#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCB5	340273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	20685483	20685484	+	Missense_Mutation	DNP	CC	CC	AG	rs2074000	byFrequency	TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr7:20685483_20685484CC>AG	ENST00000404938.2	+	8	1435_1436	c.783_784CC>AG	c.(781-786)gcCCag>gcAGag	p.Q262E	ABCB5_ENST00000406935.1_5'Flank|ABCB5_ENST00000258738.6_5'Flank|ABCB5_ENST00000443026.2_5'Flank	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	262	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)	p.A261A(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						CCTTTAGGGCCCAGGAGAAAGA	0.406																																					p.A261A|p.Q262E		.											.	ABCB5	158	1	Substitution - coding silent(1)	lung(1)	c.C783A|c.C784G						.																																			SO:0001583	missense	340273	exon8			TAGGGCCCAGGAG|AGGGCCCAGGAGA	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	Exception_encountered	7.37:g.20685483_20685484delinsAG	ENSP00000384881:p.Gln262Glu	111.0|112.0	0.0		122.0|124.0	19.0	NM_001163941	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Silent|Missense_Mutation	SNP	ENST00000404938.2	37	CCDS55090.1																																																																																			.|C|0.847;A|0.153		0.406	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	
ABCC9	10060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	21995268	21995268	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr12:21995268T>G	ENST00000261201.4	-	27	3452	c.3453A>C	c.(3451-3453)aaA>aaC	p.K1151N	ABCC9_ENST00000345162.2_Missense_Mutation_p.K1115N|ABCC9_ENST00000261200.4_Missense_Mutation_p.K1151N|RP11-729I10.2_ENST00000539874.1_RNA	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1151	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	CCCGAAAGTATTTCTGGATAA	0.448																																					p.K1151N		.											.	ABCC9	96	0			c.A3453C						.						94.0	86.0	89.0					12																	21995268		2203	4300	6503	SO:0001583	missense	10060	exon27			AAAGTATTTCTGG	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.3453A>C	12.37:g.21995268T>G	ENSP00000261201:p.Lys1151Asn	49.0	0.0		54.0	13.0	NM_005691	O60707	Missense_Mutation	SNP	ENST00000261201.4	37	CCDS8694.1	.	.	.	.	.	.	.	.	.	.	T	18.39	3.614525	0.66672	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62	5.15	3.99	0.46301	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.91432	0.7296	L	0.45228	1.405	0.48341	D	0.999631	D;P	0.59357	0.985;0.955	P;P	0.61477	0.889;0.649	D	0.90389	0.4394	10	0.49607	T	0.09	-21.0374	11.0283	0.47757	0.0:0.0732:0.0:0.9268	.	1151;1151	O60706;O60706-2	ABCC9_HUMAN;.	N	1151;778;1151;1115	ENSP00000261200:K1151N;ENSP00000440521:K778N;ENSP00000261201:K1151N;ENSP00000261202:K1115N	ENSP00000261200:K1151N	K	-	3	2	ABCC9	21886535	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.101000	0.50283	0.968000	0.38212	0.460000	0.39030	AAA	.		0.448	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691	
AOC1	26	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150555959	150555959	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr7:150555959C>T	ENST00000493429.1	+	5	2263	c.1679C>T	c.(1678-1680)tCc>tTc	p.S560F	AOC1_ENST00000467291.1_Missense_Mutation_p.S560F|AOC1_ENST00000416793.2_Missense_Mutation_p.S560F|AOC1_ENST00000480582.1_3'UTR|AOC1_ENST00000360937.4_Missense_Mutation_p.S560F			P19801	AOC1_HUMAN	amine oxidase, copper containing 1	560					amine metabolic process (GO:0009308)|cellular response to azide (GO:0097185)|cellular response to copper ion (GO:0071280)|cellular response to copper ion starvation (GO:0035874)|cellular response to heparin (GO:0071504)|cellular response to histamine (GO:0071420)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|diamine oxidase activity (GO:0052597)|drug binding (GO:0008144)|heparin binding (GO:0008201)|histamine oxidase activity (GO:0052598)|methylputrescine oxidase activity (GO:0052599)|primary amine oxidase activity (GO:0008131)|propane-1,3-diamine oxidase activity (GO:0052600)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|receptor activity (GO:0004872)|sodium channel activity (GO:0005272)|zinc ion binding (GO:0008270)									Amiloride(DB00594)	ACGCAGTACTCCTGGGAGCGC	0.592																																					p.S560F		.											.	ABP1	139	0			c.C1679T						.						29.0	32.0	31.0					7																	150555959		1980	4167	6147	SO:0001583	missense	26	exon3			AGTACTCCTGGGA	AK092514	CCDS43679.1, CCDS64797.1	7q36.1	2013-06-19	2013-06-19	2013-06-19	ENSG00000002726	ENSG00000002726	1.4.3.22		80	protein-coding gene	gene with protein product	"""diamine oxidase"""	104610	"""amiloride binding protein 1 (amine oxidase (copper-containing))"""	ABP1		8182053	Standard	NM_001091		Approved	DAO	uc003wia.2	P19801	OTTHUMG00000158306	ENST00000493429.1:c.1679C>T	7.37:g.150555959C>T	ENSP00000418614:p.Ser560Phe	154.0	0.0		155.0	21.0	NM_001091	C9J690|Q16683|Q16684|Q56II4|Q6GU42	Missense_Mutation	SNP	ENST00000493429.1	37	CCDS43679.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.063367	0.36373	.	.	ENSG00000002726	ENST00000493429;ENST00000467291;ENST00000360937;ENST00000487631;ENST00000416793;ENST00000437714	T;T;T;T	0.03889	3.77;3.77;3.77;3.77	5.57	-7.02	0.01589	Copper amine oxidase, C-terminal (3);	1.413890	0.03680	N	0.245342	T	0.09818	0.0241	M	0.76002	2.32	0.09310	N	1	P;P	0.48694	0.598;0.914	P;P	0.51016	0.547;0.656	T	0.42103	-0.9471	10	0.66056	D	0.02	-33.5783	2.3574	0.04299	0.4927:0.1233:0.0879:0.2961	.	560;560	C9J690;P19801	.;ABP1_HUMAN	F	560;560;560;86;560;436	ENSP00000418614:S560F;ENSP00000418328:S560F;ENSP00000354193:S560F;ENSP00000411613:S560F	ENSP00000354193:S560F	S	+	2	0	ABP1	150186892	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-0.791000	0.04599	-0.983000	0.03511	-0.314000	0.08810	TCC	.		0.592	AOC1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350628.1	NM_001091	
ADAMTS14	140766	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	72520494	72520494	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr10:72520494G>T	ENST00000373207.1	+	22	3557	c.3557G>T	c.(3556-3558)gGg>gTg	p.G1186V	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.G1189V	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	1186	Pro-rich.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						ACCCCCGGGGGGCTGCCTTGG	0.642																																					p.G1189V		.											.	ADAMTS14	232	0			c.G3566T						.						48.0	50.0	50.0					10																	72520494		2203	4300	6503	SO:0001583	missense	140766	exon22			CCGGGGGGCTGCC	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.3557G>T	10.37:g.72520494G>T	ENSP00000362303:p.Gly1186Val	52.0	1.0		47.0	7.0	NM_139155	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.306898	0.23821	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.60171	0.21;0.24	4.46	0.333	0.15943	.	.	.	.	.	T	0.36635	0.0974	N	0.24115	0.695	0.09310	N	1	B;B	0.26935	0.164;0.164	B;B	0.24701	0.055;0.055	T	0.19289	-1.0310	9	0.23302	T	0.38	.	5.5454	0.17061	0.1779:0.3097:0.5124:0.0	.	1186;1189	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	V	1189;1186	ENSP00000362304:G1189V;ENSP00000362303:G1186V	ENSP00000362303:G1186V	G	+	2	0	ADAMTS14	72190500	0.003000	0.15002	0.000000	0.03702	0.063000	0.16089	0.037000	0.13840	-0.026000	0.13895	0.563000	0.77884	GGG	.		0.642	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722	
ADAMTS9	56999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	64633684	64633684	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr3:64633684C>G	ENST00000498707.1	-	11	1984	c.1642G>C	c.(1642-1644)Gga>Cga	p.G548R	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.G520R	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	548	Disintegrin.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TTGTGTACTCCATTGACGTTA	0.498																																					p.G548R		.											.	ADAMTS9	230	0			c.G1642C						.						152.0	136.0	141.0					3																	64633684		2203	4300	6503	SO:0001583	missense	56999	exon11			GTACTCCATTGAC	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.1642G>C	3.37:g.64633684C>G	ENSP00000418735:p.Gly548Arg	22.0	0.0		35.0	7.0	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	C	13.31	2.200402	0.38905	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.61158	0.14;0.13	5.89	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.56659	0.2000	L	0.49571	1.57	0.80722	D	1	B;B;P;B	0.35745	0.136;0.214;0.518;0.276	B;B;B;B	0.38755	0.242;0.159;0.281;0.157	T	0.56751	-0.7927	10	0.41790	T	0.15	.	16.8886	0.86082	0.0:0.8717:0.1283:0.0	.	520;548;548;548	B7ZVX9;Q9P2N4-2;Q9P2N4-1;Q9P2N4	.;.;.;ATS9_HUMAN	R	520;548	ENSP00000295903:G520R;ENSP00000418735:G548R	ENSP00000295903:G520R	G	-	1	0	ADAMTS9	64608724	1.000000	0.71417	0.971000	0.41717	0.327000	0.28475	4.633000	0.61318	1.456000	0.47831	0.585000	0.79938	GGA	.		0.498	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
AGMO	392636	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	15405237	15405237	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr7:15405237delC	ENST00000342526.3	-	12	1334	c.1165delG	c.(1165-1167)gcafs	p.A390fs		NM_001004320.1	NP_001004320.1	Q6ZNB7	ALKMO_HUMAN	alkylglycerol monooxygenase	390					ether lipid metabolic process (GO:0046485)|fatty acid biosynthetic process (GO:0006633)|membrane lipid metabolic process (GO:0006643)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glyceryl-ether monooxygenase activity (GO:0050479)|iron ion binding (GO:0005506)			breast(1)|kidney(1)|large_intestine(6)|liver(1)|lung(30)|prostate(1)|skin(2)	42						ATAATAGCTGCCTTGGGTCTG	0.353																																					p.A389fs		.											.	AGMO	69	0			c.1165delG						.						96.0	87.0	90.0					7																	15405237		2203	4300	6503	SO:0001589	frameshift_variant	392636	exon12			TAGCTGCCTTGGG		CCDS34604.1	7p21.1	2013-03-04	2011-01-31	2011-01-31	ENSG00000187546	ENSG00000187546	1.14.16.5	"""Fatty acid hydroxylase domain containing"""	33784	protein-coding gene	gene with protein product		613738	"""transmembrane protein 195"""	TMEM195		20643956	Standard	NM_001004320		Approved	FLJ16237	uc003stb.1	Q6ZNB7	OTTHUMG00000152387	ENST00000342526.3:c.1165delG	7.37:g.15405237delC	ENSP00000341662:p.Ala390fs	105.0	0.0		104.0	18.0	NM_001004320	A4D114|A6NCH5	Frame_Shift_Del	DEL	ENST00000342526.3	37	CCDS34604.1																																																																																			.		0.353	AGMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326049.2	NM_001004320	
ALB	213	broad.mit.edu;bcgsc.ca	37	4	74283240	74283251	+	Splice_Site	DEL	TTTTTCAGGCTA	TTTTTCAGGCTA	-	rs57705126|rs201944174	byFrequency	TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	TTTTTCAGGCTA	TTTTTCAGGCTA	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr4:74283240_74283251delTTTTTCAGGCTA	ENST00000503124.1	+	9	1046_1050	c.839_843delTTTTTCAGGCTA	c.(838-843)gttttt>g	p.VF280del	ALB_ENST00000415165.2_Splice_Site_p.VF238del|ALB_ENST00000295897.4_Splice_Site_p.VF430del|ALB_ENST00000401494.3_Splice_Site_p.VF315del|ALB_ENST00000509063.1_Splice_Site_p.VF430del|ALB_ENST00000505649.1_Intron			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATGACTTCTTTTTTTCAGGCTATTAGTTCGTT	0.396																																					p.430_431del		.											.	ALB	96	0			c.1290_1293del						.																																			SO:0001630	splice_region_variant	213	exon11			CTTCTTTTTTTCA	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.840-1TTTTTCAGGCTA>-	4.37:g.74283240_74283251delTTTTTCAGGCTA		140.0	0.0		142.0	9.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000503124.1	37																																																																																				.		0.396	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	In_Frame_Del
ALPP	250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	233246210	233246210	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr2:233246210G>A	ENST00000392027.2	+	11	1582	c.1313G>A	c.(1312-1314)aGc>aAc	p.S438N	AC068134.8_ENST00000439072.1_RNA|AC068134.8_ENST00000441266.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	438					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		CAACCAGGGAGCCCCGAGTAT	0.672																																					p.S438N		.											.	ALPP	91	0			c.G1313A						.						24.0	28.0	27.0					2																	233246210		2201	4300	6501	SO:0001583	missense	250	exon11			CAGGGAGCCCCGA	M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.1313G>A	2.37:g.233246210G>A	ENSP00000375881:p.Ser438Asn	195.0	0.0		211.0	41.0	NM_001632	P05188|P06861|Q53S78|Q96DB7	Missense_Mutation	SNP	ENST00000392027.2	37	CCDS2490.1	.	.	.	.	.	.	.	.	.	.	G	8.147	0.786429	0.16189	.	.	ENSG00000163283	ENST00000392027	D	0.95885	-3.84	1.79	-3.57	0.04612	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.716583	0.13422	N	0.389051	D	0.83399	0.5246	N	0.05330	-0.07	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.72633	-0.4234	10	0.31617	T	0.26	.	0.413	0.00444	0.3612:0.1883:0.2653:0.1852	.	438	P05187	PPB1_HUMAN	N	438	ENSP00000375881:S438N	ENSP00000375881:S438N	S	+	2	0	ALPP	232954454	0.000000	0.05858	0.006000	0.13384	0.296000	0.27459	-0.468000	0.06656	-0.960000	0.03613	0.305000	0.20034	AGC	.		0.672	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257032.3	NM_001632	
ANKRD30B	374860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	14763926	14763926	+	Silent	SNP	A	A	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr18:14763926A>C	ENST00000358984.4	+	7	1242	c.1062A>C	c.(1060-1062)gcA>gcC	p.A354A	ANKRD30B_ENST00000447268.2_Silent_p.A354A|ANKRD30B_ENST00000579292.1_Intron	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	354										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						CATGGCCAGCAAAAGAAAGAT	0.378																																					p.A354A		.											.	ANKRD30B	24	0			c.A1062C						.						66.0	58.0	61.0					18																	14763926		692	1591	2283	SO:0001819	synonymous_variant	374860	exon7			GCCAGCAAAAGAA	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1062A>C	18.37:g.14763926A>C		51.0	0.0		57.0	8.0	NM_001145029	B4DGP1|F8WAG3|Q4G175	Silent	SNP	ENST00000358984.4	37	CCDS54182.1																																																																																			.		0.378	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
ANKRD34C	390616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	79585934	79585934	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr15:79585934C>A	ENST00000558647.2	+	1	308	c.308C>A	c.(307-309)tCc>tAc	p.S103Y	ANKRD34C_ENST00000421388.2_Missense_Mutation_p.S103Y			P0C6C1	AN34C_HUMAN	ankyrin repeat domain 34C	103										endometrium(3)|kidney(1)|skin(1)	5						GAAGTGGTCTCCTTATTACTG	0.502																																					p.S103Y		.											.	.	.	0			c.C308A						.						39.0	36.0	37.0					15																	79585934		685	1584	2269	SO:0001583	missense	390616	exon2			TGGTCTCCTTATT		CCDS53965.1	15q25.1	2013-01-10			ENSG00000235711	ENSG00000235711		"""Ankyrin repeat domain containing"""	33888	protein-coding gene	gene with protein product							Standard	NM_001146341		Approved		uc002bet.3	P0C6C1		ENST00000558647.2:c.308C>A	15.37:g.79585934C>A	ENSP00000454921:p.Ser103Tyr	63.0	0.0		60.0	11.0	NM_001146341	H3BNM1	Missense_Mutation	SNP	ENST00000558647.2	37	CCDS53965.1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710833	0.30322	.	.	ENSG00000235711	ENST00000421388	T	0.65549	-0.16	4.38	4.38	0.52667	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.70002	0.3174	L	0.33245	0.995	0.29022	N	0.88622	D	0.71674	0.998	D	0.70487	0.969	T	0.65759	-0.6090	9	0.87932	D	0	.	14.8392	0.70212	0.0:1.0:0.0:0.0	.	103	P0C6C1	AN34C_HUMAN	Y	103	ENSP00000401089:S103Y	ENSP00000401089:S103Y	S	+	2	0	ANKRD34C	77372989	0.980000	0.34600	0.963000	0.40424	0.141000	0.21300	2.926000	0.48892	2.404000	0.81709	0.561000	0.74099	TCC	.		0.502	ANKRD34C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416713.2	NM_001146341	
ANXA7	310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	75147452	75147452	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr10:75147452C>T	ENST00000372921.5	-	7	684	c.628G>A	c.(628-630)Ggc>Agc	p.G210S	ANXA7_ENST00000535178.1_Missense_Mutation_p.G80S|ANXA7_ENST00000492380.1_5'UTR	NM_001156.3	NP_001147.1	P20073	ANXA7_HUMAN	annexin A7	232					autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular calcium ion homeostasis (GO:0006874)|cellular water homeostasis (GO:0009992)|epithelial cell differentiation (GO:0030855)|hemostasis (GO:0007599)|membrane fusion (GO:0061025)|negative regulation of gene expression (GO:0010629)|regulation of cell shape (GO:0008360)|response to calcium ion (GO:0051592)|response to organic cyclic compound (GO:0014070)|response to salt stress (GO:0009651)|social behavior (GO:0035176)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|integrin binding (GO:0005178)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	26	Prostate(51;0.0119)					CATACCTTGCCATAGGAGGTC	0.443																																					p.G232S		.											.	ANXA7	516	0			c.G694A						.						192.0	185.0	187.0					10																	75147452		2203	4300	6503	SO:0001583	missense	310	exon8			CCTTGCCATAGGA	J04543	CCDS7325.1, CCDS7326.1	10q22.2	2005-11-09			ENSG00000138279	ENSG00000138279		"""Annexins"""	545	protein-coding gene	gene with protein product		186360		ANX7		7515686	Standard	NM_001156		Approved		uc001jtz.2	P20073	OTTHUMG00000018463	ENST00000372921.5:c.628G>A	10.37:g.75147452C>T	ENSP00000362012:p.Gly210Ser	103.0	0.0		109.0	19.0	NM_004034	Q5F2H3|Q5T0M6|Q5T0M7	Missense_Mutation	SNP	ENST00000372921.5	37	CCDS7325.1	.	.	.	.	.	.	.	.	.	.	C	33	5.271714	0.95429	.	.	ENSG00000138279	ENST00000372921;ENST00000372919;ENST00000535178	T;T;T	0.04917	3.53;3.53;3.53	5.7	5.7	0.88788	Annexin repeat, conserved site (1);	0.000000	0.64402	D	0.000001	T	0.28699	0.0711	M	0.79926	2.475	0.58432	D	0.999996	D;D;D;D;D	0.89917	0.996;1.0;1.0;0.997;1.0	D;D;D;D;D	0.91635	0.988;0.999;0.994;0.98;0.993	T	0.00688	-1.1609	10	0.72032	D	0.01	.	17.3321	0.87268	0.0:1.0:0.0:0.0	.	210;210;137;210;232	Q53HM8;B2R7L2;B4DWU2;P20073-2;P20073	.;.;.;.;ANXA7_HUMAN	S	210;232;80	ENSP00000362012:G210S;ENSP00000362010:G232S;ENSP00000442864:G80S	ENSP00000362010:G232S	G	-	1	0	ANXA7	74817458	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.022000	0.70839	2.683000	0.91414	0.650000	0.86243	GGC	.		0.443	ANXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048646.2	NM_001156	
APC	324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	112179045	112179045	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr5:112179045A>T	ENST00000457016.1	+	16	8134	c.7754A>T	c.(7753-7755)aAa>aTa	p.K2585I	APC_ENST00000508376.2_Missense_Mutation_p.K2585I|APC_ENST00000257430.4_Missense_Mutation_p.K2585I|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	2585	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GAAAAAGCAAAAAGTGAGGAT	0.358		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.K2585I	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	APC	12026	1	Unknown(1)	skin(1)	c.A7754T						.						68.0	71.0	70.0					5																	112179045		2202	4300	6502	SO:0001583	missense	324	exon17	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	AAGCAAAAAGTGA	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.7754A>T	5.37:g.112179045A>T	ENSP00000413133:p.Lys2585Ile	61.0	0.0		53.0	7.0	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	A	17.17	3.322122	0.60634	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.91237	-2.81;-2.81;-2.81	5.97	5.97	0.96955	.	0.048040	0.85682	D	0.000000	D	0.90553	0.7039	L	0.27053	0.805	0.42088	D	0.991287	D;D	0.71674	0.998;0.998	P;P	0.59288	0.855;0.77	D	0.89941	0.4073	9	.	.	.	-28.1684	16.4473	0.83942	1.0:0.0:0.0:0.0	.	2587;2585	Q4LE70;P25054	.;APC_HUMAN	I	2585	ENSP00000413133:K2585I;ENSP00000257430:K2585I;ENSP00000427089:K2585I	.	K	+	2	0	APC	112206944	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.697000	0.74603	2.281000	0.76405	0.533000	0.62120	AAA	.		0.358	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APP	351	broad.mit.edu;bcgsc.ca	37	21	27372447	27372447	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr21:27372447G>A	ENST00000346798.3	-	7	949	c.916C>T	c.(916-918)Cgc>Tgc	p.R306C	APP_ENST00000357903.3_Missense_Mutation_p.R306C|APP_ENST00000440126.3_Missense_Mutation_p.R301C|APP_ENST00000439274.2_Missense_Mutation_p.R250C|APP_ENST00000348990.5_Intron|APP_ENST00000358918.3_Missense_Mutation_p.R306C|APP_ENST00000448388.2_Intron|APP_ENST00000359726.3_Intron|APP_ENST00000354192.3_Intron	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein	306	BPTI/Kunitz inhibitor. {ECO:0000255|PROSITE-ProRule:PRU00031}.				adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				AAGTACCAGCGGGAGATCATT	0.532																																					p.R306C		.											.	APP	91	0			c.C916T						.						98.0	81.0	87.0					21																	27372447		2203	4300	6503	SO:0001583	missense	351	exon7			ACCAGCGGGAGAT	M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.916C>T	21.37:g.27372447G>A	ENSP00000284981:p.Arg306Cys	84.0	1.0		82.0	17.0	NM_001204302	B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Missense_Mutation	SNP	ENST00000346798.3	37	CCDS13576.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.7|29.7	5.028464|5.028464	0.93518|0.93518	.|.	.|.	ENSG00000142192|ENSG00000142192	ENST00000448850|ENST00000346798;ENST00000357903;ENST00000358918;ENST00000440126;ENST00000439274	.|T;T;T;T;T	.|0.63096	.|-0.02;-0.02;-0.02;-0.02;-0.02	5.08|5.08	5.08|5.08	0.68730|0.68730	.|Proteinase inhibitor I2, Kunitz metazoa (5);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.85566|0.85566	0.5726|0.5726	H|H	0.95187|0.95187	3.635|3.635	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.81914	.|0.991;0.995;0.992;0.991	D|D	0.89821|0.89821	0.3989|0.3989	5|10	.|0.87932	.|D	.|0	-16.9783|-16.9783	18.2555|18.2555	0.90019|0.90019	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|250;301;306;306	.|E9PG40;B4DII8;P05067-8;P05067	.|.;.;.;A4_HUMAN	L|C	227|306;306;306;301;250	.|ENSP00000284981:R306C;ENSP00000350578:R306C;ENSP00000351796:R306C;ENSP00000387483:R301C;ENSP00000398879:R250C	.|ENSP00000284981:R306C	P|R	-|-	2|1	0|0	APP|APP	26294318|26294318	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.263000|9.263000	0.95617|0.95617	2.648000|2.648000	0.89879|0.89879	0.650000|0.650000	0.86243|0.86243	CCG|CGC	.		0.532	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171340.1	NM_000484	
ARHGAP35	2909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	47425519	47425519	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr19:47425519A>T	ENST00000404338.3	+	1	3587	c.3587A>T	c.(3586-3588)cAg>cTg	p.Q1196L		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	1196					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										CAGGCATCCCAGGGTTATAAA	0.547																																					p.Q1196L		.											.	.	.	0			c.A3587T						.						51.0	51.0	51.0					19																	47425519		1974	4173	6147	SO:0001583	missense	2909	exon1			CATCCCAGGGTTA	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.3587A>T	19.37:g.47425519A>T	ENSP00000385720:p.Gln1196Leu	60.0	0.0		41.0	5.0	NM_004491	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	37	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	A	13.16	2.154474	0.38021	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	T	0.07444	3.19	5.6	4.52	0.55395	.	0.000000	0.64402	D	0.000002	T	0.06234	0.0161	N	0.22421	0.69	0.48830	D	0.999711	B	0.02656	0.0	B	0.04013	0.001	T	0.35151	-0.9800	10	0.27082	T	0.32	-30.6714	11.4825	0.50333	0.8498:0.1502:0.0:0.0	.	1196	Q9NRY4-2	.	L	1196	ENSP00000385720:Q1196L	ENSP00000324820:Q1196L	Q	+	2	0	ARHGAP35	52117359	0.951000	0.32395	1.000000	0.80357	0.987000	0.75469	1.958000	0.40402	2.136000	0.66102	0.533000	0.62120	CAG	.		0.547	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491	
ATG5	9474	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	106634468	106634468	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr6:106634468T>G	ENST00000369076.3	-	8	1098	c.775A>C	c.(775-777)Agc>Cgc	p.S259R	ATG5_ENST00000475645.1_5'UTR|ATG5_ENST00000343245.3_Missense_Mutation_p.S259R|ATG5_ENST00000369070.1_Missense_Mutation_p.S181R|ATG5_ENST00000360666.4_3'UTR	NM_004849.2	NP_004840.1	Q9H1Y0	ATG5_HUMAN	autophagy related 5	259					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|blood vessel remodeling (GO:0001974)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of type I interferon production (GO:0032480)|negative stranded viral RNA replication (GO:0039689)|otolith development (GO:0048840)|post-translational protein modification (GO:0043687)|regulation of cilium assembly (GO:1902017)|regulation of cytokine secretion involved in immune response (GO:0002739)|response to drug (GO:0042493)|response to fungus (GO:0009620)|vasodilation (GO:0042311)|ventricular cardiac muscle cell development (GO:0055015)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|membrane (GO:0016020)|pre-autophagosomal structure membrane (GO:0034045)				endometrium(1)|large_intestine(5)|lung(1)|prostate(1)	8	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		TCCGGGTAGCTCAGATGTTCA	0.383																																					p.S259R		.											.	ATG5	153	0			c.A775C						.						140.0	136.0	138.0					6																	106634468		2203	4300	6503	SO:0001583	missense	9474	exon8			GGTAGCTCAGATG	Y11588	CCDS5055.1, CCDS69159.1, CCDS75498.1	6q21	2014-02-12	2012-06-06	2005-09-11	ENSG00000057663	ENSG00000057663			589	protein-coding gene	gene with protein product		604261	"""APG5 (autophagy 5, S. cerevisiae)-like"", ""APG5 autophagy 5-like (S. cerevisiae)"", ""ATG5 autophagy related 5 homolog (S. cerevisiae)"""	APG5L		9563500, 11349150, 15778222	Standard	NM_001286111		Approved	ASP, APG5, hAPG5	uc003prf.3	Q9H1Y0	OTTHUMG00000016193	ENST00000369076.3:c.775A>C	6.37:g.106634468T>G	ENSP00000358072:p.Ser259Arg	44.0	0.0		40.0	12.0	NM_004849	O60875|Q5JVR2|Q68DI4|Q9H2B8|Q9HCZ7	Missense_Mutation	SNP	ENST00000369076.3	37	CCDS5055.1	.	.	.	.	.	.	.	.	.	.	T	19.92	3.916565	0.73098	.	.	ENSG00000057663	ENST00000369076;ENST00000343245;ENST00000369070	.	.	.	5.87	5.87	0.94306	.	0.086849	0.85682	D	0.000000	T	0.81805	0.4900	M	0.91459	3.21	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	T	0.82440	-0.0456	9	0.29301	T	0.29	-4.0816	16.2806	0.82678	0.0:0.0:0.0:1.0	.	181;259	Q9H1Y0-2;Q9H1Y0	.;ATG5_HUMAN	R	259;259;181	.	ENSP00000343313:S259R	S	-	1	0	ATG5	106741161	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.391000	0.79828	2.248000	0.74166	0.533000	0.62120	AGC	.		0.383	ATG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043476.1	NM_004849	
ATG5	9474	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	106634473	106634473	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr6:106634473T>C	ENST00000369076.3	-	8	1093	c.770A>G	c.(769-771)cAt>cGt	p.H257R	ATG5_ENST00000475645.1_5'UTR|ATG5_ENST00000343245.3_Missense_Mutation_p.H257R|ATG5_ENST00000369070.1_Missense_Mutation_p.H179R|ATG5_ENST00000360666.4_3'UTR	NM_004849.2	NP_004840.1	Q9H1Y0	ATG5_HUMAN	autophagy related 5	257					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|blood vessel remodeling (GO:0001974)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of type I interferon production (GO:0032480)|negative stranded viral RNA replication (GO:0039689)|otolith development (GO:0048840)|post-translational protein modification (GO:0043687)|regulation of cilium assembly (GO:1902017)|regulation of cytokine secretion involved in immune response (GO:0002739)|response to drug (GO:0042493)|response to fungus (GO:0009620)|vasodilation (GO:0042311)|ventricular cardiac muscle cell development (GO:0055015)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|membrane (GO:0016020)|pre-autophagosomal structure membrane (GO:0034045)				endometrium(1)|large_intestine(5)|lung(1)|prostate(1)	8	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		GTAGCTCAGATGTTCACTCAG	0.398																																					p.H257R		.											.	ATG5	153	0			c.A770G						.						143.0	137.0	139.0					6																	106634473		2203	4300	6503	SO:0001583	missense	9474	exon8			CTCAGATGTTCAC	Y11588	CCDS5055.1, CCDS69159.1, CCDS75498.1	6q21	2014-02-12	2012-06-06	2005-09-11	ENSG00000057663	ENSG00000057663			589	protein-coding gene	gene with protein product		604261	"""APG5 (autophagy 5, S. cerevisiae)-like"", ""APG5 autophagy 5-like (S. cerevisiae)"", ""ATG5 autophagy related 5 homolog (S. cerevisiae)"""	APG5L		9563500, 11349150, 15778222	Standard	NM_001286111		Approved	ASP, APG5, hAPG5	uc003prf.3	Q9H1Y0	OTTHUMG00000016193	ENST00000369076.3:c.770A>G	6.37:g.106634473T>C	ENSP00000358072:p.His257Arg	44.0	0.0		40.0	12.0	NM_004849	O60875|Q5JVR2|Q68DI4|Q9H2B8|Q9HCZ7	Missense_Mutation	SNP	ENST00000369076.3	37	CCDS5055.1	.	.	.	.	.	.	.	.	.	.	T	18.63	3.664959	0.67700	.	.	ENSG00000057663	ENST00000369076;ENST00000343245;ENST00000369070	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.81607	0.4858	M	0.89904	3.07	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.79108	0.991;0.992	T	0.82902	-0.0227	9	0.37606	T	0.19	-8.934	16.2806	0.82678	0.0:0.0:0.0:1.0	.	179;257	Q9H1Y0-2;Q9H1Y0	.;ATG5_HUMAN	R	257;257;179	.	ENSP00000343313:H257R	H	-	2	0	ATG5	106741166	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.391000	0.79828	2.248000	0.74166	0.533000	0.62120	CAT	.		0.398	ATG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043476.1	NM_004849	
