#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
A1BG	1	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	58861838	58861840	+	In_Frame_Del	DEL	TGT	TGT	-	rs534622150|rs140084941	byFrequency	TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	TGT	TGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:58861838_58861840delTGT	ENST00000263100.3	-	6	1149_1151	c.1088_1090delACA	c.(1087-1092)aacatt>att	p.N363del	CTD-2619J13.8_ENST00000599109.1_RNA|A1BG-AS1_ENST00000595302.1_RNA|A1BG-AS1_ENST00000593960.1_RNA|A1BG-AS1_ENST00000594950.1_RNA|A1BG-AS1_ENST00000600379.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|A1BG_ENST00000596924.1_5'Flank|A1BG-AS1_ENST00000599728.1_RNA|A1BG-AS1_ENST00000593374.1_RNA	NM_130786.3	NP_570602.2	P04217	A1BG_HUMAN	alpha-1-B glycoprotein	363	Ig-like V-type 4.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)	15		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		GCCACGGAAATGTTGTGCAGCTC	0.7																																					p.363_364del		.											.	A1BG	90	0			c.1088_1090del						.																																			SO:0001651	inframe_deletion	1	exon6			CGGAAATGTTGTG		CCDS12976.1	19q13.43	2013-10-15			ENSG00000121410	ENSG00000121410		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5	protein-coding gene	gene with protein product		138670				2591067	Standard	NM_130786		Approved		uc002qsd.4	P04217	OTTHUMG00000183507	ENST00000263100.3:c.1088_1090delACA	19.37:g.58861841_58861843delTGT	ENSP00000263100:p.Asn363del	74.0	0.0		196.0	0.0	NM_130786	A8K052|Q68CK0|Q8IYJ6|Q96P39	In_Frame_Del	DEL	ENST00000263100.3	37	CCDS12976.1																																																																																			.		0.700	A1BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466930.1	NM_130786	
ABCC3	8714	broad.mit.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48734480	48734481	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	.|Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr17:48734480_48734481GG>TT	ENST00000285238.8	+	4	502_503	c.422_423GG>TT	c.(421-423)tGG>tTT	p.W141F	ABCC3_ENST00000427699.1_Missense_Mutation_p.W141F	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	141					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	ATTATCTTCTGGTTCCTGTGTG	0.604																																					p.W141L|p.W141C		.											.	ABCC3	93	0			c.G422T|c.G423T						.																																			SO:0001583	missense	8714	exon4			TCTTCTGGTTCCT|CTTCTGGTTCCTG	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	Exception_encountered	17.37:g.48734480_48734481delinsTT	ENSP00000285238:p.Trp141Phe	56.0	1.0|0.0		107.0	13.0	NM_003786	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	37	CCDS32681.1																																																																																			.		0.604	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
ADAM19	8728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	156934075	156934075	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr5:156934075C>T	ENST00000517905.1	-	10	1023	c.979G>A	c.(979-981)Gga>Aga	p.G327R	ADAM19_ENST00000394020.1_Missense_Mutation_p.G329R|ADAM19_ENST00000257527.4_Missense_Mutation_p.G327R|ADAM19_ENST00000430702.2_Missense_Mutation_p.G60R			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	327	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATGTTGACTCCTCCAGACTGG	0.562																																					p.G327R		.											.	ADAM19	294	0			c.G979A						.						82.0	76.0	78.0					5																	156934075		2203	4300	6503	SO:0001583	missense	8728	exon10			TGACTCCTCCAGA	AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.979G>A	5.37:g.156934075C>T	ENSP00000428654:p.Gly327Arg	100.0	0.0		139.0	32.0	NM_033274	Q9BZL5|Q9UHP2	Missense_Mutation	SNP	ENST00000517905.1	37		.	.	.	.	.	.	.	.	.	.	C	36	5.604250	0.96626	.	.	ENSG00000135074	ENST00000430702;ENST00000257527;ENST00000394020;ENST00000517905	T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000006	D	0.89171	0.6639	H	0.95004	3.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91890	0.5523	10	0.87932	D	0	.	19.3107	0.94186	0.0:1.0:0.0:0.0	.	327;60	Q9H013-2;E9PD32	.;.	R	60;327;329;327	ENSP00000414088:G60R;ENSP00000257527:G327R;ENSP00000377588:G329R;ENSP00000428654:G327R	ENSP00000257527:G327R	G	-	1	0	ADAM19	156866653	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.770000	0.85390	2.561000	0.86390	0.650000	0.86243	GGA	.		0.562	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000373918.1	NM_033274	
ADAMTS18	170692	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	77323232	77323232	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr16:77323232C>T	ENST00000282849.5	-	22	3897	c.3479G>A	c.(3478-3480)tGt>tAt	p.C1160Y	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1160	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ATGGAGCAGACAACTTGAGGA	0.542																																					p.C1160Y		.											.	ADAMTS18	1036	0			c.G3479A						.						114.0	120.0	118.0					16																	77323232		2198	4300	6498	SO:0001583	missense	170692	exon22			AGCAGACAACTTG	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3479G>A	16.37:g.77323232C>T	ENSP00000282849:p.Cys1160Tyr	38.0	0.0		56.0	19.0	NM_199355	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.668611	0.88348	.	.	ENSG00000140873	ENST00000282849	T	0.69306	-0.39	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.91178	0.7221	H	0.99820	4.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94960	0.8107	10	0.87932	D	0	.	18.9804	0.92754	0.0:1.0:0.0:0.0	.	1160	Q8TE60	ATS18_HUMAN	Y	1160	ENSP00000282849:C1160Y	ENSP00000282849:C1160Y	C	-	2	0	ADAMTS18	75880733	1.000000	0.71417	0.936000	0.37596	0.830000	0.47004	7.461000	0.80834	2.740000	0.93945	0.557000	0.71058	TGT	.		0.542	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
ADARB1	104	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	46604970	46604970	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr21:46604970G>A	ENST00000360697.3	+	7	1664	c.1649G>A	c.(1648-1650)cGg>cAg	p.R550Q	ADARB1_ENST00000437626.1_3'UTR|ADARB1_ENST00000348831.4_Missense_Mutation_p.R510Q|ADARB1_ENST00000539173.1_Missense_Mutation_p.R550Q|ADARB1_ENST00000389863.4_Missense_Mutation_p.R550Q			P78563	RED1_HUMAN	adenosine deaminase, RNA-specific, B1	550	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|positive regulation of viral genome replication (GO:0045070)|regulation of cell cycle (GO:0051726)|RNA processing (GO:0006396)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA adenosine deaminase activity (GO:0003726)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(1)	17				Colorectal(79;0.115)		CAAGGGGAGCGGCTGCTCACC	0.592																																					p.R550Q		.											.	ADARB1	91	0			c.G1649A						.						117.0	109.0	112.0					21																	46604970		2203	4300	6503	SO:0001583	missense	104	exon9			GGGAGCGGCTGCT	U76420	CCDS33589.1, CCDS33590.1, CCDS42970.1	21q22.3	2012-03-22	2010-06-24		ENSG00000197381	ENSG00000197381	3.5.-.-		226	protein-coding gene	gene with protein product	"""RED1 homolog (rat)"""	601218	"""adenosine deaminase, RNA-specific, B1 (homolog of rat RED1)"""			9143496, 14759252	Standard	NR_027672		Approved	ADAR2, DRADA2, ADAR2g, DRABA2, RED1, hRED1, ADAR2a-L1, ADAR2a-L2, ADAR2a-L3, ADAR2a, ADAR2b, ADAR2c, ADAR2d	uc002zgy.2	P78563	OTTHUMG00000090295	ENST00000360697.3:c.1649G>A	21.37:g.46604970G>A	ENSP00000353920:p.Arg550Gln	42.0	0.0		60.0	20.0	NM_015834	A6NFK8|A6NJ84|C3TTQ1|C3TTQ2|C9JUP4|G5E9B4|O00395|O00465|O00691|O00692|P78555|Q4AE79|Q6P0M9|Q8NFD1	Missense_Mutation	SNP	ENST00000360697.3	37	CCDS33589.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.745115	0.89663	.	.	ENSG00000197381	ENST00000539173;ENST00000539917;ENST00000389863;ENST00000348831;ENST00000360697	D;D;D;D	0.93953	-3.32;-3.32;-3.32;-3.32	5.42	5.42	0.78866	Adenosine deaminase/editase (3);	0.000000	0.85682	D	0.000000	D	0.95626	0.8578	M	0.66378	2.025	0.80722	D	1	D;B;D;B	0.64830	0.994;0.191;0.981;0.446	D;B;P;B	0.65323	0.934;0.027;0.451;0.099	D	0.94109	0.7369	10	0.30078	T	0.28	-52.417	17.0803	0.86597	0.0:0.0:1.0:0.0	.	550;510;538;550	P78563;Q4AE77;G5E9B4;P78563-3	RED1_HUMAN;.;.;.	Q	550;550;550;510;550	ENSP00000441897:R550Q;ENSP00000374513:R550Q;ENSP00000015877:R510Q;ENSP00000353920:R550Q	ENSP00000015877:R510Q	R	+	2	0	ADARB1	45429398	1.000000	0.71417	0.996000	0.52242	0.963000	0.63663	7.566000	0.82347	2.712000	0.92718	0.563000	0.77884	CGG	.		0.592	ADARB1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206648.2	NM_015833	
ADCY2	108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	7707833	7707833	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr5:7707833C>A	ENST00000338316.4	+	9	1372	c.1283C>A	c.(1282-1284)tCt>tAt	p.S428Y	RP11-711G10.1_ENST00000514105.2_RNA|ADCY2_ENST00000537121.1_Missense_Mutation_p.S248Y	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	428					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						GTTCACATTTCTTCTGTCACC	0.388																																					p.S428Y		.											.	ADCY2	97	0			c.C1283A						.						120.0	119.0	119.0					5																	7707833		2203	4300	6503	SO:0001583	missense	108	exon9			ACATTTCTTCTGT	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1283C>A	5.37:g.7707833C>A	ENSP00000342952:p.Ser428Tyr	56.0	0.0		94.0	28.0	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	C	32	5.127244	0.94473	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	D;D	0.89552	-2.53;-2.53	5.49	5.49	0.81192	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.177244	0.48767	D	0.000179	D	0.96349	0.8809	H	0.96301	3.8	0.48395	D	0.999645	D;P	0.61080	0.989;0.537	D;P	0.65140	0.932;0.797	D	0.97414	1.0004	10	0.87932	D	0	.	19.3671	0.94468	0.0:1.0:0.0:0.0	.	248;428	B7Z2C1;Q08462	.;ADCY2_HUMAN	Y	428;279;248	ENSP00000342952:S428Y;ENSP00000444803:S248Y	ENSP00000342952:S428Y	S	+	2	0	ADCY2	7760833	1.000000	0.71417	0.940000	0.37924	0.989000	0.77384	5.779000	0.68948	2.555000	0.86185	0.650000	0.86243	TCT	.		0.388	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
ADGB	79747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	147049794	147049794	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr6:147049794C>A	ENST00000397944.3	+	20	2513	c.2437C>A	c.(2437-2439)Ctc>Atc	p.L813I	ADGB_ENST00000367493.3_Missense_Mutation_p.L232I	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	813					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						TAAGGGTAAACTCTCTGCAGC	0.428																																					p.L813I		.											.	.	.	0			c.C2437A						.						241.0	213.0	222.0					6																	147049794		692	1591	2283	SO:0001583	missense	79747	exon20			GGTAAACTCTCTG	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.2437C>A	6.37:g.147049794C>A	ENSP00000381036:p.Leu813Ile	61.0	0.0		60.0	16.0	NM_024694	Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	ENST00000397944.3	37		.	.	.	.	.	.	.	.	.	.	C	25.6	4.659590	0.88154	.	.	ENSG00000118492	ENST00000397944;ENST00000367493	T	0.36157	1.27	5.59	3.8	0.43715	Globin, structural domain (1);	.	.	.	.	T	0.40272	0.1110	M	0.76002	2.32	0.21897	N	0.999485	D	0.65815	0.995	P	0.62298	0.9	T	0.28038	-1.0056	9	0.62326	D	0.03	.	9.288	0.37769	0.0:0.8396:0.0:0.1604	.	813	Q8N7X0	CAN7L_HUMAN	I	813;232	ENSP00000381036:L813I	ENSP00000356463:L232I	L	+	1	0	C6orf103	147091487	1.000000	0.71417	0.036000	0.18154	0.634000	0.38068	3.165000	0.50778	0.720000	0.32209	0.591000	0.81541	CTC	.		0.428	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2	NM_024694	
ADGB	79747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	147103205	147103205	+	Silent	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr6:147103205C>T	ENST00000397944.3	+	30	3988	c.3912C>T	c.(3910-3912)tcC>tcT	p.S1304S	ADGB_ENST00000367488.1_Silent_p.S27S|ADGB_ENST00000523560.1_3'UTR|ADGB_ENST00000367493.3_Silent_p.S619S	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	1304					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						GCCCAGACTCCCACACTATTA	0.343																																					p.S1304S		.											.	.	.	0			c.C3912T						.						72.0	63.0	66.0					6																	147103205		692	1591	2283	SO:0001819	synonymous_variant	79747	exon30			AGACTCCCACACT	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.3912C>T	6.37:g.147103205C>T		60.0	0.0		71.0	9.0	NM_024694	Q5T402|Q5T904|Q5T905	Silent	SNP	ENST00000397944.3	37																																																																																				.		0.343	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2	NM_024694	
AGGF1	55109	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	76342325	76342325	+	Missense_Mutation	SNP	A	A	G	rs149788789	byFrequency	TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr5:76342325A>G	ENST00000312916.7	+	6	1406	c.1024A>G	c.(1024-1026)Ata>Gta	p.I342V		NM_018046.4	NP_060516.2	Q8N302	AGGF1_HUMAN	angiogenic factor with G patch and FHA domains 1	342					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|RNA processing (GO:0006396)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	nucleic acid binding (GO:0003676)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	20		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		TGGAAATACTATAGAGTCTCC	0.358																																					p.I342V		.											.	AGGF1	117	0			c.A1024G						.	A	VAL/ILE	0,4406		0,0,2203	109.0	118.0	115.0		1024	-9.1	0.0	5	dbSNP_134	115	2,8598	2.2+/-6.3	0,2,4298	yes	missense	AGGF1	NM_018046.4	29	0,2,6501	GG,GA,AA		0.0233,0.0,0.0154	benign	342/715	76342325	2,13004	2203	4300	6503	SO:0001583	missense	55109	exon6			AATACTATAGAGT	AK001145	CCDS4035.1	5q13.3	2013-10-11			ENSG00000164252	ENSG00000164252		"""G patch domain containing"""	24684	protein-coding gene	gene with protein product		608464				18564129, 17103452	Standard	NM_018046		Approved	VG5Q, HSU84971, FLJ10283, GPATC7, GPATCH7	uc003ket.3	Q8N302	OTTHUMG00000102132	ENST00000312916.7:c.1024A>G	5.37:g.76342325A>G	ENSP00000316109:p.Ile342Val	149.0	0.0		232.0	60.0	NM_018046	O00581|Q53YS3|Q9BU84|Q9NW66	Missense_Mutation	SNP	ENST00000312916.7	37	CCDS4035.1	.	.	.	.	.	.	.	.	.	.	A	0.006	-2.058578	0.00390	0.0	2.33E-4	ENSG00000164252	ENST00000312916	T	0.33865	1.39	5.29	-9.12	0.00707	.	2.366740	0.01370	N	0.012545	T	0.11110	0.0271	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17961	-1.0352	10	0.25751	T	0.34	-14.7262	6.7559	0.23514	0.6642:0.1012:0.1327:0.1018	.	342	Q8N302	AGGF1_HUMAN	V	342	ENSP00000316109:I342V	ENSP00000316109:I342V	I	+	1	0	AGGF1	76378081	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-1.988000	0.01482	-1.405000	0.02048	-1.039000	0.02377	ATA	A|0.999;G|0.001		0.358	AGGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219971.2	NM_018046	
AHNAK2	113146	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	105417167	105417167	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr14:105417167G>T	ENST00000333244.5	-	7	4740	c.4621C>A	c.(4621-4623)Ctg>Atg	p.L1541M	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1541						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGTATGCTCAGGTCAGTGGCC	0.652																																					p.L1541M		.											.	AHNAK2	47	0			c.C4621A						.						119.0	113.0	115.0					14																	105417167		1946	4089	6035	SO:0001583	missense	113146	exon7			TGCTCAGGTCAGT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.4621C>A	14.37:g.105417167G>T	ENSP00000353114:p.Leu1541Met	145.0	0.0		151.0	13.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	15.28	2.786937	0.49997	.	.	ENSG00000185567	ENST00000333244	T	0.00995	5.46	4.16	-5.81	0.02340	.	.	.	.	.	T	0.01905	0.0060	L	0.52126	1.63	0.09310	N	1	D	0.57899	0.981	P	0.54026	0.74	T	0.08207	-1.0733	9	0.45353	T	0.12	-4.4575	11.3263	0.49450	0.0:0.5958:0.2201:0.1841	.	1541	Q8IVF2	AHNK2_HUMAN	M	1541	ENSP00000353114:L1541M	ENSP00000353114:L1541M	L	-	1	2	AHNAK2	104488212	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.997000	0.01470	-0.808000	0.04387	-0.333000	0.08304	CTG	.		0.652	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ALB	213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	74285252	74285252	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr4:74285252C>T	ENST00000503124.1	+	11	1438	c.1231C>T	c.(1231-1233)Ccc>Tcc	p.P411S	ALB_ENST00000505649.1_3'UTR|ALB_ENST00000509063.1_Missense_Mutation_p.P561S|ALB_ENST00000401494.3_Missense_Mutation_p.P446S|ALB_ENST00000415165.2_Missense_Mutation_p.P369S|ALB_ENST00000295897.4_Missense_Mutation_p.P561S			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAAACACAAGCCCAAGGCAAC	0.403																																					p.P561S		.											.	ALB	96	0			c.C1681T						.						87.0	83.0	84.0					4																	74285252		2203	4300	6503	SO:0001583	missense	213	exon13			CACAAGCCCAAGG	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.1231C>T	4.37:g.74285252C>T	ENSP00000421027:p.Pro411Ser	30.0	0.0		30.0	15.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000503124.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.2|25.2	4.613772|4.613772	0.87359|0.87359	.|.	.|.	ENSG00000163631|ENSG00000163631	ENST00000511370|ENST00000295897;ENST00000415165;ENST00000329326;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202	.|T;T;T;T;T	.|0.70749	.|-0.51;-0.51;-0.51;-0.51;-0.51	6.17|6.17	6.17|6.17	0.99709|0.99709	.|Serum albumin-like (1);Serum albumin, N-terminal (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.88299|0.88299	0.6399|0.6399	M|M	0.91406|0.91406	3.205|3.205	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.97110	.|0.999;1.0;1.0;0.999;0.999	D|D	0.89512|0.89512	0.3772|0.3772	5|10	.|0.87932	.|D	.|0	-24.0555|-24.0555	19.4432|19.4432	0.94831|0.94831	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|446;369;411;561;561	.|B7WNR0;C9JKR2;D6RHD5;A6NBZ8;P02768	.|.;.;.;.;ALBU_HUMAN	V|S	405|561;369;348;411;561;446;570	.|ENSP00000295897:P561S;ENSP00000401820:P369S;ENSP00000421027:P411S;ENSP00000422784:P561S;ENSP00000384695:P446S	.|ENSP00000295897:P561S	A|P	+|+	2|1	0|0	ALB|ALB	74504116|74504116	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.848000|0.848000	0.48234|0.48234	2.294000|2.294000	0.43567|0.43567	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCC|CCC	.		0.403	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
ALS2CL	259173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	46730917	46730917	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:46730917T>A	ENST00000318962.4	-	2	97	c.14A>T	c.(13-15)gAg>gTg	p.E5V	ALS2CL_ENST00000415953.1_Missense_Mutation_p.E5V	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	5					endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		AGCTGCCTCCTCAGGGTTGCA	0.632																																					p.E5V		.											.	ALS2CL	155	0			c.A14T						.						32.0	30.0	30.0					3																	46730917		2202	4298	6500	SO:0001583	missense	259173	exon2			GCCTCCTCAGGGT	AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.14A>T	3.37:g.46730917T>A	ENSP00000313670:p.Glu5Val	66.0	0.0		119.0	15.0	NM_001190707	Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	ENST00000318962.4	37	CCDS2743.1	.	.	.	.	.	.	.	.	.	.	T	18.06	3.538531	0.65085	.	.	ENSG00000178038	ENST00000318962;ENST00000415953	T;T	0.61040	0.14;0.14	4.81	3.62	0.41486	.	0.979255	0.08309	N	0.965720	T	0.64450	0.2599	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.66084	0.941	T	0.56032	-0.8046	10	0.87932	D	0	.	8.5906	0.33686	0.0:0.0:0.1945:0.8055	.	5	Q60I27	AL2CL_HUMAN	V	5	ENSP00000313670:E5V;ENSP00000413223:E5V	ENSP00000313670:E5V	E	-	2	0	ALS2CL	46705921	0.956000	0.32656	0.919000	0.36401	0.824000	0.46624	2.200000	0.42724	0.929000	0.37192	0.460000	0.39030	GAG	.		0.632	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250567.3	NM_147129	
ANP32D	23519	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	48866816	48866816	+	Silent	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr12:48866816C>T	ENST00000266594.1	+	1	369	c.369C>T	c.(367-369)tgC>tgT	p.C123C		NM_012404.2	NP_036536.2	O95626	AN32D_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member D	123						nuclear matrix (GO:0016363)				central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	9						TTTTCACTTGCGAGGTAACCA	0.438																																					p.C123C		.											.	ANP32D	227	0			c.C369T						.						84.0	83.0	83.0					12																	48866816		2203	4300	6503	SO:0001819	synonymous_variant	23519	exon1			CACTTGCGAGGTA	U71084	CCDS31788.1	12q13.12	2008-08-04			ENSG00000139223	ENSG00000139223		"""ANP32 acidic nuclear phosphoproteins"""	16676	protein-coding gene	gene with protein product	"""pp32 related 2"""	606878				10086381, 10400610	Standard	NM_012404		Approved	PP32R2	uc010slt.2	O95626	OTTHUMG00000162681	ENST00000266594.1:c.369C>T	12.37:g.48866816C>T		77.0	0.0		81.0	28.0	NM_012404	Q6NTC4	Silent	SNP	ENST00000266594.1	37	CCDS31788.1																																																																																			.		0.438	ANP32D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370058.1	NM_012404	
ARAP1	116985	broad.mit.edu;mdanderson.org	37	11	72414044	72414044	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr11:72414044G>T	ENST00000393609.3	-	15	2275	c.2073C>A	c.(2071-2073)ttC>ttA	p.F691L	ARAP1_ENST00000393605.3_Missense_Mutation_p.F451L|ARAP1_ENST00000359373.5_Missense_Mutation_p.F691L|ARAP1_ENST00000495878.1_5'Flank|ARAP1_ENST00000426523.1_Missense_Mutation_p.F446L|ARAP1-AS2_ENST00000500163.2_RNA|ARAP1_ENST00000455638.2_Missense_Mutation_p.F691L|ARAP1_ENST00000429686.1_Missense_Mutation_p.F385L|ARAP1_ENST00000334211.8_Missense_Mutation_p.F446L	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	691					actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						GGTCCCCCGAGAAGCAGTTGA	0.662																																					p.F691L	Ovarian(102;1198 1520 13195 17913 37529)	.											.	ARAP1	91	0			c.C2073A						.						18.0	17.0	17.0					11																	72414044		2182	4282	6464	SO:0001583	missense	116985	exon15			CCCCGAGAAGCAG	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.2073C>A	11.37:g.72414044G>T	ENSP00000377233:p.Phe691Leu	25.0	0.0		26.0	4.0	NM_001040118	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	ENST00000393609.3	37	CCDS41687.1	.	.	.	.	.	.	.	.	.	.	G	6.730	0.503428	0.12822	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686;ENST00000340247	T;T;T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71;2.71;2.71	4.75	2.83	0.33086	.	0.128901	0.53938	D	0.000045	T	0.15912	0.0383	L	0.50333	1.59	0.25537	N	0.987215	B;P;P;B;B	0.47604	0.017;0.555;0.898;0.033;0.029	B;B;P;B;B	0.49922	0.017;0.105;0.626;0.053;0.039	T	0.08743	-1.0707	10	0.11485	T	0.65	.	8.5549	0.33476	0.0822:0.0:0.7656:0.1522	.	446;385;691;691;451	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	L	691;691;451;446;691;446;385;480	ENSP00000352332:F691L;ENSP00000390461:F691L;ENSP00000377230:F451L;ENSP00000335506:F446L;ENSP00000377233:F691L;ENSP00000392264:F446L;ENSP00000403127:F385L	ENSP00000335506:F446L	F	-	3	2	ARAP1	72091692	1.000000	0.71417	0.992000	0.48379	0.003000	0.03518	2.945000	0.49043	0.558000	0.29135	-0.311000	0.09066	TTC	.		0.662	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
ARHGAP15	55843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	144194492	144194492	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:144194492C>T	ENST00000295095.6	+	8	751	c.584C>T	c.(583-585)tCa>tTa	p.S195L	AC096558.1_ENST00000442794.1_RNA|AC096558.1_ENST00000549032.1_RNA|AC096558.1_ENST00000550516.1_RNA|RP11-570L15.2_ENST00000546678.1_RNA	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	195					positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		CCAAAGGATTCAAGTTGTCCA	0.343																																					p.S195L		.											.	ARHGAP15	653	0			c.C584T						.						61.0	62.0	62.0					2																	144194492		2203	4300	6503	SO:0001583	missense	55843	exon8			AGGATTCAAGTTG	AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.584C>T	2.37:g.144194492C>T	ENSP00000295095:p.Ser195Leu	90.0	0.0		133.0	50.0	NM_018460	Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Missense_Mutation	SNP	ENST00000295095.6	37	CCDS2184.1	.	.	.	.	.	.	.	.	.	.	C	12.06	1.823683	0.32237	.	.	ENSG00000075884	ENST00000295095	T	0.79454	-1.27	5.55	4.59	0.56863	.	0.999584	0.08093	N	0.999003	T	0.59595	0.2205	N	0.08118	0	0.23700	N	0.997074	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.002	T	0.41179	-0.9523	10	0.23302	T	0.38	.	9.6244	0.39741	0.2313:0.6527:0.116:0.0	.	195;195	B4E0R3;Q53QZ3	.;RHG15_HUMAN	L	195	ENSP00000295095:S195L	ENSP00000295095:S195L	S	+	2	0	ARHGAP15	143910962	0.987000	0.35691	0.955000	0.39395	0.981000	0.71138	1.497000	0.35649	2.601000	0.87937	0.650000	0.86243	TCA	.		0.343	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	NM_018460	
ARPC1B	10095	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	98987539	98987539	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:98987539A>G	ENST00000451682.1	+	7	713	c.404A>G	c.(403-405)aAg>aGg	p.K135R	ARPC1B_ENST00000252725.5_Missense_Mutation_p.K135R|PDAP1_ENST00000496335.1_5'Flank			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa	135					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			TGGGTTTGCAAGCACATCAAG	0.622																																					p.K135R		.											.	ARPC1B	90	0			c.A404G						.						176.0	160.0	165.0					7																	98987539		2203	4300	6503	SO:0001583	missense	10095	exon5			TTTGCAAGCACAT	AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.404A>G	7.37:g.98987539A>G	ENSP00000389631:p.Lys135Arg	52.0	0.0		151.0	30.0	NM_005720	Q9BU00	Missense_Mutation	SNP	ENST00000451682.1	37	CCDS5661.1	.	.	.	.	.	.	.	.	.	.	A	32	5.168347	0.94768	.	.	ENSG00000130429	ENST00000252725;ENST00000451682	T;T	0.63580	-0.05;-0.05	5.69	5.69	0.88448	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.043241	0.85682	D	0.000000	T	0.81702	0.4878	H	0.94808	3.585	0.80722	D	1	P;P	0.40553	0.721;0.721	P;P	0.52514	0.701;0.701	D	0.84915	0.0850	10	0.49607	T	0.09	-34.4296	15.6192	0.76793	1.0:0.0:0.0:0.0	.	135;135	A4D275;O15143	.;ARC1B_HUMAN	R	135	ENSP00000252725:K135R;ENSP00000389631:K135R	ENSP00000252725:K135R	K	+	2	0	ARPC1B	98825475	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	9.310000	0.96267	2.176000	0.68965	0.459000	0.35465	AAG	.		0.622	ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335894.1	NM_005720	
ASTN1	460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	176905453	176905453	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:176905453C>A	ENST00000367654.3	-	15	2666	c.2455G>T	c.(2455-2457)Gtc>Ttc	p.V819F	ASTN1_ENST00000424564.2_Missense_Mutation_p.V811F|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000367657.3_Missense_Mutation_p.V811F|ASTN1_ENST00000361833.2_Missense_Mutation_p.V811F	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	819					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						ACAGACCGGACCTTCCAGTGC	0.507																																					p.V811F		.											.	ASTN1	319	0			c.G2431T						.						149.0	122.0	131.0					1																	176905453		2203	4300	6503	SO:0001583	missense	460	exon15			ACCGGACCTTCCA	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2455G>T	1.37:g.176905453C>A	ENSP00000356626:p.Val819Phe	48.0	0.0		97.0	18.0	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37		.	.	.	.	.	.	.	.	.	.	C	17.78	3.473128	0.63737	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	5.54	5.54	0.83059	Membrane attack complex component/perforin (MACPF) domain (1);	0.124914	0.53938	D	0.000049	T	0.47673	0.1458	L	0.42245	1.32	0.53005	D	0.999961	P;P;P	0.49090	0.919;0.815;0.815	B;B;B	0.43575	0.424;0.332;0.332	T	0.52837	-0.8522	10	0.87932	D	0	-34.3281	19.09	0.93223	0.0:1.0:0.0:0.0	.	819;811;811	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	F	811;811;819;811;811	ENSP00000356629:V811F;ENSP00000354536:V811F;ENSP00000356626:V819F;ENSP00000395041:V811F	ENSP00000354536:V811F	V	-	1	0	ASTN1	175172076	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.505000	0.60421	2.613000	0.88420	0.650000	0.86243	GTC	.		0.507	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
ATF5	22809	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	50436140	50436141	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:50436140_50436141delAA	ENST00000423777.2	+	3	1017_1018	c.640_641delAA	c.(640-642)aagfs	p.K214fs	ATF5_ENST00000595125.1_Frame_Shift_Del_p.K214fs|CTC-326K19.6_ENST00000451973.1_Intron|MIR4751_ENST00000578027.1_RNA	NM_001193646.1	NP_001180575.1	Q9Y2D1	ATF5_HUMAN	activating transcription factor 5	214	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|Interaction with PTP4A1. {ECO:0000250}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|olfactory bulb interneuron development (GO:0021891)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|transcription corepressor activity (GO:0003714)			NS(1)|endometrium(2)|large_intestine(1)|skin(3)	7		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00221)|OV - Ovarian serous cystadenocarcinoma(262;0.017)	Pseudoephedrine(DB00852)	CAAGCAAAAGAAGAGAGACCAG	0.673																																					p.214_214del	GBM(48;768 989 9196 9511 26329)	.											.	ATF5	92	0			c.640_641del						.																																			SO:0001589	frameshift_variant	22809	exon4			CAAAAGAAGAGAG	AF101388	CCDS12789.1	19q13.33	2013-09-20			ENSG00000169136	ENSG00000169136		"""basic leucine zipper proteins"""	790	protein-coding gene	gene with protein product		606398				10373550	Standard	NM_012068		Approved		uc002prd.3	Q9Y2D1	OTTHUMG00000183065	ENST00000423777.2:c.640_641delAA	19.37:g.50436140_50436141delAA	ENSP00000396954:p.Lys214fs	75.0	0.0		111.0	66.0	NM_012068	B3KND3|Q9BSA1|Q9UNQ3	Frame_Shift_Del	DEL	ENST00000423777.2	37	CCDS12789.1																																																																																			.		0.673	ATF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464915.2		
ATG2B	55102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	96781503	96781503	+	Silent	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr14:96781503G>A	ENST00000359933.4	-	23	4523	c.3630C>T	c.(3628-3630)agC>agT	p.S1210S		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1210					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		GCTCATGCCAGCTAAGCCCAG	0.353																																					p.S1210S		.											.	ATG2B	93	0			c.C3630T						.						37.0	36.0	36.0					14																	96781503		2203	4300	6503	SO:0001819	synonymous_variant	55102	exon23			ATGCCAGCTAAGC	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.3630C>T	14.37:g.96781503G>A		116.0	0.0		146.0	19.0	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Silent	SNP	ENST00000359933.4	37	CCDS9944.2																																																																																			.		0.353	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
ATP8A1	10396	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	42571193	42571193	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr4:42571193C>T	ENST00000381668.5	-	15	1556	c.1325G>A	c.(1324-1326)tGc>tAc	p.C442Y	ATP8A1_ENST00000264449.10_Intron	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	442					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	ATCAGGAGAGCAGCCATAATC	0.398																																					p.C442Y		.											.	ATP8A1	92	0			c.G1325A						.						81.0	81.0	81.0					4																	42571193		2203	4300	6503	SO:0001583	missense	10396	exon15			GGAGAGCAGCCAT	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.1325G>A	4.37:g.42571193C>T	ENSP00000371084:p.Cys442Tyr	268.0	0.0		340.0	73.0	NM_006095	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	ENST00000381668.5	37	CCDS3466.1	.	.	.	.	.	.	.	.	.	.	C	0.605	-0.827339	0.02734	.	.	ENSG00000124406	ENST00000381668	T	0.62498	0.02	5.5	4.53	0.55603	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.146330	0.47093	D	0.000259	T	0.19485	0.0468	N	0.00510	-1.415	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41288	-0.9517	10	0.07990	T	0.79	.	0.9765	0.01426	0.2304:0.3991:0.1881:0.1824	.	442	Q9Y2Q0	AT8A1_HUMAN	Y	442	ENSP00000371084:C442Y	ENSP00000371084:C442Y	C	-	2	0	ATP8A1	42265950	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.802000	0.27069	2.593000	0.87608	0.591000	0.81541	TGC	.		0.398	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095	
ATR	545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	142217617	142217617	+	Splice_Site	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:142217617C>A	ENST00000350721.4	-	32	5502		c.e32-1		ATR_ENST00000383101.3_Splice_Site	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase						cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						GATTTTCCATCTGAAAAACAA	0.373								Other conserved DNA damage response genes																													.		.											.	ATR	1139	0			c.5381-1G>T						.						50.0	48.0	49.0					3																	142217617		2203	4299	6502	SO:0001630	splice_region_variant	545	exon33			TTCCATCTGAAAA	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.5381-1G>T	3.37:g.142217617C>A		110.0	0.0		142.0	42.0	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Splice_Site	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.078832	0.76528	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	.	.	.	4.95	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1878	0.89797	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATR	143700307	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.298000	0.78815	2.317000	0.78254	0.650000	0.86243	.	.		0.373	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	Intron
BOD1L1	259282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	13604910	13604910	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr4:13604910T>C	ENST00000040738.5	-	10	3749	c.3614A>G	c.(3613-3615)aAg>aGg	p.K1205R		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1205						nucleus (GO:0005634)	DNA binding (GO:0003677)										ATGCATTTTCTTGGTCAAGGT	0.413																																					p.K1205R		.											.	.	.	0			c.A3614G						.						166.0	174.0	171.0					4																	13604910		2203	4300	6503	SO:0001583	missense	259282	exon10			ATTTTCTTGGTCA	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.3614A>G	4.37:g.13604910T>C	ENSP00000040738:p.Lys1205Arg	69.0	0.0		111.0	41.0	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	T	11.96	1.795466	0.31777	.	.	ENSG00000038219	ENST00000040738	T	0.14766	2.48	5.54	3.11	0.35812	.	0.268702	0.26887	N	0.021998	T	0.14227	0.0344	L	0.59436	1.845	0.26188	N	0.97963	B	0.25904	0.137	B	0.23852	0.049	T	0.15636	-1.0430	10	0.72032	D	0.01	-8.4431	8.4821	0.33049	0.0:0.1529:0.0:0.8471	.	1205	Q8NFC6	BOD1L_HUMAN	R	1205	ENSP00000040738:K1205R	ENSP00000040738:K1205R	K	-	2	0	BOD1L	13214008	1.000000	0.71417	0.991000	0.47740	0.078000	0.17371	1.821000	0.39041	0.403000	0.25479	-0.256000	0.11100	AAG	.		0.413	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
BRSK2	9024	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	1464728	1464728	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr11:1464728C>T	ENST00000528841.1	+	8	1027	c.643C>T	c.(643-645)Ccc>Tcc	p.P215S	BRSK2_ENST00000308219.9_Missense_Mutation_p.P215S|BRSK2_ENST00000531197.1_Missense_Mutation_p.P215S|BRSK2_ENST00000528710.1_Missense_Mutation_p.P155S|BRSK2_ENST00000308230.5_Missense_Mutation_p.P215S|BRSK2_ENST00000526678.1_Missense_Mutation_p.P215S|BRSK2_ENST00000544817.1_5'UTR|BRSK2_ENST00000382179.1_Missense_Mutation_p.P261S			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	215	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		GGGGGCTCTGCCCTTCGACGA	0.677																																					p.P261S		.											.	BRSK2	333	0			c.C781T						.						20.0	24.0	23.0					11																	1464728		2139	4266	6405	SO:0001583	missense	9024	exon8			GCTCTGCCCTTCG	AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.643C>T	11.37:g.1464728C>T	ENSP00000432000:p.Pro215Ser	33.0	0.0		46.0	20.0	NM_001256630	B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Missense_Mutation	SNP	ENST00000528841.1	37	CCDS58107.1	.	.	.	.	.	.	.	.	.	.	c	25.0	4.593626	0.86953	.	.	ENSG00000174672	ENST00000308219;ENST00000531197;ENST00000308230;ENST00000528841;ENST00000526678;ENST00000528710;ENST00000382179	T;T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06;1.06	3.26	3.26	0.37387	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.137263	0.49305	U	0.000143	T	0.78528	0.4297	H	0.99104	4.43	0.80722	D	1	P;D;P;D;D	0.89917	0.915;1.0;0.852;0.996;0.995	P;D;P;D;P	0.85130	0.497;0.997;0.497;0.921;0.871	D	0.88435	0.3038	10	0.87932	D	0	.	15.048	0.71841	0.0:1.0:0.0:0.0	.	215;261;215;215;215	Q8IWQ3-4;Q8IWQ3-5;Q8IWQ3-3;Q8IWQ3;Q8IWQ3-2	.;.;.;BRSK2_HUMAN;.	S	215;215;215;215;215;155;261	ENSP00000310697:P215S;ENSP00000431152:P215S;ENSP00000310805:P215S;ENSP00000432000:P215S;ENSP00000433370:P215S;ENSP00000433235:P155S;ENSP00000371614:P261S	ENSP00000310697:P215S	P	+	1	0	BRSK2	1421304	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	7.043000	0.76572	1.835000	0.53391	0.306000	0.20318	CCC	.		0.677	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393033.1	NM_003957	
BRWD3	254065	hgsc.bcm.edu;broad.mit.edu	37	X	79937564	79937576	+	Frame_Shift_Del	DEL	AACTTCATTTGTT	AACTTCATTTGTT	-			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	AACTTCATTTGTT	AACTTCATTTGTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chrX:79937564_79937576delAACTTCATTTGTT	ENST00000373275.4	-	39	4631_4643	c.4415_4427delAACAAATGAAGTT	c.(4414-4428)aaacaaatgaagttgfs	p.KQMKL1472fs	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1472					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TTTAGGCTGCAACTTCATTTGTTTCTGCTTCCC	0.357																																					p.1472_1476del		.											.	BRWD3	134	0			c.4415_4427del						.																																			SO:0001589	frameshift_variant	254065	exon39			GGCTGCAACTTCA		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.4415_4427delAACAAATGAAGTT	X.37:g.79937564_79937576delAACTTCATTTGTT	ENSP00000362372:p.Lys1472fs	40.0	0.0		83.0	13.0	NM_153252	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Frame_Shift_Del	DEL	ENST00000373275.4	37	CCDS14447.1																																																																																			.		0.357	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	
BTBD16	118663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	124090748	124090748	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr10:124090748A>T	ENST00000260723.4	+	12	1312	c.1061A>T	c.(1060-1062)cAg>cTg	p.Q354L	BTBD16_ENST00000368994.2_Missense_Mutation_p.Q355L	NM_144587.2	NP_653188.2	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16	354										breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(3)|skin(2)|stomach(1)|urinary_tract(1)	15		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)				TGGCTCGACCAGGTTACAGTC	0.463																																					p.Q354L		.											.	BTBD16	91	0			c.A1061T						.						98.0	88.0	91.0					10																	124090748		2203	4300	6503	SO:0001583	missense	118663	exon12			TCGACCAGGTTAC	AK058088	CCDS31301.1	10q26.13	2013-01-24	2006-07-04	2006-07-04	ENSG00000138152	ENSG00000138152		"""BTB/POZ domain containing"""	26340	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 87"""	C10orf87			Standard	NM_144587		Approved	FLJ25359, Em:AC061711.1	uc001lgc.1	Q32M84	OTTHUMG00000019182	ENST00000260723.4:c.1061A>T	10.37:g.124090748A>T	ENSP00000260723:p.Gln354Leu	62.0	0.0		81.0	18.0	NM_144587	A6NM63|Q4VXL1|Q96LN0	Missense_Mutation	SNP	ENST00000260723.4	37	CCDS31301.1	.	.	.	.	.	.	.	.	.	.	A	7.930	0.740456	0.15642	.	.	ENSG00000138152	ENST00000260723;ENST00000368994	T;T	0.17854	2.25;2.25	5.98	4.14	0.48551	.	0.281347	0.29791	N	0.011184	T	0.08492	0.0211	N	0.08118	0	0.09310	N	1	B;B	0.16603	0.018;0.018	B;B	0.15870	0.014;0.014	T	0.29181	-1.0020	10	0.31617	T	0.26	-24.1955	9.1282	0.36828	0.1671:0.0:0.8329:0.0	.	355;354	Q32M84-2;Q32M84	.;BTBDG_HUMAN	L	354;355	ENSP00000260723:Q354L;ENSP00000357990:Q355L	ENSP00000260723:Q354L	Q	+	2	0	BTBD16	124080738	0.880000	0.30214	0.009000	0.14445	0.026000	0.11368	1.678000	0.37586	0.881000	0.35993	-0.132000	0.14878	CAG	.		0.463	BTBD16-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050780.3	NM_144587	
BTN1A1	696	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26505270	26505270	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr6:26505270G>A	ENST00000244513.6	+	3	611	c.545G>A	c.(544-546)gGa>gAa	p.G182E		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	182	Ig-like V-type 2.					extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						ACTTCCAAGGGAGAGAAGTTT	0.478																																					p.G182E		.											.	BTN1A1	92	0			c.G545A						.						108.0	105.0	106.0					6																	26505270		2203	4300	6503	SO:0001583	missense	696	exon3			CCAAGGGAGAGAA	U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	ENST00000244513.6:c.545G>A	6.37:g.26505270G>A	ENSP00000244513:p.Gly182Glu	101.0	1.0		205.0	88.0	NM_001732	Q4VAN3|Q4VAN4|Q9H458	Missense_Mutation	SNP	ENST00000244513.6	37	CCDS4614.1	.	.	.	.	.	.	.	.	.	.	G	13.56	2.274477	0.40194	.	.	ENSG00000124557	ENST00000244513;ENST00000377586	T	0.11930	2.73	5.63	3.86	0.44501	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.456503	0.20859	N	0.084386	T	0.12646	0.0307	M	0.75264	2.295	0.21553	N	0.999642	P	0.50156	0.932	P	0.51079	0.658	T	0.06570	-1.0819	10	0.56958	D	0.05	.	8.906	0.35523	0.1563:0.0:0.8437:0.0	.	182	Q13410	BT1A1_HUMAN	E	182	ENSP00000244513:G182E	ENSP00000244513:G182E	G	+	2	0	BTN1A1	26613249	1.000000	0.71417	0.019000	0.16419	0.321000	0.28281	3.152000	0.50677	0.741000	0.32674	0.655000	0.94253	GGA	.		0.478	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043776.1	NM_001732	
BYSL	705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	41889314	41889314	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr6:41889314A>T	ENST00000230340.4	+	1	389	c.14A>T	c.(13-15)aAg>aTg	p.K5M	MED20_ENST00000265350.4_5'Flank|MED20_ENST00000409060.1_5'Flank|MED20_ENST00000467535.1_5'Flank|MED20_ENST00000409312.1_5'Flank	NM_004053.3	NP_004044.3	Q13895	BYST_HUMAN	bystin-like	5					cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|female pregnancy (GO:0007565)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|trophectodermal cell differentiation (GO:0001829)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(5)|skin(1)	8	Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000473)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CCCAAATTCAAGGCGGCCCGT	0.647											OREG0017436	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K5M		.											.	BYSL	90	0			c.A14T						.						15.0	19.0	17.0					6																	41889314		2101	4225	6326	SO:0001583	missense	705	exon1			AATTCAAGGCGGC	L36720	CCDS34450.1	6p21.1	2008-08-29			ENSG00000112578	ENSG00000112578			1157	protein-coding gene	gene with protein product		603871				9925933, 17381424	Standard	NM_004053		Approved		uc003orl.3	Q13895	OTTHUMG00000014687	ENST00000230340.4:c.14A>T	6.37:g.41889314A>T	ENSP00000230340:p.Lys5Met	76.0	0.0	904	119.0	35.0	NM_004053	Q6P5W4|Q86W44|Q96IP8	Missense_Mutation	SNP	ENST00000230340.4	37	CCDS34450.1	.	.	.	.	.	.	.	.	.	.	A	14.83	2.653470	0.47362	.	.	ENSG00000112578	ENST00000230340	T	0.24151	1.87	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.40670	0.1126	M	0.80982	2.52	0.53688	D	0.999978	D	0.71674	0.998	P	0.60789	0.879	T	0.48055	-0.9068	10	0.87932	D	0	-21.834	14.3007	0.66346	1.0:0.0:0.0:0.0	.	5	Q13895	BYST_HUMAN	M	5	ENSP00000230340:K5M	ENSP00000230340:K5M	K	+	2	0	BYSL	41997292	1.000000	0.71417	0.109000	0.21407	0.054000	0.15201	4.722000	0.61958	2.036000	0.60181	0.533000	0.62120	AAG	.		0.647	BYSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040535.2		
RBM7	10179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	114271008	114271008	+	5'UTR	SNP	T	T	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr11:114271008T>A	ENST00000540163.1	+	0	257				RBM7_ENST00000375490.5_5'Flank|RBM7_ENST00000545678.1_5'Flank|RBM7_ENST00000544582.1_5'Flank|RP11-212D19.4_ENST00000544347.1_5'Flank|RBM7_ENST00000541475.1_5'Flank|C11orf71_ENST00000325636.4_Missense_Mutation_p.R16W			Q9Y580	RBM7_HUMAN	RNA binding motif protein 7						meiotic nuclear division (GO:0007126)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17		all_cancers(61;5.06e-12)|all_epithelial(67;5.3e-06)|all_hematologic(158;7.68e-05)|Acute lymphoblastic leukemia(157;0.000966)|Melanoma(852;0.00153)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.0818)|Prostate(24;0.104)		BRCA - Breast invasive adenocarcinoma(274;2.56e-06)|Epithelial(105;4.17e-05)|all cancers(92;0.000348)		TAGGCCACCCTGCTCCTCTGA	0.602																																					p.R16W		.											.	.	.	0			c.A46T						.						16.0	17.0	17.0					11																	114271008		2197	4287	6484	SO:0001623	5_prime_UTR_variant	54494	exon1			CCACCCTGCTCCT	AF156098	CCDS8370.1, CCDS66233.1, CCDS73395.1	11q23.1-q23.2	2013-02-12			ENSG00000076053	ENSG00000076053		"""RNA binding motif (RRM) containing"""	9904	protein-coding gene	gene with protein product		612413				12477932	Standard	NM_001286045		Approved		uc001pov.3	Q9Y580		ENST00000540163.1:c.-386T>A	11.37:g.114271008T>A		87.0	0.0		158.0	60.0	NM_001271562	B2R6K8|Q9NUT4	Missense_Mutation	SNP	ENST00000540163.1	37	CCDS8370.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.195879	0.78902	.	.	ENSG00000180425	ENST00000325636	.	.	.	5.1	-10.1	0.00402	.	0.159465	0.27375	N	0.019642	T	0.16257	0.0391	L	0.32530	0.975	0.18873	N	0.999987	B;B	0.31548	0.043;0.328	B;B	0.28011	0.035;0.085	T	0.03374	-1.1043	9	0.87932	D	0	-2.9015	5.425	0.16421	0.0956:0.205:0.5153:0.1841	.	16;16	Q6IPW1;Q6IPW1-2	CK071_HUMAN;.	W	16	.	ENSP00000325508:R16W	R	-	1	2	C11orf71	113776218	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.196000	0.00562	-1.895000	0.01104	-0.313000	0.08912	AGG	.		0.602	RBM7-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399010.1	NM_016090	
C16orf96	342346	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	4606659	4606659	+	Nonsense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr16:4606659C>T	ENST00000444310.4	+	1	169	c.169C>T	c.(169-171)Cag>Tag	p.Q57*		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						GCAGACCTCGCAGGTGGTCAT	0.597																																					p.Q57X		.											.	.	.	0			c.C169T						.						66.0	74.0	72.0					16																	4606659		692	1591	2283	SO:0001587	stop_gained	342346	exon1			ACCTCGCAGGTGG		CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.169C>T	16.37:g.4606659C>T	ENSP00000415027:p.Gln57*	51.0	0.0		81.0	21.0	NM_001145011		Nonsense_Mutation	SNP	ENST00000444310.4	37	CCDS53986.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.644445	0.67244	.	.	ENSG00000205832	ENST00000444310	.	.	.	4.74	3.79	0.43588	.	0.943592	0.08739	N	0.900900	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-0.0892	9.2358	0.37466	0.0:0.8992:0.0:0.1008	.	.	.	.	X	57	.	ENSP00000415027:Q57X	Q	+	1	0	C16orf96	4546660	0.005000	0.15991	0.001000	0.08648	0.010000	0.07245	2.064000	0.41432	1.126000	0.42016	0.655000	0.94253	CAG	.		0.597	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432384.1	NM_001145011	
C21orf59	56683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	33975557	33975557	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr21:33975557C>A	ENST00000290155.3	-	5	1202	c.580G>T	c.(580-582)Gca>Tca	p.A194S	AP000275.65_ENST00000553001.1_Missense_Mutation_p.A194S|C21orf59_ENST00000382549.4_Missense_Mutation_p.A194S|C21orf59_ENST00000540881.1_Missense_Mutation_p.A138S	NM_021254.2	NP_067077.1	P57076	CU059_HUMAN	chromosome 21 open reading frame 59	194						cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|prostate(1)|skin(1)	5						TCCTTGGCTGCCCACCACAGC	0.512																																					p.A194S		.											.	C21orf59	90	0			c.G580T						.						122.0	108.0	113.0					21																	33975557		2203	4300	6503	SO:0001583	missense	56683	exon5			TGGCTGCCCACCA	AF282851	CCDS13617.1	21q22.11	2014-02-03	2003-07-22		ENSG00000159079	ENSG00000159079			1301	protein-coding gene	gene with protein product		615494	"""chromosome 21 open reading frame 48"""	C21orf48		24094744	Standard	NM_021254		Approved	FLJ20467, FBB18, CILD26	uc002yqc.3	P57076	OTTHUMG00000179510	ENST00000290155.3:c.580G>T	21.37:g.33975557C>A	ENSP00000290155:p.Ala194Ser	74.0	0.0		101.0	26.0	NM_021254	Q53FH0	Missense_Mutation	SNP	ENST00000290155.3	37	CCDS13617.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.0|23.0	4.358422|4.358422	0.82243|0.82243	.|.	.|.	ENSG00000159079|ENSG00000159079	ENST00000553001;ENST00000440966;ENST00000382549;ENST00000290155;ENST00000543202;ENST00000540881;ENST00000458138|ENST00000425336	.|.	.|.	.|.	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	0.048668|.	0.85682|.	D|.	0.000000|.	T|T	0.69106|0.69106	0.3074|0.3074	L|L	0.45581|0.45581	1.43|1.43	0.80722|0.80722	D|D	1|1	B;B;B;B;B;P;B|.	0.42908|.	0.167;0.017;0.055;0.055;0.044;0.793;0.056|.	B;B;B;B;B;B;B|.	0.43508|.	0.05;0.04;0.095;0.204;0.084;0.422;0.113|.	T|T	0.64875|0.64875	-0.6304|-0.6304	9|5	0.27082|.	T|.	0.32|.	-30.3542|-30.3542	19.2812|19.2812	0.94053|0.94053	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	138;194;194;194;194;75;194|.	F5GXV2;Q53FH0;C9J818;P57076;D3DSE6;Q8N9H5;Q96NJ2|.	.;.;.;CU059_HUMAN;.;.;.|.	S|V	194;194;194;194;194;138;177|41	.|.	ENSP00000290155:A194S|.	A|G	-|-	1|2	0|0	C21orf59|C21orf59	32897428|32897428	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.982000|0.982000	0.71751|0.71751	7.722000|7.722000	0.84778|0.84778	2.621000|2.621000	0.88768|0.88768	0.563000|0.563000	0.77884|0.77884	GCA|GGC	.		0.512	C21orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139431.1	NM_021254	
C3orf20	84077	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	14745959	14745959	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:14745959A>G	ENST00000253697.3	+	7	1446	c.994A>G	c.(994-996)Acc>Gcc	p.T332A	C3orf20_ENST00000495387.1_3'UTR|C3orf20_ENST00000412910.1_Missense_Mutation_p.T210A|C3orf20_ENST00000435614.1_Missense_Mutation_p.T210A	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	332						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						AGACTCTCAGACCCCGGGTTT	0.507																																					p.T332A		.											.	C3orf20	94	0			c.A994G						.						150.0	160.0	157.0					3																	14745959		2203	4300	6503	SO:0001583	missense	84077	exon7			TCTCAGACCCCGG	AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.994A>G	3.37:g.14745959A>G	ENSP00000253697:p.Thr332Ala	119.0	0.0		205.0	30.0	NM_032137	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	ENST00000253697.3	37	CCDS33706.1	.	.	.	.	.	.	.	.	.	.	A	8.343	0.829143	0.16749	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.09350	3.28;2.99;2.99	3.43	-5.33	0.02713	.	1.818810	0.03725	N	0.252506	T	0.06826	0.0174	L	0.29908	0.895	0.09310	N	1	B	0.31817	0.341	B	0.28139	0.086	T	0.27938	-1.0059	10	0.30854	T	0.27	0.1437	5.0461	0.14485	0.3043:0.3146:0.3811:0.0	.	332	Q8ND61	CC020_HUMAN	A	332;210;210	ENSP00000253697:T332A;ENSP00000402933:T210A;ENSP00000396081:T210A	ENSP00000253697:T332A	T	+	1	0	C3orf20	14720963	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.700000	0.05081	-1.097000	0.03042	-0.334000	0.08254	ACC	.		0.507	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137	
C5orf22	55322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	31538578	31538578	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr5:31538578T>G	ENST00000325366.9	+	4	716	c.589T>G	c.(589-591)Tct>Gct	p.S197A	C5orf22_ENST00000355907.3_5'UTR	NM_018356.2	NP_060826.2	Q49AR2	CE022_HUMAN	chromosome 5 open reading frame 22	197										kidney(3)|large_intestine(2)|lung(10)|ovary(2)|skin(1)	18						TAACTGTGACTCTTCTTCAGA	0.433																																					p.S197A		.											.	C5orf22	92	0			c.T589G						.						81.0	77.0	79.0					5																	31538578		2203	4300	6503	SO:0001583	missense	55322	exon4			TGTGACTCTTCTT	AK002055	CCDS3895.1	5p13.3	2012-02-22			ENSG00000082213	ENSG00000082213			25639	protein-coding gene	gene with protein product							Standard	NM_018356		Approved	FLJ11193	uc003jhj.4	Q49AR2	OTTHUMG00000131067	ENST00000325366.9:c.589T>G	5.37:g.31538578T>G	ENSP00000326879:p.Ser197Ala	133.0	0.0		176.0	56.0	NM_018356	Q8ND28|Q8WU61|Q9NUR1	Missense_Mutation	SNP	ENST00000325366.9	37	CCDS3895.1	.	.	.	.	.	.	.	.	.	.	T	10.79	1.450543	0.26074	.	.	ENSG00000082213	ENST00000325366	T	0.30714	1.52	5.2	4.05	0.47172	.	0.734400	0.13716	N	0.367778	T	0.33673	0.0871	M	0.67953	2.075	0.58432	D	0.999998	B	0.31125	0.309	B	0.31946	0.138	T	0.08351	-1.0726	10	0.48119	T	0.1	-3.7463	10.7368	0.46130	0.0:0.0737:0.0:0.9263	.	197	Q49AR2	CE022_HUMAN	A	197	ENSP00000326879:S197A	ENSP00000326879:S197A	S	+	1	0	C5orf22	31574335	0.000000	0.05858	0.003000	0.11579	0.337000	0.28794	0.327000	0.19663	1.004000	0.39156	0.533000	0.62120	TCT	.		0.433	C5orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253726.2	NM_018356	
C6orf165	154313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	88138481	88138481	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr6:88138481G>T	ENST00000507897.1	+	9	1181	c.1098G>T	c.(1096-1098)atG>atT	p.M366I	C6ORF165_ENST00000369562.4_Missense_Mutation_p.M366I			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	366										NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		AGAGAGTGATGCAATGTCATC	0.378																																					p.M366I		.											.	C6orf165	90	0			c.G1098T						.						152.0	133.0	140.0					6																	88138481		2203	4300	6503	SO:0001583	missense	154313	exon9			AGTGATGCAATGT	BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.1098G>T	6.37:g.88138481G>T	ENSP00000426769:p.Met366Ile	143.0	0.0		197.0	32.0	NM_001031743	A8K969|E1P507|Q8N9U4	Missense_Mutation	SNP	ENST00000507897.1	37	CCDS34498.1	.	.	.	.	.	.	.	.	.	.	G	0.239	-1.015397	0.02078	.	.	ENSG00000213204	ENST00000369562	T	0.27720	1.65	5.18	-0.553	0.11815	.	0.723121	0.14082	N	0.342647	T	0.03220	0.0094	N	0.05124	-0.11	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.38329	-0.9666	10	0.30854	T	0.27	.	0.7963	0.01067	0.3562:0.1176:0.2955:0.2306	.	366	Q8IYR0	CF165_HUMAN	I	366	ENSP00000358575:M366I	ENSP00000358575:M366I	M	+	3	0	C6orf165	88195200	0.001000	0.12720	0.009000	0.14445	0.003000	0.03518	-0.864000	0.04254	0.409000	0.25649	-0.355000	0.07637	ATG	.		0.378	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000470406.1	NM_178823	
