	0.64402	D	0.000009	T	0.49983	0.1589	L	0.58428	1.81	0.80722	D	1	B;B;B;B	0.17667	0.0;0.001;0.023;0.0	B;B;B;B	0.25405	0.001;0.005;0.06;0.001	T	0.47209	-0.9135	10	0.46703	T	0.11	.	18.7596	0.91845	0.0:1.0:0.0:0.0	.	425;394;401;418	P11308;B5MDW0;P11308-1;P11308-4	ERG_HUMAN;.;.;.	I	394;395;418;302;401;425;402;401;326;425	ENSP00000381877:M394I;ENSP00000381879:M395I;ENSP00000288319:M418I;ENSP00000381871:M302I;ENSP00000381882:M401I;ENSP00000414150:M425I;ENSP00000381881:M402I;ENSP00000394694:M401I;ENSP00000396268:M326I;ENSP00000381891:M425I	ENSP00000288319:M418I	M	-	3	0	ERG	38677381	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.006000	0.70724	2.404000	0.81709	0.655000	0.94253	ATG	.		0.602	ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207532.2	NM_182918	
FAM65B	9750	broad.mit.edu;bcgsc.ca	37	6	24843221	24843221	+	Missense_Mutation	SNP	T	T	C			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr6:24843221T>C	ENST00000259698.4	-	14	1964	c.1789A>G	c.(1789-1791)Aga>Gga	p.R597G	FAM65B_ENST00000473070.1_5'UTR|FAM65B_ENST00000540914.1_Missense_Mutation_p.R547G|FAM65B_ENST00000378023.4_Missense_Mutation_p.R547G|FAM65B_ENST00000538035.1_Missense_Mutation_p.R576G|AL512428.1_ENST00000583229.1_RNA|FAM65B_ENST00000510784.2_Missense_Mutation_p.R581G	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	597					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						AGAAAGGATCTGCAGCCTTCA	0.468																																					p.R597G		.											.	FAM65B	91	0			c.A1789G						.						159.0	161.0	160.0					6																	24843221		1951	4144	6095	SO:0001583	missense	9750	exon14			AGGATCTGCAGCC	U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.1789A>G	6.37:g.24843221T>C	ENSP00000259698:p.Arg597Gly	105.0	1.0		113.0	7.0	NM_014722	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	ENST00000259698.4	37	CCDS47383.1	.	.	.	.	.	.	.	.	.	.	T	14.56	2.570980	0.45798	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12	5.5	-2.24	0.06909	.	0.128026	0.64402	D	0.000001	T	0.37945	0.1022	M	0.64997	1.995	0.45046	D	0.998066	P;P;P;P	0.52061	0.95;0.897;0.95;0.95	P;P;P;P	0.54889	0.763;0.488;0.702;0.574	T	0.45071	-0.9286	10	0.30854	T	0.27	-22.4055	17.3939	0.87439	0.0:0.0:0.6617:0.3383	.	581;576;547;597	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	G	597;576;547;547;581	ENSP00000259698:R597G;ENSP00000441138:R576G;ENSP00000367262:R547G;ENSP00000438425:R547G;ENSP00000441305:R581G	ENSP00000259698:R597G	R	-	1	2	FAM65B	24951200	0.849000	0.29639	0.003000	0.11579	0.829000	0.46940	0.872000	0.28037	-0.645000	0.05458	0.460000	0.39030	AGA	.		0.468	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2		
FBXO18	84893	broad.mit.edu;ucsc.edu	37	10	5945117	5945117	+	Nonsense_Mutation	SNP	A	A	T			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr10:5945117A>T	ENST00000362091.4	+	2	251	c.136A>T	c.(136-138)Aga>Tga	p.R46*	FBXO18_ENST00000379999.5_Nonsense_Mutation_p.R97*|FBXO18_ENST00000397269.3_5'UTR|FBXO18_ENST00000470089.1_Intron	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	46					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						TCCTAAACCGAGAACAAAAAG	0.458																																					p.R97X		.											.	FBXO18	228	0			c.A289T						.						74.0	71.0	72.0					10																	5945117		2203	4300	6503	SO:0001587	stop_gained	84893	exon3			AAACCGAGAACAA	AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.136A>T	10.37:g.5945117A>T	ENSP00000355415:p.Arg46*	80.0	0.0		67.0	7.0	NM_032807	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Nonsense_Mutation	SNP	ENST00000362091.4	37	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	A	38	6.771919	0.97825	.	.	ENSG00000134452	ENST00000362091;ENST00000379999	.	.	.	4.55	2.06	0.26882	.	0.268157	0.36234	N	0.002716	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.8588	6.3049	0.21133	0.6084:0.3075:0.0841:0.0	.	.	.	.	X	46;97	.	ENSP00000355415:R46X	R	+	1	2	FBXO18	5985123	0.942000	0.31987	1.000000	0.80357	0.956000	0.61745	0.981000	0.29526	0.289000	0.22422	0.459000	0.35465	AGA	.		0.458	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807	
FYCO1	79443	hgsc.bcm.edu;broad.mit.edu	37	3	46008641	46008641	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr3:46008641C>A	ENST00000296137.2	-	8	2390	c.2185G>T	c.(2185-2187)Gag>Tag	p.E729*	FYCO1_ENST00000535325.1_Nonsense_Mutation_p.E729*	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	729					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		GCCCTAAGCTCTCTGTGCCGG	0.612																																					p.E729X		.											.	FYCO1	91	0			c.G2185T						.						83.0	87.0	86.0					3																	46008641		2203	4300	6503	SO:0001587	stop_gained	79443	exon8			TAAGCTCTCTGTG	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.2185G>T	3.37:g.46008641C>A	ENSP00000296137:p.Glu729*	51.0	0.0		48.0	4.0	NM_024513	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Nonsense_Mutation	SNP	ENST00000296137.2	37	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	C	37	6.490935	0.97612	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	.	.	.	5.64	4.76	0.60689	.	0.315218	0.33772	N	0.004574	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-19.7616	15.1021	0.72288	0.0:0.8592:0.1407:0.0	.	.	.	.	X	729	.	ENSP00000296137:E729X	E	-	1	0	FYCO1	45983645	0.997000	0.39634	0.640000	0.29408	0.257000	0.26127	3.272000	0.51616	1.361000	0.45981	0.563000	0.77884	GAG	.		0.612	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
GALNT12	79695	bcgsc.ca;mdanderson.org	37	9	101570276	101570276	+	Missense_Mutation	SNP	G	G	T			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr9:101570276G>T	ENST00000375011.3	+	1	296	c.296G>T	c.(295-297)cGg>cTg	p.R99L		NM_024642.4	NP_078918.3	Q8IXK2	GLT12_HUMAN	polypeptide N-acetylgalactosaminyltransferase 12	99					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(62;0.0559)				GAGAGCGTGCGGCTGCACCAG	0.721																																					p.R99L		.											.	GALNT12	92	0			c.G296T						.						6.0	7.0	7.0					9																	101570276		2099	4152	6251	SO:0001583	missense	79695	exon1			GCGTGCGGCTGCA	AB078146	CCDS6737.1	9q22.33	2014-03-13	2014-03-13		ENSG00000119514	ENSG00000119514	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19877	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 12"""	610290	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)"""			12135769	Standard	NM_024642		Approved	GalNAc-T12	uc004ayz.3	Q8IXK2	OTTHUMG00000020348	ENST00000375011.3:c.296G>T	9.37:g.101570276G>T	ENSP00000364150:p.Arg99Leu	25.0	0.0		26.0	5.0	NM_024642	Q5TCF7|Q8NG54|Q96CT9|Q9H771	Missense_Mutation	SNP	ENST00000375011.3	37	CCDS6737.1	.	.	.	.	.	.	.	.	.	.	g	15.15	2.748208	0.49257	.	.	ENSG00000119514	ENST00000375011	T	0.55588	0.51	3.91	-0.81	0.10860	.	0.629033	0.15558	N	0.256094	T	0.36663	0.0975	L	0.45228	1.405	0.24539	N	0.994071	B	0.29646	0.253	B	0.23716	0.048	T	0.15435	-1.0437	10	0.34782	T	0.22	.	6.9639	0.24613	0.6925:0.0:0.3075:0.0	.	99	Q8IXK2	GLT12_HUMAN	L	99	ENSP00000364150:R99L	ENSP00000364150:R99L	R	+	2	0	GALNT12	100610097	0.001000	0.12720	0.284000	0.24805	0.874000	0.50279	0.431000	0.21444	-0.107000	0.12088	0.450000	0.29827	CGG	.		0.721	GALNT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053382.1	NM_024642	
GLRA3	8001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	175564944	175564944	+	Missense_Mutation	SNP	T	T	G			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr4:175564944T>G	ENST00000274093.3	-	10	1890	c.1388A>C	c.(1387-1389)cAa>cCa	p.Q463P	GLRA3_ENST00000340217.5_Missense_Mutation_p.Q448P	NM_006529.2	NP_006520.2	O75311	GLRA3_HUMAN	glycine receptor, alpha 3	463					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			endometrium(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	35		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)|Ivermectin(DB00602)|Lindane(DB00431)	GACTTAATCTTGCTGCTGATG	0.393																																					p.Q463P		.											.	GLRA3	93	0			c.A1388C						.						102.0	110.0	107.0					4																	175564944		2203	4300	6503	SO:0001583	missense	8001	exon10			TAATCTTGCTGCT	AF017724	CCDS3822.1, CCDS43283.1	4q34.1	2012-02-07			ENSG00000145451	ENSG00000145451		"""Ligand-gated ion channels / Glycine receptors"""	4328	protein-coding gene	gene with protein product		600421				9677400	Standard	NM_001042543		Approved		uc003ity.1	O75311	OTTHUMG00000149816	ENST00000274093.3:c.1388A>C	4.37:g.175564944T>G	ENSP00000274093:p.Gln463Pro	77.0	0.0		101.0	13.0	NM_006529	D3DP44|O75816|Q5D0E3	Missense_Mutation	SNP	ENST00000274093.3	37	CCDS3822.1	.	.	.	.	.	.	.	.	.	.	T	14.61	2.588129	0.46110	.	.	ENSG00000145451	ENST00000274093;ENST00000340217	T;T	0.69306	-0.24;-0.39	5.87	4.69	0.59074	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.260048	0.27664	N	0.018372	T	0.57681	0.2070	N	0.01874	-0.695	0.40139	D	0.976819	D;P	0.53462	0.96;0.932	D;P	0.64237	0.923;0.84	T	0.70263	-0.4920	10	0.87932	D	0	.	11.8396	0.52346	0.0:0.0684:0.0:0.9316	.	448;463	O75311-2;O75311	.;GLRA3_HUMAN	P	463;448	ENSP00000274093:Q463P;ENSP00000345284:Q448P	ENSP00000274093:Q463P	Q	-	2	0	GLRA3	175801519	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	2.967000	0.49216	1.047000	0.40274	0.482000	0.46254	CAA	.		0.393	GLRA3-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313427.1		