ATP6V1F	9296	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	128505594	128505594	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr7:128505594A>T	ENST00000249289.4	+	2	401	c.322A>T	c.(322-324)Agg>Tgg	p.R108W	RP11-309L24.2_ENST00000469965.1_RNA|RP11-309L24.4_ENST00000461420.1_lincRNA|ATP6V1F_ENST00000492758.1_Missense_Mutation_p.R136W	NM_004231.3	NP_004222.2	Q16864	VATF_HUMAN	ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F	108					ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase activity, uncoupled (GO:0042624)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			lung(1)|ovary(1)|prostate(1)	3						CATCCTGCGCAGGGCCAGGGG	0.652																																					p.R136W		.											.	ATP6V1F	91	0			c.A406T						.						38.0	40.0	39.0					7																	128505594		2203	4300	6503	SO:0001583	missense	9296	exon3			CTGCGCAGGGCCA	D49400	CCDS5807.1, CCDS56511.1	7q32.1	2010-04-21	2002-08-29		ENSG00000128524	ENSG00000128524	3.6.3.14	"""ATPases / V-type"""	16832	protein-coding gene	gene with protein product		607160				8581736, 8621738	Standard	NM_004231		Approved	ATP6S14, VATF, Vma7	uc022all.1	Q16864	OTTHUMG00000158365	ENST00000249289.4:c.322A>T	7.37:g.128505594A>T	ENSP00000249289:p.Arg108Trp	55.0	0.0		66.0	9.0	NM_001198909	C9J2K4|Q6IBA8	Missense_Mutation	SNP	ENST00000249289.4	37	CCDS5807.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.009244	0.75046	.	.	ENSG00000128524	ENST00000249289;ENST00000492758	T;T	0.60299	0.25;0.2	5.02	2.68	0.31781	.	0.000000	0.85682	D	0.000000	T	0.81399	0.4814	H	0.96460	3.825	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.84788	0.0777	10	0.87932	D	0	-21.2484	11.162	0.48520	0.5948:0.4052:0.0:0.0	.	108	Q16864	VATF_HUMAN	W	108;136	ENSP00000249289:R108W;ENSP00000417378:R136W	ENSP00000249289:R108W	R	+	1	2	ATP6V1F	128292830	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	1.167000	0.31847	0.739000	0.32628	0.482000	0.46254	AGG	.		0.652	ATP6V1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350800.1	NM_004231	
BMPR2	659	hgsc.bcm.edu;broad.mit.edu	37	2	203417602	203417602	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr2:203417602A>G	ENST00000374580.4	+	11	2116	c.1577A>G	c.(1576-1578)cAg>cGg	p.Q526R	BMPR2_ENST00000374574.2_Missense_Mutation_p.Q526R	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	526					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						ACTGCTATGCAGAATGAACGG	0.403																																					p.Q526R		.											.	BMPR2	1003	0			c.A1577G						.						100.0	91.0	94.0					2																	203417602		2203	4300	6503	SO:0001583	missense	659	exon11			CTATGCAGAATGA	Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.1577A>G	2.37:g.203417602A>G	ENSP00000363708:p.Gln526Arg	47.0	0.0		59.0	4.0	NM_001204	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Missense_Mutation	SNP	ENST00000374580.4	37	CCDS33361.1	.	.	.	.	.	.	.	.	.	.	A	19.44	3.828817	0.71258	.	.	ENSG00000204217	ENST00000374580;ENST00000374574	D;D	0.89050	-2.46;-2.38	5.48	5.48	0.80851	.	0.052782	0.85682	D	0.000000	T	0.81814	0.4902	N	0.24115	0.695	0.80722	D	1	B;P	0.41475	0.421;0.751	B;B	0.36335	0.118;0.222	D	0.83948	0.0315	10	0.52906	T	0.07	.	15.5618	0.76256	1.0:0.0:0.0:0.0	.	526;526	Q13161;Q13873	.;BMPR2_HUMAN	R	526	ENSP00000363708:Q526R;ENSP00000363702:Q526R	ENSP00000363702:Q526R	Q	+	2	0	BMPR2	203125847	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.108000	0.94275	2.077000	0.62373	0.402000	0.26972	CAG	.		0.403	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257743.1	NM_001204	
BMPR2	659	broad.mit.edu;ucsc.edu	37	2	203421181	203421181	+	Silent	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr2:203421181G>A	ENST00000374580.4	+	12	3332	c.2793G>A	c.(2791-2793)aaG>aaA	p.K931K	BMPR2_ENST00000374574.2_Intron	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	931					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						GGCCATCAAAGCCCAGAAGAG	0.468																																					p.K931K		.											.	BMPR2	1003	0			c.G2793A						.						94.0	100.0	98.0					2																	203421181		2203	4300	6503	SO:0001819	synonymous_variant	659	exon12			ATCAAAGCCCAGA	Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.2793G>A	2.37:g.203421181G>A		41.0	0.0		39.0	4.0	NM_001204	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Silent	SNP	ENST00000374580.4	37	CCDS33361.1																																																																																			.		0.468	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257743.1	NM_001204	
CACNA1C	775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	2794935	2794935	+	Silent	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr12:2794935G>A	ENST00000347598.4	+	46	5751	c.5751G>A	c.(5749-5751)ctG>ctA	p.L1917L	CACNA1C_ENST00000399638.1_Silent_p.L1897L|CACNA1C_ENST00000399655.1_Silent_p.L1869L|CACNA1C_ENST00000327702.7_Silent_p.L1904L|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399621.1_Silent_p.L1888L|CACNA1C_ENST00000399617.1_Silent_p.L1904L|CACNA1C_ENST00000399644.1_Silent_p.L1869L|CACNA1C_ENST00000399591.1_Silent_p.L1877L|CACNA1C_ENST00000406454.3_Silent_p.L1940L|CACNA1C_ENST00000399629.1_Silent_p.L1886L|CACNA1C_ENST00000399634.1_Silent_p.L1940L|CACNA1C_ENST00000399601.1_Silent_p.L1869L|CACNA1C_ENST00000399641.1_Silent_p.L1869L|CACNA1C_ENST00000344100.3_Silent_p.L1910L|CACNA1C_ENST00000399597.1_Silent_p.L1869L|CACNA1C_ENST00000399637.1_Silent_p.L1888L|CACNA1C_ENST00000399606.1_Silent_p.L1889L|CACNA1C_ENST00000399595.1_Silent_p.L1877L|CACNA1C_ENST00000399603.1_Silent_p.L1869L|CACNA1C_ENST00000399649.1_Silent_p.L1875L|CACNA1C_ENST00000335762.5_Silent_p.L1894L|CACNA1C_ENST00000402845.3_Silent_p.L1888L	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1952					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ATCGGCAACTGACGCTCCCAG	0.587																																					p.L1952L		.											.	CACNA1C	34	0			c.G5856A						.						49.0	50.0	49.0					12																	2794935		2012	4159	6171	SO:0001819	synonymous_variant	775	exon47			GCAACTGACGCTC	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5751G>A	12.37:g.2794935G>A		129.0	0.0		125.0	22.0	NM_199460	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	ENST00000347598.4	37	CCDS44788.1																																																																																			.		0.587	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
CACNA1E	777	broad.mit.edu;ucsc.edu	37	1	181741311	181741311	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr1:181741311G>A	ENST00000367573.2	+	37	5083	c.5083G>A	c.(5083-5085)Ggc>Agc	p.G1695S	CACNA1E_ENST00000367567.4_Missense_Mutation_p.G1302S|CACNA1E_ENST00000367570.1_Missense_Mutation_p.G1695S|RNA5SP70_ENST00000517168.1_RNA|CACNA1E_ENST00000526775.1_Missense_Mutation_p.G1676S|CACNA1E_ENST00000357570.5_Missense_Mutation_p.G1646S|CACNA1E_ENST00000358338.5_Missense_Mutation_p.G1627S|CACNA1E_ENST00000360108.3_Missense_Mutation_p.G1676S	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1695					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.G1695S(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CGAACGCTGCGGCACCGATCT	0.552																																					p.G1695S		.											.	CACNA1E	95	2	Substitution - Missense(2)	cervix(2)	c.G5083A						.						203.0	204.0	204.0					1																	181741311		2187	4276	6463	SO:0001583	missense	777	exon37			CGCTGCGGCACCG	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.5083G>A	1.37:g.181741311G>A	ENSP00000356545:p.Gly1695Ser	81.0	1.0		111.0	17.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	37	6.146306	0.97324	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98512	-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97	5.77	5.77	0.91146	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99187	0.9718	M	0.89840	3.065	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.989;1.0;0.999	D	0.99474	1.0946	10	0.87932	D	0	.	19.5857	0.95489	0.0:0.0:1.0:0.0	.	1676;1695;1695	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	S	1695;1676;1646;1627;1302;1676;1695	ENSP00000356542:G1695S;ENSP00000434814:G1676S;ENSP00000350183:G1646S;ENSP00000351101:G1627S;ENSP00000356539:G1302S;ENSP00000353222:G1676S;ENSP00000356545:G1695S	ENSP00000350183:G1646S	G	+	1	0	CACNA1E	180007934	1.000000	0.71417	0.985000	0.45067	0.994000	0.84299	9.721000	0.98766	2.737000	0.93849	0.643000	0.83706	GGC	.		0.552	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
CCDC122	160857	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	44433943	44433943	+	Silent	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr13:44433943C>T	ENST00000444614.3	-	5	678	c.420G>A	c.(418-420)ggG>ggA	p.G140G	CCDC122_ENST00000476570.2_5'UTR|CCDC122_ENST00000281508.3_Silent_p.G140G	NM_144974.3	NP_659411.2	Q5T0U0	CC122_HUMAN	coiled-coil domain containing 122	140										endometrium(1)|large_intestine(2)|lung(5)|stomach(1)	9		Lung NSC(96;7.5e-06)|Breast(139;0.00765)|Hepatocellular(98;0.00826)|Prostate(109;0.0143)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000767)|BRCA - Breast invasive adenocarcinoma(63;0.128)		TCTCTACTTCCCCCAAACTAT	0.299																																					p.G140G		.											.	CCDC122	90	0			c.G420A						.						134.0	128.0	130.0					13																	44433943		2203	4300	6503	SO:0001819	synonymous_variant	160857	exon5			TACTTCCCCCAAA	AK056408	CCDS9390.2	13q14.11	2008-10-30			ENSG00000151773	ENSG00000151773			26478	protein-coding gene	gene with protein product		613408					Standard	NM_144974		Approved	FLJ31846	uc010acf.3	Q5T0U0	OTTHUMG00000017413	ENST00000444614.3:c.420G>A	13.37:g.44433943C>T		146.0	1.0		165.0	22.0	NM_144974	B2RP70|B7ZMI9|Q96MV0	Silent	SNP	ENST00000444614.3	37	CCDS9390.2																																																																																			.		0.299	CCDC122-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276172.4	NM_144974	
CCT3	7203	broad.mit.edu;ucsc.edu;mdanderson.org	37	1	156287239	156287239	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr1:156287239G>A	ENST00000295688.3	-	9	1139	c.859C>T	c.(859-861)Ccc>Tcc	p.P287S	CCT3_ENST00000368261.3_Missense_Mutation_p.P242S|CCT3_ENST00000368259.2_Missense_Mutation_p.P249S|CCT3_ENST00000472765.2_Missense_Mutation_p.P242S	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	287					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					ACCACATCGGGCTTCAGTTGG	0.488																																					p.P287S		.											.	CCT3	92	0			c.C859T						.						202.0	186.0	191.0					1																	156287239		2203	4300	6503	SO:0001583	missense	7203	exon9			CATCGGGCTTCAG	BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.859C>T	1.37:g.156287239G>A	ENSP00000295688:p.Pro287Ser	76.0	1.0		108.0	10.0	NM_005998	A6NE14|Q5SZY1|Q9BR64	Missense_Mutation	SNP	ENST00000295688.3	37	CCDS1140.2	.	.	.	.	.	.	.	.	.	.	G	21.5	4.160164	0.78226	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765	T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12	6.15	6.15	0.99193	.	0.104621	0.64402	D	0.000003	D	0.90400	0.6995	M	0.93241	3.395	0.80722	D	1	D;D;D	0.69078	0.978;0.997;0.996	P;D;D	0.70935	0.477;0.971;0.971	D	0.91568	0.5269	10	0.72032	D	0.01	-4.8036	18.3325	0.90274	0.0:0.0:1.0:0.0	.	249;286;287	P49368-2;E9PAQ6;P49368	.;.;TCPG_HUMAN	S	287;249;242;242	ENSP00000295688:P287S;ENSP00000357242:P249S;ENSP00000357244:P242S;ENSP00000431543:P242S	ENSP00000295688:P287S	P	-	1	0	CCT3	154553863	1.000000	0.71417	0.984000	0.44739	0.123000	0.20343	9.823000	0.99369	2.932000	0.99384	0.643000	0.83706	CCC	.		0.488	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060602.3	NM_005998	
CDH23	64072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	73562794	73562794	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr10:73562794A>G	ENST00000224721.6	+	53	7642	c.7637A>G	c.(7636-7638)aAt>aGt	p.N2546S	CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000398788.3_Missense_Mutation_p.N301S	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2541	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GAAGGTCCCAATGGAGAGTTG	0.602																																					p.N2541S		.											.	CDH23	563	0			c.A7622G						.						81.0	86.0	84.0					10																	73562794		1995	4165	6160	SO:0001583	missense	64072	exon52			GTCCCAATGGAGA	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.7637A>G	10.37:g.73562794A>G	ENSP00000224721:p.Asn2546Ser	53.0	0.0		68.0	11.0	NM_022124	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37		.	.	.	.	.	.	.	.	.	.	A	22.6	4.306651	0.81247	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	T	0.60040	0.22	5.02	5.02	0.67125	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.78929	0.4361	M	0.86651	2.83	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.981	T	0.83239	-0.0059	10	0.72032	D	0.01	.	15.0383	0.71767	1.0:0.0:0.0:0.0	.	2541;2541	E9PEX1;Q9H251	.;CAD23_HUMAN	S	2546;2541;2544;301	ENSP00000381768:N301S	ENSP00000224721:N2546S	N	+	2	0	CDH23	73232800	1.000000	0.71417	0.924000	0.36721	0.732000	0.41865	8.800000	0.91900	2.016000	0.59253	0.450000	0.29827	AAT	.		0.602	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
CELSR3	1951	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	48696462	48696462	+	Silent	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr3:48696462G>A	ENST00000164024.4	-	1	3886	c.3606C>T	c.(3604-3606)gtC>gtT	p.V1202V	CELSR3_ENST00000544264.1_Silent_p.V1202V	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1202	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGTGGTCGGAGACATCGGGGT	0.537																																					p.V1202V		.											.	CELSR3	523	0			c.C3606T						.						95.0	88.0	90.0					3																	48696462		2203	4300	6503	SO:0001819	synonymous_variant	1951	exon1			GTCGGAGACATCG	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.3606C>T	3.37:g.48696462G>A		71.0	0.0		69.0	12.0	NM_001407	O75092	Silent	SNP	ENST00000164024.4	37	CCDS2775.1																																																																																			.		0.537	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
CEP120	153241	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	122725745	122725748	+	Frame_Shift_Del	DEL	AGTA	AGTA	-	rs376284108		TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	AGTA	AGTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr5:122725745_122725748delAGTA	ENST00000306467.5	-	8	1429_1432	c.1125_1128delTACT	c.(1123-1128)cttactfs	p.LT375fs	CEP120_ENST00000306481.6_Frame_Shift_Del_p.LT349fs|CEP120_ENST00000328236.5_Frame_Shift_Del_p.LT375fs			Q8N960	CE120_HUMAN	centrosomal protein 120kDa	375					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)|regulation of protein localization (GO:0032880)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	29						ATTTTGGCCCAGTAAGTGTCTTCT	0.387																																					p.375_376del		.											.	CEP120	91	0			c.1125_1128del						.																																			SO:0001589	frameshift_variant	153241	exon9			TGGCCCAGTAAGT	AK095646	CCDS4134.2, CCDS54890.1	5q23.2	2014-02-20	2008-08-14	2008-08-14	ENSG00000168944	ENSG00000168944			26690	protein-coding gene	gene with protein product		613446	"""coiled-coil domain containing 100"""	CCDC100		17920017	Standard	NM_153223		Approved	FLJ36090	uc003ktk.3	Q8N960	OTTHUMG00000128922	ENST00000306467.5:c.1125_1128delTACT	5.37:g.122725745_122725748delAGTA	ENSP00000303058:p.Leu375fs	142.0	0.0		155.0	26.0	NM_153223	Q6AI52|Q6AW89|Q8IWB5|Q8N9Y0|Q8NDE8	Frame_Shift_Del	DEL	ENST00000306467.5	37	CCDS4134.2																																																																																			.		0.387	CEP120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250899.2	NM_153223	
CEP57	9702	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	95546100	95546100	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr11:95546100A>G	ENST00000325542.5	+	3	445	c.207A>G	c.(205-207)atA>atG	p.I69M	CEP57_ENST00000538658.1_Missense_Mutation_p.I69M|CEP57_ENST00000537677.1_Missense_Mutation_p.I42M|CEP57_ENST00000541150.1_Missense_Mutation_p.I60M|CEP57_ENST00000325486.5_Missense_Mutation_p.I69M|CEP57_ENST00000536587.1_3'UTR	NM_001243776.1|NM_014679.4	NP_001230705.1|NP_055494.2	Q86XR8	CEP57_HUMAN	centrosomal protein 57kDa	69	centrosome localization domain (CLD). {ECO:0000250}.				fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|protein homooligomerization (GO:0051260)|protein import into nucleus, translocation (GO:0000060)|spermatid development (GO:0007286)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	13		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TGGCAGCCATATTTTCTGCTC	0.343									Mosaic Variegated Aneuploidy Syndrome																												p.I69M		.											.	CEP57	91	0			c.A207G						.						89.0	92.0	91.0					11																	95546100		2201	4298	6499	SO:0001583	missense	9702	exon3	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	AGCCATATTTTCT	D42054	CCDS8304.1, CCDS58166.1, CCDS58167.1	11q21	2014-09-17			ENSG00000166037	ENSG00000166037			30794	protein-coding gene	gene with protein product		607951				7788527	Standard	NM_014679		Approved	Translokin, TSP57, KIAA0092	uc001pfp.2	Q86XR8	OTTHUMG00000167740	ENST00000325542.5:c.207A>G	11.37:g.95546100A>G	ENSP00000317902:p.Ile69Met	111.0	0.0		124.0	17.0	NM_001243777	A0PJH1|A8K5D0|B4DDP5|F5H5F7|Q14704|Q5JB46|Q8IXP0|Q9BVF9	Missense_Mutation	SNP	ENST00000325542.5	37	CCDS8304.1	.	.	.	.	.	.	.	.	.	.	A	17.64	3.440347	0.63067	.	.	ENSG00000166037	ENST00000537677;ENST00000325542;ENST00000325486;ENST00000544522;ENST00000541365;ENST00000538658;ENST00000541150	T;T;T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71;0.71;0.71	5.98	0.698	0.18087	.	0.000000	0.85682	D	0.000000	T	0.58609	0.2134	L	0.56769	1.78	0.38707	D	0.953111	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.997;0.982;0.999;0.997	T	0.58375	-0.7647	10	0.87932	D	0	-11.7024	7.8807	0.29621	0.4217:0.1194:0.0:0.459	.	60;69;69;69	F5H5F7;Q86XR8-2;Q86XR8;Q86XR8-3	.;.;CEP57_HUMAN;.	M	42;69;69;60;42;69;60	ENSP00000441392:I42M;ENSP00000317902:I69M;ENSP00000317487:I69M;ENSP00000438065:I60M;ENSP00000445821:I42M;ENSP00000445706:I69M;ENSP00000443436:I60M	ENSP00000317487:I69M	I	+	3	3	CEP57	95185748	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	0.942000	0.29017	-0.129000	0.11620	-0.468000	0.05107	ATA	.		0.343	CEP57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395983.1	NM_014679	
CERKL	375298	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	182412568	182412568	+	Silent	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr2:182412568T>C	ENST00000339098.5	-	10	1217	c.1218A>G	c.(1216-1218)gcA>gcG	p.A406A	CERKL_ENST00000409440.3_Silent_p.A362A|CERKL_ENST00000479558.1_5'UTR|CERKL_ENST00000410087.3_Silent_p.A380A|CERKL_ENST00000374970.2_Silent_p.A311A|CERKL_ENST00000374969.2_Silent_p.A267A			Q49MI3	CERKL_HUMAN	ceramide kinase-like	406					negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			GAGATCCCTGTGCCCTCCTAA	0.393																																					p.A406A		.											.	CERKL	228	0			c.A1218G						.						121.0	130.0	127.0					2																	182412568		2203	4300	6503	SO:0001819	synonymous_variant	375298	exon10			TCCCTGTGCCCTC	BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.1218A>G	2.37:g.182412568T>C		106.0	0.0		116.0	12.0	NM_001030311	B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Silent	SNP	ENST00000339098.5	37	CCDS42789.1																																																																																			.		0.393	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334811.1		
CHRNA2	1135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	27321444	27321444	+	Silent	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr8:27321444G>A	ENST00000520933.2	-	5	669	c.516C>T	c.(514-516)caC>caT	p.H172H	CHRNA2_ENST00000240132.2_Silent_p.H157H|CHRNA2_ENST00000407991.1_Silent_p.H172H			Q15822	ACHA2_HUMAN	cholinergic receptor, nicotinic, alpha 2 (neuronal)	172					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transport (GO:0006811)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0208)|Epithelial(17;2.77e-10)|Colorectal(74;0.136)	Atracurium(DB00732)|Biperiden(DB00810)|Carbachol(DB00411)|Cisatracurium Besylate(DB00565)|Decamethonium(DB01245)|Dextromethorphan(DB00514)|Doxacurium chloride(DB01135)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Mecamylamine(DB00657)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicotine(DB00184)|Pancuronium(DB01337)|Pipecuronium(DB01338)|Procaine(DB00721)|Rocuronium(DB00728)|Tubocurarine(DB01199)|Vecuronium(DB01339)	GGGGCACCCAGTGCACAGTGC	0.592																																					p.H172H		.											.	CHRNA2	91	0			c.C516T						.						95.0	88.0	90.0					8																	27321444		2203	4300	6503	SO:0001819	synonymous_variant	1135	exon6			CACCCAGTGCACA	U62431	CCDS6059.1, CCDS64856.1	8p21	2012-02-11	2006-02-01		ENSG00000120903	ENSG00000120903		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1956	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 2 (neuronal)"""	118502	"""cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)"""			1505988	Standard	NM_000742		Approved		uc010lur.3	Q15822	OTTHUMG00000102083	ENST00000520933.2:c.516C>T	8.37:g.27321444G>A		75.0	0.0		73.0	10.0	NM_000742	A8KAX3|B4DK19|J3KMY9|Q9HAQ3	Silent	SNP	ENST00000520933.2	37	CCDS6059.1																																																																																			.		0.592	CHRNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376125.4		
CKMT1B	1159	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	43888719	43888719	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr15:43888719G>A	ENST00000441322.1	+	6	1226	c.866G>A	c.(865-867)gGc>gAc	p.G289D	CKMT1B_ENST00000300283.6_Missense_Mutation_p.G289D|CKMT1B_ENST00000450086.2_Missense_Mutation_p.G248D|CKMT1B_ENST00000413657.2_Missense_Mutation_p.G152D			P12532	KCRU_HUMAN	creatine kinase, mitochondrial 1B	289	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			large_intestine(1)|lung(3)|skin(1)	5		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)	Creatine(DB00148)	TTCTGCCGAGGCCTCAAAGAG	0.443																																					p.G289D		.											.	CKMT1B	90	0			c.G866A						.						93.0	105.0	101.0					15																	43888719		2148	4298	6446	SO:0001583	missense	1159	exon7			GCCGAGGCCTCAA	AK094322, J04469	CCDS10097.1	15q15	2005-04-15		2005-04-15	ENSG00000237289	ENSG00000237289	2.7.3.2		1995	protein-coding gene	gene with protein product		123290	"""creatine kinase, mitochondrial 1 (ubiquitous)"""	CKMT, CKMT1			Standard	XM_005254150		Approved	UMTCK	uc001zsc.3	P12532	OTTHUMG00000059900	ENST00000441322.1:c.866G>A	15.37:g.43888719G>A	ENSP00000413255:p.Gly289Asp	167.0	0.0		156.0	24.0	NM_020990	B4DIT8|B7ZA09|Q0VAM3|Q32NF6|Q53FC4	Missense_Mutation	SNP	ENST00000441322.1	37	CCDS10097.1	.	.	.	.	.	.	.	.	.	.	G	17.99	3.523754	0.64747	.	.	ENSG00000237289	ENST00000300283;ENST00000450086;ENST00000441322;ENST00000413657;ENST00000438947	T;T;T;T	0.12879	2.64;2.64;2.64;2.64	4.49	3.55	0.40652	ATP:guanido phosphotransferase, catalytic domain (2);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.045722	0.85682	D	0.000000	T	0.54303	0.1850	H	0.98487	4.245	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.998;1.0	D;D;D;D;D;D;D	0.91635	0.996;0.999;0.999;0.999;0.999;0.99;0.999	T	0.75033	-0.3460	10	0.87932	D	0	-1.777	14.829	0.70135	0.0:0.145:0.855:0.0	.	289;248;248;227;320;130;289	F8WCN3;E9PCP8;B4DH34;B4DGR9;P12532-2;B4DJW9;P12532	.;.;.;.;.;.;KCRU_HUMAN	D	289;248;289;152;322	ENSP00000300283:G289D;ENSP00000389267:G248D;ENSP00000413255:G289D;ENSP00000390428:G152D	ENSP00000300283:G289D	G	+	2	0	CKMT1B	41676011	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	7.660000	0.83776	1.215000	0.43411	0.485000	0.47835	GGC	.		0.443	CKMT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133147.2	NM_020990	
CLHC1	130162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	55407735	55407735	+	Missense_Mutation	SNP	A	A	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr2:55407735A>C	ENST00000401408.1	-	11	1640	c.1295T>G	c.(1294-1296)cTg>cGg	p.L432R	CLHC1_ENST00000494539.1_Intron|CLHC1_ENST00000407122.1_Missense_Mutation_p.L432R|CLHC1_ENST00000406437.2_5'UTR|CLHC1_ENST00000406076.1_Missense_Mutation_p.L310R	NM_152385.2	NP_689598.2	Q8NHS4	CLHC1_HUMAN	clathrin heavy chain linker domain containing 1	432																	TTTCTTGTGCAGGCCACATTC	0.448																																					p.L432R		.											.	.	.	0			c.T1295G						.						129.0	116.0	120.0					2																	55407735		2203	4300	6503	SO:0001583	missense	130162	exon11			TTGTGCAGGCCAC		CCDS33201.1, CCDS46287.1	2p16.1	2012-08-03	2012-08-03	2012-08-03	ENSG00000162994	ENSG00000162994			26453	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 63"""	C2orf63			Standard	NM_152385		Approved	FLJ31438	uc002ryi.2	Q8NHS4	OTTHUMG00000151918	ENST00000401408.1:c.1295T>G	2.37:g.55407735A>C	ENSP00000384869:p.Leu432Arg	80.0	0.0		68.0	13.0	NM_152385	B2RDV1|Q53R93|Q8N403	Missense_Mutation	SNP	ENST00000401408.1	37	CCDS33201.1	.	.	.	.	.	.	.	.	.	.	A	16.45	3.127453	0.56721	.	.	ENSG00000162994	ENST00000407122;ENST00000401408;ENST00000406076	T;T;T	0.46819	0.86;0.86;0.86	5.98	3.55	0.40652	Clathrin, heavy chain, linker (1);Armadillo-type fold (1);	0.370007	0.21640	N	0.071346	T	0.54464	0.1860	M	0.63428	1.95	0.24473	N	0.994384	D	0.63880	0.993	P	0.56398	0.797	T	0.48222	-0.9054	10	0.59425	D	0.04	-1.0667	6.1162	0.20127	0.7791:0.0:0.0773:0.1436	.	432	Q8NHS4	CB063_HUMAN	R	432;432;310	ENSP00000385778:L432R;ENSP00000384869:L432R;ENSP00000385512:L310R	ENSP00000384869:L432R	L	-	2	0	C2orf63	55261239	0.044000	0.20184	0.170000	0.22879	0.736000	0.42039	3.056000	0.49923	0.475000	0.27415	0.482000	0.46254	CTG	.		0.448	CLHC1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324412.4	NM_152385	
CNBD2	140894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	34568392	34568392	+	Silent	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr20:34568392T>C	ENST00000373973.3	+	4	428	c.255T>C	c.(253-255)ccT>ccC	p.P85P	CNBD2_ENST00000538900.1_Silent_p.P85P|CNBD2_ENST00000349339.1_Silent_p.P85P			Q96M20	CNBD2_HUMAN	cyclic nucleotide binding domain containing 2	85																	GTCACTTTCCTCCAAAGGCCA	0.542																																					p.P85P		.											.	.	.	0			c.T255C						.						89.0	76.0	80.0					20																	34568392		2203	4300	6503	SO:0001819	synonymous_variant	140894	exon4			CTTTCCTCCAAAG	AL359828	CCDS13270.1, CCDS56189.1	20q11.23	2012-11-15	2012-11-15	2012-11-15	ENSG00000149646	ENSG00000149646			16145	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 152"", ""cyclic nucleotide (cNMP) binding domain containing 1"""	C20orf152, CNMPD1		11780052	Standard	NM_080834		Approved	dJ954P9.1	uc002xer.1	Q96M20	OTTHUMG00000032371	ENST00000373973.3:c.255T>C	20.37:g.34568392T>C		94.0	0.0		87.0	25.0	NM_080834	Q14C79|Q5JWY7|Q5T3S1|Q9BR36|Q9BWY5	Silent	SNP	ENST00000373973.3	37																																																																																				.		0.542	CNBD2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000078960.2	NM_080834	
CTNNA2	1496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	80782957	80782957	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr2:80782957C>G	ENST00000402739.4	+	11	1685	c.1680C>G	c.(1678-1680)aaC>aaG	p.N560K	CTNNA2_ENST00000540488.1_Missense_Mutation_p.N560K|CTNNA2_ENST00000343114.3_Missense_Mutation_p.N239K|CTNNA2_ENST00000466387.1_Missense_Mutation_p.N560K|CTNNA2_ENST00000541047.1_Missense_Mutation_p.N560K|CTNNA2_ENST00000496558.1_Missense_Mutation_p.N560K|CTNNA2_ENST00000361291.4_Missense_Mutation_p.N594K	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	560					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						AGATGGAGAACTATGAAGCTG	0.512																																					p.N560K		.											.	CTNNA2	368	0			c.C1680G						.						147.0	139.0	142.0					2																	80782957		1899	4129	6028	SO:0001583	missense	1496	exon12			GGAGAACTATGAA		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1680C>G	2.37:g.80782957C>G	ENSP00000384638:p.Asn560Lys	87.0	0.0		78.0	9.0	NM_001164883	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	C	19.40	3.820310	0.71028	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114	T;T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73;0.73	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.62648	0.2445	M	0.82433	2.59	0.58432	D	0.999991	D;D;D;D	0.67145	0.996;0.987;0.984;0.984	P;P;P;P	0.53760	0.55;0.734;0.713;0.62	T	0.66428	-0.5926	9	.	.	.	.	13.0806	0.59112	0.0:0.9265:0.0:0.0735	.	192;560;560;560	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	K	560;560;594;560;560;560;239	ENSP00000418191:N560K;ENSP00000419295:N560K;ENSP00000355398:N594K;ENSP00000384638:N560K;ENSP00000444675:N560K;ENSP00000441705:N560K;ENSP00000341500:N239K	.	N	+	3	2	CTNNA2	80636468	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.352000	0.34033	2.765000	0.95021	0.650000	0.86243	AAC	.		0.512	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