CA8	767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	61135274	61135274	+	Silent	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr8:61135274G>T	ENST00000317995.4	-	7	936	c.672C>A	c.(670-672)atC>atA	p.I224I	CA8_ENST00000528666.1_5'UTR	NM_004056.4	NP_004047.3	P35219	CAH8_HUMAN	carbonic anhydrase VIII	224					one-carbon metabolic process (GO:0006730)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasm (GO:0005737)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(6)|prostate(2)|skin(1)	16		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)			Zonisamide(DB00909)	TGCAAGGTGGGATGGTGAGAG	0.463																																					p.I224I		.											.	CA8	90	0			c.C672A						.						119.0	109.0	112.0					8																	61135274		2203	4300	6503	SO:0001819	synonymous_variant	767	exon7			AGGTGGGATGGTG	L04656	CCDS6174.1	8q12.1	2012-08-21			ENSG00000178538	ENSG00000178538		"""Carbonic anhydrases"""	1382	protein-coding gene	gene with protein product		114815		CALS		17219437	Standard	NM_004056		Approved	CARP	uc003xtz.1	P35219	OTTHUMG00000165325	ENST00000317995.4:c.672C>A	8.37:g.61135274G>T		62.0	0.0		69.0	28.0	NM_004056	A8K0A5|B3KQZ7|Q32MY2	Silent	SNP	ENST00000317995.4	37	CCDS6174.1																																																																																			.		0.463	CA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383445.1		
CADPS2	93664	broad.mit.edu;mdanderson.org	37	7	122526241	122526241	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:122526241C>A	ENST00000449022.2	-	1	170	c.151G>T	c.(151-153)Ggc>Tgc	p.G51C	CADPS2_ENST00000412584.2_Missense_Mutation_p.G51C|CADPS2_ENST00000313070.7_Missense_Mutation_p.G51C|CADPS2_ENST00000334010.7_Missense_Mutation_p.G51C	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	51					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						gccgcgccgccgccgcccgcg	0.756																																					p.G51C		.											.	CADPS2	94	0			c.G151T						.						3.0	4.0	4.0					7																	122526241		1320	2996	4316	SO:0001583	missense	93664	exon1			CGCCGCCGCCGCC		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.151G>T	7.37:g.122526241C>A	ENSP00000398481:p.Gly51Cys	13.0	0.0		68.0	13.0	NM_001167940	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	ENST00000449022.2	37	CCDS55158.1	.	.	.	.	.	.	.	.	.	.	C	17.87	3.495702	0.64186	.	.	ENSG00000081803	ENST00000313070;ENST00000334010;ENST00000420900;ENST00000412584;ENST00000449022	T;T;T;T	0.47177	0.86;0.86;0.86;0.85	4.09	4.09	0.47781	.	0.367584	0.23398	N	0.048620	T	0.34279	0.0892	L	0.29908	0.895	0.27885	N	0.939525	B;B	0.10296	0.003;0.002	B;B	0.06405	0.002;0.001	T	0.30822	-0.9965	10	0.87932	D	0	.	9.1409	0.36903	0.2177:0.7823:0.0:0.0	.	51;51	Q86UW7-2;Q86UW7	.;CAPS2_HUMAN	C	51	ENSP00000325581:G51C;ENSP00000333940:G51C;ENSP00000400401:G51C;ENSP00000398481:G51C	ENSP00000325581:G51C	G	-	1	0	CADPS2	122313477	0.836000	0.29430	0.995000	0.50966	0.969000	0.65631	0.220000	0.17660	2.080000	0.62538	0.557000	0.71058	GGC	.		0.756	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954	
CCL8	6355	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	32647344	32647344	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr17:32647344A>G	ENST00000394620.1	+	2	599	c.133A>G	c.(133-135)Atc>Gtc	p.I45V		NM_005623.2	NP_005614.2	P80075	CCL8_HUMAN	chemokine (C-C motif) ligand 8	45					calcium ion transport (GO:0006816)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|exocytosis (GO:0006887)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of catalytic activity (GO:0043085)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemokine activity (GO:0008009)|heparin binding (GO:0008201)|phospholipase activator activity (GO:0016004)|protein kinase activity (GO:0004672)			NS(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Ovarian(249;0.0443)|Breast(31;0.151)				GAAAATTCCTATCCAGAGGCT	0.443																																					p.I45V		.											.	CCL8	90	0			c.A133G						.						86.0	73.0	78.0					17																	32647344		2203	4300	6503	SO:0001583	missense	6355	exon2			ATTCCTATCCAGA	X99886	CCDS11280.1	17q11.2	2013-02-25	2002-08-22	2002-08-23	ENSG00000108700	ENSG00000108700		"""Chemokine ligands"", ""Endogenous ligands"""	10635	protein-coding gene	gene with protein product		602283	"""small inducible cytokine subfamily A (Cys-Cys), member 8 (monocyte chemotactic protein 2)"""	SCYA8		9119400	Standard	NM_005623		Approved	MCP-2, HC14	uc002hib.3	P80075	OTTHUMG00000132883	ENST00000394620.1:c.133A>G	17.37:g.32647344A>G	ENSP00000378118:p.Ile45Val	54.0	0.0		38.0	29.0	NM_005623	A0AV77|P78388	Missense_Mutation	SNP	ENST00000394620.1	37	CCDS11280.1	.	.	.	.	.	.	.	.	.	.	A	3.904	-0.021432	0.07634	.	.	ENSG00000108700	ENST00000394620;ENST00000225840	.	.	.	5.62	-5.08	0.02929	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	1.466460	0.04403	N	0.364669	T	0.14527	0.0351	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.14023	0.01	T	0.15093	-1.0449	8	0.13108	T	0.6	.	2.2282	0.03990	0.2052:0.2747:0.0767:0.4433	.	45	P80075	CCL8_HUMAN	V	55;45	.	ENSP00000225840:I45V	I	+	1	0	CCL8	29671457	0.000000	0.05858	0.002000	0.10522	0.011000	0.07611	-0.623000	0.05546	-0.479000	0.06813	-0.490000	0.04691	ATC	.		0.443	CCL8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256376.2	NM_005623	
CCPG1	9236	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	55651833	55651833	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr15:55651833T>A	ENST00000310958.6	-	8	2436	c.2138A>T	c.(2137-2139)gAa>gTa	p.E713V	DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000442196.3_Missense_Mutation_p.E713V|CCPG1_ENST00000569205.1_Missense_Mutation_p.E713V|CCPG1_ENST00000425574.3_Missense_Mutation_p.E330V	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1	713					cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)				autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		TACTTCATATTCCTTCATGTT	0.338																																					p.E713V		.											.	CCPG1	91	0			c.A2138T						.						58.0	56.0	57.0					15																	55651833		1806	4060	5866	SO:0001583	missense	9236	exon8			TCATATTCCTTCA	AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.2138A>T	15.37:g.55651833T>A	ENSP00000311656:p.Glu713Val	63.0	0.0		111.0	11.0	NM_020739	A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Missense_Mutation	SNP	ENST00000310958.6	37	CCDS42039.1	.	.	.	.	.	.	.	.	.	.	T	19.96	3.922565	0.73213	.	.	ENSG00000256061	ENST00000310958;ENST00000442196;ENST00000425574	T;T;T	0.38722	3.63;3.63;1.12	5.83	5.83	0.93111	.	0.091451	0.64402	D	0.000001	T	0.60457	0.2270	M	0.65498	2.005	0.80722	D	1	D;D;D;D	0.59767	0.986;0.966;0.986;0.986	P;D;D;D	0.64237	0.875;0.923;0.92;0.92	T	0.59139	-0.7510	10	0.38643	T	0.18	.	15.3809	0.74654	0.0:0.0:0.0:1.0	.	713;330;713;569	A8K9T0;Q9ULG6-3;Q9ULG6;Q9ULG6-2	.;.;CCPG1_HUMAN;.	V	713;713;330	ENSP00000311656:E713V;ENSP00000403400:E713V;ENSP00000415128:E330V	ENSP00000311656:E713V	E	-	2	0	DYX1C1	53439125	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	5.791000	0.69045	2.240000	0.73641	0.528000	0.53228	GAA	.		0.338	CCPG1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419850.1	NM_004748	
CCR1	1230	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	46245458	46245458	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:46245458C>A	ENST00000296140.3	-	2	472	c.347G>T	c.(346-348)gGc>gTc	p.G116V	CCR3_ENST00000357422.2_Intron	NM_001295.2	NP_001286.1	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	116					calcium ion transport (GO:0006816)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|exocytosis (GO:0006887)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of bone mineralization (GO:0030502)|negative regulation of gene expression (GO:0010629)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of osteoclast differentiation (GO:0045672)|response to wounding (GO:0009611)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine (C-C motif) ligand 7 binding (GO:0035717)|chemokine receptor activity (GO:0004950)|phosphatidylinositol phospholipase C activity (GO:0004435)			autonomic_ganglia(1)|large_intestine(6)|lung(6)|pancreas(1)|skin(3)	17				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		GCTGTACAAGCCTGTGTAATA	0.498																																					p.G116V		.											.	CCR1	660	0			c.G347T						.						118.0	117.0	117.0					3																	46245458		2203	4300	6503	SO:0001583	missense	1230	exon2			TACAAGCCTGTGT		CCDS2737.1	3p21	2012-08-08			ENSG00000163823	ENSG00000163823		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1602	protein-coding gene	gene with protein product		601159		SCYAR1, CMKBR1		7679328	Standard	NM_001295		Approved	CKR-1, MIP1aR, CD191	uc003cph.1	P32246	OTTHUMG00000133451	ENST00000296140.3:c.347G>T	3.37:g.46245458C>A	ENSP00000296140:p.Gly116Val	108.0	1.0		166.0	44.0	NM_001295	Q86VA9	Missense_Mutation	SNP	ENST00000296140.3	37	CCDS2737.1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.376486	0.61735	.	.	ENSG00000163823	ENST00000296140	T	0.37752	1.18	4.86	4.86	0.63082	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.69815	0.3153	M	0.92923	3.36	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.79142	-0.1925	10	0.87932	D	0	.	18.3724	0.90411	0.0:1.0:0.0:0.0	.	116	P32246	CCR1_HUMAN	V	116	ENSP00000296140:G116V	ENSP00000296140:G116V	G	-	2	0	CCR1	46220462	1.000000	0.71417	0.968000	0.41197	0.899000	0.52679	3.234000	0.51320	2.412000	0.81896	0.655000	0.94253	GGC	.		0.498	CCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257325.2	NM_001295	
CCR3	1232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	46307579	46307579	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:46307579G>T	ENST00000357422.2	+	4	1473	c.930G>T	c.(928-930)aaG>aaT	p.K310N	CCR3_ENST00000395942.2_Missense_Mutation_p.K310N|CCR3_ENST00000545097.1_Missense_Mutation_p.K331N|CCR3_ENST00000541018.1_Missense_Mutation_p.K310N|CCR3_ENST00000395940.2_Missense_Mutation_p.K310N			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	310					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		GGTTCCGGAAGTACCTGCGCC	0.547																																					p.K331N		.											.	CCR3	660	0			c.G993T						.						110.0	91.0	97.0					3																	46307579		2203	4300	6503	SO:0001583	missense	1232	exon3			CCGGAAGTACCTG	AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.930G>T	3.37:g.46307579G>T	ENSP00000350003:p.Lys310Asn	29.0	0.0		63.0	23.0	NM_178328	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Missense_Mutation	SNP	ENST00000357422.2	37	CCDS2738.1	.	.	.	.	.	.	.	.	.	.	G	4.694	0.129045	0.08981	.	.	ENSG00000183625	ENST00000357422;ENST00000545097;ENST00000541018;ENST00000395940;ENST00000395942	T;T;T;T;T	0.38240	1.15;1.15;1.15;1.15;1.15	5.55	0.627	0.17675	.	0.093240	0.45126	D	0.000390	T	0.29491	0.0735	M	0.62723	1.935	0.39195	D	0.963042	B;B	0.28636	0.218;0.054	B;B	0.37451	0.25;0.077	T	0.06661	-1.0814	10	0.12430	T	0.62	.	2.1353	0.03760	0.5229:0.1356:0.2045:0.1369	.	331;310	F5GWL6;P51677	.;CCR3_HUMAN	N	310;331;310;310;310	ENSP00000350003:K310N;ENSP00000441600:K331N;ENSP00000440097:K310N;ENSP00000379271:K310N;ENSP00000379273:K310N	ENSP00000350003:K310N	K	+	3	2	CCR3	46282583	0.021000	0.18746	0.602000	0.28890	0.330000	0.28571	0.113000	0.15499	0.175000	0.19841	-0.140000	0.14226	AAG	.		0.547	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257380.2		
CCR2	729230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	46400024	46400024	+	Intron	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:46400024T>C	ENST00000400888.2	+	1	980				CCR2_ENST00000445132.2_Missense_Mutation_p.Y336H|CCR2_ENST00000292301.4_Intron|CCR2_ENST00000465202.1_3'UTR			P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2						blood vessel remodeling (GO:0001974)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular homeostasis (GO:0019725)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JAK-STAT cascade (GO:0007259)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of angiogenesis (GO:0016525)|negative regulation of eosinophil degranulation (GO:0043310)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of astrocyte chemotaxis (GO:2000464)|positive regulation of CD8-positive, alpha-beta T cell extravasation (GO:2000451)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of monocyte extravasation (GO:2000439)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of vascular endothelial growth factor production (GO:0010574)|response to wounding (GO:0009611)|T-helper 17 cell chemotaxis (GO:0035705)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|CCR2 chemokine receptor binding (GO:0031727)|chemokine receptor activity (GO:0004950)|protein homodimerization activity (GO:0042803)			breast(3)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)	14				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		TCCAGTTTTCTACAGGGAGAC	0.483																																					p.Y336H		.											.	CCR2	568	0			c.T1006C						.						70.0	63.0	65.0					3																	46400024		692	1591	2283	SO:0001627	intron_variant	729230	exon2			GTTTTCTACAGGG		CCDS43078.1, CCDS46813.1	3p21	2012-08-08			ENSG00000121807	ENSG00000121807		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1603	protein-coding gene	gene with protein product		601267		CMKBR2		8146186	Standard	NM_001123041		Approved	CC-CKR-2, CKR2, MCP-1-R, CD192, FLJ78302	uc003cpn.4	P41597	OTTHUMG00000156466	ENST00000400888.2:c.941+65T>C	3.37:g.46400024T>C		41.0	0.0		79.0	22.0	NM_001123396	A0AVQ3|B2RMT0|Q4VBL2	Missense_Mutation	SNP	ENST00000400888.2	37	CCDS43078.1	.	.	.	.	.	.	.	.	.	.	T	0.947	-0.707589	0.03230	.	.	ENSG00000121807	ENST00000445132	T	0.36520	1.25	4.91	3.73	0.42828	.	.	.	.	.	T	0.22859	0.0552	L	0.27053	0.805	0.51767	D	0.999936	B	0.02656	0.0	B	0.04013	0.001	T	0.05370	-1.0889	9	0.18276	T	0.48	.	9.817	0.40858	0.0:0.0834:0.0:0.9166	.	336	Q4VBL2	.	H	336	ENSP00000399285:Y336H	ENSP00000399285:Y336H	Y	+	1	0	CCR2	46375028	0.998000	0.40836	0.474000	0.27266	0.038000	0.13279	2.480000	0.45206	1.977000	0.57605	0.455000	0.32223	TAC	.		0.483	CCR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344292.1	NM_000647	
CCT3	7203	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156294772	156294772	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:156294772T>C	ENST00000295688.3	-	6	693	c.413A>G	c.(412-414)aAg>aGg	p.K138R	CCT3_ENST00000472765.2_Missense_Mutation_p.K93R|CCT3_ENST00000368261.3_Missense_Mutation_p.K93R|CCT3_ENST00000368259.2_Missense_Mutation_p.K100R	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	138					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					CCTTATTTTCTTTAGGGTGCT	0.498																																					p.K138R		.											.	CCT3	92	0			c.A413G						.						111.0	94.0	100.0					1																	156294772		2203	4300	6503	SO:0001583	missense	7203	exon6			ATTTTCTTTAGGG	BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.413A>G	1.37:g.156294772T>C	ENSP00000295688:p.Lys138Arg	37.0	0.0		41.0	26.0	NM_005998	A6NE14|Q5SZY1|Q9BR64	Missense_Mutation	SNP	ENST00000295688.3	37	CCDS1140.2	.	.	.	.	.	.	.	.	.	.	T	15.29	2.790312	0.50102	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765;ENST00000413555;ENST00000496684;ENST00000533194;ENST00000446905;ENST00000478640;ENST00000415548	T;T;T;T;T;T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22;-1.22;-1.22;-1.22;-1.22;-0.71	5.41	4.29	0.51040	.	0.111325	0.64402	D	0.000015	T	0.52338	0.1728	L	0.41906	1.305	0.36033	D	0.839533	B;B;B	0.12013	0.005;0.001;0.001	B;B;B	0.11329	0.005;0.006;0.004	T	0.52411	-0.8579	10	0.51188	T	0.08	-20.2897	8.2167	0.31516	0.0:0.0912:0.0:0.9088	.	100;137;138	P49368-2;E9PAQ6;P49368	.;.;TCPG_HUMAN	R	138;100;93;93;162;137;59;124;117;161	ENSP00000295688:K138R;ENSP00000357242:K100R;ENSP00000357244:K93R;ENSP00000431543:K93R;ENSP00000413308:K162R;ENSP00000434232:K137R;ENSP00000434481:K59R;ENSP00000388799:K124R;ENSP00000435026:K117R;ENSP00000413431:K161R	ENSP00000295688:K138R	K	-	2	0	CCT3	154561396	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	4.610000	0.61155	0.896000	0.36366	-0.443000	0.05667	AAG	.		0.498	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060602.3	NM_005998	
CDC40	51362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	110540596	110540596	+	Nonsense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr6:110540596A>T	ENST00000368932.1	+	12	1221	c.1120A>T	c.(1120-1122)Aaa>Taa	p.K374*	CDC40_ENST00000368930.1_Nonsense_Mutation_p.K374*|CDC40_ENST00000307731.1_Nonsense_Mutation_p.K374*			O60508	PRP17_HUMAN	cell division cycle 40	374					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		TACAAACCGAAAAGTACCTTA	0.323																																					p.K374X		.											.	CDC40	90	0			c.A1120T						.						135.0	130.0	131.0					6																	110540596		2203	4300	6503	SO:0001587	stop_gained	51362	exon11			AACCGAAAAGTAC	AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.1120A>T	6.37:g.110540596A>T	ENSP00000357928:p.Lys374*	99.0	0.0		115.0	18.0	NM_015891	B2RBC5|O75471|Q5SRN0|Q9UPG1	Nonsense_Mutation	SNP	ENST00000368932.1	37	CCDS5081.1	.	.	.	.	.	.	.	.	.	.	A	37	6.532367	0.97641	.	.	ENSG00000168438	ENST00000368932;ENST00000368933;ENST00000368930;ENST00000307731	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.5518	16.1773	0.81862	1.0:0.0:0.0:0.0	.	.	.	.	X	374	.	ENSP00000304370:K374X	K	+	1	0	CDC40	110647289	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	8.962000	0.93254	2.217000	0.71921	0.482000	0.46254	AAA	.		0.323	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041791.1	NM_015891	
CDKL4	344387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	39414810	39414810	+	Missense_Mutation	SNP	G	G	T	rs549348531		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:39414810G>T	ENST00000395035.3	-	6	692	c.693C>A	c.(691-693)aaC>aaA	p.N231K	CDKL4_ENST00000378803.1_Missense_Mutation_p.N231K			Q5MAI5	CDKL4_HUMAN	cyclin-dependent kinase-like 4	231	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(1)|large_intestine(2)|liver(1)|lung(7)|ovary(1)	12		all_hematologic(82;0.248)				GGAAAAACCCGTTACTTTTAA	0.328																																					p.N231K		.											.	CDKL4	334	0			c.C693A						.						110.0	117.0	115.0					2																	39414810		2203	4300	6503	SO:0001583	missense	344387	exon6			AAACCCGTTACTT		CCDS33184.1	2p22.3	2011-11-04			ENSG00000205111	ENSG00000205111		"""Cyclin-dependent kinases"""	19287	protein-coding gene	gene with protein product							Standard	NM_001009565		Approved		uc002rrm.3	Q5MAI5	OTTHUMG00000133574	ENST00000395035.3:c.693C>A	2.37:g.39414810G>T	ENSP00000378476:p.Asn231Lys	58.0	0.0		77.0	37.0	NM_001009565	Q2NME9	Missense_Mutation	SNP	ENST00000395035.3	37		.	.	.	.	.	.	.	.	.	.	G	21.3	4.128485	0.77549	.	.	ENSG00000205111	ENST00000451199;ENST00000378803;ENST00000395035	T;T;T	0.72051	-0.62;0.98;0.98	5.15	5.15	0.70609	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000013	T	0.77772	0.4180	L	0.39085	1.19	0.58432	D	0.999995	D;D	0.89917	1.0;0.994	D;D	0.80764	0.994;0.969	T	0.78386	-0.2224	10	0.49607	T	0.09	-24.6347	16.1422	0.81534	0.0:0.0:1.0:0.0	.	231;231	Q2NME9;Q5MAI5	.;CDKL4_HUMAN	K	13;231;231	ENSP00000389833:N13K;ENSP00000368080:N231K;ENSP00000378476:N231K	ENSP00000368080:N231K	N	-	3	2	CDKL4	39268314	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	4.099000	0.57755	2.415000	0.81967	0.555000	0.69702	AAC	.		0.328	CDKL4-002	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000331655.1	XM_293029	
CELSR3	1951	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	48686612	48686612	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:48686612C>A	ENST00000164024.4	-	17	6789	c.6509G>T	c.(6508-6510)tGg>tTg	p.W2170L	CELSR3_ENST00000544264.1_Missense_Mutation_p.W2175L	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	2170					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGGCTCCAGCCAACCCTGGGC	0.602																																					p.W2170L		.											.	CELSR3	523	0			c.G6509T						.						53.0	54.0	54.0					3																	48686612		2201	4299	6500	SO:0001583	missense	1951	exon17			TCCAGCCAACCCT	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.6509G>T	3.37:g.48686612C>A	ENSP00000164024:p.Trp2170Leu	50.0	0.0		66.0	13.0	NM_001407	O75092	Missense_Mutation	SNP	ENST00000164024.4	37	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	C	34	5.338415	0.95783	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.59906	0.23;0.23	5.57	5.57	0.84162	GPCR, family 2, extracellular hormone receptor domain (3);	.	.	.	.	T	0.82250	0.4996	M	0.90870	3.155	0.80722	D	1	D;D	0.89917	0.988;1.0	D;D	0.91635	0.934;0.999	D	0.85894	0.1430	9	0.87932	D	0	.	19.5412	0.95275	0.0:1.0:0.0:0.0	.	2170;2240	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	L	2170;2175	ENSP00000164024:W2170L;ENSP00000445694:W2175L	ENSP00000164024:W2170L	W	-	2	0	CELSR3	48661616	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.740000	0.55082	2.625000	0.88918	0.467000	0.42956	TGG	.		0.602	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
CEP104	9731	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	3740103	3740103	+	Silent	SNP	C	C	G	rs374760299		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:3740103C>G	ENST00000378230.3	-	19	2712	c.2388G>C	c.(2386-2388)acG>acC	p.T796T		NM_014704.3	NP_055519.1	O60308	CE104_HUMAN	centrosomal protein 104kDa	796						centriole (GO:0005814)	glutamate binding (GO:0016595)|glycine binding (GO:0016594)|thienylcyclohexylpiperidine binding (GO:0016596)			breast(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(14)|lung(8)|prostate(1)|skin(3)	39						GCAAGTGCTCCGTCAGACTGG	0.512																																					p.T796T		.											.	CEP104	92	0			c.G2388C						.						156.0	143.0	148.0					1																	3740103		2203	4300	6503	SO:0001819	synonymous_variant	9731	exon19			GTGCTCCGTCAGA	AB011134	CCDS30571.1	1p36.32	2014-02-20	2011-05-06	2011-05-06	ENSG00000116198	ENSG00000116198			24866	protein-coding gene	gene with protein product	"""glycine, glutamate, thienylcyclohexylpiperidine binding protein"""		"""KIAA0562"""	KIAA0562		7488117, 21399614	Standard	NM_014704		Approved	GlyBP, RP1-286D6.4	uc001aky.2	O60308	OTTHUMG00000003507	ENST00000378230.3:c.2388G>C	1.37:g.3740103C>G		56.0	0.0		57.0	17.0	NM_014704	Q5JSQ3|Q5SR24|Q5SR25|Q6PKF5|Q86W32|Q86X14	Silent	SNP	ENST00000378230.3	37	CCDS30571.1	.	.	.	.	.	.	.	.	.	.	C	0.249	-1.007712	0.02112	.	.	ENSG00000116198	ENST00000438539	.	.	.	5.68	-11.4	0.00090	.	.	.	.	.	T	0.43277	0.1240	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	T	0.54523	-0.8281	4	.	.	.	.	7.484	0.27421	0.0754:0.1586:0.1497:0.6164	.	.	.	.	P	93	.	.	R	-	2	0	CEP104	3729963	0.000000	0.05858	0.179000	0.23059	0.086000	0.17979	-6.131000	0.00079	-2.525000	0.00495	-1.640000	0.00773	CGG	.		0.512	CEP104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009747.3	NM_014704	
CHD9	80205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	53296958	53296958	+	Nonsense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr16:53296958G>A	ENST00000398510.3	+	19	4356	c.4269G>A	c.(4267-4269)tgG>tgA	p.W1423*	CHD9_ENST00000564845.1_Nonsense_Mutation_p.W1423*|CHD9_ENST00000566029.1_Nonsense_Mutation_p.W1423*|CHD9_ENST00000447540.1_Nonsense_Mutation_p.W1423*			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1423					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				CCAACTTCTGGCAAAAATGGG	0.368																																					p.W1423X		.											.	CHD9	272	0			c.G4269A						.						106.0	98.0	100.0					16																	53296958		1834	4091	5925	SO:0001587	stop_gained	80205	exon20			CTTCTGGCAAAAA	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.4269G>A	16.37:g.53296958G>A	ENSP00000381522:p.Trp1423*	55.0	0.0		63.0	17.0	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Nonsense_Mutation	SNP	ENST00000398510.3	37		.	.	.	.	.	.	.	.	.	.	G	45	11.760148	0.99599	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000219084	.	.	.	5.42	5.42	0.78866	.	0.000000	0.51477	D	0.000098	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.7081	19.2231	0.93806	0.0:0.0:1.0:0.0	.	.	.	.	X	1423;1423;949	.	ENSP00000219084:W949X	W	+	3	0	CHD9	51854459	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.795000	0.99099	2.521000	0.84997	0.655000	0.94253	TGG	.		0.368	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
CHL1	10752	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	384669	384669	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:384669A>G	ENST00000256509.2	+	8	1324	c.682A>G	c.(682-684)Aag>Gag	p.K228E	CHL1_ENST00000397491.2_Intron	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TATTTCAGTAAAGCATGCTAA	0.338																																					p.K228E		.											.	CHL1	583	0			c.A682G						.						180.0	166.0	170.0					3																	384669		2203	4300	6503	SO:0001583	missense	10752	exon6			TCAGTAAAGCATG	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.682A>G	3.37:g.384669A>G	ENSP00000256509:p.Lys228Glu	132.0	2.0		207.0	55.0	NM_001253388	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	A	16.68	3.191215	0.58017	.	.	ENSG00000134121	ENST00000256509	T	0.59638	0.25	5.32	5.32	0.75619	.	0.063428	0.64402	D	0.000011	T	0.48059	0.1479	.	.	.	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	T	0.39440	-0.9614	9	0.34782	T	0.22	.	14.1323	0.65263	1.0:0.0:0.0:0.0	.	228	O00533-2	.	E	228	ENSP00000256509:K228E	ENSP00000256509:K228E	K	+	1	0	CHL1	359669	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.886000	0.69743	2.130000	0.65690	0.533000	0.62120	AAG	.		0.338	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
CHSY3	337876	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	129520910	129520910	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr5:129520910A>T	ENST00000305031.4	+	3	2433	c.2075A>T	c.(2074-2076)aAg>aTg	p.K692M		NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	692					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		ATCCCAATGAAGGGAGAGTTT	0.443																																					p.K692M		.											.	CHSY3	25	0			c.A2075T						.						80.0	74.0	76.0					5																	129520910		2203	4300	6503	SO:0001583	missense	337876	exon3			CAATGAAGGGAGA	AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.2075A>T	5.37:g.129520910A>T	ENSP00000302629:p.Lys692Met	93.0	0.0		135.0	12.0	NM_175856	B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	ENST00000305031.4	37	CCDS34223.1	.	.	.	.	.	.	.	.	.	.	A	10.07	1.249908	0.22880	.	.	ENSG00000198108	ENST00000305031	T	0.36699	1.24	4.33	3.15	0.36227	.	0.341197	0.24713	N	0.036207	T	0.22205	0.0535	N	0.17082	0.46	0.31394	N	0.677447	B	0.25667	0.131	B	0.29440	0.102	T	0.19647	-1.0299	9	.	.	.	-2.2963	11.005	0.47629	0.4853:0.5147:0.0:0.0	.	692	Q70JA7	CHSS3_HUMAN	M	692	ENSP00000302629:K692M	.	K	+	2	0	CHSY3	129548809	0.993000	0.37304	0.985000	0.45067	0.901000	0.52897	3.551000	0.53698	0.966000	0.38159	0.528000	0.53228	AAG	.		0.443	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	NM_175856	
CNOT1	23019	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	58585618	58585629	+	In_Frame_Del	DEL	CCTGGGCCTGAG	CCTGGGCCTGAG	-			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	CCTGGGCCTGAG	CCTGGGCCTGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr16:58585618_58585629delCCTGGGCCTGAG	ENST00000317147.5	-	23	3397_3408	c.3065_3076delCTCAGGCCCAGG	c.(3064-3078)gctcaggcccaggtt>gtt	p.AQAQ1022del	CNOT1_ENST00000569732.1_5'UTR|CNOT1_ENST00000569240.1_In_Frame_Del_p.AQAQ1017del|CNOT1_ENST00000245138.4_5'Flank|CNOT1_ENST00000441024.2_In_Frame_Del_p.AQAQ1022del	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1022					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		TTTGCTGGAAcctgggcctgagcctgggcctg	0.495																																					p.1022_1026del		.											.	CNOT1	95	0			c.3065_3076del						.																																			SO:0001651	inframe_deletion	23019	exon23			CTGGAACCTGGGC	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.3065_3076delCTCAGGCCCAGG	16.37:g.58585618_58585629delCCTGGGCCTGAG	ENSP00000320949:p.Ala1022_Gln1025del	52.0	0.0		59.0	19.0	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	In_Frame_Del	DEL	ENST00000317147.5	37	CCDS10799.1																																																																																			.		0.495	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
CNRIP1	25927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	68546450	68546450	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:68546450T>C	ENST00000263655.3	-	1	688	c.83A>G	c.(82-84)gAc>gGc	p.D28G	CNRIP1_ENST00000409559.3_Missense_Mutation_p.D28G|CNRIP1_ENST00000481714.1_5'UTR|CNRIP1_ENST00000409862.1_Missense_Mutation_p.D28G	NM_015463.2	NP_056278.1	Q96F85	CNRP1_HUMAN	cannabinoid receptor interacting protein 1	28										kidney(1)|large_intestine(5)|liver(1)|lung(1)|skin(1)	9						GCGCTGCCCGTCCACCTTGTA	0.632																																					p.D28G		.											.	CNRIP1	69	0			c.A83G						.						47.0	36.0	40.0					2																	68546450		2175	4259	6434	SO:0001583	missense	25927	exon1			TGCCCGTCCACCT	AL110235	CCDS1886.1, CCDS46311.1	2p13	2008-02-05	2007-11-29	2007-11-29	ENSG00000119865	ENSG00000119865			24546	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 32"""	C2orf32		12477932	Standard	NM_015463		Approved	DKFZP566K1924, CRIP1, CRIP1a, CRIP1b	uc002sek.4	Q96F85	OTTHUMG00000129565	ENST00000263655.3:c.83A>G	2.37:g.68546450T>C	ENSP00000263655:p.Asp28Gly	26.0	0.0		57.0	25.0	NM_001111101	B2R4D0|Q49AN4|Q9UFZ0	Missense_Mutation	SNP	ENST00000263655.3	37	CCDS1886.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.819973	0.90873	.	.	ENSG00000119865	ENST00000409559;ENST00000263655;ENST00000409862	.	.	.	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.74794	0.3763	L	0.57536	1.79	0.80722	D	1	D;P;D	0.89917	1.0;0.869;1.0	D;B;D	0.87578	0.998;0.38;0.998	T	0.77413	-0.2597	9	0.72032	D	0.01	-10.4549	13.1031	0.59231	0.0:0.0:0.0:1.0	.	28;28;28	B8ZZB8;Q96F85;Q96F85-2	.;CNRP1_HUMAN;.	G	28	.	ENSP00000263655:D28G	D	-	2	0	CNRIP1	68399954	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.212000	0.77941	2.018000	0.59344	0.402000	0.26972	GAC	.		0.632	CNRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251758.1	NM_015463	
CNTN5	53942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	99715953	99715953	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr11:99715953T>A	ENST00000524871.1	+	6	826	c.536T>A	c.(535-537)gTg>gAg	p.V179E	CNTN5_ENST00000528682.1_Missense_Mutation_p.V179E|CNTN5_ENST00000527185.1_Missense_Mutation_p.V179E|CNTN5_ENST00000279463.3_Missense_Mutation_p.V179E|CNTN5_ENST00000418526.2_Missense_Mutation_p.V105E	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	179	Ig-like C2-type 1.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		ACCAACACTGTGGGGAGTATT	0.353																																					p.V179E		.											.	CNTN5	366	0			c.T536A						.						141.0	133.0	135.0					11																	99715953		1827	4102	5929	SO:0001583	missense	53942	exon5			ACACTGTGGGGAG	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.536T>A	11.37:g.99715953T>A	ENSP00000435637:p.Val179Glu	43.0	0.0		56.0	15.0	NM_001243270	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	T	13.61	2.289515	0.40494	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37	5.8	5.8	0.92144	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.292191	0.38605	N	0.001640	T	0.60248	0.2254	L	0.31752	0.955	0.22552	N	0.998996	B;B;B	0.21606	0.058;0.037;0.058	B;B;B	0.31442	0.082;0.036;0.13	T	0.58329	-0.7655	10	0.59425	D	0.04	.	15.3151	0.74069	0.0:0.0:0.0:1.0	.	179;105;179	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	E	179;179;179;105;179	ENSP00000433575:V179E;ENSP00000436185:V179E;ENSP00000435637:V179E;ENSP00000393229:V105E;ENSP00000279463:V179E	ENSP00000279463:V179E	V	+	2	0	CNTN5	99221163	1.000000	0.71417	0.916000	0.36221	0.281000	0.26958	4.751000	0.62169	2.216000	0.71823	0.528000	0.53228	GTG	.		0.353	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
COL6A1	1291	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	21	47423312	47423312	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr21:47423312C>G	ENST00000361866.3	+	35	2586	c.2472C>G	c.(2470-2472)ttC>ttG	p.F824L	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	824	C-terminal globular domain.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		CAGTCACGTTCTCCTCCCCGG	0.682																																					p.F824L		.											.	COL6A1	91	0			c.C2472G						.						24.0	28.0	27.0					21																	47423312		2173	4216	6389	SO:0001583	missense	1291	exon35			CACGTTCTCCTCC	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.2472C>G	21.37:g.47423312C>G	ENSP00000355180:p.Phe824Leu	8.0	0.0		19.0	6.0	NM_001848	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	ENST00000361866.3	37	CCDS13727.1	.	.	.	.	.	.	.	.	.	.	C	4.367	0.067702	0.08436	.	.	ENSG00000142156	ENST00000361866	T	0.77229	-1.08	4.84	3.03	0.35002	.	0.000000	0.85682	D	0.000000	T	0.64638	0.2616	N	0.19112	0.55	0.42148	D	0.991547	D	0.56521	0.976	P	0.46659	0.523	T	0.58679	-0.7594	10	0.25106	T	0.35	-22.8897	9.3631	0.38208	0.0:0.7033:0.0:0.2967	.	824	P12109	CO6A1_HUMAN	L	824	ENSP00000355180:F824L	ENSP00000355180:F824L	F	+	3	2	COL6A1	46247740	0.327000	0.24678	0.989000	0.46669	0.431000	0.31685	0.790000	0.26900	0.471000	0.27319	-0.347000	0.07816	TTC	.		0.682	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206877.1	NM_001848	
COLEC12	81035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	334785	334785	+	Silent	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr18:334785G>A	ENST00000400256.3	-	6	1980	c.1773C>T	c.(1771-1773)ccC>ccT	p.P591P		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	591					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				GCAGGGCCAGGGGCACCACCG	0.682																																					p.P591P		.											.	COLEC12	92	0			c.C1773T						.						37.0	34.0	35.0					18																	334785		2203	4300	6503	SO:0001819	synonymous_variant	81035	exon6			GGCCAGGGGCACC	AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.1773C>T	18.37:g.334785G>A		87.0	0.0		97.0	19.0	NM_130386	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Silent	SNP	ENST00000400256.3	37	CCDS32782.1																																																																																			.		0.682	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1		
COLGALT2	23127	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	183909842	183909842	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:183909842A>T	ENST00000361927.4	-	11	1848	c.1477T>A	c.(1477-1479)Tat>Aat	p.Y493N	COLGALT2_ENST00000367521.1_Missense_Mutation_p.Y101N|COLGALT2_ENST00000486375.1_5'UTR|COLGALT2_ENST00000367520.3_Missense_Mutation_p.Y230N|COLGALT2_ENST00000546159.1_Missense_Mutation_p.Y493N	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	493					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										CAGTAGGAATAGTCGGCTTCG	0.502																																					p.Y493N		.											.	.	.	0			c.T1477A						.						181.0	162.0	169.0					1																	183909842		2203	4300	6503	SO:0001583	missense	23127	exon11			AGGAATAGTCGGC	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.1477T>A	1.37:g.183909842A>T	ENSP00000354960:p.Tyr493Asn	215.0	2.0		338.0	63.0	NM_015101	O60327|Q9BZR0	Missense_Mutation	SNP	ENST00000361927.4	37	CCDS1360.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.788312	0.90367	.	.	ENSG00000198756	ENST00000546159;ENST00000361927;ENST00000367521;ENST00000367520	T;T	0.80123	-1.33;-1.34	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.91425	0.7294	M	0.90705	3.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.93176	0.6570	10	0.87932	D	0	-15.7103	15.6689	0.77258	1.0:0.0:0.0:0.0	.	493;493;230	F5H3T5;Q8IYK4;Q5SXQ3	.;GT252_HUMAN;.	N	493;493;101;230	ENSP00000439112:Y493N;ENSP00000354960:Y493N	ENSP00000354960:Y493N	Y	-	1	0	GLT25D2	182176465	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.020000	0.93667	2.093000	0.63338	0.533000	0.62120	TAT	.		0.502	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101	
CREBBP	1387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3860606	3860606	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr16:3860606T>A	ENST00000262367.5	-	3	1782	c.973A>T	c.(973-975)Atg>Ttg	p.M325L	CREBBP_ENST00000382070.3_Missense_Mutation_p.M325L	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	325	Interaction with SRCAP.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TAACTTACCATATTTGGCACG	0.468			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.M325L		.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	1807	0			c.A973T						.						183.0	170.0	174.0					16																	3860606		2197	4300	6497	SO:0001583	missense	1387	exon3			TTACCATATTTGG	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.973A>T	16.37:g.3860606T>A	ENSP00000262367:p.Met325Leu	74.0	0.0		92.0	38.0	NM_001079846	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	T	12.99	2.103074	0.37145	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.83992	-1.79;-1.77	5.28	5.28	0.74379	.	0.058309	0.64402	D	0.000001	T	0.78426	0.4281	L	0.45352	1.415	0.46542	D	0.999091	B;B	0.27450	0.112;0.179	B;B	0.28638	0.082;0.092	T	0.75260	-0.3380	10	0.35671	T	0.21	-18.2283	15.2145	0.73254	0.0:0.0:0.0:1.0	.	393;325	Q4LE28;Q92793	.;CBP_HUMAN	L	325;393;325	ENSP00000262367:M325L;ENSP00000371502:M325L	ENSP00000262367:M325L	M	-	1	0	CREBBP	3800607	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.382000	0.52463	1.993000	0.58246	0.460000	0.39030	ATG	.		0.468	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
CRLF2	64109	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	1327776	1327776	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chrX:1327776G>C	ENST00000381567.3	-	2	104	c.105C>G	c.(103-105)atC>atG	p.I35M	CRLF2_ENST00000381566.1_Missense_Mutation_p.I35M|CRLF2_ENST00000467626.1_5'UTR	NM_022148.2	NP_071431.2	Q9HC73	CRLF2_HUMAN	cytokine receptor-like factor 2	35					immunoglobulin secretion involved in immune response (GO:0002380)|inflammatory response (GO:0006954)|T-helper 2 cell cytokine production (GO:0035745)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(10)|lung(9)	20		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				AATTGAAGTAGATGATCTGAA	0.408			"""Mis, T"""	"""P2RY8, IGH@"""	"""B-ALL, Downs associated ALL"""																																p.I35M		.		Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	64109	cytokine receptor-like factor 2		L	.	CRLF2	299	0			c.C105G						.						242.0	239.0	240.0					X																	1327776		1912	4119	6031	SO:0001583	missense	64109	exon2			GAAGTAGATGATC	AF142570	CCDS75944.1, CCDS75945.1	Xp22.3 and Yp11.3	2011-10-07			ENSG00000205755	ENSG00000205755		"""Pseudoautosomal regions / PAR1"""	14281	protein-coding gene	gene with protein product		300357, 400023				11237741, 11474172	Standard	NM_022148		Approved	CRL2, TSLPR	uc004cpk.2	Q9HC73	OTTHUMG00000067432	ENST00000381567.3:c.105C>G	X.37:g.1327776G>C	ENSP00000370979:p.Ile35Met	385.0	0.0		460.0	65.0	NM_022148	Q9H5R3	Missense_Mutation	SNP	ENST00000381567.3	37		.	.	.	.	.	.	.	.	.	.	.	8.173	0.792207	0.16258	.	.	ENSG00000205755	ENST00000381567;ENST00000400841;ENST00000381566	D;D;D	0.95307	-3.67;-3.67;-3.67	0.52	0.52	0.17040	Fibronectin, type III (1);	0.658638	0.13278	U	0.399941	D	0.96043	0.8711	.	.	.	0.09310	N	1	D	0.76494	0.999	D	0.74023	0.982	D	0.88888	0.3344	8	0.72032	D	0.01	.	.	.	.	.	35	Q9HC73	CRLF2_HUMAN	M	35	ENSP00000370979:I35M;ENSP00000383641:I35M;ENSP00000370978:I35M	ENSP00000370978:I35M	I	-	3	3	CRLF2	1287776	0.941000	0.31946	0.194000	0.23346	0.144000	0.21451	1.469000	0.35343	0.551000	0.29008	0.068000	0.15388	ATC	.		0.408	CRLF2-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_022148	
CRYGD	1421	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	208986520	208986520	+	Nonsense_Mutation	SNP	G	G	T	rs398122948		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:208986520G>T	ENST00000264376.4	-	3	429	c.402C>A	c.(400-402)taC>taA	p.Y134*		NM_006891.3	NP_008822.2	P07320	CRGD_HUMAN	crystallin, gamma D	134	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				cellular response to reactive oxygen species (GO:0034614)|lens development in camera-type eye (GO:0002088)|lens fiber cell differentiation (GO:0070306)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			breast(1)|endometrium(1)|lung(3)	5				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)		TGGACAGCTCGTAGAGGACCC	0.582																																					p.Y134X		.											.	CRYGD	90	0			c.C402A	GRCh37	CM074129	CRYGD	M		.						100.0	93.0	95.0					2																	208986520		2203	4300	6503	SO:0001587	stop_gained	1421	exon3			CAGCTCGTAGAGG		CCDS2378.1	2q33.3	2013-02-14			ENSG00000118231	ENSG00000118231			2411	protein-coding gene	gene with protein product		123690		CRYG4			Standard	NM_006891		Approved		uc002vcn.4	P07320	OTTHUMG00000132944	ENST00000264376.4:c.402C>A	2.37:g.208986520G>T	ENSP00000264376:p.Tyr134*	80.0	0.0		98.0	48.0	NM_006891	Q17RF7|Q53R51|Q99681	Nonsense_Mutation	SNP	ENST00000264376.4	37	CCDS2378.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816367	0.50527	.	.	ENSG00000118231	ENST00000264376	.	.	.	4.25	-8.5	0.00927	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.4563	0.90721	0.8722:0.0:0.1278:0.0	.	.	.	.	X	134	.	ENSP00000264376:Y134X	Y	-	3	2	CRYGD	208694765	0.001000	0.12720	0.391000	0.26233	0.965000	0.64279	-1.607000	0.02070	-2.415000	0.00568	-1.013000	0.02462	TAC	.		0.582	CRYGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256476.2	NM_006891	
CTH	1491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	70881649	70881649	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:70881649A>G	ENST00000370938.3	+	2	323	c.179A>G	c.(178-180)tAt>tGt	p.Y60C	CTH_ENST00000464926.1_3'UTR|CTH_ENST00000411986.2_Missense_Mutation_p.Y60C|CTH_ENST00000346806.2_Missense_Mutation_p.Y60C	NM_001902.5	NP_001893.2	Q96IQ7	VSIG2_HUMAN	cystathionine gamma-lyase	0	Ig-like V-type.					integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						GGTTTTGAATATAGCCGTTCT	0.383																																					p.Y60C		.											.	CTH	91	0			c.A179G						.						85.0	92.0	89.0					1																	70881649		2203	4300	6503	SO:0001583	missense	1491	exon2			TTGAATATAGCCG	BC015807	CCDS650.1, CCDS651.1, CCDS53333.1	1p31.1	2014-06-24	2014-06-24		ENSG00000116761	ENSG00000116761	4.4.1.1		2501	protein-coding gene	gene with protein product		607657	"""cystathionase (cystathionine gamma-lyase)"""			1339280	Standard	NM_001902		Approved		uc001dfd.3	P32929	OTTHUMG00000009352	ENST00000370938.3:c.179A>G	1.37:g.70881649A>G	ENSP00000359976:p.Tyr60Cys	55.0	0.0		60.0	23.0	NM_153742	O95791|Q9NX42	Missense_Mutation	SNP	ENST00000370938.3	37	CCDS650.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.272207	0.80469	.	.	ENSG00000116761	ENST00000411986;ENST00000370938;ENST00000346806	D;D;D	0.94280	-1.97;-3.39;-1.97	5.55	5.55	0.83447	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.98280	0.9430	H	0.99590	4.645	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99683	1.0999	10	0.87932	D	0	-3.6509	14.9772	0.71283	1.0:0.0:0.0:0.0	.	60;60;60	E9PDV0;P32929-2;P32929	.;.;CGL_HUMAN	C	60	ENSP00000413407:Y60C;ENSP00000359976:Y60C;ENSP00000311554:Y60C	ENSP00000311554:Y60C	Y	+	2	0	CTH	70654237	1.000000	0.71417	0.908000	0.35775	0.991000	0.79684	8.943000	0.92975	2.234000	0.73211	0.533000	0.62120	TAT	.		0.383	CTH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025918.1	NM_001902	
CTSB	1508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	11705647	11705647	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr8:11705647T>C	ENST00000353047.6	-	6	714	c.461A>G	c.(460-462)tAt>tGt	p.Y154C	CTSB_ENST00000525076.1_5'Flank|CTSB_ENST00000415599.2_3'UTR|CTSB_ENST00000453527.2_Missense_Mutation_p.Y154C|CTSB_ENST00000534510.1_Missense_Mutation_p.Y154C|CTSB_ENST00000345125.3_Missense_Mutation_p.Y154C|CTSB_ENST00000530640.2_Missense_Mutation_p.Y154C|RP11-589N15.2_ENST00000602711.1_RNA|CTSB_ENST00000533455.1_Missense_Mutation_p.Y154C|CTSB_ENST00000531089.1_Missense_Mutation_p.Y154C|CTSB_ENST00000434271.1_Missense_Mutation_p.Y154C	NM_001908.3	NP_001899.1	P07858	CATB_HUMAN	cathepsin B	154					cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|decidualization (GO:0046697)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of apoptotic process (GO:0042981)|regulation of catalytic activity (GO:0050790)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|proteoglycan binding (GO:0043394)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(1)	16	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		TTCAGCAGGATAGCCACCATT	0.522																																					p.Y154C		.											.	CTSB	90	0			c.A461G						.						93.0	90.0	91.0					8																	11705647		2203	4300	6503	SO:0001583	missense	1508	exon8			GCAGGATAGCCAC	M14221	CCDS5986.1	8p23.1	2012-10-02			ENSG00000164733	ENSG00000164733	3.4.22.1	"""Cathepsins"""	2527	protein-coding gene	gene with protein product		116810				8112600, 3463996	Standard	XM_006716244		Approved		uc003wuq.3	P07858	OTTHUMG00000090799	ENST00000353047.6:c.461A>G	8.37:g.11705647T>C	ENSP00000345672:p.Tyr154Cys	54.0	0.0		78.0	38.0	NM_147780	B3KQR5|B3KRR5|Q503A6|Q96D87	Missense_Mutation	SNP	ENST00000353047.6	37	CCDS5986.1	.	.	.	.	.	.	.	.	.	.	T	14.11	2.438647	0.43326	.	.	ENSG00000164733	ENST00000434271;ENST00000540571;ENST00000353047;ENST00000530640;ENST00000531089;ENST00000453527;ENST00000345125;ENST00000533455;ENST00000534510;ENST00000541328;ENST00000534636;ENST00000533572;ENST00000530296	D;D;D;D;D;D;D;D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9	5.14	2.58	0.30949	Peptidase C1A, papain C-terminal (2);	0.112402	0.64402	D	0.000007	D	0.92548	0.7633	M	0.92026	3.265	0.80722	D	1	D;B;B;D;D	0.89917	1.0;0.043;0.086;1.0;1.0	D;B;B;D;D	0.79108	0.992;0.113;0.091;0.978;0.985	D	0.92301	0.5849	10	0.72032	D	0.01	.	10.0057	0.41955	0.231:0.0:0.0:0.769	.	91;154;60;154;91	B3KUJ8;A8K2H4;B4DMY4;P07858;F5H2P9	.;.;.;CATB_HUMAN;.	C	154;91;154;154;154;154;154;154;154;60;154;154;154	ENSP00000415889:Y154C;ENSP00000345672:Y154C;ENSP00000435105:Y154C;ENSP00000433215:Y154C;ENSP00000409917:Y154C;ENSP00000342070:Y154C;ENSP00000432244:Y154C;ENSP00000434217:Y154C;ENSP00000436159:Y154C;ENSP00000433995:Y154C;ENSP00000435074:Y154C	ENSP00000342070:Y154C	Y	-	2	0	CTSB	11743056	0.993000	0.37304	0.998000	0.56505	0.359000	0.29487	1.174000	0.31932	0.789000	0.33779	0.459000	0.35465	TAT	.		0.522	CTSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207586.3	NM_147780	
CTHRC1	115908	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	104384015	104384015	+	Missense_Mutation	SNP	A	A	G	rs387907029		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr8:104384015A>G	ENST00000330295.5	+	1	273	c.131A>G	c.(130-132)cAg>cGg	p.Q44R	CTHRC1_ENST00000520337.1_5'Flank|CTHRC1_ENST00000415886.2_Missense_Mutation_p.Q44R	NM_138455.3	NP_612464.1	Q96CG8	CTHR1_HUMAN	collagen triple helix repeat containing 1	44			Q -> P (found in patients with Barrett esophagus). {ECO:0000269|PubMed:21791690}.		cell migration (GO:0016477)|cochlea morphogenesis (GO:0090103)|establishment of planar polarity involved in neural tube closure (GO:0090177)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|ossification involved in bone remodeling (GO:0043932)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein binding (GO:0032092)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	collagen trimer (GO:0005581)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)				endometrium(1)|large_intestine(5)|lung(4)|ovary(1)|urinary_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)			CAGCTCCGGCAGAGGGAGGTG	0.741																																					p.Q44R		.											.	CTHRC1	91	0			c.A131G						.						6.0	6.0	6.0					8																	104384015		1925	3776	5701	SO:0001583	missense	115908	exon1			TCCGGCAGAGGGA	BC014245	CCDS6299.1, CCDS59110.1	8q22.3	2008-08-07			ENSG00000164932	ENSG00000164932			18831	protein-coding gene	gene with protein product		610635				15618538	Standard	NM_138455		Approved		uc003ylk.4	Q96CG8	OTTHUMG00000164887	ENST00000330295.5:c.131A>G	8.37:g.104384015A>G	ENSP00000330523:p.Gln44Arg	96.0	0.0		158.0	40.0	NM_138455	G3V141|Q6UW91|Q8IX63	Missense_Mutation	SNP	ENST00000330295.5	37	CCDS6299.1	.	.	.	.	.	.	.	.	.	.	A	13.56	2.272285	0.40194	.	.	ENSG00000164932	ENST00000330295;ENST00000415886	T;T	0.78126	-1.15;-1.15	4.75	2.44	0.29823	.	0.749568	0.12285	N	0.482528	T	0.55893	0.1949	N	0.14661	0.345	0.80722	D	1	B;B	0.30326	0.276;0.02	B;B	0.20184	0.028;0.007	T	0.47032	-0.9148	10	0.33141	T	0.24	-1.6978	5.7962	0.18387	0.3646:0.5207:0.1147:0.0	.	44;44	E7EVQ5;Q96CG8	.;CTHR1_HUMAN	R	44	ENSP00000330523:Q44R;ENSP00000416045:Q44R	ENSP00000330523:Q44R	Q	+	2	0	CTHRC1	104453191	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	0.530000	0.23036	0.655000	0.30866	-0.406000	0.06334	CAG	.		0.741	CTHRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380792.1	NM_138455	
CUBN	8029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	17157488	17157488	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr10:17157488C>T	ENST00000377833.4	-	7	767	c.702G>A	c.(700-702)atG>atA	p.M234I		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	234					cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTTGCTCTCGCATTAAATCCT	0.557																																					p.M234I		.											.	CUBN	166	0			c.G702A						.						121.0	104.0	110.0					10																	17157488		2203	4300	6503	SO:0001583	missense	8029	exon7			CTCTCGCATTAAA	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.702G>A	10.37:g.17157488C>T	ENSP00000367064:p.Met234Ile	58.0	0.0		68.0	31.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	c	6.369	0.436163	0.12104	.	.	ENSG00000107611	ENST00000377833	D	0.86956	-2.19	5.53	-0.351	0.12602	Growth factor, receptor (1);Epidermal growth factor-like (1);	1.536280	0.04621	N	0.401988	T	0.73923	0.3649	N	0.03608	-0.345	0.27768	N	0.943599	B	0.02656	0.0	B	0.01281	0.0	T	0.60999	-0.7151	10	0.38643	T	0.18	.	11.7812	0.52016	0.0:0.4153:0.3798:0.2048	.	234	O60494	CUBN_HUMAN	I	234	ENSP00000367064:M234I	ENSP00000367064:M234I	M	-	3	0	CUBN	17197494	0.990000	0.36364	0.274000	0.24659	0.504000	0.33889	0.408000	0.21065	0.257000	0.21650	-0.123000	0.14984	ATG	.		0.557	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
DCAKD	79877	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	43101864	43101864	+	Silent	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr17:43101864T>C	ENST00000452796.2	-	4	888	c.633A>G	c.(631-633)acA>acG	p.T211T	DCAKD_ENST00000588499.1_Silent_p.T211T|DCAKD_ENST00000342350.5_Silent_p.T211T			Q8WVC6	DCAKD_HUMAN	dephospho-CoA kinase domain containing	211					coenzyme A biosynthetic process (GO:0015937)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)			cervix(1)|endometrium(1)|large_intestine(1)|lung(2)|skin(1)	6		Prostate(33;0.155)				CAGCGAGCCCTGTGAGGACCC	0.627																																					p.T211T		.											.	DCAKD	90	0			c.A633G						.						67.0	60.0	63.0					17																	43101864		2203	4300	6503	SO:0001819	synonymous_variant	79877	exon5			GAGCCCTGTGAGG	BC006546	CCDS11493.1	17q21.31	2005-12-20				ENSG00000172992			26238	protein-coding gene	gene with protein product							Standard	XM_005257688		Approved	FLJ22955	uc010daa.1	Q8WVC6		ENST00000452796.2:c.633A>G	17.37:g.43101864T>C		56.0	0.0		35.0	29.0	NM_001128631	A8K3Z0|D3DX60|D3DX62|Q9BR71|Q9H5W1	Silent	SNP	ENST00000452796.2	37	CCDS11493.1																																																																																			.		0.627	DCAKD-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449066.1	NM_024819	
DCD	117159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	55040905	55040905	+	Splice_Site	SNP	G	G	T	rs552276383		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr12:55040905G>T	ENST00000293371.6	-	2	286	c.97C>A	c.(97-99)Cct>Act	p.P33T	DCD_ENST00000456047.2_Splice_Site_p.P33T	NM_053283.2	NP_444513.1	P81605	DCD_HUMAN	dermcidin	33					defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|killing of cells of other organism (GO:0031640)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	peptidase activity (GO:0008233)|poly(A) RNA binding (GO:0044822)			large_intestine(2)|lung(2)|ovary(1)|skin(1)	6		Myeloproliferative disorder(1001;0.0255)				AAGGACTCACGGTTCCCCGAT	0.582																																					p.P33T		.											.	DCD	91	0			c.C97A						.						53.0	35.0	41.0					12																	55040905		2188	4286	6474	SO:0001630	splice_region_variant	117159	exon2			ACTCACGGTTCCC	AF144011	CCDS8884.1, CCDS73478.1	12q13.1	2008-08-04				ENSG00000161634			14669	protein-coding gene	gene with protein product	"""proteolysis inducing factor"", ""preproteolysin"", ""diffusible survival/evasion peptide"", ""survival promoting peptide"""	606634				11694882	Standard	XM_005268627		Approved	AIDD, PIF, DSEP, HCAP, DCD-1	uc001sgj.3	P81605	OTTHUMG00000169937	ENST00000293371.6:c.97+1C>A	12.37:g.55040905G>T		29.0	0.0		33.0	5.0	NM_053283	A5JHP2|A5JHP3|P58461|Q53YJ2	Missense_Mutation	SNP	ENST00000293371.6	37	CCDS8884.1	.	.	.	.	.	.	.	.	.	.	G	4.087	0.014096	0.07959	.	.	ENSG00000161634	ENST00000293371;ENST00000456047	.	.	.	2.64	-2.13	0.07144	.	.	.	.	.	T	0.07863	0.0197	N	0.08118	0	0.09310	N	1	P;P	0.49696	0.927;0.927	B;B	0.36719	0.231;0.231	T	0.17501	-1.0367	7	.	.	.	.	1.1905	0.01864	0.1292:0.194:0.3144:0.3623	.	33;33	A5JHP3;P81605	.;DCD_HUMAN	T	33	.	.	P	-	1	0	DCD	53327172	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-2.294000	0.01144	-0.492000	0.06687	-0.311000	0.09066	CCT	.		0.582	DCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406617.1	NM_053283	Missense_Mutation
DDI1	414301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	103908253	103908253	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr11:103908253C>A	ENST00000302259.3	+	1	946	c.703C>A	c.(703-705)Ccc>Acc	p.P235T	PDGFD_ENST00000393158.2_Intron|PDGFD_ENST00000302251.5_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	235							aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		AGAAGAGGCCCCCGAGAGTTT	0.478																																					p.P235T		.											.	DDI1	137	0			c.C703A						.						114.0	127.0	123.0					11																	103908253		2202	4299	6501	SO:0001583	missense	414301	exon1			GAGGCCCCCGAGA		CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.703C>A	11.37:g.103908253C>A	ENSP00000302805:p.Pro235Thr	76.0	0.0		102.0	58.0	NM_001001711	Q7Z4U6|Q8WTS3	Missense_Mutation	SNP	ENST00000302259.3	37	CCDS31660.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.299467	0.60195	.	.	ENSG00000170967	ENST00000302259	T	0.64438	-0.1	5.02	5.02	0.67125	Peptidase aspartic (1);Peptidase aspartic, eukaryotic predicted (1);	0.000000	0.85682	D	0.000000	D	0.84147	0.5408	M	0.93720	3.45	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.87908	0.2695	10	0.87932	D	0	-14.8119	16.2348	0.82365	0.0:1.0:0.0:0.0	.	235	Q8WTU0	DDI1_HUMAN	T	235	ENSP00000302805:P235T	ENSP00000302805:P235T	P	+	1	0	DDI1	103413463	1.000000	0.71417	0.121000	0.21740	0.460000	0.32559	7.133000	0.77259	2.781000	0.95711	0.655000	0.94253	CCC	.		0.478	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387326.1	NM_001001711	