HIST1H3C	8352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26045686	26045686	+	Silent	SNP	T	T	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr6:26045686T>A	ENST00000540144.1	+	1	48	c.48T>A	c.(46-48)gcT>gcA	p.A16A	HIST1H2BB_ENST00000357905.2_5'Flank	NM_003531.2	NP_003522.1	P68431	H31_HUMAN	histone cluster 1, H3c	16					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|skin(1)	8						GCGGCAAAGCTCCGCGCAAGC	0.577																																					p.A16A		.											.	HIST1H3C	69	0			c.T48A						.						40.0	43.0	42.0					6																	26045686		2202	4300	6502	SO:0001819	synonymous_variant	8352	exon1			CAAAGCTCCGCGC	X57128	CCDS4576.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196532	ENSG00000278272		"""Histones / Replication-dependent"""	4768	protein-coding gene	gene with protein product		602812	"""H3 histone family, member C"", ""histone 1, H3c"""	H3FC		8227173, 9119399, 12408966	Standard	NM_003531		Approved	H3/c, H3.1	uc003nfv.3	P68431	OTTHUMG00000014416	ENST00000540144.1:c.48T>A	6.37:g.26045686T>A		113.0	0.0		121.0	13.0	NM_003531	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000540144.1	37	CCDS4576.1																																																																																			.		0.577	HIST1H3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040078.1	NM_003531	
GSTA2	2939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	52617735	52617735	+	Missense_Mutation	SNP	A	A	C			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr6:52617735A>C	ENST00000493422.1	-	5	486	c.331T>G	c.(331-333)Ttt>Gtt	p.F111V		NM_000846.4	NP_000837.3	P09210	GSTA2_HUMAN	glutathione S-transferase alpha 2	111	GST C-terminal.				epithelial cell differentiation (GO:0030855)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(77;0.118)				Azathioprine(DB00993)|Busulfan(DB01008)|Chloroquine(DB00608)|Clofibrate(DB00636)|Ethacrynic acid(DB00903)|Glutathione(DB00143)|Vitamin E(DB00163)	GGTTGACTAAAGGGCAGAAGA	0.383																																					p.F111V		.											.	GSTA2	91	0			c.T331G						.						213.0	200.0	205.0					6																	52617735		2203	4300	6503	SO:0001583	missense	2939	exon5			GACTAAAGGGCAG	AL109918	CCDS4944.1	6p12.2	2012-06-21	2008-11-26		ENSG00000244067	ENSG00000244067	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4627	protein-coding gene	gene with protein product		138360	"""glutathione S-transferase A2"""	GST2			Standard	NM_000846		Approved		uc003pay.3	P09210	OTTHUMG00000016263	ENST00000493422.1:c.331T>G	6.37:g.52617735A>C	ENSP00000420168:p.Phe111Val	94.0	0.0		88.0	8.0	NM_000846	Q12759|Q16491|Q9NTY6	Missense_Mutation	SNP	ENST00000493422.1	37	CCDS4944.1	.	.	.	.	.	.	.	.	.	.	N	7.617	0.676038	0.14841	.	.	ENSG00000244067	ENST00000493422	T	0.10860	2.83	2.26	-4.51	0.03483	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.729488	0.12820	N	0.436484	T	0.02455	0.0075	M	0.67517	2.055	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41016	-0.9532	10	0.46703	T	0.11	.	0.4985	0.00576	0.4261:0.1415:0.1522:0.2802	.	111	P09210	GSTA2_HUMAN	V	111	ENSP00000420168:F111V	ENSP00000420168:F111V	F	-	1	0	GSTA2	52725694	0.000000	0.05858	0.000000	0.03702	0.233000	0.25261	-3.848000	0.00351	-2.016000	0.00945	0.254000	0.18369	TTT	.		0.383	GSTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043589.1	NM_000846	
IQGAP2	10788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	75906955	75906955	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr5:75906955C>T	ENST00000274364.6	+	13	1765	c.1468C>T	c.(1468-1470)Cat>Tat	p.H490Y	CTD-2236F14.1_ENST00000511327.1_RNA|IQGAP2_ENST00000396234.3_Missense_Mutation_p.H43Y|IQGAP2_ENST00000502745.1_Missense_Mutation_p.H43Y|IQGAP2_ENST00000379730.3_Missense_Mutation_p.H49Y	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	490					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		GGACCCAGCCCATGCCCAGCA	0.408																																					p.H490Y		.											.	IQGAP2	96	0			c.C1468T						.						133.0	134.0	133.0					5																	75906955		2203	4300	6503	SO:0001583	missense	10788	exon13			CCAGCCCATGCCC	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.1468C>T	5.37:g.75906955C>T	ENSP00000274364:p.His490Tyr	108.0	0.0		74.0	10.0	NM_006633	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.475821	0.01035	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000514350;ENST00000505766;ENST00000514001;ENST00000396234;ENST00000545384;ENST00000509074;ENST00000502745	T;T;T;T;T;T;T;T	0.06218	3.33;3.33;3.33;3.33;3.33;3.33;3.33;3.33	5.8	-4.55	0.03441	.	1.197060	0.06071	N	0.660004	T	0.02767	0.0083	N	0.12182	0.205	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.0;0.003;0.001	T	0.46303	-0.9201	10	0.02654	T	1	9.0892	7.3199	0.26521	0.2072:0.5359:0.0:0.2569	.	49;440;43;490	F5H7S7;E7EWC2;Q13576-2;Q13576	.;.;.;IQGA2_HUMAN	Y	490;49;463;440;43;43;43;43;43	ENSP00000274364:H490Y;ENSP00000442313:H49Y;ENSP00000423672:H463Y;ENSP00000421097:H440Y;ENSP00000422661:H43Y;ENSP00000379535:H43Y;ENSP00000425351:H43Y;ENSP00000426027:H43Y	ENSP00000274364:H490Y	H	+	1	0	IQGAP2	75942711	0.001000	0.12720	0.000000	0.03702	0.291000	0.27294	1.612000	0.36889	-0.455000	0.07054	-0.482000	0.04802	CAT	.		0.408	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
LHFPL3	375612	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	103969491	103969491	+	Silent	SNP	G	G	T			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr7:103969491G>T	ENST00000401970.2	+	1	344	c.222G>T	c.(220-222)ctG>ctT	p.L74L	LHFPL3_ENST00000543266.1_Silent_p.L88L|LHFPL3_ENST00000424859.1_Silent_p.L74L|LHFPL3_ENST00000535008.1_Silent_p.L88L			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	88						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(6)	9						CCCGGGAGCTGACCTGCAGGG	0.617																																					p.L88L		.											.	.	.	0			c.G264T						.						46.0	53.0	51.0					7																	103969491		2019	4204	6223	SO:0001819	synonymous_variant	375612	exon1			GGAGCTGACCTGC	AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000401970.2:c.222G>T	7.37:g.103969491G>T		62.0	0.0		65.0	13.0	NM_199000	A1L383|A4D0Q5	Silent	SNP	ENST00000401970.2	37																																																																																				.		0.617	LHFPL3-002	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000348284.1	NM_199000	
LOH12CR1	118426	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	12514204	12514204	+	Silent	SNP	C	C	T			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr12:12514204C>T	ENST00000314565.4	+	2	454	c.123C>T	c.(121-123)tcC>tcT	p.S41S	LOH12CR1_ENST00000298571.6_Intron|LOH12CR1_ENST00000542728.1_Silent_p.S22S	NM_058169.3	NP_477517.1	Q969J3	L12R1_HUMAN	loss of heterozygosity, 12, chromosomal region 1	41			S -> C (in dbSNP:rs3741795).							kidney(1)|large_intestine(1)|lung(1)|ovary(1)	4		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.0205)		CTCAGGGCTCCCAGGCCTCAC	0.463																																					p.S41S		.											.	LOH12CR1	91	0			c.C123T						.						186.0	168.0	174.0					12																	12514204		2203	4300	6503	SO:0001819	synonymous_variant	118426	exon2			GGGCTCCCAGGCC	AY037865	CCDS8649.1, CCDS73448.1	12p12	2008-07-03			ENSG00000165714	ENSG00000165714			17950	protein-coding gene	gene with protein product						11896457, 15284860	Standard	XR_242885		Approved	LOH1CR12	uc001ral.2	Q969J3	OTTHUMG00000168542	ENST00000314565.4:c.123C>T	12.37:g.12514204C>T		162.0	0.0		147.0	12.0	NM_058169	Q96QS5	Silent	SNP	ENST00000314565.4	37	CCDS8649.1																																																																																			.		0.463	LOH12CR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400150.1		