CTTNBP2	83992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	117385885	117385885	+	Splice_Site	SNP	C	C	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr7:117385885C>A	ENST00000160373.3	-	14	3626	c.3535G>T	c.(3535-3537)Gct>Tct	p.A1179S		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1179					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		ATGTTCTTACCGCTACTAATG	0.408																																					p.A1179S		.											.	CTTNBP2	94	0			c.G3535T						.						86.0	85.0	86.0					7																	117385885		2203	4300	6503	SO:0001630	splice_region_variant	83992	exon14			TCTTACCGCTACT		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.3535+1G>T	7.37:g.117385885C>A		71.0	0.0		66.0	7.0	NM_033427	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	CCDS5774.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.47|19.47	3.832792|3.832792	0.71258|0.71258	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000160373|ENST00000446636	T|.	0.52057|.	0.68|.	5.87|5.87	4.98|4.98	0.66077|0.66077	.|.	0.048902|.	0.85682|.	D|.	0.000000|.	T|T	0.78253|0.78253	0.4254|0.4254	M|M	0.84082|0.84082	2.675|2.675	0.37380|0.37380	D|D	0.91201|0.91201	D|.	0.69078|.	0.997|.	P|.	0.61397|.	0.888|.	D|D	0.83610|0.83610	0.0133|0.0133	9|5	.|.	.|.	.|.	0.3876|0.3876	16.6019|16.6019	0.84818|0.84818	0.1314:0.8686:0.0:0.0|0.1314:0.8686:0.0:0.0	.|.	1179|.	Q8WZ74|.	CTTB2_HUMAN|.	S|L	1179|666	ENSP00000160373:A1179S|.	.|.	A|R	-|-	1|2	0|0	CTTNBP2|CTTNBP2	117173121|117173121	1.000000|1.000000	0.71417|0.71417	0.940000|0.940000	0.37924|0.37924	0.634000|0.634000	0.38068|0.38068	5.887000|5.887000	0.69751|0.69751	1.590000|1.590000	0.49995|0.49995	0.655000|0.655000	0.94253|0.94253	GCT|CGC	.		0.408	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	Missense_Mutation
DIS3L	115752	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	66615033	66615052	+	Frame_Shift_Del	DEL	GATGCCAGTAAACACACCAG	GATGCCAGTAAACACACCAG	-	rs202123708|rs375573302		TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	GATGCCAGTAAACACACCAG	GATGCCAGTAAACACACCAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr15:66615033_66615052delGATGCCAGTAAACACACCAG	ENST00000319212.4	+	10	1385_1404	c.1335_1354delGATGCCAGTAAACACACCAG	c.(1333-1356)gagatgccagtaaacacaccagaafs	p.EMPVNTPE445fs	DIS3L_ENST00000319194.5_Frame_Shift_Del_p.EMPVNTPE362fs|DIS3L_ENST00000441424.2_3'UTR|RP11-352G18.2_ENST00000565993.1_RNA	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	445					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						AGATGTGTGAGATGCCAGTAAACACACCAGAAAGTCCCTG	0.395																																					p.445_452del		.											.	DIS3L	92	0			c.1335_1354del						.																																			SO:0001589	frameshift_variant	115752	exon10			GTGTGAGATGCCA		CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.1335_1354delGATGCCAGTAAACACACCAG	15.37:g.66615033_66615052delGATGCCAGTAAACACACCAG	ENSP00000321711:p.Glu445fs	79.0	0.0		95.0	10.0	NM_001143688	Q8N1N8|Q8WTU9|Q96CM7	Frame_Shift_Del	DEL	ENST00000319212.4	37	CCDS45286.1																																																																																			.		0.395	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382792.2	NM_133375	
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	38775436	38775436	+	Silent	SNP	T	T	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr6:38775436T>A	ENST00000359357.3	+	22	2804	c.2550T>A	c.(2548-2550)ctT>ctA	p.L850L	DNAH8_ENST00000441566.1_Silent_p.L850L|DNAH8_ENST00000449981.2_Silent_p.L1067L			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	850					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TAGACAGTCTTCAAAAAGCTA	0.323																																					p.L1067L		.											.	DNAH8	615	0			c.T3201A						.						114.0	114.0	114.0					6																	38775436		2203	4298	6501	SO:0001819	synonymous_variant	1769	exon24			CAGTCTTCAAAAA	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.2550T>A	6.37:g.38775436T>A		101.0	0.0		122.0	28.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37																																																																																				.		0.323	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
DNAJB6	10049	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	157208729	157208729	+	Silent	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr7:157208729G>A	ENST00000262177.4	+	10	1123	c.918G>A	c.(916-918)aaG>aaA	p.K306K	DNAJB6_ENST00000452797.2_Silent_p.K257K|DNAJB6_ENST00000494267.1_3'UTR|DNAJB6_ENST00000443280.1_Silent_p.K191K	NM_058246.3	NP_490647.1	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6	306					intermediate filament organization (GO:0045109)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|lung(1)|ovary(2)|stomach(1)	5	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		AAGGTGGCaagaggaagaagc	0.498																																					p.K306K	Esophageal Squamous(46;195 967 1350 20350 43814)	.											.	DNAJB6	93	0			c.G918A						.						136.0	123.0	128.0					7																	157208729		2203	4300	6503	SO:0001819	synonymous_variant	10049	exon10			TGGCAAGAGGAAG	AB014888	CCDS5946.1, CCDS47755.1	7q36.3	2014-02-03			ENSG00000105993	ENSG00000105993		"""Heat shock proteins / DNAJ (HSP40)"""	14888	protein-coding gene	gene with protein product		611332	"""limb girdle muscular dystrophy 1D (autosomal dominant)"""	LGMD1D		10319584, 9915854, 22366786	Standard	NM_005494		Approved	MRJ	uc003wnk.3	O75190	OTTHUMG00000157242	ENST00000262177.4:c.918G>A	7.37:g.157208729G>A		36.0	0.0		52.0	7.0	NM_058246	A4D232|A8K7D8|A8KAG0|B4DN73|E9PCZ2|O95806|Q53EN8|Q59EF2|Q6FIC8|Q75MA2|Q9UIK6	Silent	SNP	ENST00000262177.4	37	CCDS5946.1																																																																																			.		0.498	DNAJB6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348119.2		
DOHH	83475	ucsc.edu;bcgsc.ca	37	19	3496791	3496791	+	Missense_Mutation	SNP	C	C	T	rs375206434		TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr19:3496791C>T	ENST00000427575.1	-	2	473	c.22G>A	c.(22-24)Gat>Aat	p.D8N	DOHH_ENST00000250937.3_Missense_Mutation_p.D8N	NM_001145165.1	NP_001138637.1			deoxyhypusine hydroxylase/monooxygenase											central_nervous_system(1)|large_intestine(1)|lung(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGATGGCATCCACCTCCTGC	0.677																																					p.D8N		.											.	DOHH	90	0			c.G22A						.						35.0	37.0	36.0					19																	3496791		2203	4300	6503	SO:0001583	missense	83475	exon2			TGGCATCCACCTC	BC002817	CCDS12108.1	19p13.3	2008-02-05	2006-05-22	2006-05-22		ENSG00000129932			28662	protein-coding gene	gene with protein product		611262	"""HEAT-like (PBS lyase) repeat containing 1"""	HLRC1		16371467, 16533814	Standard	NM_031304		Approved	MGC4293	uc002lxs.3	Q9BU89		ENST00000427575.1:c.22G>A	19.37:g.3496791C>T	ENSP00000398882:p.Asp8Asn	20.0	0.0		20.0	4.0	NM_001145165		Missense_Mutation	SNP	ENST00000427575.1	37	CCDS12108.1	.	.	.	.	.	.	.	.	.	.	C	10.70	1.424688	0.25639	.	.	ENSG00000129932	ENST00000427575;ENST00000250937	.	.	.	4.28	3.22	0.36961	Armadillo-like helical (1);	0.454150	0.22598	N	0.057997	T	0.23766	0.0575	N	0.12887	0.27	0.29460	N	0.857868	B	0.02656	0.0	B	0.01281	0.0	T	0.12630	-1.0540	9	0.30078	T	0.28	-5.6249	10.7749	0.46343	0.0:0.6264:0.3736:0.0	.	8	Q9BU89	DOHH_HUMAN	N	8	.	ENSP00000250937:D8N	D	-	1	0	DOHH	3447791	0.928000	0.31464	0.855000	0.33649	0.760000	0.43138	2.215000	0.42862	0.772000	0.33382	0.561000	0.74099	GAT	.		0.677	DOHH-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452932.1	NM_031304	
EBF4	57593	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	2730134	2730134	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr20:2730134C>A	ENST00000609451.1	+	8	799	c.727C>A	c.(727-729)Cgc>Agc	p.R243S	EBF4_ENST00000380648.4_Missense_Mutation_p.R239S			Q9BQW3	COE4_HUMAN	early B-cell factor 4	243					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										CAAGCATGGCCGCAGGGCGCG	0.726																																					p.R239S		.											.	.	.	0			c.C715A						.						18.0	21.0	20.0					20																	2730134		690	1590	2280	SO:0001583	missense	57593	exon9			CATGGCCGCAGGG	BC019106	CCDS46573.1	20p13	2008-10-23			ENSG00000088881	ENSG00000088881			29278	protein-coding gene	gene with protein product		609935				10718198	Standard	NM_001110514		Approved	KIAA1442, COE4, RP5-860F19.3, O/E-4	uc002wgt.4	Q9BQW3	OTTHUMG00000031709	ENST00000609451.1:c.727C>A	20.37:g.2730134C>A	ENSP00000477023:p.Arg243Ser	38.0	0.0		53.0	8.0	NM_001110514	Q1MTP7|Q5JY53|Q9NUB6|Q9P2A6	Missense_Mutation	SNP	ENST00000609451.1	37		.	.	.	.	.	.	.	.	.	.	c	20.7	4.034731	0.75617	.	.	ENSG00000088881	ENST00000380648;ENST00000342725	T;T	0.56103	0.48;0.48	4.34	4.34	0.51931	.	0.000000	0.48286	D	0.000182	T	0.71281	0.3321	M	0.86805	2.84	0.49389	D	0.999788	D	0.71674	0.998	D	0.65573	0.936	T	0.75121	-0.3429	10	0.59425	D	0.04	-16.6468	9.5837	0.39504	0.2092:0.7908:0.0:0.0	.	239	E9PEI2	.	S	239;243	ENSP00000370022:R239S;ENSP00000345030:R243S	ENSP00000345030:R243S	R	+	1	0	EBF4	2678134	0.967000	0.33354	1.000000	0.80357	0.997000	0.91878	2.280000	0.43443	2.263000	0.75096	0.486000	0.48141	CGC	.		0.726	EBF4-011	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471930.1	XM_938882	
ENOPH1	58478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	83372214	83372214	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr4:83372214C>A	ENST00000273920.3	+	3	473	c.205C>A	c.(205-207)Ctg>Atg	p.L69M	ENOPH1_ENST00000509635.1_5'UTR	NM_021204.3	NP_067027.1			enolase-phosphatase 1											central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|skin(1)	13						GGACGCCCACCTGGATGGGGC	0.463																																					p.L69M		.											.	ENOPH1	22	0			c.C205A						.						77.0	73.0	74.0					4																	83372214		2203	4300	6503	SO:0001583	missense	58478	exon3			GCCCACCTGGATG		CCDS3594.1, CCDS75154.1	4q21.3	2013-05-29			ENSG00000145293	ENSG00000145293	3.1.3.77		24599	protein-coding gene	gene with protein product	"""Enolase-phosphatase E1"", ""acireductone synthase"""					15843022	Standard	XM_005263168		Approved	MASA, E1, mtnC	uc003hmv.3	Q9UHY7	OTTHUMG00000130295	ENST00000273920.3:c.205C>A	4.37:g.83372214C>A	ENSP00000273920:p.Leu69Met	71.0	0.0		83.0	17.0	NM_021204		Missense_Mutation	SNP	ENST00000273920.3	37	CCDS3594.1	.	.	.	.	.	.	.	.	.	.	c	13.40	2.224668	0.39300	.	.	ENSG00000145293	ENST00000273920;ENST00000456931	.	.	.	5.36	4.5	0.54988	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);2,3-diketo-5-methylthio-1-phosphopentane phosphatase (1);	0.136231	0.50627	D	0.000112	T	0.42607	0.1210	L	0.31664	0.95	0.80722	D	1	B	0.30870	0.298	B	0.25291	0.059	T	0.35151	-0.9800	9	0.34782	T	0.22	-15.3012	12.5049	0.55975	0.0:0.867:0.0:0.133	.	69	Q9UHY7	ENOPH_HUMAN	M	69	.	ENSP00000273920:L69M	L	+	1	2	ENOPH1	83591238	1.000000	0.71417	1.000000	0.80357	0.693000	0.40251	1.432000	0.34936	2.673000	0.90976	0.650000	0.86243	CTG	.		0.463	ENOPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252638.2	NM_021204	
EVI5	7813	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	93159906	93159906	+	Frame_Shift_Del	DEL	G	G	-			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr1:93159906delG	ENST00000370331.1	-	8	1090	c.1081delC	c.(1081-1083)cagfs	p.Q361fs	EVI5_ENST00000543509.1_Frame_Shift_Del_p.Q361fs|EVI5_ENST00000540033.1_Frame_Shift_Del_p.Q361fs	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	361	Dimerization.|Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		TGATTCATCTGAAGAAGTGCT	0.323																																					p.Q361fs		.											.	EVI5	136	0			c.1081delC						.						92.0	93.0	93.0					1																	93159906		2203	4300	6503	SO:0001589	frameshift_variant	7813	exon8			TCATCTGAAGAAG	AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.1081delC	1.37:g.93159906delG	ENSP00000359356:p.Gln361fs	216.0	0.0		184.0	38.0	NM_005665	A6NKX8|B9A6J0|Q9H1Y9	Frame_Shift_Del	DEL	ENST00000370331.1	37	CCDS30774.1																																																																																			.		0.323	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030047.1	NM_005665	
FAM129B	64855	broad.mit.edu;ucsc.edu	37	9	130271257	130271257	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr9:130271257C>T	ENST00000373312.3	-	10	1528	c.1315G>A	c.(1315-1317)Gag>Aag	p.E439K	FAM129B_ENST00000373314.3_Missense_Mutation_p.E426K|FAM129B_ENST00000468379.1_Intron	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	439					negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						GGGTCTACCTCCCGCATGTGG	0.642																																					p.E439K		.											.	FAM129B	68	0			c.G1315A						.						111.0	84.0	93.0					9																	130271257		2203	4300	6503	SO:0001583	missense	64855	exon10			CTACCTCCCGCAT	AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.1315G>A	9.37:g.130271257C>T	ENSP00000362409:p.Glu439Lys	41.0	0.0		39.0	4.0	NM_022833	Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Missense_Mutation	SNP	ENST00000373312.3	37	CCDS35145.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.024837	0.93518	.	.	ENSG00000136830	ENST00000373314;ENST00000538931;ENST00000373312	T;T	0.25912	1.77;1.77	5.41	5.41	0.78517	.	0.153050	0.56097	D	0.000022	T	0.40171	0.1106	M	0.65975	2.015	0.49798	D	0.999821	P;P;P	0.52842	0.956;0.956;0.956	P;P;P	0.51487	0.65;0.671;0.671	T	0.11227	-1.0596	10	0.36615	T	0.2	-33.9572	16.6857	0.85304	0.0:1.0:0.0:0.0	.	89;426;439	F5H3T0;Q96TA1-2;Q96TA1	.;.;NIBL1_HUMAN	K	426;89;439	ENSP00000362411:E426K;ENSP00000362409:E439K	ENSP00000362409:E439K	E	-	1	0	FAM129B	129311078	0.999000	0.42202	1.000000	0.80357	0.923000	0.55619	3.809000	0.55606	2.532000	0.85374	0.561000	0.74099	GAG	.		0.642	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054196.1	NM_022833	
FAT3	120114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	92495075	92495075	+	Silent	SNP	G	G	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr11:92495075G>T	ENST00000298047.6	+	4	3740	c.3723G>T	c.(3721-3723)gtG>gtT	p.V1241V	FAT3_ENST00000409404.2_Silent_p.V1241V|RP11-203F8.1_ENST00000529884.1_RNA|FAT3_ENST00000525166.1_Silent_p.V1091V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1241	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTTGGGTGGTGGTTCAGGTTC	0.458										TCGA Ovarian(4;0.039)																											p.V1241V		.											.	FAT3	73	0			c.G3723T						.						191.0	183.0	186.0					11																	92495075		1908	4123	6031	SO:0001819	synonymous_variant	120114	exon4			GGTGGTGGTTCAG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.3723G>T	11.37:g.92495075G>T		64.0	0.0		77.0	12.0	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																				.		0.458	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FGFR3	2261	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	1803246	1803246	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr4:1803246C>T	ENST00000260795.2	+	4	700	c.598C>T	c.(598-600)Cgc>Tgc	p.R200C	FGFR3_ENST00000481110.2_Missense_Mutation_p.R200C|FGFR3_ENST00000412135.2_Missense_Mutation_p.R200C|FGFR3_ENST00000340107.4_Missense_Mutation_p.R200C|FGFR3_ENST00000352904.1_Missense_Mutation_p.R200C|FGFR3_ENST00000440486.2_Missense_Mutation_p.R200C			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	200	Ig-like C2-type 2.				alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	CGGCGAGCACCGCATTGGAGG	0.726		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.R200C		.		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	FGFR3	9542	0			c.C598T	GRCh37	CM066080	FGFR3	M		.						8.0	7.0	7.0					4																	1803246		2120	4173	6293	SO:0001583	missense	2261	exon5	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	GAGCACCGCATTG	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.598C>T	4.37:g.1803246C>T	ENSP00000260795:p.Arg200Cys	50.0	0.0		46.0	10.0	NM_001163213	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	ENST00000260795.2	37	CCDS3353.1	.	.	.	.	.	.	.	.	.	.	c	14.51	2.557684	0.45590	.	.	ENSG00000068078	ENST00000481110;ENST00000340107;ENST00000440486;ENST00000412135;ENST00000260795;ENST00000352904;ENST00000507588	D;D;D;D;D;D;T	0.85702	-2.02;-2.02;-2.02;-2.02;-2.02;-2.02;-0.51	3.67	3.67	0.42095	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.129493	0.51477	D	0.000100	D	0.94138	0.8120	H	0.95884	3.735	0.25536	N	0.987225	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.991;0.999;0.998;0.999;1.0;0.999	D	0.87509	0.2438	10	0.87932	D	0	.	11.9344	0.52866	0.1868:0.8132:0.0:0.0	.	163;200;200;200;200;200	Q8NI15;P22607-2;P22607-4;P22607-3;P22607;F8W9L4	.;.;.;.;FGFR3_HUMAN;.	C	200;200;200;200;200;200;20	ENSP00000420533:R200C;ENSP00000339824:R200C;ENSP00000414914:R200C;ENSP00000412903:R200C;ENSP00000260795:R200C;ENSP00000231803:R200C;ENSP00000427289:R20C	ENSP00000260795:R200C	R	+	1	0	FGFR3	1773044	0.872000	0.30054	0.998000	0.56505	0.295000	0.27426	1.686000	0.37669	1.765000	0.52091	0.436000	0.28706	CGC	.		0.726	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
FHL2	2274	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	105977827	105977827	+	Silent	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr2:105977827A>G	ENST00000409807.1	-	6	1087	c.753T>C	c.(751-753)tgT>tgC	p.C251C	FHL2_ENST00000393352.3_Silent_p.C251C|AC012360.6_ENST00000457290.2_RNA|FHL2_ENST00000344213.4_Silent_p.C361C|FHL2_ENST00000336660.5_3'UTR|FHL2_ENST00000409177.1_Silent_p.C367C|FHL2_ENST00000322142.8_Silent_p.C251C|FHL2_ENST00000358129.4_Silent_p.C251C|FHL2_ENST00000408995.1_Silent_p.C251C|FHL2_ENST00000393353.3_Silent_p.C251C			Q14192	FHL2_HUMAN	four and a half LIM domains 2	251	LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				androgen receptor signaling pathway (GO:0030521)|atrial cardiac muscle cell development (GO:0055014)|cellular lipid metabolic process (GO:0044255)|heart trabecula formation (GO:0060347)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast differentiation (GO:0001649)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle cell development (GO:0055015)	actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|M band (GO:0031430)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Z disc (GO:0030018)	androgen receptor binding (GO:0050681)|identical protein binding (GO:0042802)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	9						AGCACTTCTTACAGTTAAAGC	0.488																																					p.C251C		.											.	FHL2	91	0			c.T753C						.						121.0	103.0	109.0					2																	105977827		2203	4300	6503	SO:0001819	synonymous_variant	2274	exon7			CTTCTTACAGTTA		CCDS2070.1	2q12.2	2014-09-17			ENSG00000115641	ENSG00000115641			3703	protein-coding gene	gene with protein product		602633				8753811	Standard	NM_201557		Approved	SLIM3, DRAL	uc002tcy.3	Q14192	OTTHUMG00000153120	ENST00000409807.1:c.753T>C	2.37:g.105977827A>G		101.0	1.0		111.0	14.0	NM_001039492	Q13229|Q13644|Q2I5I4|Q5TM15|Q9P294	Silent	SNP	ENST00000409807.1	37	CCDS2070.1																																																																																			.		0.488	FHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329654.1		
FLNB	2317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	58089691	58089691	+	Silent	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr3:58089691C>T	ENST00000295956.4	+	10	1654	c.1489C>T	c.(1489-1491)Ctg>Ttg	p.L497L	FLNB_ENST00000357272.4_Silent_p.L497L|FLNB_ENST00000358537.3_Silent_p.L497L|FLNB_ENST00000490882.1_Silent_p.L497L|FLNB_ENST00000429972.2_Silent_p.L497L|FLNB_ENST00000419752.2_Silent_p.L328L|FLNB_ENST00000348383.5_Silent_p.L497L|FLNB_ENST00000493452.1_Silent_p.L328L	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	497					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		CACAGAGGGTCTGGAGGAGCT	0.502																																					p.L497L		.											.	FLNB	593	0			c.C1489T						.						93.0	96.0	95.0					3																	58089691		2203	4300	6503	SO:0001819	synonymous_variant	2317	exon10			GAGGGTCTGGAGG	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.1489C>T	3.37:g.58089691C>T		96.0	0.0		70.0	13.0	NM_001457	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Silent	SNP	ENST00000295956.4	37	CCDS2885.1																																																																																			.		0.502	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
FRMD4B	23150	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	69246073	69246073	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr3:69246073T>C	ENST00000398540.3	-	13	1153	c.1070A>G	c.(1069-1071)tAc>tGc	p.Y357C	FRMD4B_ENST00000478263.1_Missense_Mutation_p.Y9C|FRMD4B_ENST00000542259.1_Missense_Mutation_p.Y303C	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	357	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		CCGGTCCAAGTAAAACTGATG	0.413																																					p.Y357C		.											.	FRMD4B	72	0			c.A1070G						.						102.0	97.0	99.0					3																	69246073		1886	4130	6016	SO:0001583	missense	23150	exon13			TCCAAGTAAAACT	AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.1070A>G	3.37:g.69246073T>C	ENSP00000381549:p.Tyr357Cys	70.0	0.0		53.0	8.0	NM_015123	Q8TAI3	Missense_Mutation	SNP	ENST00000398540.3	37	CCDS46863.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.057826	0.76074	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000478263;ENST00000462512;ENST00000489817	D;D;D	0.86030	-2.06;-2.06;-2.06	5.9	5.9	0.94986	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.92371	0.7579	M	0.78801	2.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.93188	0.6580	10	0.87932	D	0	-15.3629	16.3217	0.82953	0.0:0.0:0.0:1.0	.	201;357	B4DHD5;Q9Y2L6	.;FRM4B_HUMAN	C	357;303;9;68;9	ENSP00000381549:Y357C;ENSP00000437658:Y303C;ENSP00000419869:Y68C	ENSP00000381549:Y357C	Y	-	2	0	FRMD4B	69328763	1.000000	0.71417	1.000000	0.80357	0.588000	0.36517	8.036000	0.88901	2.251000	0.74343	0.528000	0.53228	TAC	.		0.413	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1		
GBP7	388646	broad.mit.edu;mdanderson.org	37	1	89607248	89607248	+	Silent	SNP	A	A	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr1:89607248A>T	ENST00000294671.2	-	9	1587	c.1449T>A	c.(1447-1449)gcT>gcA	p.A483A		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	483						membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		CCTTCTCTCCAGCAGTGAGGG	0.517																																					p.A483A		.											.	GBP7	92	0			c.T1449A						.						143.0	125.0	131.0					1																	89607248		2203	4300	6503	SO:0001819	synonymous_variant	388646	exon9			CTCTCCAGCAGTG	AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.1449T>A	1.37:g.89607248A>T		52.0	0.0		55.0	6.0	NM_207398		Silent	SNP	ENST00000294671.2	37	CCDS720.1																																																																																			.		0.517	GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029401.1	NM_207398	
GCFC2	6936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	75897385	75897385	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr2:75897385T>G	ENST00000321027.3	-	15	2115	c.1982A>C	c.(1981-1983)aAt>aCt	p.N661T	GCFC2_ENST00000409857.3_Missense_Mutation_p.N623T|GCFC2_ENST00000541687.1_3'UTR|MRPL19_ENST00000409374.1_Intron|RP11-342K6.2_ENST00000604219.1_RNA|MRPL19_ENST00000358788.6_Intron	NM_001201334.1|NM_003203.4	NP_001188263.1|NP_003194.3	P16383	GCFC2_HUMAN	GC-rich sequence DNA-binding factor 2	661					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)										AAGGAGTCCATTCCAAAGAAG	0.378																																					p.N661T		.											.	.	.	0			c.A1982C						.						105.0	107.0	106.0					2																	75897385		2203	4300	6503	SO:0001583	missense	6936	exon15			AGTCCATTCCAAA	AB026911	CCDS1961.1, CCDS62943.1	2p12	2014-01-17	2011-11-24	2011-11-24	ENSG00000005436	ENSG00000005436			1317	protein-coding gene	gene with protein product	"""GC binding factor"""	189901	"""transcription factor 9 (binds GC-rich sequences)"", ""chromosome 2 open reading frame 3"""	TCF9, C2orf3		1370479, 2556218, 17309879, 24304693	Standard	NM_003203		Approved	DNABF, GCF	uc002sno.3	P16383	OTTHUMG00000129989	ENST00000321027.3:c.1982A>C	2.37:g.75897385T>G	ENSP00000318690:p.Asn661Thr	63.0	0.0		44.0	11.0	NM_003203	A4UHQ8|O95032|Q53TY0|Q6P2F2	Missense_Mutation	SNP	ENST00000321027.3	37	CCDS1961.1	.	.	.	.	.	.	.	.	.	.	T	9.421	1.082987	0.20309	.	.	ENSG00000005436	ENST00000321027;ENST00000409857;ENST00000427862	T;T;T	0.41400	1.0;1.0;1.0	4.65	2.14	0.27477	GC-rich sequence DNA-binding factor domain (1);	0.098090	0.64402	D	0.000002	T	0.30008	0.0751	L	0.51422	1.61	0.80722	D	1	P	0.38300	0.626	B	0.37650	0.255	T	0.05699	-1.0869	10	0.15952	T	0.53	-11.8751	5.0462	0.14485	0.0:0.0987:0.1836:0.7176	.	661	P16383	GCF_HUMAN	T	661;623;79	ENSP00000318690:N661T;ENSP00000386552:N623T;ENSP00000409340:N79T	ENSP00000318690:N661T	N	-	2	0	C2orf3	75750893	1.000000	0.71417	0.992000	0.48379	0.416000	0.31233	1.706000	0.37878	0.217000	0.20800	0.482000	0.46254	AAT	.		0.378	GCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252255.2	NM_003203	
GLI3	2737	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	42005488	42005488	+	Silent	SNP	G	G	A	rs565428084		TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr7:42005488G>A	ENST00000395925.3	-	15	3267	c.3183C>T	c.(3181-3183)caC>caT	p.H1061H	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	1061					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						AGGGGGACGAGTGGAAGTTTC	0.642									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.H1061H		.											.	GLI3	1149	0			c.C3183T						.						54.0	58.0	56.0					7																	42005488		2203	4300	6503	SO:0001819	synonymous_variant	2737	exon15	Familial Cancer Database	;	GGACGAGTGGAAG		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.3183C>T	7.37:g.42005488G>A		65.0	0.0		74.0	9.0	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Silent	SNP	ENST00000395925.3	37	CCDS5465.1																																																																																			.		0.642	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
GRM5	2915	hgsc.bcm.edu;broad.mit.edu	37	11	88241917	88241917	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr11:88241917A>T	ENST00000305447.4	-	9	3631	c.3482T>A	c.(3481-3483)gTg>gAg	p.V1161E	GRM5_ENST00000305432.5_Missense_Mutation_p.V1129E|GRM5_ENST00000455756.2_Missense_Mutation_p.V1129E|GRM5_ENST00000393297.1_Intron|GRM5_ENST00000418177.2_Missense_Mutation_p.V1161E|GRM5-AS1_ENST00000526448.1_RNA|GRM5-AS1_ENST00000531994.1_RNA	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	1161					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	GGTGAGAGCCACCAGCTCCTC	0.741																																					p.V1161E		.											.	GRM5	949	0			c.T3482A						.						7.0	8.0	8.0					11																	88241917		2136	4250	6386	SO:0001583	missense	2915	exon9			AGAGCCACCAGCT	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.3482T>A	11.37:g.88241917A>T	ENSP00000306138:p.Val1161Glu	34.0	0.0		60.0	7.0	NM_001143831	Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	A	13.64	2.296780	0.40594	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447	D;D;D;D	0.88818	-2.41;-2.43;-2.43;-2.41	4.89	4.89	0.63831	.	0.213164	0.39407	N	0.001363	T	0.79452	0.4448	N	0.19112	0.55	0.34315	D	0.685952	B;B	0.32829	0.386;0.272	B;B	0.26770	0.073;0.027	T	0.81951	-0.0698	9	.	.	.	.	14.5655	0.68173	1.0:0.0:0.0:0.0	.	1129;1161	P41594-2;P41594	.;GRM5_HUMAN	E	1161;1129;1129;1161	ENSP00000402912:V1161E;ENSP00000405690:V1129E;ENSP00000305905:V1129E;ENSP00000306138:V1161E	.	V	-	2	0	GRM5	87881565	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	8.850000	0.92190	1.827000	0.53221	0.456000	0.33151	GTG	.		0.741	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842	
HGFAC	3083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	3449280	3449280	+	Missense_Mutation	SNP	G	G	A	rs560293902		TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr4:3449280G>A	ENST00000382774.3	+	11	1532	c.1417G>A	c.(1417-1419)Gtg>Atg	p.V473M	HGFAC_ENST00000511533.1_Missense_Mutation_p.V480M	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	473	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CACGACGGACGTGACGCAGAC	0.657																																					p.V473M		.											.	HGFAC	514	0			c.G1417A						.						195.0	171.0	179.0					4																	3449280		2203	4300	6503	SO:0001583	missense	3083	exon11			ACGGACGTGACGC	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.1417G>A	4.37:g.3449280G>A	ENSP00000372224:p.Val473Met	245.0	0.0		267.0	43.0	NM_001528	Q14726|Q2M1W7|Q53X47	Missense_Mutation	SNP	ENST00000382774.3	37	CCDS3369.1	.	.	.	.	.	.	.	.	.	.	G	10.52	1.374241	0.24857	.	.	ENSG00000109758	ENST00000382774;ENST00000511533	D;D	0.88586	-2.4;-2.4	3.59	3.59	0.41128	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.326333	0.28940	N	0.013659	D	0.89487	0.6729	L	0.28115	0.83	0.40067	D	0.975964	D;P	0.89917	1.0;0.829	D;B	0.71870	0.975;0.171	D	0.89253	0.3592	10	0.38643	T	0.18	.	14.2846	0.66238	0.0:0.0:1.0:0.0	.	480;473	D6RAR4;Q04756	.;HGFA_HUMAN	M	473;480	ENSP00000372224:V473M;ENSP00000421801:V480M	ENSP00000372224:V473M	V	+	1	0	HGFAC	3419078	0.027000	0.19231	0.352000	0.25734	0.055000	0.15305	1.107000	0.31110	2.022000	0.59522	0.561000	0.74099	GTG	.		0.657	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3		