DEF6	50619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	35287441	35287441	+	Missense_Mutation	SNP	A	A	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr6:35287441A>C	ENST00000316637.5	+	8	1361	c.1356A>C	c.(1354-1356)gaA>gaC	p.E452D	DEF6_ENST00000542066.1_Missense_Mutation_p.E197D	NM_022047.3	NP_071330.3	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog (mouse)	452	Glu-rich.					cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	15						GGCGAGATGAAGAATCTGTGC	0.597																																					p.E452D		.											.	DEF6	227	0			c.A1356C						.						68.0	70.0	69.0					6																	35287441		2203	4300	6503	SO:0001583	missense	50619	exon8			AGATGAAGAATCT	AJ276095	CCDS4802.1	6p21.33-p21.1	2013-01-10	2001-11-28		ENSG00000023892	ENSG00000023892		"""Pleckstrin homology (PH) domain containing"""	2760	protein-coding gene	gene with protein product	"""SWAP-70-like adaptor protein of T cells"""	610094	"""differentially expressed in FDCP (mouse homolog) 6"""			19251698	Standard	NM_022047		Approved	IBP, SLAT, SWAP70L	uc003okk.3	Q9H4E7	OTTHUMG00000014563	ENST00000316637.5:c.1356A>C	6.37:g.35287441A>C	ENSP00000319831:p.Glu452Asp	91.0	0.0		164.0	64.0	NM_022047	Q86VF4	Missense_Mutation	SNP	ENST00000316637.5	37	CCDS4802.1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.653362	0.67472	.	.	ENSG00000023892	ENST00000542066;ENST00000316637	T;T	0.70516	-0.49;2.28	5.26	3.49	0.39957	.	0.000000	0.85682	D	0.000000	T	0.77110	0.4082	M	0.83012	2.62	0.58432	D	0.999996	D;D;D	0.71674	0.998;0.997;0.997	D;D;D	0.77557	0.99;0.978;0.978	T	0.78486	-0.2185	10	0.72032	D	0.01	-30.0273	8.3806	0.32468	0.3663:0.0:0.6337:0.0	.	197;452;452	F5H853;B2RBP7;Q9H4E7	.;.;DEFI6_HUMAN	D	197;452	ENSP00000442166:E197D;ENSP00000319831:E452D	ENSP00000319831:E452D	E	+	3	2	DEF6	35395419	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	2.228000	0.42981	0.379000	0.24794	-0.213000	0.12676	GAA	.		0.597	DEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040276.1	NM_022047	
DENND4A	10260	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	66031083	66031083	+	Silent	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr15:66031083T>C	ENST00000431932.2	-	6	970	c.762A>G	c.(760-762)gtA>gtG	p.V254V	DENND4A_ENST00000443035.3_Silent_p.V254V	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	254	UDENN.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						AAGTAGAAAATACAGGCAGAG	0.348																																					p.V254V		.											.	DENND4A	229	0			c.A762G						.						110.0	107.0	108.0					15																	66031083		1812	4074	5886	SO:0001819	synonymous_variant	10260	exon6			AGAAAATACAGGC	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.762A>G	15.37:g.66031083T>C		120.0	0.0		192.0	54.0	NM_001144823	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Silent	SNP	ENST00000431932.2	37	CCDS45285.1																																																																																			.		0.348	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	
DFFB	1677	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	3775376	3775376	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:3775376T>G	ENST00000378209.3	+	2	532	c.209T>G	c.(208-210)gTg>gGg	p.V70G	DFFB_ENST00000341385.3_Missense_Mutation_p.V70G|CEP104_ENST00000378223.3_5'Flank|DFFB_ENST00000378212.2_Missense_Mutation_p.V70G|DFFB_ENST00000338895.3_Missense_Mutation_p.V70G|CEP104_ENST00000378230.3_5'Flank	NM_004402.2	NP_004393.1	O76075	DFFB_HUMAN	DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)	70	CIDE-N. {ECO:0000255|PROSITE- ProRule:PRU00447}.				apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			endometrium(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		GCCGAGCTGGTGCTGCTCACC	0.652																																					p.V70G		.											.	DFFB	91	0			c.T209G						.						57.0	53.0	54.0					1																	3775376		2203	4300	6503	SO:0001583	missense	1677	exon2			AGCTGGTGCTGCT		CCDS52.1, CCDS72693.1	1p36.3	2014-03-06	2002-08-29		ENSG00000169598	ENSG00000169598			2773	protein-coding gene	gene with protein product		601883				9108473, 9560346	Standard	NM_004402		Approved	CAD, CPAN, DFF-40, DFF40	uc001alc.3	O76075	OTTHUMG00000003525	ENST00000378209.3:c.209T>G	1.37:g.3775376T>G	ENSP00000367454:p.Val70Gly	43.0	1.0		53.0	13.0	NM_004402	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000378209.3	37	CCDS52.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.183412	0.78677	.	.	ENSG00000169598	ENST00000378209;ENST00000338895;ENST00000378212;ENST00000341385;ENST00000448632;ENST00000430539	T;T;T	0.52754	0.65;0.65;0.65	4.65	4.65	0.58169	Caspase-activated nuclease CIDE-N (2);	0.393157	0.25768	N	0.028429	T	0.65407	0.2688	M	0.75615	2.305	0.58432	D	0.999995	P;D;P;P	0.69078	0.918;0.997;0.918;0.918	P;D;P;P	0.66602	0.697;0.945;0.697;0.697	T	0.69895	-0.5021	10	0.87932	D	0	-7.2719	12.0351	0.53420	0.0:0.0:0.0:1.0	.	70;70;70;70	B4DZS0;O76075-2;O76075;Q96P73	.;.;DFFB_HUMAN;.	G	70	ENSP00000367454:V70G;ENSP00000339524:V70G;ENSP00000367457:V70G	ENSP00000339524:V70G	V	+	2	0	DFFB	3765236	0.998000	0.40836	0.728000	0.30774	0.830000	0.47004	6.164000	0.71885	1.719000	0.51432	0.459000	0.35465	GTG	.		0.652	DFFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009821.2	NM_001282669	
DGCR14	8220	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	19132075	19132075	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr22:19132075C>T	ENST00000252137.6	-	1	122	c.79G>A	c.(79-81)Gag>Aag	p.E27K		NM_022719.2	NP_073210.1	Q96DF8	DGC14_HUMAN	DiGeorge syndrome critical region gene 14	27					mRNA splicing, via spliceosome (GO:0000398)|nervous system development (GO:0007399)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)	16	Colorectal(54;0.0993)					GCCCCAGCCTCTCCCGCCTCG	0.672																																					p.E27K		.											.	DGCR14	116	0			c.G79A						.						18.0	18.0	18.0					22																	19132075		2169	4247	6416	SO:0001583	missense	8220	exon1			CAGCCTCTCCCGC	L77566	CCDS13756.1	22q11.21	2007-02-20			ENSG00000100056	ENSG00000100056			16817	protein-coding gene	gene with protein product		601755	"""DiGeorge syndrome critical region gene 13"""	DGCR13		8776594, 9063747	Standard	NM_022719		Approved	DGSI, Es2el, ES2, DGS-H	uc002zou.3	Q96DF8	OTTHUMG00000150119	ENST00000252137.6:c.79G>A	22.37:g.19132075C>T	ENSP00000252137:p.Glu27Lys	57.0	0.0		74.0	35.0	NM_022719	Q49AH7|Q9BTZ4	Missense_Mutation	SNP	ENST00000252137.6	37	CCDS13756.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.318200	0.60524	.	.	ENSG00000100056	ENST00000252137	T	0.22134	1.97	3.61	2.59	0.31030	.	1.145130	0.06431	N	0.724232	T	0.10337	0.0253	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.21655	-1.0239	10	0.06494	T	0.89	-4.5033	8.8938	0.35451	0.0:0.8891:0.0:0.1109	.	27	Q96DF8	DGC14_HUMAN	K	27	ENSP00000252137:E27K	ENSP00000252137:E27K	E	-	1	0	DGCR14	17512075	0.000000	0.05858	0.004000	0.12327	0.622000	0.37654	0.137000	0.15995	1.110000	0.41699	0.467000	0.42956	GAG	.		0.672	DGCR14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316432.2		
DHX57	90957	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	39081308	39081308	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:39081308T>C	ENST00000295373.6	-	9	2044	c.1918A>G	c.(1918-1920)Aga>Gga	p.R640G	DHX57_ENST00000479345.2_5'Flank	NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	640	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				TATAACAGTCTGGTGGCTGAG	0.388																																					p.R640G	Melanoma(191;1090 2095 4375 23729 47341)	.											.	DHX57	228	0			c.A1918G						.						90.0	83.0	86.0					2																	39081308		2203	4300	6503	SO:0001583	missense	90957	exon9			ACAGTCTGGTGGC	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.1918A>G	2.37:g.39081308T>C	ENSP00000295373:p.Arg640Gly	73.0	1.0		76.0	24.0	NM_198963	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	ENST00000295373.6	37	CCDS1800.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.985063	0.74474	.	.	ENSG00000163214	ENST00000295373	T	0.07688	3.17	5.93	4.75	0.60458	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.64402	D	0.000020	T	0.36690	0.0976	M	0.92507	3.315	0.80722	D	1	D;D;D	0.89917	0.999;0.996;1.0	D;D;D	0.83275	0.994;0.983;0.996	T	0.43360	-0.9396	10	0.87932	D	0	.	12.1755	0.54184	0.0:0.0:0.2693:0.7307	.	640;640;32	Q6P158;B4DKW2;Q59G60	DHX57_HUMAN;.;.	G	640	ENSP00000295373:R640G	ENSP00000295373:R640G	R	-	1	2	DHX57	38934812	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.546000	0.45778	1.030000	0.39839	0.533000	0.62120	AGA	.		0.388	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646	
DIS3L	115752	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	66621720	66621720	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr15:66621720A>G	ENST00000319212.4	+	14	2568	c.2518A>G	c.(2518-2520)Atc>Gtc	p.I840V	RP11-352G18.2_ENST00000565993.1_RNA|DIS3L_ENST00000568874.1_3'UTR|DIS3L_ENST00000319194.5_Missense_Mutation_p.I757V	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	840					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						ATGCAGACATATCAACAACAG	0.353																																					p.I840V		.											.	DIS3L	92	0			c.A2518G						.						56.0	57.0	56.0					15																	66621720		2201	4298	6499	SO:0001583	missense	115752	exon14			AGACATATCAACA		CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.2518A>G	15.37:g.66621720A>G	ENSP00000321711:p.Ile840Val	98.0	0.0		160.0	18.0	NM_001143688	Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	ENST00000319212.4	37	CCDS45286.1	.	.	.	.	.	.	.	.	.	.	A	15.54	2.862715	0.51482	.	.	ENSG00000166938	ENST00000319194;ENST00000319212	T;T	0.44083	0.93;0.93	5.69	4.54	0.55810	.	0.142348	0.64402	D	0.000007	T	0.40322	0.1112	M	0.72118	2.19	0.80722	D	1	B	0.33103	0.397	B	0.31751	0.135	T	0.17961	-1.0352	10	0.18276	T	0.48	-12.4654	12.108	0.53823	0.8563:0.1437:0.0:0.0	.	840	Q8TF46	DI3L1_HUMAN	V	757;840	ENSP00000321583:I757V;ENSP00000321711:I840V	ENSP00000321583:I757V	I	+	1	0	DIS3L	64408774	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	5.483000	0.66838	1.050000	0.40346	0.533000	0.62120	ATC	.		0.353	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382792.2	NM_133375	
DNAH12	201625	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	57419403	57419403	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:57419403A>T	ENST00000351747.2	-	31	4919	c.4739T>A	c.(4738-4740)cTt>cAt	p.L1580H		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	1580	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						CTGTCCAAAAAGTTGGCCCAT	0.383																																					p.L1580H		.											.	DNAH12	47	0			c.T4739A						.						178.0	163.0	168.0					3																	57419403		692	1591	2283	SO:0001583	missense	201625	exon31			CCAAAAAGTTGGC	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.4739T>A	3.37:g.57419403A>T	ENSP00000295937:p.Leu1580His	37.0	0.0		70.0	8.0	NM_178504	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	ENST00000351747.2	37		.	.	.	.	.	.	.	.	.	.	A	18.70	3.680259	0.68042	.	.	ENSG00000174844	ENST00000351747;ENST00000495027	T;T	0.67698	-0.28;-0.28	5.73	5.73	0.89815	ATPase, dynein-related, AAA domain (1);	.	.	.	.	D	0.89770	0.6811	H	0.99325	4.515	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94037	0.7306	9	0.87932	D	0	.	16.0246	0.80532	1.0:0.0:0.0:0.0	.	1580	Q6ZR08	DYH12_HUMAN	H	1580;1603	ENSP00000295937:L1580H;ENSP00000418137:L1603H	ENSP00000295937:L1580H	L	-	2	0	DNAH12	57394443	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.167000	0.94773	2.175000	0.68902	0.533000	0.62120	CTT	.		0.383	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
DNAJB14	79982	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	100822217	100822218	+	Frame_Shift_Ins	INS	-	-	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr4:100822217_100822218insT	ENST00000442697.2	-	8	1261_1262	c.1107_1108insA	c.(1105-1110)ttagagfs	p.E370fs		NM_001031723.2|NM_001278310.1	NP_001026893.1|NP_001265239.1	Q8TBM8	DJB14_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 14	370						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				kidney(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5				OV - Ovarian serous cystadenocarcinoma(123;4.59e-09)		GTAAGCCGCTCTAATTCTTTAC	0.366																																					p.E370fs		.											.	DNAJB14	226	0			c.1108_1109insA						.																																			SO:0001589	frameshift_variant	79982	exon8			GCCGCTCTAATTC	BC022248	CCDS34035.1, CCDS75171.1	4q23	2011-09-02			ENSG00000164031	ENSG00000164031		"""Heat shock proteins / DNAJ (HSP40)"""	25881	protein-coding gene	gene with protein product							Standard	NM_001031723		Approved	FLJ14281	uc003hvl.4	Q8TBM8	OTTHUMG00000131049	ENST00000442697.2:c.1108dupA	4.37:g.100822218_100822218dupT	ENSP00000404381:p.Glu370fs	192.0	0.0		237.0	97.0	NM_001031723	Q6UXN1|Q7Z3P0|Q86TA7|Q86TM0|Q9GZU9	Frame_Shift_Ins	INS	ENST00000442697.2	37	CCDS34035.1																																																																																			.		0.366	DNAJB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253696.2	NM_001031723.2	
DSPP	1834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	88535128	88535128	+	Missense_Mutation	SNP	C	C	A	rs372553789		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr4:88535128C>A	ENST00000282478.7	+	4	1347	c.1314C>A	c.(1312-1314)caC>caA	p.H438Q	DSPP_ENST00000399271.1_Missense_Mutation_p.H438Q|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	438					biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		AAGTTGGACACAGCAATACAG	0.408																																					p.H438Q		.											.	DSPP	90	0			c.C1314A						.						156.0	144.0	148.0					4																	88535128		1965	4165	6130	SO:0001583	missense	1834	exon5			TGGACACAGCAAT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.1314C>A	4.37:g.88535128C>A	ENSP00000282478:p.His438Gln	145.0	0.0		191.0	28.0	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	C	6.618	0.482478	0.12581	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.91740	-2.9;-2.9	4.2	2.45	0.29901	.	0.481828	0.15504	N	0.258883	D	0.91543	0.7329	L	0.59436	1.845	0.25805	N	0.984467	D	0.57899	0.981	P	0.54140	0.743	T	0.83027	-0.0164	10	0.38643	T	0.18	-0.4613	6.3582	0.21412	0.0:0.7813:0.0:0.2187	.	438	Q9NZW4	DSPP_HUMAN	Q	438	ENSP00000382213:H438Q;ENSP00000282478:H438Q	ENSP00000282478:H438Q	H	+	3	2	DSPP	88754152	0.055000	0.20627	0.033000	0.17914	0.043000	0.13939	0.763000	0.26517	0.408000	0.25621	0.446000	0.29264	CAC	.		0.408	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DYNC2H1	79659	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	102984322	102984322	+	Silent	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr11:102984322A>G	ENST00000375735.2	+	2	396	c.252A>G	c.(250-252)gaA>gaG	p.E84E	DYNC2H1_ENST00000334267.7_Silent_p.E84E|DYNC2H1_ENST00000398093.3_Silent_p.E84E	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	84	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TGCGACCTGAAGTAATTACTG	0.328																																					p.E84E		.											.	DYNC2H1	68	0			c.A252G						.						166.0	161.0	163.0					11																	102984322		1862	4106	5968	SO:0001819	synonymous_variant	79659	exon2			ACCTGAAGTAATT	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.252A>G	11.37:g.102984322A>G		135.0	0.0		224.0	9.0	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	ENST00000375735.2	37	CCDS53701.1																																																																																			.		0.328	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
EDNRA	1909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	148441067	148441067	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr4:148441067C>A	ENST00000324300.5	+	3	1000	c.485C>A	c.(484-486)cCc>cAc	p.P162H	EDNRA_ENST00000339690.5_Intron|EDNRA_ENST00000506066.1_Intron|EDNRA_ENST00000511804.1_5'UTR|EDNRA_ENST00000358556.4_Intron	NM_001957.3	NP_001948.1	P25101	EDNRA_HUMAN	endothelin receptor type A	162					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|glomerular filtration (GO:0003094)|glucose transport (GO:0015758)|head development (GO:0060322)|heart development (GO:0007507)|histamine secretion (GO:0001821)|in utero embryonic development (GO:0001701)|maternal process involved in parturition (GO:0060137)|metabolic process (GO:0008152)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP biosynthetic process (GO:0030818)|neural crest cell development (GO:0014032)|patterning of blood vessels (GO:0001569)|penile erection (GO:0043084)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of kidney development (GO:0090184)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of odontogenesis (GO:0042482)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|Rho protein signal transduction (GO:0007266)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|smooth muscle cell proliferation (GO:0048659)|smooth muscle contraction (GO:0006939)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	endothelin receptor activity (GO:0004962)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)	17	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Acetylsalicylic acid(DB00945)|Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	AAGCTGTTCCCCTTTTTGCAG	0.502																																					p.P162H		.											.	EDNRA	586	0			c.C485A						.						217.0	202.0	207.0					4																	148441067		2203	4300	6503	SO:0001583	missense	1909	exon3			TGTTCCCCTTTTT	D90348	CCDS3769.1, CCDS54810.1, CCDS58927.1	4q31.22	2013-09-20			ENSG00000151617	ENSG00000151617		"""GPCR / Class A : Endothelin receptors"""	3179	protein-coding gene	gene with protein product		131243				1659806	Standard	NM_001957		Approved		uc003iky.3	P25101	OTTHUMG00000161354	ENST00000324300.5:c.485C>A	4.37:g.148441067C>A	ENSP00000315011:p.Pro162His	75.0	0.0		112.0	53.0	NM_001957	B2R723|B4E2V6|B7Z9G6|D3DP03|E7ER36|O43441|Q16432|Q16433|Q8TBH2	Missense_Mutation	SNP	ENST00000324300.5	37	CCDS3769.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.821411	0.90873	.	.	ENSG00000151617	ENST00000394047;ENST00000324300	T	0.37058	1.22	5.48	5.48	0.80851	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.66616	0.2807	M	0.86268	2.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71945	-0.4439	10	0.87932	D	0	-17.8311	18.9432	0.92612	0.0:1.0:0.0:0.0	.	162	P25101	EDNRA_HUMAN	H	162	ENSP00000315011:P162H	ENSP00000315011:P162H	P	+	2	0	EDNRA	148660517	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.060000	0.76692	2.572000	0.86782	0.591000	0.81541	CCC	.		0.502	EDNRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364635.1		
EFCAB14	9813	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	47144177	47144177	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:47144177C>T	ENST00000371933.3	-	11	2420	c.1444G>A	c.(1444-1446)Gga>Aga	p.G482R	EFCAB14_ENST00000544071.1_Intron|EFCAB14-AS1_ENST00000442839.1_RNA|EFCAB14-AS1_ENST00000418985.1_RNA	NM_014774.2	NP_055589.1	O75071	EFC14_HUMAN	EF-hand calcium binding domain 14	482	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)										GAGTATCTTCCATCTCCATCG	0.448																																					p.G482R		.											.	.	.	0			c.G1444A						.						117.0	111.0	113.0					1																	47144177		2203	4300	6503	SO:0001583	missense	9813	exon11			ATCTTCCATCTCC	AB007963	CCDS30706.1	1p33	2013-01-10	2012-11-29	2012-11-29	ENSG00000159658	ENSG00000159658		"""EF-hand domain containing"""	29051	protein-coding gene	gene with protein product			"""KIAA0494"""	KIAA0494		9455484	Standard	NM_014774		Approved		uc001cqk.4	O75071	OTTHUMG00000007992	ENST00000371933.3:c.1444G>A	1.37:g.47144177C>T	ENSP00000361001:p.Gly482Arg	41.0	0.0		60.0	19.0	NM_014774	D3DQ23|Q5SXB8	Missense_Mutation	SNP	ENST00000371933.3	37	CCDS30706.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.068198	0.76301	.	.	ENSG00000159658	ENST00000371933	T	0.25912	1.77	5.14	4.2	0.49525	EF-hand-like domain (1);	0.356104	0.29355	N	0.012381	T	0.42131	0.1189	L	0.47716	1.5	0.80722	D	1	D;B	0.89917	1.0;0.221	D;B	0.97110	1.0;0.074	T	0.15578	-1.0432	10	0.56958	D	0.05	-7.7213	12.5155	0.56030	0.0:0.921:0.0:0.079	.	274;482	B7Z3D1;O75071	.;K0494_HUMAN	R	482	ENSP00000361001:G482R	ENSP00000361001:G482R	G	-	1	0	KIAA0494	46916764	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.307000	0.51888	2.672000	0.90937	0.591000	0.81541	GGA	.		0.448	EFCAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021931.1	NM_014774	
EGF	1950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	110915962	110915962	+	Silent	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr4:110915962C>T	ENST00000265171.5	+	20	3376	c.2931C>T	c.(2929-2931)ccC>ccT	p.P977P	EGF_ENST00000509793.1_Silent_p.P935P|RNU6-35P_ENST00000384530.1_RNA|EGF_ENST00000503392.1_Silent_p.P936P	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	977	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.				activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	CTGAATGTCCCCTGTCCCACG	0.453																																					p.P977P		.											.	EGF	524	0			c.C2931T						.						174.0	145.0	155.0					4																	110915962		2203	4300	6503	SO:0001819	synonymous_variant	1950	exon20			ATGTCCCCTGTCC	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.2931C>T	4.37:g.110915962C>T		42.0	0.0		62.0	19.0	NM_001963	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Silent	SNP	ENST00000265171.5	37	CCDS3689.1																																																																																			.		0.453	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1		
ENAH	55740	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	225707015	225707018	+	Frame_Shift_Del	DEL	TCTT	TCTT	-			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	TCTT	TCTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:225707015_225707018delTCTT	ENST00000366844.3	-	5	1135_1138	c.684_687delAAGA	c.(682-687)gaaagafs	p.ER228fs	ENAH_ENST00000284563.6_Frame_Shift_Del_p.ER247fs|ENAH_ENST00000366843.2_Frame_Shift_Del_p.ER228fs|ENAH_ENST00000391874.2_5'UTR	NM_001008493.1|NM_018212.4	NP_001008493.1|NP_060682.2	Q8N8S7	ENAH_HUMAN	enabled homolog (Drosophila)	228					actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|intracellular transport (GO:0046907)|neural tube closure (GO:0001843)|T cell receptor signaling pathway (GO:0050852)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)|synapse (GO:0045202)	WW domain binding (GO:0050699)			NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.19)		CTCGTTCTTGTCTTTCTTGCCTCT	0.603																																					p.228_229del		.											.	ENAH	516	0			c.684_687del						.																																			SO:0001589	frameshift_variant	55740	exon5			TTCTTGTCTTTCT	AK001635	CCDS31040.1, CCDS31041.1	1q32.2	2013-08-06			ENSG00000154380	ENSG00000154380			18271	protein-coding gene	gene with protein product	"""mammalian enabled"""	609061				1420303	Standard	XM_005273182		Approved	FLJ10773, NDPP1, MENA	uc001hpc.1	Q8N8S7	OTTHUMG00000037742	ENST00000366844.3:c.684_687delAAGA	1.37:g.225707019_225707022delTCTT	ENSP00000355809:p.Glu228fs	56.0	0.0		93.0	22.0	NM_001008493	D0PQI2|Q502W5|Q5T5M7|Q5VTQ9|Q5VTR0|Q9NVF3|Q9UFB8	Frame_Shift_Del	DEL	ENST00000366844.3	37	CCDS31041.1																																																																																			.		0.603	ENAH-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000357426.2	NM_018212	
EPB42	2038	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	43502619	43502619	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr15:43502619C>A	ENST00000441366.2	-	5	793	c.568G>T	c.(568-570)Gac>Tac	p.D190Y	EPB42_ENST00000540029.1_Missense_Mutation_p.D112Y|EPB42_ENST00000300215.3_Missense_Mutation_p.D220Y	NM_000119.2|NM_001114134.1	NP_000110.2|NP_001107606.1	P16452	EPB42_HUMAN	erythrocyte membrane protein band 4.2	190					cell morphogenesis (GO:0000902)|erythrocyte maturation (GO:0043249)|hemoglobin metabolic process (GO:0020027)|iron ion homeostasis (GO:0055072)|peptide cross-linking (GO:0018149)|regulation of cell shape (GO:0008360)|spleen development (GO:0048536)	cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.7e-07)		AGGCTGAGGTCAATGACATCC	0.597																																					p.D220Y		.											.	EPB42	92	0			c.G658T						.						108.0	92.0	97.0					15																	43502619		2203	4299	6502	SO:0001583	missense	2038	exon5			TGAGGTCAATGAC	M60298	CCDS10093.1, CCDS45249.1	15q15-q21	2013-05-02			ENSG00000166947	ENSG00000166947		"""Transglutaminases"""	3381	protein-coding gene	gene with protein product	"""Erythrocyte surface protein band 4.2"""	177070				1284644	Standard	NM_000119		Approved	PA, MGC116735, MGC116737	uc001zrb.4	P16452	OTTHUMG00000130701	ENST00000441366.2:c.568G>T	15.37:g.43502619C>A	ENSP00000396616:p.Asp190Tyr	33.0	0.0		40.0	7.0	NM_000119	Q4KKX0|Q4VB97	Missense_Mutation	SNP	ENST00000441366.2	37	CCDS45249.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.497619	0.44455	.	.	ENSG00000166947	ENST00000300215;ENST00000540029;ENST00000441366;ENST00000397027	D;D;D	0.82711	-1.64;-1.64;-1.64	5.64	3.77	0.43336	.	0.108239	0.64402	D	0.000004	D	0.91429	0.7295	M	0.91038	3.17	0.39628	D	0.97013	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.79108	0.943;0.982;0.992;0.982	D	0.91410	0.5150	10	0.87932	D	0	-25.5336	8.7678	0.34713	0.0:0.826:0.0:0.174	.	112;190;220;190	F5H563;B7Z4C3;P16452-2;P16452	.;.;.;EPB42_HUMAN	Y	220;112;190;190	ENSP00000300215:D220Y;ENSP00000444699:D112Y;ENSP00000396616:D190Y	ENSP00000300215:D220Y	D	-	1	0	EPB42	41289911	0.452000	0.25713	0.625000	0.29200	0.332000	0.28634	0.624000	0.24462	0.738000	0.32606	0.650000	0.86243	GAC	.		0.597	EPB42-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432219.1	NM_000119	
EPHA7	2045	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	93969103	93969103	+	Silent	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr6:93969103G>A	ENST00000369303.4	-	10	2077	c.1893C>T	c.(1891-1893)tcC>tcT	p.S631S		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	631					brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TTTTAATACAGGAGGCATCTA	0.428																																					p.S631S		.											.	EPHA7	1453	0			c.C1893T						.						173.0	156.0	162.0					6																	93969103		2203	4300	6503	SO:0001819	synonymous_variant	2045	exon10			AATACAGGAGGCA	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.1893C>T	6.37:g.93969103G>A		90.0	0.0		92.0	62.0	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Silent	SNP	ENST00000369303.4	37	CCDS5031.1																																																																																			.		0.428	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
ERBB2IP	55914	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	65370901	65370901	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr5:65370901A>G	ENST00000284037.5	+	23	4195	c.3806A>G	c.(3805-3807)aAt>aGt	p.N1269S	ERBB2IP_ENST00000380943.2_Missense_Mutation_p.N1228S|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.N1228S|ERBB2IP_ENST00000506030.1_Missense_Mutation_p.N1276S|ERBB2IP_ENST00000380939.2_Intron|ERBB2IP_ENST00000503913.1_Intron|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.N1224S|ERBB2IP_ENST00000416865.2_Missense_Mutation_p.N467S|ERBB2IP_ENST00000380935.1_Intron|ERBB2IP_ENST00000380936.1_Missense_Mutation_p.N1228S|ERBB2IP_ENST00000508515.1_Intron	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	1269					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		CCTCAGGCAAATTATAGTCAA	0.428																																					p.N1276S		.											.	ERBB2IP	653	0			c.A3827G						.						84.0	88.0	86.0					5																	65370901		2203	4300	6503	SO:0001583	missense	55914	exon23			AGGCAAATTATAG		CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.3806A>G	5.37:g.65370901A>G	ENSP00000284037:p.Asn1269Ser	151.0	2.0		219.0	65.0	NM_001253699	A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	ENST00000284037.5	37	CCDS58953.1	.	.	.	.	.	.	.	.	.	.	A	18.12	3.553965	0.65425	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000416865;ENST00000380936;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000512354	T;T;T;T;T;T;T	0.34072	1.46;1.48;1.44;1.57;1.38;1.48;1.48	5.92	5.92	0.95590	.	0.077621	0.53938	D	0.000043	T	0.26991	0.0661	L	0.29908	0.895	0.80722	D	1	B;B;B;B;P;B;B	0.34562	0.009;0.003;0.005;0.003;0.457;0.004;0.006	B;B;B;B;B;B;B	0.28385	0.007;0.017;0.008;0.012;0.089;0.005;0.012	T	0.04427	-1.0952	10	0.26408	T	0.33	.	16.3492	0.83195	1.0:0.0:0.0:0.0	.	467;1228;1276;1276;1224;1269;1228	B4DIP2;Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-2	.;.;.;.;.;LAP2_HUMAN;.	S	1269;1228;467;1228;1228;1224;1276;106	ENSP00000284037:N1269S;ENSP00000370330:N1228S;ENSP00000397833:N467S;ENSP00000370323:N1228S;ENSP00000370325:N1228S;ENSP00000422766:N1224S;ENSP00000426632:N1276S	ENSP00000284037:N1269S	N	+	2	0	ERBB2IP	65406657	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.511000	0.73733	2.266000	0.75297	0.528000	0.53228	AAT	.		0.428	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215070.1	NM_018695	
ERBB3	2065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56486836	56486836	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr12:56486836C>T	ENST00000267101.3	+	11	1690	c.1250C>T	c.(1249-1251)aCc>aTc	p.T417I	ERBB3_ENST00000553131.1_5'Flank|ERBB3_ENST00000415288.2_Missense_Mutation_p.T358I|ERBB3_ENST00000450146.2_Intron	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	417					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			AATTTGACAACCATTGGAGGC	0.478																																					p.T417I		.											.	ERBB3	1403	0			c.C1250T						.						74.0	73.0	73.0					12																	56486836		2203	4300	6503	SO:0001583	missense	2065	exon11			TGACAACCATTGG	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.1250C>T	12.37:g.56486836C>T	ENSP00000267101:p.Thr417Ile	62.0	0.0		80.0	12.0	NM_001982	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	37	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.970575	0.74246	.	.	ENSG00000065361	ENST00000267101;ENST00000415288	T;T	0.78126	-1.15;-1.15	5.06	5.06	0.68205	EGF receptor, L domain (1);	0.000000	0.64402	D	0.000003	T	0.75606	0.3872	L	0.33245	0.995	0.80722	D	1	P	0.40050	0.7	P	0.48840	0.592	T	0.69465	-0.5138	10	0.14252	T	0.57	.	17.3497	0.87320	0.0:1.0:0.0:0.0	.	417	P21860	ERBB3_HUMAN	I	417;358	ENSP00000267101:T417I;ENSP00000408340:T358I	ENSP00000267101:T417I	T	+	2	0	ERBB3	54773103	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.700000	0.54786	2.638000	0.89438	0.655000	0.94253	ACC	.		0.478	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
ERBB3	2065	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	56486845	56486845	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr12:56486845G>T	ENST00000267101.3	+	11	1699	c.1259G>T	c.(1258-1260)gGc>gTc	p.G420V	ERBB3_ENST00000553131.1_5'Flank|ERBB3_ENST00000415288.2_Missense_Mutation_p.G361V|ERBB3_ENST00000450146.2_Intron	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	420					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			ACCATTGGAGGCAGAAGCCTC	0.468																																					p.G420V		.											.	ERBB3	1403	0			c.G1259T						.						61.0	61.0	61.0					12																	56486845		2203	4300	6503	SO:0001583	missense	2065	exon11			TTGGAGGCAGAAG	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.1259G>T	12.37:g.56486845G>T	ENSP00000267101:p.Gly420Val	56.0	0.0		77.0	12.0	NM_001982	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	37	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.755766	0.89843	.	.	ENSG00000065361	ENST00000267101;ENST00000415288	T;T	0.55052	0.54;0.54	5.06	5.06	0.68205	EGF receptor, L domain (1);	0.000000	0.64402	D	0.000003	T	0.81645	0.4866	H	0.96398	3.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87518	0.2444	10	0.87932	D	0	.	17.3497	0.87320	0.0:0.0:1.0:0.0	.	420	P21860	ERBB3_HUMAN	V	420;361	ENSP00000267101:G420V;ENSP00000408340:G361V	ENSP00000267101:G420V	G	+	2	0	ERBB3	54773112	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.256000	0.95535	2.638000	0.89438	0.655000	0.94253	GGC	.		0.468	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
EYA1	2138	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	72211880	72211880	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr8:72211880G>A	ENST00000340726.3	-	8	1271	c.632C>T	c.(631-633)tCa>tTa	p.S211L	EYA1_ENST00000388743.2_Missense_Mutation_p.S210L|EYA1_ENST00000388741.2_Missense_Mutation_p.S177L|EYA1_ENST00000419131.1_Missense_Mutation_p.S206L|EYA1_ENST00000388742.4_Missense_Mutation_p.S211L|EYA1_ENST00000303824.7_Missense_Mutation_p.S205L|EYA1_ENST00000388740.3_Missense_Mutation_p.S178L	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	211					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			TACCTGCTGTGAACTATTAAA	0.289																																					p.S211L		.											.	EYA1	652	0			c.C632T	GRCh37	CM044880	EYA1	M		.						112.0	121.0	118.0					8																	72211880		2203	4299	6502	SO:0001583	missense	2138	exon8			TGCTGTGAACTAT	AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.632C>T	8.37:g.72211880G>A	ENSP00000342626:p.Ser211Leu	58.0	0.0		90.0	14.0	NM_000503	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Missense_Mutation	SNP	ENST00000340726.3	37	CCDS34906.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850367	0.71719	.	.	ENSG00000104313	ENST00000388742;ENST00000340726;ENST00000388744;ENST00000388740;ENST00000303824;ENST00000388741;ENST00000388743;ENST00000419131	D;D;D;D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62;-1.62;-1.62;-1.62	5.56	5.56	0.83823	.	0.118168	0.64402	D	0.000019	D	0.82765	0.5108	L	0.57536	1.79	0.58432	D	0.999999	B;B;B;B;B	0.29805	0.091;0.257;0.125;0.18;0.053	B;B;B;B;B	0.31946	0.079;0.096;0.138;0.108;0.138	T	0.79962	-0.1582	10	0.44086	T	0.13	-14.3784	19.8772	0.96880	0.0:0.0:1.0:0.0	.	205;138;178;211;206	A6NCB9;Q0P517;Q99502-2;Q99502;G5E9R4	.;.;.;EYA1_HUMAN;.	L	211;211;179;178;205;177;210;206	ENSP00000373394:S211L;ENSP00000342626:S211L;ENSP00000373392:S178L;ENSP00000303221:S205L;ENSP00000373393:S177L;ENSP00000373395:S210L;ENSP00000410176:S206L	ENSP00000303221:S205L	S	-	2	0	EYA1	72374434	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.388000	0.97237	2.774000	0.95407	0.585000	0.79938	TCA	.		0.289	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060	
FAM104B	90736	broad.mit.edu;bcgsc.ca	37	X	55187569	55187569	+	Splice_Site	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chrX:55187569C>T	ENST00000358460.4	-	1	174		c.e1+1		FAM104B_ENST00000478918.1_5'Flank|FAM104B_ENST00000332132.4_Splice_Site|FAM104B_ENST00000472571.2_Splice_Site|FAM104B_ENST00000489298.1_5'Flank|FAM104B_ENST00000425133.2_Splice_Site|FAM104B_ENST00000477847.2_5'Flank			Q5XKR9	F104B_HUMAN	family with sequence similarity 104, member B											endometrium(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	8						GACGAACTTACCGTACAGGGC	0.657																																					.		.											.	FAM104B	130	0			c.20+1G>A						.						40.0	28.0	32.0					X																	55187569		2201	4298	6499	SO:0001630	splice_region_variant	90736	exon2			AACTTACCGTACA	BC000919	CCDS35305.1, CCDS35305.2, CCDS55422.1, CCDS55423.1, CCDS55424.1, CCDS55425.1, CCDS55426.1	Xp11.22	2008-02-05	2006-05-16	2006-05-16	ENSG00000182518	ENSG00000182518			25085	protein-coding gene	gene with protein product			"""chromosome X open reading frame 44"""	CXorf44		12477932	Standard	NM_138362		Approved	FLJ20434	uc004dug.2	Q5XKR9	OTTHUMG00000021646	ENST00000358460.4:c.20+1G>A	X.37:g.55187569C>T		47.0	0.0		58.0	5.0	NM_138362	A6NEH1|B4DSV6|D6R9S5|D6RDJ5|E9PH40|Q8WVU5|Q9BRA1	Splice_Site	SNP	ENST00000358460.4	37	CCDS35305.2	.	.	.	.	.	.	.	.	.	.	C	11.10	1.537981	0.27475	.	.	ENSG00000182518	ENST00000358460;ENST00000332132;ENST00000425133;ENST00000472571	.	.	.	1.64	0.697	0.18081	.	.	.	.	.	.	.	.	.	.	.	0.33613	D	0.603834	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.6444	0.12565	0.3718:0.6282:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAM104B	55204294	0.000000	0.05858	0.000000	0.03702	0.534000	0.34807	-0.088000	0.11198	0.158000	0.19367	0.292000	0.19580	.	.		0.657	FAM104B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056851.1	NM_138362	Intron
FAM171B	165215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	187627500	187627500	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:187627500A>G	ENST00000304698.5	+	8	2634	c.2431A>G	c.(2431-2433)Act>Gct	p.T811A		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	811						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						AGATAGCAAGACTAACATCTG	0.458																																					p.T811A		.											.	FAM171B	141	0			c.A2431G						.						78.0	76.0	77.0					2																	187627500		2203	4299	6502	SO:0001583	missense	165215	exon8			AGCAAGACTAACA	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.2431A>G	2.37:g.187627500A>G	ENSP00000304108:p.Thr811Ala	186.0	0.0		241.0	102.0	NM_177454	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	ENST00000304698.5	37	CCDS33347.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.131662	0.77662	.	.	ENSG00000144369	ENST00000304698	T	0.30448	1.53	6.02	6.02	0.97574	.	0.128251	0.52532	D	0.000065	T	0.45175	0.1329	L	0.36672	1.1	0.52501	D	0.999956	D;D	0.63046	0.992;0.992	P;P	0.62740	0.906;0.906	T	0.37220	-0.9715	10	0.66056	D	0.02	-19.2732	16.5494	0.84464	1.0:0.0:0.0:0.0	.	811;812	Q6P995;A8K122	F171B_HUMAN;.	A	811	ENSP00000304108:T811A	ENSP00000304108:T811A	T	+	1	0	FAM171B	187335745	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.818000	0.55678	2.299000	0.77371	0.528000	0.53228	ACT	.		0.458	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454	
FAM189A2	9413	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	72000833	72000833	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr9:72000833G>T	ENST00000257515.8	+	9	1246	c.826G>T	c.(826-828)Gac>Tac	p.D276Y	FAM189A2_ENST00000469179.1_3'UTR|FAM189A2_ENST00000455972.1_Missense_Mutation_p.D276Y|FAM189A2_ENST00000303068.7_Missense_Mutation_p.D111Y|FAM189A2_ENST00000377216.3_5'Flank	NM_004816.3	NP_004807.3	Q15884	F1892_HUMAN	family with sequence similarity 189, member A2	276						integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(5)|liver(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12						GTCGAAGAGTGACCCTGTGCT	0.562																																					p.D276Y		.											.	FAM189A2	90	0			c.G826T						.						105.0	82.0	90.0					9																	72000833		2203	4300	6503	SO:0001583	missense	9413	exon9			AAGAGTGACCCTG	L27479	CCDS6629.1	9q21.11	2009-07-09	2009-07-09	2009-07-09	ENSG00000135063	ENSG00000135063			24820	protein-coding gene	gene with protein product		607710	"""chromosome 9 open reading frame 61"""	C9orf61		7951235	Standard	NM_004816		Approved	X123	uc010mon.1	Q15884	OTTHUMG00000019979	ENST00000257515.8:c.826G>T	9.37:g.72000833G>T	ENSP00000257515:p.Asp276Tyr	65.0	0.0		58.0	24.0	NM_004816	Q14CN5|Q5T6C8|Q5T6C9|Q6ZTX4|Q96N10	Missense_Mutation	SNP	ENST00000257515.8	37	CCDS6629.1	.	.	.	.	.	.	.	.	.	.	G	18.77	3.695658	0.68386	.	.	ENSG00000135063	ENST00000455972;ENST00000257515;ENST00000303068;ENST00000377225	T;T;T	0.47528	1.89;1.89;0.84	5.93	5.93	0.95920	.	0.247207	0.42682	D	0.000680	T	0.70369	0.3216	M	0.73962	2.25	0.58432	D	0.999996	D;D	0.89917	1.0;0.995	D;P	0.97110	1.0;0.867	T	0.71632	-0.4534	10	0.72032	D	0.01	-13.4037	18.1269	0.89589	0.0:0.0:1.0:0.0	.	111;276	F2Z2T9;Q15884	.;F1892_HUMAN	Y	276;276;111;275	ENSP00000395675:D276Y;ENSP00000257515:D276Y;ENSP00000304435:D111Y	ENSP00000257515:D276Y	D	+	1	0	FAM189A2	71190653	1.000000	0.71417	1.000000	0.80357	0.385000	0.30292	5.878000	0.69682	2.826000	0.97356	0.655000	0.94253	GAC	.		0.562	FAM189A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052576.2	NM_004816	
FAM65C	140876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	49221275	49221275	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr20:49221275G>C	ENST00000327979.2	-	12	1392	c.981C>G	c.(979-981)agC>agG	p.S327R	FAM65C_ENST00000045083.2_Missense_Mutation_p.S327R|FAM65C_ENST00000535356.1_Missense_Mutation_p.S331R			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	327										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGCCCGTGGGGCTGGGTGACA	0.597																																					p.S327R		.											.	FAM65C	92	0			c.C981G						.						43.0	42.0	43.0					20																	49221275		2203	4300	6503	SO:0001583	missense	140876	exon12			CGTGGGGCTGGGT	AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.981C>G	20.37:g.49221275G>C	ENSP00000332663:p.Ser327Arg	34.0	0.0		86.0	12.0	NM_080829	Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	ENST00000327979.2	37	CCDS13431.2	.	.	.	.	.	.	.	.	.	.	G	16.99	3.273776	0.59649	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.02158	4.42;4.42;4.42	3.95	-0.174	0.13319	.	0.342469	0.30723	N	0.009005	T	0.04137	0.0115	L	0.39898	1.24	0.32027	N	0.599977	D;D	0.71674	0.998;0.995	P;P	0.60541	0.876;0.836	T	0.32455	-0.9906	10	0.59425	D	0.04	-27.2238	3.7886	0.08710	0.2285:0.0:0.416:0.3555	.	331;327	F5H0X2;Q96MK2	.;FA65C_HUMAN	R	327;327;331	ENSP00000332663:S327R;ENSP00000045083:S327R;ENSP00000439802:S331R	ENSP00000045083:S327R	S	-	3	2	FAM65C	48654682	0.981000	0.34729	0.994000	0.49952	0.816000	0.46133	0.132000	0.15891	0.243000	0.21327	0.561000	0.74099	AGC	.		0.597	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257962.1		
FASTKD2	22868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	207634821	207634821	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:207634821A>G	ENST00000236980.6	+	3	1132	c.784A>G	c.(784-786)Atc>Gtc	p.I262V	FASTKD2_ENST00000403094.3_Missense_Mutation_p.I262V|FASTKD2_ENST00000402774.3_Missense_Mutation_p.I262V	NM_014929.3	NP_055744.2	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	262					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(2)	21				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		ATAGGAACGTATCAATGAGTG	0.373																																					p.I262V		.											.	FASTKD2	118	0			c.A784G						.						179.0	162.0	168.0					2																	207634821		2203	4300	6503	SO:0001583	missense	22868	exon3			GAACGTATCAATG	BC001544	CCDS2371.1	2q33.3	2008-02-05	2006-07-07	2006-07-07	ENSG00000118246	ENSG00000118246			29160	protein-coding gene	gene with protein product		612322	"""KIAA0971"""	KIAA0971			Standard	NM_014929		Approved		uc002vbx.3	Q9NYY8	OTTHUMG00000132917	ENST00000236980.6:c.784A>G	2.37:g.207634821A>G	ENSP00000236980:p.Ile262Val	70.0	0.0		100.0	45.0	NM_001136193	Q9NVX6|Q9Y2H7	Missense_Mutation	SNP	ENST00000236980.6	37	CCDS2371.1	.	.	.	.	.	.	.	.	.	.	A	13.09	2.133139	0.37630	.	.	ENSG00000118246	ENST00000236980;ENST00000402774;ENST00000403094	T;T;T	0.16324	2.35;2.35;2.35	5.57	5.57	0.84162	.	0.156953	0.42964	D	0.000635	T	0.24122	0.0584	M	0.72118	2.19	0.29664	N	0.843026	P;P	0.47106	0.89;0.495	P;B	0.47626	0.552;0.152	T	0.12372	-1.0550	10	0.15952	T	0.53	-18.0976	10.336	0.43850	0.721:0.279:0.0:0.0	.	262;262	Q9NYY8-2;Q9NYY8	.;FAKD2_HUMAN	V	262	ENSP00000236980:I262V;ENSP00000385990:I262V;ENSP00000384929:I262V	ENSP00000236980:I262V	I	+	1	0	FASTKD2	207343066	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	4.485000	0.60279	2.120000	0.65058	0.482000	0.46254	ATC	.		0.373	FASTKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256428.2	NM_014929	
FBN2	2201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	127685696	127685696	+	Splice_Site	SNP	A	A	G	rs183336575	byFrequency	TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr5:127685696A>G	ENST00000508053.1	-	28	3788	c.2814T>C	c.(2812-2814)gaT>gaC	p.D938D	FBN2_ENST00000262464.4_Splice_Site_p.D938D|FBN2_ENST00000508989.1_Splice_Site_p.D905D			P35556	FBN2_HUMAN	fibrillin 2	938	TB 4.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GGCAAGCTGTATCTGTAACAA	0.353																																					p.D938D		.											.	FBN2	146	0			c.T2814C						.						73.0	66.0	68.0					5																	127685696		2203	4300	6503	SO:0001630	splice_region_variant	2201	exon22			AGCTGTATCTGTA	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.2813-1T>C	5.37:g.127685696A>G		54.0	0.0		71.0	7.0	NM_001999	B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	37	CCDS34222.1																																																																																			A|0.999;C|0.000		0.353	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	Silent
FBN2	2201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	127704957	127704957	+	Silent	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr5:127704957T>C	ENST00000508053.1	-	22	3140	c.2166A>G	c.(2164-2166)gcA>gcG	p.A722A	Y_RNA_ENST00000384560.1_RNA|FBN2_ENST00000262464.4_Silent_p.A722A|FBN2_ENST00000508989.1_Silent_p.A689A|FBN2_ENST00000511489.1_5'UTR			P35556	FBN2_HUMAN	fibrillin 2	722	TB 3.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ACTTGGTCACTGCACCGGGGA	0.483																																					p.A722A		.											.	FBN2	146	0			c.A2166G						.						179.0	143.0	155.0					5																	127704957		2203	4300	6503	SO:0001819	synonymous_variant	2201	exon16			GGTCACTGCACCG	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.2166A>G	5.37:g.127704957T>C		60.0	0.0		92.0	16.0	NM_001999	B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	37	CCDS34222.1																																																																																			.		0.483	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
FAT2	2196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	150925186	150925186	+	Silent	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr5:150925186G>T	ENST00000261800.5	-	9	5514	c.5502C>A	c.(5500-5502)ccC>ccA	p.P1834P		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1834	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATTGGAAAGAGGGCATGCTCT	0.428																																					p.P1834P		.											.	FAT2	96	0			c.C5502A						.						67.0	71.0	70.0					5																	150925186		2203	4300	6503	SO:0001819	synonymous_variant	2196	exon9			GAAAGAGGGCATG	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.5502C>A	5.37:g.150925186G>T		73.0	0.0		129.0	26.0	NM_001447	O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	CCDS4317.1																																																																																			.		0.428	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
FBXO24	26261	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	100190612	100190612	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:100190612G>T	ENST00000241071.6	+	5	1087	c.765G>T	c.(763-765)gaG>gaT	p.E255D	PCOLCE-AS1_ENST00000544873.1_RNA|FBXO24_ENST00000468962.1_Missense_Mutation_p.E243D|FBXO24_ENST00000360609.2_Missense_Mutation_p.E241D|FBXO24_ENST00000427939.2_Missense_Mutation_p.E293D|FBXO24_ENST00000465843.1_Missense_Mutation_p.E241D|PCOLCE-AS1_ENST00000442166.2_RNA	NM_033506.2	NP_277041.1	O75426	FBX24_HUMAN	F-box protein 24	255					protein ubiquitination (GO:0016567)	ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(3)|skin(4)|urinary_tract(2)	28	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					TTGGTCAGGAGACCCAGCGGG	0.547																																					p.E293D		.											.	FBXO24	229	0			c.G879T						.						79.0	64.0	69.0					7																	100190612		2203	4300	6503	SO:0001583	missense	26261	exon5			TCAGGAGACCCAG	AF174604	CCDS5698.1, CCDS5699.1, CCDS5699.2, CCDS55138.1	7q22	2005-10-07	2004-06-15		ENSG00000106336	ENSG00000106336		"""F-boxes /  ""other"""""	13595	protein-coding gene	gene with protein product		609097	"""F-box only protein 24"""			10531035, 10531037	Standard	NM_012172		Approved	FBX24	uc011kjz.1	O75426	OTTHUMG00000159543	ENST00000241071.6:c.765G>T	7.37:g.100190612G>T	ENSP00000241071:p.Glu255Asp	70.0	0.0		173.0	8.0	NM_012172	A4D2D4|B4DX91|B4DY42|Q9H0G1	Missense_Mutation	SNP	ENST00000241071.6	37	CCDS5698.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.691653	0.88735	.	.	ENSG00000106336	ENST00000241071;ENST00000360609;ENST00000465843;ENST00000468962;ENST00000427939	T;T;T;T;T	0.51574	2.33;0.7;0.7;2.33;2.31	5.74	5.74	0.90152	.	0.000000	0.64402	D	0.000004	T	0.50188	0.1601	N	0.08118	0	0.45390	D	0.998375	D;D;D;D	0.62365	0.991;0.991;0.991;0.99	P;P;P;D	0.72982	0.901;0.901;0.901;0.979	T	0.57365	-0.7824	10	0.46703	T	0.11	-31.9831	17.4859	0.87688	0.0:0.0:1.0:0.0	.	243;293;255;241	B4DY42;B4DX91;O75426;O75426-2	.;.;FBX24_HUMAN;.	D	255;241;241;243;293	ENSP00000241071:E255D;ENSP00000353821:E241D;ENSP00000419602:E241D;ENSP00000420239:E243D;ENSP00000416558:E293D	ENSP00000241071:E255D	E	+	3	2	FBXO24	100028548	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.450000	0.60041	2.740000	0.93945	0.558000	0.71614	GAG	.		0.547	FBXO24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356104.1		
FBXO38	81545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	147788727	147788727	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr5:147788727C>G	ENST00000340253.5	+	8	1077	c.909C>G	c.(907-909)tgC>tgG	p.C303W	FBXO38_ENST00000509699.2_3'UTR|FBXO38_ENST00000513826.1_Missense_Mutation_p.C303W|FBXO38_ENST00000394370.3_Missense_Mutation_p.C303W|FBXO38_ENST00000296701.6_Missense_Mutation_p.C303W			Q6PIJ6	FBX38_HUMAN	F-box protein 38	303					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)			ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGGAGCTTGCAAAAATGCTC	0.358																																					p.C303W		.											.	FBXO38	231	0			c.C909G						.						245.0	239.0	241.0					5																	147788727		2203	4300	6503	SO:0001583	missense	81545	exon8			AGCTTGCAAAAAT	BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.909C>G	5.37:g.147788727C>G	ENSP00000342023:p.Cys303Trp	150.0	0.0		205.0	57.0	NM_001271723	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	ENST00000340253.5	37		.	.	.	.	.	.	.	.	.	.	C	16.59	3.165088	0.57476	.	.	ENSG00000145868	ENST00000340253;ENST00000296701;ENST00000394370;ENST00000513826	T;T;T;T	0.21031	2.03;5.29;2.03;5.29	5.29	2.45	0.29901	.	0.000000	0.85682	D	0.000000	T	0.31104	0.0786	L	0.32530	0.975	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.85130	0.995;0.995;0.997	T	0.02004	-1.1231	10	0.87932	D	0	-10.7367	8.9713	0.35908	0.0:0.7435:0.0:0.2565	.	303;303;303	Q6PIJ6-3;Q6PIJ6-2;Q6PIJ6	.;.;FBX38_HUMAN	W	303	ENSP00000342023:C303W;ENSP00000296701:C303W;ENSP00000377895:C303W;ENSP00000426410:C303W	ENSP00000296701:C303W	C	+	3	2	FBXO38	147768920	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.645000	0.37238	0.277000	0.22141	-0.229000	0.12294	TGC	.		0.358	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793	
FCGBP	8857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	40364247	40364247	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:40364247G>A	ENST00000221347.6	-	31	14402	c.14395C>T	c.(14395-14397)Cgc>Tgc	p.R4799C		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4799						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGGTAGTAGCGGCCATCATGG	0.657																																					p.R4799C		.											.	FCGBP	98	0			c.C14395T						.						43.0	44.0	44.0					19																	40364247		2199	4297	6496	SO:0001583	missense	8857	exon31			AGTAGCGGCCATC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.14395C>T	19.37:g.40364247G>A	ENSP00000221347:p.Arg4799Cys	38.0	0.0		89.0	21.0	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.518025	0.27211	.	.	ENSG00000090920	ENST00000221347	T	0.05025	3.51	4.86	4.86	0.63082	.	0.780127	0.11686	U	0.539392	T	0.26340	0.0643	M	0.85462	2.755	0.41668	D	0.989225	D	0.89917	1.0	D	0.63033	0.91	T	0.00708	-1.1600	10	0.59425	D	0.04	.	12.2542	0.54615	0.0:0.0:0.8297:0.1702	.	4799	Q9Y6R7	FCGBP_HUMAN	C	4799	ENSP00000221347:R4799C	ENSP00000221347:R4799C	R	-	1	0	FCGBP	45056087	0.000000	0.05858	0.501000	0.27601	0.096000	0.18686	0.645000	0.24782	2.417000	0.82017	0.313000	0.20887	CGC	.		0.657	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
FPGT	8790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	74671023	74671023	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:74671023G>A	ENST00000609362.1	+	4	1329	c.1292G>A	c.(1291-1293)gGg>gAg	p.G431E	FPGT-TNNI3K_ENST00000370893.1_Intron|FPGT_ENST00000370894.5_Missense_Mutation_p.G159R|FPGT_ENST00000370898.3_Missense_Mutation_p.G444E|TNNI3K_ENST00000370891.2_Intron|FPGT-TNNI3K_ENST00000557284.2_Intron|FPGT-TNNI3K_ENST00000370899.3_Intron|FPGT_ENST00000534056.1_Missense_Mutation_p.G177E|FPGT-TNNI3K_ENST00000370895.1_Intron|FPGT-TNNI3K_ENST00000533006.1_Intron|FPGT_ENST00000524915.1_Intron	NM_003838.4	NP_003829.3	O14772	FPGT_HUMAN	fucose-1-phosphate guanylyltransferase	431					fucose metabolic process (GO:0006004)	cytoplasm (GO:0005737)	catalytic activity (GO:0003824)|fucose-1-phosphate guanylyltransferase activity (GO:0047341)|GTP binding (GO:0005525)			breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	39						GTTTCAGTTGGGGAAAACTGC	0.413																																					p.G431E		.											.	FPGT	91	0			c.G1292A						.						119.0	127.0	124.0					1																	74671023		2203	4300	6503	SO:0001583	missense	8790	exon4			CAGTTGGGGAAAA	AF017445	CCDS663.1, CCDS663.2	1p31.1	2013-09-24			ENSG00000254685	ENSG00000254685	2.7.7.30		3825	protein-coding gene	gene with protein product		603609				9804772	Standard	NM_003838		Approved	GFPP		O14772	OTTHUMG00000009571	ENST00000609362.1:c.1292G>A	1.37:g.74671023G>A	ENSP00000476680:p.Gly431Glu	129.0	0.0		137.0	28.0	NM_003838	A6NMH3|B4DRX2|B4E2Y7|E9PNQ2|Q8N5J7	Missense_Mutation	SNP	ENST00000609362.1	37	CCDS663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.16|15.16	2.750374|2.750374	0.49257|0.49257	.|.	.|.	ENSG00000254685|ENSG00000254685	ENST00000370898;ENST00000534056|ENST00000370894	T;T|.	0.71579|.	-0.58;-0.58|.	5.72|5.72	3.85|3.85	0.44370|0.44370	L-fucokinase (1);|.	.|.	.|.	.|.	.|.	T|T	0.67683|0.67683	0.2919|0.2919	M|M	0.82630|0.82630	2.6|2.6	0.80722|0.80722	D|D	1|1	P;P;P|.	0.43169|.	0.513;0.719;0.8|.	B;B;P|.	0.48873|.	0.307;0.403;0.593|.	T|T	0.73033|0.73033	-0.4110|-0.4110	9|6	0.56958|0.87932	D|D	0.05|0	.|.	11.6377|11.6377	0.51213|0.51213	0.0668:0.1247:0.8085:0.0|0.0668:0.1247:0.8085:0.0	.|.	177;56;431|.	E9PNQ2;B4E2Y7;O14772|.	.;.;FPGT_HUMAN|.	E|R	431;177|159	ENSP00000359935:G431E;ENSP00000432819:G177E|.	ENSP00000359935:G431E|ENSP00000359931:G159R	G|G	+|+	2|1	0|0	TNNI3K|TNNI3K	74443611|74443611	1.000000|1.000000	0.71417|0.71417	0.930000|0.930000	0.37139|0.37139	0.432000|0.432000	0.31715|0.31715	5.424000|5.424000	0.66464|0.66464	0.761000|0.761000	0.33130|0.33130	0.655000|0.655000	0.94253|0.94253	GGG|GGG	.		0.413	FPGT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