LRIG1	26018	hgsc.bcm.edu;broad.mit.edu	37	3	66431944	66431944	+	Missense_Mutation	SNP	G	G	A	rs201954431		TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr3:66431944G>A	ENST00000273261.3	-	17	3253	c.2729C>T	c.(2728-2730)gCg>gTg	p.A910V	LRIG1_ENST00000383703.3_Missense_Mutation_p.A887V|LRIG1_ENST00000496559.2_5'UTR|SLC25A26_ENST00000536651.1_Intron	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	910					innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TTTCTCCATCGCTTTCCACGG	0.517																																					p.A910V		.											.	LRIG1	230	0			c.C2729T						.	G	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	135.0	129.0	131.0		2729	-6.0	0.0	3		131	0,8600		0,0,4300	yes	missense	LRIG1	NM_015541.2	64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	910/1094	66431944	1,13005	2203	4300	6503	SO:0001583	missense	26018	exon17			TCCATCGCTTTCC	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.2729C>T	3.37:g.66431944G>A	ENSP00000273261:p.Ala910Val	94.0	0.0		91.0	4.0	NM_015541	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.608442	0.28623	2.27E-4	0.0	ENSG00000144749	ENST00000273261;ENST00000383703;ENST00000383702	T;T	0.63417	-0.04;0.01	5.96	-5.96	0.02234	.	1.368680	0.04469	N	0.375714	T	0.30293	0.0760	N	0.01297	-0.9	0.09310	N	1	B;B;B	0.12013	0.005;0.005;0.002	B;B;B	0.09377	0.004;0.002;0.001	T	0.37174	-0.9717	10	0.13108	T	0.6	.	13.175	0.59621	0.1944:0.202:0.6036:0.0	.	887;910;910	Q96JA1-2;Q5XWD3;Q96JA1	.;.;LRIG1_HUMAN	V	910;887;813	ENSP00000273261:A910V;ENSP00000373208:A887V	ENSP00000273261:A910V	A	-	2	0	LRIG1	66514634	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.151000	0.10175	-1.444000	0.01950	-0.768000	0.03414	GCG	.		0.517	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRRK1	79705	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	101569225	101569225	+	Silent	SNP	G	G	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr15:101569225G>A	ENST00000388948.3	+	20	3110	c.2751G>A	c.(2749-2751)agG>agA	p.R917R	LRRK1_ENST00000284395.5_Silent_p.R914R	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ACGGCCTGAGGAACCTCTACT	0.552																																					p.R917R		.											.	LRRK1	602	0			c.G2751A						.						93.0	99.0	97.0					15																	101569225		1923	4133	6056	SO:0001819	synonymous_variant	79705	exon20			CCTGAGGAACCTC	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.2751G>A	15.37:g.101569225G>A		68.0	1.0		63.0	7.0	NM_024652		Silent	SNP	ENST00000388948.3	37	CCDS42086.1																																																																																			.		0.552	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
MYH9	4627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	36700184	36700184	+	Silent	SNP	G	G	T			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr22:36700184G>T	ENST00000216181.5	-	19	2477	c.2247C>A	c.(2245-2247)ctC>ctA	p.L749L		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	749	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						GATTGCTGTCGAGCTCCAGGG	0.602			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																												p.L749L		.		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	.	MYH9	292	0			c.C2247A						.						63.0	58.0	60.0					22																	36700184		2203	4300	6503	SO:0001819	synonymous_variant	4627	exon19	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	GCTGTCGAGCTCC		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2247C>A	22.37:g.36700184G>T		119.0	0.0		103.0	16.0	NM_002473	A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	ENST00000216181.5	37	CCDS13927.1																																																																																			.		0.602	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	
NIN	51199	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	51190328	51190328	+	IGR	SNP	C	C	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr14:51190328C>A	ENST00000382041.3	-	0	6496				NIN_ENST00000530997.2_Missense_Mutation_p.L2085F|NIN_ENST00000389868.3_3'UTR|RP11-248J18.3_ENST00000602615.1_RNA|NIN_ENST00000245441.5_Missense_Mutation_p.L2085F	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)						centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					GAGCTTTCAACAACTGGGCAT	0.433			T	PDGFRB	MPD																																p.L2085F		.		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	.	NIN	229	0			c.G6255T						.						143.0	135.0	137.0					14																	51190328		1893	4116	6009	SO:0001628	intergenic_variant	51199	exon31			TTTCAACAACTGG	AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569		14.37:g.51190328C>A		136.0	0.0		111.0	18.0	NM_020921	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	ENST00000382041.3	37	CCDS32079.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.982684|3.982684	0.74474|0.74474	.|.	.|.	ENSG00000100503|ENSG00000100503	ENST00000245441;ENST00000311149|ENST00000530997	T|.	0.56941|.	0.43|.	5.92|5.92	3.02|3.02	0.34903|0.34903	.|.	0.079506|.	0.51477|.	N|.	0.000085|.	T|T	0.63733|0.63733	0.2536|0.2536	M|M	0.68317|0.68317	2.08|2.08	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.59085|0.59085	-0.7520|-0.7520	10|5	0.66056|.	D|.	0.02|.	-5.9259|-5.9259	10.2581|10.2581	0.43410|0.43410	0.0:0.7759:0.0:0.2241|0.0:0.7759:0.0:0.2241	.|.	2085|.	Q8N4C6-7|.	.|.	F|F	2085;2068|1576	ENSP00000245441:L2085F|.	ENSP00000245441:L2085F|.	L|V	-|-	3|1	2|0	NIN|NIN	50260078|50260078	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	1.008000|1.008000	0.29872|0.29872	0.358000|0.358000	0.24211|0.24211	-0.345000|-0.345000	0.07892|0.07892	TTG|GTT	.		0.433	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946	
NOTCH3	4854	broad.mit.edu;mdanderson.org	37	19	15288466	15288466	+	Missense_Mutation	SNP	A	A	G			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr19:15288466A>G	ENST00000263388.2	-	24	4348	c.4273T>C	c.(4273-4275)Tgg>Cgg	p.W1425R		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1425					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CATTGCCGCCAGGGGTCGCCC	0.716																																					p.W1425R		.											.	NOTCH3	855	0			c.T4273C						.						4.0	4.0	4.0					19																	15288466		1902	3845	5747	SO:0001583	missense	4854	exon24			GCCGCCAGGGGTC	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.4273T>C	19.37:g.15288466A>G	ENSP00000263388:p.Trp1425Arg	14.0	0.0		14.0	3.0	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	A	28.4	4.915119	0.92178	.	.	ENSG00000074181	ENST00000263388	D	0.91521	-2.86	4.66	4.66	0.58398	Notch domain (4);	.	.	.	.	D	0.94978	0.8375	M	0.83012	2.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94689	0.7872	9	0.44086	T	0.13	.	13.0613	0.59008	1.0:0.0:0.0:0.0	.	1425	Q9UM47	NOTC3_HUMAN	R	1425	ENSP00000263388:W1425R	ENSP00000263388:W1425R	W	-	1	0	NOTCH3	15149466	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.048000	0.93830	1.728000	0.51552	0.260000	0.18958	TGG	.		0.716	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
PENK	5179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	57354357	57354357	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr8:57354357C>T	ENST00000314922.3	-	2	354	c.278G>A	c.(277-279)aGc>aAc	p.S93N	PENK_ENST00000523274.1_5'UTR|PENK_ENST00000451791.2_Missense_Mutation_p.S93N	NM_006211.3	NP_006202.1	P01210	PENK_HUMAN	proenkephalin	93					aggressive behavior (GO:0002118)|behavioral fear response (GO:0001662)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|startle response (GO:0001964)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	21		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			TAGCAAATGGCTTTCTTCCGG	0.483																																					p.S93N		.											.	PENK	517	0			c.G278A						.						107.0	104.0	105.0					8																	57354357		2203	4300	6503	SO:0001583	missense	5179	exon4			AAATGGCTTTCTT		CCDS6168.1	8q23-q24	2013-02-26				ENSG00000181195		"""Endogenous ligands"""	8831	protein-coding gene	gene with protein product	"""preproenkephalin"""	131330				6281660	Standard	NM_006211		Approved		uc003xsz.2	P01210		ENST00000314922.3:c.278G>A	8.37:g.57354357C>T	ENSP00000324248:p.Ser93Asn	91.0	0.0		81.0	10.0	NM_001135690	B2RC23|Q6FHC6|Q6FHE6	Missense_Mutation	SNP	ENST00000314922.3	37	CCDS6168.1	.	.	.	.	.	.	.	.	.	.	C	6.392	0.440467	0.12104	.	.	ENSG00000181195	ENST00000539312;ENST00000314922;ENST00000451791;ENST00000518974	T;T;T	0.43688	2.3;2.3;0.94	6.08	4.3	0.51218	.	0.376529	0.36002	N	0.002856	T	0.28962	0.0719	L	0.31926	0.97	0.40735	D	0.982786	B	0.06786	0.001	B	0.06405	0.002	T	0.07986	-1.0744	10	0.16896	T	0.51	-6.2633	9.8319	0.40948	0.0:0.771:0.0:0.229	.	93	P01210	PENK_HUMAN	N	93	ENSP00000324248:S93N;ENSP00000400894:S93N;ENSP00000428012:S93N	ENSP00000324248:S93N	S	-	2	0	PENK	57516911	0.001000	0.12720	0.499000	0.27577	0.749000	0.42624	-0.126000	0.10563	0.918000	0.36919	0.655000	0.94253	AGC	.		0.483	PENK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378645.1		
PMP2	5375	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	82357195	82357195	+	Missense_Mutation	SNP	T	T	C			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr8:82357195T>C	ENST00000256103.2	-	2	239	c.103A>G	c.(103-105)Aat>Gat	p.N35D	PMP2_ENST00000519260.1_Intron|RP11-157I4.4_ENST00000524085.2_RNA	NM_002677.3	NP_002668.1	P02689	MYP2_HUMAN	peripheral myelin protein 2	35					membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	cholesterol binding (GO:0015485)|fatty acid binding (GO:0005504)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			Epithelial(68;0.186)			TTGGCCAAATTTCCCAGTTTT	0.398																																					p.N35D		.											.	PMP2	90	0			c.A103G						.						101.0	97.0	98.0					8																	82357195		2203	4300	6503	SO:0001583	missense	5375	exon2			CCAAATTTCCCAG	X62167	CCDS6229.1	8q21.3-q22.1	2013-03-01			ENSG00000147588	ENSG00000147588		"""Fatty acid binding protein family"""	9117	protein-coding gene	gene with protein product		170715				1720307, 8288226	Standard	NM_002677		Approved	MP2, FABP8, M-FABP	uc003ycb.1	P02689	OTTHUMG00000164600	ENST00000256103.2:c.103A>G	8.37:g.82357195T>C	ENSP00000256103:p.Asn35Asp	82.0	0.0		105.0	22.0	NM_002677	Q6FHL4	Missense_Mutation	SNP	ENST00000256103.2	37	CCDS6229.1	.	.	.	.	.	.	.	.	.	.	T	15.47	2.844477	0.51164	.	.	ENSG00000147588	ENST00000256103	T	0.08546	3.08	6.16	5.01	0.66863	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.186077	0.56097	D	0.000027	T	0.13543	0.0328	M	0.82132	2.575	0.80722	D	1	B	0.21905	0.062	B	0.25884	0.064	T	0.01982	-1.1235	10	0.46703	T	0.11	.	8.404	0.32603	0.0:0.2159:0.0:0.7841	.	35	P02689	MYP2_HUMAN	D	35	ENSP00000256103:N35D	ENSP00000256103:N35D	N	-	1	0	PMP2	82519750	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.064000	0.41432	1.143000	0.42306	0.528000	0.53228	AAT	.		0.398	PMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379365.1	NM_002677	