HSH2D	84941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	16265269	16265269	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr19:16265269G>C	ENST00000253680.6	+	7	973	c.442G>C	c.(442-444)Gaa>Caa	p.E148Q	HSH2D_ENST00000588246.1_Missense_Mutation_p.E148Q|HSH2D_ENST00000397372.4_Missense_Mutation_p.E59Q|HSH2D_ENST00000593154.2_Missense_Mutation_p.E148Q			Q96JZ2	HSH2D_HUMAN	hematopoietic SH2 domain containing	148					negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of mitochondrial depolarization (GO:0051902)|positive regulation of signal transduction (GO:0009967)|T cell activation (GO:0042110)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(1)|kidney(1)|large_intestine(2)	4						AGTGGCCGAGGAAGCTGCCTG	0.617																																					p.E148Q		.											.	.	.	0			c.G442C						.						21.0	25.0	24.0					19																	16265269		1954	4091	6045	SO:0001583	missense	84941	exon7			GCCGAGGAAGCTG	AK027792	CCDS74304.1	19p13.12	2013-02-14				ENSG00000196684		"""SH2 domain containing"""	24920	protein-coding gene	gene with protein product		608349				11700021	Standard	NM_032855		Approved	ALX, HSH2, FLJ14886	uc002ndp.4	Q96JZ2		ENST00000253680.6:c.442G>C	19.37:g.16265269G>C	ENSP00000253680:p.Glu148Gln	34.0	0.0		33.0	10.0	NM_032855	B5ME72|Q6ZNG7	Missense_Mutation	SNP	ENST00000253680.6	37		.	.	.	.	.	.	.	.	.	.	G	11.93	1.786974	0.31593	.	.	ENSG00000196684	ENST00000397372;ENST00000253680	T	0.48201	0.82	3.97	2.94	0.34122	.	1.229700	0.05981	N	0.644185	T	0.39517	0.1081	L	0.42245	1.32	0.09310	N	1	P;P	0.39883	0.693;0.567	B;B	0.35931	0.214;0.086	T	0.31586	-0.9938	10	0.45353	T	0.12	.	7.2638	0.26217	0.1178:0.0:0.8822:0.0	.	91;148	Q96JZ2-2;Q96JZ2	.;HSH2D_HUMAN	Q	59;148	ENSP00000253680:E148Q	ENSP00000253680:E148Q	E	+	1	0	HSH2D	16126269	0.791000	0.28800	0.027000	0.17364	0.034000	0.12701	2.273000	0.43381	1.278000	0.44430	0.591000	0.81541	GAA	.		0.617	HSH2D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_032855	
IL10RA	3587	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	117869720	117869720	+	Silent	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr11:117869720C>T	ENST00000227752.3	+	7	1221	c.1101C>T	c.(1099-1101)agC>agT	p.S367S	IL10RA_ENST00000545409.1_Silent_p.S218S|IL10RA_ENST00000541785.1_Silent_p.S347S|IL10RA_ENST00000533700.1_3'UTR	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	367					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		GCAGCAATAGCACAGACAGCG	0.652																																					p.S367S		.											.	IL10RA	91	0			c.C1101T						.						29.0	31.0	31.0					11																	117869720		2200	4296	6496	SO:0001819	synonymous_variant	3587	exon7			CAATAGCACAGAC	U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.1101C>T	11.37:g.117869720C>T		54.0	0.0		38.0	9.0	NM_001558	A8K6I0|B0YJ27	Silent	SNP	ENST00000227752.3	37	CCDS8388.1																																																																																			.		0.652	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390167.1		
IL12A	3592	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	159710887	159710887	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr3:159710887C>T	ENST00000305579.2	+	3	660	c.353C>T	c.(352-354)gCc>gTc	p.A118V	IL12A-AS1_ENST00000497452.1_RNA|IL12A_ENST00000466512.1_Missense_Mutation_p.A118V|IL12A_ENST00000480787.1_Intron	NM_000882.3	NP_000873.2	P29459	IL12A_HUMAN	interleukin 12A	84					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cell adhesion (GO:0045785)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|response to lipopolysaccharide (GO:0032496)|response to UV-B (GO:0010224)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)	interleukin-12 beta subunit binding (GO:0042163)|interleukin-12 receptor binding (GO:0005143)|interleukin-27 binding (GO:0045513)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)	9			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			ACAGTGGAGGCCTGTTTACCA	0.378																																					p.A118V		.											.	IL12A	90	0			c.C353T						.						81.0	89.0	86.0					3																	159710887		2203	4300	6503	SO:0001583	missense	3592	exon3			TGGAGGCCTGTTT	M65271	CCDS3187.1	3q25.33	2014-04-04	2014-04-04		ENSG00000168811	ENSG00000168811		"""Interleukins and interleukin receptors"""	5969	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor 1, 35 kD subunit"", ""cytotoxic lymphocyte maturation factor 1, p35"", ""interleukin 12, p35"", ""IL-12, subunit p35"", ""NF cell stimulatory factor chain 1"", ""interleukin-12 alpha chain"", ""IL35 subunit"""	161560	"""interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)"""	NKSF1		1673147	Standard	NM_000882		Approved	CLMF, IL-12A, p35, NFSK	uc003fcx.3	P29459	OTTHUMG00000158942	ENST00000305579.2:c.353C>T	3.37:g.159710887C>T	ENSP00000303231:p.Ala118Val	85.0	0.0		89.0	17.0	NM_000882	Q96QZ1	Missense_Mutation	SNP	ENST00000305579.2	37	CCDS3187.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.982038	0.53827	.	.	ENSG00000168811	ENST00000305579;ENST00000466512	.	.	.	5.66	4.76	0.60689	.	0.292876	0.37623	N	0.002019	T	0.70193	0.3196	M	0.78801	2.425	0.30689	N	0.751493	D	0.89917	1.0	D	0.87578	0.998	T	0.69595	-0.5103	9	0.38643	T	0.18	-12.8423	12.1144	0.53858	0.17:0.83:0.0:0.0	.	118	O60595	.	V	118	.	ENSP00000303231:A118V	A	+	2	0	IL12A	161193581	1.000000	0.71417	0.996000	0.52242	0.393000	0.30537	1.790000	0.38734	2.665000	0.90641	0.563000	0.77884	GCC	.		0.378	IL12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352602.2	NM_000882	
JAM3	83700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	134014256	134014256	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr11:134014256T>C	ENST00000299106.4	+	4	536	c.377T>C	c.(376-378)aTt>aCt	p.I126T	JAM3_ENST00000441717.3_Intron|JAM3_ENST00000524969.1_3'UTR|JAM3_ENST00000529443.2_Missense_Mutation_p.I171T			Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3	126	Ig-like V-type.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|establishment of cell polarity (GO:0030010)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|myelination (GO:0042552)|myeloid progenitor cell differentiation (GO:0002318)|neutrophil homeostasis (GO:0001780)|regulation of actin cytoskeleton organization by cell-cell adhesion (GO:0090138)|regulation of neutrophil chemotaxis (GO:0090022)|spermatid development (GO:0007286)|transmission of nerve impulse (GO:0019226)	cell-cell contact zone (GO:0044291)|desmosome (GO:0030057)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	integrin binding (GO:0005178)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)	10	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		CGCAAGGAAATTGATGAGATT	0.473																																					p.I126T		.											.	JAM3	91	0			c.T377C						.						186.0	152.0	163.0					11																	134014256		2201	4297	6498	SO:0001583	missense	83700	exon4			AGGAAATTGATGA	AF356518	CCDS8494.1, CCDS55799.1, CCDS8494.2	11q25	2013-01-29			ENSG00000166086	ENSG00000166086		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15532	protein-coding gene	gene with protein product		606871					Standard	NM_032801		Approved	JAM-C, JAMC	uc001qhb.3	Q9BX67	OTTHUMG00000167130	ENST00000299106.4:c.377T>C	11.37:g.134014256T>C	ENSP00000299106:p.Ile126Thr	65.0	0.0		64.0	7.0	NM_032801	B3KWG9|Q8WWL8|Q96FL1	Missense_Mutation	SNP	ENST00000299106.4	37	CCDS8494.2	.	.	.	.	.	.	.	.	.	.	T	16.22	3.061268	0.55432	.	.	ENSG00000166086	ENST00000299106	.	.	.	5.03	5.03	0.67393	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.326123	0.32372	N	0.006189	T	0.33904	0.0879	L	0.51422	1.61	0.27547	N	0.950611	P	0.40731	0.728	B	0.37833	0.259	T	0.21655	-1.0239	9	0.19590	T	0.45	.	10.2363	0.43286	0.0:0.0:0.1659:0.8341	.	126	Q9BX67	JAM3_HUMAN	T	171	.	ENSP00000299106:I171T	I	+	2	0	JAM3	133519466	0.986000	0.35501	1.000000	0.80357	0.856000	0.48823	3.980000	0.56895	1.905000	0.55150	0.459000	0.35465	ATT	.		0.473	JAM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393303.4	NM_032801	
KCNG2	26251	broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	77659126	77659126	+	Silent	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr18:77659126C>T	ENST00000316249.3	+	2	711	c.711C>T	c.(709-711)tcC>tcT	p.S237S	KCNG2_ENST00000590307.1_3'UTR	NM_012283.1	NP_036415.1	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G, member 2	237					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(2)|endometrium(4)|lung(7)|skin(1)|upper_aerodigestive_tract(4)	18		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		TGCTGCGCTCCCTGCAGGCCG	0.667																																					p.S237S		.											.	KCNG2	90	0			c.C711T						.						49.0	41.0	43.0					18																	77659126		2203	4300	6503	SO:0001819	synonymous_variant	26251	exon2			GCGCTCCCTGCAG	AJ011021	CCDS12019.1	18q23	2011-07-05			ENSG00000178342	ENSG00000178342		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6249	protein-coding gene	gene with protein product		605696				10551266, 16382104	Standard	NM_012283		Approved	Kv6.2, KCNF2	uc010xfl.2	Q9UJ96	OTTHUMG00000044541	ENST00000316249.3:c.711C>T	18.37:g.77659126C>T		32.0	0.0		26.0	6.0	NM_012283		Silent	SNP	ENST00000316249.3	37	CCDS12019.1																																																																																			.		0.667	KCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103906.1	NM_012283	
KCNN1	3780	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	18092581	18092581	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr19:18092581C>A	ENST00000222249.9	+	5	881	c.562C>A	c.(562-564)Ctc>Atc	p.L188I		NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	188					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	GCGCGTGTTCCTCATCTCGCT	0.662																																					p.L188I		.											.	KCNN1	22	0			c.C562A						.																																			SO:0001583	missense	3780	exon5			GTGTTCCTCATCT	U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.562C>A	19.37:g.18092581C>A	ENSP00000476519:p.Leu188Ile	74.0	0.0		63.0	9.0	NM_002248	Q5KR10|Q6DJU4	Missense_Mutation	SNP	ENST00000222249.9	37		.	.	.	.	.	.	.	.	.	.	C	9.670	1.146542	0.21288	.	.	ENSG00000105642	ENST00000222249;ENST00000536713	.	.	.	5.04	1.48	0.22813	Potassium channel, calcium-activated, SK, conserved region (1);	0.122701	0.56097	D	0.000040	T	0.36963	0.0986	L	0.59436	1.845	0.28031	N	0.934136	B	0.10296	0.003	B	0.21151	0.033	T	0.19224	-1.0312	9	0.22706	T	0.39	-16.4959	5.3444	0.16000	0.0:0.4808:0.0:0.5192	.	188	Q92952	KCNN1_HUMAN	I	205;188	.	ENSP00000222249:L205I	L	+	1	0	KCNN1	17953581	1.000000	0.71417	0.440000	0.26846	0.427000	0.31564	3.900000	0.56295	0.539000	0.28788	0.561000	0.74099	CTC	.		0.662	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248	
KIAA0319L	79932	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	35921730	35921730	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr1:35921730T>C	ENST00000325722.3	-	10	1774	c.1540A>G	c.(1540-1542)Acc>Gcc	p.T514A	KIAA0319L_ENST00000485551.1_5'UTR|KIAA0319L_ENST00000373266.4_5'Flank	NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	514	PKD 3. {ECO:0000255|PROSITE- ProRule:PRU00151}.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TGGGGCAGGGTGATCACTTGG	0.532																																					p.T514A		.											.	KIAA0319L	92	0			c.A1540G						.						203.0	199.0	200.0					1																	35921730		2203	4300	6503	SO:0001583	missense	79932	exon10			GCAGGGTGATCAC	AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.1540A>G	1.37:g.35921730T>C	ENSP00000318406:p.Thr514Ala	139.0	0.0		120.0	16.0	NM_024874	B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Missense_Mutation	SNP	ENST00000325722.3	37	CCDS390.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.023903	0.75390	.	.	ENSG00000142687	ENST00000325722;ENST00000426982;ENST00000440579	T;T;T	0.13196	2.61;2.61;2.61	5.59	5.59	0.84812	PKD/Chitinase domain (1);Fibronectin, type III (1);PKD/REJ-like protein (1);PKD domain (2);	0.107592	0.64402	D	0.000009	T	0.36386	0.0965	M	0.80332	2.49	0.80722	D	1	D;P	0.67145	0.996;0.924	P;P	0.61800	0.894;0.777	T	0.13335	-1.0513	10	0.42905	T	0.14	-12.8938	14.9413	0.70994	0.0:0.0:0.0:1.0	.	514;514	Q8IZA0-2;Q8IZA0	.;K319L_HUMAN	A	514	ENSP00000318406:T514A;ENSP00000395883:T514A;ENSP00000407576:T514A	ENSP00000318406:T514A	T	-	1	0	KIAA0319L	35694317	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.366000	0.73095	2.129000	0.65627	0.528000	0.53228	ACC	.		0.532	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012684.2	NM_024874	
KIF26B	55083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	245849634	245849634	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr1:245849634G>A	ENST00000407071.2	+	12	3789	c.3349G>A	c.(3349-3351)Gag>Aag	p.E1117K	KIF26B_ENST00000366518.4_Missense_Mutation_p.E736K	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1117					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GGCGTCTAGGGAGTCCTTGCT	0.617																																					p.E1117K		.											.	KIF26B	25	0			c.G3349A						.						72.0	80.0	77.0					1																	245849634		1942	4144	6086	SO:0001583	missense	55083	exon12			TCTAGGGAGTCCT	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.3349G>A	1.37:g.245849634G>A	ENSP00000385545:p.Glu1117Lys	58.0	0.0		74.0	8.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	37	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	G	13.79	2.340931	0.41498	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.78707	-1.2;-1.19	5.76	5.76	0.90799	.	.	.	.	.	T	0.79787	0.4506	M	0.77103	2.36	0.58432	D	0.999992	B;B	0.25719	0.06;0.132	B;B	0.18263	0.017;0.021	T	0.76277	-0.3018	9	0.46703	T	0.11	.	19.9554	0.97216	0.0:0.0:1.0:0.0	.	736;1117	B7WPD9;Q2KJY2	.;KI26B_HUMAN	K	1117;736;733	ENSP00000385545:E1117K;ENSP00000355475:E736K	ENSP00000355475:E736K	E	+	1	0	KIF26B	243916257	1.000000	0.71417	0.962000	0.40283	0.214000	0.24535	7.132000	0.77251	2.735000	0.93741	0.549000	0.68633	GAG	.		0.617	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
LAMA1	284217	broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	6955380	6955380	+	Missense_Mutation	SNP	G	G	A	rs550959766	byFrequency	TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr18:6955380G>A	ENST00000389658.3	-	57	8272	c.8179C>T	c.(8179-8181)Cct>Tct	p.P2727S	RP11-781P6.1_ENST00000584722.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2727	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				TGATTAAAAGGCAAGATGAAA	0.488																																					p.P2727S		.											.	LAMA1	149	0			c.C8179T						.						88.0	69.0	75.0					18																	6955380		2203	4300	6503	SO:0001583	missense	284217	exon57			TAAAAGGCAAGAT	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.8179C>T	18.37:g.6955380G>A	ENSP00000374309:p.Pro2727Ser	55.0	0.0		58.0	8.0	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	G	5.831	0.337621	0.11013	.	.	ENSG00000101680	ENST00000389658	T	0.70282	-0.47	5.32	3.52	0.40303	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.285769	0.33753	N	0.004594	T	0.59376	0.2189	L	0.56769	1.78	0.27235	N	0.959291	B;B	0.31790	0.34;0.331	B;B	0.24848	0.047;0.056	T	0.46303	-0.9201	10	0.09843	T	0.71	.	10.7691	0.46312	0.0714:0.1321:0.7965:0.0	.	2727;57	P25391;B3KSD8	LAMA1_HUMAN;.	S	2727	ENSP00000374309:P2727S	ENSP00000374309:P2727S	P	-	1	0	LAMA1	6945380	0.929000	0.31497	0.067000	0.19924	0.049000	0.14656	2.203000	0.42752	0.624000	0.30286	0.563000	0.77884	CCT	.		0.488	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
LAMB1	3912	broad.mit.edu;ucsc.edu;mdanderson.org	37	7	107616134	107616134	+	Splice_Site	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr7:107616134G>A	ENST00000222399.6	-	10	1419	c.1189C>T	c.(1189-1191)Cga>Tga	p.R397*	LAMB1_ENST00000393561.1_Splice_Site_p.R421*|LAMB1_ENST00000393560.1_Splice_Site_p.R397*	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	397	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CTCAACATACGTTCACAGAAA	0.478																																					p.R397X		.											.	LAMB1	97	0			c.C1189T						.						132.0	129.0	130.0					7																	107616134		2203	4300	6503	SO:0001630	splice_region_variant	3912	exon10			ACATACGTTCACA	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.1189+1C>T	7.37:g.107616134G>A		70.0	1.0		66.0	12.0	NM_002291	Q14D91	Nonsense_Mutation	SNP	ENST00000222399.6	37	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	G	39	7.828110	0.98513	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	.	.	.	5.23	3.33	0.38152	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2976	0.60307	0.0:0.1294:0.7511:0.1195	.	.	.	.	X	421;397;397	.	.	R	-	1	2	LAMB1	107403370	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	3.448000	0.52943	1.409000	0.46915	0.655000	0.94253	CGA	.		0.478	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	Nonsense_Mutation
LARP1B	55132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	128999091	128999091	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr4:128999091C>G	ENST00000326639.6	+	4	402	c.191C>G	c.(190-192)gCt>gGt	p.A64G	LARP1B_ENST00000441387.1_Missense_Mutation_p.A64G|LARP1B_ENST00000512292.1_Missense_Mutation_p.A64G|LARP1B_ENST00000354456.3_5'UTR|LARP1B_ENST00000427266.1_Missense_Mutation_p.A64G|LARP1B_ENST00000394288.3_Missense_Mutation_p.A64G|LARP1B_ENST00000432347.2_Missense_Mutation_p.A64G|LARP1B_ENST00000264584.5_Missense_Mutation_p.A64G	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	64						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						GAGGATGAGGCTCAGTCAAGT	0.348																																					p.A64G		.											.	LARP1B	68	0			c.C191G						.						124.0	118.0	120.0					4																	128999091		2203	4300	6503	SO:0001583	missense	55132	exon4			ATGAGGCTCAGTC		CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.191C>G	4.37:g.128999091C>G	ENSP00000321997:p.Ala64Gly	302.0	0.0		289.0	48.0	NM_032239	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Missense_Mutation	SNP	ENST00000326639.6	37	CCDS3738.1	.	.	.	.	.	.	.	.	.	.	C	9.196	1.027280	0.19512	.	.	ENSG00000138709	ENST00000326639;ENST00000512292;ENST00000508819;ENST00000394288;ENST00000432347;ENST00000264584;ENST00000441387;ENST00000427266	T;T;T;T;T;T;T;T	0.47869	1.89;1.48;1.44;0.85;0.83;1.86;1.86;1.47	3.88	3.88	0.44766	.	0.217137	0.38778	N	0.001578	T	0.33556	0.0867	L	0.31664	0.95	0.80722	D	1	B;B;B;B	0.14805	0.003;0.005;0.005;0.011	B;B;B;B	0.16722	0.004;0.01;0.006;0.016	T	0.10965	-1.0607	10	0.22706	T	0.39	.	11.3929	0.49825	0.0:0.8165:0.1835:0.0	.	64;64;64;64	Q659C4;G3XAJ5;Q659C4-3;G3V0E9	LAR1B_HUMAN;.;.;.	G	64	ENSP00000321997:A64G;ENSP00000422850:A64G;ENSP00000427281:A64G;ENSP00000377829:A64G;ENSP00000390395:A64G;ENSP00000264584:A64G;ENSP00000396521:A64G;ENSP00000403586:A64G	ENSP00000264584:A64G	A	+	2	0	LARP1B	129218541	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	1.745000	0.38278	2.176000	0.68965	0.289000	0.19496	GCT	.		0.348	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257173.2	NM_018078	
LRRC69	100130742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	92114976	92114976	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr8:92114976G>A	ENST00000448384.2	+	1	87	c.87G>A	c.(85-87)atG>atA	p.M29I	LRRC69_ENST00000343709.3_Missense_Mutation_p.M29I	NM_001129890.1	NP_001123362.1	Q6ZNQ3	LRC69_HUMAN	leucine rich repeat containing 69	29										endometrium(1)	1						TGACAAAGATGCCCTCAGCAT	0.408																																					p.M29I		.											.	.	.	0			c.G87A						.						155.0	125.0	134.0					8																	92114976		692	1591	2283	SO:0001583	missense	100130742	exon1			AAAGATGCCCTCA	AK130865		8q21.3	2010-07-14			ENSG00000214954	ENSG00000214954			34303	protein-coding gene	gene with protein product							Standard	NM_001129890		Approved		uc010mal.1	Q6ZNQ3	OTTHUMG00000164023	ENST00000448384.2:c.87G>A	8.37:g.92114976G>A	ENSP00000400803:p.Met29Ile	102.0	0.0		106.0	24.0	NM_001129890		Missense_Mutation	SNP	ENST00000448384.2	37		.	.	.	.	.	.	.	.	.	.	G	7.060	0.566229	0.13560	.	.	ENSG00000214954	ENST00000518304;ENST00000343709;ENST00000448384	T;T	0.35048	1.33;2.26	5.11	4.23	0.50019	.	0.254057	0.24544	U	0.037620	T	0.17874	0.0429	N	0.08118	0	0.27177	N	0.960757	B;B	0.14438	0.01;0.002	B;B	0.12156	0.007;0.002	T	0.14531	-1.0469	10	0.21540	T	0.41	-19.4923	9.6682	0.39996	0.0938:0.0:0.9062:0.0	.	29;29	Q6ZNQ3;Q6ZNQ3-2	LRC69_HUMAN;.	I	29	ENSP00000343221:M29I;ENSP00000400803:M29I	ENSP00000343221:M29I	M	+	3	0	LRRC69	92184152	1.000000	0.71417	1.000000	0.80357	0.469000	0.32828	2.713000	0.47194	1.529000	0.49120	0.655000	0.94253	ATG	.		0.408	LRRC69-007	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000415207.1	NM_001129890	
LSG1	55341	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	194371616	194371616	+	Silent	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr3:194371616T>C	ENST00000265245.5	-	10	1727	c.1413A>G	c.(1411-1413)gtA>gtG	p.V471V	AC046143.2_ENST00000582474.1_RNA	NM_018385.2	NP_060855.2	Q9H089	LSG1_HUMAN	large 60S subunit nuclear export GTPase 1	471					GTP catabolic process (GO:0006184)|nuclear export (GO:0051168)|protein transport (GO:0015031)|ribosome biogenesis (GO:0042254)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)	16	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		ATATTAGTGATACAGGAGGAA	0.423																																					p.V471V		.											.	LSG1	90	0			c.A1413G						.						98.0	96.0	97.0					3																	194371616		2203	4300	6503	SO:0001819	synonymous_variant	55341	exon10			TAGTGATACAGGA		CCDS33922.1	3q29	2013-08-21	2013-08-21		ENSG00000041802	ENSG00000041802			25652	protein-coding gene	gene with protein product		610780	"""large subunit GTPase 1 homolog (S. cerevisiae)"""			11230166	Standard	NM_018385		Approved	FLJ11301	uc003fui.3	Q9H089	OTTHUMG00000156021	ENST00000265245.5:c.1413A>G	3.37:g.194371616T>C		41.0	0.0		75.0	9.0	NM_018385	A0JLT4|A0PJK3|A6NI18|Q7L9H8|Q9NUK8	Silent	SNP	ENST00000265245.5	37	CCDS33922.1	.	.	.	.	.	.	.	.	.	.	T	0.084	-1.179348	0.01633	.	.	ENSG00000041802	ENST00000437613	.	.	.	5.63	-7.4	0.01397	.	.	.	.	.	T	0.44808	0.1311	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49513	-0.8932	4	.	.	.	.	6.0885	0.19980	0.1141:0.4991:0.1511:0.2358	.	.	.	.	C	205	.	.	Y	-	2	0	LSG1	195852905	0.963000	0.33076	0.001000	0.08648	0.029000	0.11900	0.026000	0.13599	-1.098000	0.03038	-0.899000	0.02877	TAT	.		0.423	LSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342740.1	NM_018385	
MDM1	56890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	68719226	68719226	+	Missense_Mutation	SNP	T	T	C	rs374381882		TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr12:68719226T>C	ENST00000303145.7	-	4	714	c.628A>G	c.(628-630)Aat>Gat	p.N210D	MDM1_ENST00000540418.1_5'UTR|MDM1_ENST00000411698.2_Intron|MDM1_ENST00000430606.2_3'UTR|MDM1_ENST00000545724.1_5'UTR|MDM1_ENST00000393543.3_3'UTR	NM_017440.4	NP_059136.2	Q8TC05	MDM1_HUMAN	Mdm1 nuclear protein homolog (mouse)	210					retina development in camera-type eye (GO:0060041)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(7)	33			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		GCTACCTGATTGGCTGCAAAA	0.323																																					p.N210D		.											.	MDM1	95	0			c.A628G						.	T	,,,ASP/ASN	1,4405	2.1+/-5.4	0,1,2202	118.0	130.0	126.0		,,,628	1.1	1.0	12		126	0,8600		0,0,4300	no	intron,utr-3,utr-3,missense	MDM1	NM_001205028.1,NM_001205029.1,NM_020128.2,NM_017440.4	,,,23	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	,,,benign	,,,210/715	68719226	1,13005	2203	4300	6503	SO:0001583	missense	56890	exon4			CCTGATTGGCTGC	AF007130	CCDS8983.1, CCDS44938.1, CCDS55841.1, CCDS55842.1	12q15	2008-04-14	2008-04-14			ENSG00000111554			29917	protein-coding gene	gene with protein product		613813	"""Mdm4, transformed 3T3 cell double minute 1, p53 binding protein (mouse)"""			8619474, 9110174	Standard	NM_017440		Approved		uc001stz.2	Q8TC05		ENST00000303145.7:c.628A>G	12.37:g.68719226T>C	ENSP00000302537:p.Asn210Asp	122.0	0.0		130.0	16.0	NM_017440	B4DM65|E7EPQ3|O43406|Q8WTV9|Q9NR04	Missense_Mutation	SNP	ENST00000303145.7	37	CCDS8983.1	.	.	.	.	.	.	.	.	.	.	T	9.255	1.041623	0.19748	2.27E-4	0.0	ENSG00000111554	ENST00000303145;ENST00000541686	T;T	0.20463	2.07;2.07	5.29	1.12	0.20585	.	0.499339	0.22696	N	0.056747	T	0.12774	0.0310	L	0.39898	1.24	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.12502	-1.0545	9	.	.	.	-7.1741	3.6246	0.08108	0.0:0.2096:0.4986:0.2918	.	210	Q8TC05	MDM1_HUMAN	D	210;205	ENSP00000302537:N210D;ENSP00000446000:N205D	.	N	-	1	0	MDM1	67005493	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.482000	0.35486	0.384000	0.24942	0.459000	0.35465	AAT	.		0.323	MDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402402.1	NM_020128	
MEF2D	4209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156450690	156450690	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr1:156450690G>C	ENST00000348159.4	-	4	812	c.332C>G	c.(331-333)cCc>cGc	p.P111R	MEF2D_ENST00000464356.2_Intron|MEF2D_ENST00000353795.3_Intron|MEF2D_ENST00000360595.3_Missense_Mutation_p.P111R|MEF2D_ENST00000368240.2_Missense_Mutation_p.P111R|MEF2D_ENST00000340875.5_Intron	NM_005920.2	NP_005911.1	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	111					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|chondrocyte differentiation (GO:0002062)|endochondral ossification (GO:0001958)|muscle organ development (GO:0007517)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|histone deacetylase binding (GO:0042826)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	15	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTCCAGCAGGGGGCTCTGTTC	0.667											OREG0013874	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P111R		.											.	MEF2D	659	0			c.C332G						.						69.0	77.0	74.0					1																	156450690		2203	4300	6503	SO:0001583	missense	4209	exon4			AGCAGGGGGCTCT	BC054520	CCDS1143.1, CCDS60304.1	1q12-q23	2008-02-05	2007-04-24		ENSG00000116604	ENSG00000116604		"""Myocyte enhancer factors"""	6997	protein-coding gene	gene with protein product		600663				8269842	Standard	NM_005920		Approved		uc001fpb.4	Q14814	OTTHUMG00000033095	ENST00000348159.4:c.332C>G	1.37:g.156450690G>C	ENSP00000271555:p.Pro111Arg	45.0	0.0	1778	51.0	7.0	NM_005920	D3DVC0|Q14815|Q5T9U5|Q5T9U6	Missense_Mutation	SNP	ENST00000348159.4	37	CCDS1143.1	.	.	.	.	.	.	.	.	.	.	G	32	5.113501	0.94339	.	.	ENSG00000116604	ENST00000348159;ENST00000368240;ENST00000360595;ENST00000541336	T;T;T	0.68181	-0.31;-0.31;-0.31	5.08	5.08	0.68730	Holliday junction regulator protein family C-terminal repeat (1);	0.048511	0.85682	D	0.000000	T	0.80681	0.4669	M	0.85859	2.78	0.80722	D	1	D;D;P	0.62365	0.98;0.991;0.749	P;D;P	0.66716	0.876;0.946;0.856	D	0.83901	0.0290	10	0.87932	D	0	-21.1416	17.4126	0.87491	0.0:0.0:1.0:0.0	.	116;111;111	Q4LE66;Q14814;Q14814-4	.;MEF2D_HUMAN;.	R	111	ENSP00000271555:P111R;ENSP00000357223:P111R;ENSP00000353803:P111R	ENSP00000271555:P111R	P	-	2	0	MEF2D	154717314	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.466000	0.80914	2.529000	0.85273	0.561000	0.74099	CCC	.		0.667	MEF2D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080562.2	NM_005920	
MUC17	140453	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	100695190	100695191	+	Frame_Shift_Ins	INS	-	-	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr7:100695190_100695191insA	ENST00000306151.4	+	9	13114_13115	c.13050_13051insA	c.(13051-13053)aagfs	p.K4351fs		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4351					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TCAGTGTCTCCAAGAACTGTAA	0.574																																					p.S4350fs		.											.	MUC17	95	0			c.13050_13051insA						.																																			SO:0001589	frameshift_variant	140453	exon9			TGTCTCCAAGAAC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.13052dupA	7.37:g.100695192_100695192dupA	ENSP00000302716:p.Lys4351fs	93.0	0.0		114.0	15.0	NM_001040105	O14761|Q685J2|Q8TDH7	Frame_Shift_Ins	INS	ENST00000306151.4	37	CCDS34711.1																																																																																			.		0.574	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC17	140453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100683668	100683668	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr7:100683668A>T	ENST00000306151.4	+	3	9035	c.8971A>T	c.(8971-8973)Agt>Tgt	p.S2991C		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2991	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TCCATTAACAAGTATGTCTGT	0.507																																					p.S2991C		.											.	MUC17	95	0			c.A8971T						.						242.0	252.0	249.0					7																	100683668		2203	4300	6503	SO:0001583	missense	140453	exon3			TTAACAAGTATGT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8971A>T	7.37:g.100683668A>T	ENSP00000302716:p.Ser2991Cys	58.0	0.0		66.0	11.0	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	A	6.492	0.458991	0.12342	.	.	ENSG00000169876	ENST00000306151	T	0.02032	4.49	0.513	-0.665	0.11403	.	.	.	.	.	T	0.01940	0.0061	N	0.14661	0.345	0.09310	N	1	D	0.62365	0.991	P	0.49477	0.612	T	0.48490	-0.9031	9	0.38643	T	0.18	.	3.7701	0.08637	0.6255:0.0:0.3745:0.0	.	2991	Q685J3	MUC17_HUMAN	C	2991	ENSP00000302716:S2991C	ENSP00000302716:S2991C	S	+	1	0	MUC17	100470388	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-0.252000	0.08806	-0.290000	0.09025	0.102000	0.15555	AGT	.		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MYCBP2	23077	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	13	77750664	77750664	+	Nonsense_Mutation	SNP	C	C	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr13:77750664C>A	ENST00000544440.2	-	36	5343	c.5326G>T	c.(5326-5328)Gag>Tag	p.E1776*	MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000407578.2_Nonsense_Mutation_p.E1814*|MYCBP2_ENST00000357337.6_Nonsense_Mutation_p.E1776*					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AGTCTGATCTCAGCTATATCA	0.378																																					p.E1814X		.											.	MYCBP2	236	0			c.G5440T						.						158.0	135.0	143.0					13																	77750664		2203	4300	6503	SO:0001587	stop_gained	23077	exon36			TGATCTCAGCTAT	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.5326G>T	13.37:g.77750664C>A	ENSP00000444596:p.Glu1776*	93.0	0.0		93.0	15.0	NM_015057		Nonsense_Mutation	SNP	ENST00000544440.2	37		.	.	.	.	.	.	.	.	.	.	C	46	12.823792	0.99699	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.0877	0.93212	0.0:1.0:0.0:0.0	.	.	.	.	X	1776;1814;1776	.	ENSP00000349892:E1776X	E	-	1	0	MYCBP2	76648665	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.593000	0.87608	0.655000	0.94253	GAG	.		0.378	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