FUT1	2523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	49253497	49253497	+	Nonsense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:49253497C>A	ENST00000310160.3	-	4	2016	c.1042G>T	c.(1042-1044)Gag>Tag	p.E348*	FUT1_ENST00000601931.1_5'Flank	NM_000148.3	NP_000139.1	P19526	FUT1_HUMAN	fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)	348			E -> K (in para-Bombay allele H5; dbSNP:rs56131151). {ECO:0000269|PubMed:9226185}.		carbohydrate metabolic process (GO:0005975)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(3)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000135)|all cancers(93;0.000354)|Epithelial(262;0.0191)|GBM - Glioblastoma multiforme(486;0.0222)		CCCACCCACTCGGGCAGGAAG	0.552																																					p.E348X		.											.	FUT1	227	0			c.G1042T	GRCh37	CM970544	FUT1	M	rs56131151	.																																			SO:0001587	stop_gained	2523	exon4			CCCACTCGGGCAG		CCDS12733.1	19q13.33	2014-07-19	2006-01-19		ENSG00000174951	ENSG00000174951	2.4.1.69	"""Blood group antigens"", ""Fucosyltransferases"""	4012	protein-coding gene	gene with protein product		211100	"""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, Bombay phenotype included)"", ""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase)"""	H, HSC			Standard	NM_000148		Approved		uc002pkk.3	P19526		ENST00000310160.3:c.1042G>T	19.37:g.49253497C>A	ENSP00000312021:p.Glu348*	21.0	0.0		47.0	18.0	NM_000148	O14505|O14506|O14507	Nonsense_Mutation	SNP	ENST00000310160.3	37	CCDS12733.1	.	.	.	.	.	.	.	.	.	.	C	45	11.366407	0.99551	.	.	ENSG00000174951	ENST00000310160;ENST00000539428	.	.	.	4.69	3.61	0.41365	.	0.202037	0.34652	N	0.003797	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-6.5371	12.6485	0.56748	0.0:0.8321:0.1679:0.0	.	.	.	.	X	348;338	.	ENSP00000312021:E348X	E	-	1	0	FUT1	53945309	0.690000	0.27699	0.860000	0.33809	0.708000	0.40852	1.042000	0.30303	1.290000	0.44636	0.561000	0.74099	GAG	.		0.552	FUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466194.1	NM_000148	
GABRG3	2567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	27271951	27271951	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr15:27271951G>T	ENST00000333743.6	+	3	507	c.253G>T	c.(253-255)Gtg>Ttg	p.V85L	GABRG3_ENST00000555083.1_Missense_Mutation_p.V85L	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	85					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CATTGGTCCTGTGTCATCAAT	0.378																																					p.V85L	NSCLC(114;800 1656 7410 37729 45293)	.											.	.	.	0			c.G253T						.						118.0	109.0	112.0					15																	27271951		1922	4149	6071	SO:0001583	missense	2567	exon3			GGTCCTGTGTCAT		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.253G>T	15.37:g.27271951G>T	ENSP00000331912:p.Val85Leu	143.0	0.0		150.0	50.0	NM_001270873	G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	37	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266090	0.59540	.	.	ENSG00000182256	ENST00000333743;ENST00000555083	D;D	0.82081	-1.57;-1.57	5.96	5.96	0.96718	Neurotransmitter-gated ion-channel ligand-binding (3);	0.079672	0.51477	D	0.000097	D	0.85323	0.5670	M	0.74467	2.265	0.53005	D	0.999966	B;P	0.35793	0.081;0.521	B;B	0.40410	0.1;0.328	D	0.86091	0.1550	10	0.87932	D	0	.	15.9083	0.79447	0.0:0.0:1.0:0.0	.	85;85	Q99928;G3V594	GBRG3_HUMAN;.	L	85	ENSP00000331912:V85L;ENSP00000452244:V85L	ENSP00000331912:V85L	V	+	1	0	GABRG3	24854697	1.000000	0.71417	0.989000	0.46669	0.657000	0.38888	7.057000	0.76669	2.814000	0.96858	0.655000	0.94253	GTG	.		0.378	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2		
GALNT3	2591	broad.mit.edu;mdanderson.org	37	2	166627194	166627194	+	Missense_Mutation	SNP	C	C	A	rs544219924		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:166627194C>A	ENST00000392701.3	-	2	792	c.17G>T	c.(16-18)cGa>cTa	p.R6L		NM_004482.3	NP_004473.2	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	6					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(1)	20						TTTTACTAGTCGCTTTAGGTG	0.289																																					p.R6L		.											.	GALNT3	92	0			c.G17T						.						41.0	46.0	44.0					2																	166627194		2059	4251	6310	SO:0001583	missense	2591	exon2			ACTAGTCGCTTTA		CCDS2226.1	2q24-q31	2014-03-13	2014-03-13		ENSG00000115339	ENSG00000115339	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4125	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 3"""	601756	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)"""			9592121, 15133511	Standard	NM_004482		Approved	GalNAc-T3, HHS, HFTC	uc010fph.1	Q14435	OTTHUMG00000132157	ENST00000392701.3:c.17G>T	2.37:g.166627194C>A	ENSP00000376465:p.Arg6Leu	9.0	0.0		23.0	14.0	NM_004482	Q53TG9|Q7Z476	Missense_Mutation	SNP	ENST00000392701.3	37	CCDS2226.1	.	.	.	.	.	.	.	.	.	.	C	1.954	-0.440569	0.04636	.	.	ENSG00000115339	ENST00000392701;ENST00000412248;ENST00000431484;ENST00000414977;ENST00000422973;ENST00000447156	T;T;T;T;D	0.91945	0.45;0.17;-1.1;-1.09;-2.94	5.8	4.85	0.62838	.	2.033500	0.02079	N	0.052216	D	0.83436	0.5254	N	0.08118	0	0.80722	D	1	B;B	0.14805	0.006;0.011	B;B	0.14578	0.008;0.011	T	0.74460	-0.3658	10	0.33940	T	0.23	.	3.4263	0.07412	0.2701:0.5144:0.1279:0.0876	.	6;6	Q14435;Q14435-2	GALT3_HUMAN;.	L	6	ENSP00000376465:R6L;ENSP00000412643:R6L;ENSP00000397112:R6L;ENSP00000413477:R6L;ENSP00000413694:R6L	ENSP00000376465:R6L	R	-	2	0	GALNT3	166335440	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	0.995000	0.29706	2.732000	0.93576	0.650000	0.86243	CGA	.		0.289	GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255205.2	NM_004482	
GATAD2A	54815	hgsc.bcm.edu;broad.mit.edu	37	19	19612809	19612809	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:19612809G>T	ENST00000360315.3	+	10	1844	c.1532G>T	c.(1531-1533)cGc>cTc	p.R511L	GATAD2A_ENST00000358713.3_Missense_Mutation_p.R511L|GATAD2A_ENST00000404158.1_Missense_Mutation_p.R512L|GATAD2A_ENST00000252577.5_Intron|GATAD2A_ENST00000429563.2_Intron|GATAD2A_ENST00000537887.1_Missense_Mutation_p.R140L	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	511					anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						TTGGCGTTCCGCTCAGGAGAG	0.667																																					p.R511L		.											.	GATAD2A	90	0			c.G1532T						.						59.0	61.0	60.0					19																	19612809		2203	4300	6503	SO:0001583	missense	54815	exon10			CGTTCCGCTCAGG	AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.1532G>T	19.37:g.19612809G>T	ENSP00000353463:p.Arg511Leu	27.0	0.0		36.0	5.0	NM_017660	B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Missense_Mutation	SNP	ENST00000360315.3	37	CCDS12402.2	.	.	.	.	.	.	.	.	.	.	G	10.40	1.340155	0.24339	.	.	ENSG00000167491	ENST00000360315;ENST00000537887;ENST00000404158;ENST00000358713	T;T	0.33216	1.42;1.42	4.78	3.72	0.42706	.	0.396523	0.27991	N	0.017026	T	0.19366	0.0465	N	0.25647	0.755	0.31349	N	0.682731	B;B	0.10296	0.003;0.001	B;B	0.08055	0.003;0.002	T	0.07083	-1.0791	10	0.27082	T	0.32	-23.8315	9.5191	0.39124	0.1046:0.0:0.8954:0.0	.	531;511	B5MC40;Q86YP4	.;P66A_HUMAN	L	511;140;531;511	ENSP00000353463:R511L;ENSP00000351552:R511L	ENSP00000351552:R511L	R	+	2	0	GATAD2A	19473809	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.859000	0.48364	2.370000	0.80446	0.585000	0.79938	CGC	.		0.667	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326671.4	NM_017660	
GCN1L1	10985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	120594723	120594723	+	Missense_Mutation	SNP	C	C	T	rs201424442		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr12:120594723C>T	ENST00000300648.6	-	27	3173	c.3161G>A	c.(3160-3162)cGc>cAc	p.R1054H	MIR4498_ENST00000577599.1_RNA	NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1054					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CACCTGTAAGCGAGGCGAGCC	0.562													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19196	0.0		0.0	False		,,,				2504	0.0				p.R1054H		.											.	GCN1L1	94	0			c.G3161A						.	C	HIS/ARG	0,4226		0,0,2113	61.0	70.0	67.0		3161	2.7	1.0	12		67	1,8421		0,1,4210	yes	missense	GCN1L1	NM_006836.1	29	0,1,6323	TT,TC,CC		0.0119,0.0,0.0079	possibly-damaging	1054/2672	120594723	1,12647	2113	4211	6324	SO:0001583	missense	10985	exon27			TGTAAGCGAGGCG	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.3161G>A	12.37:g.120594723C>T	ENSP00000300648:p.Arg1054His	34.0	0.0		32.0	10.0	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611391	0.87258	0.0	1.19E-4	ENSG00000089154	ENST00000300648	T	0.37411	1.2	5.52	2.73	0.32206	Armadillo-like helical (1);Armadillo-type fold (1);	0.120029	0.64402	N	0.000015	T	0.37812	0.1017	L	0.49350	1.555	0.80722	D	1	D	0.65815	0.995	P	0.50934	0.654	T	0.08868	-1.0701	10	0.39692	T	0.17	.	8.6118	0.33806	0.0:0.71:0.0:0.29	.	1054	Q92616	GCN1L_HUMAN	H	1054	ENSP00000300648:R1054H	ENSP00000300648:R1054H	R	-	2	0	GCN1L1	119079106	1.000000	0.71417	0.992000	0.48379	0.877000	0.50540	2.516000	0.45520	0.695000	0.31675	0.591000	0.81541	CGC	.		0.562	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
GIMAP6	474344	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	150327197	150327197	+	Nonsense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:150327197C>A	ENST00000328902.5	-	2	250	c.34G>T	c.(34-36)Gag>Tag	p.E12*	GIMAP6_ENST00000493969.1_Nonsense_Mutation_p.E12*	NM_001244072.1|NM_024711.5	NP_001231001.1|NP_078987.3	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	12						cytosol (GO:0005829)	GTP binding (GO:0005525)			endometrium(4)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGGGGATTCTCCTGGGGAATT	0.423																																					p.E12X		.											.	GIMAP6	93	0			c.G34T						.						137.0	141.0	140.0					7																	150327197		2203	4300	6503	SO:0001587	stop_gained	474344	exon2			GATTCTCCTGGGG	AK026343	CCDS34778.1, CCDS59087.1, CCDS75676.1	7q36.1	2014-04-04			ENSG00000133561	ENSG00000133561		"""GTPases, IMAP"""	21918	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 6"""					15474311	Standard	NM_001244072		Approved	FLJ22690, IAN6	uc022apv.1	Q6P9H5	OTTHUMG00000159137	ENST00000328902.5:c.34G>T	7.37:g.150327197C>A	ENSP00000330374:p.Glu12*	45.0	0.0		106.0	11.0	NM_001244072	C9J7B6|D3DWZ4|Q5ZPR6|Q9H612	Nonsense_Mutation	SNP	ENST00000328902.5	37	CCDS34778.1	.	.	.	.	.	.	.	.	.	.	c	15.28	2.786960	0.49997	.	.	ENSG00000133561	ENST00000328902;ENST00000477013;ENST00000493969	.	.	.	2.69	0.803	0.18691	.	.	.	.	.	.	.	.	.	.	.	0.52099	D	0.999947	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	4.4641	0.11680	0.0:0.6578:0.0:0.3422	.	.	.	.	X	12	.	ENSP00000330374:E12X	E	-	1	0	GIMAP6	149958130	0.003000	0.15002	0.006000	0.13384	0.001000	0.01503	0.307000	0.19296	0.221000	0.20879	-0.265000	0.10407	GAG	.		0.423	GIMAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353457.1	NM_024711	
GNAS	2778	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	20	57428390	57428390	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr20:57428390G>A	ENST00000371100.4	+	1	622	c.70G>A	c.(70-72)Gaa>Aaa	p.E24K	GNAS_ENST00000306120.3_5'Flank|GNAS_ENST00000371102.4_Missense_Mutation_p.E24K|GNAS_ENST00000313949.7_Intron|GNAS-AS1_ENST00000424094.2_RNA|GNAS_ENST00000464624.2_3'UTR|GNAS-AS1_ENST00000598163.1_RNA|GNAS_ENST00000371099.2_Missense_Mutation_p.E24K|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000371098.2_Intron	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			TGAAATCGGGGAACAGCCCGA	0.602			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.E24K	Colon(117;935 1597 6045 8307 46442)	.		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	.	GNAS	4767	0			c.G70A						.						22.0	26.0	25.0					20																	57428390		692	1591	2283	SO:0001583	missense	2778	exon1			ATCGGGGAACAGC	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371100.4:c.70G>A	20.37:g.57428390G>A	ENSP00000360141:p.Glu24Lys	68.0	0.0		126.0	11.0	NM_080425	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371100.4	37	CCDS46622.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.752578	0.49362	.	.	ENSG00000087460	ENST00000371099;ENST00000371100;ENST00000371102	D;D	0.90900	-2.75;-2.74	4.36	2.21	0.28008	.	.	.	.	.	D	0.86410	0.5926	L	0.57536	1.79	0.80722	D	1	P	0.43024	0.798	B	0.36289	0.221	D	0.84091	0.0390	9	0.72032	D	0.01	.	10.7614	0.46266	0.0:0.3739:0.6261:0.0	.	24	Q5JWF2	GNAS1_HUMAN	K	24	ENSP00000360141:E24K;ENSP00000360143:E24K	ENSP00000360140:E24K	E	+	1	0	GNAS	56861785	0.656000	0.27385	0.682000	0.30024	0.865000	0.49528	0.783000	0.26802	0.455000	0.26910	0.563000	0.77884	GAA	.		0.602	GNAS-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080417.3	NM_000516	
GOLGB1	2804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121413069	121413069	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:121413069C>A	ENST00000340645.5	-	13	6411	c.6286G>T	c.(6286-6288)Gca>Tca	p.A2096S	GOLGB1_ENST00000393667.3_Missense_Mutation_p.A2101S	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2096					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		AGATTGTCTGCTAGGACCCTT	0.418																																					p.A2101S		.											.	GOLGB1	161	0			c.G6301T						.						148.0	150.0	149.0					3																	121413069		2203	4300	6503	SO:0001583	missense	2804	exon13			TGTCTGCTAGGAC	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.6286G>T	3.37:g.121413069C>A	ENSP00000341848:p.Ala2096Ser	42.0	0.0		67.0	9.0	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.981711	0.53827	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.17370	2.28;2.28	5.93	5.93	0.95920	.	0.000000	0.64402	D	0.000012	T	0.40767	0.1130	M	0.75264	2.295	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.999;0.99	T	0.13818	-1.0495	10	0.09843	T	0.71	.	17.8272	0.88669	0.0:1.0:0.0:0.0	.	2021;2101;2101;2096	F1T0J2;E7EP74;B2ZZ91;Q14789	.;.;.;GOGB1_HUMAN	S	2096;2101	ENSP00000341848:A2096S;ENSP00000377275:A2101S	ENSP00000341848:A2096S	A	-	1	0	GOLGB1	122895759	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.841000	0.55850	2.818000	0.97014	0.591000	0.81541	GCA	.		0.418	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
GPR158	57512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	25464991	25464991	+	Silent	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr10:25464991C>T	ENST00000376351.3	+	1	1001	c.642C>T	c.(640-642)gcC>gcT	p.A214A	GPR158-AS1_ENST00000449643.1_RNA	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	214					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						CCCACCTGGCCAACGCCACTC	0.711																																					p.A214A		.											.	GPR158	141	0			c.C642T						.						20.0	19.0	19.0					10																	25464991		2199	4298	6497	SO:0001819	synonymous_variant	57512	exon1			CCTGGCCAACGCC	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.642C>T	10.37:g.25464991C>T		34.0	0.0		46.0	23.0	NM_020752	Q6QR81|Q9ULT3	Silent	SNP	ENST00000376351.3	37	CCDS31166.1																																																																																			.		0.711	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110	
GPRIN1	114787	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176025588	176025588	+	Silent	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr5:176025588C>T	ENST00000303991.4	-	2	1425	c.1248G>A	c.(1246-1248)gtG>gtA	p.V416V		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	416					neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAACTGGATCCACCTTGCCTG	0.532																																					p.V416V		.											.	GPRIN1	92	0			c.G1248A						.						67.0	61.0	63.0					5																	176025588		2203	4300	6503	SO:0001819	synonymous_variant	114787	exon2			TGGATCCACCTTG	AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.1248G>A	5.37:g.176025588C>T		63.0	0.0		81.0	27.0	NM_052899	C9JM70|Q8ND74|Q96PZ4	Silent	SNP	ENST00000303991.4	37	CCDS4405.1																																																																																			.		0.532	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253149.1	NM_052899	
HBP1	26959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	106820464	106820464	+	Silent	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:106820464A>G	ENST00000222574.4	+	2	312	c.126A>G	c.(124-126)ccA>ccG	p.P42P	HBP1_ENST00000468410.1_Silent_p.P42P|HBP1_ENST00000485846.1_Silent_p.P42P	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	42					cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						AGAATTTGCCATCTTCACCTG	0.378																																					p.P52P		.											.	HBP1	91	0			c.A156G						.						144.0	139.0	141.0					7																	106820464		2203	4300	6503	SO:0001819	synonymous_variant	26959	exon2			TTTGCCATCTTCA	BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.126A>G	7.37:g.106820464A>G		85.0	0.0		120.0	31.0	NM_001244262	B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Silent	SNP	ENST00000222574.4	37	CCDS5741.1																																																																																			.		0.378	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349297.1	NM_012257	
HELZ	9931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	65144766	65144766	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr17:65144766C>T	ENST00000358691.5	-	20	2706	c.2540G>A	c.(2539-2541)cGa>cAa	p.R847Q	HELZ_ENST00000580168.1_Missense_Mutation_p.R848Q	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	847						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					CTCATAGAGTCGGTCAAGTAA	0.458																																					p.R847Q		.											.	HELZ	92	0			c.G2540A						.						232.0	227.0	229.0					17																	65144766		1898	4114	6012	SO:0001583	missense	9931	exon20			TAGAGTCGGTCAA	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.2540G>A	17.37:g.65144766C>T	ENSP00000351524:p.Arg847Gln	35.0	0.0		84.0	55.0	NM_014877	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.788606	0.70337	.	.	ENSG00000198265	ENST00000358691	D	0.94793	-3.52	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.98432	0.9478	H	0.96720	3.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99047	1.0826	10	0.87932	D	0	-12.4353	20.0585	0.97663	0.0:1.0:0.0:0.0	.	848;847	B7ZLW2;P42694	.;HELZ_HUMAN	Q	847	ENSP00000351524:R847Q	ENSP00000351524:R847Q	R	-	2	0	HELZ	62575228	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.046000	0.76592	2.812000	0.96745	0.557000	0.71058	CGA	.		0.458	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
HERC2	8924	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	28422626	28422626	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr15:28422626C>A	ENST00000261609.7	-	60	9301	c.9193G>T	c.(9193-9195)Gat>Tat	p.D3065Y		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ACTTTTCCATCGACAGTTAAA	0.483																																					p.D3065Y		.											.	HERC2	234	0			c.G9193T						.						90.0	79.0	83.0					15																	28422626		2203	4300	6503	SO:0001583	missense	8924	exon60			TTCCATCGACAGT	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.9193G>T	15.37:g.28422626C>A	ENSP00000261609:p.Asp3065Tyr	60.0	0.0		109.0	30.0	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.871615	0.91587	.	.	ENSG00000128731	ENST00000261609	D	0.89196	-2.48	5.79	5.79	0.91817	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.96150	0.8745	M	0.92923	3.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96468	0.9346	10	0.87932	D	0	.	20.0366	0.97561	0.0:1.0:0.0:0.0	.	3065	O95714	HERC2_HUMAN	Y	3065	ENSP00000261609:D3065Y	ENSP00000261609:D3065Y	D	-	1	0	HERC2	26096221	1.000000	0.71417	0.948000	0.38648	0.747000	0.42532	7.642000	0.83385	2.736000	0.93811	0.561000	0.74099	GAT	.		0.483	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
HGF	3082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	81374398	81374398	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:81374398G>T	ENST00000222390.5	-	6	890	c.664C>A	c.(664-666)Ctc>Atc	p.L222I	HGF_ENST00000444829.2_Missense_Mutation_p.L222I|HGF_ENST00000453411.1_Missense_Mutation_p.L217I|HGF_ENST00000457544.2_Missense_Mutation_p.L217I	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	222	Kringle 2. {ECO:0000255|PROSITE- ProRule:PRU00121}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						TGATCCATGAGACCTCGATAA	0.393																																					p.L222I		.											.	HGF	516	0			c.C664A						.						93.0	87.0	89.0					7																	81374398		2203	4300	6503	SO:0001583	missense	3082	exon6			CCATGAGACCTCG		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.664C>A	7.37:g.81374398G>T	ENSP00000222390:p.Leu222Ile	35.0	0.0		59.0	11.0	NM_000601	A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Missense_Mutation	SNP	ENST00000222390.5	37	CCDS5597.1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.363000	0.61403	.	.	ENSG00000019991	ENST00000222390;ENST00000457544;ENST00000444829;ENST00000453411;ENST00000394769	T;T;T;T	0.62498	0.02;0.02;0.02;0.02	4.73	4.73	0.59995	Kringle (4);Kringle-like fold (1);	0.099613	0.64402	D	0.000001	T	0.41650	0.1168	N	0.03050	-0.425	0.80722	D	1	B;B;B;B	0.10296	0.0;0.001;0.001;0.003	B;B;B;B	0.22152	0.038;0.029;0.022;0.037	T	0.29792	-1.0000	10	0.33940	T	0.23	.	18.2555	0.90019	0.0:0.0:1.0:0.0	.	217;222;217;222	P14210-5;P14210-2;P14210-3;P14210	.;.;.;HGF_HUMAN	I	222;217;222;217;222	ENSP00000222390:L222I;ENSP00000391238:L217I;ENSP00000389854:L222I;ENSP00000408270:L217I	ENSP00000222390:L222I	L	-	1	0	HGF	81212334	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.772000	0.91757	2.609000	0.88269	0.655000	0.94253	CTC	.		0.393	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601	
HHEX	3087	broad.mit.edu;mdanderson.org	37	10	94450055	94450055	+	Silent	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr10:94450055G>T	ENST00000282728.5	+	1	2111	c.312G>T	c.(310-312)ccG>ccT	p.P104P	HHEX_ENST00000472590.2_5'Flank|HHEX_ENST00000492654.2_5'Flank	NM_002729.4	NP_002720.1	Q03014	HHEX_HUMAN	hematopoietically expressed homeobox	104	Pro-rich.				anterior/posterior pattern specification (GO:0009952)|B cell differentiation (GO:0030183)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|DNA conformation change (GO:0071103)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|forebrain morphogenesis (GO:0048853)|gall bladder development (GO:0061010)|hepatic duct development (GO:0061011)|hepatoblast differentiation (GO:0061017)|hepatocyte differentiation (GO:0070365)|in utero embryonic development (GO:0001701)|interkinetic nuclear migration (GO:0022027)|mRNA export from nucleus (GO:0006406)|multicellular organism growth (GO:0035264)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|pancreas development (GO:0031016)|poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|primary lung bud formation (GO:0060431)|primitive streak formation (GO:0090009)|protein localization to nucleus (GO:0034504)|regulation of cell proliferation (GO:0042127)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|eukaryotic initiation factor 4E binding (GO:0008190)|protein homodimerization activity (GO:0042803)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			kidney(2)|large_intestine(2)|lung(5)|ovary(1)	10						ACCCCTTCCCGCGGACGGTGA	0.746																																					p.P104P		.											.	HHEX	227	0			c.G312T						.						6.0	7.0	7.0					10																	94450055		2046	4030	6076	SO:0001819	synonymous_variant	3087	exon1			CTTCCCGCGGACG	Z21533	CCDS7423.1	10q23.33	2011-06-20	2007-02-15		ENSG00000152804	ENSG00000152804		"""Homeoboxes / ANTP class : NKL subclass"""	4901	protein-coding gene	gene with protein product		604420		PRHX		8096636, 8103988	Standard	NM_002729		Approved	HEX, HOX11L-PEN	uc001kid.3	Q03014	OTTHUMG00000018762	ENST00000282728.5:c.312G>T	10.37:g.94450055G>T		62.0	0.0		88.0	12.0	NM_002729	B1AQ17|Q96CE9	Silent	SNP	ENST00000282728.5	37	CCDS7423.1																																																																																			.		0.746	HHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049402.2		
HIST1H1C	3006	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26056379	26056379	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr6:26056379A>G	ENST00000343677.2	-	1	320	c.278T>C	c.(277-279)cTg>cCg	p.L93P		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	93	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						CGTTTGCACCAGAGTGCCCTT	0.547																																					p.L93P		.											.	HIST1H1C	231	0			c.T278C						.						109.0	114.0	113.0					6																	26056379		2203	4300	6503	SO:0001583	missense	3006	exon1			TGCACCAGAGTGC	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.278T>C	6.37:g.26056379A>G	ENSP00000339566:p.Leu93Pro	65.0	0.0		129.0	60.0	NM_005319	A8K4I2	Missense_Mutation	SNP	ENST00000343677.2	37	CCDS4577.1	.	.	.	.	.	.	.	.	.	.	A	18.63	3.665582	0.67700	.	.	ENSG00000187837	ENST00000343677	T	0.56444	0.46	5.63	5.63	0.86233	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.64402	D	0.000002	T	0.79776	0.4504	H	0.99197	4.465	0.80722	D	1	P	0.50943	0.94	P	0.59643	0.861	D	0.88061	0.2794	10	0.87932	D	0	-12.168	15.3144	0.74062	1.0:0.0:0.0:0.0	.	93	P16403	H12_HUMAN	P	93	ENSP00000339566:L93P	ENSP00000339566:L93P	L	-	2	0	HIST1H1C	26164358	1.000000	0.71417	1.000000	0.80357	0.266000	0.26442	9.082000	0.94059	2.271000	0.75665	0.533000	0.62120	CTG	.		0.547	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319	
HNRNPH2	3188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	100668006	100668006	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chrX:100668006G>T	ENST00000316594.5	+	2	1108	c.1030G>T	c.(1030-1032)Gct>Tct	p.A344S		NM_001032393.2|NM_001199973.1|NM_001199974.1|NM_019597.4	NP_001027565.1|NP_001186902.1|NP_001186903.1|NP_062543.1	P55795	HNRH2_HUMAN	heterogeneous nuclear ribonucleoprotein H2 (H')	344	2 X 16 AA Gly-rich approximate repeats.|RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|large_intestine(2)|lung(6)|skin(1)	12						TGCTGTGGCAGCTATGGCAAA	0.438																																					p.A344S		.											.	HNRNPH2	130	0			c.G1030T						.						111.0	99.0	103.0					X																	100668006		2203	4300	6503	SO:0001583	missense	3188	exon2			GTGGCAGCTATGG	U01923	CCDS14485.1	Xq22	2013-02-12		2008-04-18	ENSG00000126945	ENSG00000126945		"""RNA binding motif (RRM) containing"""	5042	protein-coding gene	gene with protein product		300610		HNRPH2		7499401	Standard	NM_019597		Approved	hnRNPH', FTP3, HNRPH'	uc004ehn.3	P55795	OTTHUMG00000022029	ENST00000316594.5:c.1030G>T	X.37:g.100668006G>T	ENSP00000361927:p.Ala344Ser	75.0	0.0		111.0	45.0	NM_001032393	A1L400|Q9HHA7	Missense_Mutation	SNP	ENST00000316594.5	37	CCDS14485.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.512140	0.64522	.	.	ENSG00000126945	ENST00000457902;ENST00000316594	T	0.59906	0.23	4.62	4.62	0.57501	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.79034	0.4378	M	0.93720	3.45	0.80722	D	1	B	0.24426	0.103	P	0.46796	0.527	T	0.82074	-0.0637	10	0.87932	D	0	-18.5968	14.0571	0.64776	0.0:0.0:1.0:0.0	.	344	P55795	HNRH2_HUMAN	S	299;344	ENSP00000361927:A344S	ENSP00000361927:A344S	A	+	1	0	HNRNPH2	100554662	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.562000	0.98145	2.281000	0.76405	0.513000	0.50165	GCT	.		0.438	HNRNPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057556.1	NM_019597	
HYOU1	10525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118922612	118922612	+	Silent	SNP	T	T	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr11:118922612T>A	ENST00000404233.3	-	12	1381	c.1257A>T	c.(1255-1257)gcA>gcT	p.A419A	HYOU1_ENST00000543287.1_Silent_p.A332A|HYOU1_ENST00000525859.1_Silent_p.A419A|HYOU1_ENST00000529972.1_Silent_p.A419A	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	419					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		CCTGGTACACTGCCCCCATGG	0.582																																					p.A419A		.											.	HYOU1	90	0			c.A1257T						.						87.0	83.0	84.0					11																	118922612		2200	4295	6495	SO:0001819	synonymous_variant	10525	exon12			GTACACTGCCCCC	U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.1257A>T	11.37:g.118922612T>A		64.0	0.0		104.0	33.0	NM_006389	A8C1Z0|B7Z909|Q2I204|Q53H25	Silent	SNP	ENST00000404233.3	37	CCDS8408.1																																																																																			.		0.582	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389353.1	NM_006389	
IFNA8	3445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	21409382	21409382	+	Silent	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr9:21409382A>G	ENST00000380205.1	+	1	237	c.207A>G	c.(205-207)aaA>aaG	p.K69K		NM_002170.3	NP_002161.2	P32881	IFNA8_HUMAN	interferon, alpha 8	69					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	9				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0174)		TTGATGATAAACAGTTCCAGA	0.488																																					p.K69K		.											.	IFNA8	90	0			c.A207G						.						94.0	91.0	92.0					9																	21409382		2203	4300	6503	SO:0001819	synonymous_variant	3445	exon1			TGATAAACAGTTC		CCDS6507.1	9p22	2010-08-24			ENSG00000120242	ENSG00000120242		"""Interferons"""	5429	protein-coding gene	gene with protein product	"""interferon alpha-B''"", ""interferon alpha type 201"""	147568				1385305	Standard	NM_002170		Approved	IFN-alphaB	uc003zpc.1	P32881	OTTHUMG00000019677	ENST00000380205.1:c.207A>G	9.37:g.21409382A>G		70.0	0.0		73.0	38.0	NM_002170	P01565|P09236|Q5VWV7|Q5VYQ3	Silent	SNP	ENST00000380205.1	37	CCDS6507.1																																																																																			.		0.488	IFNA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051906.1	NM_002170	
IL18	3606	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	112014513	112014513	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr11:112014513C>T	ENST00000280357.7	-	6	607	c.388G>A	c.(388-390)Gat>Aat	p.D130N	IL18_ENST00000533858.1_5'UTR|SDHD_ENST00000532699.1_Intron|IL18_ENST00000528832.1_Missense_Mutation_p.D130N|IL18_ENST00000524595.1_Missense_Mutation_p.D126N	NM_001562.3	NP_001553.1	Q14116	IL18_HUMAN	interleukin 18	130					angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|cellular response to organic cyclic compound (GO:0071407)|chemokine biosynthetic process (GO:0042033)|granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0042253)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma biosynthetic process (GO:0042095)|interleukin-13 biosynthetic process (GO:0042231)|interleukin-2 biosynthetic process (GO:0042094)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|natural killer cell activation (GO:0030101)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of tissue remodeling (GO:0034105)|regulation of cell adhesion (GO:0030155)|sleep (GO:0030431)|T-helper 1 type immune response (GO:0042088)|type 2 immune response (GO:0042092)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)						all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|Epithelial(105;8.15e-07)|all cancers(92;1.43e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.055)		CTTTTTGTATCCTTGATGTTA	0.313																																					p.D130N		.											.	IL18	90	0			c.G388A						.						71.0	67.0	68.0					11																	112014513		1826	4074	5900	SO:0001583	missense	3606	exon6			TTGTATCCTTGAT	U90434	CCDS44731.1, CCDS58180.1	11q22.2-q22.3	2014-04-04	2014-04-04		ENSG00000150782	ENSG00000150782		"""Interleukins and interleukin receptors"""	5986	protein-coding gene	gene with protein product	"""interferon-gamma-inducing factor"""	600953	"""interleukin 18 (interferon-gamma-inducing factor)"""			7477296, 9693051	Standard	NM_001562		Approved	IGIF, IL1F4, IL-1g, IL-18	uc001pnb.2	Q14116	OTTHUMG00000167006	ENST00000280357.7:c.388G>A	11.37:g.112014513C>T	ENSP00000280357:p.Asp130Asn	60.0	0.0		81.0	44.0	NM_001562	O75599|Q6FGY3|Q6WWJ7	Missense_Mutation	SNP	ENST00000280357.7	37	CCDS44731.1	.	.	.	.	.	.	.	.	.	.	C	9.727	1.161296	0.21538	.	.	ENSG00000150782	ENST00000280357;ENST00000524595;ENST00000528832	T;T;T	0.16457	2.34;2.34;2.34	5.09	2.09	0.27110	.	0.685512	0.13612	N	0.375097	T	0.13030	0.0316	L	0.49126	1.545	0.09310	N	1	B;B;B	0.14012	0.003;0.002;0.009	B;B;B	0.22601	0.013;0.013;0.04	T	0.38308	-0.9667	10	0.11485	T	0.65	-15.9847	4.6568	0.12622	0.172:0.6441:0.0:0.1838	.	126;130;130	Q6WWJ7;Q14116;Q96KJ8	.;IL18_HUMAN;.	N	130;126;130	ENSP00000280357:D130N;ENSP00000434561:D126N;ENSP00000434161:D130N	ENSP00000280357:D130N	D	-	1	0	IL18	111519723	0.001000	0.12720	0.007000	0.13788	0.004000	0.04260	0.635000	0.24629	0.738000	0.32606	0.655000	0.94253	GAT	.		0.313	IL18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392409.1	NM_001562	
IL4R	3566	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	27374563	27374563	+	Silent	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr16:27374563G>T	ENST00000395762.2	+	11	2149	c.1890G>T	c.(1888-1890)ggG>ggT	p.G630G	IL4R_ENST00000170630.2_Silent_p.G630G|IL4R_ENST00000543915.2_Silent_p.G630G|IL4R_ENST00000380922.3_Silent_p.G615G	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	630	Required for IL4-induced gene expression.				defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						GGGAAGAGGGGTATAAGCCTT	0.602																																					p.G630G		.											.	IL4R	227	0			c.G1890T						.						60.0	58.0	59.0					16																	27374563		2197	4300	6497	SO:0001819	synonymous_variant	3566	exon11			AGAGGGGTATAAG	X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.1890G>T	16.37:g.27374563G>T		24.0	1.0		23.0	5.0	NM_000418	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Silent	SNP	ENST00000395762.2	37	CCDS10629.1																																																																																			.		0.602	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4		
IPO13	9670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	44422488	44422488	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:44422488A>T	ENST00000372343.3	+	5	1773	c.1111A>T	c.(1111-1113)Att>Ttt	p.I371F	IPO13_ENST00000492152.1_3'UTR	NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13	371					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				TCAGGATGATATTCTATCCTT	0.542																																					p.I371F		.											.	IPO13	226	0			c.A1111T						.						83.0	82.0	82.0					1																	44422488		2203	4300	6503	SO:0001583	missense	9670	exon5			GATGATATTCTAT	AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.1111A>T	1.37:g.44422488A>T	ENSP00000361418:p.Ile371Phe	31.0	0.0		38.0	19.0	NM_014652	D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Missense_Mutation	SNP	ENST00000372343.3	37	CCDS503.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.842889	0.51057	.	.	ENSG00000117408	ENST00000372343	T	0.67345	-0.26	5.82	5.82	0.92795	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.60753	0.2293	L	0.44542	1.39	0.80722	D	1	P	0.42357	0.777	B	0.38500	0.275	T	0.63915	-0.6529	10	0.48119	T	0.1	-14.9255	16.1778	0.81874	1.0:0.0:0.0:0.0	.	371	O94829	IPO13_HUMAN	F	371	ENSP00000361418:I371F	ENSP00000361418:I371F	I	+	1	0	IPO13	44195075	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.970000	0.93415	2.225000	0.72522	0.459000	0.35465	ATT	.		0.542	IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022846.1	NM_014652	
KIAA0825	285600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	93775731	93775731	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr5:93775731A>T	ENST00000513200.3	-	13	2525	c.2453T>A	c.(2452-2454)cTg>cAg	p.L818Q	KIAA0825_ENST00000312498.7_Missense_Mutation_p.L818Q|KIAA0825_ENST00000427991.2_Missense_Mutation_p.L818Q	NM_001145678.1	NP_001139150.1	Q8IV33	K0825_HUMAN	KIAA0825	818										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						ATCATGATGCAGTAGGGTTTC	0.453																																					p.L818Q		.											.	KIAA0825	91	0			c.T2453A						.						156.0	135.0	141.0					5																	93775731		692	1591	2283	SO:0001583	missense	285600	exon14			TGATGCAGTAGGG	BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000513200.3:c.2453T>A	5.37:g.93775731A>T	ENSP00000424618:p.Leu818Gln	231.0	0.0		326.0	104.0	NM_001145678	O94914|Q6ZNN2	Missense_Mutation	SNP	ENST00000513200.3	37		.	.	.	.	.	.	.	.	.	.	A	18.22	3.575530	0.65878	.	.	ENSG00000185261	ENST00000513200;ENST00000427991;ENST00000312498	T;T;T	0.56444	0.46;0.46;0.47	5.55	5.55	0.83447	.	0.000000	0.50627	D	0.000101	T	0.71178	0.3309	M	0.68952	2.095	0.48341	D	0.999634	D	0.89917	1.0	D	0.91635	0.999	T	0.74659	-0.3591	10	0.87932	D	0	.	15.7041	0.77563	1.0:0.0:0.0:0.0	.	818	Q8IV33	K0825_HUMAN	Q	818	ENSP00000424618:L818Q;ENSP00000400288:L818Q;ENSP00000312205:L818Q	ENSP00000312205:L818Q	L	-	2	0	KIAA0825	93801487	1.000000	0.71417	0.453000	0.27007	0.814000	0.46013	7.077000	0.76814	2.105000	0.64084	0.383000	0.25322	CTG	.		0.453	KIAA0825-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000254102.5	NM_173665	
KCTD16	57528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	143586687	143586687	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr5:143586687G>A	ENST00000507359.3	+	2	1501	c.410G>A	c.(409-411)aGt>aAt	p.S137N	KCTD16_ENST00000512467.1_Missense_Mutation_p.S137N	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	137					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			TTCTGCCACAGTGACTTTGAA	0.527																																					p.S137N		.											.	KCTD16	137	0			c.G410A						.						83.0	88.0	87.0					5																	143586687		2203	4300	6503	SO:0001583	missense	57528	exon3			GCCACAGTGACTT	AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.410G>A	5.37:g.143586687G>A	ENSP00000426548:p.Ser137Asn	40.0	0.0		60.0	10.0	NM_020768	Q9P2M9	Missense_Mutation	SNP	ENST00000507359.3	37	CCDS34260.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.527374	0.85706	.	.	ENSG00000183775	ENST00000512467;ENST00000507359	T;T	0.49720	0.77;0.77	5.75	5.75	0.90469	BTB/POZ fold (1);	0.000000	0.85682	D	0.000000	T	0.62804	0.2458	M	0.77313	2.365	0.58432	D	0.999999	D	0.59767	0.986	P	0.50825	0.651	T	0.65492	-0.6155	10	0.51188	T	0.08	.	19.942	0.97168	0.0:0.0:1.0:0.0	.	137	Q68DU8	KCD16_HUMAN	N	137	ENSP00000424151:S137N;ENSP00000426548:S137N	ENSP00000426548:S137N	S	+	2	0	KCTD16	143566880	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.807000	0.99171	2.714000	0.92807	0.561000	0.74099	AGT	.		0.527	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3	XM_098368	
KLHDC9	126823	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	161068351	161068351	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:161068351G>T	ENST00000368011.4	+	1	168	c.26G>T	c.(25-27)cGg>cTg	p.R9L	KLHDC9_ENST00000490724.2_Intron|PFDN2_ENST00000468311.1_5'Flank|KLHDC9_ENST00000392192.2_Missense_Mutation_p.R9L	NM_152366.4	NP_689579.3	Q8NEP7	KLDC9_HUMAN	kelch domain containing 9	9										lung(5)|upper_aerodigestive_tract(1)	6	all_cancers(52;1.28e-19)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			CCCCCGGGTCGGGCCGCAGGC	0.706																																					p.R9L		.											.	KLHDC9	22	0			c.G26T						.						8.0	9.0	9.0					1																	161068351		2171	4230	6401	SO:0001583	missense	126823	exon1			CGGGTCGGGCCGC	BC022077	CCDS30919.1, CCDS41425.1	1q23.3	2008-02-05			ENSG00000162755	ENSG00000162755			28489	protein-coding gene	gene with protein product	"""kelch/ankyrin repeat containing cyclin A1 interacting protein"""					15159402	Standard	NM_152366		Approved	KARCA1	uc001fxr.3	Q8NEP7	OTTHUMG00000031479	ENST00000368011.4:c.26G>T	1.37:g.161068351G>T	ENSP00000356990:p.Arg9Leu	62.0	0.0		125.0	29.0	NM_001007255	Q5SY56|Q6NXT9|Q6PKN4|Q8N5E1|Q8NA16	Missense_Mutation	SNP	ENST00000368011.4	37	CCDS30919.1	.	.	.	.	.	.	.	.	.	.	G	11.48	1.651183	0.29336	.	.	ENSG00000162755	ENST00000368011;ENST00000392192	T;T	0.54071	1.79;0.59	3.28	0.271	0.15640	.	1.195530	0.06431	N	0.724182	T	0.12944	0.0314	N	0.14661	0.345	0.09310	N	1	B;B	0.23937	0.094;0.029	B;B	0.20767	0.031;0.008	T	0.21895	-1.0232	10	0.40728	T	0.16	-23.1162	3.3909	0.07289	0.2529:0.219:0.5281:0.0	.	9;9	Q8NEP7-2;Q8NEP7	.;KLDC9_HUMAN	L	9	ENSP00000356990:R9L;ENSP00000376030:R9L	ENSP00000356990:R9L	R	+	2	0	KLHDC9	159334975	0.000000	0.05858	0.001000	0.08648	0.744000	0.42396	-0.004000	0.12878	0.054000	0.16065	0.313000	0.20887	CGG	.		0.706	KLHDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077092.1	NM_152366	
KIF26B	55083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	245849630	245849630	+	Silent	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:245849630T>C	ENST00000407071.2	+	12	3785	c.3345T>C	c.(3343-3345)tcT>tcC	p.S1115S	KIF26B_ENST00000366518.4_Silent_p.S734S	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1115					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GCGTGGCGTCTAGGGAGTCCT	0.627																																					p.S1115S		.											.	KIF26B	25	0			c.T3345C						.						69.0	77.0	74.0					1																	245849630		1942	4141	6083	SO:0001819	synonymous_variant	55083	exon12			GGCGTCTAGGGAG	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.3345T>C	1.37:g.245849630T>C		68.0	0.0		98.0	29.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Silent	SNP	ENST00000407071.2	37	CCDS44342.1																																																																																			.		0.627	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
KRTAP29-1	100533177	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	17	39458187	39458187	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr17:39458187G>C	ENST00000391353.1	-	1	916	c.917C>G	c.(916-918)gCt>gGt	p.A306G		NM_001257309.1	NP_001244238.1	A8MX34	KR291_HUMAN	keratin associated protein 29-1	306	7 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)											CACACAGCAAGCTGATTTGCA	0.502																																					p.A306G		.											.	.	.	0			c.C917G						.																																			SO:0001583	missense	100533177	exon1			CAGCAAGCTGATT		CCDS62183.1	17q21.2	2013-06-20			ENSG00000212658	ENSG00000212658		"""Keratin associated proteins"""	34211	protein-coding gene	gene with protein product							Standard	NM_001257309		Approved	KAP29.2	uc031rai.1	A8MX34	OTTHUMG00000133662	ENST00000391353.1:c.917C>G	17.37:g.39458187G>C	ENSP00000375148:p.Ala306Gly	86.0	0.0		62.0	28.0	NM_001257309		Missense_Mutation	SNP	ENST00000391353.1	37		.	.	.	.	.	.	.	.	.	.	G	12.72	2.023021	0.35701	.	.	ENSG00000212658	ENST00000391353	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	T	0.54935	0.1889	.	.	.	.	.	.	.	.	.	.	.	.	T	0.64322	-0.6435	4	0.33940	T	0.23	.	10.936	0.47245	0.0:0.0:0.8127:0.1873	.	.	.	.	G	306	.	ENSP00000375148:A306G	A	-	2	0	KRTAP29-1	36711713	0.963000	0.33076	0.975000	0.42487	0.869000	0.49853	2.202000	0.42743	2.295000	0.77249	0.455000	0.32223	GCT	.		0.502	KRTAP29-1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257828.2		
KRTDAP	388533	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	35978347	35978347	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:35978347delT	ENST00000338897.3	-	6	371	c.283delA	c.(283-285)actfs	p.T95fs	KRTDAP_ENST00000484218.2_Frame_Shift_Del_p.T81fs|KRTDAP_ENST00000479340.1_5'UTR	NM_207392.2	NP_997275.1	P60985	KTDAP_HUMAN	keratinocyte differentiation-associated protein	95					cell differentiation (GO:0030154)	extracellular region (GO:0005576)				breast(1)|lung(4)|prostate(1)	6	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GCATCAGGAGTTGCGCTCCTC	0.547																																					p.T95fs		.											.	KRTDAP	90	0			c.283delA						.						126.0	121.0	123.0					19																	35978347		2203	4300	6503	SO:0001589	frameshift_variant	388533	exon6			CAGGAGTTGCGCT	AA297512	CCDS12462.1, CCDS59377.1	19q13.12	2013-06-20			ENSG00000188508	ENSG00000188508			16313	protein-coding gene	gene with protein product						11054531	Standard	NM_207392		Approved	KDAP, UNQ467	uc002nzh.3	P60985	OTTHUMG00000155449	ENST00000338897.3:c.283delA	19.37:g.35978347delT	ENSP00000339251:p.Thr95fs	50.0	0.0		84.0	19.0	NM_207392	A1L4D7	Frame_Shift_Del	DEL	ENST00000338897.3	37	CCDS12462.1																																																																																			.		0.547	KRTDAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340164.1		
LAMA2	3908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	129588356	129588356	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr6:129588356G>A	ENST00000421865.2	+	16	2363	c.2314G>A	c.(2314-2316)Gaa>Aaa	p.E772K		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	772	Laminin EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CGTCACTGGAGAATGCCTGGT	0.502																																					p.E772K		.											.	LAMA2	162	0			c.G2314A						.						272.0	226.0	242.0					6																	129588356		2203	4300	6503	SO:0001583	missense	3908	exon16			ACTGGAGAATGCC	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.2314G>A	6.37:g.129588356G>A	ENSP00000400365:p.Glu772Lys	67.0	0.0		69.0	9.0	NM_000426	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.238393	0.58886	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.61510	0.1	5.75	5.75	0.90469	EGF-like, laminin (3);	0.274054	0.36482	N	0.002569	T	0.42675	0.1213	L	0.33753	1.03	0.44366	D	0.997267	P;P	0.43231	0.801;0.801	B;B	0.43990	0.339;0.438	T	0.22521	-1.0214	10	0.25106	T	0.35	.	19.9525	0.97208	0.0:0.0:1.0:0.0	.	772;772	A6NF00;P24043	.;LAMA2_HUMAN	K	772	ENSP00000400365:E772K	ENSP00000346769:E772K	E	+	1	0	LAMA2	129630049	1.000000	0.71417	0.955000	0.39395	0.993000	0.82548	3.863000	0.56016	2.719000	0.93026	0.655000	0.94253	GAA	.		0.502	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
LAMC2	3918	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	183209512	183209512	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:183209512T>A	ENST00000264144.4	+	22	3379	c.3314T>A	c.(3313-3315)cTc>cAc	p.L1105H	LAMC2_ENST00000493293.1_Missense_Mutation_p.L1105H|LAMC2_ENST00000461729.1_3'UTR	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	1105	Domain II and I.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)			breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						TTAGACGGCCTCCTGCATCTG	0.507																																					p.L1105H		.											.	LAMC2	93	0			c.T3314A						.						120.0	93.0	102.0					1																	183209512		2203	4300	6503	SO:0001583	missense	3918	exon22			ACGGCCTCCTGCA	Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.3314T>A	1.37:g.183209512T>A	ENSP00000264144:p.Leu1105His	94.0	0.0		130.0	11.0	NM_005562	Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Missense_Mutation	SNP	ENST00000264144.4	37	CCDS1352.1	.	.	.	.	.	.	.	.	.	.	T	15.02	2.709161	0.48517	.	.	ENSG00000058085	ENST00000493293;ENST00000264144	T;T	0.77489	1.97;-1.1	5.59	5.59	0.84812	.	0.321794	0.29522	N	0.011920	T	0.75997	0.3926	L	0.27053	0.805	0.44067	D	0.996816	D;D;D	0.60575	0.979;0.979;0.988	P;B;P	0.52758	0.514;0.41;0.708	T	0.79638	-0.1720	10	0.87932	D	0	.	14.3256	0.66518	0.0:0.0:0.0:1.0	.	1105;1105;1105	Q2M1N2;Q13753;Q13753-2	.;LAMC2_HUMAN;.	H	1105	ENSP00000432063:L1105H;ENSP00000264144:L1105H	ENSP00000264144:L1105H	L	+	2	0	LAMC2	181476135	1.000000	0.71417	0.988000	0.46212	0.025000	0.11179	4.621000	0.61233	2.119000	0.64992	0.533000	0.62120	CTC	.		0.507	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086258.1	NM_005562	
LGALS9	3965	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	25972916	25972916	+	Silent	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr17:25972916C>T	ENST00000395473.2	+	7	2074	c.606C>T	c.(604-606)agC>agT	p.S202S	LGALS9_ENST00000313648.6_Silent_p.S170S|LGALS9_ENST00000310394.5_Silent_p.S158S|LGALS9_ENST00000302228.5_Silent_p.S170S|LGALS9_ENST00000413914.2_Silent_p.S145S	NM_009587.2	NP_033665.1	O00182	LEG9_HUMAN	lectin, galactoside-binding, soluble, 9	202					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|galactose binding (GO:0005534)|signal transducer activity (GO:0004871)			endometrium(3)|large_intestine(2)|lung(12)|skin(1)	18	Lung NSC(42;0.0103)		BRCA - Breast invasive adenocarcinoma(3;0.0141)	UCEC - Uterine corpus endometrioid carcinoma (53;0.155)		CAGTGCAGAGCGCCCCTGGAC	0.537																																					p.S202S	Melanoma(106;677 1527 28724 29571 46552)|Ovarian(193;263 2088 2118 29005 43023)	.											.	LGALS9	226	0			c.C606T						.						51.0	50.0	50.0					17																	25972916		2202	4280	6482	SO:0001819	synonymous_variant	3965	exon7			GCAGAGCGCCCCT	AB006782	CCDS11222.1, CCDS32592.1	17q11.2	2013-03-28	2008-07-25		ENSG00000168961	ENSG00000168961		"""Lectins, galactoside-binding"""	6570	protein-coding gene	gene with protein product	"""galectin 9"""	601879				9045665	Standard	NM_009587		Approved	LGALS9A	uc002gzp.3	O00182	OTTHUMG00000179831	ENST00000395473.2:c.606C>T	17.37:g.25972916C>T		184.0	0.0		300.0	148.0	NM_009587	A7VJG6|O14532|O75028|Q3B8N1|Q53FQ0|Q9NQ58	Silent	SNP	ENST00000395473.2	37	CCDS11222.1																																																																																			.		0.537	LGALS9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255583.1	NM_009587	
LOXL4	84171	broad.mit.edu;mdanderson.org	37	10	100011440	100011440	+	Silent	SNP	T	T	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr10:100011440T>A	ENST00000260702.3	-	13	2121	c.1971A>T	c.(1969-1971)gcA>gcT	p.A657A	RP11-34A14.3_ENST00000433374.1_RNA	NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	657	Lysyl-oxidase like.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		AGTTGGCACATGCGTAGCGCC	0.537																																					p.A657A		.											.	LOXL4	230	0			c.A1971T						.						91.0	76.0	81.0					10																	100011440		2203	4300	6503	SO:0001819	synonymous_variant	84171	exon13			GGCACATGCGTAG	AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.1971A>T	10.37:g.100011440T>A		44.0	0.0		62.0	8.0	NM_032211	Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Silent	SNP	ENST00000260702.3	37	CCDS7473.1																																																																																			.		0.537	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049766.1	NM_032211	
LRP1	4035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57552232	57552232	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr12:57552232A>G	ENST00000243077.3	+	11	2075	c.1609A>G	c.(1609-1611)Atc>Gtc	p.I537V		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	537					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CCGGCCAGGCATCATCCGGGG	0.592																																					p.I537V		.											.	LRP1	596	0			c.A1609G						.						93.0	75.0	81.0					12																	57552232		2203	4300	6503	SO:0001583	missense	4035	exon11			CCAGGCATCATCC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.1609A>G	12.37:g.57552232A>G	ENSP00000243077:p.Ile537Val	61.0	0.0		58.0	17.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	A	8.885	0.952583	0.18431	.	.	ENSG00000123384	ENST00000243077	T	0.29142	1.58	4.3	3.11	0.35812	Six-bladed beta-propeller, TolB-like (1);	0.083168	0.48767	D	0.000172	T	0.15003	0.0362	N	0.13098	0.295	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.07347	-1.0777	10	0.10377	T	0.69	.	9.4304	0.38606	0.8209:0.1791:0.0:0.0	.	537	Q07954	LRP1_HUMAN	V	537	ENSP00000243077:I537V	ENSP00000243077:I537V	I	+	1	0	LRP1	55838499	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.081000	0.57627	0.939000	0.37446	0.459000	0.35465	ATC	.		0.592	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
LRRC47	57470	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	3712543	3712543	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:3712543G>C	ENST00000378251.1	-	1	525	c.498C>G	c.(496-498)gaC>gaG	p.D166E		NM_020710.2	NP_065761.1	Q8N1G4	LRC47_HUMAN	leucine rich repeat containing 47	166							phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17	all_cancers(77;0.0375)|Ovarian(185;0.0634)|all_lung(157;0.208)|Lung NSC(156;0.21)	all_epithelial(116;1.34e-16)|all_lung(118;2.53e-06)|Lung NSC(185;0.00028)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;5.49e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.43e-22)|GBM - Glioblastoma multiforme(42;3.69e-16)|Colorectal(212;1.21e-05)|COAD - Colon adenocarcinoma(227;5.87e-05)|Kidney(185;0.000367)|BRCA - Breast invasive adenocarcinoma(365;0.000704)|KIRC - Kidney renal clear cell carcinoma(229;0.00567)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		CGGGAAAGGAGTCTAGGCAAT	0.697																																					p.D166E		.											.	LRRC47	154	0			c.C498G						.						13.0	12.0	12.0					1																	3712543		2166	4247	6413	SO:0001583	missense	57470	exon1			AAAGGAGTCTAGG	AB033011	CCDS51.1	1p36.32	2008-02-05			ENSG00000130764	ENSG00000130764			29207	protein-coding gene	gene with protein product						10574461	Standard	NM_020710		Approved	KIAA1185, RP1-286D6.3	uc001akx.1	Q8N1G4	OTTHUMG00000003506	ENST00000378251.1:c.498C>G	1.37:g.3712543G>C	ENSP00000367498:p.Asp166Glu	20.0	0.0		18.0	6.0	NM_020710	Q9ULN5	Missense_Mutation	SNP	ENST00000378251.1	37	CCDS51.1	.	.	.	.	.	.	.	.	.	.	G	1.088	-0.665020	0.03428	.	.	ENSG00000130764	ENST00000378251	T	0.08720	3.06	4.08	4.08	0.47627	.	0.634547	0.16442	N	0.214262	T	0.04452	0.0122	N	0.05608	-0.01	0.19300	N	0.999973	B	0.28820	0.224	B	0.28916	0.096	T	0.28170	-1.0052	10	0.02654	T	1	-27.7811	15.2691	0.73686	0.0:0.0:1.0:0.0	.	166	Q8N1G4	LRC47_HUMAN	E	166	ENSP00000367498:D166E	ENSP00000367498:D166E	D	-	3	2	LRRC47	3702403	0.000000	0.05858	0.992000	0.48379	0.228000	0.25075	0.236000	0.17967	1.817000	0.53016	0.561000	0.74099	GAC	.		0.697	LRRC47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009744.1	NM_020710	
LTF	4057	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	46480950	46480950	+	Missense_Mutation	SNP	G	G	T	rs149901533		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:46480950G>T	ENST00000231751.4	-	15	2040	c.1745C>A	c.(1744-1746)gCt>gAt	p.A582D	LTF_ENST00000493056.1_5'UTR|LTF_ENST00000426532.2_Missense_Mutation_p.A538D|LTF_ENST00000417439.1_Missense_Mutation_p.A580D	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	582	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		CAAATCCTTAGCCCATGCCTC	0.542																																					p.A582D		.											.	LTF	703	0			c.C1745A						.						90.0	81.0	84.0					3																	46480950		2203	4300	6503	SO:0001583	missense	4057	exon15			TCCTTAGCCCATG		CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.1745C>A	3.37:g.46480950G>T	ENSP00000231751:p.Ala582Asp	66.0	0.0		130.0	37.0	NM_002343	A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Missense_Mutation	SNP	ENST00000231751.4	37	CCDS33747.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.777802	0.70107	.	.	ENSG00000012223	ENST00000231751;ENST00000426532;ENST00000417439;ENST00000443496	T;T;T;T	0.08807	3.05;3.05;3.05;3.05	5.16	5.16	0.70880	.	0.100111	0.64402	D	0.000002	T	0.45518	0.1346	H	0.97265	3.97	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.996;1.0;0.996	T	0.64127	-0.6480	10	0.87932	D	0	.	16.9598	0.86269	0.0:0.0:1.0:0.0	.	580;569;582	E7ER44;E7EQB2;P02788	.;.;TRFL_HUMAN	D	582;538;580;569	ENSP00000231751:A582D;ENSP00000405719:A538D;ENSP00000405546:A580D;ENSP00000397427:A569D	ENSP00000231751:A582D	A	-	2	0	LTF	46455954	1.000000	0.71417	0.972000	0.41901	0.378000	0.30076	8.052000	0.89448	2.790000	0.95986	0.655000	0.94253	GCT	G|0.999;A|0.000		0.542	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343951.2	NM_002343	