PPP1R14D	54866	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	41120819	41120819	+	Silent	SNP	A	A	C			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr15:41120819A>C	ENST00000299174.5	-	1	88	c.21T>G	c.(19-21)gcT>gcG	p.A7A	PPP1R14D_ENST00000427255.2_Silent_p.A7A	NM_017726.7	NP_060196.1	Q9NXH3	PP14D_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 14D	7					regulation of phosphorylation (GO:0042325)	cytoplasm (GO:0005737)	protein phosphatase inhibitor activity (GO:0004864)			breast(1)|large_intestine(2)|lung(2)|skin(1)	6		all_cancers(109;6.29e-14)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.88e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		ATGTGCAGGAAGCAGGGCTTG	0.547																																					p.A7A		.											.	PPP1R14D	658	0			c.T21G						.						95.0	83.0	87.0					15																	41120819		2203	4300	6503	SO:0001819	synonymous_variant	54866	exon1			GCAGGAAGCAGGG	AK000258	CCDS10066.1, CCDS45230.1	15q11.2-q14	2012-04-17			ENSG00000166143	ENSG00000166143		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14953	protein-coding gene	gene with protein product	"""gut and brain phosphatase inhibitor 1"", ""PKC-dependent PP1 inhibitory protein"""	613256				11948623	Standard	NM_017726		Approved	CPI17-like, FLJ20251, GBPI-1, MGC119014, MGC119016	uc001zmz.3	Q9NXH3	OTTHUMG00000130064	ENST00000299174.5:c.21T>G	15.37:g.41120819A>C		86.0	0.0		70.0	14.0	NM_017726	Q4V773	Silent	SNP	ENST00000299174.5	37	CCDS10066.1																																																																																			.		0.547	PPP1R14D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252355.2	NM_017726	
PSMA8	143471	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	23772351	23772352	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr18:23772351_23772352insA	ENST00000308268.6	+	7	836_837	c.747_748insA	c.(748-750)aaafs	p.K250fs	PSMA8_ENST00000343848.6_Frame_Shift_Ins_p.K206fs|PSMA8_ENST00000415576.2_Frame_Shift_Ins_p.K244fs	NM_001025096.1|NM_144662.2	NP_001020267.1|NP_653263.2	Q8TAA3	PSA7L_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 8	250					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|proteasome core complex, alpha-subunit complex (GO:0019773)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)	p.K249N(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|skin(2)	16	all_cancers(21;0.000585)|Lung NSC(5;0.00148)|all_lung(6;0.0038)|Ovarian(20;0.124)		OV - Ovarian serous cystadenocarcinoma(3;0.000324)|all cancers(3;0.000954)|LUSC - Lung squamous cell carcinoma(2;0.181)			AAGCAGAGAAGAAAAAATCAAA	0.302																																					p.K249fs		.											.	PSMA8	91	1	Substitution - Missense(1)	large_intestine(1)	c.747_748insA						.																																			SO:0001589	frameshift_variant	143471	exon7			AGAGAAGAAAAAA	BC047355	CCDS32808.1, CCDS45842.1, CCDS45843.1	18q11.2	2006-12-18				ENSG00000154611		"""Proteasome (prosome, macropain) subunits"""	22985	protein-coding gene	gene with protein product							Standard	XM_005258199		Approved	MGC26605, PSMA7L	uc002kvq.3	Q8TAA3		ENST00000308268.6:c.753dupA	18.37:g.23772357_23772357dupA	ENSP00000311121:p.Lys250fs	73.0	0.0		97.0	15.0	NM_144662	B0YJ75|Q8IVP4|Q8TA98|Q8TAA2	Frame_Shift_Ins	INS	ENST00000308268.6	37	CCDS32808.1																																																																																			.		0.302	PSMA8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000446255.1	NM_144662	
RHBDD1	84236	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	227729638	227729638	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr2:227729638G>A	ENST00000341329.3	+	2	471	c.229G>A	c.(229-231)Gat>Aat	p.D77N	RHBDD1_ENST00000392062.2_Missense_Mutation_p.D77N	NM_032276.3	NP_115652.2	Q8TEB9	RHBL4_HUMAN	rhomboid domain containing 1	77					apoptotic process (GO:0006915)|cellular response to unfolded protein (GO:0034620)|cellular response to UV (GO:0034644)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|membrane protein intracellular domain proteolysis (GO:0031293)|membrane protein proteolysis (GO:0033619)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein processing (GO:0010954)|positive regulation of secretion (GO:0051047)|post-translational protein modification (GO:0043687)|spermatid differentiation (GO:0048515)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of endoplasmic reticulum membrane (GO:0030176)|mitochondrion (GO:0005739)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)	p.D77N(1)		breast(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)		TCACCATGCTGATGATTGGCA	0.453																																					p.D77N		.											.	RHBDD1	91	1	Substitution - Missense(1)	skin(1)	c.G229A						.						171.0	159.0	163.0					2																	227729638		2203	4300	6503	SO:0001583	missense	84236	exon4			CATGCTGATGATT	AK074258	CCDS2464.1	2q36.3	2012-07-09			ENSG00000144468	ENSG00000144468			23081	protein-coding gene	gene with protein product						12838346	Standard	NM_032276		Approved	DKFZp547E052	uc002voi.3	Q8TEB9	OTTHUMG00000133178	ENST00000341329.3:c.229G>A	2.37:g.227729638G>A	ENSP00000344779:p.Asp77Asn	131.0	0.0		98.0	9.0	NM_001167608	Q495B9|Q53S43|Q5EBM8|Q6P5V8|Q8IV60|Q9H057	Missense_Mutation	SNP	ENST00000341329.3	37	CCDS2464.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.254607	0.39896	.	.	ENSG00000144468	ENST00000424132;ENST00000341329;ENST00000392062;ENST00000423616;ENST00000448992	T;T;T;T;T	0.13538	2.58;2.58;2.58;2.58;2.58	6.04	3.3	0.37823	Peptidase S54, rhomboid domain (1);	0.176196	0.64402	N	0.000012	T	0.30759	0.0775	L	0.59912	1.85	0.43617	D	0.995992	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.00822	-1.1552	10	0.20046	T	0.44	-13.515	14.614	0.68534	0.1711:0.0:0.8289:0.0	.	77;77	C9K011;Q8TEB9	.;RHBD1_HUMAN	N	77	ENSP00000400765:D77N;ENSP00000344779:D77N;ENSP00000375914:D77N;ENSP00000399694:D77N;ENSP00000388847:D77N	ENSP00000344779:D77N	D	+	1	0	RHBDD1	227437882	1.000000	0.71417	0.001000	0.08648	0.079000	0.17450	5.481000	0.66826	0.168000	0.19655	-2.010000	0.00438	GAT	.		0.453	RHBDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256885.2		
RNF11	26994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	51736890	51736890	+	Missense_Mutation	SNP	T	T	C			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr1:51736890T>C	ENST00000242719.3	+	3	847	c.361T>C	c.(361-363)Tat>Cat	p.Y121H	RNF11_ENST00000494873.1_3'UTR	NM_014372.4	NP_055187.1	Q9Y3C5	RNF11_HUMAN	ring finger protein 11	121					protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.0?(2)		large_intestine(1)	1						CATGCACATCTATCACCTGGA	0.473																																					p.Y121H		.											.	RNF11	226	2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)	c.T361C						.						244.0	202.0	216.0					1																	51736890		2203	4300	6503	SO:0001583	missense	26994	exon3			CACATCTATCACC	AB024703	CCDS556.1	1p32	2013-01-09			ENSG00000123091	ENSG00000123091		"""RING-type (C3HC4) zinc fingers"""	10056	protein-coding gene	gene with protein product		612598				10673045, 10810093	Standard	NM_014372		Approved	CGI-123, Sid1669p, MGC51169	uc001csi.4	Q9Y3C5	OTTHUMG00000008190	ENST00000242719.3:c.361T>C	1.37:g.51736890T>C	ENSP00000242719:p.Tyr121His	51.0	0.0		61.0	6.0	NM_014372	A8KAI2|Q5T7R8	Missense_Mutation	SNP	ENST00000242719.3	37	CCDS556.1	.	.	.	.	.	.	.	.	.	.	T	19.23	3.788012	0.70337	.	.	ENSG00000123091	ENST00000242719	T	0.45668	0.89	5.89	5.89	0.94794	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	T	0.66587	0.2804	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.70806	-0.4772	10	0.87932	D	0	-1.8925	16.3127	0.82898	0.0:0.0:0.0:1.0	.	121	Q9Y3C5	RNF11_HUMAN	H	121	ENSP00000242719:Y121H	ENSP00000242719:Y121H	Y	+	1	0	RNF11	51509478	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.004000	0.88535	2.246000	0.74042	0.533000	0.62120	TAT	.		0.473	RNF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022419.1	NM_014372	