MYO3A	53904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	26457744	26457744	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr10:26457744C>T	ENST00000265944.5	+	28	3381	c.3215C>T	c.(3214-3216)tCa>tTa	p.S1072L	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1072	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TTCTTGTGTTCAAGAAGATAC	0.328																																					p.S1072L		.											.	MYO3A	1007	0			c.C3215T						.						119.0	121.0	120.0					10																	26457744		2203	4300	6503	SO:0001583	missense	53904	exon28			TGTGTTCAAGAAG	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3215C>T	10.37:g.26457744C>T	ENSP00000265944:p.Ser1072Leu	83.0	0.0		85.0	14.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.483989	0.44147	.	.	ENSG00000095777	ENST00000265944	T	0.70749	-0.51	5.63	5.63	0.86233	.	0.270481	0.36778	N	0.002406	T	0.57519	0.2059	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.49606	-0.8922	10	0.27785	T	0.31	.	20.0499	0.97621	0.0:1.0:0.0:0.0	.	1072	Q8NEV4	MYO3A_HUMAN	L	1072	ENSP00000265944:S1072L	ENSP00000265944:S1072L	S	+	2	0	MYO3A	26497750	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.172000	0.58243	2.798000	0.96311	0.655000	0.94253	TCA	.		0.328	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
NAP1L2	4674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	72433658	72433658	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chrX:72433658A>G	ENST00000373517.3	-	1	1026	c.671T>C	c.(670-672)aTt>aCt	p.I224T	NAP1L2_ENST00000536638.1_Missense_Mutation_p.I82T	NM_021963.3	NP_068798.1	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	224	Glu-rich (acidic).				nucleosome assembly (GO:0006334)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of neuron differentiation (GO:0045666)|regulation of stem cell division (GO:2000035)	nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(12)|skin(3)	29	Renal(35;0.156)					AGTAGCCTCAATGTCGtcctc	0.423																																					p.I224T		.											.	NAP1L2	130	0			c.T671C						.						70.0	54.0	59.0					X																	72433658		2203	4300	6503	SO:0001583	missense	4674	exon1			GCCTCAATGTCGT	AF136178	CCDS14423.1	Xq13	2008-02-05			ENSG00000186462	ENSG00000186462			7638	protein-coding gene	gene with protein product		300026				8789438	Standard	NM_021963		Approved	BPX, MGC26243	uc004ebi.3	Q9ULW6	OTTHUMG00000021827	ENST00000373517.3:c.671T>C	X.37:g.72433658A>G	ENSP00000362616:p.Ile224Thr	52.0	0.0		98.0	14.0	NM_021963	B2RE61|B4E161|Q8TAN6	Missense_Mutation	SNP	ENST00000373517.3	37	CCDS14423.1	.	.	.	.	.	.	.	.	.	.	a	0.004	-2.329258	0.00229	.	.	ENSG00000186462	ENST00000373517;ENST00000536638	T;T	0.40225	1.04;1.04	3.01	-5.44	0.02624	.	.	.	.	.	T	0.13586	0.0329	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30268	-0.9984	9	0.14252	T	0.57	0.1061	7.0647	0.25145	0.3014:0.1413:0.5572:0.0	.	224	Q9ULW6	NP1L2_HUMAN	T	224;82	ENSP00000362616:I224T;ENSP00000441555:I82T	ENSP00000362616:I224T	I	-	2	0	NAP1L2	72350383	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	-2.003000	0.01463	-1.573000	0.01659	-0.453000	0.05500	ATT	.		0.423	NAP1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057225.1	NM_021963	
NEMF	9147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	50251848	50251848	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr14:50251848T>G	ENST00000298310.5	-	31	3484	c.3035A>C	c.(3034-3036)aAa>aCa	p.K1012T	NEMF_ENST00000556925.1_5'UTR|NEMF_ENST00000545773.1_Missense_Mutation_p.K970T|NEMF_ENST00000546046.1_Missense_Mutation_p.K991T|NEMF_ENST00000382135.2_Missense_Mutation_p.K212T			O60524	NEMF_HUMAN	nuclear export mediator factor	1012					nuclear export (GO:0051168)	nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						AAGTTTCACTTTATATCTTTA	0.284																																					p.K1012T		.											.	NEMF	90	0			c.A3035C						.						49.0	50.0	50.0					14																	50251848		2202	4300	6502	SO:0001583	missense	9147	exon31			TTCACTTTATATC	AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.3035A>C	14.37:g.50251848T>G	ENSP00000298310:p.Lys1012Thr	79.0	0.0		86.0	21.0	NM_004713	A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Missense_Mutation	SNP	ENST00000298310.5	37	CCDS9694.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.053969	0.75960	.	.	ENSG00000165525	ENST00000298310;ENST00000545773;ENST00000382135;ENST00000546046;ENST00000555970	T;T;T;T	0.59772	0.26;0.26;0.24;0.31	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.81293	0.4792	M	0.91354	3.2	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.998;0.999	D	0.85741	0.1337	10	0.87932	D	0	-26.1922	16.1277	0.81406	0.0:0.0:0.0:1.0	.	991;987;970;1012;212	O60524-3;O60524-5;O60524-4;O60524;O60524-2	.;.;.;NEMF_HUMAN;.	T	1012;970;212;991;970	ENSP00000298310:K1012T;ENSP00000438309:K970T;ENSP00000441016:K991T;ENSP00000452540:K970T	ENSP00000298310:K1012T	K	-	2	0	NEMF	49321598	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.153000	0.77428	2.273000	0.75805	0.482000	0.46254	AAA	.		0.284	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410798.1	NM_004713	
NKAIN4	128414	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	61880213	61880213	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr20:61880213T>C	ENST00000370316.3	-	3	316	c.227A>G	c.(226-228)aAc>aGc	p.N76S	NKAIN4_ENST00000370307.2_Missense_Mutation_p.N14S|NKAIN4_ENST00000370313.1_Missense_Mutation_p.N14S|NKAIN4_ENST00000466885.1_5'Flank	NM_152864.3	NP_690603.3	Q8IVV8	NKAI4_HUMAN	Na+/K+ transporting ATPase interacting 4	76						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|lung(1)|ovary(1)	4	all_cancers(38;2.72e-09)					GATGAAGACGTTCCAGGTGAC	0.632																																					p.N76S		.											.	NKAIN4	68	0			c.A227G						.						72.0	54.0	60.0					20																	61880213		2202	4300	6502	SO:0001583	missense	128414	exon3			AAGACGTTCCAGG	BC041812	CCDS13514.1	20q13.33	2007-10-04	2007-10-04	2007-10-04	ENSG00000101198	ENSG00000101198		"""Na+/K+ transporting ATPase interacting"""	16191	protein-coding gene	gene with protein product		612873	"""chromosome 20 open reading frame 58"""	C20orf58		17606467	Standard	NM_152864		Approved	bA261N11.2, FAM77A	uc002yek.3	Q8IVV8	OTTHUMG00000032959	ENST00000370316.3:c.227A>G	20.37:g.61880213T>C	ENSP00000359340:p.Asn76Ser	38.0	0.0		46.0	9.0	NM_152864	Q4VXQ6|Q9BQU8|Q9BQU9	Missense_Mutation	SNP	ENST00000370316.3	37	CCDS13514.1	.	.	.	.	.	.	.	.	.	.	T	15.90	2.968631	0.53614	.	.	ENSG00000101198	ENST00000370313;ENST00000370316;ENST00000370307;ENST00000370317	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	3.44	3.44	0.39384	.	0.000000	0.85682	U	0.000000	T	0.53594	0.1806	M	0.87758	2.905	0.43199	D	0.995042	D;D	0.89917	0.999;1.0	D;D	0.87578	0.998;0.998	T	0.61471	-0.7056	10	0.87932	D	0	-9.841	11.5998	0.50995	0.0:0.0:0.0:1.0	.	14;76	A6NNM2;Q8IVV8	.;NKAI4_HUMAN	S	14;76;14;6	ENSP00000359336:N14S;ENSP00000359340:N76S;ENSP00000359330:N14S;ENSP00000359341:N6S	ENSP00000359330:N14S	N	-	2	0	NKAIN4	61350658	1.000000	0.71417	0.816000	0.32577	0.316000	0.28119	6.682000	0.74528	1.201000	0.43203	0.260000	0.18958	AAC	.		0.632	NKAIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080117.3	NM_152864	
NOTCH3	4854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15292445	15292445	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr19:15292445A>T	ENST00000263388.2	-	17	2809	c.2734T>A	c.(2734-2736)Tgc>Agc	p.C912S		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	912	EGF-like 23; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CCTGGCGGGCAGGTGCAGGTG	0.692																																					p.C912S		.											.	NOTCH3	855	0			c.T2734A						.						16.0	13.0	14.0					19																	15292445		2111	4110	6221	SO:0001583	missense	4854	exon17			GCGGGCAGGTGCA	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.2734T>A	19.37:g.15292445A>T	ENSP00000263388:p.Cys912Ser	101.0	0.0		94.0	17.0	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.139544	0.77775	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.96619	-4.07	5.45	5.45	0.79879	EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.34879	N	0.003609	D	0.99004	0.9660	H	0.99249	4.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99044	1.0825	10	0.87932	D	0	.	14.4883	0.67631	1.0:0.0:0.0:0.0	.	863;912	Q59FL3;Q9UM47	.;NOTC3_HUMAN	S	912;862	ENSP00000263388:C912S	ENSP00000263388:C912S	C	-	1	0	NOTCH3	15153445	1.000000	0.71417	1.000000	0.80357	0.383000	0.30230	6.249000	0.72427	2.077000	0.62373	0.459000	0.35465	TGC	.		0.692	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
NOVA1	4857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	26949245	26949245	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr14:26949245T>C	ENST00000344429.5	-	3	388	c.385A>G	c.(385-387)Aag>Gag	p.K129E	NOVA1_ENST00000267422.7_Missense_Mutation_p.K7E|NOVA1_ENST00000465357.2_Missense_Mutation_p.K129E|NOVA1_ENST00000539517.2_Missense_Mutation_p.K129E|NOVA1_ENST00000574031.1_Missense_Mutation_p.K129E|NOVA1_ENST00000547619.1_Missense_Mutation_p.K129E	NM_006491.2	NP_006482.1	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	132					locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		GGTTCTGTCTTGGCCACATTT	0.438																																					p.K129E		.											.	NOVA1	229	0			c.A385G						.						206.0	171.0	183.0					14																	26949245		2203	4300	6503	SO:0001583	missense	4857	exon3			CTGTCTTGGCCAC	U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000344429.5:c.385A>G	14.37:g.26949245T>C	ENSP00000342387:p.Lys129Glu	104.0	0.0		85.0	14.0	NM_006489	A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Missense_Mutation	SNP	ENST00000344429.5	37	CCDS9635.1	.	.	.	.	.	.	.	.	.	.	T	33	5.234573	0.95207	.	.	ENSG00000139910	ENST00000465357;ENST00000539517;ENST00000267422;ENST00000449198;ENST00000347476;ENST00000549146;ENST00000549571;ENST00000344429;ENST00000547619	T;T;T;T;T;T;T;T;T	0.50277	1.35;1.44;1.37;1.46;1.44;0.81;0.94;0.77;0.75	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000002	T	0.60702	0.2289	L	0.39245	1.2	0.58432	D	0.999994	D;D;P;D	0.67145	0.992;0.996;0.956;0.974	D;D;P;D	0.69824	0.966;0.936;0.899;0.953	T	0.63769	-0.6562	10	0.87932	D	0	-21.9861	15.9798	0.80097	0.0:0.0:0.0:1.0	.	129;132;129;129	P51513-2;P51513;D3DS81;P51513-4	.;NOVA1_HUMAN;.;.	E	129;129;7;88;7;7;92;129;129	ENSP00000447391:K129E;ENSP00000438875:K129E;ENSP00000267422:K7E;ENSP00000408914:K88E;ENSP00000299472:K7E;ENSP00000449113:K7E;ENSP00000449185:K92E;ENSP00000342387:K129E;ENSP00000448157:K129E	ENSP00000267422:K7E	K	-	1	0	NOVA1	26019085	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.013000	0.88655	2.169000	0.68431	0.477000	0.44152	AAG	.		0.438	NOVA1-001	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276557.1	NM_006491	
NPEPL1	79716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	57266852	57266852	+	5'Flank	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr20:57266852A>G	ENST00000356091.6	+	0	0				NPEPL1_ENST00000525817.1_Intron|STX16-NPEPL1_ENST00000530122.1_Intron|NPEPL1_ENST00000525967.1_Missense_Mutation_p.Y11C	NM_024663.3	NP_078939.3	Q8NDH3	PEPL1_HUMAN	aminopeptidase-like 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)			AGAGGAGGGTACCAACCAAAG	0.403																																					p.Y11C		.											.	.	.	0			c.A32G						.																																			SO:0001631	upstream_gene_variant	79716	exon2			GAGGGTACCAACC	AK021645	CCDS46621.1, CCDS56200.1, CCDS56201.1	20q13.32	2008-07-02			ENSG00000215440	ENSG00000215440			16244	protein-coding gene	gene with protein product						14702039	Standard	NM_001204872		Approved	FLJ11583, bA261P9.2	uc010zzs.1	Q8NDH3	OTTHUMG00000033060		20.37:g.57266852A>G	Exception_encountered	55.0	0.0		67.0	15.0	NM_001204872	A6NGZ0|B4DMW7|B7ZBN0|E9PN47|G5EA34|Q53G37|Q5W083|Q8TF28|Q8WUI2|Q9H1T6|Q9HAI5	Missense_Mutation	SNP	ENST00000356091.6	37	CCDS46621.1	.	.	.	.	.	.	.	.	.	.	A	7.961	0.746948	0.15710	.	.	ENSG00000215440	ENST00000525967	T	0.30981	1.51	2.33	0.0992	0.14501	.	.	.	.	.	T	0.12860	0.0312	N	0.08118	0	0.09310	N	0.999999	B	0.26845	0.161	B	0.27262	0.078	T	0.32903	-0.9889	8	.	.	.	.	4.629	0.12491	0.3386:0.0:0.6614:0.0	.	11	E9PN47	.	C	11	ENSP00000434810:Y11C	.	Y	+	2	0	NPEPL1	56700258	0.001000	0.12720	0.007000	0.13788	0.002000	0.02628	-0.003000	0.12901	0.096000	0.17463	-0.321000	0.08615	TAC	.		0.403	NPEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080402.6	NM_024663	
NRXN3	9369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	79933569	79933569	+	Missense_Mutation	SNP	G	G	A	rs373319691		TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr14:79933569G>A	ENST00000557594.1	+	2	1206	c.253G>A	c.(253-255)Gct>Act	p.A85T	NRXN3_ENST00000554719.1_Missense_Mutation_p.A717T|NRXN3_ENST00000556003.1_3'UTR|NRXN3_ENST00000281127.7_Missense_Mutation_p.A85T|NRXN3_ENST00000335750.5_Missense_Mutation_p.A717T|NRXN3_ENST00000428277.2_Missense_Mutation_p.A85T	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	85	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TGCAGCTGGCGCTACGTACAT	0.557																																					p.A717T		.											.	NRXN3	587	0			c.G2149A						.						118.0	86.0	97.0					14																	79933569		2203	4300	6503	SO:0001583	missense	9369	exon13			GCTGGCGCTACGT	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.253G>A	14.37:g.79933569G>A	ENSP00000451672:p.Ala85Thr	67.0	0.0		81.0	11.0	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000557594.1	37		.	.	.	.	.	.	.	.	.	.	G	9.638	1.138311	0.21123	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750;ENST00000557594;ENST00000281127;ENST00000428277	T;T;T;T;T	0.78364	-1.17;-1.17;1.15;1.15;1.15	5.83	5.83	0.93111	Concanavalin A-like lectin/glucanase (1);Laminin G domain (1);	0.055635	0.64402	D	0.000001	T	0.47395	0.1443	N	0.00453	-1.485	0.54753	D	0.999986	B;B;B;B	0.26975	0.005;0.165;0.019;0.001	B;B;B;B	0.17979	0.006;0.02;0.005;0.001	T	0.57207	-0.7851	9	.	.	.	.	20.103	0.97881	0.0:0.0:1.0:0.0	.	85;85;85;717	Q9HDB5-4;Q9HDB5-2;Q9HDB5;Q9Y4C0-3	.;.;NRX3B_HUMAN;.	T	1090;1079;717;717;85;85;85	ENSP00000451648:A717T;ENSP00000338349:A717T;ENSP00000451672:A85T;ENSP00000281127:A85T;ENSP00000394426:A85T	.	A	+	1	0	NRXN3	79003322	1.000000	0.71417	0.994000	0.49952	0.957000	0.61999	5.980000	0.70516	2.738000	0.93877	0.655000	0.94253	GCT	.		0.557	NRXN3-004	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000413790.1	NM_001105250	
NSMAF	8439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	59536325	59536325	+	Silent	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr8:59536325A>G	ENST00000038176.3	-	7	611	c.399T>C	c.(397-399)taT>taC	p.Y133Y	NSMAF_ENST00000519858.1_5'Flank|NSMAF_ENST00000427130.2_Silent_p.Y164Y	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor	133					ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				ATTCAAAAACATATTCCATTT	0.403																																					p.Y164Y		.											.	NSMAF	91	0			c.T492C						.						78.0	71.0	73.0					8																	59536325		2203	4300	6503	SO:0001819	synonymous_variant	8439	exon7			AAAAACATATTCC	X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.399T>C	8.37:g.59536325A>G		188.0	0.0		198.0	55.0	NM_001144772	B4DFB0|E9PCH0|Q8IW26	Silent	SNP	ENST00000038176.3	37	CCDS6173.1																																																																																			.		0.403	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378384.1	NM_003580	
NXPE1	120400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	114398621	114398621	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr11:114398621G>T	ENST00000424269.1	-	3	835	c.836C>A	c.(835-837)tCc>tAc	p.S279Y	snoU13_ENST00000459372.1_RNA|NXPE1_ENST00000536271.1_5'UTR|NXPE1_ENST00000251921.2_Missense_Mutation_p.S137Y|NXPE1_ENST00000536312.1_Silent_p.V291V			Q8N323	NXPE1_HUMAN	neurexophilin and PC-esterase domain family, member 1	279						extracellular region (GO:0005576)											TCCCACTTTGGACCTTCAAAA	0.378																																					p.S137Y		.											.	.	.	0			c.C410A						.						111.0	91.0	98.0					11																	114398621		2201	4296	6497	SO:0001583	missense	120400	exon4			ACTTTGGACCTTC	BC029049	CCDS8372.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000095110	ENSG00000095110			28527	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member A"""	FAM55A		12477932	Standard	NM_152315		Approved	MGC34290	uc001ppa.3	Q8N323	OTTHUMG00000168284	ENST00000424269.1:c.836C>A	11.37:g.114398621G>T	ENSP00000411690:p.Ser279Tyr	93.0	0.0		92.0	15.0	NM_152315	B0YJ13	Missense_Mutation	SNP	ENST00000424269.1	37		.	.	.	.	.	.	.	.	.	.	G	15.99	2.995531	0.54147	.	.	ENSG00000095110	ENST00000251921;ENST00000424269	T;T	0.15834	2.39;2.58	3.37	2.44	0.29823	.	0.431903	0.18735	N	0.132612	T	0.26195	0.0639	M	0.86953	2.85	0.30941	N	0.72587	.	.	.	.	.	.	T	0.34054	-0.9844	8	0.02654	T	1	.	10.107	0.42539	0.0:0.0:0.798:0.202	.	.	.	.	Y	137;279	ENSP00000251921:S137Y;ENSP00000411690:S279Y	ENSP00000251921:S137Y	S	-	2	0	FAM55A	113903831	1.000000	0.71417	0.999000	0.59377	0.427000	0.31564	1.319000	0.33655	0.964000	0.38108	-0.188000	0.12872	TCC	.		0.378	NXPE1-201	KNOWN	basic	protein_coding	protein_coding		NM_152315	
NYNRIN	57523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	24878595	24878595	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr14:24878595A>G	ENST00000382554.3	+	4	1913	c.1595A>G	c.(1594-1596)cAg>cGg	p.Q532R		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	532					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						CTGACAGATCAGTCAGTACCT	0.552																																					p.Q532R		.											.	NYNRIN	3	0			c.A1595G						.						37.0	40.0	39.0					14																	24878595		2022	4178	6200	SO:0001583	missense	57523	exon4			CAGATCAGTCAGT	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.1595A>G	14.37:g.24878595A>G	ENSP00000371994:p.Gln532Arg	52.0	0.0		54.0	6.0	NM_025081	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	37	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	A	9.467	1.094695	0.20471	.	.	ENSG00000205978	ENST00000382554	T	0.11063	2.81	4.52	-4.39	0.03611	.	.	.	.	.	T	0.06962	0.0177	N	0.19112	0.55	0.09310	N	1	B	0.23650	0.089	B	0.24848	0.056	T	0.39840	-0.9594	9	0.66056	D	0.02	.	9.9308	0.41521	0.2162:0.6304:0.1534:0.0	.	532	Q9P2P1	NYNRI_HUMAN	R	532	ENSP00000371994:Q532R	ENSP00000371994:Q532R	Q	+	2	0	NYNRIN	23948435	0.815000	0.29118	0.000000	0.03702	0.002000	0.02628	0.922000	0.28734	-0.761000	0.04670	-2.124000	0.00347	CAG	.		0.552	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
OR2T12	127064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248458182	248458182	+	Silent	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr1:248458182C>T	ENST00000317996.1	-	1	698	c.699G>A	c.(697-699)aaG>aaA	p.K233K		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			CAAAGGCCTTCTTGCGGGCTT	0.522																																					p.K233K		.											.	OR2T12	71	0			c.G699A						.						93.0	89.0	90.0					1																	248458182		2203	4300	6503	SO:0001819	synonymous_variant	127064	exon1			GGCCTTCTTGCGG	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.699G>A	1.37:g.248458182C>T		290.0	0.0		343.0	55.0	NM_001004692		Silent	SNP	ENST00000317996.1	37	CCDS31110.1																																																																																			.		0.522	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692	
OR4N3P	390539	bcgsc.ca;mdanderson.org	37	15	22413834	22413834	+	IGR	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr15:22413834A>G								RP11-69H14.6 (30026 upstream) : RP11-2F9.4 (20055 downstream)																							CCGCTACATCACCATCTGCCT	0.493																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	390539	.			TACATCACCATCT																													15.37:g.22413834A>G		263.0	1.0		223.0	16.0	.		RNA	SNP		37																																																																																				.	0	0.493								
PABPC3	5042	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	25671982	25671982	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr13:25671982C>A	ENST00000281589.3	+	1	1683	c.1646C>A	c.(1645-1647)cCt>cAt	p.P549H		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	549	PABC. {ECO:0000255|PROSITE- ProRule:PRU00641}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		GCATCTGCCCCTCCTCAAAAG	0.473																																					p.P549H		.											.	PABPC3	72	0			c.C1646A						.						109.0	99.0	102.0					13																	25671982		2203	4300	6503	SO:0001583	missense	5042	exon1			CTGCCCCTCCTCA	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1646C>A	13.37:g.25671982C>A	ENSP00000281589:p.Pro549His	73.0	0.0		72.0	17.0	NM_030979	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	C	10.19	1.281984	0.23392	.	.	ENSG00000151846	ENST00000281589	T	0.48522	0.81	0.875	0.875	0.19130	Polyadenylate-binding protein/Hyperplastic disc protein (5);	0.135250	0.32161	U	0.006500	T	0.68485	0.3006	M	0.93283	3.4	0.51233	D	0.999919	D	0.56287	0.975	P	0.62298	0.9	T	0.71642	-0.4531	10	0.87932	D	0	.	7.5489	0.27783	0.0:1.0:0.0:0.0	.	549	Q9H361	PABP3_HUMAN	H	549	ENSP00000281589:P549H	ENSP00000281589:P549H	P	+	2	0	PABPC3	24569982	1.000000	0.71417	0.991000	0.47740	0.020000	0.10135	5.265000	0.65519	0.759000	0.33084	0.313000	0.20887	CCT	.		0.473	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
PAK4	10298	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39660216	39660216	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr19:39660216G>A	ENST00000593690.1	+	4	450	c.23G>A	c.(22-24)cGg>cAg	p.R8Q	PAK4_ENST00000358301.3_Missense_Mutation_p.R8Q|PAK4_ENST00000599470.1_Missense_Mutation_p.R8Q|PAK4_ENST00000360442.3_Missense_Mutation_p.R8Q|PAK4_ENST00000321944.4_Missense_Mutation_p.R8Q|PAK4_ENST00000435673.2_Missense_Mutation_p.R8Q|PAK4_ENST00000599386.1_Missense_Mutation_p.R8Q	NM_001014831.2	NP_001014831.1	O96013	PAK4_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 4	8					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	13	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			AGGAAGAAGCGGGTGGAGATC	0.657																																					p.R8Q		.											.	PAK4	957	0			c.G23A						.						53.0	54.0	54.0					19																	39660216		2203	4300	6503	SO:0001583	missense	10298	exon2			AGAAGCGGGTGGA	AJ011855	CCDS12528.1, CCDS33019.1	19p11-q11	2008-06-17	2008-06-17						16059	protein-coding gene	gene with protein product		605451	"""p21(CDKN1A)-activated kinase 4"""			9822598, 10461188	Standard	NM_001014831		Approved		uc002okn.1	O96013		ENST00000593690.1:c.23G>A	19.37:g.39660216G>A	ENSP00000469413:p.Arg8Gln	109.0	0.0		102.0	19.0	NM_001014832	B4DGG6|Q8N4E1|Q8NCH5|Q8NDE3|Q9BU33|Q9ULS8	Missense_Mutation	SNP	ENST00000593690.1	37	CCDS12528.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224710	0.79576	.	.	ENSG00000130669	ENST00000358301;ENST00000321944;ENST00000435673;ENST00000360442	T;T;T;T	0.74209	-0.82;-0.79;-0.82;-0.82	3.74	3.74	0.42951	.	0.000000	0.64402	U	0.000002	D	0.84266	0.5434	M	0.75447	2.3	0.50039	D	0.999849	D;D;D	0.76494	0.999;0.998;0.997	D;D;D	0.72982	0.96;0.979;0.953	D	0.86406	0.1745	10	0.72032	D	0.01	.	13.4054	0.60911	0.0:0.0:1.0:0.0	.	8;8;8	O96013-4;O96013-3;O96013	.;.;PAK4_HUMAN	Q	8	ENSP00000351049:R8Q;ENSP00000326864:R8Q;ENSP00000392753:R8Q;ENSP00000353625:R8Q	ENSP00000326864:R8Q	R	+	2	0	PAK4	44352056	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	9.474000	0.97718	2.067000	0.61834	0.479000	0.44913	CGG	.		0.657	PAK4-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463823.1		
PANX3	116337	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	124489603	124489603	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr11:124489603G>C	ENST00000284288.2	+	4	1018	c.951G>C	c.(949-951)aaG>aaC	p.K317N		NM_052959.2	NP_443191.1	Q96QZ0	PANX3_HUMAN	pannexin 3	317					cell-cell signaling (GO:0007267)|ion transport (GO:0006811)|protein hexamerization (GO:0034214)|transmembrane transport (GO:0055085)	gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|urinary_tract(1)	26	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		TCAGCAGAAAGATGCTAGGAT	0.448																																					p.K317N		.											.	PANX3	68	0			c.G951C						.						158.0	142.0	147.0					11																	124489603		2201	4299	6500	SO:0001583	missense	116337	exon4			CAGAAAGATGCTA	AF406650	CCDS8447.1	11q24.2	2011-12-02			ENSG00000154143	ENSG00000154143		"""Ion channels / Pannexins"""	20573	protein-coding gene	gene with protein product		608422					Standard	NM_052959		Approved	Px3	uc001qah.3	Q96QZ0	OTTHUMG00000165925	ENST00000284288.2:c.951G>C	11.37:g.124489603G>C	ENSP00000284288:p.Lys317Asn	125.0	0.0		124.0	22.0	NM_052959		Missense_Mutation	SNP	ENST00000284288.2	37	CCDS8447.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.856474	0.51376	.	.	ENSG00000154143	ENST00000284288	T	0.19669	2.13	5.5	-1.51	0.08664	.	0.096756	0.64402	D	0.000002	T	0.23649	0.0572	M	0.62723	1.935	0.32447	N	0.545887	D	0.60575	0.988	P	0.46479	0.518	T	0.42716	-0.9435	10	0.56958	D	0.05	-16.777	11.55	0.50715	0.4919:0.0:0.5081:0.0	.	317	Q96QZ0	PANX3_HUMAN	N	317	ENSP00000284288:K317N	ENSP00000284288:K317N	K	+	3	2	PANX3	123994813	1.000000	0.71417	0.994000	0.49952	0.959000	0.62525	0.578000	0.23773	-0.160000	0.11002	0.561000	0.74099	AAG	.		0.448	PANX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387064.1		
PAX4	5078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	127255566	127255566	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr7:127255566C>A	ENST00000341640.2	-	1	214	c.9G>T	c.(7-9)caG>caT	p.Q3H	PAX4_ENST00000463946.1_5'UTR|PAX4_ENST00000378740.2_Missense_Mutation_p.Q3H|PAX4_ENST00000338516.3_Missense_Mutation_p.Q11H	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	11					cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						GCCCCCCAAGCTGGTTCATGC	0.632																																					p.Q3H	Ovarian(113;737 1605 7858 27720 34092)	.											.	PAX4	227	0			c.G9T						.						75.0	77.0	76.0					7																	127255566		2203	4300	6503	SO:0001583	missense	5078	exon1			CCCAAGCTGGTTC		CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.9G>T	7.37:g.127255566C>A	ENSP00000339906:p.Gln3His	60.0	0.0		56.0	14.0	NM_006193	O95161|Q6B0H0	Missense_Mutation	SNP	ENST00000341640.2	37	CCDS5797.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.887875	0.52014	.	.	ENSG00000106331	ENST00000341640;ENST00000338516;ENST00000378740	D;D	0.99567	-6.18;-6.18	5.67	3.88	0.44766	Paired box protein, N-terminal (4);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99582	0.9849	M	0.91510	3.215	0.51767	D	0.999933	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99204	1.0874	10	0.87932	D	0	.	7.7323	0.28793	0.0:0.7458:0.0:0.2542	.	3;11	O43316-4;O43316	.;PAX4_HUMAN	H	3;11;11	ENSP00000339906:Q3H;ENSP00000344297:Q11H	ENSP00000344297:Q11H	Q	-	3	2	PAX4	127042802	1.000000	0.71417	0.999000	0.59377	0.347000	0.29111	2.355000	0.44107	0.748000	0.32831	0.655000	0.94253	CAG	.		0.632	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349165.1		
PCNX	22990	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	71444965	71444965	+	Silent	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr14:71444965G>A	ENST00000304743.2	+	6	2357	c.1911G>A	c.(1909-1911)gaG>gaA	p.E637E	PCNX_ENST00000238570.5_Silent_p.E637E|PCNX_ENST00000439984.3_Silent_p.E637E	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	637						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		AGTCTCCTGAGGGCAGATACA	0.468																																					p.E637E		.											.	PCNX	91	0			c.G1911A						.						104.0	97.0	99.0					14																	71444965		2203	4300	6503	SO:0001819	synonymous_variant	22990	exon6			TCCTGAGGGCAGA	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.1911G>A	14.37:g.71444965G>A		54.0	0.0		43.0	5.0	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Silent	SNP	ENST00000304743.2	37	CCDS9806.1																																																																																			.		0.468	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
PDZD2	23037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	32074465	32074465	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr5:32074465C>T	ENST00000438447.1	+	18	3641	c.3253C>T	c.(3253-3255)Ccc>Tcc	p.P1085S	PDZD2_ENST00000282493.3_Missense_Mutation_p.P1085S			O15018	PDZD2_HUMAN	PDZ domain containing 2	1085					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						AAGTAGCGCACCCAAATTGGA	0.592																																					p.P1085S		.											.	PDZD2	563	0			c.C3253T						.						128.0	142.0	137.0					5																	32074465		2203	4300	6503	SO:0001583	missense	23037	exon17			AGCGCACCCAAAT	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.3253C>T	5.37:g.32074465C>T	ENSP00000402033:p.Pro1085Ser	67.0	0.0		59.0	10.0	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	C	16.34	3.097127	0.56075	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.41400	1.0;1.0	5.54	5.54	0.83059	.	0.163418	0.29383	N	0.012314	T	0.65165	0.2665	M	0.69823	2.125	0.53005	D	0.999961	P;D	0.89917	0.473;1.0	B;D	0.87578	0.069;0.998	T	0.67329	-0.5698	10	0.72032	D	0.01	.	16.9926	0.86358	0.0:1.0:0.0:0.0	.	911;1085	B4E3P2;O15018	.;PDZD2_HUMAN	S	1085;887;1085	ENSP00000402033:P1085S;ENSP00000282493:P1085S	ENSP00000282493:P1085S	P	+	1	0	PDZD2	32110222	0.998000	0.40836	0.937000	0.37676	0.012000	0.07955	5.260000	0.65490	2.603000	0.88011	0.467000	0.42956	CCC	.		0.592	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