MAG	4099	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	35800910	35800919	+	Frame_Shift_Del	DEL	GAGCGAGCGG	GAGCGAGCGG	-	rs201311667		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	GAGCGAGCGG	GAGCGAGCGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:35800910_35800919delGAGCGAGCGG	ENST00000392213.3	+	8	1524_1533	c.1365_1374delGAGCGAGCGG	c.(1363-1374)gagagcgagcggfs	p.ESER455fs	MAG_ENST00000537831.2_Frame_Shift_Del_p.ESER430fs|MAG_ENST00000361922.4_Frame_Shift_Del_p.ESER455fs|MAG_ENST00000593348.1_3'UTR	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	455	Ig-like C2-type 4.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCGTGAACGAGAGCGAGCGGGAGTTCGTGT	0.69																																					p.455_458del		.											.	MAG	947	0			c.1365_1374del						.																																			SO:0001589	frameshift_variant	4099	exon8			GAACGAGAGCGAG	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1365_1374delGAGCGAGCGG	19.37:g.35800910_35800919delGAGCGAGCGG	ENSP00000376048:p.Glu455fs	52.0	0.0		55.0	23.0	NM_080600	B7Z2E5|F5GYC0|Q567S4	Frame_Shift_Del	DEL	ENST00000392213.3	37	CCDS12455.1																																																																																			.		0.690	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466071.1	NM_080600	
MAGEA11	4110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	148798282	148798282	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chrX:148798282C>T	ENST00000355220.5	+	5	1238	c.1136C>T	c.(1135-1137)cCt>cTt	p.P379L	MAGEA11_ENST00000333104.4_Missense_Mutation_p.P350L	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	379	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P379H(1)		cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					GGCACTGATCCTGCATGCTAT	0.557																																					p.P379L		.											.	MAGEA11	132	1	Substitution - Missense(1)	lung(1)	c.C1136T						.						120.0	112.0	115.0					X																	148798282		2203	4300	6503	SO:0001583	missense	4110	exon5			CTGATCCTGCATG		CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.1136C>T	X.37:g.148798282C>T	ENSP00000347358:p.Pro379Leu	47.0	0.0		123.0	68.0	NM_005366	Q5ETU4|Q6ZRZ5	Missense_Mutation	SNP	ENST00000355220.5	37	CCDS48180.1	.	.	.	.	.	.	.	.	.	.	N	15.55	2.867745	0.51588	.	.	ENSG00000185247	ENST00000333104;ENST00000355220	T;T	0.06371	3.31;3.31	0.909	0.909	0.19332	.	.	.	.	.	T	0.22704	0.0548	M	0.89214	3.015	0.09310	N	0.999999	D;D	0.59357	0.981;0.985	D;D	0.66602	0.945;0.945	T	0.04255	-1.0965	8	.	.	.	.	4.8361	0.13466	0.0:1.0:0.0:0.0	.	350;379	G5E962;P43364	.;MAGAB_HUMAN	L	350;379	ENSP00000328177:P350L;ENSP00000347358:P379L	.	P	+	2	0	MAGEA11	148576123	0.037000	0.19845	0.003000	0.11579	0.810000	0.45777	1.737000	0.38197	0.721000	0.32231	0.377000	0.23210	CCT	.		0.557	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058725.4	NM_005366	
MAGEL2	54551	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	23890418	23890418	+	Silent	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr15:23890418G>A	ENST00000532292.1	-	1	757	c.663C>T	c.(661-663)ccC>ccT	p.P221P		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	104					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		CACAGGCAAAGGGATCCTGCA	0.567																																					p.P824P		.											.	.	.	0			c.C2472T						.						61.0	64.0	63.0					15																	23890418		2003	4181	6184	SO:0001819	synonymous_variant	54551	exon1			GGCAAAGGGATCC	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.663C>T	15.37:g.23890418G>A		74.0	0.0		86.0	23.0	NM_019066		Silent	SNP	ENST00000532292.1	37		.	.	.	.	.	.	.	.	.	.	G	8.708	0.911413	0.17833	.	.	ENSG00000254585	ENST00000532292	.	.	.	4.21	-6.13	0.02118	.	.	.	.	.	T	0.52613	0.1745	.	.	.	0.50313	D	0.999867	.	.	.	.	.	.	T	0.59467	-0.7449	5	0.87932	D	0	.	3.4447	0.07477	0.1023:0.2393:0.4503:0.2081	.	.	.	.	L	253	.	ENSP00000433433:P253L	P	-	2	0	MAGEL2	21441511	0.004000	0.15560	0.264000	0.24511	0.987000	0.75469	-1.972000	0.01502	-1.281000	0.02399	-0.188000	0.12872	CCT	.		0.567	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066	
MAN2A2	4122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	91450650	91450650	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr15:91450650G>T	ENST00000559717.1	+	8	1580	c.1121G>T	c.(1120-1122)cGc>cTc	p.R374L	MAN2A2_ENST00000360468.3_Missense_Mutation_p.R374L|MAN2A2_ENST00000431652.2_5'UTR			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	374					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GATTTCAAACGCCTGCCTGGT	0.557																																					p.R374L		.											.	MAN2A2	136	0			c.G1121T						.						79.0	78.0	78.0					15																	91450650		2198	4298	6496	SO:0001583	missense	4122	exon7			TCAAACGCCTGCC	L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.1121G>T	15.37:g.91450650G>T	ENSP00000452948:p.Arg374Leu	74.0	0.0		95.0	38.0	NM_006122	A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	ENST00000559717.1	37	CCDS32332.1	.	.	.	.	.	.	.	.	.	.	G	36	5.645149	0.96704	.	.	ENSG00000196547	ENST00000360468	T	0.23552	1.9	5.67	5.67	0.87782	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.000000	0.85682	D	0.000000	T	0.60894	0.2304	M	0.88704	2.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.999	T	0.67352	-0.5692	10	0.87932	D	0	-30.8742	19.8235	0.96607	0.0:0.0:1.0:0.0	.	44;374;374	B4DIK4;P49641-1;P49641	.;.;MA2A2_HUMAN	L	374	ENSP00000353655:R374L	ENSP00000353655:R374L	R	+	2	0	MAN2A2	89251654	1.000000	0.71417	0.996000	0.52242	0.946000	0.59487	9.869000	0.99810	2.696000	0.92011	0.456000	0.33151	CGC	.		0.557	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122	
MARS	4141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57884114	57884114	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr12:57884114G>T	ENST00000262027.5	+	6	749	c.615G>T	c.(613-615)caG>caT	p.Q205H	ARHGAP9_ENST00000550288.1_5'Flank|ARHGAP9_ENST00000393797.2_5'Flank|MARS_ENST00000315473.5_5'UTR|MARS_ENST00000447721.2_3'UTR	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	205					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	TCCAAAAGCAGCCCCAGCCCA	0.597																																					p.Q205H		.											.	MARS	654	0			c.G615T						.						93.0	103.0	99.0					12																	57884114		2203	4300	6503	SO:0001583	missense	4141	exon6			AAAGCAGCCCCAG	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.615G>T	12.37:g.57884114G>T	ENSP00000262027:p.Gln205His	36.0	0.0		42.0	8.0	NM_004990	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	ENST00000262027.5	37	CCDS8942.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.59|13.59	2.281463|2.281463	0.40394|0.40394	.|.	.|.	ENSG00000166986|ENSG00000166986	ENST00000262027|ENST00000552371	T|.	0.32515|.	1.45|.	4.44|4.44	3.54|3.54	0.40534|0.40534	.|.	0.216251|.	0.40064|.	N|.	0.001195|.	T|T	0.55033|0.55033	0.1895|0.1895	L|L	0.48642|0.48642	1.525|1.525	0.80722|0.80722	D|D	1|1	B;B|.	0.16396|.	0.017;0.009|.	B;B|.	0.15052|.	0.012;0.006|.	T|T	0.50759|0.50759	-0.8790|-0.8790	10|5	0.41790|.	T|.	0.15|.	-14.7929|-14.7929	7.4037|7.4037	0.26979|0.26979	0.0911:0.0:0.7422:0.1667|0.0911:0.0:0.7422:0.1667	.|.	78;205|.	B4E0E9;P56192|.	.;SYMC_HUMAN|.	H|I	205|77	ENSP00000262027:Q205H|.	ENSP00000262027:Q205H|.	Q|S	+|+	3|2	2|0	MARS|MARS	56170381|56170381	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	2.044000|2.044000	0.41241|0.41241	1.234000|1.234000	0.43709|0.43709	0.514000|0.514000	0.50259|0.50259	CAG|AGC	.		0.597	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407014.1	NM_004990	
MCM7	4176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99695002	99695002	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:99695002T>C	ENST00000303887.5	-	10	1768	c.1123A>G	c.(1123-1125)Atc>Gtc	p.I375V	MCM7_ENST00000343023.6_Intron|MCM7_ENST00000354230.3_Missense_Mutation_p.I199V	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	375	MCM.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CAGATGTTGATGTTGCCTGGA	0.547																																					p.I375V		.											.	MCM7	651	0			c.A1123G						.						114.0	96.0	102.0					7																	99695002		2203	4300	6503	SO:0001583	missense	4176	exon10			TGTTGATGTTGCC		CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.1123A>G	7.37:g.99695002T>C	ENSP00000307288:p.Ile375Val	37.0	0.0		96.0	21.0	NM_005916	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Missense_Mutation	SNP	ENST00000303887.5	37	CCDS5683.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.726663	0.89298	.	.	ENSG00000166508	ENST00000303887;ENST00000542483;ENST00000362082;ENST00000354230	T;T	0.10099	2.91;2.91	4.97	4.97	0.65823	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.26919	0.0659	M	0.80982	2.52	0.80722	D	1	P	0.41848	0.763	P	0.51582	0.674	T	0.01294	-1.1393	10	0.52906	T	0.07	-20.3004	12.6646	0.56835	0.0:0.0:0.0:1.0	.	375	P33993	MCM7_HUMAN	V	375;312;268;199	ENSP00000307288:I375V;ENSP00000346171:I199V	ENSP00000307288:I375V	I	-	1	0	MCM7	99532938	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.708000	0.68377	2.083000	0.62718	0.533000	0.62120	ATC	.		0.547	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336534.3		
MEP1A	4224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	46787312	46787312	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr6:46787312A>G	ENST00000230588.4	+	7	436	c.427A>G	c.(427-429)Att>Gtt	p.I143V		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	143	Metalloprotease.				digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			GAACATTTCCATTGGCCAAGG	0.453																																					p.I143V		.											.	MEP1A	183	0			c.A427G						.						159.0	141.0	147.0					6																	46787312		2203	4300	6503	SO:0001583	missense	4224	exon7			ATTTCCATTGGCC		CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.427A>G	6.37:g.46787312A>G	ENSP00000230588:p.Ile143Val	59.0	0.0		95.0	53.0	NM_005588	A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Missense_Mutation	SNP	ENST00000230588.4	37	CCDS4918.1	.	.	.	.	.	.	.	.	.	.	A	17.05	3.288753	0.59976	.	.	ENSG00000112818	ENST00000230588	T	0.66995	-0.24	5.69	5.69	0.88448	Peptidase, metallopeptidase (1);Peptidase M12A, astacin (1);Metallopeptidase, catalytic domain (1);	0.061183	0.85682	D	0.000000	T	0.70456	0.3226	L	0.52759	1.655	0.53688	D	0.999978	D;D	0.63880	0.993;0.993	D;D	0.63381	0.914;0.914	T	0.73933	-0.3826	10	0.59425	D	0.04	-19.3152	15.9609	0.79930	1.0:0.0:0.0:0.0	.	171;143	B7ZL91;Q16819	.;MEP1A_HUMAN	V	143	ENSP00000230588:I143V	ENSP00000230588:I143V	I	+	1	0	MEP1A	46895271	0.973000	0.33851	1.000000	0.80357	0.466000	0.32739	2.478000	0.45189	2.162000	0.67917	0.528000	0.53228	ATT	.		0.453	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040803.1	NM_005588	
MMP9	4318	hgsc.bcm.edu;bcgsc.ca	37	20	44642129	44642129	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr20:44642129C>A	ENST00000372330.3	+	9	1585	c.1566C>A	c.(1564-1566)gaC>gaA	p.D522E	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	522					collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	ACATCTTCGACGCCATCGCGG	0.627											OREG0025990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D522E		.											.	MMP9	652	0			c.C1566A						.						28.0	30.0	30.0					20																	44642129		2203	4300	6503	SO:0001583	missense	4318	exon9			CTTCGACGCCATC		CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.1566C>A	20.37:g.44642129C>A	ENSP00000361405:p.Asp522Glu	61.0	0.0	925	119.0	8.0	NM_004994	B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Missense_Mutation	SNP	ENST00000372330.3	37	CCDS13390.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.017836	0.54576	.	.	ENSG00000100985	ENST00000372330	T	0.08370	3.1	4.9	-6.62	0.01813	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.33702	0.0872	H	0.95611	3.695	0.48901	D	0.999729	D	0.89917	1.0	D	0.91635	0.999	T	0.56709	-0.7934	10	0.49607	T	0.09	.	16.1145	0.81295	0.0:0.2294:0.0:0.7706	.	522	P14780	MMP9_HUMAN	E	522	ENSP00000361405:D522E	ENSP00000361405:D522E	D	+	3	2	MMP9	44075536	0.000000	0.05858	0.338000	0.25549	0.261000	0.26267	-2.798000	0.00762	-1.439000	0.01962	-0.136000	0.14681	GAC	.		0.627	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080337.1		
MOGAT3	346606	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100839352	100839352	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:100839352G>A	ENST00000223114.4	-	7	1067	c.901C>T	c.(901-903)Ctc>Ttc	p.L301F	MOGAT3_ENST00000440203.2_Silent_p.A329A|MOGAT3_ENST00000379423.3_Missense_Mutation_p.P233L	NM_178176.2	NP_835470.1	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	301					glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(3)	22	Lung NSC(181;0.168)|all_lung(186;0.215)					GTGGGGTGGAGGCGCTGGGGG	0.682																																					p.L301F		.											.	MOGAT3	92	0			c.C901T						.						31.0	31.0	31.0					7																	100839352		2202	4300	6502	SO:0001583	missense	346606	exon7			GGTGGAGGCGCTG	AY229854	CCDS5714.1, CCDS75643.1	7q22	2012-09-06			ENSG00000106384	ENSG00000106384	2.3.1.20, 2.3.1.22		23249	protein-coding gene	gene with protein product		610184				12618427, 14970677	Standard	XM_005250309		Approved	DC7, MGAT3	uc003uyc.3	Q86VF5	OTTHUMG00000023328	ENST00000223114.4:c.901C>T	7.37:g.100839352G>A	ENSP00000223114:p.Leu301Phe	39.0	0.0		67.0	21.0	NM_178176	Q496A6|Q496A7|Q496A8|Q9UDW7	Missense_Mutation	SNP	ENST00000223114.4	37	CCDS5714.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.04|12.04	1.818533|1.818533	0.32145|0.32145	.|.	.|.	ENSG00000106384|ENSG00000106384	ENST00000223114|ENST00000379423	D|T	0.93763|0.29397	-3.28|1.57	5.02|5.02	0.732|0.732	0.18283|0.18283	.|.	1.147710|.	0.06542|.	N|.	0.743373|.	T|T	0.27454|0.27454	0.0674|0.0674	L|L	0.61218|0.61218	1.895|1.895	0.09310|0.09310	N|N	1|1	P|B	0.49696|0.25743	0.927|0.133	P|B	0.48952|0.25759	0.596|0.063	T|T	0.31081|0.31081	-0.9956|-0.9956	10|9	0.62326|0.62326	D|D	0.03|0.03	-9.5366|-9.5366	4.1772|4.1772	0.10358|0.10358	0.0844:0.272:0.4824:0.1612|0.0844:0.272:0.4824:0.1612	.|.	301|233	Q86VF5|Q86VF5-2	MOGT3_HUMAN|.	F|L	301|233	ENSP00000223114:L301F|ENSP00000368734:P233L	ENSP00000223114:L301F|ENSP00000368734:P233L	L|P	-|-	1|2	0|0	MOGAT3|MOGAT3	100626072|100626072	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.005000|0.005000	0.04900|0.04900	-0.007000|-0.007000	0.12810|0.12810	-0.164000|-0.164000	0.10927|0.10927	-0.145000|-0.145000	0.13849|0.13849	CTC|CCT	.		0.682	MOGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059649.3	NM_178176	
MRPL51	51258	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	6602118	6602118	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr12:6602118T>C	ENST00000229238.3	-	2	561	c.100A>G	c.(100-102)Ata>Gta	p.I34V	NCAPD2_ENST00000545962.1_5'Flank|NCAPD2_ENST00000315579.5_5'Flank|MRPL51_ENST00000543703.1_Intron|MRPL51_ENST00000543164.1_5'UTR	NM_016497.3	NP_057581.2	Q4U2R6	RM51_HUMAN	mitochondrial ribosomal protein L51	34					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			kidney(2)|large_intestine(1)|lung(3)	6						GTGAGCCTTATACCGATCAAT	0.522																																					p.I34V		.											.	MRPL51	90	0			c.A100G						.						83.0	87.0	85.0					12																	6602118		2203	4300	6503	SO:0001583	missense	51258	exon2			GCCTTATACCGAT	AB051355	CCDS8547.1	12p13.3-p13.1	2014-02-19	2002-01-07	2002-01-11		ENSG00000111639		"""Mitochondrial ribosomal proteins / large subunits"""	14044	protein-coding gene	gene with protein product		611855	"""mitochondrial ribosomal protein 64"""	MRP64		11551941, 11543634	Standard	NM_016497		Approved	CDA09, HSPC241, bMRP64	uc001qom.2	Q4U2R6		ENST00000229238.3:c.100A>G	12.37:g.6602118T>C	ENSP00000229238:p.Ile34Val	66.0	0.0		78.0	33.0	NM_016497	Q96Q57|Q9BQ36|Q9P0N7	Missense_Mutation	SNP	ENST00000229238.3	37	CCDS8547.1	.	.	.	.	.	.	.	.	.	.	T	1.391	-0.580802	0.03854	.	.	ENSG00000111639	ENST00000229238	T	0.40476	1.03	4.96	-0.0191	0.13961	.	0.314945	0.37623	N	0.002001	T	0.10423	0.0255	N	0.01576	-0.805	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.30765	-0.9967	10	0.02654	T	1	-22.4516	3.8453	0.08933	0.223:0.3883:0.0:0.3887	.	34	Q4U2R6	RM51_HUMAN	V	34	ENSP00000229238:I34V	ENSP00000229238:I34V	I	-	1	0	MRPL51	6472379	0.777000	0.28628	0.141000	0.22245	0.095000	0.18619	1.167000	0.31847	-0.014000	0.14175	-0.464000	0.05259	ATA	.		0.522	MRPL51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399956.1	NM_016497	
MTM1	4534	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	149818234	149818234	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chrX:149818234G>A	ENST00000370396.2	+	10	967	c.913G>A	c.(913-915)Gaa>Aaa	p.E305K	MTM1_ENST00000306167.7_3'UTR|MTM1_ENST00000413012.2_Missense_Mutation_p.E268K|MTM1_ENST00000542741.1_Missense_Mutation_p.E210K|MTM1_ENST00000543350.1_Missense_Mutation_p.E190K	NM_000252.2	NP_000243.1	Q13496	MTM1_HUMAN	myotubularin 1	305	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				endosome to lysosome transport (GO:0008333)|intermediate filament organization (GO:0045109)|mitochondrion distribution (GO:0048311)|mitochondrion morphogenesis (GO:0070584)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|protein transport (GO:0015031)|regulation of vacuole organization (GO:0044088)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	intermediate filament binding (GO:0019215)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Acute lymphoblastic leukemia(192;6.56e-05)					TCATAACGCCGAACTTTTCTT	0.323																																					p.E305K		.											.	MTM1	228	0			c.G913A						.						117.0	108.0	111.0					X																	149818234		2203	4298	6501	SO:0001583	missense	4534	exon10			AACGCCGAACTTT	U46024	CCDS14694.1	Xq27.3-q28	2014-09-17			ENSG00000171100	ENSG00000171100		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7448	protein-coding gene	gene with protein product		300415	"""myotubular myopathy 1"""				Standard	NM_000252		Approved		uc004fef.4	Q13496	OTTHUMG00000024158	ENST00000370396.2:c.913G>A	X.37:g.149818234G>A	ENSP00000359423:p.Glu305Lys	62.0	0.0		149.0	10.0	NM_000252	A6NDB1|B7Z491|F2Z330|Q8NEL1	Missense_Mutation	SNP	ENST00000370396.2	37	CCDS14694.1	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681730	0.68042	.	.	ENSG00000171100	ENST00000370396;ENST00000542741;ENST00000543350;ENST00000413012	D;D;D;D	0.89939	-2.59;-2.59;-2.59;-2.59	5.83	4.97	0.65823	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.000000	0.85682	D	0.000000	D	0.91102	0.7199	L	0.52126	1.63	0.51482	D	0.999924	D;D	0.56968	0.978;0.973	P;P	0.58077	0.832;0.592	D	0.91623	0.5312	10	0.87932	D	0	.	14.1344	0.65276	0.0738:0.0:0.9262:0.0	.	268;305	B7Z491;Q13496	.;MTM1_HUMAN	K	305;210;190;268	ENSP00000359423:E305K;ENSP00000444015:E210K;ENSP00000439784:E190K;ENSP00000389157:E268K	ENSP00000359423:E305K	E	+	1	0	MTM1	149568892	1.000000	0.71417	0.819000	0.32651	0.872000	0.50106	9.822000	0.99363	1.227000	0.43598	-0.198000	0.12761	GAA	.		0.323	MTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060847.3	NM_000252	
MTMR7	9108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	17228586	17228586	+	Nonsense_Mutation	SNP	G	G	T	rs368887856		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr8:17228586G>T	ENST00000180173.5	-	3	304	c.270C>A	c.(268-270)tgC>tgA	p.C90*	MTMR7_ENST00000521857.1_Nonsense_Mutation_p.C90*	NM_004686.4	NP_004677.3	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	90					inositol phosphate dephosphorylation (GO:0046855)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(8)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	32				Colorectal(111;0.112)		ACACGTCGTGGCAATCTCTTT	0.468																																					p.C90X		.											.	MTMR7	91	0			c.C270A						.	G	stop/CYS	0,4406		0,0,2203	154.0	139.0	144.0		270	4.3	1.0	8		144	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	MTMR7	NM_004686.4		0,1,6502	TT,TG,GG		0.0116,0.0,0.0077		90/661	17228586	1,13005	2203	4300	6503	SO:0001587	stop_gained	9108	exon3			GTCGTGGCAATCT	AF073482	CCDS34851.1	8p22	2011-06-09			ENSG00000003987	ENSG00000003987		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7454	protein-coding gene	gene with protein product		603562				9736772, 12890864	Standard	NM_004686		Approved		uc003wxm.3	Q9Y216	OTTHUMG00000163771	ENST00000180173.5:c.270C>A	8.37:g.17228586G>T	ENSP00000180173:p.Cys90*	79.0	0.0		106.0	35.0	NM_004686	A1L4K9|B4DG87|Q68DX4	Nonsense_Mutation	SNP	ENST00000180173.5	37	CCDS34851.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.359020	0.82353	0.0	1.16E-4	ENSG00000003987	ENST00000180173;ENST00000521857	.	.	.	5.23	4.35	0.52113	.	0.135141	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9859	0.64334	0.0736:0.0:0.9264:0.0	.	.	.	.	X	90	.	ENSP00000180173:C90X	C	-	3	2	MTMR7	17272957	1.000000	0.71417	0.998000	0.56505	0.515000	0.34225	1.678000	0.37586	1.326000	0.45319	0.655000	0.94253	TGC	.		0.468	MTMR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375311.1	NM_004686	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9071326	9071326	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:9071326C>A	ENST00000397910.4	-	3	16323	c.16120G>T	c.(16120-16122)Gtg>Ttg	p.V5374L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5376	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGGTTGTCACCAGAACAGAA	0.512																																					p.V5374L		.											.	MUC16	566	0			c.G16120T						.						198.0	189.0	192.0					19																	9071326		2053	4203	6256	SO:0001583	missense	94025	exon3			TTGTCACCAGAAC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16120G>T	19.37:g.9071326C>A	ENSP00000381008:p.Val5374Leu	66.0	0.0		105.0	21.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	4.525	0.097503	0.08681	.	.	ENSG00000181143	ENST00000397910	T	0.25579	1.79	2.39	-4.78	0.03209	.	.	.	.	.	T	0.10680	0.0261	N	0.12746	0.255	.	.	.	B	0.16603	0.018	B	0.12837	0.008	T	0.24584	-1.0156	8	0.87932	D	0	.	1.7129	0.02896	0.2868:0.1934:0.3935:0.1263	.	5374	B5ME49	.	L	5374	ENSP00000381008:V5374L	ENSP00000381008:V5374L	V	-	1	0	MUC16	8932326	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.813000	0.04491	-1.722000	0.01377	0.313000	0.20887	GTG	.		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9071328	9071328	+	Missense_Mutation	SNP	A	A	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:9071328A>C	ENST00000397910.4	-	3	16321	c.16118T>G	c.(16117-16119)cTg>cGg	p.L5373R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5375	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGTTGTCACCAGAACAGAAGT	0.517																																					p.L5373R		.											.	MUC16	566	0			c.T16118G						.						195.0	185.0	188.0					19																	9071328		2042	4204	6246	SO:0001583	missense	94025	exon3			GTCACCAGAACAG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16118T>G	19.37:g.9071328A>C	ENSP00000381008:p.Leu5373Arg	69.0	0.0		107.0	21.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	a	1.276	-0.611833	0.03690	.	.	ENSG00000181143	ENST00000397910	T	0.24350	1.86	2.39	-4.52	0.03472	.	.	.	.	.	T	0.23133	0.0559	N	0.24115	0.695	.	.	.	P	0.49185	0.92	P	0.55391	0.775	T	0.30327	-0.9982	8	0.87932	D	0	.	5.4596	0.16610	0.2651:0.0:0.5533:0.1816	.	5373	B5ME49	.	R	5373	ENSP00000381008:L5373R	ENSP00000381008:L5373R	L	-	2	0	MUC16	8932328	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.534000	0.06150	-1.373000	0.02134	-2.546000	0.00178	CTG	.		0.517	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC2	4583	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	1097846	1097847	+	Frame_Shift_Ins	INS	-	-	C	rs201012212		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr11:1097846_1097847insC	ENST00000441003.2	+	36	6966_6967	c.6939_6940insC	c.(6940-6942)cccfs	p.P2314fs	MUC2_ENST00000361558.6_3'UTR	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4676					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCGTCACTGTGCCCGGGGGCGG	0.673																																					p.V2309fs		.											.	MUC2	90	0			c.6927_6928insC						.																																			SO:0001589	frameshift_variant	4583	exon37			CACTGTGCCCGGG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.6942dupC	11.37:g.1097849_1097849dupC	ENSP00000415183:p.Pro2314fs	34.0	0.0		37.0	18.0	NM_002457	Q14878	Frame_Shift_Ins	INS	ENST00000441003.2	37																																																																																				.		0.673	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC6	4588	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	1017897	1017897	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr11:1017897G>T	ENST00000421673.2	-	31	4954	c.4904C>A	c.(4903-4905)aCc>aAc	p.T1635N		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1635	Approximate repeats.|Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTGTGCATGGGTAGGGGTGAT	0.562																																					p.T1635N		.											.	MUC6	23	0			c.C4904A						.						545.0	519.0	528.0					11																	1017897		2199	4295	6494	SO:0001583	missense	4588	exon31			GCATGGGTAGGGG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4904C>A	11.37:g.1017897G>T	ENSP00000406861:p.Thr1635Asn	285.0	0.0		282.0	30.0	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	9.105	1.005047	0.19199	.	.	ENSG00000184956	ENST00000421673	T	0.27890	1.64	2.39	2.39	0.29439	.	.	.	.	.	T	0.45155	0.1328	L	0.56280	1.765	0.09310	N	1	D	0.76494	0.999	D	0.78314	0.991	T	0.12016	-1.0564	9	0.49607	T	0.09	.	6.8723	0.24127	0.0:0.0:0.7245:0.2755	.	1635	Q6W4X9	MUC6_HUMAN	N	1635	ENSP00000406861:T1635N	ENSP00000406861:T1635N	T	-	2	0	MUC6	1007897	0.000000	0.05858	0.023000	0.16930	0.017000	0.09413	0.259000	0.18405	1.293000	0.44690	0.297000	0.19635	ACC	.		0.562	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC5B	727897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1248993	1248993	+	Silent	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr11:1248993C>A	ENST00000529681.1	+	7	814	c.756C>A	c.(754-756)gcC>gcA	p.A252A	MUC5B_ENST00000447027.1_Silent_p.A252A	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	252	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTTGCCGGCCGGCAACTGCA	0.697																																					p.A252A		.											.	.	.	0			c.C756A						.						11.0	13.0	13.0					11																	1248993		1842	3920	5762	SO:0001819	synonymous_variant	727897	exon7			GCCGGCCGGCAAC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.756C>A	11.37:g.1248993C>A		57.0	0.0		56.0	15.0	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			.		0.697	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MYO7B	4648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	128380906	128380906	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:128380906A>T	ENST00000409816.2	+	27	3729	c.3697A>T	c.(3697-3699)Agc>Tgc	p.S1233C	MYO7B_ENST00000389524.4_Missense_Mutation_p.S1233C|MYO7B_ENST00000428314.1_Missense_Mutation_p.S1233C|RP11-286H15.1_ENST00000609697.1_RNA|MYO7B_ENST00000409090.1_Missense_Mutation_p.S86C			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1233	FERM 1. {ECO:0000255|PROSITE- ProRule:PRU00084}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GCAGGGCCTCAGCGACCACCT	0.627																																					p.S1233C		.											.	MYO7B	47	0			c.A3697T						.						54.0	63.0	60.0					2																	128380906		2142	4243	6385	SO:0001583	missense	4648	exon28			GGCCTCAGCGACC		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.3697A>T	2.37:g.128380906A>T	ENSP00000386461:p.Ser1233Cys	29.0	0.0		58.0	9.0	NM_001080527	Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	37	CCDS46405.1	.	.	.	.	.	.	.	.	.	.	.	15.82	2.947391	0.53186	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000272666;ENST00000409816;ENST00000437387;ENST00000409090	T;T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99;-0.99	4.82	3.62	0.41486	Band 4.1 domain (1);FERM domain (1);	0.720633	0.13276	N	0.400116	T	0.70107	0.3186	L	0.53249	1.67	0.21967	N	0.999446	P	0.47604	0.898	B	0.42188	0.379	T	0.59731	-0.7399	10	0.56958	D	0.05	.	10.5338	0.44992	0.8369:0.163:0.0:0.0	.	1233	Q6PIF6	MYO7B_HUMAN	C	1233;1233;86;1233;86;86	ENSP00000374175:S1233C;ENSP00000415090:S1233C;ENSP00000386461:S1233C;ENSP00000404927:S86C;ENSP00000386850:S86C	ENSP00000272666:S86C	S	+	1	0	MYO7B	128097376	0.991000	0.36638	0.372000	0.25991	0.757000	0.42996	3.133000	0.50531	0.650000	0.30769	0.402000	0.26972	AGC	.		0.627	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001	
NCAPH2	29781	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50961497	50961497	+	Silent	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr22:50961497C>A	ENST00000420993.2	+	19	1701	c.1579C>A	c.(1579-1581)Cgg>Agg	p.R527R	CTA-384D8.36_ENST00000608319.1_RNA|NCAPH2_ENST00000395701.3_Silent_p.R527R|NCAPH2_ENST00000299821.11_Silent_p.R528R	NM_001185011.1|NM_152299.3	NP_001171940.1|NP_689512.2	Q6IBW4	CNDH2_HUMAN	non-SMC condensin II complex, subunit H2	527					chromosome condensation (GO:0030261)|mitotic cell cycle (GO:0000278)	chromosome (GO:0005694)|membrane (GO:0016020)|nucleoplasm (GO:0005654)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|lung(10)|ovary(1)|prostate(2)|skin(3)|stomach(1)	24		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.212)		GCTGGTCTCACGGTTCCCCCA	0.637																																					p.R528R		.											.	NCAPH2	92	0			c.C1582A						.						64.0	45.0	52.0					22																	50961497		2203	4300	6503	SO:0001819	synonymous_variant	29781	exon19			GTCTCACGGTTCC	BC001937	CCDS14094.2, CCDS43038.1, CCDS54546.1	22q13.33	2008-02-04			ENSG00000025770	ENSG00000025770			25071	protein-coding gene	gene with protein product	"""kleisin beta"", ""CAP-H2 subunit of the condensin II complex"""	611230				10493829	Standard	NM_014551		Approved	384D8-2, hCAP-H2, CAP-H2	uc003blx.4	Q6IBW4	OTTHUMG00000150205	ENST00000420993.2:c.1579C>A	22.37:g.50961497C>A		29.0	0.0		45.0	13.0	NM_001185011	B7WPH1|O43788|Q13391|Q96C14|Q96GJ0|Q9BQ71|Q9BUT3|Q9BVD1	Silent	SNP	ENST00000420993.2	37	CCDS14094.2																																																																																			.		0.637	NCAPH2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317012.1	NM_152299	
NEK3	4752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	52718081	52718081	+	Silent	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr13:52718081T>C	ENST00000400357.2	-	9	2139	c.846A>G	c.(844-846)aaA>aaG	p.K282K	NEK3_ENST00000378101.2_Silent_p.K282K|NEK3_ENST00000452082.2_Silent_p.K303K|NEK3_ENST00000339406.3_Silent_p.K282K			P51956	NEK3_HUMAN	NIMA-related kinase 3	282	Interaction with VAV2.				mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|stomach(2)	18		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		GCTTCGAATTTTTTATTTCTT	0.274																																					p.K282K		.											.	NEK3	359	0			c.A846G						.						66.0	53.0	57.0					13																	52718081		1639	3684	5323	SO:0001819	synonymous_variant	4752	exon10			CGAATTTTTTATT	AK290259, BC019916	CCDS73576.1	13q14.2-q21.1	2014-07-17	2012-11-15		ENSG00000136098	ENSG00000136098	2.7.11.1		7746	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase NEK3"", ""phosphorylase B kinase kinase"", ""glycogen synthase A kinase"", ""hydroxyalkyl-protein kinase"""	604044	"""NIMA (never in mitosis gene a)-related kinase 3"""			8274451, 7522034	Standard	NM_002498		Approved	HSPK36, MGC29949	uc010tgy.2	P51956	OTTHUMG00000016958	ENST00000400357.2:c.846A>G	13.37:g.52718081T>C		74.0	0.0		82.0	23.0	NM_002498	A8K2J4|Q5TAP2|Q8J023|Q8WUN5	Silent	SNP	ENST00000400357.2	37	CCDS53871.1																																																																																			.		0.274	NEK3-002	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045047.3		
NLRP9	338321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	56223244	56223244	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:56223244C>G	ENST00000332836.2	-	8	2792	c.2765G>C	c.(2764-2766)tGg>tCg	p.W922S	CTD-2611O12.7_ENST00000597680.1_RNA|CTD-2611O12.8_ENST00000596293.1_RNA	NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	922						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CAAGGCAATCCAGTCGAGGTT	0.582																																					p.W922S		.											.	NLRP9	294	0			c.G2765C						.						106.0	82.0	90.0					19																	56223244		2202	4299	6501	SO:0001583	missense	338321	exon8			GCAATCCAGTCGA	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.2765G>C	19.37:g.56223244C>G	ENSP00000331857:p.Trp922Ser	88.0	0.0		154.0	53.0	NM_176820	B2RN12|Q86W27	Missense_Mutation	SNP	ENST00000332836.2	37	CCDS12934.1	.	.	.	.	.	.	.	.	.	.	C	7.371	0.626916	0.14257	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.39997	1.05	3.09	-0.538	0.11868	.	.	.	.	.	T	0.25269	0.0614	L	0.31371	0.925	0.09310	N	1	P	0.38863	0.65	B	0.39660	0.306	T	0.18999	-1.0319	9	0.08837	T	0.75	.	6.3517	0.21379	0.1993:0.4121:0.3886:0.0	.	922	Q7RTR0	NALP9_HUMAN	S	922	ENSP00000331857:W922S	ENSP00000331857:W922S	W	-	2	0	NLRP9	60915056	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.817000	0.04472	0.017000	0.15025	-0.171000	0.13296	TGG	.		0.582	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
NMNAT3	349565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	139297767	139297767	+	Silent	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:139297767C>T	ENST00000296202.7	-	4	621	c.240G>A	c.(238-240)gtG>gtA	p.V80V	NMNAT3_ENST00000406824.1_5'UTR|NMNAT3_ENST00000413939.2_Intron|NMNAT3_ENST00000406164.1_Silent_p.V43V|RP11-319G6.1_ENST00000381790.3_RNA|NMNAT3_ENST00000511444.1_Silent_p.V43V|NMNAT3_ENST00000507242.1_5'UTR|NMNAT3_ENST00000512391.1_Silent_p.V80V|NMNAT3_ENST00000339837.5_Silent_p.V43V|RP11-319G6.1_ENST00000515247.1_RNA			Q96T66	NMNA3_HUMAN	nicotinamide nucleotide adenylyltransferase 3	80					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)	9						CCCAAGGGTCCACCCGGATCC	0.592																																					p.V43V		.											.	NMNAT3	90	0			c.G129A						.						124.0	101.0	109.0					3																	139297767		2203	4300	6503	SO:0001819	synonymous_variant	349565	exon3			AGGGTCCACCCGG	AF345564	CCDS3111.1, CCDS56282.1	3q23	2013-09-20			ENSG00000163864	ENSG00000163864			20989	protein-coding gene	gene with protein product		608702				12574164	Standard	NM_178177		Approved	PNAT3	uc003etk.3	Q96T66	OTTHUMG00000159951	ENST00000296202.7:c.240G>A	3.37:g.139297767C>T		87.0	0.0		99.0	18.0	NM_178177	B3KVR6|D3DNF2|D3DNF3|Q8N4G1	Silent	SNP	ENST00000296202.7	37																																																																																				.		0.592	NMNAT3-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000358469.1	NM_178177	
NOVA1	4857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	26949267	26949267	+	Silent	SNP	T	T	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr14:26949267T>G	ENST00000344429.5	-	3	366	c.363A>C	c.(361-363)cgA>cgC	p.R121R	NOVA1_ENST00000267422.7_5'UTR|NOVA1_ENST00000539517.2_Silent_p.R121R|NOVA1_ENST00000465357.2_Silent_p.R121R|NOVA1_ENST00000547619.1_Silent_p.R121R|NOVA1_ENST00000574031.1_Silent_p.R121R	NM_006491.2	NP_006482.1	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	124					locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		GGGGCATTTCTCGAATTTTTT	0.443																																					p.R121R		.											.	NOVA1	229	0			c.A363C						.						172.0	143.0	153.0					14																	26949267		2203	4300	6503	SO:0001819	synonymous_variant	4857	exon3			CATTTCTCGAATT	U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000344429.5:c.363A>C	14.37:g.26949267T>G		83.0	0.0		85.0	30.0	NM_006489	A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Silent	SNP	ENST00000344429.5	37	CCDS9635.1																																																																																			.		0.443	NOVA1-001	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276557.1	NM_006491	
NR2F2	7026	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	96875737	96875737	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr15:96875737C>A	ENST00000394166.3	+	1	1792	c.403C>A	c.(403-405)Cgc>Agc	p.R135S	NR2F2_ENST00000421109.2_Intron|NR2F2_ENST00000453270.2_5'Flank|NR2F2_ENST00000394171.2_5'Flank|MIR1469_ENST00000410719.1_RNA	NM_021005.3	NP_066285.1	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	135	Interaction with ZFPM2. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|blood vessel morphogenesis (GO:0048514)|fertilization (GO:0009566)|forebrain development (GO:0030900)|intracellular receptor signaling pathway (GO:0030522)|limb development (GO:0060173)|lipid metabolic process (GO:0006629)|maternal placenta development (GO:0001893)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|radial pattern formation (GO:0009956)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(2)|lung(3)|ovary(2)|urinary_tract(1)	17	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			CCAGTACTGCCGCCTCAAAAA	0.607																																					p.R135S		.											.	NR2F2	228	0			c.C403A						.						76.0	70.0	72.0					15																	96875737		2197	4298	6495	SO:0001583	missense	7026	exon1			TACTGCCGCCTCA	M64497	CCDS10375.1, CCDS45358.1, CCDS45359.1	15q26	2013-01-16			ENSG00000185551	ENSG00000185551		"""Nuclear hormone receptors"""	7976	protein-coding gene	gene with protein product		107773		ARP1, TFCOUP2		8530078, 11544252	Standard	NM_021005		Approved	COUP-TFII, COUPTFB, SVP40, NF-E3	uc010uri.2	P24468	OTTHUMG00000149848	ENST00000394166.3:c.403C>A	15.37:g.96875737C>A	ENSP00000377721:p.Arg135Ser	97.0	0.0		157.0	40.0	NM_021005	B4DQJ2|B6ZGU1|Q03754|Q3KQR7	Missense_Mutation	SNP	ENST00000394166.3	37	CCDS10375.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.934441	0.92458	.	.	ENSG00000185551	ENST00000394166	D	0.98585	-5.01	4.92	4.92	0.64577	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	0.000000	0.64402	D	0.000001	D	0.99366	0.9777	H	0.97291	3.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98457	1.0594	10	0.87932	D	0	.	16.7089	0.85380	0.0:1.0:0.0:0.0	.	135	P24468	COT2_HUMAN	S	135	ENSP00000377721:R135S	ENSP00000377721:R135S	R	+	1	0	NR2F2	94676741	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.769000	0.85360	2.271000	0.75665	0.561000	0.74099	CGC	.		0.607	NR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313534.1		
POM121	9883	bcgsc.ca;mdanderson.org	37	7	72419590	72419590	+	IGR	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:72419590A>T	ENST00000434423.2	+	0	3750				POM121_ENST00000395270.1_3'UTR|NSUN5P2_ENST00000388955.4_RNA			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				ATGCAGACGCACCGGGCTAGG	0.637																																					.		.											.	NSUN5P2	90	0			.						.						36.0	40.0	39.0					7																	72419590		2202	4300	6502	SO:0001628	intergenic_variant	260294	.			AGACGCACCGGGC	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527		7.37:g.72419590A>T		63.0	0.0		165.0	34.0	.	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	RNA	SNP	ENST00000434423.2	37																																																																																				.		0.637	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347344.1		
NT5C2	22978	broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	104899213	104899213	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr10:104899213G>C	ENST00000404739.3	-	2	148	c.125C>G	c.(124-126)gCa>gGa	p.A42G	NT5C2_ENST00000369857.4_5'UTR|NT5C2_ENST00000470299.1_Intron|NT5C2_ENST00000343289.5_Missense_Mutation_p.A42G|NT5C2_ENST00000423468.2_Missense_Mutation_p.A13G			P49902	5NTC_HUMAN	5'-nucleotidase, cytosolic II	42					cell death (GO:0008219)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|nucleobase-containing small molecule metabolic process (GO:0055086)|phosphorylation (GO:0016310)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleoside phosphotransferase activity (GO:0050146)|nucleotide binding (GO:0000166)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|urinary_tract(1)	16		all_hematologic(284;0.176)|Colorectal(252;0.178)		Epithelial(162;1.33e-08)|all cancers(201;1.04e-07)|BRCA - Breast invasive adenocarcinoma(275;0.159)	Adenosine triphosphate(DB00171)|Ribavirin(DB00811)	CTTTTCCATTGCTAAACTTCG	0.308																																					p.A42G		.											.	NT5C2	90	0			c.C125G						.						69.0	60.0	63.0					10																	104899213		2194	4292	6486	SO:0001583	missense	22978	exon4			TCCATTGCTAAAC	D38524	CCDS7544.1	10q24.32	2014-03-03	2002-04-18	2002-04-19	ENSG00000076685	ENSG00000076685			8022	protein-coding gene	gene with protein product	"""purine 5' nucleotidase"""	600417	"""5'-nucleotidase (purine), cytosolic type B"""	NT5B		7999131, 24482476	Standard	NM_012229		Approved	PNT5, GMP, cN-II, SPG65	uc001kwq.3	P49902	OTTHUMG00000018981	ENST00000404739.3:c.125C>G	10.37:g.104899213G>C	ENSP00000383960:p.Ala42Gly	58.0	1.0		75.0	7.0	NM_012229	B7Z382|D3DR91|Q5JUV5	Missense_Mutation	SNP	ENST00000404739.3	37	CCDS7544.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.601542	0.46423	.	.	ENSG00000076685	ENST00000343289;ENST00000404739;ENST00000423468;ENST00000452156	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	5.9	5.9	0.94986	HAD-like domain (1);	0.000000	0.85682	D	0.000000	T	0.45013	0.1321	M	0.79123	2.44	0.80722	D	1	D;D	0.67145	0.976;0.996	P;P	0.59595	0.815;0.86	T	0.14643	-1.0465	10	0.19147	T	0.46	-15.5508	20.2768	0.98488	0.0:0.0:1.0:0.0	.	13;42	B7Z382;P49902	.;5NTC_HUMAN	G	42;42;13;42	ENSP00000339479:A42G;ENSP00000383960:A42G;ENSP00000392236:A13G;ENSP00000396468:A42G	ENSP00000339479:A42G	A	-	2	0	NT5C2	104889203	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	9.675000	0.98638	2.808000	0.96608	0.650000	0.86243	GCA	.		0.308	NT5C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050121.1	NM_012229	
NYAP1	222950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100085812	100085812	+	Silent	SNP	C	C	T	rs372170892		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:100085812C>T	ENST00000300179.2	+	4	627	c.468C>T	c.(466-468)agC>agT	p.S156S	NYAP1_ENST00000423930.1_Silent_p.S156S|NYAP1_ENST00000454988.1_Silent_p.S99S	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	156	Involved in CYFIP1- and NCKAP1-binding. {ECO:0000250}.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GAGAGTCCAGCCGGAAGGTTC	0.597																																					p.S156S		.											.	.	.	0			c.C468T						.	C		0,4406		0,0,2203	111.0	126.0	121.0		468	4.4	1.0	7		121	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C7orf51	NM_173564.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		156/842	100085812	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	222950	exon4			GTCCAGCCGGAAG	AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.468C>T	7.37:g.100085812C>T		93.0	0.0		202.0	44.0	NM_173564	Q6U9Y3|Q8N1V0	Silent	SNP	ENST00000300179.2	37	CCDS5696.1																																																																																			.		0.597	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2	NM_173564	
OR2T1	26696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248569656	248569656	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:248569656A>G	ENST00000366474.1	+	1	361	c.361A>G	c.(361-363)Atg>Gtg	p.M121V		NM_030904.1	NP_112166.1	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T, member 1	121						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	39	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTTAATTGACATGATGTATAT	0.453																																					p.M121V		.											.	OR2T1	69	0			c.A361G						.						181.0	169.0	173.0					1																	248569656		2203	4300	6503	SO:0001583	missense	26696	exon1			ATTGACATGATGT	U86215	CCDS31115.1	1q44	2012-08-09			ENSG00000175143	ENSG00000175143		"""GPCR / Class A : Olfactory receptors"""	8277	protein-coding gene	gene with protein product						9500546	Standard	NM_030904		Approved	OR1-25	uc010pzm.2	O43869	OTTHUMG00000040450	ENST00000366474.1:c.361A>G	1.37:g.248569656A>G	ENSP00000355430:p.Met121Val	61.0	0.0		83.0	32.0	NM_030904	Q6IEZ9	Missense_Mutation	SNP	ENST00000366474.1	37	CCDS31115.1	.	.	.	.	.	.	.	.	.	.	a	6.014	0.371053	0.11409	.	.	ENSG00000175143	ENST00000366474	T	0.02656	4.21	4.75	3.56	0.40772	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44688	U	0.000438	T	0.01627	0.0052	N	0.11313	0.125	0.29352	N	0.865306	B	0.17268	0.021	B	0.12156	0.007	T	0.34502	-0.9826	10	0.34782	T	0.22	.	4.9551	0.14035	0.7481:0.0:0.0887:0.1632	.	121	O43869	OR2T1_HUMAN	V	121	ENSP00000355430:M121V	ENSP00000355430:M121V	M	+	1	0	OR2T1	246636279	0.002000	0.14202	1.000000	0.80357	0.562000	0.35680	0.144000	0.16135	1.993000	0.58246	0.528000	0.53228	ATG	.		0.453	OR2T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097346.2		
OR4C15	81309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	55322576	55322576	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr11:55322576C>G	ENST00000314644.2	+	1	794	c.794C>G	c.(793-795)tCc>tGc	p.S265C		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	211						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						ATAAACTTCTCCTTGTTGCTT	0.483										HNSCC(20;0.049)																											p.S265C		.											.	OR4C15	70	0			c.C794G						.						209.0	151.0	171.0					11																	55322576		2201	4296	6497	SO:0001583	missense	81309	exon1			ACTTCTCCTTGTT	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.794C>G	11.37:g.55322576C>G	ENSP00000324958:p.Ser265Cys	91.0	0.0		90.0	12.0	NM_001001920	Q6IFE2	Missense_Mutation	SNP	ENST00000314644.2	37	CCDS31501.1	.	.	.	.	.	.	.	.	.	.	C	12.06	1.824623	0.32237	.	.	ENSG00000181939	ENST00000314644	T	0.38401	1.14	4.8	2.88	0.33553	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.51856	0.1699	L	0.58428	1.81	0.09310	N	1	D	0.76494	0.999	D	0.69479	0.964	T	0.30650	-0.9971	9	0.62326	D	0.03	.	9.6211	0.39721	0.0:0.8208:0.0:0.1792	.	211	Q8NGM1	OR4CF_HUMAN	C	265	ENSP00000324958:S265C	ENSP00000324958:S265C	S	+	2	0	OR4C15	55079152	0.000000	0.05858	0.869000	0.34112	0.629000	0.37895	-1.043000	0.03535	1.241000	0.43820	0.385000	0.25706	TCC	.		0.483	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920	
OR4K17	390436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20585602	20585602	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr14:20585602A>T	ENST00000315543.4	+	1	37	c.37A>T	c.(37-39)Agt>Tgt	p.S13C		NM_001004715.1	NP_001004715.1	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K, member 17	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|skin(3)	21	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		CCATGGTATGAGTGATCTTTT	0.368																																					p.S13C		.											.	OR4K17	71	0			c.A37T						.						97.0	90.0	93.0					14																	20585602		2203	4300	6503	SO:0001583	missense	390436	exon1			GGTATGAGTGATC		CCDS32030.1	14q11.2	2013-09-23			ENSG00000176230	ENSG00000176230		"""GPCR / Class A : Olfactory receptors"""	15355	protein-coding gene	gene with protein product							Standard	NM_001004715		Approved		uc001vwo.1	Q8NGC6	OTTHUMG00000170783	ENST00000315543.4:c.37A>T	14.37:g.20585602A>T	ENSP00000319197:p.Ser13Cys	69.0	0.0		99.0	50.0	NM_001004715	Q6IF12	Missense_Mutation	SNP	ENST00000315543.4	37	CCDS32030.1	.	.	.	.	.	.	.	.	.	.	.	13.76	2.333352	0.41297	.	.	ENSG00000176230	ENST00000315543	T	0.28666	1.6	2.31	1.16	0.20824	.	.	.	.	.	T	0.26557	0.0649	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22208	-1.0223	6	0.45353	T	0.12	.	5.5848	0.17269	0.8479:0.0:0.1521:0.0	.	.	.	.	C	13	ENSP00000319197:S13C	ENSP00000319197:S13C	S	+	1	0	OR4K17	19655442	0.002000	0.14202	0.000000	0.03702	0.044000	0.14063	1.020000	0.30027	0.322000	0.23283	0.164000	0.16699	AGT	.		0.368	OR4K17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410346.1		
OR6P1	128366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158532535	158532535	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:158532535G>T	ENST00000334632.1	-	1	859	c.860C>A	c.(859-861)cCa>cAa	p.P287Q		NM_001160325.1	NP_001153797.1	Q8NGX9	OR6P1_HUMAN	olfactory receptor, family 6, subfamily P, member 1	287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|lung(1)	6						GTAGATGGCTGGGTTGAAGAA	0.493																																					p.P287Q		.											.	OR6P1	68	0			c.C860A						.						121.0	100.0	106.0					1																	158532535		692	1591	2283	SO:0001583	missense	128366	exon1			ATGGCTGGGTTGA	BK004193	CCDS53391.1	1q23.1	2012-08-09			ENSG00000186440	ENSG00000186440		"""GPCR / Class A : Olfactory receptors"""	15036	protein-coding gene	gene with protein product							Standard	NM_001160325		Approved		uc010pim.2	Q8NGX9	OTTHUMG00000019633	ENST00000334632.1:c.860C>A	1.37:g.158532535G>T	ENSP00000334721:p.Pro287Gln	77.0	0.0		131.0	30.0	NM_001160325	Q6IFR9	Missense_Mutation	SNP	ENST00000334632.1	37	CCDS53391.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.067957	0.55539	.	.	ENSG00000186440	ENST00000334632	T	0.64260	-0.09	5.11	5.11	0.69529	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43747	D	0.000530	T	0.81541	0.4844	M	0.91196	3.185	0.41222	D	0.986516	D	0.89917	1.0	D	0.91635	0.999	D	0.85446	0.1158	10	0.87932	D	0	.	17.4637	0.87626	0.0:0.0:1.0:0.0	.	287	Q8NGX9	OR6P1_HUMAN	Q	287	ENSP00000334721:P287Q	ENSP00000334721:P287Q	P	-	2	0	OR6P1	156799159	1.000000	0.71417	1.000000	0.80357	0.480000	0.33159	5.448000	0.66612	2.657000	0.90304	0.591000	0.81541	CCA	.		0.493	OR6P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051848.1		
OSBPL2	9885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	60835074	60835074	+	Silent	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr20:60835074G>A	ENST00000313733.3	+	3	277	c.75G>A	c.(73-75)gaG>gaA	p.E25E	OSBPL2_ENST00000439951.2_Intron|OSBPL2_ENST00000358053.2_Splice_Site_p.E13E	NM_144498.1	NP_653081.1	Q9H1P3	OSBL2_HUMAN	oxysterol binding protein-like 2	25					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			AATTTTCAGAGGCAAATCAGA	0.423																																					p.E25E		.											.	OSBPL2	69	0			c.G75A						.						94.0	98.0	97.0					20																	60835074		2203	4300	6503	SO:0001819	synonymous_variant	9885	exon3			TTCAGAGGCAAAT	AB018315	CCDS13494.1, CCDS13495.1, CCDS63323.1	20q13.3	2008-08-01	2001-11-28		ENSG00000130703	ENSG00000130703		"""Oxysterol binding proteins"""	15761	protein-coding gene	gene with protein product		606731	"""oxysterol-binding protein-like 2"""			10588946, 11861666	Standard	NM_144498		Approved	KIAA0772, ORP-2	uc002yck.1	Q9H1P3	OTTHUMG00000032909	ENST00000313733.3:c.75G>A	20.37:g.60835074G>A		42.0	0.0		103.0	9.0	NM_144498	A8K736|Q6IBT0|Q9BZB1|Q9Y4B8	Silent	SNP	ENST00000313733.3	37	CCDS13495.1																																																																																			.		0.423	OSBPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080021.1	NM_014835	
OTOGL	283310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	80762078	80762078	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr12:80762078G>C	ENST00000547103.1	+	54	6547	c.6541G>C	c.(6541-6543)Gtt>Ctt	p.V2181L	OTOGL_ENST00000458043.2_Missense_Mutation_p.V2193L|OTOGL_ENST00000546620.1_Missense_Mutation_p.V212L			Q3ZCN5	OTOGL_HUMAN	otogelin-like	2181					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TGGAACATCAGTTGTATACGC	0.423																																					p.V2193L		.											.	.	.	0			c.G6577C						.						136.0	119.0	125.0					12																	80762078		2203	4300	6503	SO:0001583	missense	283310	exon54			ACATCAGTTGTAT	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.6541G>C	12.37:g.80762078G>C	ENSP00000447211:p.Val2181Leu	55.0	0.0		60.0	17.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.14|11.14	1.549734|1.549734	0.27652|0.27652	.|.	.|.	ENSG00000165899|ENSG00000165899	ENST00000298820|ENST00000547103;ENST00000458043;ENST00000546620;ENST00000550182	.|T;T;T;T	.|0.42900	.|2.44;2.44;2.33;0.96	4.74|4.74	3.83|3.83	0.44106|0.44106	.|.	.|0.689513	.|0.13304	.|N	.|0.398006	T|T	0.30854|0.30854	0.0778|0.0778	L|L	0.42245|0.42245	1.32|1.32	0.24826|0.24826	N|N	0.992553|0.992553	.|B	.|0.30236	.|0.274	.|B	.|0.29353	.|0.101	T|T	0.18209|0.18209	-1.0344|-1.0344	5|10	.|0.15952	.|T	.|0.53	.|.	7.0272|7.0272	0.24946|0.24946	0.087:0.0:0.6063:0.3067|0.087:0.0:0.6063:0.3067	.|.	.|558	.|Q3ZCN5	.|OTOGL_HUMAN	H|L	600|2181;2193;212;210	.|ENSP00000447211:V2181L;ENSP00000400895:V2193L;ENSP00000449094:V212L;ENSP00000449641:V210L	.|ENSP00000400895:V2193L	Q|V	+|+	3|1	2|0	OTOGL|OTOGL	79286209|79286209	0.527000|0.527000	0.26306|0.26306	1.000000|1.000000	0.80357|0.80357	0.386000|0.386000	0.30323|0.30323	3.314000|3.314000	0.51943|0.51943	1.246000|1.246000	0.43901|0.43901	0.585000|0.585000	0.79938|0.79938	CAG|GTT	.		0.423	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
PALD1	27143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	72289050	72289050	+	Missense_Mutation	SNP	G	G	T	rs550643851		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr10:72289050G>T	ENST00000263563.6	+	3	519	c.251G>T	c.(250-252)cGg>cTg	p.R84L		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	84						cytosol (GO:0005829)											ACGTTGGGCCGGCTCTCGGAC	0.602																																					p.R84L		.											.	.	.	0			c.G251T						.						79.0	64.0	69.0					10																	72289050		2203	4300	6503	SO:0001583	missense	27143	exon3			TGGGCCGGCTCTC	AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.251G>T	10.37:g.72289050G>T	ENSP00000263563:p.Arg84Leu	14.0	0.0		38.0	14.0	NM_014431	B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Missense_Mutation	SNP	ENST00000263563.6	37	CCDS31215.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.610557	0.87258	.	.	ENSG00000107719	ENST00000263563;ENST00000373214	T	0.29142	1.58	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.60051	0.2239	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65829	-0.6073	10	0.87932	D	0	-35.6225	18.3331	0.90277	0.0:0.0:1.0:0.0	.	84	Q9ULE6	PALD_HUMAN	L	84	ENSP00000263563:R84L	ENSP00000263563:R84L	R	+	2	0	KIAA1274	71959056	1.000000	0.71417	1.000000	0.80357	0.603000	0.37013	6.226000	0.72277	2.501000	0.84356	0.655000	0.94253	CGG	.		0.602	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048515.2	NM_014431	