RTN4R	65078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	20229527	20229527	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr22:20229527G>A	ENST00000043402.7	-	2	1567	c.1129C>T	c.(1129-1131)Cgg>Tgg	p.R377W	RTN4R_ENST00000469601.1_5'Flank	NM_023004.5	NP_075380.1	Q9BZR6	RTN4R_HUMAN	reticulon 4 receptor	377					axonogenesis (GO:0007409)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			lung(1)|ovary(1)|prostate(1)	3	Colorectal(54;0.0993)					TTGATGTGCCGTGGGCCAGAG	0.687																																					p.R377W		.											.	RTN4R	90	0			c.C1129T	GRCh37	CM086907	RTN4R	M		.						34.0	35.0	34.0					22																	20229527		2192	4272	6464	SO:0001583	missense	65078	exon2			TGTGCCGTGGGCC	AF283463	CCDS13777.1	22q11	2008-05-02			ENSG00000040608	ENSG00000040608			18601	protein-coding gene	gene with protein product		605566				11201742	Standard	NM_023004		Approved	NOGOR	uc002zrv.3	Q9BZR6	OTTHUMG00000150572	ENST00000043402.7:c.1129C>T	22.37:g.20229527G>A	ENSP00000043402:p.Arg377Trp	22.0	0.0		30.0	12.0	NM_023004	D3DX28	Missense_Mutation	SNP	ENST00000043402.7	37	CCDS13777.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.795123	0.31777	.	.	ENSG00000040608	ENST00000043402	T	0.63255	-0.03	3.84	-1.49	0.08718	.	.	.	.	.	T	0.59528	0.2200	N	0.22421	0.69	0.09310	N	1	D	0.89917	1.0	D	0.64687	0.928	T	0.52193	-0.8608	9	0.87932	D	0	.	6.3987	0.21626	0.0:0.1616:0.2918:0.5466	.	377	Q9BZR6	RTN4R_HUMAN	W	377	ENSP00000043402:R377W	ENSP00000043402:R377W	R	-	1	2	RTN4R	18609527	0.000000	0.05858	0.040000	0.18447	0.249000	0.25844	0.059000	0.14322	-0.007000	0.14345	0.313000	0.20887	CGG	.		0.687	RTN4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318950.2		
RUNX3	864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	25229111	25229111	+	Silent	SNP	G	G	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr1:25229111G>A	ENST00000308873.6	-	5	758	c.750C>T	c.(748-750)cgC>cgT	p.R250R	RUNX3_ENST00000496967.1_5'UTR|RUNX3_ENST00000399916.1_Silent_p.R264R|RUNX3_ENST00000540420.1_Silent_p.R157R|RUNX3_ENST00000338888.3_Silent_p.R264R	NM_004350.2	NP_004341.1	Q13761	RUNX3_HUMAN	runt-related transcription factor 3	250	Pro/Ser/Thr-rich.				axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		TGGGGAAGGAGCGGTCAAACT	0.647																																					p.R264R		.											.	RUNX3	414	0			c.C792T						.						78.0	75.0	76.0					1																	25229111		2192	4290	6482	SO:0001819	synonymous_variant	864	exon6			GAAGGAGCGGTCA	BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000308873.6:c.750C>T	1.37:g.25229111G>A		141.0	0.0		105.0	17.0	NM_001031680	B1AJV5|Q12969|Q13760	Silent	SNP	ENST00000308873.6	37	CCDS257.1																																																																																			.		0.647	RUNX3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009284.1	NM_004350	
SETD8	387893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	123880924	123880924	+	Missense_Mutation	SNP	T	T	G	rs77198130		TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr12:123880924T>G	ENST00000402868.3	+	5	968	c.542T>G	c.(541-543)cTt>cGt	p.L181R	SETD8_ENST00000330479.4_Missense_Mutation_p.L181R|SETD8_ENST00000478781.2_3'UTR			Q9NQR1	SETD8_HUMAN	SET domain containing (lysine methyltransferase) 8	222					histone lysine methylation (GO:0034968)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|urinary_tract(1)	13	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)		AATCGCAAACTTACGGATTTC	0.502																																					p.L181R		.											.	SETD8	90	0			c.T542G						.						84.0	84.0	84.0					12																	123880924		2203	4300	6503	SO:0001583	missense	387893	exon5			GCAAACTTACGGA	AY102937	CCDS9247.1	12q24.31	2011-07-01			ENSG00000183955	ENSG00000183955		"""Chromatin-modifying enzymes / K-methyltransferases"""	29489	protein-coding gene	gene with protein product		607240				15933070, 12086618, 12121615	Standard	NM_020382		Approved	SET8, SET07, PR-Set7, KMT5A	uc001uew.3	Q9NQR1	OTTHUMG00000150477	ENST00000402868.3:c.542T>G	12.37:g.123880924T>G	ENSP00000384629:p.Leu181Arg	50.0	0.0		34.0	8.0	NM_020382	A8K9D0|Q86W83|Q8TD09	Missense_Mutation	SNP	ENST00000402868.3	37	CCDS9247.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.601866	0.87055	.	.	ENSG00000183955	ENST00000402868;ENST00000330479;ENST00000437502	D;D	0.98531	-4.98;-4.98	5.84	5.84	0.93424	.	0.109289	0.64402	D	0.000007	D	0.98112	0.9377	L	0.48642	1.525	0.54753	D	0.999988	D;D	0.58970	0.984;0.973	P;P	0.59948	0.866;0.847	D	0.99357	1.0916	10	0.72032	D	0.01	-12.3499	16.2159	0.82217	0.0:0.0:0.0:1.0	.	222;181	Q9NQR1;Q9NQR1-2	SETD8_HUMAN;.	R	181;181;172	ENSP00000384629:L181R;ENSP00000332995:L181R	ENSP00000332995:L181R	L	+	2	0	SETD8	122446877	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.834000	0.75339	2.243000	0.73865	0.533000	0.62120	CTT	.		0.502	SETD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318263.1	NM_020382	
SORBS1	10580	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	97197265	97197265	+	Missense_Mutation	SNP	T	T	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr10:97197265T>A	ENST00000361941.3	-	2	84	c.58A>T	c.(58-60)Agc>Tgc	p.S20C	SORBS1_ENST00000371241.1_Missense_Mutation_p.S20C|SORBS1_ENST00000393949.1_Missense_Mutation_p.S20C|SORBS1_ENST00000347291.4_Missense_Mutation_p.S20C|SORBS1_ENST00000354106.3_Missense_Mutation_p.S20C|SORBS1_ENST00000306402.6_Missense_Mutation_p.S20C|SORBS1_ENST00000371247.2_Missense_Mutation_p.S20C|SORBS1_ENST00000474353.2_5'UTR|SORBS1_ENST00000371239.1_Missense_Mutation_p.S20C|SORBS1_ENST00000607232.1_Missense_Mutation_p.S20C|SORBS1_ENST00000353505.5_Missense_Mutation_p.S20C|SORBS1_ENST00000371249.2_Missense_Mutation_p.S20C|SORBS1_ENST00000371246.2_Missense_Mutation_p.S20C|SORBS1_ENST00000277982.5_Missense_Mutation_p.S20C|SORBS1_ENST00000371245.3_Missense_Mutation_p.S20C|SORBS1_ENST00000371227.4_Missense_Mutation_p.S20C	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TGCCCATTGCTGCCAGGTGCC	0.498																																					p.S20C		.											.	SORBS1	155	0			c.A58T						.						182.0	148.0	159.0					10																	97197265		2203	4300	6503	SO:0001583	missense	10580	exon2			CATTGCTGCCAGG	AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.58A>T	10.37:g.97197265T>A	ENSP00000355136:p.Ser20Cys	189.0	0.0		148.0	11.0	NM_001034955		Missense_Mutation	SNP	ENST00000361941.3	37	CCDS31255.1	.	.	.	.	.	.	.	.	.	.	T	14.91	2.676251	0.47886	.	.	ENSG00000095637	ENST00000371245;ENST00000306402;ENST00000371249;ENST00000371247;ENST00000371227;ENST00000371246;ENST00000393949;ENST00000353505;ENST00000347291;ENST00000361941;ENST00000277982;ENST00000371241;ENST00000354106;ENST00000371239	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.19938	2.71;2.21;2.66;2.51;2.33;2.83;2.29;2.71;2.11;2.51;2.83;2.59;2.29;2.6	5.19	4.02	0.46733	.	0.166674	0.28821	N	0.014028	T	0.31482	0.0798	L	0.32530	0.975	0.20403	N	0.999905	P;P;D;D;D;D;D;D;D;D;D;D	0.76494	0.947;0.464;0.999;0.996;0.993;0.986;0.983;0.996;0.996;0.994;0.998;0.996	P;B;D;D;P;P;P;D;P;P;D;P	0.68621	0.541;0.112;0.957;0.937;0.9;0.849;0.9;0.959;0.849;0.759;0.959;0.849	T	0.05616	-1.0874	10	0.87932	D	0	-1.7903	9.9905	0.41868	0.0:0.0:0.1704:0.8296	.	20;20;20;20;20;20;20;20;20;20;20;20	B7Z9B7;B4DTX5;F2Z2S3;Q9BX66-11;Q9BX66-10;Q9BX66-9;Q9BX66-4;Q9BX66-8;Q9BX66-3;Q9BX66;Q9BX66-2;Q9BX66-6	.;.;.;.;.;.;.;.;.;SRBS1_HUMAN;.;.	C	20	ENSP00000360291:S20C;ENSP00000302556:S20C;ENSP00000360295:S20C;ENSP00000360293:S20C;ENSP00000360271:S20C;ENSP00000360292:S20C;ENSP00000377521:S20C;ENSP00000343998:S20C;ENSP00000277985:S20C;ENSP00000355136:S20C;ENSP00000277982:S20C;ENSP00000360285:S20C;ENSP00000277984:S20C;ENSP00000360283:S20C	ENSP00000277982:S20C	S	-	1	0	SORBS1	97187255	1.000000	0.71417	0.846000	0.33378	0.440000	0.31957	4.662000	0.61525	0.880000	0.35969	0.528000	0.53228	AGC	.		0.498	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049517.1		
ST3GAL5	8869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	86075256	86075256	+	Silent	SNP	C	C	T	rs144270260	byFrequency	TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr2:86075256C>T	ENST00000377332.3	-	4	498	c.390G>A	c.(388-390)gcG>gcA	p.A130A	ST3GAL5_ENST00000393808.3_Silent_p.A107A|ST3GAL5_ENST00000393805.1_Silent_p.A102A	NM_003896.3	NP_003887.3	Q9UNP4	SIAT9_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 5	130					carbohydrate metabolic process (GO:0005975)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	lactosylceramide alpha-2,3-sialyltransferase activity (GO:0047291)|neolactotetraosylceramide alpha-2,3-sialyltransferase activity (GO:0004513)|sialyltransferase activity (GO:0008373)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15						CAAATAACAGCGCCATTGATG	0.473																																					p.A130A		.											.	ST3GAL5	90	0			c.G390A						.	C	,	0,4406		0,0,2203	285.0	288.0	287.0		321,390	-10.1	0.0	2	dbSNP_134	287	6,8594	5.7+/-21.5	0,6,4294	no	coding-synonymous,coding-synonymous	ST3GAL5	NM_001042437.1,NM_003896.3	,	0,6,6497	TT,TC,CC		0.0698,0.0,0.0461	,	107/396,130/419	86075256	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	8869	exon4			TAACAGCGCCATT	AB018356	CCDS1986.2, CCDS42705.1	2p11.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000115525	ENSG00000115525	2.4.99.9	"""Sialyltransferases"""	10872	protein-coding gene	gene with protein product		604402	"""sialyltransferase 9 (CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase; GM3 synthase)"""	SIAT9		9822625	Standard	NM_003896		Approved	ST3GalV, SIATGM3S	uc002sqq.1	Q9UNP4	OTTHUMG00000130171	ENST00000377332.3:c.390G>A	2.37:g.86075256C>T		160.0	0.0		128.0	24.0	NM_003896	B3KM82|D6W5L9|O94902|Q53QU1|Q6NZX4|Q6YFL1	Silent	SNP	ENST00000377332.3	37	CCDS1986.2																																																																																			C|0.999;T|0.001		0.473	ST3GAL5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252486.1	NM_003896	