PHF10	55274	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	170116083	170116083	+	Nonsense_Mutation	SNP	G	G	A	rs140258100		TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr6:170116083G>A	ENST00000339209.4	-	5	634	c.511C>T	c.(511-513)Caa>Taa	p.Q171*	PHF10_ENST00000464779.1_5'Flank|PHF10_ENST00000366780.4_Nonsense_Mutation_p.Q169*	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10	171	Essential to induce neural progenitor proliferation. {ECO:0000250}.|SAY.				nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		GTAATTCGTTGACGTTCTTTT	0.333																																					p.Q171X		.											.	PHF10	226	0			c.C511T						.						116.0	109.0	112.0					6																	170116083		2202	4300	6502	SO:0001587	stop_gained	55274	exon5			TTCGTTGACGTTC	AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.511C>T	6.37:g.170116083G>A	ENSP00000341805:p.Gln171*	238.0	0.0		175.0	30.0	NM_018288	Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Nonsense_Mutation	SNP	ENST00000339209.4	37	CCDS5308.2	.	.	.	.	.	.	.	.	.	.	G	35	5.494501	0.96339	.	.	ENSG00000130024	ENST00000366780;ENST00000339209	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-22.8934	19.3383	0.94329	0.0:0.0:1.0:0.0	.	.	.	.	X	169;171	.	ENSP00000341805:Q171X	Q	-	1	0	PHF10	169858008	1.000000	0.71417	0.829000	0.32907	0.868000	0.49771	7.306000	0.78905	2.807000	0.96579	0.650000	0.86243	CAA	G|1.000;C|0.000		0.333	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346732.1	NM_018288	
PICK1	9463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	38469082	38469082	+	Missense_Mutation	SNP	G	G	A	rs199605777		TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr22:38469082G>A	ENST00000404072.3	+	10	1113	c.766G>A	c.(766-768)Gtg>Atg	p.V256M	PICK1_ENST00000356976.3_Missense_Mutation_p.V256M|RP5-1039K5.13_ENST00000445483.1_RNA	NM_001039583.1|NM_001039584.1	NP_001034672.1|NP_001034673.1	Q9NRD5	PICK1_HUMAN	protein interacting with PRKCA 1	256	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				ATP catabolic process (GO:0006200)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|dendritic spine maintenance (GO:0097062)|dendritic spine organization (GO:0097061)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|glial cell development (GO:0021782)|long term synaptic depression (GO:0060292)|monoamine transport (GO:0015844)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|neuronal ion channel clustering (GO:0045161)|positive regulation of receptor internalization (GO:0002092)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|protein targeting (GO:0006605)|receptor clustering (GO:0043113)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endocytic vesicle membrane (GO:0030666)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein kinase C binding (GO:0005080)|receptor binding (GO:0005102)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	Melanoma(58;0.045)					GTACCTGGACGTGAAGTTTGA	0.582																																					p.V256M		.											.	PICK1	226	0			c.G766A						.						193.0	153.0	166.0					22																	38469082		2203	4300	6503	SO:0001583	missense	9463	exon10			CTGGACGTGAAGT	AL049654	CCDS13965.1	22q13.1	2006-02-14	2006-02-14	2006-02-14	ENSG00000100151	ENSG00000100151			9394	protein-coding gene	gene with protein product		605926	"""protein kinase C, alpha binding protein"", ""protein interacting with PRKCA"""	PRKCABP		10340301, 10591208	Standard	XM_006724377		Approved	dJ1039K5, MGC15204	uc003aus.3	Q9NRD5	OTTHUMG00000151159	ENST00000404072.3:c.766G>A	22.37:g.38469082G>A	ENSP00000385205:p.Val256Met	110.0	0.0		120.0	18.0	NM_012407	B3KS52|O95906	Missense_Mutation	SNP	ENST00000404072.3	37	CCDS13965.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.641864	0.87859	.	.	ENSG00000100151	ENST00000404072;ENST00000356976	T;T	0.78246	-1.16;-1.16	5.64	5.64	0.86602	Arfaptin-like (3);	0.000000	0.85682	D	0.000000	D	0.87051	0.6081	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.64877	0.93	D	0.87222	0.2254	10	0.72032	D	0.01	-35.3262	20.0957	0.97842	0.0:0.0:1.0:0.0	.	256	Q9NRD5	PICK1_HUMAN	M	256	ENSP00000385205:V256M;ENSP00000349465:V256M	ENSP00000349465:V256M	V	+	1	0	PICK1	36799028	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.205000	0.95048	2.837000	0.97791	0.655000	0.94253	GTG	G|0.999;A|0.001		0.582	PICK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321569.2	NM_012407	
PIH1D3	139212	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	106486408	106486408	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chrX:106486408G>C	ENST00000372453.3	+	7	587	c.525G>C	c.(523-525)ttG>ttC	p.L175F	PIH1D3_ENST00000336387.4_Missense_Mutation_p.L175F|PIH1D3_ENST00000535523.1_Missense_Mutation_p.L175F	NM_173494.1	NP_775765.1	Q9NQM4	PIHD3_HUMAN	PIH1 domain containing 3	175																	GGAAGCTGTTGATAACTCTTC	0.353																																					p.L175F		.											.	.	.	0			c.G525C						.						97.0	96.0	97.0					X																	106486408		2203	4299	6502	SO:0001583	missense	139212	exon7			GCTGTTGATAACT	AL136112	CCDS14528.1	Xq22.3	2014-05-20	2012-07-18	2012-07-18	ENSG00000080572	ENSG00000080572			28570	protein-coding gene	gene with protein product	"""sarcoma antigen NY-SAR-97"""		"""chromosome X open reading frame 41"""	CXorf41		12601173, 24421334	Standard	NM_001169154		Approved	MGC35261, NYSAR97	uc004enc.3	Q9NQM4	OTTHUMG00000022160	ENST00000372453.3:c.525G>C	X.37:g.106486408G>C	ENSP00000361531:p.Leu175Phe	96.0	0.0		131.0	34.0	NM_173494	D3DUX5|Q86WE1	Missense_Mutation	SNP	ENST00000372453.3	37	CCDS14528.1	.	.	.	.	.	.	.	.	.	.	G	0.986	-0.695475	0.03279	.	.	ENSG00000080572	ENST00000372453;ENST00000535523;ENST00000336387	T;T;T	0.17691	2.26;2.26;2.26	5.03	2.03	0.26663	.	0.279934	0.28555	N	0.014928	T	0.30293	0.0760	M	0.73598	2.24	0.09310	N	1	D	0.61080	0.989	P	0.62298	0.9	T	0.05666	-1.0871	10	0.49607	T	0.09	0.3886	3.5279	0.07766	0.2619:0.2365:0.5015:0.0	.	175	Q9NQM4	CX041_HUMAN	F	175	ENSP00000361531:L175F;ENSP00000441930:L175F;ENSP00000337757:L175F	ENSP00000337757:L175F	L	+	3	2	CXorf41	106373064	0.257000	0.24022	0.030000	0.17652	0.016000	0.09150	0.586000	0.23894	0.874000	0.35823	0.544000	0.68410	TTG	.		0.353	PIH1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057832.1	NM_173494	
PJA2	9867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	108714881	108714881	+	Missense_Mutation	SNP	G	G	T	rs143063686		TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr5:108714881G>T	ENST00000361189.2	-	4	546	c.307C>A	c.(307-309)Ccc>Acc	p.P103T	PJA2_ENST00000511624.1_5'UTR|PJA2_ENST00000361557.3_Missense_Mutation_p.P103T	NM_014819.4	NP_055634.3	O43164	PJA2_HUMAN	praja ring finger 2, E3 ubiquitin protein ligase	103					long-term memory (GO:0007616)|protein ubiquitination (GO:0016567)|regulation of protein kinase A signaling (GO:0010738)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		CCACAAGTGGGAATTTCTGTT	0.388																																					p.P103T		.											.	PJA2	92	0			c.C307A						.						66.0	66.0	66.0					5																	108714881		2202	4300	6502	SO:0001583	missense	9867	exon4			AAGTGGGAATTTC	AB007898	CCDS4099.1	5q22.1	2013-01-09	2012-02-23	2003-06-05	ENSG00000198961	ENSG00000198961		"""RING-type (C3HC4) zinc fingers"""	17481	protein-coding gene	gene with protein product			"""ring finger protein 131"", ""praja ring finger 2"""	RNF131			Standard	NM_014819		Approved	KIAA0438, Neurodap1	uc003kos.4	O43164	OTTHUMG00000128750	ENST00000361189.2:c.307C>A	5.37:g.108714881G>T	ENSP00000354775:p.Pro103Thr	90.0	0.0		77.0	9.0	NM_014819	A8K6U4|D3DSZ5|Q68D49|Q8N1G5	Missense_Mutation	SNP	ENST00000361189.2	37	CCDS4099.1	.	.	.	.	.	.	.	.	.	.	G	9.715	1.158192	0.21454	.	.	ENSG00000198961	ENST00000361189;ENST00000361557	T;T	0.05996	3.36;3.36	6.16	0.21	0.15231	.	0.833028	0.11168	N	0.592392	T	0.10680	0.0261	M	0.63843	1.955	0.09310	N	0.999993	P	0.48640	0.913	P	0.47470	0.548	T	0.17868	-1.0355	10	0.87932	D	0	1.2813	6.9814	0.24706	0.3703:0.1067:0.523:0.0	.	103	O43164	PJA2_HUMAN	T	103	ENSP00000354775:P103T;ENSP00000355284:P103T	ENSP00000354775:P103T	P	-	1	0	PJA2	108742780	0.773000	0.28580	0.314000	0.25224	0.492000	0.33523	0.219000	0.17641	-0.252000	0.09528	-0.781000	0.03364	CCC	G|1.000;A|0.000		0.388	PJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250663.1	NM_014819	
PKDREJ	10343	broad.mit.edu;mdanderson.org	37	22	46658708	46658708	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr22:46658708G>C	ENST00000253255.5	-	1	511	c.512C>G	c.(511-513)cCg>cGg	p.P171R		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	171					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		CTggggccgcgggcctggcgc	0.801																																					p.P171R		.											.	PKDREJ	156	0			c.C512G						.						3.0	4.0	4.0					22																	46658708		1908	3663	5571	SO:0001583	missense	10343	exon1			GGCCGCGGGCCTG	AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.512C>G	22.37:g.46658708G>C	ENSP00000253255:p.Pro171Arg	46.0	0.0		57.0	11.0	NM_006071	B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	37	CCDS14073.1	.	.	.	.	.	.	.	.	.	.	G	5.805	0.332904	0.11013	.	.	ENSG00000130943	ENST00000253255	T	0.55760	0.5	2.9	-1.1	0.09872	.	2.027030	0.02551	N	0.095701	T	0.28067	0.0692	N	0.03608	-0.345	0.09310	N	1	B	0.20671	0.047	B	0.19666	0.026	T	0.11036	-1.0604	10	0.23302	T	0.38	-3.4149	5.5959	0.17327	0.1203:0.3876:0.4921:0.0	.	171	Q9NTG1	PKDRE_HUMAN	R	171	ENSP00000253255:P171R	ENSP00000253255:P171R	P	-	2	0	PKDREJ	45037372	0.002000	0.14202	0.000000	0.03702	0.004000	0.04260	0.197000	0.17197	-0.457000	0.07033	0.505000	0.49811	CCG	.		0.801	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
PPP2R5A	5525	broad.mit.edu;bcgsc.ca	37	1	212519188	212519197	+	Frame_Shift_Del	DEL	TCCTGAAGAC	TCCTGAAGAC	-			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	TCCTGAAGAC	TCCTGAAGAC	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr1:212519188_212519197delTCCTGAAGAC	ENST00000261461.2	+	5	1191_1200	c.617_626delTCCTGAAGAC	c.(616-627)ttcctgaagactfs	p.FLKT206fs	PPP2R5A_ENST00000498129.2_3'UTR|PPP2R5A_ENST00000537030.3_Frame_Shift_Del_p.FLKT149fs	NM_006243.3	NP_006234.1	Q15172	2A5A_HUMAN	protein phosphatase 2, regulatory subunit B', alpha	206					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of lipid kinase activity (GO:0090219)|positive regulation of protein dephosphorylation (GO:0035307)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|M band (GO:0031430)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)|Z disc (GO:0030018)	kinase binding (GO:0019900)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.0125)|all cancers(67;0.029)|Epithelial(68;0.154)|GBM - Glioblastoma multiforme(131;0.155)		GAACGTGACTTCCTGAAGACTGTTCTGCAC	0.324																																					p.206_209del		.											.	PPP2R5A	659	0			c.617_626del						.																																			SO:0001589	frameshift_variant	5525	exon5			GTGACTTCCTGAA	BC022474	CCDS1503.1, CCDS55686.1	1q32.2-q32.3	2010-06-18	2010-04-14		ENSG00000066027	ENSG00000066027		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9309	protein-coding gene	gene with protein product		601643	"""protein phosphatase 2, regulatory subunit B (B56), alpha isoform"", ""protein phosphatase 2, regulatory subunit B', alpha isoform"""			7592815	Standard	NM_006243		Approved	PR61A, B56A	uc001hjb.3	Q15172	OTTHUMG00000036750	ENST00000261461.2:c.617_626delTCCTGAAGAC	1.37:g.212519188_212519197delTCCTGAAGAC	ENSP00000261461:p.Phe206fs	112.0	0.0		126.0	8.0	NM_006243	B2R6D2|B7Z7L2|D3DT99|Q2NL72|Q5VVB2|Q8TBI9	Frame_Shift_Del	DEL	ENST00000261461.2	37	CCDS1503.1																																																																																			.		0.324	PPP2R5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089302.1	NM_006243	
PRICKLE2	166336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	64133075	64133075	+	Missense_Mutation	SNP	C	C	A	rs372367565		TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr3:64133075C>A	ENST00000295902.6	-	7	1676	c.1091G>T	c.(1090-1092)cGg>cTg	p.R364L	PRICKLE2_ENST00000564377.1_Missense_Mutation_p.R420L	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	364					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		GGCTGACAGCCGGTTAGAACT	0.617																																					p.R364L		.											.	PRICKLE2	95	0			c.G1091T						.						94.0	106.0	102.0					3																	64133075		2203	4300	6503	SO:0001583	missense	166336	exon7			GACAGCCGGTTAG	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.1091G>T	3.37:g.64133075C>A	ENSP00000295902:p.Arg364Leu	61.0	0.0		65.0	11.0	NM_198859	Q0VF44	Missense_Mutation	SNP	ENST00000295902.6	37	CCDS2902.1	.	.	.	.	.	.	.	.	.	.	C	9.873	1.199349	0.22121	.	.	ENSG00000163637	ENST00000295902	T	0.60171	0.21	6.08	4.24	0.50183	.	0.085246	0.48286	N	0.000189	T	0.68339	0.2990	L	0.53249	1.67	0.58432	D	0.999997	D	0.69078	0.997	P	0.60682	0.878	T	0.69049	-0.5248	10	0.49607	T	0.09	-17.0019	15.2738	0.73726	0.2786:0.7213:0.0:0.0	.	364	Q7Z3G6	PRIC2_HUMAN	L	364	ENSP00000295902:R364L	ENSP00000295902:R364L	R	-	2	0	PRICKLE2	64108115	0.997000	0.39634	0.992000	0.48379	0.001000	0.01503	6.157000	0.71846	0.843000	0.35070	-0.169000	0.13324	CGG	.		0.617	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
PRIM2	5558	broad.mit.edu;bcgsc.ca	37	6	57393173	57393173	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr6:57393173C>G	ENST00000607273.1	+	9	910	c.823C>G	c.(823-825)Cag>Gag	p.Q275E	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	275					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTCTTTAGATCAGATTGATTT	0.308																																					.		.											.	PRIM2	227	0			.						.						79.0	76.0	77.0					6																	57393173		1835	4077	5912	SO:0001583	missense	5558	.			TTAGATCAGATTG		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000607273.1:c.823C>G	6.37:g.57393173C>G	ENSP00000475738:p.Gln275Glu	117.0	0.0		92.0	6.0	.	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Missense_Mutation	SNP	ENST00000607273.1	37																																																																																				.		0.308	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000947	
PRKDC	5591	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	48701735	48701735	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr8:48701735A>G	ENST00000314191.2	-	76	10788	c.10732T>C	c.(10732-10734)Tct>Cct	p.S3578P	PRKDC_ENST00000338368.3_Missense_Mutation_p.S3578P|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3579					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TCAGGATTAGAGAGCTGATCT	0.308								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	.											.	PRKDC	1515	0			.						.						66.0	62.0	63.0					8																	48701735		1811	4077	5888	SO:0001583	missense	5591	.			GATTAGAGAGCTG		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.10732T>C	8.37:g.48701735A>G	ENSP00000313420:p.Ser3578Pro	293.0	0.0		290.0	39.0	.	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		.	.	.	.	.	.	.	.	.	.	A	20.8	4.055901	0.76074	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.02656	4.27;4.21	5.42	5.42	0.78866	.	0.116612	0.64402	D	0.000011	T	0.11665	0.0284	M	0.76002	2.32	0.53688	D	0.999974	D;D	0.61697	0.99;0.978	P;P	0.56788	0.759;0.806	T	0.00403	-1.1761	10	0.56958	D	0.05	.	14.9552	0.71107	1.0:0.0:0.0:0.0	.	3578;3579	E7EUY0;P78527	.;PRKDC_HUMAN	P	3578	ENSP00000313420:S3578P;ENSP00000345182:S3578P	ENSP00000313420:S3578P	S	-	1	0	PRKDC	48864288	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	2.710000	0.47169	2.194000	0.70268	0.533000	0.62120	TCT	.		0.308	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
ARHGAP8	23779	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	45255714	45255714	+	Splice_Site	SNP	G	G	C	rs76060959	byFrequency	TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr22:45255714G>C	ENST00000389774.2	+	12	1215	c.1074G>C	c.(1072-1074)gcG>gcC	p.A358A	ARHGAP8_ENST00000517296.3_Splice_Site_p.A537A|ARHGAP8_ENST00000336963.4_Intron|ARHGAP8_ENST00000389773.5_Splice_Site_p.A449A|PRR5-ARHGAP8_ENST00000361473.5_Splice_Site_p.A458A|ARHGAP8_ENST00000356099.6_Splice_Site_p.A327A|PRR5-ARHGAP8_ENST00000352766.7_Splice_Site_p.A537A	NM_001017526.1	NP_001017526.1	P85298	RHG08_HUMAN	Rho GTPase activating protein 8	358	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(9)|prostate(1)|skin(7)	29		all_neural(38;0.00409)|Ovarian(80;0.00976)|Glioma(61;0.0649)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0204)		TCCTGCATGCGGTGAGTGGGG	0.657													G|||	2	0.000399361	0.0	0.0029	5008	,	,		19818	0.0		0.0	False		,,,				2504	0.0				p.A449A		.											.	PRR5-ARHGAP8	161	0			c.G1347C						.						58.0	49.0	52.0					22																	45255714		2203	4300	6503	SO:0001630	splice_region_variant	553158	exon14			GCATGCGGTGAGT	AF177331	CCDS14060.2, CCDS33664.1, CCDS56233.1	22q13.3	2010-05-11			ENSG00000241484	ENSG00000241484		"""Rho GTPase activating proteins"""	677	protein-coding gene	gene with protein product		609405				10591208	Standard	NM_001198726		Approved	FLJ20185, BPGAP1		P85298	OTTHUMG00000030234	ENST00000389774.2:c.1074+1G>C	22.37:g.45255714G>C		51.0	0.0		36.0	10.0	NM_181334	A6ZJ79|A6ZJ80|O75983|O95695|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Silent	SNP	ENST00000389774.2	37	CCDS33664.1	.	.	.	.	.	.	.	.	.	.	G	2.463	-0.323772	0.05350	.	.	ENSG00000248405	ENST00000515632	.	.	.	3.96	0.524	0.17066	.	.	.	.	.	T	0.56863	0.2014	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49542	-0.8929	4	.	.	.	.	9.226	0.37407	0.2483:0.0:0.7517:0.0	.	.	.	.	P	398	.	.	R	+	2	0	PRR5-ARHGAP8	43634378	0.998000	0.40836	0.167000	0.22817	0.009000	0.06853	2.651000	0.46674	0.010000	0.14839	-0.350000	0.07774	CGG	A|0.007;G|0.993		0.657	ARHGAP8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000075088.4	NM_017701	Silent
PRSS36	146547	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	31150725	31150725	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr16:31150725G>C	ENST00000268281.4	-	15	2360	c.2302C>G	c.(2302-2304)Ccg>Gcg	p.P768A	PRSS36_ENST00000418068.2_Missense_Mutation_p.P665A|PRSS36_ENST00000569305.1_Missense_Mutation_p.P763A	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	768	Peptidase S1 3. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)			kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						AGGAGGGGCGGTGCTGAGGTC	0.637																																					p.P768A		.											.	PRSS36	91	0			c.C2302G						.						55.0	54.0	54.0					16																	31150725		2197	4300	6497	SO:0001583	missense	146547	exon15			GGGGCGGTGCTGA	AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.2302C>G	16.37:g.31150725G>C	ENSP00000268281:p.Pro768Ala	103.0	0.0		84.0	16.0	NM_173502	A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Missense_Mutation	SNP	ENST00000268281.4	37	CCDS32436.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.533163	0.45073	.	.	ENSG00000178226	ENST00000268281;ENST00000418068	D;D	0.91740	-2.35;-2.9	5.83	4.87	0.63330	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.92430	0.7597	L	0.27053	0.805	0.33715	D	0.616266	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.87578	0.98;0.998;0.998	D	0.93282	0.6661	9	0.66056	D	0.02	.	11.3467	0.49565	0.0861:0.0:0.9139:0.0	.	665;763;768	E7EX56;B7ZMK8;Q5K4E3	.;.;POLS2_HUMAN	A	768;665	ENSP00000268281:P768A;ENSP00000407160:P665A	ENSP00000268281:P768A	P	-	1	0	PRSS36	31058226	0.553000	0.26513	0.989000	0.46669	0.028000	0.11728	1.324000	0.33712	2.755000	0.94549	0.561000	0.74099	CCG	.		0.637	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000433542.1	NM_173502	
PSEN1	5663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	73653618	73653618	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr14:73653618A>G	ENST00000324501.5	+	6	810	c.538A>G	c.(538-540)Att>Gtt	p.I180V	PSEN1_ENST00000357710.4_Missense_Mutation_p.I176V|PSEN1_ENST00000557511.1_Missense_Mutation_p.I180V|PSEN1_ENST00000261970.3_Missense_Mutation_p.I180V|PSEN1_ENST00000394164.1_Missense_Mutation_p.I176V|PSEN1_ENST00000344094.3_Missense_Mutation_p.I180V|PSEN1_ENST00000406768.1_Missense_Mutation_p.I88V	NM_000021.3|NM_007318.2	NP_000012.1|NP_015557.2	P49768	PSN1_HUMAN	presenilin 1	180					activation of MAPKK activity (GO:0000186)|amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|autophagic vacuole assembly (GO:0000045)|beta-amyloid formation (GO:0034205)|beta-amyloid metabolic process (GO:0050435)|blood vessel development (GO:0001568)|brain morphogenesis (GO:0048854)|Cajal-Retzius cell differentiation (GO:0021870)|calcium ion transmembrane transport (GO:0070588)|canonical Wnt signaling pathway (GO:0060070)|cell fate specification (GO:0001708)|cellular response to DNA damage stimulus (GO:0006974)|cerebral cortex cell migration (GO:0021795)|choline transport (GO:0015871)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|L-glutamate transport (GO:0015813)|membrane protein ectodomain proteolysis (GO:0006509)|memory (GO:0007613)|mitochondrial transport (GO:0006839)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of axonogenesis (GO:0050771)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of receptor recycling (GO:0001921)|post-embryonic development (GO:0009791)|protein glycosylation (GO:0006486)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of phosphorylation (GO:0042325)|regulation of protein binding (GO:0043393)|regulation of resting membrane potential (GO:0060075)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)|skeletal system morphogenesis (GO:0048705)|skin morphogenesis (GO:0043589)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|somitogenesis (GO:0001756)|synaptic vesicle targeting (GO:0016080)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary rootlet (GO:0035253)|cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)|perinuclear region of cytoplasm (GO:0048471)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|calcium channel activity (GO:0005262)|endopeptidase activity (GO:0004175)|PDZ domain binding (GO:0030165)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		TTTTTCATTCATTTACTTGGG	0.338																																					p.I180V		.											.	PSEN1	659	0			c.A538G						.						205.0	198.0	201.0					14																	73653618		2203	4300	6503	SO:0001583	missense	5663	exon6			TCATTCATTTACT	AJ008005	CCDS9812.1, CCDS9813.1	14q24.3	2014-09-17	2008-07-28		ENSG00000080815	ENSG00000080815			9508	protein-coding gene	gene with protein product		104311	"""Alzheimer disease 3"""	AD3		1411576	Standard	NM_007318		Approved	FAD, S182, PS1	uc001xnr.3	P49768	OTTHUMG00000141279	ENST00000324501.5:c.538A>G	14.37:g.73653618A>G	ENSP00000326366:p.Ile180Val	155.0	0.0		141.0	26.0	NM_000021	B2R6D3|O95465|Q14762|Q15719|Q15720|Q96P33|Q9UIF0	Missense_Mutation	SNP	ENST00000324501.5	37	CCDS9812.1	.	.	.	.	.	.	.	.	.	.	A	16.31	3.086104	0.55861	.	.	ENSG00000080815	ENST00000324501;ENST00000357710;ENST00000261970;ENST00000344094;ENST00000394164;ENST00000557511;ENST00000406768	D;D;D;D;D;D;D	0.99541	-6.12;-6.12;-6.12;-6.12;-6.12;-6.12;-6.12	5.46	5.46	0.80206	.	0.092352	0.64402	D	0.000001	D	0.99184	0.9717	M	0.64676	1.99	0.80722	D	1	B;P	0.50369	0.393;0.934	B;P	0.50934	0.406;0.654	D	0.99201	1.0873	10	0.62326	D	0.03	-20.2897	15.8313	0.78752	1.0:0.0:0.0:0.0	.	176;180	P49768-2;P49768	.;PSN1_HUMAN	V	180;176;180;180;176;180;88	ENSP00000326366:I180V;ENSP00000350342:I176V;ENSP00000261970:I180V;ENSP00000339523:I180V;ENSP00000377719:I176V;ENSP00000451429:I180V;ENSP00000385948:I88V	ENSP00000261970:I180V	I	+	1	0	PSEN1	72723371	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	6.516000	0.73755	2.199000	0.70637	0.402000	0.26972	ATT	.		0.338	PSEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280500.2		
RAB18	22931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	27821473	27821473	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr10:27821473C>T	ENST00000356940.6	+	4	326	c.224C>T	c.(223-225)cCc>cTc	p.P75L	RAB18_ENST00000375802.3_Intron|RAB18_ENST00000465772.1_3'UTR|RAB18_ENST00000535776.1_Intron	NM_001256410.1|NM_001256415.1|NM_021252.4	NP_001243339.1|NP_001243344.1|NP_067075.1	Q9NP72	RAB18_HUMAN	RAB18, member RAS oncogene family	75					brain development (GO:0007420)|endoplasmic reticulum tubular network organization (GO:0071786)|eye development (GO:0001654)|GTP catabolic process (GO:0006184)|lipid particle organization (GO:0034389)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			kidney(1)|large_intestine(1)|lung(1)	3						ACATTAACTCCCAGCTATTAT	0.289																																					p.P104L		.											.	RAB18	227	0			c.C311T						.						115.0	122.0	120.0					10																	27821473		2203	4296	6499	SO:0001583	missense	22931	exon5			TAACTCCCAGCTA	AJ277145	CCDS7155.1, CCDS58073.1, CCDS73080.1, CCDS73081.1	10p12	2011-03-07			ENSG00000099246	ENSG00000099246		"""RAB, member RAS oncogene"""	14244	protein-coding gene	gene with protein product		602207				10648831	Standard	NM_021252		Approved		uc001itw.4	Q9NP72	OTTHUMG00000017861	ENST00000356940.6:c.224C>T	10.37:g.27821473C>T	ENSP00000349415:p.Pro75Leu	32.0	0.0		51.0	9.0	NM_001256410	B3KMC7|B7Z333|D3DRW1|Q53FX8|Q56UN9|Q6FIH1	Missense_Mutation	SNP	ENST00000356940.6	37	CCDS7155.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165748	0.78339	.	.	ENSG00000099246	ENST00000356940;ENST00000540268	T	0.77229	-1.08	5.93	5.03	0.67393	Small GTP-binding protein domain (1);	.	.	.	.	D	0.86360	0.5914	M	0.69185	2.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.97110	1.0;1.0;0.974	D	0.87625	0.2512	9	0.72032	D	0.01	.	13.9572	0.64157	0.0:0.9277:0.0:0.0723	.	75;104;75	B7Z4P9;Q56UN9;Q9NP72	.;.;RAB18_HUMAN	L	75;53	ENSP00000349415:P75L	ENSP00000349415:P75L	P	+	2	0	RAB18	27861479	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	7.216000	0.77974	1.497000	0.48584	0.655000	0.94253	CCC	.		0.289	RAB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047326.2	NM_021252	
RASGRF2	5924	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	80376525	80376525	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr5:80376525G>A	ENST00000265080.4	+	7	1145	c.1078G>A	c.(1078-1080)Gac>Aac	p.D360N	RASGRF2_ENST00000502677.1_3'UTR	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	360	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		CAGAGATTTTGACAAACTCTT	0.428																																					p.D360N		.											.	RASGRF2	725	0			c.G1078A						.						122.0	120.0	120.0					5																	80376525		2203	4300	6503	SO:0001583	missense	5924	exon7			GATTTTGACAAAC	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.1078G>A	5.37:g.80376525G>A	ENSP00000265080:p.Asp360Asn	111.0	1.0		116.0	16.0	NM_006909	B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	37	CCDS4052.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.043579	0.75732	.	.	ENSG00000113319	ENST00000265080	T	0.62498	0.02	5.85	5.85	0.93711	Dbl homology (DH) domain (5);	0.042803	0.85682	D	0.000000	T	0.43853	0.1266	N	0.05124	-0.11	0.58432	D	0.999999	B;B	0.25169	0.119;0.032	B;B	0.25614	0.062;0.047	T	0.37407	-0.9707	10	0.14252	T	0.57	.	20.1775	0.98187	0.0:0.0:1.0:0.0	.	360;360	D6RAS9;O14827	.;RGRF2_HUMAN	N	360	ENSP00000265080:D360N	ENSP00000265080:D360N	D	+	1	0	RASGRF2	80412281	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.771000	0.95319	0.561000	0.74099	GAC	.		0.428	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909	
RAPGEF6	51735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	130778169	130778169	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr5:130778169C>A	ENST00000509018.1	-	23	3688	c.3483G>T	c.(3481-3483)atG>atT	p.M1161I	RAPGEF6_ENST00000296859.6_Missense_Mutation_p.M1169I|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.M1174I|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.M1169I|RAPGEF6_ENST00000512052.1_Missense_Mutation_p.M884I|RAPGEF6_ENST00000308008.6_Missense_Mutation_p.M1161I|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.M1211I	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	1161					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		CAGCTGACCTCATAGGCACTG	0.448																																					p.M1174I	Melanoma(168;435 1955 13113 13877 23213)	.											.	RAPGEF6	661	0			c.G3522T						.						187.0	173.0	178.0					5																	130778169		2203	4300	6503	SO:0001583	missense	51735	exon25			TGACCTCATAGGC	AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.3483G>T	5.37:g.130778169C>A	ENSP00000421684:p.Met1161Ile	128.0	0.0		131.0	25.0	NM_001164387	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	37	CCDS34225.1	.	.	.	.	.	.	.	.	.	.	C	6.005	0.369283	0.11352	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000512052;ENST00000308008;ENST00000514667	T;T;T;T;T;T;T	0.25085	2.02;1.92;1.92;2.02;1.82;1.82;2.11	5.84	4.98	0.66077	Ras guanine nucleotide exchange factor, domain (1);	0.469272	0.24745	N	0.035957	T	0.16854	0.0405	N	0.14661	0.345	0.80722	D	1	B;B;B;B;B;B;B	0.13145	0.001;0.001;0.007;0.002;0.004;0.002;0.001	B;B;B;B;B;B;B	0.19666	0.006;0.003;0.026;0.004;0.01;0.014;0.006	T	0.05517	-1.0880	10	0.21014	T	0.42	.	14.9361	0.70957	0.0:0.9315:0.0:0.0685	.	1169;1169;1161;884;1211;1174;1161	A3KN82;B7ZML2;Q8TEU7-2;D6RE77;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;.;.;RPGF6_HUMAN	I	1161;1174;1169;1169;1174;884;1161;1211	ENSP00000421684:M1161I;ENSP00000309298:M1174I;ENSP00000426081:M1169I;ENSP00000296859:M1169I;ENSP00000426910:M884I;ENSP00000311419:M1161I;ENSP00000426948:M1211I	ENSP00000426948:M1211I	M	-	3	0	RAPGEF6;FNIP1	130806068	1.000000	0.71417	0.922000	0.36590	0.050000	0.14768	4.336000	0.59304	1.480000	0.48289	-0.253000	0.11424	ATG	.		0.448	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340	