PARP12	64761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	139726111	139726111	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:139726111C>A	ENST00000263549.3	-	11	2539	c.1666G>T	c.(1666-1668)Gcc>Tcc	p.A556S		NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12	556	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					TCGTCCACGGCCTTCCCTCCG	0.582																																					p.A556S		.											.	PARP12	525	0			c.G1666T						.						97.0	89.0	92.0					7																	139726111		2203	4300	6503	SO:0001583	missense	64761	exon11			CCACGGCCTTCCC	AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.1666G>T	7.37:g.139726111C>A	ENSP00000263549:p.Ala556Ser	41.0	0.0		95.0	16.0	NM_022750	Q9H610|Q9NP36|Q9NTI3	Missense_Mutation	SNP	ENST00000263549.3	37	CCDS5857.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	c|c|c	7.093|7.093|7.093	0.572570|0.572570|0.572570	0.13623|0.13623|0.13623	.|.|.	.|.|.	ENSG00000059378|ENSG00000059378|ENSG00000059378	ENST00000263549|ENST00000489809|ENST00000484111	T|T|.	0.06142|0.53206|.	3.34|0.63|.	4.77|4.77|4.77	-0.402|-0.402|-0.402	0.12404|0.12404|0.12404	Poly(ADP-ribose) polymerase, catalytic domain (2);|.|.	1.698970|.|.	0.03082|.|.	N|.|.	0.158679|.|.	T|T|T	0.12433|0.12433|0.12433	0.0302|0.0302|0.0302	N|N|N	0.02286|0.02286|0.02286	-0.61|-0.61|-0.61	0.09310|0.09310|0.09310	N|N|N	1|1|1	B|.|.	0.09022|.|.	0.002|.|.	B|.|.	0.20184|.|.	0.028|.|.	T|T|T	0.30995|0.30995|0.30995	-0.9959|-0.9959|-0.9959	10|7|5	0.09590|0.31617|.	T|T|.	0.72|0.26|.	.|.|.	8.3507|8.3507|8.3507	0.32301|0.32301|0.32301	0.0:0.7035:0.1111:0.1854|0.0:0.7035:0.1111:0.1854|0.0:0.7035:0.1111:0.1854	.|.|.	556|.|.	Q9H0J9|.|.	PAR12_HUMAN|.|.	S|V|S	556|150|27	ENSP00000263549:A556S|ENSP00000417606:G150V|.	ENSP00000263549:A556S|ENSP00000417606:G150V|.	A|G|R	-|-|-	1|2|3	0|0|2	PARP12|PARP12|PARP12	139372580|139372580|139372580	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.000000|0.000000|0.000000	0.03702|0.03702|0.03702	0.722000|0.722000|0.722000	0.41435|0.41435|0.41435	-0.350000|-0.350000|-0.350000	0.07721|0.07721|0.07721	-0.430000|-0.430000|-0.430000	0.07318|0.07318|0.07318	0.461000|0.461000|0.461000	0.40582|0.40582|0.40582	GCC|GGC|AGG	.		0.582	PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348413.1	NM_022750	
PCDH11Y	83259	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	Y	4967403	4967403	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chrY:4967403A>G	ENST00000333703.4	+	5	2264	c.1751A>G	c.(1750-1752)cAg>cGg	p.Q584R	PCDH11Y_ENST00000215473.6_Missense_Mutation_p.Q595R|PCDH11Y_ENST00000362095.5_Missense_Mutation_p.Q595R	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	595	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						ATTATTGATCAGAATGACAAT	0.368																																					p.Q595R		.											.	.	.	0			c.A1784G						.						50.0	42.0	44.0					Y																	4967403		698	2094	2792	SO:0001583	missense	83259	exon2			TTGATCAGAATGA	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.1751A>G	Y.37:g.4967403A>G	ENSP00000330552:p.Gln584Arg	89.0	0.0		112.0	18.0	NM_032972	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000333703.4	37	CCDS14776.1																																																																																			.		0.368	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973	
PCDH1	5097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	141248170	141248170	+	Silent	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr5:141248170T>C	ENST00000394536.3	-	2	1006	c.867A>G	c.(865-867)ctA>ctG	p.L289L	PCDH1_ENST00000456271.1_Silent_p.L277L|PCDH1_ENST00000287008.3_Silent_p.L289L|PCDH1_ENST00000511044.1_5'Flank|PCDH1_ENST00000536585.1_Silent_p.L267L|PCDH1_ENST00000503492.1_Silent_p.L289L	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	289	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		TATTCTCAGATAGTTCGGCCT	0.612																																					p.L289L	Ovarian(132;1609 1739 4190 14731 45037)	.											.	PCDH1	95	0			c.A867G						.						37.0	39.0	39.0					5																	141248170		2203	4300	6503	SO:0001819	synonymous_variant	5097	exon2			CTCAGATAGTTCG	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.867A>G	5.37:g.141248170T>C		52.0	0.0		87.0	11.0	NM_032420	Q8IUP2	Silent	SNP	ENST00000394536.3	37	CCDS43375.1																																																																																			.		0.612	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420	
PCDH9	5101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	67800963	67800963	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr13:67800963C>T	ENST00000377865.2	-	1	1744	c.1610G>A	c.(1609-1611)cGa>cAa	p.R537Q	PCDH9_ENST00000456367.1_Missense_Mutation_p.R537Q|PCDH9_ENST00000377861.3_Missense_Mutation_p.R537Q|PCDH9_ENST00000328454.5_Missense_Mutation_p.R537Q|PCDH9_ENST00000544246.1_Missense_Mutation_p.R537Q			Q9HC56	PCDH9_HUMAN	protocadherin 9	537	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		AAAAATGAATCGTTCTTGTTC	0.463																																					p.R537Q		.											.	PCDH9	96	0			c.G1610A						.						87.0	89.0	88.0					13																	67800963		2203	4300	6503	SO:0001583	missense	5101	exon2			ATGAATCGTTCTT	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.1610G>A	13.37:g.67800963C>T	ENSP00000367096:p.Arg537Gln	85.0	0.0		77.0	30.0	NM_203487	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.299159	0.60195	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78	6.08	6.08	0.98989	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.55768	0.1941	N	0.17838	0.53	0.58432	D	0.999994	D;D;D;D	0.65815	0.978;0.99;0.994;0.995	P;P;P;D	0.63283	0.821;0.806;0.859;0.913	T	0.57602	-0.7783	10	0.62326	D	0.03	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	537;537;537;537	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	Q	537	ENSP00000442186:R537Q;ENSP00000367096:R537Q;ENSP00000401699:R537Q;ENSP00000332060:R537Q;ENSP00000367092:R537Q	ENSP00000332060:R537Q	R	-	2	0	PCDH9	66698964	0.974000	0.33945	0.732000	0.30844	0.992000	0.81027	6.089000	0.71384	2.894000	0.99253	0.655000	0.94253	CGA	.		0.463	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
PCK2	5106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24572377	24572377	+	Silent	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr14:24572377C>T	ENST00000216780.4	+	9	1649	c.1381C>T	c.(1381-1383)Ctg>Ttg	p.L461L	PCK2_ENST00000559250.1_Silent_p.L473L|PCK2_ENST00000545054.2_Silent_p.L327L|NRL_ENST00000561028.1_Intron|PCK2_ENST00000561286.1_Silent_p.L327L|PCK2_ENST00000558096.1_Intron	NM_004563.2	NP_004554.2	Q16822	PCKGM_HUMAN	phosphoenolpyruvate carboxykinase 2 (mitochondrial)	461					carbohydrate metabolic process (GO:0005975)|cellular response to glucose stimulus (GO:0071333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|NADH oxidation (GO:0006116)|oxaloacetate metabolic process (GO:0006107)|positive regulation of insulin secretion (GO:0032024)|pyruvate metabolic process (GO:0006090)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)|phosphoenolpyruvate carboxykinase activity (GO:0004611)			breast(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(265;0.0184)		AGGGGTACCCCTGGTATACGA	0.557																																					p.L461L		.											.	PCK2	227	0			c.C1381T						.						120.0	98.0	106.0					14																	24572377		2203	4300	6503	SO:0001819	synonymous_variant	5106	exon9			GTACCCCTGGTAT	AK129934	CCDS9609.1, CCDS41928.1	14q12	2006-06-09			ENSG00000100889	ENSG00000100889	4.1.1.32		8725	protein-coding gene	gene with protein product		614095				8645161, 9657976	Standard	XM_005267726		Approved	PEPCK, PEPCK2	uc001wlt.3	Q16822	OTTHUMG00000028791	ENST00000216780.4:c.1381C>T	14.37:g.24572377C>T		54.0	0.0		89.0	10.0	NM_004563	O43253|Q86U01|Q9BV62	Silent	SNP	ENST00000216780.4	37	CCDS9609.1																																																																																			.		0.557	PCK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071900.3	NM_001018073	
PCSK5	5125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	78965753	78965753	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr9:78965753C>A	ENST00000545128.1	+	35	5433	c.4895C>A	c.(4894-4896)gCg>gAg	p.A1632E		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	1632	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						GGAAAAGGAGCGTTGAATTGT	0.443																																					p.A1632E		.											.	PCSK5	93	0			c.C4895A						.						154.0	144.0	147.0					9																	78965753		876	1991	2867	SO:0001583	missense	5125	exon35			AAGGAGCGTTGAA		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.4895C>A	9.37:g.78965753C>A	ENSP00000446280:p.Ala1632Glu	54.0	0.0		65.0	28.0	NM_001190482	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	C	15.36	2.811372	0.50527	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000424854	T;T	0.63417	-0.04;-0.04	5.87	2.94	0.34122	.	0.523213	0.19934	N	0.102782	T	0.47469	0.1447	L	0.48877	1.53	0.09310	N	0.999999	.	.	.	.	.	.	T	0.39014	-0.9634	8	0.02654	T	1	-0.704	6.9448	0.24512	0.1212:0.5789:0.2345:0.0654	.	.	.	.	E	1632;1362;1332	ENSP00000446280:A1632E;ENSP00000411654:A1332E	ENSP00000365945:A1362E	A	+	2	0	PCSK5	78155573	0.005000	0.15991	0.007000	0.13788	0.116000	0.19942	0.077000	0.14738	0.430000	0.26230	0.655000	0.94253	GCG	.		0.443	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PDE11A	50940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	178634089	178634089	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:178634089G>A	ENST00000286063.6	-	10	2067	c.1750C>T	c.(1750-1752)Cat>Tat	p.H584Y	PDE11A_ENST00000497003.1_5'UTR|PDE11A_ENST00000358450.4_Missense_Mutation_p.H334Y|PDE11A_ENST00000409504.1_Missense_Mutation_p.H226Y|PDE11A_ENST00000449286.2_Missense_Mutation_p.H226Y|PDE11A_ENST00000389683.3_Missense_Mutation_p.H140Y	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	584					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	CATGTTGCATGGTATGATAGC	0.338									Primary Pigmented Nodular Adrenocortical Disease, Familial																												p.H584Y		.											.	PDE11A	93	0			c.C1750T						.						102.0	93.0	96.0					2																	178634089		2203	4300	6503	SO:0001583	missense	50940	exon10	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	TTGCATGGTATGA	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.1750C>T	2.37:g.178634089G>A	ENSP00000286063:p.His584Tyr	38.0	0.0		55.0	27.0	NM_016953	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	ENST00000286063.6	37	CCDS33334.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928267	0.73327	.	.	ENSG00000128655	ENST00000286063;ENST00000358450;ENST00000409504;ENST00000389683;ENST00000449286	T;T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44;-0.44	5.73	5.73	0.89815	.	0.183052	0.64402	D	0.000017	D	0.84474	0.5480	M	0.88377	2.95	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.997;0.998	D	0.86669	0.1909	10	0.87932	D	0	.	15.7604	0.78076	0.0:0.0:1.0:0.0	.	334;584	Q9HCR9-2;Q9HCR9	.;PDE11_HUMAN	Y	584;334;226;140;226	ENSP00000286063:H584Y;ENSP00000351232:H334Y;ENSP00000386539:H226Y;ENSP00000374333:H140Y;ENSP00000390599:H226Y	ENSP00000286063:H584Y	H	-	1	0	PDE11A	178342335	1.000000	0.71417	0.999000	0.59377	0.927000	0.56198	5.937000	0.70162	2.854000	0.98071	0.655000	0.94253	CAT	.		0.338	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2		
PDE1B	5153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54963367	54963367	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr12:54963367T>C	ENST00000243052.3	+	5	884	c.448T>C	c.(448-450)Tac>Cac	p.Y150H	PDE1B_ENST00000538346.1_Missense_Mutation_p.Y109H|PDE1B_ENST00000394277.3_3'UTR|PDE1B_ENST00000550620.1_Missense_Mutation_p.Y130H	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	150					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	GGGCCCCACTTACTCTACTGC	0.507																																					p.Y150H		.											.	PDE1B	92	0			c.T448C						.						141.0	115.0	124.0					12																	54963367		2203	4300	6503	SO:0001583	missense	5153	exon5			CCCACTTACTCTA	U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.448T>C	12.37:g.54963367T>C	ENSP00000243052:p.Tyr150His	90.0	0.0		111.0	47.0	NM_000924	Q92825|Q96KP3	Missense_Mutation	SNP	ENST00000243052.3	37	CCDS8882.1	.	.	.	.	.	.	.	.	.	.	T	16.42	3.116963	0.56505	.	.	ENSG00000123360	ENST00000243052;ENST00000538346;ENST00000550620	T;T;T	0.69926	-0.44;-0.4;-0.41	4.16	0.618	0.17624	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.480321	0.21722	N	0.070103	T	0.73210	0.3558	M	0.67397	2.05	0.36352	D	0.860136	D;D	0.62365	0.991;0.984	D;P	0.67725	0.953;0.899	T	0.72181	-0.4368	10	0.37606	T	0.19	.	6.8959	0.24255	0.0:0.3464:0.0:0.6536	.	130;150	Q01064-2;Q01064	.;PDE1B_HUMAN	H	150;109;130	ENSP00000243052:Y150H;ENSP00000442559:Y109H;ENSP00000448519:Y130H	ENSP00000243052:Y150H	Y	+	1	0	PDE1B	53249634	0.971000	0.33674	0.780000	0.31762	0.694000	0.40290	0.357000	0.20199	0.097000	0.17492	0.533000	0.62120	TAC	.		0.507	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1		
PDE4C	5143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	18321780	18321780	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:18321780G>C	ENST00000355502.3	-	19	2969	c.2098C>G	c.(2098-2100)Cca>Gca	p.P700A	PDE4C_ENST00000598111.2_Missense_Mutation_p.P415A|PDE4C_ENST00000262805.12_Missense_Mutation_p.P668A|PDE4C_ENST00000594465.3_Missense_Mutation_p.P700A|PDE4C_ENST00000594617.3_Missense_Mutation_p.P700A|PDE4C_ENST00000447275.3_Missense_Mutation_p.P594A|PDE4C_ENST00000539010.1_Missense_Mutation_p.P469A|AC068499.10_ENST00000599416.2_RNA|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000597297.1_Missense_Mutation_p.P470A			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	700					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	CCAGGGTCTGGGCCGGCTTCA	0.587																																					p.P700A		.											.	PDE4C	94	0			c.C2098G						.						98.0	78.0	85.0					19																	18321780		2203	4300	6503	SO:0001583	missense	5143	exon16			GGTCTGGGCCGGC		CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.2098C>G	19.37:g.18321780G>C	ENSP00000347689:p.Pro700Ala	77.0	0.0		89.0	34.0	NM_000923	B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Missense_Mutation	SNP	ENST00000355502.3	37	CCDS12373.1	.	.	.	.	.	.	.	.	.	.	G	8.024	0.760210	0.15914	.	.	ENSG00000105650	ENST00000536045;ENST00000355502;ENST00000536507;ENST00000262805;ENST00000447275;ENST00000545961;ENST00000336173;ENST00000539010;ENST00000543547	T;T;T;T	0.69806	-0.43;-0.41;-0.39;-0.11	3.85	0.201	0.15186	.	3.221270	0.00682	N	0.000687	T	0.52500	0.1738	L	0.40543	1.245	0.09310	N	1	B;B;B;B	0.22683	0.043;0.073;0.043;0.003	B;B;B;B	0.21708	0.01;0.036;0.027;0.003	T	0.19484	-1.0304	10	0.07644	T	0.81	.	3.5148	0.07721	0.2269:0.0:0.5773:0.1957	.	700;668;506;415	Q08493;Q08493-3;O43850;O76104	PDE4C_HUMAN;.;.;.	A	779;700;688;668;594;506;414;469;809	ENSP00000347689:P700A;ENSP00000262805:P668A;ENSP00000402091:P594A;ENSP00000439470:P469A	ENSP00000262805:P668A	P	-	1	0	PDE4C	18182780	0.001000	0.12720	0.001000	0.08648	0.000000	0.00434	0.913000	0.28611	0.317000	0.23160	-0.263000	0.10527	CCA	.		0.587	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466295.1		
PDHA1	5160	broad.mit.edu;bcgsc.ca	37	X	19367484	19367484	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chrX:19367484A>G	ENST00000422285.2	+	2	217	c.112A>G	c.(112-114)Att>Gtt	p.I38V	PDHA1_ENST00000540249.1_Missense_Mutation_p.I38V|PDHA1_ENST00000379805.3_Missense_Mutation_p.I38V|PDHA1_ENST00000545074.1_Missense_Mutation_p.I38V|PDHA1_ENST00000379806.5_Missense_Mutation_p.I76V			P08559	ODPA_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 1	38					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)	18	Hepatocellular(33;0.183)					TACATTTGAAATTAAGGTAAG	0.303																																					p.I76V		.											.	PDHA1	227	0			c.A226G						.						72.0	65.0	68.0					X																	19367484		2203	4298	6501	SO:0001583	missense	5160	exon3			TTTGAAATTAAGG		CCDS14192.1, CCDS55380.1, CCDS55381.1, CCDS55382.1	Xp22.1	2008-02-05			ENSG00000131828	ENSG00000131828	1.2.4.1		8806	protein-coding gene	gene with protein product		300502		PDHA			Standard	NM_001173454		Approved		uc004czh.4	P08559	OTTHUMG00000021224	ENST00000422285.2:c.112A>G	X.37:g.19367484A>G	ENSP00000394382:p.Ile38Val	75.0	0.0		82.0	5.0	NM_001173454	A5YVE9|B2R5P7|B7Z3T7|B7Z3X5|Q53H41|Q5JPT8|Q9NP12|Q9UBJ8|Q9UBU0|Q9UNG4|Q9UNG5	Missense_Mutation	SNP	ENST00000422285.2	37	CCDS14192.1	.	.	.	.	.	.	.	.	.	.	A	12.26	1.883265	0.33255	.	.	ENSG00000131828	ENST00000379806;ENST00000545074;ENST00000540249;ENST00000423505;ENST00000417819;ENST00000422285;ENST00000355808;ENST00000379815;ENST00000379805	D;D;D;D;D;D;D;D	0.98649	-4.63;-4.55;-4.38;-4.8;-3.23;-4.57;-5.05;-4.89	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.96932	0.8998	M	0.68952	2.095	0.52099	D	0.999944	B;B;B;B;B	0.09022	0.002;0.0;0.0;0.001;0.0	B;B;B;B;B	0.10450	0.005;0.002;0.003;0.002;0.003	D	0.94782	0.7954	10	0.19590	T	0.45	-21.4569	9.7769	0.40626	0.9185:0.0:0.0815:0.0	.	38;38;38;76;38	B7Z3X5;B7Z3T7;B2R5P7;A5YVE9;P08559	.;.;.;.;ODPA_HUMAN	V	76;38;38;76;66;38;38;66;38	ENSP00000369134:I76V;ENSP00000438550:I38V;ENSP00000440761:I38V;ENSP00000406473:I76V;ENSP00000404616:I66V;ENSP00000394382:I38V;ENSP00000348062:I38V;ENSP00000369133:I38V	ENSP00000348062:I38V	I	+	1	0	PDHA1	19277405	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.192000	0.50989	1.878000	0.54408	0.486000	0.48141	ATT	.		0.303	PDHA1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055977.1		
PIK3C2B	5287	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	204429747	204429747	+	Silent	SNP	G	G	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:204429747G>C	ENST00000367187.3	-	7	1909	c.1353C>G	c.(1351-1353)cgC>cgG	p.R451R	PIK3C2B_ENST00000424712.2_Silent_p.R451R	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	451	PI3K-RBD. {ECO:0000255|PROSITE- ProRule:PRU00879}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			TGTCAAACTTGCGGCAGTATT	0.562																																					p.R451R		.											.	PIK3C2B	1310	0			c.C1353G						.						155.0	122.0	133.0					1																	204429747		2203	4300	6503	SO:0001819	synonymous_variant	5287	exon7			AAACTTGCGGCAG	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.1353C>G	1.37:g.204429747G>C		60.0	0.0		144.0	9.0	NM_002646	O95666|Q5SW99	Silent	SNP	ENST00000367187.3	37	CCDS1446.1																																																																																			.		0.562	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646	
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	110535606	110535606	+	Missense_Mutation	SNP	C	C	T	rs267601722		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr8:110535606C>T	ENST00000378402.5	+	76	12579	c.12475C>T	c.(12475-12477)Ctt>Ttt	p.L4159F		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	4159					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CCTTACTCCCCTTAGAACAGG	0.388										HNSCC(38;0.096)																											p.L4159F		.											.	PKHD1L1	145	0			c.C12475T						.						135.0	125.0	128.0					8																	110535606		1889	4116	6005	SO:0001583	missense	93035	exon76			ACTCCCCTTAGAA	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.12475C>T	8.37:g.110535606C>T	ENSP00000367655:p.Leu4159Phe	91.0	0.0		123.0	7.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	6.308	0.424906	0.11987	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.85702	-2.02;-1.85	5.82	4.87	0.63330	.	0.898083	0.09506	N	0.793031	T	0.78848	0.4348	L	0.51422	1.61	0.21740	N	0.999568	P	0.40398	0.716	B	0.36186	0.219	T	0.66376	-0.5939	10	0.10111	T	0.7	.	10.4284	0.44391	0.2397:0.7603:0.0:0.0	.	4159	Q86WI1	PKHL1_HUMAN	F	4159;1087	ENSP00000367655:L4159F;ENSP00000437376:L1087F	ENSP00000367655:L4159F	L	+	1	0	PKHD1L1	110604782	0.187000	0.23238	0.996000	0.52242	0.742000	0.42306	0.551000	0.23361	2.751000	0.94390	0.650000	0.86243	CTT	.		0.388	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
PLCB4	5332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	9319611	9319611	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr20:9319611G>C	ENST00000378493.1	+	4	311	c.296G>C	c.(295-297)tGt>tCt	p.C99S	PLCB4_ENST00000378501.2_Missense_Mutation_p.C99S|PLCB4_ENST00000278655.4_Missense_Mutation_p.C99S|PLCB4_ENST00000334005.3_Missense_Mutation_p.C99S|PLCB4_ENST00000378473.3_Missense_Mutation_p.C99S|PLCB4_ENST00000414679.2_Missense_Mutation_p.C99S|PLCB4_ENST00000492632.1_3'UTR			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	99					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						CGGATAGTTTGTGTCTGCAGT	0.408																																					p.C99S		.											.	PLCB4	274	0			c.G296C						.						159.0	143.0	149.0					20																	9319611		2203	4300	6503	SO:0001583	missense	5332	exon5			TAGTTTGTGTCTG		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.296G>C	20.37:g.9319611G>C	ENSP00000367754:p.Cys99Ser	57.0	0.0		88.0	27.0	NM_182797	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	ENST00000378493.1	37	CCDS13105.1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.903745	0.52333	.	.	ENSG00000101333	ENST00000407043;ENST00000441846;ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501	T;T;T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09;1.09;1.09	5.57	5.57	0.84162	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.55289	0.1911	L	0.29908	0.895	0.80722	D	1	B;D;B	0.57899	0.429;0.981;0.253	B;D;B	0.69824	0.183;0.966;0.115	T	0.57087	-0.7871	10	0.66056	D	0.02	.	19.5465	0.95299	0.0:0.0:1.0:0.0	.	99;99;99	E2QRH8;Q15147;Q15147-4	.;PLCB4_HUMAN;.	S	99	ENSP00000385805:C99S;ENSP00000412982:C99S;ENSP00000334105:C99S;ENSP00000367734:C99S;ENSP00000278655:C99S;ENSP00000367754:C99S;ENSP00000367762:C99S	ENSP00000278655:C99S	C	+	2	0	PLCB4	9267611	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.818000	0.91991	2.643000	0.89663	0.591000	0.81541	TGT	.		0.408	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
PLCE1	51196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	96006140	96006140	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr10:96006140T>C	ENST00000371380.3	+	7	3093	c.2858T>C	c.(2857-2859)aTa>aCa	p.I953T	PLCE1_ENST00000260766.3_Missense_Mutation_p.I953T|PLCE1_ENST00000371375.1_Missense_Mutation_p.I645T|PLCE1_ENST00000371385.3_Missense_Mutation_p.I645T			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	953					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				GGCATTGATATACACACTGTG	0.473																																					p.I953T		.											.	PLCE1	229	0			c.T2858C						.						123.0	124.0	124.0					10																	96006140		1971	4161	6132	SO:0001583	missense	51196	exon8			TTGATATACACAC		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.2858T>C	10.37:g.96006140T>C	ENSP00000360431:p.Ile953Thr	92.0	0.0		112.0	51.0	NM_016341	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	T	16.77	3.215138	0.58452	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	6.04	6.04	0.98038	.	0.237560	0.43579	D	0.000560	T	0.34803	0.0910	N	0.24115	0.695	0.40129	D	0.976695	B;B;B	0.25007	0.116;0.082;0.051	B;B;B	0.27380	0.034;0.079;0.012	T	0.19451	-1.0305	10	0.72032	D	0.01	.	16.6349	0.85050	0.0:0.0:0.0:1.0	.	953;645;953	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	T	953;953;645;645	ENSP00000260766:I953T;ENSP00000360431:I953T;ENSP00000360438:I645T;ENSP00000360426:I645T	ENSP00000260766:I953T	I	+	2	0	PLCE1	95996130	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.803000	0.69129	2.330000	0.79161	0.477000	0.44152	ATA	.		0.473	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
PLEK	5341	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	68613639	68613639	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:68613639T>A	ENST00000234313.7	+	5	657	c.478T>A	c.(478-480)Tgc>Agc	p.C160S		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	160	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		TCTAGGTAACTGCGTCATTGA	0.532																																					p.C160S		.											.	PLEK	91	0			c.T478A						.						109.0	93.0	98.0					2																	68613639		2203	4300	6503	SO:0001583	missense	5341	exon5			GGTAACTGCGTCA	X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.478T>A	2.37:g.68613639T>A	ENSP00000234313:p.Cys160Ser	50.0	0.0		77.0	16.0	NM_002664	B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Missense_Mutation	SNP	ENST00000234313.7	37	CCDS1887.1	.	.	.	.	.	.	.	.	.	.	T	0.529	-0.858737	0.02610	.	.	ENSG00000115956	ENST00000234313	T	0.20598	2.06	5.23	4.02	0.46733	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.255160	0.46145	D	0.000303	T	0.13200	0.0320	L	0.28274	0.84	0.34774	D	0.734028	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.002	T	0.16748	-1.0392	10	0.07990	T	0.79	.	12.2787	0.54751	0.0:0.0:0.3339:0.6661	.	178;160	Q59GZ2;P08567	.;PLEK_HUMAN	S	160	ENSP00000234313:C160S	ENSP00000234313:C160S	C	+	1	0	PLEK	68467143	0.995000	0.38212	1.000000	0.80357	0.684000	0.39900	-0.260000	0.08708	0.727000	0.32360	0.533000	0.62120	TGC	.		0.532	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251755.1	NM_002664	
PLXNB2	23654	broad.mit.edu;bcgsc.ca	37	22	50721222	50721234	+	Frame_Shift_Del	DEL	GGGACCCCCCGTA	GGGACCCCCCGTA	-	rs558571072|rs373522178|rs537392262		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	GGGACCCCCCGTA	GGGACCCCCCGTA	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr22:50721222_50721234delGGGACCCCCCGTA	ENST00000449103.1	-	18	3033_3045	c.2893_2905delTACGGGGGGTCCC	c.(2893-2907)tacggggggtcccccfs	p.YGGSP965fs	PLXNB2_ENST00000359337.4_Frame_Shift_Del_p.YGGSP965fs|PLXNB2_ENST00000496720.1_5'Flank			O15031	PLXB2_HUMAN	plexin B2	965	IPT/TIG 2.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)	p.P1012S(1)		breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TTGGGCACGGGGGACCCCCCGTAGGAGACCTCC	0.662																																					p.965_969del		.											.	PLXNB2	211	1	Substitution - Missense(1)	skin(1)	c.2893_2905del						.																																			SO:0001589	frameshift_variant	23654	exon18			GCACGGGGGACCC		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.2893_2905delTACGGGGGGTCCC	22.37:g.50721222_50721234delGGGACCCCCCGTA	ENSP00000409171:p.Tyr965fs	48.0	0.0		35.0	7.0	NM_012401	A6QRH0|Q7KZU3|Q9BSU7	Frame_Shift_Del	DEL	ENST00000449103.1	37	CCDS43035.1																																																																																			.		0.662	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
POU5F1B	5462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	128428491	128428491	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr8:128428491A>G	ENST00000465342.2	+	2	1537	c.380A>G	c.(379-381)gAg>gGg	p.E127G	CASC8_ENST00000502082.1_RNA|POU5F1B_ENST00000391675.1_Missense_Mutation_p.E127G|CASC8_ENST00000501396.1_RNA|CASC8_ENST00000523825.1_RNA			Q06416	P5F1B_HUMAN	POU class 5 homeobox 1B	127					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)|prostate(1)|urinary_tract(1)	3						CTGGAGAAGGAGAAGCTAGAG	0.587																																					p.E127G		.											.	.	.	0			c.A380G						.						20.0	19.0	19.0					8																	128428491		692	1591	2283	SO:0001583	missense	5462	exon1			AGAAGGAGAAGCT	AF268615	CCDS55274.1	8q24.21	2011-06-20	2009-04-15	2009-04-15	ENSG00000212993	ENSG00000212993		"""Homeoboxes / POU class"""	9223	protein-coding gene	gene with protein product		615739	"""POU domain class 5, transcription factor 1 pseudogene 1"", ""POU class 5 homeobox 1 pseudogene 1"""	OTF3P1, POU5F1P1		1408763	Standard	NM_001159542		Approved	OTF3C	uc003ysf.3	Q06416	OTTHUMG00000157807	ENST00000465342.2:c.380A>G	8.37:g.128428491A>G	ENSP00000419298:p.Glu127Gly	32.0	0.0		73.0	34.0	NM_001159542	D5K9S4|D5K9S9|D5K9T0|D5K9T1|D5K9T3|D5K9U3|D5K9U6|D5K9V4|D5K9V6|D5K9W0|D5K9W2|D5K9W7|D5K9X2|D5K9X3|D5K9X5|D5K9X8|D5K9X9|E9LRB1|E9LRB2|E9LRH5|E9LRH6|E9LRH7|E9LRK4|E9LRK5|E9LRK7|E9LRK8|E9LRM7|E9LRM9|E9LRN2|E9LRN4|E9LRN5|E9LRP8|E9LRQ0|E9LRQ2|E9LRQ3|E9LRQ4|E9LRQ5|E9LRS3|Q2VIK6|Q9BZV7|Q9BZV9	Missense_Mutation	SNP	ENST00000465342.2	37	CCDS55274.1	.	.	.	.	.	.	.	.	.	.	A	12.25	1.881019	0.33255	.	.	ENSG00000212993	ENST00000465342;ENST00000391675	T;T	0.24151	1.87;1.87	1.59	0.214	0.15249	.	0.000000	0.42964	D	0.000633	T	0.31670	0.0804	L	0.59436	1.845	0.09310	N	1	D	0.69078	0.997	D	0.66847	0.947	T	0.22103	-1.0226	10	0.17369	T	0.5	.	1.5534	0.02580	0.4987:0.0:0.1968:0.3045	.	127	Q06416	P5F1B_HUMAN	G	127	ENSP00000419298:E127G;ENSP00000375557:E127G	ENSP00000375557:E127G	E	+	2	0	POU5F1B	128497673	0.023000	0.18921	0.000000	0.03702	0.110000	0.19582	1.216000	0.32443	0.059000	0.16252	0.102000	0.15555	GAG	.		0.587	POU5F1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349649.2	NM_001159542	
PPAP2C	8612	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	291305	291305	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:291305T>C	ENST00000269812.3	-	1	81	c.32A>G	c.(31-33)gAc>gGc	p.D11G	PPAP2C_ENST00000434325.2_Intron|PPAP2C_ENST00000327790.3_5'Flank	NM_003712.2|NM_177526.1	NP_003703.1|NP_803545.1	O43688	LPP2_HUMAN	phosphatidic acid phosphatase type 2C	11					dephosphorylation (GO:0016311)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(1)|skin(1)	5		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCACAGCACGTCGAGCAGCAC	0.731																																					p.D11G		.											.	PPAP2C	90	0			c.A32G						.						47.0	52.0	50.0					19																	291305		2180	4285	6465	SO:0001583	missense	8612	exon1			AGCACGTCGAGCA	AF035959	CCDS12023.1, CCDS12024.1, CCDS45889.1	19p13	2009-05-27				ENSG00000141934	3.1.3.4		9230	protein-coding gene	gene with protein product		607126				9570154, 9607309	Standard	NM_177543		Approved	PAP-2c, LPP2	uc002loh.3	O43688		ENST00000269812.3:c.32A>G	19.37:g.291305T>C	ENSP00000269812:p.Asp11Gly	53.0	1.0		94.0	15.0	NM_003712	A6NLV0|E9PAY8	Missense_Mutation	SNP	ENST00000269812.3	37	CCDS12023.1	.	.	.	.	.	.	.	.	.	.	t	20.7	4.037201	0.75617	.	.	ENSG00000141934	ENST00000269812	T	0.74421	-0.84	3.51	3.51	0.40186	.	.	.	.	.	T	0.81597	0.4856	M	0.62209	1.925	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.81560	-0.0877	9	0.72032	D	0.01	.	8.4192	0.32690	0.0:0.0:0.0:1.0	.	11	O43688	LPP2_HUMAN	G	11	ENSP00000269812:D11G	ENSP00000269812:D11G	D	-	2	0	PPAP2C	242305	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	2.474000	0.45154	1.226000	0.43582	0.240000	0.17902	GAC	.		0.731	PPAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451777.2		
PPP1R13B	23368	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	104205095	104205095	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr14:104205095C>T	ENST00000202556.9	-	14	3067	c.2785G>A	c.(2785-2787)Gtc>Atc	p.V929I	PPP1R13B_ENST00000423488.2_Missense_Mutation_p.V348I|PPP1R13B_ENST00000555391.1_5'UTR	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	929					intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				CCGGCGCAGACGGCGTTGTGC	0.607																																					p.V929I		.											.	PPP1R13B	227	0			c.G2785A						.						133.0	145.0	141.0					14																	104205095		2159	4263	6422	SO:0001583	missense	23368	exon14			CGCAGACGGCGTT	AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.2785G>A	14.37:g.104205095C>T	ENSP00000202556:p.Val929Ile	103.0	0.0		112.0	23.0	NM_015316	B2RMX5|O94870	Missense_Mutation	SNP	ENST00000202556.9	37	CCDS41997.1	.	.	.	.	.	.	.	.	.	.	C	35	5.425828	0.96131	.	.	ENSG00000088808	ENST00000202556;ENST00000423488	T;T	0.68181	-0.1;-0.31	5.25	5.25	0.73442	Src homology-3 domain (1);Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.77478	0.4136	L	0.54908	1.71	0.80722	D	1	D	0.59357	0.985	D	0.77004	0.989	T	0.69892	-0.5022	10	0.13853	T	0.58	.	19.0309	0.92957	0.0:1.0:0.0:0.0	.	929	Q96KQ4	ASPP1_HUMAN	I	929;348	ENSP00000202556:V929I;ENSP00000395213:V348I	ENSP00000202556:V929I	V	-	1	0	PPP1R13B	103274848	1.000000	0.71417	0.991000	0.47740	0.642000	0.38348	7.528000	0.81941	2.744000	0.94065	0.561000	0.74099	GTC	.		0.607	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414591.1	NM_015316	
PRDM15	63977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	43248679	43248679	+	Silent	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr21:43248679C>A	ENST00000269844.3	-	19	2585	c.2475G>T	c.(2473-2475)acG>acT	p.T825T	PRDM15_ENST00000538201.1_Silent_p.T479T|PRDM15_ENST00000398548.1_Silent_p.T496T|PRDM15_ENST00000447207.2_Silent_p.T459T|PRDM15_ENST00000422911.1_Silent_p.T516T	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	825					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						CACATTGGAACGTCTTGTCAT	0.478																																					p.T825T		.											.	PRDM15	90	0			c.G2475T						.						410.0	347.0	368.0					21																	43248679		2203	4300	6503	SO:0001819	synonymous_variant	63977	exon19			TTGGAACGTCTTG	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.2475G>T	21.37:g.43248679C>A		38.0	0.0		58.0	9.0	NM_022115	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Silent	SNP	ENST00000269844.3	37	CCDS13676.1																																																																																			.		0.478	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
PRKAG2	51422	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	151254299	151254299	+	Silent	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:151254299T>C	ENST00000287878.4	-	16	2202	c.1698A>G	c.(1696-1698)acA>acG	p.T566T	PRKAG2_ENST00000492843.1_Silent_p.T442T|PRKAG2_ENST00000392801.2_Silent_p.T522T|PRKAG2_ENST00000418337.2_Silent_p.T325T|PRKAG2_ENST00000433631.2_Silent_p.T441T	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit	566					ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	ACTCCGTTTCTGTCTCCTTTT	0.498																																					p.T566T		.											.	PRKAG2	658	0			c.A1698G						.						235.0	221.0	226.0					7																	151254299		2203	4300	6503	SO:0001819	synonymous_variant	51422	exon16			CGTTTCTGTCTCC	AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.1698A>G	7.37:g.151254299T>C		75.0	0.0		177.0	36.0	NM_016203	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Silent	SNP	ENST00000287878.4	37	CCDS5928.1																																																																																			.		0.498	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348440.2	NM_016203	
PRKDC	5591	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	48794637	48794637	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr8:48794637T>C	ENST00000314191.2	-	38	4851	c.4795A>G	c.(4795-4797)Atg>Gtg	p.M1599V	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Missense_Mutation_p.M1599V	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	1600					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TGGTCTAACATGCCGTTCAAA	0.398								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	.											.	PRKDC	1515	0			.						.						134.0	125.0	128.0					8																	48794637		1889	4126	6015	SO:0001583	missense	5591	.			CTAACATGCCGTT		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.4795A>G	8.37:g.48794637T>C	ENSP00000313420:p.Met1599Val	47.0	0.0		63.0	21.0	.	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		.	.	.	.	.	.	.	.	.	.	T	6.118	0.389991	0.11581	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.02395	4.38;4.31	5.28	2.84	0.33178	Armadillo-like helical (1);Armadillo-type fold (1);	0.161766	0.52532	D	0.000063	T	0.04588	0.0125	M	0.64404	1.975	0.45250	D	0.998251	B;B	0.32573	0.102;0.376	B;B	0.30316	0.03;0.114	T	0.33059	-0.9883	10	0.66056	D	0.02	.	12.2316	0.54490	0.0:0.0:0.3453:0.6547	.	1599;1600	E7EUY0;P78527	.;PRKDC_HUMAN	V	1599	ENSP00000313420:M1599V;ENSP00000345182:M1599V	ENSP00000313420:M1599V	M	-	1	0	PRKDC	48957190	0.981000	0.34729	0.937000	0.37676	0.218000	0.24690	1.789000	0.38724	0.277000	0.22141	0.377000	0.23210	ATG	.		0.398	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
PROSER1	80209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	39588511	39588511	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr13:39588511T>C	ENST00000352251.3	-	11	1711	c.878A>G	c.(877-879)aAt>aGt	p.N293S	PROSER1_ENST00000350125.3_Missense_Mutation_p.N271S|PROSER1_ENST00000484434.3_Intron	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	293	Pro-rich.																TGATGGATGATTAATTGCCTT	0.502																																					p.N293S		.											.	.	.	0			c.A878G						.						112.0	93.0	99.0					13																	39588511		2203	4300	6503	SO:0001583	missense	80209	exon11			GGATGATTAATTG	AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.878A>G	13.37:g.39588511T>C	ENSP00000332034:p.Asn293Ser	45.0	0.0		59.0	25.0	NM_025138	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	ENST00000352251.3	37	CCDS9368.2	.	.	.	.	.	.	.	.	.	.	T	0.015	-1.568324	0.00895	.	.	ENSG00000120685	ENST00000352251;ENST00000350125	T;T	0.30981	1.51;1.51	4.52	-6.58	0.01836	.	.	.	.	.	T	0.12263	0.0298	N	0.11560	0.145	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.33343	-0.9872	8	.	.	.	-0.3502	8.0823	0.30752	0.0:0.4538:0.233:0.3132	.	271;293	A6NJ97;Q86XN7	.;PRSR1_HUMAN	S	293;271	ENSP00000332034:N293S;ENSP00000339123:N271S	.	N	-	2	0	PROSER1	38486511	0.050000	0.20438	0.000000	0.03702	0.000000	0.00434	-0.124000	0.10595	-1.559000	0.01688	-1.964000	0.00472	AAT	.		0.502	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044607.5	NM_025138	
PSG3	5671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	43237165	43237165	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:43237165C>A	ENST00000327495.5	-	3	664	c.480G>T	c.(478-480)gaG>gaT	p.E160D	PSG3_ENST00000595140.1_Missense_Mutation_p.E160D|PSG3_ENST00000490592.1_5'Flank	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	160	Ig-like C2-type 1.				defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				CCTCCATGTCCTCCCTGGGGT	0.542																																					p.E160D		.											.	PSG3	92	0			c.G480T						.						202.0	199.0	200.0					19																	43237165		2203	4300	6503	SO:0001583	missense	5671	exon3			CATGTCCTCCCTG		CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.480G>T	19.37:g.43237165C>A	ENSP00000332215:p.Glu160Asp	47.0	0.0		62.0	22.0	NM_021016	Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	ENST00000327495.5	37	CCDS12611.1	.	.	.	.	.	.	.	.	.	.	-	11.75	1.731758	0.30684	.	.	ENSG00000221826	ENST00000327495	T	0.12672	2.66	1.59	0.424	0.16468	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.36496	0.0969	M	0.89968	3.075	0.09310	N	1	D;P	0.63880	0.993;0.798	D;P	0.70935	0.971;0.797	T	0.12630	-1.0540	9	0.87932	D	0	.	4.0653	0.09857	0.0:0.7552:0.0:0.2448	.	138;160	Q08266;Q16557	.;PSG3_HUMAN	D	160	ENSP00000332215:E160D	ENSP00000332215:E160D	E	-	3	2	PSG3	47929005	0.001000	0.12720	0.003000	0.11579	0.006000	0.05464	-0.169000	0.09911	0.021000	0.15133	0.393000	0.25936	GAG	.		0.542	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321423.2	NM_021016	
PRR12	57479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50119469	50119469	+	Silent	SNP	C	C	T	rs200097233	byFrequency	TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:50119469C>T	ENST00000418929.2	+	9	5502	c.5490C>T	c.(5488-5490)agC>agT	p.S1830S		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	1009							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		GAGCCCCCAGCGAGGACGGTG	0.682													C|||	5	0.000998403	0.0015	0.0043	5008	,	,		13540	0.0		0.0	False		,,,				2504	0.0				p.S1830S		.											.	PRR12	70	0			c.C5490T						.	C		2,3754		0,2,1876	5.0	7.0	6.0		5490	-6.6	0.9	19		6	0,8082		0,0,4041	no	coding-synonymous	PRR12	NM_020719.1		0,2,5917	TT,TC,CC		0.0,0.0532,0.0169		1830/2037	50119469	2,11836	1878	4041	5919	SO:0001819	synonymous_variant	57479	exon9			CCCCAGCGAGGAC	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.5490C>T	19.37:g.50119469C>T		26.0	0.0		58.0	22.0	NM_020719	E9PB06|Q8N4J6	Silent	SNP	ENST00000418929.2	37	CCDS46143.1																																																																																			C|0.999;T|0.001		0.682	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
PTPN11	5781	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	112910827	112910827	+	Missense_Mutation	SNP	A	A	G	rs121918456		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr12:112910827A>G	ENST00000351677.2	+	7	1034	c.836A>G	c.(835-837)tAt>tGt	p.Y279C	PTPN11_ENST00000392597.1_Missense_Mutation_p.Y279C	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	279	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.		Y -> C (in NS1 and LEOPARD1). {ECO:0000269|PubMed:11992261, ECO:0000269|PubMed:12058348, ECO:0000269|PubMed:12960218, ECO:0000269|PubMed:15121796, ECO:0000269|PubMed:15520399, ECO:0000269|PubMed:16679933}.|Y -> S (in LEOPARD1). {ECO:0000269|PubMed:15121796, ECO:0000269|PubMed:15520399}.		abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						aaaaatagatataaaaacaTC	0.398			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.Y279C		.		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	.	PTPN11	7239	0			c.A836G	GRCh37	CM021133|CM041069	PTPN11	M	rs121918456	.						56.0	61.0	60.0					12																	112910827		2202	4298	6500	SO:0001583	missense	5781	exon7	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	ATAGATATAAAAA	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.836A>G	12.37:g.112910827A>G	ENSP00000340944:p.Tyr279Cys	235.0	0.0		286.0	126.0	NM_080601	A8K1D9|Q96HD7	Missense_Mutation	SNP	ENST00000351677.2	37	CCDS9163.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.113664	0.77210	.	.	ENSG00000179295	ENST00000392597;ENST00000351677	D;D	0.99494	-6.01;-6.01	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.99594	0.9853	H	0.95114	3.625	0.80722	A	1	P;P	0.50819	0.939;0.846	P;P	0.57776	0.827;0.753	D	0.97782	1.0233	9	0.87932	D	0	.	15.2426	0.73482	1.0:0.0:0.0:0.0	.	279;279	Q06124-2;Q06124-3	.;.	C	279	ENSP00000376376:Y279C;ENSP00000340944:Y279C	ENSP00000340944:Y279C	Y	+	2	0	PTPN11	111395210	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.562000	0.90719	2.302000	0.77476	0.528000	0.53228	TAT	.		0.398	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
PTPRM	5797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	7888209	7888209	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr18:7888209A>T	ENST00000332175.8	+	3	1339	c.302A>T	c.(301-303)tAt>tTt	p.Y101F	PTPRM_ENST00000400060.4_Missense_Mutation_p.Y101F|PTPRM_ENST00000580170.1_Missense_Mutation_p.Y101F|PTPRM_ENST00000400053.4_Missense_Mutation_p.Y39F	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	101	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GATTTTCACTATTTTGTGTCC	0.483																																					p.Y101F		.											.	PTPRM	228	0			c.A302T						.						119.0	119.0	119.0					18																	7888209		2203	4300	6503	SO:0001583	missense	5797	exon3			TTCACTATTTTGT	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.302A>T	18.37:g.7888209A>T	ENSP00000331418:p.Tyr101Phe	97.0	0.0		86.0	20.0	NM_001105244	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.780820	0.90195	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053	T;T;T	0.03124	4.04;4.04;4.04	5.83	5.83	0.93111	Concanavalin A-like lectin/glucanase (1);MAM domain (5);	0.000000	0.85682	D	0.000000	T	0.07413	0.0187	M	0.73430	2.235	0.80722	D	1	B;B	0.11235	0.004;0.004	B;B	0.15484	0.013;0.013	T	0.04678	-1.0934	10	0.49607	T	0.09	.	11.9004	0.52680	0.8696:0.0:0.0:0.1304	.	101;101	A7MBN1;P28827	.;PTPRM_HUMAN	F	101;101;39	ENSP00000331418:Y101F;ENSP00000382933:Y101F;ENSP00000382927:Y39F	ENSP00000331418:Y101F	Y	+	2	0	PTPRM	7878209	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.062000	0.71155	2.236000	0.73375	0.533000	0.62120	TAT	.		0.483	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
RAB25	57111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156039508	156039508	+	Silent	SNP	C	C	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:156039508C>G	ENST00000361084.5	+	4	721	c.480C>G	c.(478-480)acC>acG	p.T160T	RAB25_ENST00000487325.1_3'UTR	NM_020387.2	NP_065120.2	P57735	RAB25_HUMAN	RAB25, member RAS oncogene family	160					positive regulation of cell proliferation (GO:0008284)|protein transport (GO:0015031)|pseudopodium organization (GO:0031268)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5	Hepatocellular(266;0.158)|all_neural(408;0.195)					TGGACTCTACCAATGTTGAGC	0.478																																					p.T160T		.											.	RAB25	227	0			c.C480G						.						266.0	259.0	261.0					1																	156039508		1963	4143	6106	SO:0001819	synonymous_variant	57111	exon4			CTCTACCAATGTT	AF083124	CCDS41413.1	1q22	2008-07-03			ENSG00000132698	ENSG00000132698		"""RAB, member RAS oncogene"""	18238	protein-coding gene	gene with protein product		612942				11697911	Standard	NM_020387		Approved	CATX-8	uc001fnc.3	P57735	OTTHUMG00000017457	ENST00000361084.5:c.480C>G	1.37:g.156039508C>G		126.0	0.0		188.0	48.0	NM_020387	Q5VYA2|Q8NG24|Q96GB1|Q9BT12	Silent	SNP	ENST00000361084.5	37	CCDS41413.1																																																																																			.		0.478	RAB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046185.1		
RAD51	5888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	40998470	40998470	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr15:40998470A>T	ENST00000267868.3	+	4	589	c.321A>T	c.(319-321)aaA>aaT	p.K107N	RAD51_ENST00000532743.1_Intron|RAD51_ENST00000423169.2_Missense_Mutation_p.K107N|RAD51_ENST00000557850.1_Intron|RAD51_ENST00000382643.3_Intron	NM_002875.4	NP_002866.2	Q06609	RAD51_HUMAN	RAD51 recombinase	107					ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA unwinding involved in DNA replication (GO:0006268)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|mitotic recombination (GO:0006312)|positive regulation of DNA ligation (GO:0051106)|protein homooligomerization (GO:0051260)|reciprocal meiotic recombination (GO:0007131)|regulation of double-strand break repair via homologous recombination (GO:0010569)	condensed chromosome (GO:0000793)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|lateral element (GO:0000800)|mitochondrion (GO:0005739)|nuclear chromosome (GO:0000228)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|PML body (GO:0016605)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA polymerase binding (GO:0070182)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|single-stranded DNA binding (GO:0003697)|single-stranded DNA-dependent ATPase activity (GO:0043142)			breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	9		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)		CTGGCTCCAAAGAGCTTGACA	0.413								Homologous recombination																													p.K107N		.											.	RAD51	563	0			c.A321T						.						70.0	67.0	68.0					15																	40998470		2203	4300	6503	SO:0001583	missense	5888	exon4			CTCCAAAGAGCTT	D13804	CCDS10062.1, CCDS53931.1, CCDS53932.1	15q15.1	2014-06-12	2013-07-02		ENSG00000051180	ENSG00000051180			9817	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 5"""	179617	"""RAD51 (S. cerevisiae) homolog (E coli RecA homolog)"", ""RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)"", ""RAD51 homolog (S. cerevisiae)"""	RAD51A, RECA		8358431, 8479919	Standard	NM_002875		Approved	HsRad51, HsT16930, BRCC5	uc010bbx.3	Q06609	OTTHUMG00000130067	ENST00000267868.3:c.321A>T	15.37:g.40998470A>T	ENSP00000267868:p.Lys107Asn	234.0	0.0		337.0	108.0	NM_001164270	B0FXP0|B2R8T6|Q6FHX9|Q6ZNA8|Q9BV60	Missense_Mutation	SNP	ENST00000267868.3	37	CCDS10062.1	.	.	.	.	.	.	.	.	.	.	A	16.04	3.009313	0.54361	.	.	ENSG00000051180	ENST00000527860;ENST00000423169;ENST00000267868	T;T;T	0.43688	0.94;0.94;0.94	4.55	4.55	0.56014	DNA recombination/repair protein RecA/RadB, ATP-binding domain (1);DNA recombination and repair protein Rad51, C-terminal (1);	.	.	.	.	T	0.50137	0.1598	M	0.85630	2.765	0.80722	D	1	B;B	0.22800	0.075;0.029	B;B	0.23852	0.045;0.049	T	0.57087	-0.7871	9	0.72032	D	0.01	.	14.0465	0.64708	1.0:0.0:0.0:0.0	.	107;107	Q06609-3;Q06609	.;RAD51_HUMAN	N	107	ENSP00000432759:K107N;ENSP00000406602:K107N;ENSP00000267868:K107N	ENSP00000267868:K107N	K	+	3	2	RAD51	38785762	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	4.859000	0.62954	1.908000	0.55244	0.377000	0.23210	AAA	.		0.413	RAD51-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252358.1	NM_002875, NM_133487	
RALGAPB	57148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	37191272	37191272	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr20:37191272G>A	ENST00000262879.6	+	24	3913	c.3629G>A	c.(3628-3630)gGt>gAt	p.G1210D	RALGAPB_ENST00000397042.3_Missense_Mutation_p.G1206D|RALGAPB_ENST00000397038.1_Missense_Mutation_p.G988D|RALGAPB_ENST00000397040.1_Missense_Mutation_p.G1210D			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	1210	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						AGACACCCTGGTTGGACTGGG	0.423																																					p.G1210D		.											.	RALGAPB	92	0			c.G3629A						.						184.0	161.0	169.0					20																	37191272		2203	4300	6503	SO:0001583	missense	57148	exon24			ACCCTGGTTGGAC	AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.3629G>A	20.37:g.37191272G>A	ENSP00000262879:p.Gly1210Asp	124.0	0.0		217.0	29.0	NM_020336	A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Missense_Mutation	SNP	ENST00000262879.6	37	CCDS13305.1	.	.	.	.	.	.	.	.	.	.	G	33	5.267402	0.95399	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000397038;ENST00000397040;ENST00000438490	D;D;D;D;D	0.94758	-3.51;-3.51;-3.51;-3.51;-3.51	5.79	5.79	0.91817	Rap/ran-GAP (1);	0.000000	0.85682	D	0.000000	D	0.97356	0.9135	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.97501	1.0060	10	0.87932	D	0	.	20.0498	0.97621	0.0:0.0:1.0:0.0	.	1206;1210	A2A2E9;Q86X10	.;RLGPB_HUMAN	D	1210;1206;988;1210;1038	ENSP00000262879:G1210D;ENSP00000380235:G1206D;ENSP00000380231:G988D;ENSP00000380233:G1210D;ENSP00000416646:G1038D	ENSP00000262879:G1210D	G	+	2	0	RALGAPB	36624686	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.753000	0.94483	0.557000	0.71058	GGT	.		0.423	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079191.1	NM_020336	
RASAL2	9462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	178427346	178427346	+	Silent	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:178427346A>G	ENST00000462775.1	+	12	2621	c.2496A>G	c.(2494-2496)gaA>gaG	p.E832E	RASAL2_ENST00000367649.3_Silent_p.E973E|RASAL2_ENST00000448150.3_Silent_p.E962E	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	832					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						GCAGCATGGAAGATTTCACTA	0.478																																					p.E973E		.											.	RASAL2	155	0			c.A2919G						.						74.0	72.0	72.0					1																	178427346		2203	4300	6503	SO:0001819	synonymous_variant	9462	exon14			CATGGAAGATTTC	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.2496A>G	1.37:g.178427346A>G		42.0	0.0		59.0	12.0	NM_170692	F8W755|O95174|Q2TB22|Q5TFU9	Silent	SNP	ENST00000462775.1	37	CCDS1322.1	.	.	.	.	.	.	.	.	.	.	A	6.268	0.417562	0.11870	.	.	ENSG00000075391	ENST00000433130	.	.	.	5.55	-2.64	0.06114	.	.	.	.	.	T	0.63141	0.2486	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61093	-0.7132	4	.	.	.	.	13.2065	0.59800	0.4135:0.0:0.5865:0.0	.	.	.	.	G	383	.	.	R	+	1	2	RASAL2	176693969	0.996000	0.38824	0.988000	0.46212	0.998000	0.95712	0.417000	0.21214	-0.500000	0.06614	0.533000	0.62120	AGA	.		0.478	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692	
RBBP6	5930	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	24583179	24583180	+	Frame_Shift_Ins	INS	-	-	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr16:24583179_24583180insT	ENST00000319715.4	+	18	5224_5225	c.4792_4793insT	c.(4792-4794)gttfs	p.V1598fs	RBBP6_ENST00000381039.3_Frame_Shift_Ins_p.V758fs|RBBP6_ENST00000348022.2_Frame_Shift_Ins_p.V1564fs	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1598					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		AGAGACACAGGTTGAAAAAGAG	0.386																																					p.V1598fs		.											.	RBBP6	230	0			c.4792_4793insT						.																																			SO:0001589	frameshift_variant	5930	exon18			ACACAGGTTGAAA		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.4794dupT	16.37:g.24583181_24583181dupT	ENSP00000317872:p.Val1598fs	123.0	0.0		147.0	30.0	NM_006910	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Frame_Shift_Ins	INS	ENST00000319715.4	37	CCDS10621.1																																																																																			.		0.386	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
REPS1	85021	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	139265148	139265148	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr6:139265148T>C	ENST00000450536.2	-	6	1332	c.758A>G	c.(757-759)cAg>cGg	p.Q253R	REPS1_ENST00000367663.4_Missense_Mutation_p.Q253R|REPS1_ENST00000415951.2_Missense_Mutation_p.Q253R|REPS1_ENST00000409812.2_Missense_Mutation_p.Q253R|REPS1_ENST00000258062.5_Missense_Mutation_p.Q253R			Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	253					receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|SH3 domain binding (GO:0017124)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	19				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		TACTGTTGTCTGGTCCTGTAA	0.358																																					p.Q253R		.											.	REPS1	522	0			c.A758G						.						131.0	115.0	121.0					6																	139265148		2203	4300	6503	SO:0001583	missense	85021	exon6			GTTGTCTGGTCCT		CCDS5193.2, CCDS47488.1, CCDS69212.1, CCDS69213.1	6q24.1	2013-01-10			ENSG00000135597	ENSG00000135597		"""EF-hand domain containing"""	15578	protein-coding gene	gene with protein product		614825					Standard	XM_005267177		Approved		uc011edr.2	Q96D71	OTTHUMG00000015685	ENST00000450536.2:c.758A>G	6.37:g.139265148T>C	ENSP00000392065:p.Gln253Arg	92.0	0.0		106.0	65.0	NM_001128617	B7ZBZ8|B7ZBZ9|B7ZC00|J3KP76|Q5JWJ5|Q5JWJ6|Q5JWJ7|Q8NDR7|Q8WU62|Q9BXY9	Missense_Mutation	SNP	ENST00000450536.2	37		.	.	.	.	.	.	.	.	.	.	T	11.84	1.758179	0.31137	.	.	ENSG00000135597	ENST00000450536;ENST00000367663;ENST00000529597;ENST00000409812;ENST00000258062;ENST00000415951;ENST00000367668	T;T;T;T;T;T	0.35605	1.3;1.32;1.35;1.33;1.3;1.3	6.01	6.01	0.97437	.	0.155181	0.64402	D	0.000009	T	0.13329	0.0323	N	0.24115	0.695	0.43761	D	0.996278	B;P;B;P	0.41848	0.002;0.763;0.001;0.651	B;B;B;B	0.39027	0.006;0.288;0.002;0.15	T	0.05115	-1.0905	10	0.11182	T	0.66	-6.3368	16.5285	0.84344	0.0:0.0:0.0:1.0	.	253;253;253;253	Q96D71-3;Q96D71-2;Q96D71;E9PMG1	.;.;REPS1_HUMAN;.	R	253;253;239;253;253;253;201	ENSP00000392065:Q253R;ENSP00000356635:Q253R;ENSP00000434251:Q239R;ENSP00000386699:Q253R;ENSP00000258062:Q253R;ENSP00000397941:Q253R	ENSP00000258062:Q253R	Q	-	2	0	REPS1	139306841	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.674000	0.61612	2.307000	0.77673	0.528000	0.53228	CAG	.		0.358	REPS1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000042447.3		