TAAR2	9287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	132938785	132938785	+	Missense_Mutation	SNP	C	C	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr6:132938785C>A	ENST00000367931.1	-	2	559	c.560G>T	c.(559-561)gGa>gTa	p.G187V	TAAR2_ENST00000537809.1_Missense_Mutation_p.G142V|TAAR2_ENST00000275191.2_Missense_Mutation_p.G142V			Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2	187					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)	p.G187E(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)	23	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		GCCCTCTATTCCATCTGCATA	0.463																																					p.G187V		.											.	TAAR2	91	1	Substitution - Missense(1)	skin(1)	c.G560T						.						75.0	65.0	69.0					6																	132938785		2203	4299	6502	SO:0001583	missense	9287	exon2			TCTATTCCATCTG	AF112460	CCDS34541.1, CCDS5157.1	6q24	2012-08-08	2005-02-23	2005-02-24	ENSG00000146378	ENSG00000146378		"""GPCR / Class A : Trace amine associated receptors"""	4514	protein-coding gene	gene with protein product		604849	"""G protein-coupled receptor 58"""	GPR58		10684976, 15718104	Standard	NM_014626		Approved		uc003qdl.1	Q9P1P5	OTTHUMG00000015585	ENST00000367931.1:c.560G>T	6.37:g.132938785C>A	ENSP00000356908:p.Gly187Val	123.0	0.0		96.0	12.0	NM_001033080	Q5QD02|Q6NWS1|Q6NWS2|Q6NWS3	Missense_Mutation	SNP	ENST00000367931.1	37	CCDS34541.1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.080470	0.55753	.	.	ENSG00000146378	ENST00000275191;ENST00000367931;ENST00000537809	T;T;T	0.72051	-0.62;-0.62;-0.62	6.0	6.0	0.97389	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.83330	0.5231	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.85003	0.0901	10	0.72032	D	0.01	-31.393	15.5602	0.76237	0.0:0.9326:0.0:0.0674	.	187	Q9P1P5	TAAR2_HUMAN	V	142;187;142	ENSP00000275191:G142V;ENSP00000356908:G187V;ENSP00000441263:G142V	ENSP00000275191:G142V	G	-	2	0	TAAR2	132980478	0.947000	0.32204	0.961000	0.40146	0.540000	0.34992	2.348000	0.44045	2.846000	0.97976	0.650000	0.86243	GGA	.		0.463	TAAR2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390735.1	NM_014626	
THOC5	8563	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	29907254	29907254	+	Missense_Mutation	SNP	T	T	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr22:29907254T>A	ENST00000490103.1	-	19	1951	c.1829A>T	c.(1828-1830)aAg>aTg	p.K610M	CTA-256D12.11_ENST00000411969.1_RNA|THOC5_ENST00000397871.1_Missense_Mutation_p.K610M|THOC5_ENST00000397872.1_Missense_Mutation_p.K610M|THOC5_ENST00000397873.2_Missense_Mutation_p.K610M	NM_003678.4	NP_003669.4	Q13769	THOC5_HUMAN	THO complex 5	610					blastocyst development (GO:0001824)|cell morphogenesis (GO:0000902)|monocyte differentiation (GO:0030224)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of macrophage differentiation (GO:0045650)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|primitive hemopoiesis (GO:0060215)|regulation of mRNA export from nucleus (GO:0010793)|regulation of stem cell division (GO:2000035)|RNA splicing (GO:0008380)|stem cell division (GO:0017145)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	mRNA binding (GO:0003729)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						ACACAGCTCCTTGTAGCACAC	0.587																																					p.K610M		.											.	THOC5	585	0			c.A1829T						.						102.0	86.0	91.0					22																	29907254		2203	4300	6503	SO:0001583	missense	8563	exon20			AGCTCCTTGTAGC	AB023200	CCDS13859.1	22q12	2013-02-11			ENSG00000100296	ENSG00000100296		"""THO complex subunits"""	19074	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 79"""	612733	"""chromosome 22 open reading frame 19"""	C22orf19		11979277, 8242058, 10231032, 19015024, 18373705	Standard	NM_003678		Approved	PK1.3, KIAA0983, Fmip, fSAP79	uc003afs.3	Q13769	OTTHUMG00000151291	ENST00000490103.1:c.1829A>T	22.37:g.29907254T>A	ENSP00000420306:p.Lys610Met	51.0	0.0		60.0	8.0	NM_001002878	O60839|Q9UPZ5	Missense_Mutation	SNP	ENST00000490103.1	37	CCDS13859.1	.	.	.	.	.	.	.	.	.	.	T	14.94	2.684577	0.47991	.	.	ENSG00000100296	ENST00000490103;ENST00000397872;ENST00000397871;ENST00000397873	T;T;T;T	0.24350	1.86;1.86;1.86;1.86	6.05	3.57	0.40892	.	0.340144	0.38272	N	0.001743	T	0.22085	0.0532	L	0.47716	1.5	0.33191	D	0.550866	P	0.39624	0.681	B	0.37601	0.254	T	0.32981	-0.9886	10	0.45353	T	0.12	-30.2859	10.3983	0.44214	0.0:0.2017:0.0:0.7983	.	610	Q13769	THOC5_HUMAN	M	610	ENSP00000420306:K610M;ENSP00000380970:K610M;ENSP00000380969:K610M;ENSP00000380971:K610M	ENSP00000380969:K610M	K	-	2	0	THOC5	28237254	1.000000	0.71417	0.997000	0.53966	0.935000	0.57460	1.174000	0.31932	1.061000	0.40601	0.528000	0.53228	AAG	.		0.587	THOC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322097.1	NM_003678	
TMEM150B	284417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55824349	55824349	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr19:55824349C>T	ENST00000326652.4	-	8	762	c.580G>A	c.(580-582)Gcg>Acg	p.A194T	TMEM150B_ENST00000438693.1_Missense_Mutation_p.A194T|CTD-2105E13.14_ENST00000596786.1_RNA	NM_001282011.1	NP_001268940.1	A6NC51	T150B_HUMAN	transmembrane protein 150B	194						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3						CCGAAGAGCGCGAACAGCAGC	0.677																																					p.A194T		.											.	TMEM150B	68	0			c.G580A						.						34.0	42.0	39.0					19																	55824349		2175	4271	6446	SO:0001583	missense	284417	exon8			AGAGCGCGAACAG	BC020862	CCDS42629.1	19q13.42	2009-06-12	2009-06-12	2009-06-12		ENSG00000180061			34415	protein-coding gene	gene with protein product			"""transmembrane protein 224"""	TMEM224			Standard	XM_005258812		Approved		uc010esw.1	A6NC51		ENST00000326652.4:c.580G>A	19.37:g.55824349C>T	ENSP00000320757:p.Ala194Thr	98.0	0.0		86.0	11.0	NM_001085488	B7ZW71	Missense_Mutation	SNP	ENST00000326652.4	37	CCDS42629.1	.	.	.	.	.	.	.	.	.	.	.	3.981	-0.006402	0.07773	.	.	ENSG00000180061	ENST00000326652;ENST00000438693	T;T	0.44482	0.92;0.92	4.55	-9.11	0.00711	.	3.398480	0.00628	N	0.000462	T	0.23727	0.0574	N	0.13098	0.295	0.09310	N	1	B	0.17465	0.022	B	0.06405	0.002	T	0.19910	-1.0291	10	0.21014	T	0.42	6.9623	11.427	0.50015	0.0:0.4132:0.4512:0.1356	.	194	A6NC51	T150B_HUMAN	T	194	ENSP00000320757:A194T;ENSP00000412658:A194T	ENSP00000320757:A194T	A	-	1	0	TMEM150B	60516161	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-5.438000	0.00122	-3.570000	0.00139	-0.350000	0.07774	GCG	.		0.677	TMEM150B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452685.1	NM_001085488	
TMPRSS7	344805	broad.mit.edu;ucsc.edu;mdanderson.org	37	3	111785346	111785346	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr3:111785346C>T	ENST00000452346.2	+	13	1666	c.1663C>T	c.(1663-1665)Caa>Taa	p.Q555*	TMPRSS7_ENST00000419127.1_Nonsense_Mutation_p.Q429*			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	555					proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						AAACTGCACTCAAAGTGAGGG	0.507																																					p.Q429X		.											.	TMPRSS7	70	0			c.C1285T						.						76.0	77.0	76.0					3																	111785346		1989	4175	6164	SO:0001587	stop_gained	344805	exon11			TGCACTCAAAGTG	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.1663C>T	3.37:g.111785346C>T	ENSP00000398236:p.Gln555*	98.0	1.0		143.0	19.0	NM_001042575	C9J8P7|E9PAS3|Q17RH4	Nonsense_Mutation	SNP	ENST00000452346.2	37		.	.	.	.	.	.	.	.	.	.	C	37	6.420900	0.97555	.	.	ENSG00000176040	ENST00000452346;ENST00000443106;ENST00000437906;ENST00000419127	.	.	.	5.67	3.84	0.44239	.	0.561698	0.17408	N	0.175272	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	.	4.6871	0.12762	0.1605:0.6125:0.1452:0.0817	.	.	.	.	X	555;543;529;429	.	ENSP00000411645:Q429X	Q	+	1	0	TMPRSS7	113268036	0.002000	0.14202	0.326000	0.25389	0.992000	0.81027	-0.071000	0.11505	0.821000	0.34540	0.655000	0.94253	CAA	.		0.507	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000347592.2	XM_293599	