RBP3	5949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	48381913	48381913	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr10:48381913G>A	ENST00000224600.4	-	4	3849	c.3736C>T	c.(3736-3738)Cac>Tac	p.H1246Y		NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	1246					lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	CCCTACAGGTGGTCCTGCAGG	0.652																																					p.H1246Y		.											.	RBP3	153	0			c.C3736T						.						28.0	25.0	26.0					10																	48381913		2203	4300	6503	SO:0001583	missense	5949	exon4			ACAGGTGGTCCTG	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.3736C>T	10.37:g.48381913G>A	ENSP00000224600:p.His1246Tyr	58.0	0.0		34.0	6.0	NM_002900	Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	37	CCDS7218.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.633097	0.29068	.	.	ENSG00000107618	ENST00000224600	T	0.63744	-0.06	4.41	0.911	0.19343	.	1.796310	0.03632	N	0.238040	T	0.41789	0.1174	N	0.08118	0	0.09310	N	1	B	0.24483	0.104	B	0.17433	0.018	T	0.39482	-0.9612	10	0.72032	D	0.01	.	5.3732	0.16150	0.4354:0.0:0.5645:0.0	.	1246	P10745	RET3_HUMAN	Y	1246	ENSP00000224600:H1246Y	ENSP00000224600:H1246Y	H	-	1	0	RBP3	48001919	0.013000	0.17824	0.003000	0.11579	0.012000	0.07955	0.584000	0.23864	0.421000	0.25980	0.561000	0.74099	CAC	.		0.652	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900	
REV3L	5980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	111670435	111670435	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr6:111670435T>C	ENST00000358835.3	-	21	7859	c.7405A>G	c.(7405-7407)Atc>Gtc	p.I2469V	REV3L_ENST00000368805.1_Missense_Mutation_p.I2469V|REV3L_ENST00000435970.1_Missense_Mutation_p.I2391V|REV3L_ENST00000368802.3_Missense_Mutation_p.I2469V			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2469					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TTTCTCATGATTCTCCAAAGA	0.299								DNA polymerases (catalytic subunits)																													p.I2469V		.											.	REV3L	294	0			c.A7405G						.						135.0	129.0	131.0					6																	111670435		2202	4298	6500	SO:0001583	missense	5980	exon20			TCATGATTCTCCA	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.7405A>G	6.37:g.111670435T>C	ENSP00000351697:p.Ile2469Val	111.0	0.0		88.0	16.0	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	37	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	T	13.21	2.168802	0.38315	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970;ENST00000543871	T;T;T;T	0.07688	3.17;3.17;3.17;3.17	5.77	5.77	0.91146	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.276070	0.35320	N	0.003291	T	0.03305	0.0096	L	0.33245	0.995	0.31509	N	0.66389	B	0.15930	0.015	B	0.23419	0.046	T	0.37174	-0.9717	10	0.22706	T	0.39	.	16.0836	0.81023	0.0:0.0:0.0:1.0	.	2469	O60673	DPOLZ_HUMAN	V	2469;2469;2469;2391;542	ENSP00000357792:I2469V;ENSP00000357795:I2469V;ENSP00000351697:I2469V;ENSP00000402003:I2391V	ENSP00000351697:I2469V	I	-	1	0	REV3L	111777128	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.619000	0.54196	2.196000	0.70406	0.528000	0.53228	ATC	.		0.299	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
RFPL3	10738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	32754310	32754310	+	Silent	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr22:32754310C>T	ENST00000249007.4	+	1	457	c.252C>T	c.(250-252)gtC>gtT	p.V84V	RFPL3_ENST00000382088.3_Silent_p.V55V|RFPL3S_ENST00000461833.1_5'Flank|RFPL3_ENST00000397468.1_Silent_p.V55V	NM_001098535.1	NP_001092005.1	O75679	RFPL3_HUMAN	ret finger protein-like 3	84							zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|stomach(1)	15						GTTCCATGGTCTCTCAGAGGA	0.532																																					p.V84V		.											.	RFPL3	91	0			c.C252T						.						128.0	119.0	122.0					22																	32754310		2203	4300	6503	SO:0001819	synonymous_variant	10738	exon1			CATGGTCTCTCAG	AJ010232	CCDS13904.1, CCDS43011.1	22q12	2006-04-25			ENSG00000128276	ENSG00000128276			9980	protein-coding gene	gene with protein product		605970				10508838	Standard	NM_006604		Approved		uc010gwn.3	O75679	OTTHUMG00000030290	ENST00000249007.4:c.252C>T	22.37:g.32754310C>T		119.0	0.0		137.0	25.0	NM_001098535	A2A279|Q6IC03|Q6IC04|Q6NSX3|Q8N5R4	Silent	SNP	ENST00000249007.4	37	CCDS43011.1																																																																																			.		0.532	RFPL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075172.3	NM_006604	
RSAD2	91543	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	7027257	7027257	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr2:7027257A>G	ENST00000382040.3	+	3	836	c.700A>G	c.(700-702)Acg>Gcg	p.T234A	RSAD2_ENST00000541728.1_Missense_Mutation_p.T127A	NM_080657.4	NP_542388.2			radical S-adenosyl methionine domain containing 2											endometrium(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)	20	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			OV - Ovarian serous cystadenocarcinoma(76;0.191)		AGAGGACATGACGGAACAGAT	0.408																																					p.T234A		.											.	RSAD2	90	0			c.A700G						.						83.0	76.0	78.0					2																	7027257		2203	4300	6503	SO:0001583	missense	91543	exon3			GACATGACGGAAC	AF442151	CCDS1656.1	2p25.2	2008-02-05			ENSG00000134321	ENSG00000134321			30908	protein-coding gene	gene with protein product		607810				11752458	Standard	NM_080657		Approved	cig5, viperin, vig1	uc002qyp.1	Q8WXG1	OTTHUMG00000090352	ENST00000382040.3:c.700A>G	2.37:g.7027257A>G	ENSP00000371471:p.Thr234Ala	81.0	0.0		86.0	13.0	NM_080657		Missense_Mutation	SNP	ENST00000382040.3	37	CCDS1656.1	.	.	.	.	.	.	.	.	.	.	A	8.642	0.896251	0.17686	.	.	ENSG00000134321	ENST00000382040;ENST00000541728	D;D	0.90900	-2.75;-2.75	5.79	4.62	0.57501	Elongator protein 3/MiaB/NifB (1);	0.982446	0.08333	N	0.962036	D	0.87720	0.6248	L	0.45137	1.4	0.26788	N	0.969454	B	0.10296	0.003	B	0.10450	0.005	T	0.73981	-0.3811	9	.	.	.	-7.8887	13.0855	0.59138	0.8659:0.1341:0.0:0.0	.	234	Q8WXG1	RSAD2_HUMAN	A	234;127	ENSP00000371471:T234A;ENSP00000440859:T127A	.	T	+	1	0	RSAD2	6944708	0.994000	0.37717	0.785000	0.31869	0.483000	0.33249	3.216000	0.51176	0.990000	0.38787	0.533000	0.62120	ACG	.		0.408	RSAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206724.2	NM_080657	
SACS	26278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	23911712	23911712	+	Silent	SNP	G	G	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr13:23911712G>T	ENST00000382292.3	-	9	6576	c.6303C>A	c.(6301-6303)tcC>tcA	p.S2101S	SACS_ENST00000382298.3_Silent_p.S2101S|SACS_ENST00000402364.1_Silent_p.S1351S			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2101					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GCCCCTCCAAGGAACAAGGAA	0.398																																					p.S2101S		.											.	SACS	298	0			c.C6303A						.						61.0	61.0	61.0					13																	23911712		2203	4299	6502	SO:0001819	synonymous_variant	26278	exon10			CTCCAAGGAACAA	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.6303C>A	13.37:g.23911712G>T		57.0	0.0		62.0	12.0	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	ENST00000382292.3	37	CCDS9300.2																																																																																			.		0.398	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
SDK1	221935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	3998620	3998620	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr7:3998620C>T	ENST00000404826.2	+	8	1347	c.1208C>T	c.(1207-1209)aCt>aTt	p.T403I	SDK1_ENST00000389531.3_Missense_Mutation_p.T403I	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	403	Ig-like C2-type 4.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GTAGAAGAAACTGTGGACATC	0.468																																					p.T403I		.											.	SDK1	138	0			c.C1208T						.						122.0	120.0	121.0					7																	3998620		2203	4300	6503	SO:0001583	missense	221935	exon8			AAGAAACTGTGGA	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.1208C>T	7.37:g.3998620C>T	ENSP00000385899:p.Thr403Ile	56.0	0.0		58.0	9.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	C	5.957	0.360578	0.11296	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.69306	-0.39;-0.39	5.35	3.48	0.39840	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.192456	0.33040	N	0.005348	T	0.61590	0.2359	M	0.70595	2.14	0.19300	N	0.999974	P	0.41524	0.753	B	0.41691	0.364	T	0.55023	-0.8205	10	0.37606	T	0.19	.	4.8625	0.13590	0.289:0.5132:0.1254:0.0723	.	403	Q7Z5N4	SDK1_HUMAN	I	403	ENSP00000385899:T403I;ENSP00000374182:T403I	ENSP00000374182:T403I	T	+	2	0	SDK1	3965146	0.000000	0.05858	0.485000	0.27403	0.276000	0.26787	0.129000	0.15830	0.696000	0.31696	0.655000	0.94253	ACT	.		0.468	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
SEL1L2	80343	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	13830846	13830846	+	Silent	SNP	C	C	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr20:13830846C>A	ENST00000284951.5	-	19	2012	c.1938G>T	c.(1936-1938)ctG>ctT	p.L646L	SEL1L2_ENST00000378072.5_Silent_p.L533L|SEL1L2_ENST00000486903.1_5'UTR			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	646						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						CATTAAAAAACAGGATATCCC	0.468																																					p.L533L		.											.	SEL1L2	70	0			c.G1599T						.						79.0	75.0	76.0					20																	13830846		1909	4127	6036	SO:0001819	synonymous_variant	80343	exon17			AAAAAACAGGATA	AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.1938G>T	20.37:g.13830846C>A		50.0	0.0		62.0	14.0	NM_001271539	B4DXX5	Silent	SNP	ENST00000284951.5	37																																																																																				.		0.468	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078067.3	NM_025229	
SEMA6D	80031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48058317	48058317	+	Silent	SNP	T	T	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr15:48058317T>G	ENST00000316364.5	+	15	2023	c.1584T>G	c.(1582-1584)tcT>tcG	p.S528S	SEMA6D_ENST00000536845.2_Silent_p.S528S|SEMA6D_ENST00000558014.1_Silent_p.S528S|SEMA6D_ENST00000354744.4_Silent_p.S528S|SEMA6D_ENST00000358066.4_Silent_p.S528S|SEMA6D_ENST00000389428.3_Silent_p.S528S|SEMA6D_ENST00000389432.2_Silent_p.S528S|SEMA6D_ENST00000537942.1_Silent_p.S528S|SEMA6D_ENST00000355997.3_Silent_p.S528S|SEMA6D_ENST00000558816.1_Silent_p.S528S|SEMA6D_ENST00000389433.2_Silent_p.S528S	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	528	PSI.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GTATTGCATCTCGTGACCCGT	0.438																																					p.S528S		.											.	SEMA6D	138	0			c.T1584G						.						116.0	101.0	106.0					15																	48058317		2198	4297	6495	SO:0001819	synonymous_variant	80031	exon15			TGCATCTCGTGAC	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.1584T>G	15.37:g.48058317T>G		113.0	0.0		108.0	23.0	NM_153617	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Silent	SNP	ENST00000316364.5	37	CCDS32225.1																																																																																			.		0.438	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
SHC2	25759	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	430742	430742	+	Silent	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr19:430742T>C	ENST00000264554.6	-	9	1115	c.1116A>G	c.(1114-1116)ccA>ccG	p.P372P		NM_012435.2	NP_036567.2	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing) transforming protein 2	372	CH1.				activation of MAPK activity (GO:0000187)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)	cytosol (GO:0005829)				endometrium(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGAAGGAGATGGGCCCTGGA	0.632																																					p.P372P		.											.	SHC2	392	0			c.A1116G						.						57.0	68.0	65.0					19																	430742		1945	4137	6082	SO:0001819	synonymous_variant	25759	exon9			AGGAGATGGGCCC	AB001451	CCDS45891.1	19p13.3	2013-02-14				ENSG00000129946		"""SH2 domain containing"""	29869	protein-coding gene	gene with protein product	"""neuronal Shc adaptor homolog"""	605217				7527937, 9507002	Standard	NM_012435		Approved	SLI, SCK, SHCB	uc002loq.4	P98077		ENST00000264554.6:c.1116A>G	19.37:g.430742T>C		64.0	0.0		41.0	11.0	NM_012435	O60230|Q9NPL5|Q9UCX4	Silent	SNP	ENST00000264554.6	37	CCDS45891.1																																																																																			.		0.632	SHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451840.3		
SHCBP1	79801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	46617445	46617445	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr16:46617445G>C	ENST00000303383.3	-	12	1942	c.1676C>G	c.(1675-1677)gCt>gGt	p.A559G		NM_024745.4	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	559					fibroblast growth factor receptor signaling pathway (GO:0008543)|regulation of neural precursor cell proliferation (GO:2000177)					breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				TCCATCTTCAGCATTTTCTTG	0.313																																					p.A559G		.											.	SHCBP1	154	0			c.C1676G						.						61.0	65.0	64.0					16																	46617445		2202	4298	6500	SO:0001583	missense	79801	exon12			TCTTCAGCATTTT	AK055931	CCDS10720.1	16q11	2008-02-05			ENSG00000171241	ENSG00000171241			29547	protein-coding gene	gene with protein product		611027				10086341	Standard	NM_024745		Approved	FLJ22009	uc002eec.4	Q8NEM2	OTTHUMG00000132540	ENST00000303383.3:c.1676C>G	16.37:g.46617445G>C	ENSP00000306473:p.Ala559Gly	342.0	0.0		320.0	34.0	NM_024745	Q96N60|Q9BVS0|Q9H6P6	Missense_Mutation	SNP	ENST00000303383.3	37	CCDS10720.1	.	.	.	.	.	.	.	.	.	.	G	5.568	0.289563	0.10567	.	.	ENSG00000171241	ENST00000303383	T	0.24723	1.84	3.85	-0.067	0.13762	.	1.065300	0.07195	N	0.856398	T	0.16041	0.0386	N	0.19112	0.55	0.09310	N	1	B	0.17038	0.02	B	0.19148	0.024	T	0.33574	-0.9863	10	0.62326	D	0.03	0.0779	5.348	0.16020	0.204:0.0:0.6454:0.1506	.	559	Q8NEM2	SHCBP_HUMAN	G	559	ENSP00000306473:A559G	ENSP00000306473:A559G	A	-	2	0	SHCBP1	45174946	0.523000	0.26274	0.058000	0.19502	0.302000	0.27658	1.296000	0.33389	-0.086000	0.12550	0.460000	0.39030	GCT	.		0.313	SHCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255740.1	NM_024745	
SLAMF8	56833	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	159802826	159802826	+	Silent	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr1:159802826A>G	ENST00000289707.5	+	3	677	c.528A>G	c.(526-528)ccA>ccG	p.P176P	C1orf204_ENST00000491974.1_5'Flank|SLAMF8_ENST00000368104.4_Silent_p.P67P|SLAMF8_ENST00000471286.1_3'UTR	NM_020125.2	NP_064510.1	Q9P0V8	SLAF8_HUMAN	SLAM family member 8	176	Ig-like C2-type.				cellular response to drug (GO:0035690)|defense response to bacterium (GO:0042742)|phagosome acidification (GO:0090383)|regulation of kinase activity (GO:0043549)|regulation of NAD(P)H oxidase activity (GO:0033860)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|large_intestine(4)|lung(6)	12	all_hematologic(112;0.0597)					GTATGGAACCACACAGCCTCT	0.547																																					p.P176P		.											.	SLAMF8	90	0			c.A528G						.						139.0	125.0	130.0					1																	159802826		2203	4300	6503	SO:0001819	synonymous_variant	56833	exon3			GGAACCACACAGC	AF146761	CCDS1188.1	1q23.1	2013-01-11			ENSG00000158714	ENSG00000158714		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21391	protein-coding gene	gene with protein product		606620				11313408	Standard	NM_020125		Approved	BLAME, SBBI42, CD353	uc001fue.4	Q9P0V8	OTTHUMG00000035433	ENST00000289707.5:c.528A>G	1.37:g.159802826A>G		64.0	0.0		65.0	7.0	NM_020125	Q32MC6|Q5VU15	Silent	SNP	ENST00000289707.5	37	CCDS1188.1																																																																																			.		0.547	SLAMF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085983.1	NM_020125	
SHCBP1L	81626	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	182872216	182872216	+	Silent	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr1:182872216G>A	ENST00000367547.3	-	9	1904	c.1668C>T	c.(1666-1668)acC>acT	p.T556T	SHCBP1L_ENST00000488956.1_5'UTR|SHCBP1L_ENST00000423786.1_Silent_p.T437T	NM_030933.2	NP_112195.2	Q9BZQ2	SHP1L_HUMAN	SHC SH2-domain binding protein 1-like	628										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|pancreas(1)|prostate(1)|skin(2)	15						AACTGTTACTGGTTCTGAGGT	0.323																																					p.T556T		.											.	SHCBP1L	91	0			c.C1668T						.						113.0	115.0	115.0					1																	182872216		2203	4298	6501	SO:0001819	synonymous_variant	81626	exon9			GTTACTGGTTCTG	AF288397	CCDS30955.1	1q25	2011-01-24	2011-01-24	2011-01-24	ENSG00000157060	ENSG00000157060			16788	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 14"""	C1orf14		11318611	Standard	NM_030933		Approved		uc001gpu.3	Q9BZQ2	OTTHUMG00000035419	ENST00000367547.3:c.1668C>T	1.37:g.182872216G>A		82.0	0.0		83.0	19.0	NM_030933	Q4G195|Q9BZQ3|Q9H2B6	Silent	SNP	ENST00000367547.3	37	CCDS30955.1																																																																																			.		0.323	SHCBP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085956.1	NM_030933	
SLC44A2	57153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10742002	10742002	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr19:10742002A>G	ENST00000335757.5	+	6	758	c.382A>G	c.(382-384)Agc>Ggc	p.S128G	SLC44A2_ENST00000586078.1_Missense_Mutation_p.S128G|SLC44A2_ENST00000407327.4_Missense_Mutation_p.S126G			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	128					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	GAATGCTCGCAGCTCCCGGGA	0.532																																					p.S128G		.											.	SLC44A2	91	0			c.A382G						.						119.0	121.0	120.0					19																	10742002		2203	4300	6503	SO:0001583	missense	57153	exon6			GCTCGCAGCTCCC	AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.382A>G	19.37:g.10742002A>G	ENSP00000336888:p.Ser128Gly	49.0	0.0		57.0	9.0	NM_020428	B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Missense_Mutation	SNP	ENST00000335757.5	37	CCDS12245.1	.	.	.	.	.	.	.	.	.	.	A	5.402	0.259277	0.10239	.	.	ENSG00000129353	ENST00000407327;ENST00000335757;ENST00000380614	T;T	0.10005	2.92;2.92	4.71	-0.041	0.13869	.	0.976571	0.08374	N	0.955563	T	0.09113	0.0225	L	0.41492	1.28	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43718	-0.9374	10	0.20046	T	0.44	.	8.7421	0.34564	0.6438:0.0:0.3562:0.0	.	128;126	Q8IWA5;Q8IWA5-3	CTL2_HUMAN;.	G	126;128;128	ENSP00000385135:S126G;ENSP00000336888:S128G	ENSP00000336888:S128G	S	+	1	0	SLC44A2	10603002	0.000000	0.05858	0.000000	0.03702	0.704000	0.40688	-0.166000	0.09954	-0.221000	0.09973	0.374000	0.22700	AGC	.		0.532	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452045.1		
SLC6A19	340024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	1216776	1216776	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr5:1216776C>A	ENST00000304460.10	+	7	1047	c.991C>A	c.(991-993)Cag>Aag	p.Q331K		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	331					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CCGCGCCACACAGCGCTACGA	0.612																																					p.Q331K		.											.	SLC6A19	90	0			c.C991A						.						217.0	157.0	177.0					5																	1216776		2203	4300	6503	SO:0001583	missense	340024	exon7			GCCACACAGCGCT	AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.991C>A	5.37:g.1216776C>A	ENSP00000305302:p.Gln331Lys	58.0	0.0		62.0	9.0	NM_001003841	A8K446	Missense_Mutation	SNP	ENST00000304460.10	37	CCDS34130.1	.	.	.	.	.	.	.	.	.	.	C	3.838	-0.034445	0.07543	.	.	ENSG00000174358	ENST00000304460	T	0.73363	-0.74	4.61	2.75	0.32379	.	0.292824	0.36234	N	0.002716	T	0.55545	0.1927	N	0.17838	0.53	0.23376	N	0.997808	B	0.06786	0.001	B	0.13407	0.009	T	0.28202	-1.0051	10	0.05959	T	0.93	.	14.2262	0.65860	0.0:0.2986:0.7014:0.0	.	331	Q695T7	S6A19_HUMAN	K	331	ENSP00000305302:Q331K	ENSP00000305302:Q331K	Q	+	1	0	SLC6A19	1269776	0.998000	0.40836	0.249000	0.24280	0.006000	0.05464	2.621000	0.46418	0.349000	0.23975	-0.479000	0.04858	CAG	.		0.612	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365557.1	XM_291120	
SLC9A4	389015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	103120102	103120102	+	Missense_Mutation	SNP	G	G	A	rs541859382		TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr2:103120102G>A	ENST00000295269.4	+	3	1373	c.916G>A	c.(916-918)Gtc>Atc	p.V306I		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	306					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GCCACTCATCGTCTTCATGTT	0.428																																					p.V306I		.											.	SLC9A4	92	0			c.G916A						.						221.0	206.0	211.0					2																	103120102		2203	4300	6503	SO:0001583	missense	389015	exon3			CTCATCGTCTTCA		CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.916G>A	2.37:g.103120102G>A	ENSP00000295269:p.Val306Ile	113.0	0.0		113.0	18.0	NM_001011552	Q69YK0	Missense_Mutation	SNP	ENST00000295269.4	37	CCDS33264.1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874774	0.72180	.	.	ENSG00000180251	ENST00000295269	T	0.17528	2.27	5.61	5.61	0.85477	Cation/H+ exchanger (1);	0.052565	0.85682	D	0.000000	T	0.15825	0.0381	N	0.13272	0.32	0.44871	D	0.997886	D	0.55800	0.973	P	0.48270	0.572	T	0.08513	-1.0718	10	0.14656	T	0.56	.	20.0018	0.97417	0.0:0.0:1.0:0.0	.	306	Q6AI14	SL9A4_HUMAN	I	306	ENSP00000295269:V306I	ENSP00000295269:V306I	V	+	1	0	SLC9A4	102486534	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	4.413000	0.59795	2.793000	0.96121	0.655000	0.94253	GTC	.		0.428	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329498.1	NM_001011552.3	
SPINK5	11005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	147481371	147481371	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr5:147481371A>T	ENST00000256084.7	+	15	1372	c.1330A>T	c.(1330-1332)Agg>Tgg	p.R444W	SPINK5_ENST00000398454.1_Missense_Mutation_p.R444W|SPINK5_ENST00000359874.3_Missense_Mutation_p.R444W	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	444	Kazal-like 7. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCAAATCCAGGAAAAACGG	0.458																																					p.R444W		.											.	SPINK5	138	0			c.A1330T						.						102.0	97.0	99.0					5																	147481371		1879	4109	5988	SO:0001583	missense	11005	exon15			AAATCCAGGAAAA	AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.1330A>T	5.37:g.147481371A>T	ENSP00000256084:p.Arg444Trp	93.0	0.0		92.0	9.0	NM_001127699	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	ENST00000256084.7	37	CCDS43382.1	.	.	.	.	.	.	.	.	.	.	A	9.490	1.100481	0.20552	.	.	ENSG00000133710	ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	T;T;T;T	0.06687	3.27;3.27;3.27;3.27	3.99	-0.0887	0.13672	Proteinase inhibitor I1, Kazal (1);	0.878007	0.09732	N	0.763072	T	0.09069	0.0224	L	0.57536	1.79	0.09310	N	1	B;B;B;B	0.13145	0.002;0.007;0.002;0.007	B;B;B;B	0.17722	0.006;0.019;0.004;0.013	T	0.36768	-0.9734	10	0.66056	D	0.02	-0.8881	4.2672	0.10769	0.4664:0.1843:0.0:0.3492	.	425;444;444;444	B4DWS3;Q9NQ38-3;Q9NQ38;Q9NQ38-2	.;.;ISK5_HUMAN;.	W	444;444;425;444	ENSP00000381472:R444W;ENSP00000352936:R444W;ENSP00000421519:R425W;ENSP00000256084:R444W	ENSP00000256084:R444W	R	+	1	2	SPINK5	147461564	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.237000	0.08990	-0.012000	0.14223	0.528000	0.53228	AGG	.		0.458	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000259215.2	NM_001127698	
SSPO	23145	broad.mit.edu;ucsc.edu;mdanderson.org	37	7	149521651	149521651	+	RNA	SNP	A	A	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr7:149521651A>T	ENST00000378016.2	+	0	13730							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CAGCACCGCCACCGGCTCTGT	0.697																																					p.H4577L		.											.	.	.	0			c.A13730T						.						20.0	24.0	23.0					7																	149521651		1980	4148	6128			23145	exon95			ACCGCCACCGGCT	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149521651A>T		31.0	0.0		28.0	5.0	NM_198455	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																				.		0.697	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
STAT2	6773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56742763	56742763	+	Silent	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr12:56742763A>G	ENST00000314128.4	-	17	1544	c.1521T>C	c.(1519-1521)taT>taC	p.Y507Y	STAT2_ENST00000556539.1_5'UTR|STAT2_ENST00000557235.1_Silent_p.Y503Y			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	507					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						CTCGGCCAACATAGGAGGAGA	0.567																																					p.Y507Y		.											.	STAT2	847	0			c.T1521C						.						71.0	72.0	72.0					12																	56742763		2203	4300	6503	SO:0001819	synonymous_variant	6773	exon17			GCCAACATAGGAG	BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.1521T>C	12.37:g.56742763A>G		27.0	0.0		43.0	6.0	NM_005419	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Silent	SNP	ENST00000314128.4	37	CCDS8917.1																																																																																			.		0.567	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410277.1	NM_005419	
STXBP3	6814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	109340861	109340861	+	Splice_Site	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr1:109340861T>C	ENST00000370008.3	+	16	1499		c.e16+2			NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3						blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		ATTATGGAGGTAAAAATCATT	0.358																																					.		.											.	STXBP3	93	0			c.1449+2T>C						.						74.0	80.0	78.0					1																	109340861		2203	4299	6502	SO:0001630	splice_region_variant	6814	exon16			TGGAGGTAAAAAT	D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.1449+2T>C	1.37:g.109340861T>C		343.0	0.0		344.0	43.0	NM_007269	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Splice_Site	SNP	ENST00000370008.3	37	CCDS790.1	.	.	.	.	.	.	.	.	.	.	T	19.85	3.904031	0.72754	.	.	ENSG00000116266	ENST00000370008	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2063	0.65737	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	STXBP3	109142384	1.000000	0.71417	0.998000	0.56505	0.855000	0.48748	6.965000	0.76067	2.097000	0.63578	0.477000	0.44152	.	.		0.358	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1	NM_007269	Intron
SYNE2	23224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	64628942	64628942	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr14:64628942T>C	ENST00000344113.4	+	88	16459	c.16247T>C	c.(16246-16248)aTg>aCg	p.M5416T	SYNE2_ENST00000554584.1_Missense_Mutation_p.M5333T|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Missense_Mutation_p.M2050T|SYNE2_ENST00000394768.2_Missense_Mutation_p.M1801T|SYNE2_ENST00000357395.3_Missense_Mutation_p.M1801T|SYNE2_ENST00000358025.3_Missense_Mutation_p.M5416T	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5416					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AACATCAGCATGTCTGGAAAC	0.537																																					p.M5416T		.											.	SYNE2	164	0			c.T16247C						.						110.0	103.0	105.0					14																	64628942		2203	4300	6503	SO:0001583	missense	23224	exon88			TCAGCATGTCTGG	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.16247T>C	14.37:g.64628942T>C	ENSP00000341781:p.Met5416Thr	57.0	0.0		54.0	11.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	T	15.14	2.743982	0.49151	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.55234	0.92;4.23;0.93;0.53;4.28;4.23	5.84	1.04	0.20106	.	0.367169	0.23581	N	0.046645	T	0.32010	0.0815	N	0.25890	0.77	0.80722	D	1	B;B;B;B;B	0.10296	0.0;0.001;0.001;0.0;0.003	B;B;B;B;B	0.06405	0.002;0.002;0.001;0.001;0.002	T	0.07214	-1.0784	10	0.13108	T	0.6	.	8.0715	0.30691	0.0:0.3142:0.0:0.6858	.	1801;5339;5333;5416;5416	Q8WXH0-7;F8WAA3;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;.;SYNE2_HUMAN;.	T	5416;1801;5416;5333;5339;2050;1801	ENSP00000350719:M5416T;ENSP00000349969:M1801T;ENSP00000341781:M5416T;ENSP00000452570:M5333T;ENSP00000450831:M2050T;ENSP00000378249:M1801T	ENSP00000261678:M5339T	M	+	2	0	SYNE2	63698695	0.996000	0.38824	0.990000	0.47175	0.991000	0.79684	0.658000	0.24979	0.159000	0.19401	0.533000	0.62120	ATG	.		0.537	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
SYT10	341359	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	33592330	33592330	+	Frame_Shift_Del	DEL	C	C	-	rs561584640		TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr12:33592330delC	ENST00000228567.3	-	1	424	c.128delG	c.(127-129)ggcfs	p.G43fs	SYT10_ENST00000535526.1_5'UTR	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	43					regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					GCCCTGGCTGCCCCTGTCCCG	0.682																																					p.G43fs		.											.	SYT10	92	0			c.128delG						.						106.0	104.0	105.0					12																	33592330		2203	4300	6503	SO:0001589	frameshift_variant	341359	exon1			TGGCTGCCCCTGT	AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.128delG	12.37:g.33592330delC	ENSP00000228567:p.Gly43fs	52.0	0.0		53.0	13.0	NM_198992	Q495U2	Frame_Shift_Del	DEL	ENST00000228567.3	37	CCDS8732.1																																																																																			.		0.682	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403222.1	NM_198992	