RGN	9104	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	46949222	46949222	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chrX:46949222G>T	ENST00000352078.4	+	4	739	c.394G>T	c.(394-396)Ggg>Tgg	p.G132W	RGN_ENST00000457380.1_Intron|RGN_ENST00000336169.3_Missense_Mutation_p.G132W|RGN_ENST00000397180.1_Missense_Mutation_p.G132W|RNU6-1189P_ENST00000383958.1_RNA	NM_004683.4	NP_004674.1	Q15493	RGN_HUMAN	regucalcin	132					cellular calcium ion homeostasis (GO:0006874)|L-ascorbic acid biosynthetic process (GO:0019853)|positive regulation of ATPase activity (GO:0032781)|regulation of calcium-mediated signaling (GO:0050848)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|enzyme regulator activity (GO:0030234)|gluconolactonase activity (GO:0004341)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	9						GCGGCACCAGGGGGCCCTGTA	0.507																																					p.G132W		.											.	RGN	130	0			c.G394T						.						93.0	79.0	84.0					X																	46949222		2203	4300	6503	SO:0001583	missense	9104	exon4			CACCAGGGGGCCC	D31815	CCDS14272.1, CCDS75968.1	Xp11.3	2014-03-14	2013-04-26		ENSG00000130988	ENSG00000130988	3.1.1.17		9989	protein-coding gene	gene with protein product	"""senescence marker protein-30"", ""gluconolactonase"""	300212	"""regucalcin (senescence marker protein-30)"""			7548213	Standard	NM_152869		Approved	SMP30, RC	uc004dha.1	Q15493	OTTHUMG00000021435	ENST00000352078.4:c.394G>T	X.37:g.46949222G>T	ENSP00000253303:p.Gly132Trp	43.0	0.0		55.0	7.0	NM_004683	A4FTW1|A8K271|Q53FC9|Q5JRR5	Missense_Mutation	SNP	ENST00000352078.4	37	CCDS14272.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210029	0.39003	.	.	ENSG00000130988	ENST00000397180;ENST00000352078;ENST00000336169	T;T;T	0.44482	0.92;0.92;0.92	5.5	4.62	0.57501	SMP-30/Gluconolaconase/LRE-like region (1);Six-bladed beta-propeller, TolB-like (1);	0.106384	0.64402	D	0.000005	T	0.75867	0.3908	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84372	0.0544	10	0.87932	D	0	-23.9076	14.7556	0.69560	0.0:0.0:0.8545:0.1455	.	132	Q15493	RGN_HUMAN	W	132	ENSP00000380365:G132W;ENSP00000253303:G132W;ENSP00000338400:G132W	ENSP00000338400:G132W	G	+	1	0	RGN	46834166	1.000000	0.71417	0.817000	0.32601	0.013000	0.08279	6.331000	0.72929	1.050000	0.40346	0.594000	0.82650	GGG	.		0.507	RGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056385.1	NM_004683	
RIF1	55183	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	152322315	152322315	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:152322315C>T	ENST00000243326.5	+	29	6764	c.6281C>T	c.(6280-6282)tCt>tTt	p.S2094F	RIF1_ENST00000428287.2_Missense_Mutation_p.S2094F|RIF1_ENST00000444746.2_Missense_Mutation_p.S2094F|RIF1_ENST00000430328.2_Missense_Mutation_p.S2094F|RIF1_ENST00000453091.2_Missense_Mutation_p.S2094F			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TATAGTAAATCTGAAGAAAAA	0.348																																					p.S2094F		.											.	RIF1	300	0			c.C6281T						.						61.0	62.0	62.0					2																	152322315		2203	4300	6503	SO:0001583	missense	55183	exon30			GTAAATCTGAAGA	AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.6281C>T	2.37:g.152322315C>T	ENSP00000243326:p.Ser2094Phe	108.0	0.0		149.0	74.0	NM_018151	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	C	2.949	-0.217220	0.06101	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.10382	2.88;2.88;2.88;2.88;2.88	4.87	-1.62	0.08372	.	1.348360	0.04637	N	0.404688	T	0.05686	0.0149	N	0.14661	0.345	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.08055	0.001;0.003	T	0.39272	-0.9622	10	0.09843	T	0.71	2.9121	6.1943	0.20542	0.0:0.3485:0.1354:0.5161	.	2094;2094	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	F	2094	ENSP00000390181:S2094F;ENSP00000414615:S2094F;ENSP00000415691:S2094F;ENSP00000243326:S2094F;ENSP00000416123:S2094F	ENSP00000243326:S2094F	S	+	2	0	RIF1	152030561	0.416000	0.25424	0.000000	0.03702	0.020000	0.10135	0.432000	0.21461	-0.211000	0.10124	0.650000	0.86243	TCT	.		0.348	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3		
RMND1	55005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	151751308	151751308	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr6:151751308C>T	ENST00000367303.4	-	5	816	c.694G>A	c.(694-696)Gga>Aga	p.G232R	RMND1_ENST00000336451.3_Missense_Mutation_p.G21R	NM_017909.2	NP_060379.2	Q9NWS8	RMND1_HUMAN	required for meiotic nuclear division 1 homolog (S. cerevisiae)	232					translation (GO:0006412)	mitochondrion (GO:0005739)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.146)	OV - Ovarian serous cystadenocarcinoma(155;6.8e-11)		ACAGCAGCTCCTTCCCTGATT	0.284																																					p.G232R		.											.	RMND1	90	0			c.G694A						.						57.0	60.0	59.0					6																	151751308		2201	4290	6491	SO:0001583	missense	55005	exon5			CAGCTCCTTCCCT	AK000634	CCDS5232.1, CCDS75539.1	6q25.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000155906	ENSG00000155906			21176	protein-coding gene	gene with protein product		614917	"""chromosome 6 open reading frame 96"""	C6orf96			Standard	NM_001271937		Approved	bA351K16.3, FLJ20627, RMD1	uc003qoi.3	Q9NWS8	OTTHUMG00000015837	ENST00000367303.4:c.694G>A	6.37:g.151751308C>T	ENSP00000356272:p.Gly232Arg	322.0	0.0		389.0	56.0	NM_017909	A8K8H4|Q0VDG6|Q5SZ48|Q5SZ83|Q6NSC5|Q96EN7	Missense_Mutation	SNP	ENST00000367303.4	37	CCDS5232.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.975121	0.74360	.	.	ENSG00000155906	ENST00000336451;ENST00000367303;ENST00000444024	D;D	0.97888	-4.59;-3.14	4.17	4.17	0.49024	.	0.000000	0.85682	D	0.000000	D	0.99105	0.9692	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99208	1.0875	10	0.87932	D	0	-21.1437	16.6062	0.84830	0.0:1.0:0.0:0.0	.	232	Q9NWS8	RMND1_HUMAN	R	21;232;62	ENSP00000336683:G21R;ENSP00000356272:G232R	ENSP00000336683:G21R	G	-	1	0	RMND1	151793001	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	5.504000	0.66968	2.308000	0.77769	0.313000	0.20887	GGA	.		0.284	RMND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042718.2	NM_017909	
RNF148	378925	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	122342607	122342620	+	Frame_Shift_Del	DEL	AGAATGATTCCCGA	AGAATGATTCCCGA	-	rs544403291|rs142695415		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	AGAATGATTCCCGA	AGAATGATTCCCGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:122342607_122342620delAGAATGATTCCCGA	ENST00000434824.1	-	1	401_414	c.185_198delTCGGGAATCATTCT	c.(184-198)ttcgggaatcattctfs	p.FGNHS62fs	CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000449022.2_Intron|RNF148_ENST00000447240.1_Intron	NM_198085.1	NP_932351.1	Q8N7C7	RN148_HUMAN	ring finger protein 148	62						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.S66T(2)		endometrium(2)|kidney(1)|large_intestine(6)|lung(7)	16						TTTCCAGAGGAGAATGATTCCCGAACACTCCACT	0.467																																					p.62_66del		.											.	RNF148	204	2	Substitution - Missense(2)	lung(2)	c.185_198del						.																																			SO:0001589	frameshift_variant	378925	exon1			CAGAGGAGAATGA	BC029264	CCDS47692.1	7q31.33	2013-01-09			ENSG00000235631	ENSG00000235631		"""RING-type (C3HC4) zinc fingers"""	22411	protein-coding gene	gene with protein product						8744354	Standard	NM_198085		Approved	MGC35222	uc003vkk.1	Q8N7C7	OTTHUMG00000157099	ENST00000434824.1:c.185_198delTCGGGAATCATTCT	7.37:g.122342607_122342620delAGAATGATTCCCGA	ENSP00000388207:p.Phe62fs	59.0	0.0		117.0	23.0	NM_198085	A4D0X4|Q8N308	Frame_Shift_Del	DEL	ENST00000434824.1	37	CCDS47692.1																																																																																			.		0.467	RNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347424.1	NM_198085	
ROBO2	6092	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	77607255	77607255	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:77607255A>T	ENST00000461745.1	+	9	2292	c.1392A>T	c.(1390-1392)agA>agT	p.R464S	ROBO2_ENST00000487694.3_Missense_Mutation_p.R480S|ROBO2_ENST00000332191.8_Missense_Mutation_p.R464S	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	464	Ig-like C2-type 5.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GAGATCCAAGAGCAACAATTC	0.398																																					p.R464S		.											.	ROBO2	328	0			c.A1392T						.						100.0	98.0	99.0					3																	77607255		1884	4122	6006	SO:0001583	missense	6092	exon9			TCCAAGAGCAACA	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.1392A>T	3.37:g.77607255A>T	ENSP00000417164:p.Arg464Ser	89.0	0.0		170.0	11.0	NM_002942	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	A	16.25	3.070312	0.55539	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.39229	1.09;1.09;1.09	5.68	4.5	0.54988	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.48286	D	0.000200	T	0.54319	0.1851	M	0.83223	2.63	0.43114	D	0.994827	P;P;P	0.50066	0.859;0.931;0.859	P;P;P	0.51777	0.679;0.646;0.679	T	0.71262	-0.4645	9	0.87932	D	0	.	8.1412	0.31084	0.7916:0.1357:0.0727:0.0	.	480;464;464	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	S	480;480;484;464;464;185	ENSP00000417335:R480S;ENSP00000417164:R464S;ENSP00000327536:R464S	ENSP00000327536:R464S	R	+	3	2	ROBO2	77689945	1.000000	0.71417	0.999000	0.59377	0.275000	0.26752	1.034000	0.30204	2.293000	0.77203	0.477000	0.44152	AGA	.		0.398	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
RP1L1	94137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	10470654	10470654	+	Silent	SNP	G	G	A	rs200317816	byFrequency	TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr8:10470654G>A	ENST00000382483.3	-	4	1177	c.954C>T	c.(952-954)gaC>gaT	p.D318D		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	318					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		ACAGGCTGCCGTCCTCATTCA	0.662													G|||	39	0.00778754	0.0	0.0	5008	,	,		16661	0.0		0.0	False		,,,				2504	0.0399				p.D318D		.											.	RP1L1	139	0			c.C954T						.	G		0,4274		0,0,2137	84.0	93.0	90.0		954	-10.9	0.2	8		90	3,8481		0,3,4239	no	coding-synonymous	RP1L1	NM_178857.5		0,3,6376	AA,AG,GG		0.0354,0.0,0.0235		318/2401	10470654	3,12755	2137	4242	6379	SO:0001819	synonymous_variant	94137	exon4			GCTGCCGTCCTCA	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.954C>T	8.37:g.10470654G>A		57.0	0.0		95.0	44.0	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	CCDS43708.1																																																																																			G|0.999;A|0.001		0.662	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
RPGRIP1	57096	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	21770659	21770659	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr14:21770659G>A	ENST00000400017.2	+	4	503	c.503G>A	c.(502-504)aGg>aAg	p.R168K	RPGRIP1_ENST00000556336.1_Missense_Mutation_p.R168K|RPGRIP1_ENST00000206660.6_Missense_Mutation_p.R168K|RPGRIP1_ENST00000557771.1_Missense_Mutation_p.R168K	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	168					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		CCAAGGGACAGGCTGAGCTAC	0.493																																					p.R168K		.											.	RPGRIP1	140	0			c.G503A						.						48.0	48.0	48.0					14																	21770659		1956	4147	6103	SO:0001583	missense	57096	exon4			GGGACAGGCTGAG	AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.503G>A	14.37:g.21770659G>A	ENSP00000382895:p.Arg168Lys	33.0	0.0		42.0	13.0	NM_020366	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	ENST00000400017.2	37	CCDS45080.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.008872	0.54361	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.31513	0.0799	L	0.58101	1.795	0.80722	D	1	P	0.43750	0.816	B	0.36766	0.232	T	0.11227	-1.0596	10	0.12766	T	0.61	-16.4631	15.2387	0.73452	0.0:0.0:1.0:0.0	.	168	Q96KN7	RPGR1_HUMAN	K	168	ENSP00000450445:R168K;ENSP00000451219:R168K;ENSP00000382895:R168K;ENSP00000206660:R168K	ENSP00000206660:R168K	R	+	2	0	RPGRIP1	20840499	0.939000	0.31865	0.023000	0.16930	0.733000	0.41908	4.513000	0.60476	2.582000	0.87167	0.650000	0.86243	AGG	.		0.493	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366	
SACS	26278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	23905055	23905055	+	Silent	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr13:23905055A>G	ENST00000382292.3	-	9	13233	c.12960T>C	c.(12958-12960)ctT>ctC	p.L4320L	SACS_ENST00000382298.3_Silent_p.L4320L|SACS_ENST00000402364.1_Silent_p.L3570L			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	4320	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CCGATTCTGGAAGCTTCCATG	0.383																																					p.L4320L		.											.	SACS	298	0			c.T12960C						.						116.0	126.0	123.0					13																	23905055		2203	4299	6502	SO:0001819	synonymous_variant	26278	exon10			TTCTGGAAGCTTC	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.12960T>C	13.37:g.23905055A>G		85.0	0.0		60.0	27.0	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	ENST00000382292.3	37	CCDS9300.2																																																																																			.		0.383	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
SACS	26278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	23905368	23905368	+	Missense_Mutation	SNP	T	T	C	rs550068559	byFrequency	TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr13:23905368T>C	ENST00000382292.3	-	9	12920	c.12647A>G	c.(12646-12648)gAc>gGc	p.D4216G	SACS_ENST00000382298.3_Missense_Mutation_p.D4216G|SACS_ENST00000402364.1_Missense_Mutation_p.D3466G			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	4216					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		ACTAGAATTGTCAGCATCTTC	0.343													T|||	2	0.000399361	0.0	0.0	5008	,	,		21397	0.0		0.0	False		,,,				2504	0.002				p.D4216G		.											.	SACS	298	0			c.A12647G						.						50.0	53.0	52.0					13																	23905368		2203	4299	6502	SO:0001583	missense	26278	exon10			GAATTGTCAGCAT	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.12647A>G	13.37:g.23905368T>C	ENSP00000371729:p.Asp4216Gly	52.0	0.0		34.0	14.0	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	T	12.52	1.963518	0.34659	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87729	-2.14;-2.29;-2.14	5.44	4.19	0.49359	.	0.142736	0.64402	D	0.000006	T	0.80412	0.4618	L	0.40543	1.245	0.46356	D	0.999002	B	0.32573	0.376	B	0.26770	0.073	T	0.81402	-0.0949	10	0.59425	D	0.04	.	12.1105	0.53836	0.0:0.0:0.1433:0.8567	.	4216	Q9NZJ4	SACS_HUMAN	G	4216;3466;4216	ENSP00000371729:D4216G;ENSP00000385844:D3466G;ENSP00000371735:D4216G	ENSP00000371729:D4216G	D	-	2	0	SACS	22803368	1.000000	0.71417	0.988000	0.46212	0.981000	0.71138	5.063000	0.64332	2.049000	0.60858	0.460000	0.39030	GAC	.		0.343	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
SAG	6295	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	234217900	234217900	+	Missense_Mutation	SNP	G	G	T	rs371502229		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:234217900G>T	ENST00000409110.1	+	2	295	c.65G>T	c.(64-66)cGg>cTg	p.R22L		NM_000541.4	NP_000532.2	P10523	ARRS_HUMAN	S-antigen; retina and pineal gland (arrestin)	22					cell surface receptor signaling pathway (GO:0007166)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cytosol (GO:0005829)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|kidney(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		AAGATCTCCCGGGACAAATCG	0.443																																					p.R22L		.											.	SAG	23	0			c.G65T						.						57.0	59.0	58.0					2																	234217900		1884	4118	6002	SO:0001583	missense	6295	exon2			TCTCCCGGGACAA		CCDS46545.1	2q37.1	2013-02-14			ENSG00000130561	ENSG00000130561			10521	protein-coding gene	gene with protein product	"""arrestin 1"""	181031				2249983	Standard	NM_000541		Approved	ARRESTIN, RP47	uc002vuh.2	P10523	OTTHUMG00000153213	ENST00000409110.1:c.65G>T	2.37:g.234217900G>T	ENSP00000386444:p.Arg22Leu	69.0	0.0		87.0	39.0	NM_000541	A0FDN6|Q53SV3|Q99858	Missense_Mutation	SNP	ENST00000409110.1	37	CCDS46545.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059127	0.76074	.	.	ENSG00000130561	ENST00000252857;ENST00000447536;ENST00000409110;ENST00000415974;ENST00000478615	T;T;T	0.17370	2.28;2.28;2.28	4.46	4.46	0.54185	Arrestin, N-terminal (1);Immunoglobulin E-set (1);	0.236368	0.34959	N	0.003558	T	0.23965	0.0580	L	0.59436	1.845	0.80722	D	1	D	0.60160	0.987	P	0.46885	0.53	T	0.02190	-1.1198	10	0.62326	D	0.03	-14.1626	14.3198	0.66479	0.0:0.0:1.0:0.0	.	22	P10523	ARRS_HUMAN	L	22	ENSP00000408937:R22L;ENSP00000386444:R22L;ENSP00000409475:R22L	ENSP00000252857:R22L	R	+	2	0	SAG	233882639	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.418000	0.59828	2.484000	0.83849	0.555000	0.69702	CGG	.		0.443	SAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330126.1	NM_000541	
SALL2	6297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	21991101	21991101	+	Missense_Mutation	SNP	G	G	T	rs267603925		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr14:21991101G>T	ENST00000327430.3	-	2	3055	c.2761C>A	c.(2761-2763)Ccc>Acc	p.P921T	SALL2_ENST00000538754.1_Intron|SALL2_ENST00000317492.5_Intron|AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000450879.2_Missense_Mutation_p.P784T	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	921					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		GCCTGGGAGGGAAAGGCCTGG	0.602																																					p.P921T		.											.	SALL2	92	0			c.C2761A						.						66.0	68.0	67.0					14																	21991101		2203	4300	6503	SO:0001583	missense	6297	exon2			GGGAGGGAAAGGC	AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.2761C>A	14.37:g.21991101G>T	ENSP00000333537:p.Pro921Thr	75.0	0.0		111.0	37.0	NM_005407	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	ENST00000327430.3	37	CCDS32045.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.05|11.05	1.524731|1.524731	0.27299|0.27299	.|.	.|.	ENSG00000165821|ENSG00000165821	ENST00000546363|ENST00000327430;ENST00000450879	T|T;T	0.38722|0.26810	1.12|1.71;1.71	4.69|4.69	3.76|3.76	0.43208|0.43208	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|0.000000	.|0.38837	.|N	.|0.001556	T|T	0.09113|0.09113	0.0225|0.0225	N|N	0.03281|0.03281	-0.365|-0.365	0.35584|0.35584	D|D	0.806488|0.806488	.|B;B;B;B	.|0.33694	.|0.421;0.421;0.281;0.281	.|B;B;B;B	.|0.30646	.|0.083;0.118;0.037;0.027	T|T	0.24621|0.24621	-1.0155|-1.0155	7|10	0.87932|0.21014	D|T	0|0.42	-22.7312|-22.7312	6.1929|6.1929	0.20534|0.20534	0.1001:0.1917:0.7082:0.0|0.1001:0.1917:0.7082:0.0	.|.	.|784;784;682;921	.|B4DK65;E7EW59;B4DFD9;Q9Y467	.|.;.;.;SALL2_HUMAN	L|T	779|921;784	ENSP00000440054:F779L|ENSP00000333537:P921T;ENSP00000396773:P784T	ENSP00000440054:F779L|ENSP00000333537:P921T	F|P	-|-	3|1	2|0	SALL2|SALL2	21060941|21060941	1.000000|1.000000	0.71417|0.71417	0.806000|0.806000	0.32338|0.32338	0.569000|0.569000	0.35902|0.35902	1.132000|1.132000	0.31418|0.31418	1.124000|1.124000	0.41980|0.41980	0.563000|0.563000	0.77884|0.77884	TTC|CCC	.		0.602	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407	
C19orf67	646457	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14199510	14199510	+	5'Flank	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:14199510C>T	ENST00000548523.1	-	0	0				C19orf67_ENST00000547589.1_5'Flank|SAMD1_ENST00000541938.1_5'Flank|PRKACA_ENST00000350356.3_5'Flank|SAMD1_ENST00000533683.2_Silent_p.P371P	NM_001277378.1	NP_001264307.1	A6NJJ6	CS067_HUMAN	chromosome 19 open reading frame 67											central_nervous_system(1)	1						TCGCCTGCTCCGGGAATCCAG	0.567																																					p.P371P		.											.	.	.	0			c.G1113A						.						51.0	56.0	54.0					19																	14199510		2012	4170	6182	SO:0001631	upstream_gene_variant	90378	exon4			CTGCTCCGGGAAT		CCDS59360.1	19p13.12	2008-07-02			ENSG00000188032	ENSG00000188032			34354	protein-coding gene	gene with protein product							Standard	NM_001277378		Approved		uc031rjr.1	A6NJJ6			19.37:g.14199510C>T	Exception_encountered	68.0	0.0		94.0	21.0	NM_138352		Silent	SNP	ENST00000548523.1	37	CCDS59360.1																																																																																			.		0.567	C19orf67-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403368.1	XM_929382	
SCLY	51540	broad.mit.edu;mdanderson.org	37	2	239006994	239006994	+	Nonstop_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:239006994T>C	ENST00000555827.1	+	12	1400	c.1336T>C	c.(1336-1338)Tag>Cag	p.*446Q	SCLY_ENST00000422984.2_Nonstop_Mutation_p.*352Q|ESPNL_ENST00000409169.1_5'Flank|ESPNL_ENST00000343063.3_5'Flank|SCLY_ENST00000254663.6_Nonstop_Mutation_p.*454Q|SCLY_ENST00000429612.2_Nonstop_Mutation_p.*240Q			Q96I15	SCLY_HUMAN	selenocysteine lyase	0					cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)	pyridoxal phosphate binding (GO:0030170)|selenocysteine lyase activity (GO:0009000)|transferase activity (GO:0016740)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	22		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;1.37e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.6e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.25e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000128)|Lung(119;0.0118)|LUSC - Lung squamous cell carcinoma(224;0.0285)		GGACCAGGCCTAGCACTGGGG	0.706																																					p.X454Q	Melanoma(24;424 891 11947 32582 36034)|Ovarian(46;648 1065 26199 32764 45893)	.											.	SCLY	92	0			c.T1360C						.						16.0	16.0	16.0					2																	239006994		2195	4296	6491	SO:0001578	stop_lost	51540	exon12			CAGGCCTAGCACT	AF175767	CCDS2524.1, CCDS2524.2	2q37.3	2008-02-05			ENSG00000132330	ENSG00000132330			18161	protein-coding gene	gene with protein product	"""putative selenocysteine lyase"""	611056				10692412	Standard	NM_016510		Approved	SCL	uc010fyv.4	Q96I15	OTTHUMG00000133336	ENST00000555827.1:c.1336T>C	2.37:g.239006994T>C	ENSP00000450613:p.*446Glnext*26	9.0	0.0		12.0	4.0	NM_016510	B9A068|J3KN06|Q53SN1|Q53SN8|Q7L670|Q9NVT7|Q9NZR7	Missense_Mutation	SNP	ENST00000555827.1	37		.	.	.	.	.	.	.	.	.	.	T	3.128	-0.179117	0.06380	.	.	ENSG00000132330	ENST00000254663;ENST00000555827;ENST00000422984;ENST00000429612	.	.	.	3.92	2.74	0.32292	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.1908	0.20524	0.0:0.117:0.0:0.883	.	.	.	.	Q	454;446;352;240	.	.	X	+	1	0	SCLY	238671733	0.840000	0.29493	0.206000	0.23566	0.011000	0.07611	1.199000	0.32235	0.672000	0.31204	-0.372000	0.07161	TAG	.		0.706	SCLY-204	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_016510	
SCUBE1	80274	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	43608519	43608519	+	Silent	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr22:43608519C>T	ENST00000360835.4	-	17	2259	c.2133G>A	c.(2131-2133)gaG>gaA	p.E711E	Z82214.3_ENST00000420269.1_RNA	NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	711					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				TGCGCCCGGGCTCAGGCTGGT	0.642																																					p.E711E		.											.	SCUBE1	93	0			c.G2133A						.						47.0	40.0	42.0					22																	43608519		2170	4252	6422	SO:0001819	synonymous_variant	80274	exon17			CCCGGGCTCAGGC		CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.2133G>A	22.37:g.43608519C>T		59.0	0.0		64.0	8.0	NM_173050	Q5R336	Silent	SNP	ENST00000360835.4	37	CCDS14048.1																																																																																			.		0.642	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319582.3	NM_173050	
SFT2D2	375035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	168204373	168204373	+	Nonsense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:168204373A>T	ENST00000271375.4	+	4	343	c.271A>T	c.(271-273)Aag>Tag	p.K91*	SFT2D2_ENST00000367829.1_Intron|SFT2D2_ENST00000471981.1_3'UTR|SFT2D2_ENST00000367825.3_Intron	NM_199344.2	NP_955376.1			SFT2 domain containing 2											lung(3)|skin(1)	4	all_hematologic(923;0.215)					GAAACAGCTGAAGCGAATGTT	0.458																																					p.K91X		.											.	SFT2D2	69	0			c.A271T						.						380.0	369.0	373.0					1																	168204373		2203	4300	6503	SO:0001587	stop_gained	375035	exon4			CAGCTGAAGCGAA	AL035297	CCDS1271.1	1q24.2	2008-02-05			ENSG00000213064	ENSG00000213064			25140	protein-coding gene	gene with protein product							Standard	NM_199344		Approved	UNQ512, dJ747L4.C1.2	uc001gfi.4	O95562	OTTHUMG00000034650	ENST00000271375.4:c.271A>T	1.37:g.168204373A>T	ENSP00000271375:p.Lys91*	136.0	0.0		213.0	119.0	NM_199344		Nonsense_Mutation	SNP	ENST00000271375.4	37	CCDS1271.1	.	.	.	.	.	.	.	.	.	.	A	36	5.639031	0.96693	.	.	ENSG00000213064	ENST00000271375	.	.	.	5.04	5.04	0.67666	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.8292	12.3349	0.55060	1.0:0.0:0.0:0.0	.	.	.	.	X	91	.	ENSP00000271375:K91X	K	+	1	0	SFT2D2	166470997	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.669000	0.68081	1.881000	0.54492	0.528000	0.53228	AAG	.		0.458	SFT2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083827.2	NM_199344	
SIGLECL1	284369	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	51770635	51770635	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:51770635A>G	ENST00000316401.7	+	5	800	c.419A>G	c.(418-420)cAt>cGt	p.H140R	SIGLECL1_ENST00000597824.1_Missense_Mutation_p.H46R|CTD-3187F8.2_ENST00000597569.1_RNA|SIGLECL1_ENST00000593968.1_3'UTR	NM_173635.1	NP_775906.1	Q96PQ1	SIG12_HUMAN	SIGLEC family like 1	504	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)										AGAGTGAAACATATCAGAAAG	0.458																																					p.H140R		.											.	.	.	0			c.A419G						.						124.0	127.0	126.0					19																	51770635		2203	4300	6503	SO:0001583	missense	284369	exon5			TGAAACATATCAG	AK097554	CCDS12827.1	19q13.33	2013-03-20	2012-07-20	2012-07-20	ENSG00000179213	ENSG00000179213			26856	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 75"", ""sialic acid binding Ig-like lectin 23, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 7"""	C19orf75, SIGLEC23P, SIGLECP7			Standard	NM_173635		Approved	FLJ40235	uc002pwb.1	Q8N7X8	OTTHUMG00000182881	ENST00000316401.7:c.419A>G	19.37:g.51770635A>G	ENSP00000321249:p.His140Arg	9.0	0.0		13.0	7.0	NM_173635	Q8IYH7	Missense_Mutation	SNP	ENST00000316401.7	37	CCDS12827.1	.	.	.	.	.	.	.	.	.	.	A	4.357	0.065714	0.08388	.	.	ENSG00000179213	ENST00000316401	T	0.29917	1.55	3.49	0.0143	0.14099	.	1.722310	0.03364	N	0.197990	T	0.14184	0.0343	N	0.08118	0	0.09310	N	1	B;B	0.18013	0.025;0.009	B;B	0.18263	0.021;0.011	T	0.13575	-1.0504	10	0.24483	T	0.36	-1.7619	0.668	0.00854	0.4651:0.201:0.1212:0.2127	.	46;140	B7ZLS6;Q8N7X8	.;CS075_HUMAN	R	140	ENSP00000321249:H140R	ENSP00000321249:H140R	H	+	2	0	C19orf75	56462447	0.013000	0.17824	0.034000	0.17996	0.832000	0.47134	-0.050000	0.11904	-0.091000	0.12440	0.528000	0.53228	CAT	.		0.458	SIGLECL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464161.2	NM_173635	
SLC24A1	9187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	65917213	65917213	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr15:65917213A>T	ENST00000261892.6	+	2	1082	c.795A>T	c.(793-795)gaA>gaT	p.E265D	SLC24A1_ENST00000546330.1_Missense_Mutation_p.E265D|SLC24A1_ENST00000399033.4_Missense_Mutation_p.E265D|SLC24A1_ENST00000544319.2_Missense_Mutation_p.E265D|SLC24A1_ENST00000537259.1_Missense_Mutation_p.E265D|SLC24A1_ENST00000339868.6_Missense_Mutation_p.E265D	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	265					calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						ATGAGGTAGAAGCAAACGTCT	0.473																																					p.E265D		.											.	.	.	0			c.A795T						.						101.0	93.0	96.0					15																	65917213		1884	4111	5995	SO:0001583	missense	9187	exon2			GGTAGAAGCAAAC	AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.795A>T	15.37:g.65917213A>T	ENSP00000261892:p.Glu265Asp	92.0	0.0		178.0	53.0	NM_004727	O43485|O75184|Q17RM9	Missense_Mutation	SNP	ENST00000261892.6	37	CCDS45284.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.322577	0.81580	.	.	ENSG00000074621	ENST00000537259;ENST00000261892;ENST00000339868;ENST00000544319;ENST00000399033;ENST00000546330	T;T;T;T;T;T	0.69926	-0.12;-0.34;-0.33;-0.37;-0.44;-0.33	4.89	-0.00958	0.14000	.	0.389426	0.24345	N	0.039335	T	0.68044	0.2958	L	0.49126	1.545	0.09310	N	1	P;P;P;D;D	0.69078	0.932;0.888;0.888;0.997;0.996	P;P;P;D;P	0.64042	0.655;0.453;0.453;0.921;0.836	T	0.57596	-0.7784	10	0.87932	D	0	.	3.8692	0.09029	0.5136:0.1886:0.2978:0.0	.	265;265;265;265;265	O60721-2;Q17RM9;O60721;F5H127;B4E1W0	.;.;NCKX1_HUMAN;.;.	D	265	ENSP00000439693:E265D;ENSP00000261892:E265D;ENSP00000341837:E265D;ENSP00000445163:E265D;ENSP00000381991:E265D;ENSP00000439190:E265D	ENSP00000261892:E265D	E	+	3	2	SLC24A1	63704266	0.039000	0.19947	0.023000	0.16930	0.988000	0.76386	0.602000	0.24134	0.098000	0.17522	0.533000	0.62120	GAA	.		0.473	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397304.1	NM_004727	
SLC26A4	5172	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	107314761	107314761	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:107314761A>G	ENST00000265715.3	+	5	792	c.568A>G	c.(568-570)Agt>Ggt	p.S190G		NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	190					chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						CCTGATTGCCAGTGCCCTGAC	0.373									Pendred syndrome																												p.S190G		.											.	SLC26A4	96	0			c.A568G						.						99.0	94.0	96.0					7																	107314761		2203	4300	6503	SO:0001583	missense	5172	exon5	Familial Cancer Database	Goiter-Deafness syndrome	ATTGCCAGTGCCC	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.568A>G	7.37:g.107314761A>G	ENSP00000265715:p.Ser190Gly	62.0	1.0		143.0	30.0	NM_000441	B7Z266|O43170	Missense_Mutation	SNP	ENST00000265715.3	37	CCDS5746.1	.	.	.	.	.	.	.	.	.	.	A	2.636	-0.285152	0.05605	.	.	ENSG00000091137	ENST00000265715	D	0.93488	-3.23	5.07	5.07	0.68467	.	0.123117	0.56097	D	0.000030	D	0.89983	0.6873	L	0.55017	1.72	0.80722	D	1	B	0.11235	0.004	B	0.15052	0.012	D	0.85714	0.1321	10	0.33940	T	0.23	.	9.3797	0.38306	0.9199:0.0:0.0801:0.0	.	190	O43511	S26A4_HUMAN	G	190	ENSP00000265715:S190G	ENSP00000265715:S190G	S	+	1	0	SLC26A4	107101997	0.998000	0.40836	0.511000	0.27724	0.024000	0.10985	3.669000	0.54561	1.914000	0.55421	0.533000	0.62120	AGT	.		0.373	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337148.1	NM_000441	
SLC2A5	6518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	9117613	9117614	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:9117613_9117614CC>AA	ENST00000377424.4	-	3	365_366	c.186_187GG>TT	c.(184-189)atGGaa>atTTaa	p.62_63ME>I*	SLC2A5_ENST00000377414.3_Nonsense_Mutation_p.62_63ME>I*|SLC2A5_ENST00000535586.1_Intron	NM_003039.2	NP_003030.1	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated glucose/fructose transporter), member 5	62					carbohydrate metabolic process (GO:0005975)|cellular response to fructose stimulus (GO:0071332)|fructose transport (GO:0015755)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fructose transmembrane transporter activity (GO:0005353)|glucose transmembrane transporter activity (GO:0005355)			endometrium(6)|kidney(15)|large_intestine(6)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	36	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		GGGAAGTCTTCCATGAATTCAC	0.441																																					p.E63X|p.M62I		.											.	SLC2A5	517	0			c.G187T|c.G186T						.																																			SO:0001587	stop_gained	6518	exon3			AGTCTTCCATGAA|GTCTTCCATGAAT	BC001820	CCDS99.1, CCDS44054.1	1p36.2	2013-05-22			ENSG00000142583	ENSG00000142583		"""Solute carriers"""	11010	protein-coding gene	gene with protein product		138230		GLUT5		9691177	Standard	NM_003039		Approved		uc001apo.3	P22732	OTTHUMG00000001771	ENST00000377424.4:c.186_187delinsAA	1.37:g.9117613_9117614delinsAA	ENSP00000366641:p.M62_E63delinsI*	70.0	0.0		75.0	26.0	NM_003039	Q14770|Q5T977|Q8IVB3	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000377424.4	37	CCDS99.1																																																																																			.		0.441	SLC2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004932.1	NM_003039	
SLC38A3	10991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	50256338	50256338	+	RNA	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:50256338G>T	ENST00000420502.1	+	0	1417									solute carrier family 38, member 3											breast(1)|cervix(1)|endometrium(1)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(193;0.000275)|KIRC - Kidney renal clear cell carcinoma(197;0.00548)|Kidney(197;0.00615)		CAACCTGCTGGTCATCTTTGC	0.577																																					p.V422F		.											.	SLC38A3	67	0			c.G1264T						.						81.0	82.0	81.0					3																	50256338		2065	4211	6276			10991	exon14			CTGCTGGTCATCT	U49082	CCDS74940.1	3p21.3	2013-05-22			ENSG00000188338	ENSG00000188338		"""Solute carriers"""	18044	protein-coding gene	gene with protein product		604437				10619430, 10823827	Standard	XM_006712954		Approved	G17, SN1	uc003cyn.4	Q99624	OTTHUMG00000156764		3.37:g.50256338G>T		36.0	0.0		69.0	13.0	NM_006841		Missense_Mutation	SNP	ENST00000420502.1	37																																																																																				.		0.577	SLC38A3-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000345635.2	NM_006841	
SLC4A8	9498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	51864175	51864175	+	Splice_Site	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr12:51864175G>T	ENST00000453097.2	+	13	1741		c.e13-1		SLC4A8_ENST00000514353.3_Splice_Site|SLC4A8_ENST00000358657.3_Splice_Site|SLC4A8_ENST00000546663.1_Splice_Site|SLC4A8_ENST00000535225.2_Splice_Site|SLC4A8_ENST00000394856.1_Splice_Site	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		TTTCCTCTCAGAGTGCAATTG	0.478																																					.		.											.	SLC4A8	95	0			c.1366-1G>T						.						190.0	169.0	176.0					12																	51864175		2203	4300	6503	SO:0001630	splice_region_variant	9498	exon13			CTCTCAGAGTGCA	AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.1525-1G>T	12.37:g.51864175G>T		84.0	0.0		90.0	34.0	NM_001258401		Splice_Site	SNP	ENST00000453097.2	37	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.165795	0.78339	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000551071	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2369	0.89952	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC4A8	50150442	1.000000	0.71417	0.998000	0.56505	0.906000	0.53458	9.869000	0.99810	2.687000	0.91594	0.563000	0.77884	.	.		0.478	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858	Intron
SLC4A9	83697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	139740530	139740530	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr5:139740530C>T	ENST00000230993.6	+	2	471	c.436C>T	c.(436-438)Cca>Tca	p.P146S	SLC4A9_ENST00000432095.2_Missense_Mutation_p.P122S|SLC4A9_ENST00000507527.1_Missense_Mutation_p.P146S|SLC4A9_ENST00000506757.2_Missense_Mutation_p.P122S|SLC4A9_ENST00000506545.1_Missense_Mutation_p.P122S	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	146					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGGACTGCCCAGCTCAGAG	0.652																																					p.P146S		.											.	SLC4A9	67	0			c.C436T						.						11.0	13.0	12.0					5																	139740530		1926	4124	6050	SO:0001583	missense	83697	exon2			GACTGCCCAGCTC	AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	ENST00000230993.6:c.436C>T	5.37:g.139740530C>T	ENSP00000230993:p.Pro146Ser	57.0	0.0		74.0	13.0	NM_001258428	B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Missense_Mutation	SNP	ENST00000230993.6	37	CCDS58973.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.416019	0.42817	.	.	ENSG00000113073	ENST00000230993;ENST00000506757;ENST00000432095;ENST00000506545;ENST00000507527	T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24	5.1	4.21	0.49690	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.628911	0.15868	N	0.240649	T	0.70745	0.3259	L	0.43152	1.355	0.26578	N	0.973428	B;B;B;B	0.13145	0.005;0.007;0.001;0.004	B;B;B;B	0.20767	0.011;0.031;0.004;0.013	T	0.63161	-0.6699	10	0.48119	T	0.1	.	11.1849	0.48650	0.0:0.8146:0.1854:0.0	.	122;146;122;122	E9PDK1;Q96Q91;Q96Q91-2;Q96Q91-3	.;B3A4_HUMAN;.;.	S	146;122;122;122;146	ENSP00000230993:P146S;ENSP00000424424:P122S;ENSP00000410056:P122S;ENSP00000422855:P122S;ENSP00000427661:P146S	ENSP00000230993:P146S	P	+	1	0	SLC4A9	139720714	0.966000	0.33281	1.000000	0.80357	0.994000	0.84299	0.917000	0.28665	1.314000	0.45095	0.561000	0.74099	CCA	.		0.652	SLC4A9-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372823.1	NM_031467	
SLCO4A1	28231	broad.mit.edu;ucsc.edu;mdanderson.org	37	20	61287812	61287812	+	Silent	SNP	C	C	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr20:61287812C>G	ENST00000370507.1	+	1	102	c.6C>G	c.(4-6)ccC>ccG	p.P2P	SLCO4A1_ENST00000217159.1_Silent_p.P2P			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	2					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CGGAGATGCCCCTGCATCAGC	0.672																																					p.P2P	Pancreas(168;741 2006 10379 40139 45334)	.											.	SLCO4A1	91	0			c.C6G						.						24.0	25.0	24.0					20																	61287812		2173	4257	6430	SO:0001819	synonymous_variant	28231	exon2			GATGCCCCTGCAT	AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.6C>G	20.37:g.61287812C>G		16.0	0.0		20.0	5.0	NM_016354	Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Silent	SNP	ENST00000370507.1	37	CCDS13501.1																																																																																			.		0.672	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080048.2	NM_016354	
SMARCA4	6597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11137010	11137010	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:11137010G>T	ENST00000429416.3	+	24	3484	c.3203G>T	c.(3202-3204)gGc>gTc	p.G1068V	SMARCA4_ENST00000358026.2_Missense_Mutation_p.G1068V|SMARCA4_ENST00000541122.2_Missense_Mutation_p.G1068V|SMARCA4_ENST00000444061.3_Missense_Mutation_p.G1068V|SMARCA4_ENST00000413806.3_Missense_Mutation_p.G1068V|SMARCA4_ENST00000450717.3_Missense_Mutation_p.G1068V|SMARCA4_ENST00000344626.4_Missense_Mutation_p.G1068V|SMARCA4_ENST00000590574.1_Missense_Mutation_p.G1068V|SMARCA4_ENST00000589677.1_Missense_Mutation_p.G1068V	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1068					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TTCACTGGCGGCATTGTCCAA	0.592			"""F, N, Mis"""		NSCLC																																p.G1068V		.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4	1523	1	Unknown(1)	lung(1)	c.G3203T						.						81.0	69.0	73.0					19																	11137010		2203	4300	6503	SO:0001583	missense	6597	exon23			CTGGCGGCATTGT	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3203G>T	19.37:g.11137010G>T	ENSP00000395654:p.Gly1068Val	87.0	0.0		102.0	11.0	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.712237	0.48517	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84;-0.84;-0.84;-0.84	4.49	4.49	0.54785	.	0.060357	0.64402	D	0.000003	T	0.79747	0.4499	M	0.83012	2.62	0.80722	D	1	B;P;B;B;B;B;B;B	0.45396	0.446;0.857;0.446;0.151;0.446;0.134;0.151;0.151	B;P;B;B;B;B;B;B	0.44811	0.272;0.461;0.272;0.13;0.272;0.094;0.185;0.185	D	0.84758	0.0760	10	0.87932	D	0	-29.5641	16.1707	0.81812	0.0:0.0:1.0:0.0	.	1068;1068;1068;1068;1068;288;1068;1068	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	V	1068;1068;1132;1068;1068;1068;1068;1068	ENSP00000395654:G1068V;ENSP00000350720:G1068V;ENSP00000343896:G1068V;ENSP00000445036:G1068V;ENSP00000392837:G1068V;ENSP00000397783:G1068V;ENSP00000414727:G1068V	ENSP00000343896:G1068V	G	+	2	0	SMARCA4	10998010	1.000000	0.71417	0.998000	0.56505	0.519000	0.34347	9.104000	0.94239	2.351000	0.79841	0.555000	0.69702	GGC	.		0.592	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
SP140L	93349	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	231256927	231256927	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:231256927C>A	ENST00000415673.2	+	12	1176	c.1090C>A	c.(1090-1092)Cta>Ata	p.L364I	SP140L_ENST00000243810.6_Missense_Mutation_p.L364I|SP140L_ENST00000396563.4_Missense_Mutation_p.L329I|SP140L_ENST00000444636.1_Missense_Mutation_p.L364I	NM_138402.4	NP_612411.4	Q9H930	SP14L_HUMAN	SP140 nuclear body protein-like	364	SAND. {ECO:0000255|PROSITE- ProRule:PRU00185}.					nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|skin(1)	20						CGGGTGGCCCCTACGACGGCT	0.483																																					p.L364I		.											.	SP140L	23	0			c.C1090A						.						80.0	94.0	89.0					2																	231256927		2056	4187	6243	SO:0001583	missense	93349	exon12			TGGCCCCTACGAC	BC004921	CCDS46538.1	2q37.1	2013-01-28			ENSG00000185404	ENSG00000185404		"""Zinc fingers, PHD-type"""	25105	protein-coding gene	gene with protein product						12477932	Standard	NM_138402		Approved		uc010fxm.1	Q9H930	OTTHUMG00000153730	ENST00000415673.2:c.1090C>A	2.37:g.231256927C>A	ENSP00000397911:p.Leu364Ile	106.0	0.0		110.0	53.0	NM_138402	Q2M375|Q4ZG65|Q9BSP3	Missense_Mutation	SNP	ENST00000415673.2	37	CCDS46538.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.365104	0.41902	.	.	ENSG00000185404	ENST00000444636;ENST00000415673;ENST00000243810;ENST00000396563	T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93	3.44	2.54	0.30619	.	.	.	.	.	D	0.84871	0.5568	M	0.82716	2.605	0.09310	N	1	D;D	0.89917	1.0;0.982	D;D	0.91635	0.999;0.952	T	0.72168	-0.4372	9	0.87932	D	0	.	8.1663	0.31228	0.2388:0.7612:0.0:0.0	.	329;364	Q9H930-2;Q9H930-4	.;.	I	364;364;364;329	ENSP00000395195:L364I;ENSP00000397911:L364I;ENSP00000243810:L364I;ENSP00000379811:L329I	ENSP00000243810:L364I	L	+	1	2	SP140L	230965171	0.416000	0.25424	0.016000	0.15963	0.113000	0.19764	3.071000	0.50041	0.983000	0.38602	0.591000	0.81541	CTA	.		0.483	SP140L-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374538.1	NM_138402	
STAB2	55576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	104136187	104136187	+	Silent	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr12:104136187C>T	ENST00000388887.2	+	56	6090	c.5886C>T	c.(5884-5886)tgC>tgT	p.C1962C		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TTCCAGCCTGCCCTGGAGGAC	0.542																																					p.C1962C		.											.	STAB2	104	0			c.C5886T						.						111.0	101.0	104.0					12																	104136187		2203	4300	6503	SO:0001819	synonymous_variant	55576	exon56			AGCCTGCCCTGGA	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.5886C>T	12.37:g.104136187C>T		53.0	0.0		67.0	27.0	NM_017564		Silent	SNP	ENST00000388887.2	37	CCDS31888.1																																																																																			.		0.542	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
SYT4	6860	broad.mit.edu;ucsc.edu;mdanderson.org	37	18	40854347	40854347	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr18:40854347G>A	ENST00000255224.3	-	2	415	c.47C>T	c.(46-48)aCa>aTa	p.T16I	SYT4_ENST00000586678.1_Intron|SYT4_ENST00000590752.1_Intron	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	16					exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						CCCCACCACTGTGGGGATTTC	0.413																																					p.T16I	NSCLC(85;81 1419 2855 22820 35912)	.											.	SYT4	132	0			c.C47T						.						36.0	37.0	37.0					18																	40854347		2203	4299	6502	SO:0001583	missense	6860	exon2			ACCACTGTGGGGA	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.47C>T	18.37:g.40854347G>A	ENSP00000255224:p.Thr16Ile	14.0	0.0		21.0	5.0	NM_020783	B4DEU3|Q9P2K4	Missense_Mutation	SNP	ENST00000255224.3	37	CCDS11922.1	.	.	.	.	.	.	.	.	.	.	G	11.39	1.626091	0.28978	.	.	ENSG00000132872	ENST00000255224	T	0.34859	1.34	5.98	5.11	0.69529	.	0.396051	0.31188	N	0.008093	T	0.31136	0.0787	L	0.36672	1.1	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.03993	-1.0986	10	0.39692	T	0.17	.	15.193	0.73060	0.067:0.0:0.933:0.0	.	16	Q9H2B2	SYT4_HUMAN	I	16	ENSP00000255224:T16I	ENSP00000255224:T16I	T	-	2	0	SYT4	39108345	0.991000	0.36638	0.999000	0.59377	0.824000	0.46624	2.985000	0.49362	1.545000	0.49373	-0.142000	0.14014	ACA	.		0.413	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783	
TCTA	6988	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49449889	49449889	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:49449889G>T	ENST00000273590.3	+	1	251	c.30G>T	c.(28-30)ttG>ttT	p.L10F	RHOA_ENST00000265538.3_5'UTR|RHOA_ENST00000422781.1_5'Flank|RHOA_ENST00000418115.1_5'Flank|TCTA_ENST00000493381.1_3'UTR|RHOA_ENST00000454011.2_5'Flank	NM_022171.2	NP_071503.1	P57738	TCTA_HUMAN	T-cell leukemia translocation altered	10						integral component of membrane (GO:0016021)				large_intestine(4)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GGCAGGCCTTGCAGGCTCTGC	0.697																																					p.L10F		.											.	TCTA	90	0			c.G30T						.						48.0	54.0	52.0					3																	49449889		2201	4297	6498	SO:0001583	missense	6988	exon1			GGCCTTGCAGGCT		CCDS2796.1	3p21	2012-02-27	2012-02-27		ENSG00000145022	ENSG00000145022			11692	protein-coding gene	gene with protein product		600690	"""T-cell leukemia translocation altered gene"""			7728759	Standard	NM_022171		Approved		uc003cwv.4	P57738	OTTHUMG00000156846	ENST00000273590.3:c.30G>T	3.37:g.49449889G>T	ENSP00000273590:p.Leu10Phe	48.0	0.0		46.0	12.0	NM_022171	B2R4I4|Q6I9U4|Q9BSB0	Missense_Mutation	SNP	ENST00000273590.3	37	CCDS2796.1	.	.	.	.	.	.	.	.	.	.	G	17.31	3.358352	0.61403	.	.	ENSG00000145022	ENST00000273590	.	.	.	5.18	5.18	0.71444	.	0.230121	0.37136	N	0.002221	T	0.42966	0.1226	N	0.14661	0.345	0.44555	D	0.997515	B	0.26809	0.16	B	0.30716	0.119	T	0.37150	-0.9718	9	0.41790	T	0.15	-4.3308	14.0669	0.64837	0.0:0.0:1.0:0.0	.	10	P57738	TCTA_HUMAN	F	10	.	ENSP00000273590:L10F	L	+	3	2	TCTA	49424893	1.000000	0.71417	0.997000	0.53966	0.457000	0.32468	2.407000	0.44565	2.695000	0.91970	0.555000	0.69702	TTG	.		0.697	TCTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346210.1	NM_022171	
THADA	63892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	43819108	43819108	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:43819108T>C	ENST00000405006.4	-	3	505	c.154A>G	c.(154-156)Atc>Gtc	p.I52V	THADA_ENST00000402360.2_Missense_Mutation_p.I52V|THADA_ENST00000404790.1_Missense_Mutation_p.I52V|THADA_ENST00000415080.2_5'UTR|THADA_ENST00000405975.2_Missense_Mutation_p.I52V|THADA_ENST00000403856.1_Missense_Mutation_p.I52V	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	52										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				ATATAATGGATTTGTGACACT	0.318																																					p.I52V		.											.	THADA	228	0			c.A154G						.						56.0	53.0	54.0					2																	43819108		1836	4070	5906	SO:0001583	missense	63892	exon3			AATGGATTTGTGA	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.154A>G	2.37:g.43819108T>C	ENSP00000385995:p.Ile52Val	99.0	0.0		128.0	62.0	NM_001083953	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	ENST00000405006.4	37	CCDS46268.1	.	.	.	.	.	.	.	.	.	.	T	18.21	3.573316	0.65765	.	.	ENSG00000115970	ENST00000405975;ENST00000356975;ENST00000405006;ENST00000402360;ENST00000404790;ENST00000403856	T;T;T;T;T	0.39056	2.54;2.54;1.18;1.15;1.1	4.86	4.86	0.63082	.	0.055295	0.64402	D	0.000002	T	0.60261	0.2255	M	0.63843	1.955	0.80722	D	1	D;D;D;D	0.69078	0.997;0.996;0.997;0.994	D;D;D;D	0.83275	0.993;0.99;0.996;0.978	T	0.61471	-0.7056	10	0.49607	T	0.09	.	13.1718	0.59602	0.0:0.0:0.0:1.0	.	52;52;52;52	B5MC89;Q8IY32;Q6YHU6-5;Q6YHU6	.;.;.;THADA_HUMAN	V	52	ENSP00000386088:I52V;ENSP00000385995:I52V;ENSP00000385441:I52V;ENSP00000384266:I52V;ENSP00000385469:I52V	ENSP00000349464:I52V	I	-	1	0	THADA	43672612	1.000000	0.71417	0.993000	0.49108	0.886000	0.51366	4.678000	0.61641	2.039000	0.60335	0.482000	0.46254	ATC	.		0.318	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065	
THAP10	56906	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	71175115	71175115	+	Frame_Shift_Del	DEL	G	G	-	rs148723779		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr15:71175115delG	ENST00000249861.4	-	2	1074	c.562delC	c.(562-564)cgtfs	p.R188fs	LRRC49_ENST00000544974.2_Intron	NM_020147.3	NP_064532.1	Q9P2Z0	THA10_HUMAN	THAP domain containing 10	188							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|kidney(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						CTACGGTGACGGGGCCTTTTC	0.373																																					p.R188fs		.											.	THAP10	92	0			c.562delC						.						118.0	116.0	117.0					15																	71175115		2199	4297	6496	SO:0001589	frameshift_variant	56906	exon2			GGTGACGGGGCCT	AL360202	CCDS10237.1	15q22.32	2013-01-25			ENSG00000129028	ENSG00000129028		"""THAP (C2CH-type zinc finger) domain containing"""	23193	protein-coding gene	gene with protein product		612538				12575992	Standard	NM_020147		Approved		uc002asv.3	Q9P2Z0	OTTHUMG00000133388	ENST00000249861.4:c.562delC	15.37:g.71175115delG	ENSP00000249861:p.Arg188fs	177.0	0.0		241.0	74.0	NM_020147	B2R8R0	Frame_Shift_Del	DEL	ENST00000249861.4	37	CCDS10237.1																																																																																			.		0.373	THAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257242.2	NM_020147	
TMCO3	55002	hgsc.bcm.edu;broad.mit.edu	37	13	114201642	114201642	+	Frame_Shift_Del	DEL	C	C	-	rs576852684		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr13:114201642delC	ENST00000434316.2	+	11	2077	c.1718delC	c.(1717-1719)gcgfs	p.A573fs	TMCO3_ENST00000375391.1_Intron	NM_017905.4	NP_060375.4	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3	573						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)			NS(1)|endometrium(4)|large_intestine(9)|liver(1)|lung(8)|prostate(1)|stomach(1)	25	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			ACGTTTGTGGCGTACGAGCTC	0.582																																					p.A573fs		.											.	TMCO3	90	0			c.1718delC						.						251.0	165.0	194.0					13																	114201642		2203	4300	6503	SO:0001589	frameshift_variant	55002	exon11			TTGTGGCGTACGA	BC012564	CCDS9537.1	13q34	2008-02-05	2005-07-22	2005-07-22	ENSG00000150403	ENSG00000150403			20329	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 11"""	C13orf11			Standard	NM_017905		Approved	FLJ20623	uc001vtu.4	Q6UWJ1	OTTHUMG00000017389	ENST00000434316.2:c.1718delC	13.37:g.114201642delC	ENSP00000389399:p.Ala573fs	45.0	0.0		70.0	12.0	NM_017905	Q5JSB1|Q6NUN1|Q8NG29|Q8TCI6|Q96EA6|Q9NWT2	Frame_Shift_Del	DEL	ENST00000434316.2	37	CCDS9537.1																																																																																			.		0.582	TMCO3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045931.3	NM_017905	
TMCO3	55002	hgsc.bcm.edu;bcgsc.ca	37	13	114201644	114201644	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr13:114201644T>A	ENST00000434316.2	+	11	2079	c.1720T>A	c.(1720-1722)Tac>Aac	p.Y574N	TMCO3_ENST00000375391.1_Intron	NM_017905.4	NP_060375.4	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3	574						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)			NS(1)|endometrium(4)|large_intestine(9)|liver(1)|lung(8)|prostate(1)|stomach(1)	25	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			GTTTGTGGCGTACGAGCTCAC	0.582																																					p.Y574N		.											.	TMCO3	90	0			c.T1720A						.						251.0	164.0	194.0					13																	114201644		2203	4300	6503	SO:0001583	missense	55002	exon11			GTGGCGTACGAGC	BC012564	CCDS9537.1	13q34	2008-02-05	2005-07-22	2005-07-22	ENSG00000150403	ENSG00000150403			20329	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 11"""	C13orf11			Standard	NM_017905		Approved	FLJ20623	uc001vtu.4	Q6UWJ1	OTTHUMG00000017389	ENST00000434316.2:c.1720T>A	13.37:g.114201644T>A	ENSP00000389399:p.Tyr574Asn	47.0	0.0		71.0	13.0	NM_017905	Q5JSB1|Q6NUN1|Q8NG29|Q8TCI6|Q96EA6|Q9NWT2	Missense_Mutation	SNP	ENST00000434316.2	37	CCDS9537.1	.	.	.	.	.	.	.	.	.	.	T	7.341	0.620999	0.14193	.	.	ENSG00000150403	ENST00000434316	T	0.14516	2.5	4.78	3.56	0.40772	Cation/H+ exchanger (1);	0.220946	0.39834	N	0.001247	T	0.08980	0.0222	N	0.25647	0.755	0.80722	D	1	B	0.25206	0.12	B	0.24541	0.054	T	0.19976	-1.0289	10	0.13853	T	0.58	-15.8785	10.54	0.45026	0.0:0.0777:0.0:0.9223	.	574	Q6UWJ1	TMCO3_HUMAN	N	574	ENSP00000389399:Y574N	ENSP00000389399:Y574N	Y	+	1	0	TMCO3	113249645	1.000000	0.71417	0.005000	0.12908	0.083000	0.17756	5.908000	0.69916	0.668000	0.31126	0.374000	0.22700	TAC	.		0.582	TMCO3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045931.3	NM_017905	
TMEM229A	730130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	123672284	123672284	+	Silent	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:123672284G>A	ENST00000455783.1	-	1	1239	c.774C>T	c.(772-774)ttC>ttT	p.F258F	RP5-921G16.1_ENST00000484322.1_RNA	NM_001136002.1	NP_001129474.1	B2RXF0	T229A_HUMAN	transmembrane protein 229A	258						host cell nucleus (GO:0042025)|integral component of membrane (GO:0016021)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)	6						AGAAGAAGGTGAAGAAGATCT	0.622																																					p.F258F		.											.	.	.	0			c.C774T						.						59.0	64.0	62.0					7																	123672284		692	1591	2283	SO:0001819	synonymous_variant	730130	exon1			GAAGGTGAAGAAG	BC157828	CCDS47694.1	7q31.32	2009-09-22			ENSG00000234224	ENSG00000234224			37279	protein-coding gene	gene with protein product							Standard	NM_001136002		Approved		uc011kob.2	B2RXF0	OTTHUMG00000154762	ENST00000455783.1:c.774C>T	7.37:g.123672284G>A		58.0	0.0		145.0	24.0	NM_001136002	A4D0X6	Silent	SNP	ENST00000455783.1	37	CCDS47694.1																																																																																			.		0.622	TMEM229A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336960.3	NM_001136002	
TMEM33	55161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	41951403	41951403	+	Splice_Site	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr4:41951403G>T	ENST00000504986.1	+	6	979		c.e6+1		TMEM33_ENST00000513702.1_Splice_Site|TMEM33_ENST00000325094.5_Splice_Site	NM_018126.2	NP_060596.2	P57088	TMM33_HUMAN	transmembrane protein 33							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)				endometrium(1)|large_intestine(3)|lung(4)|ovary(1)	9						CATATTGTCGGTAAGCTGATG	0.318																																					.		.											.	TMEM33	91	0			c.614+1G>T						.						111.0	113.0	113.0					4																	41951403		2203	4300	6503	SO:0001630	splice_region_variant	55161	exon6			TTGTCGGTAAGCT	BC000948	CCDS3464.1	4p14	2008-02-05			ENSG00000109133	ENSG00000109133			25541	protein-coding gene	gene with protein product						12477932	Standard	NM_018126		Approved	FLJ10525	uc003gwi.2	P57088	OTTHUMG00000099381	ENST00000504986.1:c.614+1G>T	4.37:g.41951403G>T		23.0	0.0		25.0	11.0	NM_018126	B3KSS8|Q9H953	Splice_Site	SNP	ENST00000504986.1	37	CCDS3464.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.445879	0.84101	.	.	ENSG00000109133	ENST00000504986;ENST00000508448;ENST00000513702;ENST00000325094;ENST00000513558	.	.	.	5.16	5.16	0.70880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6287	0.91350	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMEM33	41646160	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.199000	0.95003	2.403000	0.81681	0.591000	0.81541	.	.		0.318	TMEM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216834.2	NM_018126	Intron