TRPA1	8989	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	72975749	72975749	+	Missense_Mutation	SNP	G	G	T			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr8:72975749G>T	ENST00000262209.4	-	5	817	c.610C>A	c.(610-612)Caa>Aaa	p.Q204K		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	204					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	AATGCAGCTTGGTGAATAGGG	0.343																																					p.Q204K		.											.	TRPA1	230	0			c.C610A						.						105.0	102.0	103.0					8																	72975749		2203	4300	6503	SO:0001583	missense	8989	exon5			CAGCTTGGTGAAT	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.610C>A	8.37:g.72975749G>T	ENSP00000262209:p.Gln204Lys	58.0	0.0		85.0	7.0	NM_007332	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	G	7.856	0.724951	0.15439	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.64085	-0.08;2.44	5.46	4.54	0.55810	Ankyrin repeat-containing domain (3);	0.520658	0.22669	N	0.057092	T	0.52289	0.1725	L	0.51422	1.61	0.30999	N	0.720539	B	0.27823	0.19	B	0.26202	0.067	T	0.52931	-0.8509	10	0.29301	T	0.29	-5.112	9.3615	0.38199	0.0:0.1688:0.607:0.2243	.	204	O75762	TRPA1_HUMAN	K	56;204	ENSP00000428151:Q56K;ENSP00000262209:Q204K	ENSP00000262209:Q204K	Q	-	1	0	TRPA1	73138303	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.572000	0.45999	2.724000	0.93272	0.650000	0.86243	CAA	.		0.343	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
TSC1	7248	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	135781136	135781136	+	Missense_Mutation	SNP	A	A	G			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr9:135781136A>G	ENST00000298552.3	-	15	2050	c.1829T>C	c.(1828-1830)gTg>gCg	p.V610A	TSC1_ENST00000545250.1_Missense_Mutation_p.V559A|TSC1_ENST00000440111.2_Missense_Mutation_p.V610A	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	610					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		TGGCAATGCCACCTCAAAAAG	0.498			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.V610A		.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	TSC1	1906	1	Unknown(1)	bone(1)	c.T1829C						.						111.0	100.0	104.0					9																	135781136		2203	4300	6503	SO:0001583	missense	7248	exon15	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AATGCCACCTCAA	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.1829T>C	9.37:g.135781136A>G	ENSP00000298552:p.Val610Ala	141.0	0.0		150.0	10.0	NM_000368	B7Z897|Q5VVN5	Missense_Mutation	SNP	ENST00000298552.3	37	CCDS6956.1	.	.	.	.	.	.	.	.	.	.	A	19.61	3.860222	0.71834	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250	D;D;D	0.88046	-2.33;-2.33;-2.33	5.94	5.94	0.96194	.	0.279923	0.39985	N	0.001201	D	0.83663	0.5303	L	0.54323	1.7	0.80722	D	1	B;B	0.33448	0.412;0.412	B;B	0.34038	0.174;0.174	T	0.80498	-0.1356	10	0.11794	T	0.64	-10.9031	15.5809	0.76439	1.0:0.0:0.0:0.0	.	559;610	B7Z897;Q92574	.;TSC1_HUMAN	A	610;610;559	ENSP00000298552:V610A;ENSP00000394524:V610A;ENSP00000444017:V559A	ENSP00000298552:V610A	V	-	2	0	TSC1	134770957	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.584000	0.67490	2.275000	0.75901	0.528000	0.53228	GTG	.		0.498	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
TSSC4	10078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	2424029	2424029	+	Missense_Mutation	SNP	G	G	T			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr11:2424029G>T	ENST00000333256.6	+	3	609	c.166G>T	c.(166-168)Ggg>Tgg	p.G56W	TSSC4_ENST00000380996.5_Intron|TSSC4_ENST00000451491.2_Missense_Mutation_p.G56W|TSSC4_ENST00000380992.1_Intron|AC124057.5_ENST00000433035.1_RNA			Q9Y5U2	TSSC4_HUMAN	tumor suppressing subtransferable candidate 4	56										endometrium(3)|large_intestine(1)|lung(4)	8		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.00145)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGGGCTGCCTGGGGAGGAGGA	0.637																																					p.G56W		.											.	TSSC4	90	0			c.G166T						.						47.0	34.0	39.0					11																	2424029		2190	4286	6476	SO:0001583	missense	10078	exon2			CTGCCTGGGGAGG	AF125568	CCDS7735.1, CCDS73241.1	11p15.5	2008-02-05			ENSG00000184281	ENSG00000184281			12386	protein-coding gene	gene with protein product		603852				10072438	Standard	XM_005252722		Approved		uc001lwl.3	Q9Y5U2	OTTHUMG00000009895	ENST00000333256.6:c.166G>T	11.37:g.2424029G>T	ENSP00000331087:p.Gly56Trp	94.0	0.0		100.0	12.0	NM_005706	C9JS66|Q86VL2|Q9BRS6	Missense_Mutation	SNP	ENST00000333256.6	37	CCDS7735.1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.878104	0.33162	.	.	ENSG00000184281	ENST00000333256;ENST00000437110;ENST00000435795;ENST00000485682;ENST00000496468;ENST00000451491	T;T;T;T;T;T	0.47177	2.43;1.44;0.85;0.85;1.44;2.43	2.78	0.535	0.17133	.	0.907565	0.08908	N	0.876244	T	0.42131	0.1189	L	0.57536	1.79	0.09310	N	0.999997	B	0.23735	0.09	B	0.18263	0.021	T	0.34153	-0.9840	9	.	.	.	-10.3048	10.1334	0.42693	0.0:0.0:0.6491:0.3509	.	56	Q9Y5U2	TSSC4_HUMAN	W	56	ENSP00000331087:G56W;ENSP00000396925:G56W;ENSP00000403475:G56W;ENSP00000431430:G56W;ENSP00000435013:G56W;ENSP00000411224:G56W	.	G	+	1	0	TSSC4	2380605	0.114000	0.22134	0.088000	0.20740	0.559000	0.35586	0.534000	0.23098	0.490000	0.27771	0.462000	0.41574	GGG	.		0.637	TSSC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027369.3	NM_005706	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca|broad.mit.edu;bcgsc.ca	37	2	179614477	179614478	+	Intron	DNP	TA	TA	AC			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T|A	T|A	.	.	.	.	Unknown|.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr2:179614477_179614478TA>AC	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.Y4217V|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATCCTTAATATATAATTGGTGG	0.371																																					p.Y4217F|p.Y4217D		.											.	TTN	636	0			c.A12650T|c.T12649G						.																																			SO:0001627	intron_variant	7273	exon46			TTAATATATAATT|TAATATATAATTG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361_10361delinsAC	2.37:g.179614477_179614478delinsAC		134.0|137.0	0.0|1.0		145.0|143.0	8.0|7.0	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37																																																																																				.		0.371	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
WHAMM	123720	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	83481941	83481941	+	Silent	SNP	T	T	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr15:83481941T>A	ENST00000286760.4	+	2	795	c.696T>A	c.(694-696)gtT>gtA	p.V232V		NM_001080435.1	NP_001073904.1	Q8TF30	WHAMM_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules	232	Mediates association with membranes. {ECO:0000269|PubMed:18614018}.				actin filament organization (GO:0007015)|actin filament reorganization (GO:0090527)|ER to Golgi vesicle-mediated transport (GO:0006888)|focal adhesion assembly (GO:0048041)|lamellipodium assembly (GO:0030032)|membrane tubulation (GO:0097320)|positive regulation of actin nucleation (GO:0051127)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|Golgi membrane (GO:0000139)	Arp2/3 complex binding (GO:0071933)|GTP-Rho binding (GO:0017049)|microtubule binding (GO:0008017)			endometrium(6)|large_intestine(5)|lung(1)|prostate(1)	13						AGGAATTGGTTACCGTGGCAA	0.393																																					p.V232V		.											.	.	.	0			c.T696A						.						113.0	99.0	104.0					15																	83481941		1898	4129	6027	SO:0001819	synonymous_variant	123720	exon2			ATTGGTTACCGTG	AK126887	CCDS45333.1	15q25.2	2009-02-18	2009-02-18	2009-02-18	ENSG00000156232	ENSG00000156232			30493	protein-coding gene	gene with protein product		612393	"""WAS protein homology region 2 domain containing 1"""	WHDC1		11853319, 18226259, 18614018, 18812086	Standard	XM_005272422		Approved	KIAA1971	uc002bje.3	Q8TF30		ENST00000286760.4:c.696T>A	15.37:g.83481941T>A		260.0	0.0		192.0	32.0	NM_001080435	Q8N1J9	Silent	SNP	ENST00000286760.4	37	CCDS45333.1																																																																																			.		0.393	WHAMM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418463.1		
ZC3H12D	340152	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	149771968	149771968	+	Missense_Mutation	SNP	C	C	T			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr6:149771968C>T	ENST00000409806.3	-	6	1753	c.1435G>A	c.(1435-1437)Gcc>Acc	p.A479T	ZC3H12D_ENST00000416573.2_3'UTR|ZC3H12D_ENST00000389942.5_Missense_Mutation_p.A479T|ZC3H12D_ENST00000498662.1_5'Flank			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D	479					negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		CGAGCCCGGGCGCGCGCGTCC	0.721																																					p.A479T		.											.	.	.	0			c.G1435A						.						7.0	13.0	12.0					6																	149771968		681	1580	2261	SO:0001583	missense	340152	exon6			CCCGGGCGCGCGC			6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.1435G>A	6.37:g.149771968C>T	ENSP00000386616:p.Ala479Thr	22.0	0.0		27.0	8.0	NM_207360	A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	Missense_Mutation	SNP	ENST00000409806.3	37		.	.	.	.	.	.	.	.	.	.	C	11.96	1.795999	0.31777	.	.	ENSG00000178199	ENST00000389942;ENST00000409806	T;T	0.34472	1.36;1.36	3.6	-7.2	0.01495	.	1.311170	0.05730	U	0.599408	T	0.03520	0.0101	N	0.03608	-0.345	0.09310	N	0.999998	B	0.06786	0.001	B	0.04013	0.001	T	0.24584	-1.0156	10	0.59425	D	0.04	.	1.3493	0.02169	0.2367:0.2469:0.3373:0.1791	.	479	A2A288	ZC12D_HUMAN	T	479	ENSP00000374592:A479T;ENSP00000386616:A479T	ENSP00000374592:A479T	A	-	1	0	ZC3H12D	149813661	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.073000	0.03430	-2.164000	0.00782	-0.254000	0.11334	GCC	.		0.721	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000286400.2	NM_207360	