TBL1XR1	79718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	176755936	176755936	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr3:176755936C>A	ENST00000430069.1	-	12	1331	c.1072G>T	c.(1072-1074)Gac>Tac	p.D358Y	TBL1XR1_ENST00000457928.2_Missense_Mutation_p.D358Y			Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	358					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			CCAGTTGGGTCCCATTTGATA	0.363																																					p.D358Y		.											.	TBL1XR1	187	0			c.G1072T						.						88.0	84.0	85.0					3																	176755936		1867	4100	5967	SO:0001583	missense	79718	exon12			TTGGGTCCCATTT	AK022956	CCDS46961.1	3q26.33	2013-01-10	2008-01-17		ENSG00000177565	ENSG00000177565		"""WD repeat domain containing"""	29529	protein-coding gene	gene with protein product		608628	"""transducin (beta)-like 1X-linked receptor 1"""			11063877, 11931768	Standard	NM_024665		Approved	IRA1, FLJ12894, TBLR1, C21, DC42	uc003fix.4	Q9BZK7	OTTHUMG00000157140	ENST00000430069.1:c.1072G>T	3.37:g.176755936C>A	ENSP00000405574:p.Asp358Tyr	201.0	0.0		251.0	42.0	NM_024665	D3DNQ9|Q14DC3|Q9H2I1|Q9H9A1	Missense_Mutation	SNP	ENST00000430069.1	37	CCDS46961.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.799932	0.90538	.	.	ENSG00000177565	ENST00000430069;ENST00000457928;ENST00000536758	T;T	0.60920	0.15;0.15	5.48	5.48	0.80851	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.73877	0.3643	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.75596	-0.3263	10	0.72032	D	0.01	-6.249	18.3369	0.90291	0.0:1.0:0.0:0.0	.	358	Q9BZK7	TBL1R_HUMAN	Y	358;358;220	ENSP00000405574:D358Y;ENSP00000413251:D358Y	ENSP00000405574:D358Y	D	-	1	0	TBL1XR1	178238630	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.741000	0.84997	2.581000	0.87130	0.585000	0.79938	GAC	.		0.363	TBL1XR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347587.3	NM_024665	
TBX4	9496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	59557329	59557329	+	Splice_Site	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr17:59557329A>G	ENST00000240335.1	+	6	835	c.790A>G	c.(790-792)Agc>Ggc	p.S264G	TBX4_ENST00000589449.1_3'UTR|TBX4_ENST00000393853.4_Splice_Site_p.S264G	NM_018488.2	NP_060958.2	P57082	TBX4_HUMAN	T-box 4	264					angiogenesis (GO:0001525)|embryonic limb morphogenesis (GO:0030326)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(15)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CCGACTGCAGAGGTGGGGCTG	0.587																																					p.S264G		.											.	TBX4	227	0			c.A790G						.						68.0	72.0	70.0					17																	59557329		2203	4300	6503	SO:0001630	splice_region_variant	9496	exon6			CTGCAGAGGTGGG	AF188703	CCDS11629.1	17q21-q22	2005-10-11				ENSG00000121075		"""T-boxes"""	11603	protein-coding gene	gene with protein product		601719				10945475	Standard	NM_018488		Approved		uc002izi.3	P57082		ENST00000240335.1:c.791+1A>G	17.37:g.59557329A>G		65.0	0.0		79.0	10.0	NM_018488	A5PKU7|B2RMT1|B7ZLV3	Missense_Mutation	SNP	ENST00000240335.1	37	CCDS11629.1	.	.	.	.	.	.	.	.	.	.	A	16.85	3.236750	0.58886	.	.	ENSG00000121075	ENST00000393853;ENST00000240335	D;D	0.81908	-1.55;-1.55	5.43	5.43	0.79202	.	0.142496	0.64402	D	0.000003	D	0.85435	0.5696	L	0.38838	1.175	0.49582	D	0.999803	D;D	0.54964	0.969;0.969	D;D	0.63381	0.914;0.914	D	0.84586	0.0664	9	.	.	.	.	14.6668	0.68915	1.0:0.0:0.0:0.0	.	264;264	A5PKU7;P57082	.;TBX4_HUMAN	G	264	ENSP00000377435:S264G;ENSP00000240335:S264G	.	S	+	1	0	TBX4	56912111	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.682000	0.68182	2.049000	0.60858	0.459000	0.35465	AGC	.		0.587	TBX4-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449649.1	NM_018488	Missense_Mutation
TEDDM1	127670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	182369506	182369506	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr1:182369506G>C	ENST00000367565.1	-	1	245	c.115C>G	c.(115-117)Ctc>Gtc	p.L39V		NM_172000.3	NP_741997.3	Q5T9Z0	TEDM1_HUMAN	transmembrane epididymal protein 1	39						integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(2)	7						AATGTTAAGAGGGAGCCAGTC	0.473																																					p.L39V		.											.	TEDDM1	92	0			c.C115G						.						148.0	127.0	134.0					1																	182369506		2203	4300	6503	SO:0001583	missense	127670	exon1			TTAAGAGGGAGCC	AJ515384	CCDS30953.1	1q25.3	2009-09-17		2005-08-09	ENSG00000203730	ENSG00000203730			30233	protein-coding gene	gene with protein product	"""putative membrane protein HE9"", ""transmembrane protein 45C"", ""epididymal protein 9"""						Standard	NM_172000		Approved	HE9, Epdd1, TMEM45C, EDDM9	uc001gpe.3	Q5T9Z0	OTTHUMG00000037398	ENST00000367565.1:c.115C>G	1.37:g.182369506G>C	ENSP00000356536:p.Leu39Val	102.0	0.0		121.0	15.0	NM_172000	Q8IVJ0	Missense_Mutation	SNP	ENST00000367565.1	37	CCDS30953.1	.	.	.	.	.	.	.	.	.	.	G	6.955	0.546171	0.13312	.	.	ENSG00000203730	ENST00000367565	T	0.48836	0.8	5.05	-10.1	0.00402	.	2.497220	0.01289	N	0.009955	T	0.25606	0.0623	N	0.25890	0.77	0.09310	N	1	B	0.15473	0.013	B	0.17433	0.018	T	0.10359	-1.0633	10	0.19590	T	0.45	-0.3392	2.5543	0.04756	0.1252:0.2266:0.2989:0.3493	.	39	Q5T9Z0	TEDM1_HUMAN	V	39	ENSP00000356536:L39V	ENSP00000356536:L39V	L	-	1	0	TEDDM1	180636129	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-1.551000	0.02178	-1.921000	0.01068	-0.274000	0.10170	CTC	.		0.473	TEDDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091029.1	NM_172000	
TIMD4	91937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	156375492	156375492	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr5:156375492A>T	ENST00000274532.2	-	5	835	c.779T>A	c.(778-780)cTc>cAc	p.L260H	TIMD4_ENST00000407087.3_Intron	NM_138379.2	NP_612388.2	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain containing 4	260	Ser-rich.					integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(23)|ovary(2)|skin(2)	37	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGTTGATGGGAGATCCCAAAC	0.413																																					p.L260H		.											.	TIMD4	92	0			c.T779A						.						73.0	62.0	66.0					5																	156375492		2203	4300	6503	SO:0001583	missense	91937	exon5			GATGGGAGATCCC	BC008988	CCDS4332.1, CCDS54943.1	5q33.3	2013-01-11			ENSG00000145850	ENSG00000145850		"""Immunoglobulin superfamily / V-set domain containing"""	25132	protein-coding gene	gene with protein product		610096				12477932	Standard	NM_001146726		Approved		uc003lwh.2	Q96H15	OTTHUMG00000130244	ENST00000274532.2:c.779T>A	5.37:g.156375492A>T	ENSP00000274532:p.Leu260His	74.0	0.0		80.0	12.0	NM_138379	B5MCL9	Missense_Mutation	SNP	ENST00000274532.2	37	CCDS4332.1	.	.	.	.	.	.	.	.	.	.	A	12.99	2.102577	0.37145	.	.	ENSG00000145850	ENST00000274532	T	0.26518	1.73	4.12	2.92	0.33932	.	1.052400	0.07506	N	0.908096	T	0.17492	0.0420	L	0.32530	0.975	0.09310	N	1	P	0.36974	0.576	B	0.27796	0.083	T	0.19484	-1.0304	10	0.62326	D	0.03	-5.9091	6.8157	0.23829	0.7931:0.0:0.0:0.2069	.	260	Q96H15	TIMD4_HUMAN	H	260	ENSP00000274532:L260H	ENSP00000274532:L260H	L	-	2	0	TIMD4	156308070	0.006000	0.16342	0.003000	0.11579	0.009000	0.06853	0.624000	0.24462	0.885000	0.36088	0.482000	0.46254	CTC	.		0.413	TIMD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252568.1	NM_138379	
TLR3	7098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	186998195	186998195	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr4:186998195A>G	ENST00000296795.3	+	2	526	c.422A>G	c.(421-423)aAt>aGt	p.N141S		NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	141					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		ATTAAAAATAATCCCTTTGTC	0.338																																					p.N141S		.											.	TLR3	524	0			c.A422G						.						35.0	36.0	36.0					4																	186998195		2203	4300	6503	SO:0001583	missense	7098	exon2			AAAATAATCCCTT	U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.422A>G	4.37:g.186998195A>G	ENSP00000296795:p.Asn141Ser	101.0	0.0		137.0	24.0	NM_003265	B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Missense_Mutation	SNP	ENST00000296795.3	37	CCDS3846.1	.	.	.	.	.	.	.	.	.	.	A	10.28	1.306594	0.23736	.	.	ENSG00000164342	ENST00000296795;ENST00000513189;ENST00000542020	T;T	0.78707	0.53;-1.2	5.86	5.86	0.93980	.	0.380726	0.34676	N	0.003769	T	0.65780	0.2724	N	0.21617	0.685	0.80722	D	1	B	0.10296	0.003	B	0.15484	0.013	T	0.60999	-0.7151	10	0.14252	T	0.57	.	16.2668	0.82588	1.0:0.0:0.0:0.0	.	141	O15455	TLR3_HUMAN	S	141	ENSP00000296795:N141S;ENSP00000423386:N141S	ENSP00000296795:N141S	N	+	2	0	TLR3	187235189	0.989000	0.36119	0.656000	0.29637	0.075000	0.17131	7.133000	0.77259	2.240000	0.73641	0.533000	0.62120	AAT	.		0.338	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360313.4		
TNS4	84951	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	38638655	38638655	+	Silent	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr17:38638655A>G	ENST00000254051.6	-	7	1673	c.1515T>C	c.(1513-1515)aaT>aaC	p.N505N		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	505	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			GGATGAGGTCATTGCTGTCCT	0.557																																					p.N505N		.											.	TNS4	155	0			c.T1515C						.						92.0	85.0	87.0					17																	38638655		2203	4300	6503	SO:0001819	synonymous_variant	84951	exon7			GAGGTCATTGCTG	AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.1515T>C	17.37:g.38638655A>G		29.0	0.0		50.0	8.0	NM_032865	A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Silent	SNP	ENST00000254051.6	37	CCDS11368.1																																																																																			.		0.557	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257154.3	NM_032865	
TP53BP2	7159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	223983762	223983762	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr1:223983762T>A	ENST00000343537.7	-	13	2770	c.2479A>T	c.(2479-2481)Agt>Tgt	p.S827C	TP53BP2_ENST00000391879.2_Missense_Mutation_p.S60C|TP53BP2_ENST00000498843.1_5'UTR|TP53BP2_ENST00000391878.2_Missense_Mutation_p.S698C	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	821	Pro-rich.				cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		GGCATGTCACTGTTCTCTGTA	0.502																																					p.S827C		.											.	TP53BP2	229	0			c.A2479T						.						124.0	122.0	122.0					1																	223983762		2203	4300	6503	SO:0001583	missense	7159	exon13			TGTCACTGTTCTC	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.2479A>T	1.37:g.223983762T>A	ENSP00000341957:p.Ser827Cys	60.0	0.0		96.0	14.0	NM_001031685	B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	ENST00000343537.7	37	CCDS44319.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.32|12.32	1.901247|1.901247	0.33535|0.33535	.|.	.|.	ENSG00000143514|ENSG00000143514	ENST00000494100|ENST00000391878;ENST00000343537;ENST00000391879	.|T;T;T	.|0.50813	.|0.78;0.95;0.73	5.55|5.55	1.79|1.79	0.24919|0.24919	.|.	.|0.654370	.|0.17801	.|N	.|0.161563	T|T	0.39627|0.39627	0.1085|0.1085	L|L	0.56769|0.56769	1.78|1.78	0.09310|0.09310	N|N	0.999994|0.999994	.|P;P	.|0.45348	.|0.856;0.726	.|B;B	.|0.40101	.|0.319;0.156	T|T	0.25745|0.25745	-1.0123|-1.0123	5|10	.|0.51188	.|T	.|0.08	.|.	6.7368|6.7368	0.23413|0.23413	0.0:0.1363:0.1283:0.7354|0.0:0.1363:0.1283:0.7354	.|.	.|827;821	.|B4DG66;Q13625	.|.;ASPP2_HUMAN	L|C	160|698;827;60	.|ENSP00000375750:S698C;ENSP00000341957:S827C;ENSP00000375751:S60C	.|ENSP00000341957:S827C	Q|S	-|-	2|1	0|0	TP53BP2|TP53BP2	222050385|222050385	0.001000|0.001000	0.12720|0.12720	0.601000|0.601000	0.28877|0.28877	0.224000|0.224000	0.24922|0.24922	1.230000|1.230000	0.32612|0.32612	0.410000|0.410000	0.25675|0.25675	0.460000|0.460000	0.39030|0.39030	CAG|AGT	.		0.502	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426	
TRPM5	29850	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	2429133	2429133	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr11:2429133A>T	ENST00000155858.6	-	19	2800	c.2792T>A	c.(2791-2793)gTg>gAg	p.V931E	TRPM5_ENST00000533060.1_Missense_Mutation_p.V931E|AC124057.5_ENST00000433035.1_RNA|TRPM5_ENST00000528453.1_Missense_Mutation_p.V931E|TRPM5_ENST00000452833.1_Missense_Mutation_p.V933E	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		GGAGCAGTTCACACGGGCTTC	0.627																																					p.V931E	NSCLC(1;49 61 17205 18850 43201)	.											.	TRPM5	137	0			c.T2792A						.						108.0	95.0	100.0					11																	2429133		2202	4299	6501	SO:0001583	missense	29850	exon19			CAGTTCACACGGG	AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.2792T>A	11.37:g.2429133A>T	ENSP00000155858:p.Val931Glu	97.0	0.0		117.0	16.0	NM_014555		Missense_Mutation	SNP	ENST00000155858.6	37	CCDS31340.1	.	.	.	.	.	.	.	.	.	.	A	9.329	1.060166	0.19987	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453	T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56	3.56	3.56	0.40772	Ion transport (1);	0.494629	0.19916	U	0.103196	T	0.34861	0.0912	N	0.01576	-0.805	0.33515	D	0.591694	B;B;B	0.34103	0.128;0.437;0.371	B;B;B	0.34093	0.03;0.175;0.064	T	0.45862	-0.9232	10	0.08837	T	0.75	-24.4573	5.1953	0.15233	0.7714:0.0:0.2286:0.0	.	931;933;931	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	E	925;931;933;931;931	ENSP00000434383:V925E;ENSP00000155858:V931E;ENSP00000387965:V933E;ENSP00000434121:V931E;ENSP00000436809:V931E	ENSP00000155858:V931E	V	-	2	0	TRPM5	2385709	0.991000	0.36638	0.965000	0.40720	0.312000	0.27988	3.305000	0.51873	1.418000	0.47098	0.379000	0.24179	GTG	.		0.627	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000027378.1	NM_014555	
UNC79	57578	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	93963599	93963599	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr14:93963599G>T	ENST00000393151.2	+	7	865	c.865G>T	c.(865-867)Gca>Tca	p.A289S	UNC79_ENST00000555664.1_Missense_Mutation_p.A289S|UNC79_ENST00000553484.1_Missense_Mutation_p.A289S|UNC79_ENST00000256339.4_Missense_Mutation_p.A112S			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	289					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						ACCTCCTGGGGCAATAAGCGA	0.502																																					p.A112S		.											.	.	.	0			c.G334T						.						66.0	62.0	63.0					14																	93963599		2203	4300	6503	SO:0001583	missense	57578	exon7			CCTGGGGCAATAA	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.865G>T	14.37:g.93963599G>T	ENSP00000376858:p.Ala289Ser	31.0	0.0		25.0	5.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	G	19.73	3.882190	0.72294	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.18338	2.22;2.22;2.22;2.22	5.48	5.48	0.80851	.	0.062950	0.64402	D	0.000008	T	0.33818	0.0876	L	0.43152	1.355	0.80722	D	1	D	0.67145	0.996	D	0.76071	0.987	T	0.02138	-1.1207	10	0.14656	T	0.56	-13.9151	19.3549	0.94408	0.0:0.0:1.0:0.0	.	289	C9JQL1	.	S	112;289;289;289;289	ENSP00000256339:A112S;ENSP00000450868:A289S;ENSP00000451360:A289S;ENSP00000376858:A289S	ENSP00000256339:A112S	A	+	1	0	KIAA1409	93033352	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.569000	0.86673	0.563000	0.77884	GCA	.		0.502	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
UNC79	57578	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	94120287	94120287	+	Splice_Site	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr14:94120287T>C	ENST00000393151.2	+	38	6315	c.6315T>C	c.(6313-6315)gaT>gaC	p.D2105D	UNC79_ENST00000555664.1_Splice_Site_p.D2066D|UNC79_ENST00000553484.1_Splice_Site_p.D2127D|UNC79_ENST00000256339.4_Splice_Site_p.D1928D			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2105					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						ACTTTCCAGATGGGACTTTTT	0.478																																					p.D1928D		.											.	.	.	0			c.T5784C						.						175.0	161.0	166.0					14																	94120287		2203	4300	6503	SO:0001630	splice_region_variant	57578	exon38			TCCAGATGGGACT	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.6314-1T>C	14.37:g.94120287T>C		91.0	1.0		93.0	17.0	NM_020818	B5MDL6|Q6ZUT7	Silent	SNP	ENST00000393151.2	37																																																																																				.		0.478	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	Silent
XIRP2	129446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	168107754	168107754	+	Silent	SNP	G	G	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr2:168107754G>T	ENST00000409195.1	+	9	9941	c.9852G>T	c.(9850-9852)gtG>gtT	p.V3284V	XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409273.1_Silent_p.V3062V|XIRP2_ENST00000295237.9_Silent_p.V3284V|XIRP2_ENST00000409043.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	3109					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						ATCACATGGTGCCCGACACTG	0.473																																					p.V3284V		.											.	XIRP2	104	0			c.G9852T						.						94.0	94.0	94.0					2																	168107754		2019	4176	6195	SO:0001819	synonymous_variant	129446	exon9			CATGGTGCCCGAC	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.9852G>T	2.37:g.168107754G>T		108.0	0.0		81.0	22.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	37	CCDS42769.1																																																																																			.		0.473	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
XRCC4	7518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	82649043	82649043	+	Silent	SNP	C	C	T			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr5:82649043C>T	ENST00000511817.1	+	8	1073	c.993C>T	c.(991-993)gaC>gaT	p.D331D	XRCC4_ENST00000338635.6_Silent_p.D331D|XRCC4_ENST00000282268.3_Silent_p.D329D|XRCC4_ENST00000396027.4_Silent_p.D329D			Q13426	XRCC4_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 4	331					cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|immunoglobulin V(D)J recombination (GO:0033152)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ligase activity (GO:0051351)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytosol (GO:0005829)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(2)|skin(3)	17		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		GCCCAGAAGACCTCTTTGATG	0.358								Non-homologous end-joining																													p.D331D		.											.	XRCC4	229	0			c.C993T						.						117.0	127.0	123.0					5																	82649043		2203	4300	6503	SO:0001819	synonymous_variant	7518	exon8			AGAAGACCTCTTT	AB017445	CCDS4058.1, CCDS4059.1	5q14.2	2008-02-05			ENSG00000152422	ENSG00000152422			12831	protein-coding gene	gene with protein product	"""X-ray repair, complementing defective, repair in Chinese hamster"", ""DNA repair protein XRCC4"""	194363				1697445, 7665175	Standard	NM_022406		Approved		uc003kib.3	Q13426	OTTHUMG00000131319	ENST00000511817.1:c.993C>T	5.37:g.82649043C>T		238.0	0.0		261.0	56.0	NM_022406	A8K3X4|Q9BS72|Q9UP94	Silent	SNP	ENST00000511817.1	37	CCDS4059.1																																																																																			.		0.358	XRCC4-003	NOVEL	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369624.1	NM_022550	
ZC3H12D	340152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	149777857	149777857	+	Nonsense_Mutation	SNP	C	C	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr6:149777857C>A	ENST00000409806.3	-	4	943	c.625G>T	c.(625-627)Gag>Tag	p.E209*	ZC3H12D_ENST00000389942.5_Nonsense_Mutation_p.E209*|ZC3H12D_ENST00000542614.1_Nonsense_Mutation_p.E209*|ZC3H12D_ENST00000416573.2_Nonsense_Mutation_p.E209*			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D	209					negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		CACTTCCACTCGGGGTTCTCG	0.642																																					p.E209X		.											.	.	.	0			c.G625T						.						75.0	86.0	83.0					6																	149777857		2126	4260	6386	SO:0001587	stop_gained	340152	exon4			TCCACTCGGGGTT			6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.625G>T	6.37:g.149777857C>A	ENSP00000386616:p.Glu209*	50.0	0.0		35.0	7.0	NM_207360	A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	Nonsense_Mutation	SNP	ENST00000409806.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	39|39	7.863205|7.863205	0.98531|0.98531	.|.	.|.	ENSG00000178199|ENSG00000178199	ENST00000389942;ENST00000416573;ENST00000409806;ENST00000542614|ENST00000458251	.|.	.|.	.|.	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	0.069314|.	0.64402|.	D|.	0.000017|.	.|T	.|0.67942	.|0.2947	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.66791	.|-0.5834	.|3	0.87932|.	D|.	0|.	-23.8876|-23.8876	18.1465|18.1465	0.89656|0.89656	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	209|50	.|.	ENSP00000374592:E209X|.	E|R	-|-	1|2	0|0	ZC3H12D|ZC3H12D	149819550|149819550	0.995000|0.995000	0.38212|0.38212	0.994000|0.994000	0.49952|0.49952	0.998000|0.998000	0.95712|0.95712	3.052000|3.052000	0.49893|0.49893	2.526000|2.526000	0.85167|0.85167	0.561000|0.561000	0.74099|0.74099	GAG|CGA	.		0.642	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000286400.2	NM_207360	
ZNF385D	79750	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	21462713	21462713	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr3:21462713G>A	ENST00000281523.2	-	8	1699	c.1181C>T	c.(1180-1182)cCt>cTt	p.P394L		NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	394						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						AATTTAGTAAGGAGCAAACAG	0.438																																					p.P394L		.											.	ZNF385D	156	0			c.C1181T						.						33.0	32.0	33.0					3																	21462713		2203	4300	6503	SO:0001583	missense	79750	exon8			TAGTAAGGAGCAA	BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.1181C>T	3.37:g.21462713G>A	ENSP00000281523:p.Pro394Leu	41.0	0.0		54.0	6.0	NM_024697		Missense_Mutation	SNP	ENST00000281523.2	37	CCDS2636.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.130601	0.77549	.	.	ENSG00000151789	ENST00000281523	T	0.79247	-1.25	5.95	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.75391	0.3843	L	0.57536	1.79	0.80722	D	1	B	0.21225	0.053	B	0.17722	0.019	T	0.73603	-0.3930	10	0.87932	D	0	-29.7027	15.1365	0.72572	0.0677:0.0:0.9323:0.0	.	394	Q9H6B1	Z385D_HUMAN	L	394	ENSP00000281523:P394L	ENSP00000281523:P394L	P	-	2	0	ZNF385D	21437717	1.000000	0.71417	0.993000	0.49108	0.995000	0.86356	9.809000	0.99208	1.526000	0.49068	0.557000	0.71058	CCT	.		0.438	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	NM_024697	
ZNF510	22869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	99522338	99522338	+	Silent	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr9:99522338T>C	ENST00000375231.1	-	6	1424	c.774A>G	c.(772-774)aaA>aaG	p.K258K	ZNF510_ENST00000223428.4_Silent_p.K258K|ZNF510_ENST00000472201.1_5'Flank			Q9Y2H8	ZN510_HUMAN	zinc finger protein 510	258					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	21		Acute lymphoblastic leukemia(62;0.0527)				CTTTTCCAATTTTATTACATT	0.303																																					p.K258K		.											.	ZNF510	90	0			c.A774G						.						52.0	54.0	53.0					9																	99522338		2202	4300	6502	SO:0001819	synonymous_variant	22869	exon6			TCCAATTTTATTA	AB023189	CCDS35074.1	9q22.33	2013-01-08			ENSG00000081386	ENSG00000081386		"""Zinc fingers, C2H2-type"", ""-"""	29161	protein-coding gene	gene with protein product						10231032	Standard	XM_005251807		Approved	KIAA0972	uc004awn.1	Q9Y2H8	OTTHUMG00000020303	ENST00000375231.1:c.774A>G	9.37:g.99522338T>C		76.0	0.0		70.0	15.0	NM_014930	Q5SZP5	Silent	SNP	ENST00000375231.1	37	CCDS35074.1																																																																																			.		0.303	ZNF510-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053287.1	NM_014930	
ZNF568	374900	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	37413702	37413702	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr19:37413702T>A	ENST00000333987.7	+	3	536	c.30T>A	c.(28-30)aaT>aaA	p.N10K	ZNF568_ENST00000455427.2_Intron|ZNF568_ENST00000427117.1_Missense_Mutation_p.N10K|ZNF568_ENST00000415168.1_Intron	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	10					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGATCAGCAATAGCTGTGTGA	0.507																																					p.N10K		.											.	ZNF568	136	0			c.T30A						.						113.0	111.0	112.0					19																	37413702		1980	4157	6137	SO:0001583	missense	374900	exon3			CAGCAATAGCTGT	BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.30T>A	19.37:g.37413702T>A	ENSP00000334685:p.Asn10Lys	47.0	0.0		53.0	9.0	NM_001204838	B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	ENST00000333987.7	37	CCDS42558.1	.	.	.	.	.	.	.	.	.	.	T	11.54	1.670042	0.29693	.	.	ENSG00000198453	ENST00000427117;ENST00000333987;ENST00000444991	T;T;T	0.06068	5.89;3.58;3.35	3.05	-0.648	0.11464	.	.	.	.	.	T	0.02380	0.0073	N	0.08118	0	0.80722	D	1	B	0.09022	0.002	B	0.14023	0.01	T	0.47898	-0.9081	9	0.12103	T	0.63	.	3.0189	0.06069	0.0:0.2903:0.2341:0.4755	.	10	Q3ZCX4	ZN568_HUMAN	K	10	ENSP00000407012:N10K;ENSP00000334685:N10K;ENSP00000389794:N10K	ENSP00000334685:N10K	N	+	3	2	ZNF568	42105542	0.003000	0.15002	0.882000	0.34594	0.722000	0.41435	-0.658000	0.05329	-0.197000	0.10350	0.454000	0.30748	AAT	.		0.507	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109572.2	NM_198539	
ZNF92	168374	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	64863556	64863556	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr7:64863556A>G	ENST00000328747.7	+	4	728	c.529A>G	c.(529-531)Aac>Gac	p.N177D	ZNF92_ENST00000431504.1_Missense_Mutation_p.N101D|ZNF92_ENST00000357512.2_Missense_Mutation_p.N145D|ZNF92_ENST00000450302.2_Missense_Mutation_p.N108D	NM_152626.2	NP_689839.1	Q03936	ZNF92_HUMAN	zinc finger protein 92	177					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(3)|lung(4)|pancreas(1)|skin(1)|stomach(1)	13		Lung NSC(55;0.159)				CAAATGTAAAAACCGTGGCAA	0.289																																					p.N177D		.											.	ZNF92	514	0			c.A529G						.						28.0	29.0	29.0					7																	64863556		2203	4294	6497	SO:0001583	missense	168374	exon4			TGTAAAAACCGTG	M61872	CCDS34646.1, CCDS47596.1, CCDS75608.1, CCDS75609.1	7q11.21	2013-01-08	2006-05-12		ENSG00000146757	ENSG00000146757		"""Zinc fingers, C2H2-type"", ""-"""	13168	protein-coding gene	gene with protein product		603974	"""zinc finger protein 92 (HTF12)"""			8467795	Standard	NM_001287533		Approved	HPF12, TF12	uc003ttz.3	Q03936	OTTHUMG00000156557	ENST00000328747.7:c.529A>G	7.37:g.64863556A>G	ENSP00000332595:p.Asn177Asp	50.0	0.0		53.0	12.0	NM_152626	A6NNF9|Q8N492|Q8NB35	Missense_Mutation	SNP	ENST00000328747.7	37	CCDS34646.1	.	.	.	.	.	.	.	.	.	.	A	3.731	-0.055490	0.07362	.	.	ENSG00000146757	ENST00000328747;ENST00000431504;ENST00000357512;ENST00000450302	T;T;T;T	0.27557	2.49;1.66;1.66;1.66	0.427	-0.759	0.11045	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12092	0.0294	N	0.03891	-0.335	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.11329	0.006;0.001	T	0.22138	-1.0225	9	0.56958	D	0.05	.	4.3551	0.11174	0.3764:0.0:0.6236:0.0	.	145;177	Q03936-3;Q03936	.;ZNF92_HUMAN	D	177;101;145;108	ENSP00000332595:N177D;ENSP00000400495:N101D;ENSP00000350113:N145D;ENSP00000396126:N108D	ENSP00000332595:N177D	N	+	1	0	ZNF92	64500991	0.001000	0.12720	0.020000	0.16555	0.019000	0.09904	0.105000	0.15333	-0.455000	0.07054	-0.456000	0.05471	AAC	.		0.289	ZNF92-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344589.2	NM_152626	
ZNFX1	57169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	47864666	47864666	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr20:47864666T>C	ENST00000396105.1	-	14	5141	c.4895A>G	c.(4894-4896)tAt>tGt	p.Y1632C	ZNFX1_ENST00000371752.1_Missense_Mutation_p.Y1632C|ZNFX1_ENST00000371754.4_Intron	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1632							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GCTAGTTCCATACCTCAGGTT	0.488																																					p.Y1632C		.											.	ZNFX1	24	0			c.A4895G						.						59.0	58.0	58.0					20																	47864666		2203	4300	6503	SO:0001583	missense	57169	exon14			GTTCCATACCTCA	AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.4895A>G	20.37:g.47864666T>C	ENSP00000379412:p.Tyr1632Cys	101.0	0.0		100.0	25.0	NM_021035	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	ENST00000396105.1	37	CCDS13417.1	.	.	.	.	.	.	.	.	.	.	T	17.38	3.375618	0.61735	.	.	ENSG00000124201	ENST00000371752;ENST00000396105	T;T	0.58358	0.34;0.34	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.77942	0.4206	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82686	-0.0334	10	0.87932	D	0	-19.4309	15.4003	0.74834	0.0:0.0:0.0:1.0	.	1632	Q9P2E3	ZNFX1_HUMAN	C	1632	ENSP00000360817:Y1632C;ENSP00000379412:Y1632C	ENSP00000360817:Y1632C	Y	-	2	0	ZNFX1	47298073	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	7.993000	0.88291	2.317000	0.78254	0.459000	0.35465	TAT	.		0.488	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035	
HIST1H1C	3006	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	26056228	26056229	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-MI-A75E-01A-11D-A32G-10	TCGA-MI-A75E-10A-01D-A32G-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ea65f8a8-708d-4880-9272-8bbb6f840341	08d2414c-c7d1-47bc-b387-9302d862a298	g.chr6:26056228_26056229GC>AA	ENST00000343677.2	-	1	470_471	c.428_429GC>TT	c.(427-429)gGC>gTT	p.G143V		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	143					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						GAGTTGCGCCGCCAGCCGCCTT	0.579																																					p.G143V		.											.	.	.	0			.						.																																			SO:0001583	missense	3006	.			TGCGCCGCCAGCC	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.428_429delinsAA	6.37:g.26056228_26056229delinsAA	ENSP00000339566:p.Gly143Val	93.0	0.0		95.0	18.0	.	A8K4I2	Missense_Mutation	DNP	ENST00000343677.2	37	CCDS4577.1																																																																																			.		0.579	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319	