ZBTB2	57621	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	151687673	151687673	+	Missense_Mutation	SNP	C	C	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr6:151687673C>A	ENST00000325144.4	-	3	668	c.528G>T	c.(526-528)caG>caT	p.Q176H		NM_020861.1	NP_065912.1	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2	176					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		GCTGGGAGAGCTGTGAGGCCT	0.562																																					p.Q176H		.											.	ZBTB2	91	0			c.G528T						.						83.0	87.0	86.0					6																	151687673		2203	4300	6503	SO:0001583	missense	57621	exon3			GGAGAGCTGTGAG	BC020172	CCDS5231.1	6q25.1	2013-01-09			ENSG00000181472	ENSG00000181472		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20868	protein-coding gene	gene with protein product						10819331	Standard	NM_020861		Approved	KIAA1483, ZNF437, bA351K16.2	uc003qoh.3	Q8N680	OTTHUMG00000015834	ENST00000325144.4:c.528G>T	6.37:g.151687673C>A	ENSP00000323183:p.Gln176His	89.0	0.0		77.0	15.0	NM_020861	A8K7C7|Q5SZ81|Q9P245	Missense_Mutation	SNP	ENST00000325144.4	37	CCDS5231.1	.	.	.	.	.	.	.	.	.	.	C	9.615	1.132176	0.21041	.	.	ENSG00000181472	ENST00000325144	T	0.05258	3.47	5.26	4.19	0.49359	.	0.404785	0.29273	N	0.012630	T	0.02230	0.0069	N	0.24115	0.695	0.42839	D	0.994044	B	0.20164	0.042	B	0.17433	0.018	T	0.35101	-0.9802	10	0.59425	D	0.04	-24.7215	11.2898	0.49244	0.0:0.8423:0.0:0.1577	.	176	Q8N680	ZBTB2_HUMAN	H	176	ENSP00000323183:Q176H	ENSP00000323183:Q176H	Q	-	3	2	ZBTB2	151729366	1.000000	0.71417	0.997000	0.53966	0.883000	0.51084	0.679000	0.25291	2.451000	0.82905	0.561000	0.74099	CAG	.		0.562	ZBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042715.1	NM_020861	
ZNF133	7692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	18296766	18296766	+	Missense_Mutation	SNP	C	C	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr20:18296766C>A	ENST00000316358.4	+	4	1368	c.1271C>A	c.(1270-1272)aCc>aAc	p.T424N	RP4-568F9.3_ENST00000436848.1_RNA|ZNF133_ENST00000535822.1_Missense_Mutation_p.T329N|ZNF133_ENST00000396026.3_Missense_Mutation_p.T427N|ZNF133_ENST00000401790.1_Missense_Mutation_p.T424N|ZNF133_ENST00000462170.1_3'UTR|ZNF133_ENST00000402618.2_Missense_Mutation_p.T361N|ZNF133_ENST00000377671.3_Missense_Mutation_p.T423N|ZNF133_ENST00000538547.1_Missense_Mutation_p.T329N	NM_001282998.1|NM_001282999.1|NM_001283000.1|NM_001283001.1|NM_001283008.1	NP_001269927.1|NP_001269928.1|NP_001269929.1|NP_001269930.1|NP_001269937.1	P52736	ZN133_HUMAN	zinc finger protein 133	424					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26						CAGAATTCAACCCTCATCTCT	0.557																																					p.T423N		.											.	ZNF133	92	0			c.C1268A						.						81.0	85.0	84.0					20																	18296766		2203	4300	6503	SO:0001583	missense	7692	exon4			ATTCAACCCTCAT	AK123005	CCDS13134.1, CCDS63234.1, CCDS63235.1, CCDS74703.1, CCDS74704.1	20p11.23	2013-01-08	2006-06-13		ENSG00000125846	ENSG00000125846		"""Zinc fingers, C2H2-type"", ""-"""	12917	protein-coding gene	gene with protein product		604075	"""zinc finger protein 150 (pHZ-66)"", ""zinc finger protein 133 (clone pHZ-13)"""	ZNF150		7557990, 7649249	Standard	XM_005260819		Approved	pHZ-13, pHZ-66	uc010gcs.3	P52736	OTTHUMG00000031965	ENST00000316358.4:c.1271C>A	20.37:g.18296766C>A	ENSP00000346090:p.Thr424Asn	55.0	0.0		45.0	7.0	NM_001083330	A8K5S4|B4DHU7|B4DIB8|B7ZAS1|F5H289|J3KQ11|J3KQJ0|Q53XU1|Q5JXV8|Q9BUV2|Q9H443	Missense_Mutation	SNP	ENST00000316358.4	37		.	.	.	.	.	.	.	.	.	.	C	1.761	-0.486844	0.04352	.	.	ENSG00000125846	ENST00000377671;ENST00000396026;ENST00000402618;ENST00000401790;ENST00000538547;ENST00000535822;ENST00000316358	T;T;T;T;T;T;T	0.07444	5.44;5.44;3.19;5.44;3.19;3.19;5.44	4.59	4.59	0.56863	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.51477	D	0.000098	T	0.03783	0.0107	N	0.12443	0.215	0.21822	N	0.999527	B;B;B;B	0.27679	0.089;0.185;0.014;0.014	B;B;B;B	0.22880	0.019;0.042;0.013;0.018	T	0.41197	-0.9522	10	0.02654	T	1	-19.7732	10.4126	0.44303	0.1945:0.8055:0.0:0.0	.	361;427;424;423	B4DIB8;B4DHU7;P52736;P52736-2	.;.;ZN133_HUMAN;.	N	423;427;361;424;329;329;424	ENSP00000366899:T423N;ENSP00000400897:T427N;ENSP00000385279:T361N;ENSP00000383945:T424N;ENSP00000442978:T329N;ENSP00000439427:T329N;ENSP00000346090:T424N	ENSP00000346090:T424N	T	+	2	0	ZNF133	18244766	0.000000	0.05858	1.000000	0.80357	0.978000	0.69477	-0.290000	0.08354	2.837000	0.97791	0.655000	0.94253	ACC	.		0.557	ZNF133-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000127616.1	NM_003434	
ZNF311	282890	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	28963560	28963560	+	Silent	SNP	T	T	G			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr6:28963560T>G	ENST00000377179.3	-	7	1731	c.1219A>C	c.(1219-1221)Aga>Cga	p.R407R	ZNF311_ENST00000483450.1_5'UTR	NM_001010877.2	NP_001010877.2	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	407					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(2)	28						GTGTGGATTCTTATGTGTTTG	0.517																																					p.R407R		.											.	ZNF311	22	0			c.A1219C						.						85.0	80.0	82.0					6																	28963560		1510	2709	4219	SO:0001819	synonymous_variant	282890	exon7			GGATTCTTATGTG	AL833166	CCDS34357.1	6p21.33	2013-01-08			ENSG00000197935	ENSG00000197935		"""Zinc fingers, C2H2-type"", ""-"""	13847	protein-coding gene	gene with protein product							Standard	XM_006715067		Approved		uc003nlu.2	Q5JNZ3	OTTHUMG00000031292	ENST00000377179.3:c.1219A>C	6.37:g.28963560T>G		197.0	0.0		286.0	15.0	NM_001010877	A2BFK5|B0S7Y4|Q92971	Silent	SNP	ENST00000377179.3	37	CCDS34357.1																																																																																			.		0.517	ZNF311-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076631.3	XM_212581	
ZNF33A	7581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	38343571	38343571	+	Silent	SNP	T	T	C			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr10:38343571T>C	ENST00000458705.2	+	5	674	c.516T>C	c.(514-516)tgT>tgC	p.C172C	ZNF33A_ENST00000374618.3_Silent_p.C173C|ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000432900.2_Silent_p.C179C|ZNF33A_ENST00000307441.9_Silent_p.C172C			Q06730	ZN33A_HUMAN	zinc finger protein 33A	172					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						TTAATGCCTGTGGGAAATTGT	0.328																																					p.C173C		.											.	ZNF33A	93	0			c.T519C						.						64.0	65.0	65.0					10																	38343571		2203	4299	6502	SO:0001819	synonymous_variant	7581	exon5			TGCCTGTGGGAAA	D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.516T>C	10.37:g.38343571T>C		84.0	0.0		55.0	11.0	NM_006954	A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Silent	SNP	ENST00000458705.2	37	CCDS31182.1																																																																																			.		0.328	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047614.1	NM_006974	
ZNF366	167465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	71756473	71756473	+	Missense_Mutation	SNP	G	G	A			TCGA-KR-A7K8-01A-11D-A33K-10	TCGA-KR-A7K8-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a4fc5ba8-74ba-4047-8857-5d6d6cbc978b	96ab975c-1da6-431f-a23b-cbfeaf1697dc	g.chr5:71756473G>A	ENST00000318442.5	-	2	1341	c.851C>T	c.(850-852)aCg>aTg	p.T284M		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	284					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		CCCGCAGTGCGTGCACGCGTG	0.637																																					p.T284M		.											.	ZNF366	91	0			c.C851T						.						123.0	112.0	116.0					5																	71756473		2203	4300	6503	SO:0001583	missense	167465	exon2			CAGTGCGTGCACG	AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.851C>T	5.37:g.71756473G>A	ENSP00000313158:p.Thr284Met	57.0	0.0		59.0	7.0	NM_152625	Q5HYI9|Q7RTV4	Missense_Mutation	SNP	ENST00000318442.5	37	CCDS4015.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.213632	0.39102	.	.	ENSG00000178175	ENST00000318442	T	0.77358	-1.09	5.79	0.231	0.15377	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.993471	0.08180	N	0.985683	T	0.81079	0.4748	L	0.43923	1.385	0.09310	N	1	D	0.53885	0.963	P	0.54210	0.745	T	0.74115	-0.3769	10	0.66056	D	0.02	-7.745	16.8323	0.85947	0.0:0.4978:0.4146:0.0876	.	284	Q8N895	ZN366_HUMAN	M	284	ENSP00000313158:T284M	ENSP00000313158:T284M	T	-	2	0	ZNF366	71792229	0.000000	0.05858	0.013000	0.15412	0.897000	0.52465	0.606000	0.24194	0.064000	0.16427	0.561000	0.74099	ACG	.		0.637	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218574.3		