TMPRSS7	344805	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	111780660	111780660	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:111780660A>T	ENST00000452346.2	+	11	1340	c.1337A>T	c.(1336-1338)cAg>cTg	p.Q446L	TMPRSS7_ENST00000419127.1_Missense_Mutation_p.Q320L			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	446	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						ATGGATCATCAGACAATTTTT	0.483																																					p.Q320L		.											.	TMPRSS7	70	0			c.A959T						.						127.0	129.0	128.0					3																	111780660		1929	4134	6063	SO:0001583	missense	344805	exon9			ATCATCAGACAAT	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.1337A>T	3.37:g.111780660A>T	ENSP00000398236:p.Gln446Leu	71.0	0.0		122.0	35.0	NM_001042575	C9J8P7|E9PAS3|Q17RH4	Missense_Mutation	SNP	ENST00000452346.2	37		.	.	.	.	.	.	.	.	.	.	A	15.30	2.791297	0.50102	.	.	ENSG00000176040	ENST00000452346;ENST00000443106;ENST00000437906;ENST00000419127	T;T	0.32272	1.46;1.46	5.62	4.47	0.54385	CUB (1);	0.571239	0.18210	N	0.148215	T	0.20210	0.0486	L	0.36672	1.1	0.32112	N	0.589153	B;B	0.27625	0.183;0.066	B;B	0.27887	0.084;0.05	T	0.14392	-1.0474	10	0.19590	T	0.45	.	5.3101	0.15825	0.7307:0.1804:0.0889:0.0	.	446;320	Q7RTY8;Q7RTY8-2	TMPS7_HUMAN;.	L	446;434;420;320	ENSP00000398236:Q446L;ENSP00000411645:Q320L	ENSP00000411645:Q320L	Q	+	2	0	TMPRSS7	113263350	0.996000	0.38824	0.994000	0.49952	0.982000	0.71751	1.819000	0.39022	2.138000	0.66242	0.455000	0.32223	CAG	.		0.483	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000347592.2	XM_293599	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr17:7578271T>C	ENST00000269305.4	-	6	767	c.578A>G	c.(577-579)cAt>cGt	p.H193R	TP53_ENST00000445888.2_Missense_Mutation_p.H193R|TP53_ENST00000413465.2_Missense_Mutation_p.H193R|TP53_ENST00000359597.4_Missense_Mutation_p.H193R|TP53_ENST00000455263.2_Missense_Mutation_p.H193R|TP53_ENST00000420246.2_Missense_Mutation_p.H193R|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.H193R	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,head_neck,carcinoma,0	TP53	70225	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	c.A578G	GRCh37	CM083194|CM951225	TP53	M		.						97.0	87.0	90.0					17																	7578271		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ATAAGATGCTGAG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>G	17.37:g.7578271T>C	ENSP00000269305:p.His193Arg	110.0	0.0		102.0	83.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413611	0.42817	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99850	-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.92738	3.34	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97536	1.0083	10	0.72032	D	0.01	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193R;ENSP00000352610:H193R;ENSP00000269305:H193R;ENSP00000398846:H193R;ENSP00000391127:H193R;ENSP00000391478:H193R;ENSP00000425104:H61R;ENSP00000423862:H100R	ENSP00000269305:H193R	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT	.		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TNRC6C	57690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	76046694	76046694	+	Silent	SNP	G	G	A	rs566391812		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr17:76046694G>A	ENST00000588061.1	+	5	2278	c.1551G>A	c.(1549-1551)gtG>gtA	p.V517V	TNRC6C_ENST00000335749.4_Silent_p.V517V|TNRC6C_ENST00000544502.1_Silent_p.V517V|TNRC6C_ENST00000301624.4_Silent_p.V517V|TNRC6C_ENST00000588847.1_Silent_p.V517V|TNRC6C_ENST00000541771.1_Silent_p.V517V			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	517	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CTGCCGCTGTGCCAGCAAACA	0.557																																					p.V517V		.											.	TNRC6C	24	0			c.G1551A						.						62.0	72.0	69.0					17																	76046694		2028	4183	6211	SO:0001819	synonymous_variant	57690	exon4			CGCTGTGCCAGCA	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.1551G>A	17.37:g.76046694G>A		32.0	0.0		52.0	28.0	NM_018996	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Silent	SNP	ENST00000588061.1	37	CCDS45798.1																																																																																			.		0.557	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996	
TPM2	7169	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	35685682	35685688	+	Frame_Shift_Del	DEL	CTTCTGC	CTTCTGC	-			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	CTTCTGC	CTTCTGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr9:35685682_35685688delCTTCTGC	ENST00000360958.2	-	3	434_440	c.330_336delGCAGAAG	c.(328-336)ctgcagaagfs	p.LQK110fs	TPM2_ENST00000378292.3_Frame_Shift_Del_p.LQK110fs|TPM2_ENST00000329305.2_Frame_Shift_Del_p.LQK110fs|TPM2_ENST00000378300.5_Frame_Shift_Del_p.LQK110fs	NM_003289.3	NP_003280.2	P07951	TPM2_HUMAN	tropomyosin 2 (beta)	110					muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)	cytosol (GO:0005829)|muscle thin filament tropomyosin (GO:0005862)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_epithelial(49;0.121)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CCTCCTCCAGCTTCTGCAGGGCTGTAG	0.671																																					p.110_112del		.											.	TPM2	515	0			c.330_336del						.																																			SO:0001589	frameshift_variant	7169	exon3			CTCCAGCTTCTGC		CCDS6586.1, CCDS6587.1	9p13	2014-09-17	2003-12-02		ENSG00000198467	ENSG00000198467		"""Tropomyosins"""	12011	protein-coding gene	gene with protein product	"""nemaline myopathy type 4"""	190990	"""arthrogryposis multiplex congenital, distal, type 1"""	AMCD1		7606936	Standard	NM_003289		Approved	DA1, NEM4	uc003zxq.3	P07951	OTTHUMG00000019878	ENST00000360958.2:c.330_336delGCAGAAG	9.37:g.35685682_35685688delCTTCTGC	ENSP00000354219:p.Leu110fs	54.0	0.0		48.0	17.0	NM_213674	A6NM85|P06468|Q13894|Q53FM4|Q5TCU4|Q5TCU7|Q9UH67	Frame_Shift_Del	DEL	ENST00000360958.2	37	CCDS6587.1																																																																																			.		0.671	TPM2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052376.1	NM_003289	
TPO	7173	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	1481040	1481040	+	Silent	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:1481040G>T	ENST00000345913.4	+	8	1093	c.1002G>T	c.(1000-1002)ccG>ccT	p.P334P	TPO_ENST00000349624.3_Intron|TPO_ENST00000337415.3_Silent_p.P334P|TPO_ENST00000382201.3_Silent_p.P334P|TPO_ENST00000382198.1_Intron|TPO_ENST00000329066.4_Silent_p.P334P|TPO_ENST00000346956.3_Silent_p.P334P|TPO_ENST00000497517.2_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	334					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GCAGCTCCCCGGCCCTAGAGA	0.692																																					p.P334P		.											.	TPO	332	0			c.G1002T						.						16.0	15.0	16.0					2																	1481040		2187	4283	6470	SO:0001819	synonymous_variant	7173	exon8			CTCCCCGGCCCTA		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1002G>T	2.37:g.1481040G>T		29.0	0.0		74.0	7.0	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Silent	SNP	ENST00000345913.4	37	CCDS1643.1																																																																																			.		0.692	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
TPRG1L	127262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	3542442	3542442	+	Silent	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:3542442A>G	ENST00000378344.2	+	3	530	c.459A>G	c.(457-459)aaA>aaG	p.K153K	RP11-46F15.2_ENST00000435049.1_RNA|TPRG1L_ENST00000344579.5_Intron	NM_182752.3	NP_877429.2	Q5T0D9	TPRGL_HUMAN	tumor protein p63 regulated 1-like	153						cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(1)	8	all_cancers(77;0.0119)|all_epithelial(69;0.00481)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.41e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.83e-22)|GBM - Glioblastoma multiforme(42;4.77e-14)|Colorectal(212;1.12e-05)|COAD - Colon adenocarcinoma(227;5.61e-05)|Kidney(185;0.000351)|BRCA - Breast invasive adenocarcinoma(365;0.000688)|KIRC - Kidney renal clear cell carcinoma(229;0.00553)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.201)		TTCCCCCTAAATCGCTCAACA	0.502																																					p.K153K		.											.	TPRG1L	68	0			c.A459G						.						65.0	61.0	63.0					1																	3542442		2203	4299	6502	SO:0001819	synonymous_variant	127262	exon3			CCCTAAATCGCTC	BC019034	CCDS47.1	1p36.32	2008-02-05	2008-01-16	2008-01-16	ENSG00000158109	ENSG00000158109			27007	protein-coding gene	gene with protein product		611460	"""family with sequence similarity 79, member A"""	FAM79A		12477932	Standard	NM_182752		Approved	RP11-46F15.3, FLJ21811	uc001akm.3	Q5T0D9	OTTHUMG00000000609	ENST00000378344.2:c.459A>G	1.37:g.3542442A>G		15.0	0.0		25.0	6.0	NM_182752	A8K1K4|Q8WV04	Silent	SNP	ENST00000378344.2	37	CCDS47.1																																																																																			.		0.502	TPRG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001466.1	NM_182752	
TRAF6	7189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	36511424	36511424	+	Silent	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr11:36511424C>T	ENST00000526995.1	-	7	1779	c.1533G>A	c.(1531-1533)gaG>gaA	p.E511E	TRAF6_ENST00000348124.5_Silent_p.E511E|TRAF6_ENST00000529150.1_5'Flank	NM_004620.3	NP_004611.1	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6, E3 ubiquitin protein ligase	511					activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of protein kinase activity (GO:0032147)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|apoptotic signaling pathway (GO:0097190)|bone resorption (GO:0045453)|cell development (GO:0048468)|cellular response to lipopolysaccharide (GO:0071222)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein autoubiquitination (GO:0051865)|protein complex assembly (GO:0006461)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of immunoglobulin secretion (GO:0051023)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	histone deacetylase binding (GO:0042826)|ligase activity (GO:0016874)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase B binding (GO:0043422)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)	27	all_lung(20;0.211)	all_hematologic(20;0.107)				GCTGAAAACCCTCCCTCCGAA	0.488																																					p.E511E		.											.	TRAF6	660	0			c.G1533A						.						149.0	147.0	148.0					11																	36511424		2202	4298	6500	SO:0001819	synonymous_variant	7189	exon7			AAAACCCTCCCTC		CCDS7901.1	11p12	2013-01-09	2012-02-23		ENSG00000175104	ENSG00000175104		"""RING-type (C3HC4) zinc fingers"""	12036	protein-coding gene	gene with protein product		602355	"""TNF receptor-associated factor 6"""			8837778	Standard	NM_004620		Approved	RNF85	uc001mws.2	Q9Y4K3	OTTHUMG00000166391	ENST00000526995.1:c.1533G>A	11.37:g.36511424C>T		105.0	0.0		95.0	29.0	NM_004620	A6NKI7|A8KAB3|D3DR16|Q8NEH5	Silent	SNP	ENST00000526995.1	37	CCDS7901.1																																																																																			.		0.488	TRAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389530.1	NM_145803	
TRAK1	22906	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	42243973	42243973	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:42243973delC	ENST00000327628.5	+	13	1873	c.1473delC	c.(1471-1473)ggcfs	p.G491fs	TRAK1_ENST00000396175.1_Frame_Shift_Del_p.G433fs|TRAK1_ENST00000341421.3_Frame_Shift_Del_p.G433fs|TRAK1_ENST00000487159.1_3'UTR|TRAK1_ENST00000449246.1_Frame_Shift_Del_p.G417fs	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	491	Interaction with HGS.				endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						GCACCCCAGGCTCCCACGACC	0.637																																					p.G491fs	GBM(44;195 884 22595 31865 41850)	.											.	TRAK1	91	0			c.1473delC						.						25.0	34.0	31.0					3																	42243973		2203	4297	6500	SO:0001589	frameshift_variant	22906	exon13			CCCAGGCTCCCAC		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.1473delC	3.37:g.42243973delC	ENSP00000328998:p.Gly491fs	123.0	0.0		211.0	26.0	NM_001265608	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Frame_Shift_Del	DEL	ENST00000327628.5	37	CCDS43072.1																																																																																			.		0.637	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
TRPM4	54795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49686109	49686109	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:49686109A>T	ENST00000252826.5	+	11	1664	c.1538A>T	c.(1537-1539)aAg>aTg	p.K513M	TRPM4_ENST00000427978.2_Missense_Mutation_p.K513M|TRPM4_ENST00000355712.5_Missense_Mutation_p.K159M	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	513					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		CTGCTGGGGAAGATGTGCGCG	0.716																																					p.K513M		.											.	TRPM4	91	0			c.A1538T						.						13.0	16.0	15.0					19																	49686109		2189	4284	6473	SO:0001583	missense	54795	exon11			TGGGGAAGATGTG	AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.1538A>T	19.37:g.49686109A>T	ENSP00000252826:p.Lys513Met	55.0	0.0		69.0	15.0	NM_001195227	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	ENST00000252826.5	37	CCDS33073.1	.	.	.	.	.	.	.	.	.	.	a	13.26	2.185144	0.38609	.	.	ENSG00000130529	ENST00000252826;ENST00000427978;ENST00000355712	T;T;T	0.63744	-0.06;-0.06;-0.06	4.03	2.92	0.33932	.	4.180590	0.01703	U	0.027296	T	0.68897	0.3051	L	0.55481	1.735	0.09310	N	1	P;P;P;P	0.50943	0.94;0.785;0.785;0.874	P;P;B;P	0.50378	0.533;0.639;0.444;0.461	T	0.55464	-0.8137	10	0.87932	D	0	-9.5923	8.8871	0.35409	0.8139:0.186:0.0:0.0	.	159;339;513;513	B4DIX5;Q8TD43-2;Q8TD43-3;Q8TD43	.;.;.;TRPM4_HUMAN	M	513;513;159	ENSP00000252826:K513M;ENSP00000407492:K513M;ENSP00000347944:K159M	ENSP00000252826:K513M	K	+	2	0	TRPM4	54377921	1.000000	0.71417	0.276000	0.24689	0.213000	0.24496	3.238000	0.51352	1.625000	0.50366	0.358000	0.22013	AAG	.		0.716	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465543.2	NM_017636	
TUSC3	7991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	15480657	15480657	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr8:15480657T>G	ENST00000503731.1	+	2	355	c.207T>G	c.(205-207)aaT>aaG	p.N69K	TUSC3_ENST00000503191.1_3'UTR|TUSC3_ENST00000382020.4_Missense_Mutation_p.N69K|TUSC3_ENST00000506802.1_Missense_Mutation_p.N69K|TUSC3_ENST00000509380.1_Missense_Mutation_p.N69K	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	69	Thioredoxin.				cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		TCCGAATGAATGGTGATAAAT	0.393																																					p.N69K		.											.	TUSC3	516	0			c.T207G						.						81.0	81.0	81.0					8																	15480657		2203	4300	6503	SO:0001583	missense	7991	exon2			AATGAATGGTGAT	AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.207T>G	8.37:g.15480657T>G	ENSP00000424544:p.Asn69Lys	66.0	0.0		93.0	34.0	NM_178234	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Missense_Mutation	SNP	ENST00000503731.1	37	CCDS5994.1	.	.	.	.	.	.	.	.	.	.	T	19.46	3.832711	0.71258	.	.	ENSG00000104723	ENST00000382020;ENST00000506802;ENST00000509380;ENST00000503731	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.59	1.74	0.24563	Thioredoxin domain (1);Thioredoxin-like fold (2);	0.085998	0.85682	D	0.000000	T	0.62780	0.2456	M	0.85945	2.785	0.52099	D	0.999943	D;D;D;D;D;D	0.76494	0.969;0.998;0.989;0.999;0.994;0.999	D;D;D;D;D;D	0.83275	0.968;0.969;0.979;0.983;0.95;0.996	T	0.62426	-0.6857	10	0.51188	T	0.08	-22.2402	8.9569	0.35823	0.0:0.3572:0.0:0.6428	.	69;69;69;69;69;69	D6RDV0;D6RIY7;Q13454-2;Q13454;D6RA37;A8MSM0	.;.;.;TUSC3_HUMAN;.;.	K	69	ENSP00000371450:N69K;ENSP00000425777:N69K;ENSP00000423426:N69K;ENSP00000424544:N69K	ENSP00000221167:N69K	N	+	3	2	TUSC3	15525028	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.591000	0.23969	0.433000	0.26313	0.528000	0.53228	AAT	.		0.393	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1	NM_006765	
TUSC3	7991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	15480659	15480659	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr8:15480659G>T	ENST00000503731.1	+	2	357	c.209G>T	c.(208-210)gGt>gTt	p.G70V	TUSC3_ENST00000503191.1_3'UTR|TUSC3_ENST00000382020.4_Missense_Mutation_p.G70V|TUSC3_ENST00000506802.1_Missense_Mutation_p.G70V|TUSC3_ENST00000509380.1_Missense_Mutation_p.G70V	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	70	Thioredoxin.				cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		CGAATGAATGGTGATAAATTC	0.403																																					p.G70V		.											.	TUSC3	516	0			c.G209T						.						81.0	82.0	81.0					8																	15480659		2203	4300	6503	SO:0001583	missense	7991	exon2			TGAATGGTGATAA	AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.209G>T	8.37:g.15480659G>T	ENSP00000424544:p.Gly70Val	67.0	0.0		91.0	33.0	NM_178234	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Missense_Mutation	SNP	ENST00000503731.1	37	CCDS5994.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.643729	0.87859	.	.	ENSG00000104723	ENST00000382020;ENST00000506802;ENST00000509380;ENST00000503731	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.59	5.59	0.84812	Thioredoxin domain (1);Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.67998	0.2953	M	0.80847	2.515	0.80722	D	1	D;P;D;P;P;D	0.89917	1.0;0.949;1.0;0.949;0.949;1.0	D;P;D;P;P;D	0.97110	0.999;0.837;0.998;0.771;0.837;1.0	T	0.67150	-0.5743	10	0.44086	T	0.13	-16.7342	18.9566	0.92661	0.0:0.0:1.0:0.0	.	70;70;70;70;70;70	D6RDV0;D6RIY7;Q13454-2;Q13454;D6RA37;A8MSM0	.;.;.;TUSC3_HUMAN;.;.	V	70	ENSP00000371450:G70V;ENSP00000425777:G70V;ENSP00000423426:G70V;ENSP00000424544:G70V	ENSP00000221167:G70V	G	+	2	0	TUSC3	15525030	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.804000	0.96469	0.650000	0.86243	GGT	.		0.403	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1	NM_006765	
UBE3C	9690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	156974809	156974809	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:156974809G>C	ENST00000348165.5	+	8	1138	c.778G>C	c.(778-780)Gtt>Ctt	p.V260L	UBE3C_ENST00000389103.4_Missense_Mutation_p.V217L	NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	260					protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		CAGGCAACAAGTTTTTACAGC	0.368																																					p.V260L		.											.	UBE3C	704	0			c.G778C						.						71.0	76.0	75.0					7																	156974809		2203	4300	6503	SO:0001583	missense	9690	exon8			CAACAAGTTTTTA	AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.778G>C	7.37:g.156974809G>C	ENSP00000309198:p.Val260Leu	76.0	0.0		148.0	24.0	NM_014671	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	ENST00000348165.5	37	CCDS34789.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894760	0.52121	.	.	ENSG00000009335	ENST00000348165;ENST00000389103	T	0.53423	0.62	5.08	4.07	0.47477	.	0.130780	0.56097	D	0.000040	T	0.40619	0.1124	M	0.62723	1.935	0.58432	D	0.999994	B;B;B	0.33739	0.085;0.422;0.251	B;B;B	0.37422	0.026;0.221;0.249	T	0.15838	-1.0423	10	0.13853	T	0.58	.	6.011	0.19575	0.2356:0.0:0.7644:0.0	.	260;260;217	Q15386;Q15386-2;Q15386-3	UBE3C_HUMAN;.;.	L	260;217	ENSP00000309198:V260L	ENSP00000309198:V260L	V	+	1	0	UBE3C	156667570	1.000000	0.71417	0.952000	0.39060	0.779000	0.44077	3.643000	0.54374	2.366000	0.80165	0.455000	0.32223	GTT	.		0.368	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348108.1	NM_014671	
UTP20	27340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	101750830	101750830	+	Missense_Mutation	SNP	A	A	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr12:101750830A>C	ENST00000261637.4	+	43	5835	c.5661A>C	c.(5659-5661)gaA>gaC	p.E1887D	snoU13_ENST00000458958.1_RNA	NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1887					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						TTTTAAAAGAATTACAGACTA	0.378																																					p.E1887D		.											.	UTP20	155	0			c.A5661C						.						75.0	72.0	73.0					12																	101750830		2203	4300	6503	SO:0001583	missense	27340	exon43			AAAAGAATTACAG	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.5661A>C	12.37:g.101750830A>C	ENSP00000261637:p.Glu1887Asp	64.0	0.0		77.0	11.0	NM_014503	Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	37	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.349155	0.82132	.	.	ENSG00000120800	ENST00000261637	T	0.47177	0.85	5.79	-0.493	0.12038	Armadillo-type fold (1);	0.047730	0.85682	D	0.000000	T	0.57725	0.2073	L	0.61387	1.9	0.46981	D	0.999271	D	0.65815	0.995	D	0.67103	0.949	T	0.56068	-0.8040	10	0.48119	T	0.1	-24.176	9.6997	0.40178	0.4399:0.0:0.5601:0.0	.	1887	O75691	UTP20_HUMAN	D	1887	ENSP00000261637:E1887D	ENSP00000261637:E1887D	E	+	3	2	UTP20	100274961	1.000000	0.71417	0.982000	0.44146	0.953000	0.61014	0.754000	0.26390	0.107000	0.17824	0.533000	0.62120	GAA	.		0.378	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
VPS13A	23230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	79973288	79973288	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr9:79973288C>G	ENST00000360280.3	+	57	8229	c.7969C>G	c.(7969-7971)Cat>Gat	p.H2657D	VPS13A_ENST00000376636.3_Missense_Mutation_p.H2618D|VPS13A_ENST00000357409.5_Missense_Mutation_p.H2657D|VPS13A_ENST00000376634.4_Missense_Mutation_p.H2657D	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	2657					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						AAATCAGATACATGGTGCTGT	0.318																																					p.H2657D		.											.	VPS13A	161	0			c.C7969G						.						177.0	165.0	169.0					9																	79973288		2203	4300	6503	SO:0001583	missense	23230	exon57			CAGATACATGGTG	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.7969C>G	9.37:g.79973288C>G	ENSP00000353422:p.His2657Asp	64.0	0.0		111.0	40.0	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	ENST00000360280.3	37	CCDS6655.1	.	.	.	.	.	.	.	.	.	.	C	10.74	1.434321	0.25813	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	5.92	3.94	0.45596	.	0.459125	0.25050	N	0.033532	T	0.65729	0.2719	L	0.34521	1.04	0.80722	D	1	B;B;B;B	0.28636	0.0;0.139;0.218;0.218	B;B;B;B	0.23574	0.001;0.021;0.047;0.047	T	0.61579	-0.7034	9	.	.	.	.	13.3116	0.60384	0.2867:0.7133:0.0:0.0	.	2618;2657;2657;2657	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	D	2657;2618;2657;2657	ENSP00000365821:H2657D;ENSP00000365823:H2618D;ENSP00000353422:H2657D;ENSP00000349985:H2657D	.	H	+	1	0	VPS13A	79163108	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	4.089000	0.57685	1.462000	0.47948	0.650000	0.86243	CAT	.		0.318	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
ALG3	10195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	183959188	183959188	+	IGR	SNP	C	C	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:183959188C>G	ENST00000397676.3	-	0	1528				VWA5B2_ENST00000273794.5_Missense_Mutation_p.P841R|VWA5B2_ENST00000426955.2_Missense_Mutation_p.P1059R|MIR1224_ENST00000408193.1_RNA|EIF2B5_ENST00000444495.1_Intron|ALG3_ENST00000463495.1_5'Flank	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GACTACCTGCCCTTGGTGAGG	0.672																																					p.P1059R		.											.	.	.	0			c.C3176G						.						21.0	24.0	23.0					3																	183959188		1559	3573	5132	SO:0001628	intergenic_variant	90113	exon18			ACCTGCCCTTGGT	BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823		3.37:g.183959188C>G		188.0	0.0		262.0	77.0	NM_138345	A8JZZ6|Q9BT71	Missense_Mutation	SNP	ENST00000397676.3	37	CCDS46968.1	.	.	.	.	.	.	.	.	.	.	C	18.99	3.739400	0.69304	.	.	ENSG00000145198	ENST00000426955;ENST00000273794	T;T	0.39229	1.64;1.09	4.79	4.79	0.61399	.	0.000000	0.50627	D	0.000115	T	0.63570	0.2522	M	0.74647	2.275	0.80722	D	1	D;D;D	0.89917	0.993;1.0;1.0	P;D;D	0.85130	0.844;0.997;0.997	T	0.66870	-0.5814	10	0.87932	D	0	-6.9618	13.5504	0.61728	0.0:1.0:0.0:0.0	.	841;1059;1070	E9PF42;B9EGN7;Q8N398	.;.;VW5B2_HUMAN	R	1059;841	ENSP00000398688:P1059R;ENSP00000273794:P841R	ENSP00000273794:P841R	P	+	2	0	VWA5B2	185441882	0.422000	0.25473	0.993000	0.49108	0.814000	0.46013	1.723000	0.38053	2.655000	0.90218	0.462000	0.41574	CCC	.		0.672	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346033.1	NM_005787	
WBSCR27	155368	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	73256365	73256365	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:73256365C>A	ENST00000297873.4	-	2	155	c.106G>T	c.(106-108)Gct>Tct	p.A36S		NM_152559.2	NP_689772.2	Q8N6F8	WBS27_HUMAN	Williams Beuren syndrome chromosome region 27	36										NS(1)|central_nervous_system(1)|lung(2)|prostate(1)	5		Lung NSC(55;0.159)				TAGTCCGGAGCCCAGCGGTCA	0.627																																					p.A36S		.											.	WBSCR27	90	0			c.G106T						.						62.0	57.0	59.0					7																	73256365		2203	4300	6503	SO:0001583	missense	155368	exon2			CCGGAGCCCAGCG	AF534110	CCDS5561.1	7q11.23	2004-07-05			ENSG00000165171	ENSG00000165171			19068	protein-coding gene	gene with protein product		612546					Standard	NM_152559		Approved		uc003tzj.2	Q8N6F8	OTTHUMG00000130033	ENST00000297873.4:c.106G>T	7.37:g.73256365C>A	ENSP00000297873:p.Ala36Ser	34.0	0.0		125.0	15.0	NM_152559		Missense_Mutation	SNP	ENST00000297873.4	37	CCDS5561.1	.	.	.	.	.	.	.	.	.	.	C	12.24	1.878739	0.33162	.	.	ENSG00000165171	ENST00000297873	T	0.72505	-0.66	4.57	2.74	0.32292	.	0.000000	0.85682	D	0.000000	T	0.79828	0.4513	M	0.71206	2.165	0.40776	D	0.983138	D;D	0.89917	0.976;1.0	P;D	0.70227	0.698;0.968	T	0.76465	-0.2949	10	0.38643	T	0.18	-0.1076	10.2754	0.43507	0.0:0.8158:0.0:0.1842	.	36;36	B4DWM3;Q8N6F8	.;WBS27_HUMAN	S	36	ENSP00000297873:A36S	ENSP00000297873:A36S	A	-	1	0	WBSCR27	72894301	1.000000	0.71417	0.673000	0.29887	0.002000	0.02628	1.924000	0.40065	0.147000	0.19030	-1.134000	0.01955	GCT	.		0.627	WBSCR27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252312.1	NM_152559	
XIRP2	129446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	168106334	168106334	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:168106334A>T	ENST00000409195.1	+	9	8521	c.8432A>T	c.(8431-8433)gAc>gTc	p.D2811V	XIRP2_ENST00000295237.9_Missense_Mutation_p.D2811V|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.D2589V|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2636					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AGCGGATCTGACAGAGGGAAA	0.398																																					p.D2811V		.											.	XIRP2	104	0			c.A8432T						.						69.0	68.0	68.0					2																	168106334		1845	4095	5940	SO:0001583	missense	129446	exon9			GATCTGACAGAGG	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.8432A>T	2.37:g.168106334A>T	ENSP00000386840:p.Asp2811Val	102.0	0.0		131.0	55.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	A	3.299	-0.143332	0.06669	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.02579	4.24;4.24;4.24	6.02	-4.86	0.03132	.	1.146790	0.06178	N	0.678890	T	0.02230	0.0069	N	0.25647	0.755	0.09310	N	0.999999	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.0;0.001;0.001	T	0.48625	-0.9019	10	0.24483	T	0.36	0.0761	8.5414	0.33395	0.3836:0.0977:0.0:0.5187	.	2636;2636;2589	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	V	2811;2811;2589;225	ENSP00000386840:D2811V;ENSP00000295237:D2811V;ENSP00000387255:D2589V	ENSP00000295237:D2811V	D	+	2	0	XIRP2	167814580	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.002000	0.12924	-0.443000	0.07180	0.533000	0.62120	GAC	.		0.398	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
YEATS2	55689	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	183480001	183480001	+	Silent	SNP	C	C	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:183480001C>A	ENST00000305135.5	+	15	2076	c.1881C>A	c.(1879-1881)tcC>tcA	p.S627S		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	627					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TAGCTGTGTCCCCTCAAAAAC	0.537																																					p.S627S		.											.	YEATS2	138	0			c.C1881A						.						92.0	92.0	92.0					3																	183480001		1980	4167	6147	SO:0001819	synonymous_variant	55689	exon15			TGTGTCCCCTCAA	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.1881C>A	3.37:g.183480001C>A		46.0	0.0		47.0	10.0	NM_018023	A7E2B9|D3DNS9|Q641P6|Q9NW96	Silent	SNP	ENST00000305135.5	37	CCDS43175.1																																																																																			.		0.537	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2	NM_018023	
ZBTB43	23099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	129595192	129595192	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr9:129595192A>G	ENST00000373464.4	+	3	668	c.404A>G	c.(403-405)aAt>aGt	p.N135S	ZBTB43_ENST00000449886.1_Missense_Mutation_p.N135S|ZBTB43_ENST00000373457.1_Missense_Mutation_p.N135S	NM_014007.3	NP_054726.1	O43298	ZBT43_HUMAN	zinc finger and BTB domain containing 43	135					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						CAGAAGCTAAATCATGGCAGT	0.488																																					p.N135S		.											.	ZBTB43	91	0			c.A404G						.						48.0	48.0	48.0					9																	129595192		2203	4300	6503	SO:0001583	missense	23099	exon2			AGCTAAATCATGG	AF049907	CCDS6867.1	9q33.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000169155	ENSG00000169155		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	17908	protein-coding gene	gene with protein product			"""zinc finger protein 297B"""	ZNF297B			Standard	NM_014007		Approved	KIAA0414, ZNF-X, FLJ22470, ZBTB22B	uc010mxf.3	O43298	OTTHUMG00000020693	ENST00000373464.4:c.404A>G	9.37:g.129595192A>G	ENSP00000362563:p.Asn135Ser	66.0	0.0		64.0	22.0	NM_001135776	Q5JU96	Missense_Mutation	SNP	ENST00000373464.4	37	CCDS6867.1	.	.	.	.	.	.	.	.	.	.	A	2.002	-0.429247	0.04701	.	.	ENSG00000169155	ENST00000449886;ENST00000373464;ENST00000450858;ENST00000373457	T;T;T;T	0.56103	2.99;2.99;0.48;2.99	5.75	5.75	0.90469	.	0.055071	0.64402	D	0.000002	T	0.36717	0.0977	N	0.24115	0.695	0.34063	D	0.657497	B	0.33288	0.406	B	0.25884	0.064	T	0.48387	-0.9040	10	0.19147	T	0.46	.	16.3473	0.83146	1.0:0.0:0.0:0.0	.	135	O43298	ZBT43_HUMAN	S	135	ENSP00000390344:N135S;ENSP00000362563:N135S;ENSP00000412145:N135S;ENSP00000362556:N135S	ENSP00000362556:N135S	N	+	2	0	ZBTB43	128635013	0.987000	0.35691	0.963000	0.40424	0.989000	0.77384	3.573000	0.53856	2.320000	0.78422	0.528000	0.53228	AAT	.		0.488	ZBTB43-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054124.1	NM_001135776	
ZC3H15	55854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	187351141	187351141	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr2:187351141G>A	ENST00000337859.6	+	1	259	c.32G>A	c.(31-33)gGc>gAc	p.G11D	ZC3H15_ENST00000544130.1_5'UTR	NM_018471.2	NP_060941.2	Q8WU90	ZC3HF_HUMAN	zinc finger CCCH-type containing 15	11					cytokine-mediated signaling pathway (GO:0019221)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			CAGGCCGGGGGCAGCAAAAAG	0.617																																					p.G11D		.											.	ZC3H15	91	0			c.G32A						.						43.0	59.0	54.0					2																	187351141		1895	4094	5989	SO:0001583	missense	55854	exon1			CCGGGGGCAGCAA		CCDS42791.1	2q32.1	2012-07-05			ENSG00000065548	ENSG00000065548		"""Zinc fingers, CCCH-type domain containing"""	29528	protein-coding gene	gene with protein product	"""likely ortholog of mouse immediate early response, erythropoietin 4"""					10880228	Standard	NM_018471		Approved	LEREPO4	uc002upo.3	Q8WU90	OTTHUMG00000154251	ENST00000337859.6:c.32G>A	2.37:g.187351141G>A	ENSP00000338788:p.Gly11Asp	80.0	0.0		116.0	15.0	NM_018471	B4DMW2|D3DPG7|Q5QTQ4|Q8WZ06|Q9NUZ3|Q9NZ37|Q9P079	Missense_Mutation	SNP	ENST00000337859.6	37	CCDS42791.1	.	.	.	.	.	.	.	.	.	.	G	18.43	3.623283	0.66901	.	.	ENSG00000065548	ENST00000337859;ENST00000536434	T	0.61627	0.09	5.38	4.49	0.54785	.	0.260854	0.36167	N	0.002747	T	0.48484	0.1502	L	0.36672	1.1	0.80722	D	1	B	0.21520	0.057	B	0.29716	0.106	T	0.38067	-0.9678	10	0.27082	T	0.32	-1.9242	12.0046	0.53251	0.0:0.1744:0.8256:0.0	.	11	Q8WU90	ZC3HF_HUMAN	D	11	ENSP00000338788:G11D	ENSP00000338788:G11D	G	+	2	0	ZC3H15	187059386	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.054000	0.41335	1.230000	0.43646	0.655000	0.94253	GGC	.		0.617	ZC3H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334547.2	NM_018471	
ZFHX3	463	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	72984387	72984387	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr16:72984387G>C	ENST00000268489.5	-	3	3869	c.3197C>G	c.(3196-3198)gCc>gGc	p.A1066G	ZFHX3_ENST00000397992.5_Missense_Mutation_p.A152G	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1066					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CTTCAGGCTGGCCTCGTGCCT	0.607																																					p.A1066G		.											.	ZFHX3	72	0			c.C3197G						.						66.0	57.0	60.0					16																	72984387		2198	4300	6498	SO:0001583	missense	463	exon3			AGGCTGGCCTCGT	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.3197C>G	16.37:g.72984387G>C	ENSP00000268489:p.Ala1066Gly	60.0	1.0		76.0	31.0	NM_006885	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	G	19.75	3.885064	0.72410	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.53857	0.6;0.6	5.31	5.31	0.75309	.	0.129019	0.34603	N	0.003834	T	0.62889	0.2465	L	0.28400	0.85	0.80722	D	1	D	0.65815	0.995	D	0.67548	0.952	T	0.66196	-0.5984	10	0.66056	D	0.02	.	18.9874	0.92777	0.0:0.0:1.0:0.0	.	1066	Q15911	ZFHX3_HUMAN	G	1066;152	ENSP00000268489:A1066G;ENSP00000438926:A152G	ENSP00000268489:A1066G	A	-	2	0	ZFHX3	71541888	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.520000	0.81821	2.472000	0.83506	0.650000	0.86243	GCC	.		0.607	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
ZKSCAN8	7745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	28121655	28121655	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr6:28121655C>G	ENST00000330236.6	+	6	1781	c.1597C>G	c.(1597-1599)Ctc>Gtc	p.L533V	ZKSCAN8_ENST00000457389.2_Missense_Mutation_p.L533V	NM_001278119.1|NM_001278121.1|NM_001278122.1|NM_006298.2	NP_001265048.1|NP_001265050.1|NP_001265051.1|NP_006289.2	Q15776	ZKSC8_HUMAN	zinc finger with KRAB and SCAN domains 8	533					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GAACACTGGTCTCATTCAACA	0.438																																					p.L533V		.											.	.	.	0			c.C1597G						.						78.0	78.0	78.0					6																	28121655		2203	4300	6503	SO:0001583	missense	7745	exon6			ACTGGTCTCATTC		CCDS4645.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000198315	ENSG00000198315		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12983	protein-coding gene	gene with protein product		602240	"""zinc finger protein 192"""	ZNF192			Standard	NM_001278119		Approved	LD5-1, ZSCAN40	uc003nkn.2	Q15776	OTTHUMG00000014510	ENST00000330236.6:c.1597C>G	6.37:g.28121655C>G	ENSP00000332750:p.Leu533Val	49.0	0.0		76.0	31.0	NM_006298	A1L3D4|B4DYF1|Q4VAR1|Q4VAR2|Q4VAR3|Q9H4T1	Missense_Mutation	SNP	ENST00000330236.6	37	CCDS4645.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.034057	0.54896	.	.	ENSG00000198315	ENST00000330236;ENST00000457389	T;T	0.52983	0.64;0.64	5.85	5.85	0.93711	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.48767	D	0.000173	T	0.64204	0.2577	M	0.80746	2.51	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.68337	-0.5435	10	0.87932	D	0	.	13.8457	0.63466	0.153:0.8469:0.0:0.0	.	533	Q15776	ZN192_HUMAN	V	533	ENSP00000332750:L533V;ENSP00000402948:L533V	ENSP00000332750:L533V	L	+	1	0	ZNF192	28229634	0.882000	0.30256	1.000000	0.80357	0.999000	0.98932	1.925000	0.40074	2.773000	0.95371	0.655000	0.94253	CTC	.		0.438	ZKSCAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040178.2		
ZMIZ2	83637	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44798889	44798889	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:44798889G>A	ENST00000309315.4	+	7	946	c.823G>A	c.(823-825)Ggg>Agg	p.G275R	ZMIZ2_ENST00000433667.1_Missense_Mutation_p.G243R|ZMIZ2_ENST00000265346.7_Missense_Mutation_p.G275R|ZMIZ2_ENST00000441627.1_Missense_Mutation_p.G275R|ZMIZ2_ENST00000413916.1_Missense_Mutation_p.G243R	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	275	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						GGTGTATCCAGGGCAGCAGTA	0.602																																					p.G275R	NSCLC(20;604 852 1948 16908 50522)	.											.	ZMIZ2	137	0			c.G823A						.						104.0	116.0	112.0					7																	44798889		2029	4168	6197	SO:0001583	missense	83637	exon6			TATCCAGGGCAGC	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.823G>A	7.37:g.44798889G>A	ENSP00000311778:p.Gly275Arg	60.0	1.0		80.0	20.0	NM_174929	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	ENST00000309315.4	37	CCDS43576.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.386127	0.82902	.	.	ENSG00000122515	ENST00000413916;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39	4.67	4.67	0.58626	.	0.401973	0.19885	N	0.103864	T	0.46288	0.1385	L	0.43923	1.385	0.42996	D	0.994506	P;P;P	0.51240	0.943;0.76;0.943	P;P;P	0.59115	0.852;0.544;0.852	T	0.36504	-0.9745	10	0.51188	T	0.08	-4.36	11.689	0.51503	0.0:0.0:0.8227:0.1773	.	275;275;243	Q8NF64-2;Q8NF64;Q8NF64-3	.;ZMIZ2_HUMAN;.	R	243;275;275;243;275;275	ENSP00000409648:G243R;ENSP00000311778:G275R;ENSP00000414723:G275R;ENSP00000396601:G243R;ENSP00000265346:G275R	ENSP00000265346:G275R	G	+	1	0	ZMIZ2	44765414	0.905000	0.30787	0.991000	0.47740	0.959000	0.62525	2.895000	0.48648	2.413000	0.81919	0.462000	0.41574	GGG	.		0.602	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449	
ZNF257	113835	hgsc.bcm.edu;broad.mit.edu	37	19	22271140	22271141	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	TA	TA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:22271140_22271141delTA	ENST00000594947.1	+	4	732_733	c.588_589delTA	c.(586-591)attagafs	p.IR196fs	ZNF257_ENST00000600162.1_3'UTR	NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	196					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				GAATTCATATTAGAGAGAATTC	0.361																																					p.196_197del		.											.	ZNF257	90	0			c.588_589del						.																																			SO:0001589	frameshift_variant	113835	exon4			TCATATTAGAGAG	AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.588_589delTA	19.37:g.22271140_22271141delTA	ENSP00000470209:p.Ile196fs	23.0	0.0		40.0	14.0	NM_033468	B3KPS4|E9PG34|Q8NE34	Frame_Shift_Del	DEL	ENST00000594947.1	37	CCDS46030.1																																																																																			.		0.361	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464382.1		
ZNF280C	55609	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	129350034	129350035	+	Frame_Shift_Ins	INS	-	-	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chrX:129350034_129350035insA	ENST00000370978.4	-	14	1721_1722	c.1568_1569insT	c.(1567-1569)ttafs	p.L523fs		NM_017666.4	NP_060136.1	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	523					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(4)|large_intestine(9)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26						GTGCAGTTGGTAATTTTGACTG	0.376																																					p.L523fs		.											.	ZNF280C	132	0			c.1569_1570insT						.																																			SO:0001589	frameshift_variant	55609	exon14			AGTTGGTAATTTT	AL834333	CCDS14622.1	Xq25	2008-05-02	2007-09-20	2007-09-20	ENSG00000056277	ENSG00000056277			25955	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 3 (Drosophila)"""	SUHW3		12477932	Standard	NM_017666		Approved	FLJ20095, ZNF633	uc004evm.3	Q8ND82	OTTHUMG00000022393	ENST00000370978.4:c.1569dupT	X.37:g.129350036_129350036dupA	ENSP00000360017:p.Leu523fs	37.0	0.0		61.0	28.0	NM_017666	A8K2V8|Q9NXR3	Frame_Shift_Ins	INS	ENST00000370978.4	37	CCDS14622.1																																																																																			.		0.376	ZNF280C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058251.1	NM_017666	
ZNF337	26152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	25656381	25656381	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr20:25656381G>T	ENST00000376436.1	-	4	2082	c.1543C>A	c.(1543-1545)Cgt>Agt	p.R515S	ZNF337_ENST00000481610.1_5'Flank|RP4-694B14.5_ENST00000439498.1_RNA|RP4-694B14.5_ENST00000428254.1_RNA|RP4-694B14.5_ENST00000455791.1_RNA|RP4-694B14.5_ENST00000414393.1_RNA|ZNF337_ENST00000538750.1_Missense_Mutation_p.R483S|RP4-694B14.5_ENST00000421829.1_RNA|ZNF337_ENST00000252979.5_Missense_Mutation_p.R515S			Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	515					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CAGAAAAAACGTTTCTCACCC	0.507																																					p.R515S		.											.	ZNF337	90	0			c.C1543A						.						91.0	89.0	90.0					20																	25656381		2203	4300	6503	SO:0001583	missense	26152	exon5			AAAAACGTTTCTC		CCDS13174.1	20p11.1	2013-09-20			ENSG00000130684	ENSG00000130684		"""Zinc fingers, C2H2-type"", ""-"""	15809	protein-coding gene	gene with protein product							Standard	XM_005260702		Approved	dJ694B14.1	uc002wuz.3	Q9Y3M9	OTTHUMG00000032131	ENST00000376436.1:c.1543C>A	20.37:g.25656381G>T	ENSP00000365619:p.Arg515Ser	72.0	0.0		97.0	30.0	NM_015655	B4DSM2|Q9Y3Y5	Missense_Mutation	SNP	ENST00000376436.1	37	CCDS13174.1	.	.	.	.	.	.	.	.	.	.	.	19.05	3.752857	0.69648	.	.	ENSG00000130684	ENST00000376436;ENST00000252979;ENST00000376412;ENST00000538750	T;T;T	0.07444	3.19;3.19;3.19	1.29	1.29	0.21616	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05686	0.0149	N	0.21194	0.64	0.09310	N	0.999996	B;B	0.29835	0.258;0.258	B;B	0.24541	0.054;0.054	T	0.35151	-0.9800	9	0.51188	T	0.08	.	8.5422	0.33399	0.0:0.0:1.0:0.0	.	483;515	B4DSM2;Q9Y3M9	.;ZN337_HUMAN	S	515;515;515;483	ENSP00000365619:R515S;ENSP00000252979:R515S;ENSP00000442181:R483S	ENSP00000252979:R515S	R	-	1	0	ZNF337	25604381	0.736000	0.28164	0.001000	0.08648	0.812000	0.45895	4.548000	0.60718	1.011000	0.39340	0.298000	0.19748	CGT	.		0.507	ZNF337-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078454.1		
ZNF337	26152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	25656385	25656385	+	Missense_Mutation	SNP	C	C	G	rs190880125	byFrequency	TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr20:25656385C>G	ENST00000376436.1	-	4	2078	c.1539G>C	c.(1537-1539)gaG>gaC	p.E513D	ZNF337_ENST00000481610.1_5'Flank|RP4-694B14.5_ENST00000439498.1_RNA|RP4-694B14.5_ENST00000428254.1_RNA|RP4-694B14.5_ENST00000455791.1_RNA|RP4-694B14.5_ENST00000414393.1_RNA|ZNF337_ENST00000538750.1_Missense_Mutation_p.E481D|RP4-694B14.5_ENST00000421829.1_RNA|ZNF337_ENST00000252979.5_Missense_Mutation_p.E513D			Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	513					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AAAAACGTTTCTCACCCAAGT	0.512																																					p.E513D		.											.	ZNF337	90	0			c.G1539C						.						91.0	89.0	90.0					20																	25656385		2203	4300	6503	SO:0001583	missense	26152	exon5			ACGTTTCTCACCC		CCDS13174.1	20p11.1	2013-09-20			ENSG00000130684	ENSG00000130684		"""Zinc fingers, C2H2-type"", ""-"""	15809	protein-coding gene	gene with protein product							Standard	XM_005260702		Approved	dJ694B14.1	uc002wuz.3	Q9Y3M9	OTTHUMG00000032131	ENST00000376436.1:c.1539G>C	20.37:g.25656385C>G	ENSP00000365619:p.Glu513Asp	71.0	0.0		95.0	30.0	NM_015655	B4DSM2|Q9Y3Y5	Missense_Mutation	SNP	ENST00000376436.1	37	CCDS13174.1	.	.	.	.	.	.	.	.	.	.	.	15.63	2.891801	0.52014	.	.	ENSG00000130684	ENST00000376436;ENST00000252979;ENST00000376412;ENST00000538750	T;T;T	0.11277	2.79;2.79;2.79	1.29	-1.02	0.10135	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10465	0.0256	L	0.47016	1.485	0.23923	N	0.996452	P;P	0.52170	0.951;0.797	B;B	0.44278	0.445;0.365	T	0.19516	-1.0303	9	0.66056	D	0.02	.	5.5727	0.17206	0.0:0.6433:0.0:0.3567	.	481;513	B4DSM2;Q9Y3M9	.;ZN337_HUMAN	D	513;513;513;481	ENSP00000365619:E513D;ENSP00000252979:E513D;ENSP00000442181:E481D	ENSP00000252979:E513D	E	-	3	2	ZNF337	25604385	1.000000	0.71417	0.002000	0.10522	0.823000	0.46562	0.700000	0.25601	-0.298000	0.08921	0.298000	0.19748	GAG	C|0.999;T|0.001		0.512	ZNF337-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078454.1		
ZNF44	51710	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	12384142	12384142	+	Missense_Mutation	SNP	T	T	C	rs61737488	byFrequency	TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:12384142T>C	ENST00000356109.5	-	5	1190	c.1072A>G	c.(1072-1074)Aca>Gca	p.T358A	ZNF44_ENST00000355684.5_Missense_Mutation_p.T310A	NM_001164276.1	NP_001157748.1	P15621	ZNF44_HUMAN	zinc finger protein 44	358					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		TGTTTACATGTATAGGGTTTC	0.413																																					p.T358A		.											.	ZNF44	23	0			c.A1072G						.						111.0	115.0	114.0					19																	12384142		2202	4300	6502	SO:0001583	missense	51710	exon5			TACATGTATAGGG	X52338	CCDS45988.1, CCDS54223.1	19p13.2	2013-01-08	2006-05-11		ENSG00000197857	ENSG00000197857		"""Zinc fingers, C2H2-type"", ""-"""	13110	protein-coding gene	gene with protein product		194542	"""zinc finger protein 58"", ""zinc finger protein 44 (KOX 7)"", ""zinc finger protein 55"""	ZNF58, ZNF55		1946370, 1505991	Standard	NM_016264		Approved	KOX7, ZNF504	uc010xmj.2	P15621	OTTHUMG00000156424	ENST00000356109.5:c.1072A>G	19.37:g.12384142T>C	ENSP00000348419:p.Thr358Ala	65.0	0.0		99.0	7.0	NM_001164276	B4DML9|B9EGJ5|B9ZVM2|P17018|Q9ULZ7	Missense_Mutation	SNP	ENST00000356109.5	37	CCDS54223.1	.	.	.	.	.	.	.	.	.	.	T	10.26	1.301338	0.23650	.	.	ENSG00000197857	ENST00000393337;ENST00000356109;ENST00000457673;ENST00000355684	T;T;T	0.19532	2.14;2.14;2.14	0.846	-0.306	0.12780	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08088	0.0202	N	0.10733	0.035	.	.	.	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.31336	-0.9947	8	0.44086	T	0.13	.	0.2054	0.00150	0.2453:0.2754:0.2453:0.234	.	358;310	P15621;F8W7T7	ZNF44_HUMAN;.	A	358;358;310;310	ENSP00000377008:T358A;ENSP00000348419:T358A;ENSP00000347910:T310A	ENSP00000347910:T310A	T	-	1	0	ZNF44	12245142	0.000000	0.05858	0.004000	0.12327	0.828000	0.46876	-7.387000	0.00037	-0.090000	0.12462	0.254000	0.18369	ACA	T|0.105;C|0.895		0.413	ZNF44-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344132.1	NM_016264	
ZNF468	90333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53344538	53344538	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:53344538C>T	ENST00000595646.1	-	4	1129	c.1009G>A	c.(1009-1011)Gca>Aca	p.A337T	ZNF28_ENST00000594602.1_Intron|ZNF468_ENST00000390651.4_Missense_Mutation_p.A284T|ZNF468_ENST00000396409.4_Missense_Mutation_p.A284T|ZNF468_ENST00000243639.4_3'UTR			Q5VIY5	ZN468_HUMAN	zinc finger protein 468	337					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(3)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(134;0.0358)		GAATTATATGCGAAAGCCTCA	0.363																																					p.A337T		.											.	ZNF468	92	0			c.G1009A						.						125.0	129.0	127.0					19																	53344538		2203	4300	6503	SO:0001583	missense	90333	exon4			TATATGCGAAAGC	AK023558	CCDS33094.1, CCDS62781.1	19q13.41	2013-01-08				ENSG00000204604		"""Zinc fingers, C2H2-type"", ""-"""	33105	protein-coding gene	gene with protein product						16144304	Standard	NM_001277120		Approved		uc002qaf.3	Q5VIY5		ENST00000595646.1:c.1009G>A	19.37:g.53344538C>T	ENSP00000470381:p.Ala337Thr	42.0	0.0		61.0	23.0	NM_001008801	A8MV20|Q5CZB8|Q5VIY4|Q68DI7	Missense_Mutation	SNP	ENST00000595646.1	37	CCDS33094.1	.	.	.	.	.	.	.	.	.	.	-	4.573	0.106515	0.08780	.	.	ENSG00000204604	ENST00000243639;ENST00000396409;ENST00000390651;ENST00000393865	T;T	0.07567	3.18;3.18	1.99	0.889	0.19212	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03915	0.0110	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45323	-0.9269	9	0.25106	T	0.35	.	3.3498	0.07149	0.0:0.1646:0.2323:0.6031	.	337	Q5VIY5	ZN468_HUMAN	T	337;284;284;87	ENSP00000379690:A284T;ENSP00000445669:A284T	ENSP00000243639:A337T	A	-	1	0	ZNF468	58036350	0.552000	0.26505	0.000000	0.03702	0.000000	0.00434	0.652000	0.24888	0.039000	0.15632	-0.373000	0.07131	GCA	.		0.363	ZNF468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463098.1	NM_001008801	
ZNF586	54807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	58290644	58290644	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:58290644G>T	ENST00000396154.2	+	3	862	c.689G>T	c.(688-690)gGa>gTa	p.G230V	ZNF586_ENST00000598183.1_Intron|ZNF586_ENST00000396150.4_Nonsense_Mutation_p.E188*|ZNF586_ENST00000391702.3_Missense_Mutation_p.G187V|ZNF586_ENST00000599802.1_Intron|ZNF586_ENST00000598885.1_Intron	NM_017652.3	NP_060122.2	Q9NXT0	ZN586_HUMAN	zinc finger protein 586	230					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)	15		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATTCACACTGGAGAGAGGCCT	0.423																																					p.E188X		.											.	ZNF586	92	0			c.G562T						.						107.0	113.0	111.0					19																	58290644		2200	4300	6500	SO:0001583	missense	54807	exon2			ACACTGGAGAGAG	AK095993	CCDS42640.1, CCDS56107.1, CCDS56108.1	19q13.43	2013-01-08				ENSG00000083828		"""Zinc fingers, C2H2-type"", ""-"""	25949	protein-coding gene	gene with protein product						12477932	Standard	NM_017652		Approved	FLJ20070	uc002qqd.3	Q9NXT0		ENST00000396154.2:c.689G>T	19.37:g.58290644G>T	ENSP00000379458:p.Gly230Val	37.0	0.0		52.0	12.0	NM_001077426	A0JLV8|A8MY63|B3KTS9|E7ERT1|G3XAH3	Nonsense_Mutation	SNP	ENST00000396154.2	37	CCDS42640.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.12|16.12	3.032181|3.032181	0.54790|0.54790	.|.	.|.	ENSG00000083828|ENSG00000083828	ENST00000396150|ENST00000449441;ENST00000391702;ENST00000396154	.|T;T	.|0.01599	.|4.74;4.74	1.59|1.59	1.59|1.59	0.23543|0.23543	.|Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|.	.|.	.|.	.|.	.|T	.|0.09818	.|0.0241	M|M	0.85299|0.85299	2.745|2.745	0.48087|0.48087	D|D	0.999589|0.999589	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	.|T	.|0.01743	.|-1.1283	.|9	0.28530|0.87932	T|D	0.3|0	.|.	10.1074|10.1074	0.42541|0.42541	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|230	.|Q9NXT0	.|ZN586_HUMAN	X|V	188|230;187;230	.|ENSP00000375583:G187V;ENSP00000379458:G230V	ENSP00000379454:E188X|ENSP00000375583:G187V	E|G	+|+	1|2	0|0	ZNF586|ZNF586	62982456|62982456	0.805000|0.805000	0.28982|0.28982	0.094000|0.094000	0.20943|0.20943	0.048000|0.048000	0.14542|0.14542	2.114000|2.114000	0.41911|0.41911	0.837000|0.837000	0.34925|0.34925	0.609000|0.609000	0.83330|0.83330	GAG|GGA	.		0.423	ZNF586-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466825.2	NM_017652	
ZNF831	128611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	57766370	57766370	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr20:57766370G>T	ENST00000371030.2	+	1	296	c.296G>T	c.(295-297)gGg>gTg	p.G99V		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	99	Pro-rich.						metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CAGCCTGAAGGGCCTGGCCCC	0.721																																					p.G99V		.											.	ZNF831	126	0			c.G296T						.						8.0	10.0	10.0					20																	57766370		1979	4115	6094	SO:0001583	missense	128611	exon1			CTGAAGGGCCTGG	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.296G>T	20.37:g.57766370G>T	ENSP00000360069:p.Gly99Val	26.0	0.0		55.0	11.0	NM_178457	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.753907	0.49362	.	.	ENSG00000124203	ENST00000371030	T	0.05513	3.43	5.67	4.72	0.59763	.	.	.	.	.	T	0.13500	0.0327	L	0.27053	0.805	0.09310	N	0.999999	D	0.89917	1.0	D	0.69307	0.963	T	0.10109	-1.0644	9	0.87932	D	0	-15.7075	11.4179	0.49962	0.0822:0.0:0.9178:0.0	.	99	Q5JPB2	ZN831_HUMAN	V	99	ENSP00000360069:G99V	ENSP00000360069:G99V	G	+	2	0	ZNF831	57199765	0.962000	0.33011	0.253000	0.24343	0.921000	0.55340	1.828000	0.39111	2.677000	0.91161	0.561000	0.74099	GGG	.		0.721	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
ZNF845	91664	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	53848860	53848860	+	Silent	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr19:53848860G>A	ENST00000595091.1	+	4	336	c.117G>A	c.(115-117)gaG>gaA	p.E39E	ZNF845_ENST00000458035.1_Silent_p.E39E			Q96IR2	ZN845_HUMAN	zinc finger protein 845	39	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						TGATGCTGGAGAATTATAGGA	0.463																																					p.E39E		.											.	.	.	0			c.G117A						.						58.0	65.0	63.0					19																	53848860		692	1589	2281	SO:0001819	synonymous_variant	91664	exon3			GCTGGAGAATTAT	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.117G>A	19.37:g.53848860G>A		31.0	0.0		59.0	29.0	NM_138374		Silent	SNP	ENST00000595091.1	37	CCDS46170.1																																																																																			.		0.463	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908	
ZSCAN25	221785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99226838	99226838	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr7:99226838C>T	ENST00000394152.2	+	8	1157	c.830C>T	c.(829-831)gCa>gTa	p.A277V	ZSCAN25_ENST00000466948.1_Intron|ZSCAN25_ENST00000262941.6_Missense_Mutation_p.A205V|ZSCAN25_ENST00000334715.3_Missense_Mutation_p.A277V	NM_145115.2	NP_660090.2	Q6NSZ9	ZSC25_HUMAN	zinc finger and SCAN domain containing 25	277					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GAAAAGGAGGCAAAACCCCCA	0.552																																					p.A277V		.											.	.	.	0			c.C830T						.						72.0	79.0	76.0					7																	99226838		2203	4300	6503	SO:0001583	missense	221785	exon8			AGGAGGCAAAACC	AK057030	CCDS5671.2	7q22.1	2013-01-09	2013-01-09	2013-01-09	ENSG00000197037	ENSG00000197037		"""-"", ""Zinc fingers, C2H2-type"""	21961	protein-coding gene	gene with protein product			"""zinc finger protein 498"""	ZNF498		11179890	Standard	XM_005250194		Approved	FLJ32468	uc003url.1	Q6NSZ9	OTTHUMG00000074055	ENST00000394152.2:c.830C>T	7.37:g.99226838C>T	ENSP00000377708:p.Ala277Val	58.0	0.0		117.0	27.0	NM_145115	A4D290|D6W5T5|Q14C82|Q14C99|Q5EBM9|Q6DJZ0|Q6N032|Q6ZML3	Missense_Mutation	SNP	ENST00000394152.2	37	CCDS5671.2	.	.	.	.	.	.	.	.	.	.	C	5.833	0.337936	0.11013	.	.	ENSG00000197037	ENST00000394152;ENST00000334715;ENST00000262941	T;T;T	0.08546	3.13;3.13;3.08	3.89	-0.099	0.13626	Krueppel-associated box (1);	0.823172	0.10196	N	0.704056	T	0.04952	0.0133	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.47005	-0.9150	10	0.16896	T	0.51	-0.3209	7.6674	0.28439	0.0:0.5811:0.0:0.4189	.	205;277	Q6NSZ9-2;Q6NSZ9	.;ZN498_HUMAN	V	277;277;205	ENSP00000377708:A277V;ENSP00000334800:A277V;ENSP00000262941:A205V	ENSP00000262941:A205V	A	+	2	0	ZNF498	99064774	0.000000	0.05858	0.001000	0.08648	0.401000	0.30781	-1.281000	0.02802	-0.033000	0.13736	0.561000	0.74099	GCA	.		0.552	ZSCAN25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157203.4	NM_145115	
ZXDC	79364	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	126194031	126194032	+	Frame_Shift_Ins	INS	-	-	T			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:126194031_126194032insT	ENST00000389709.3	-	1	730_731	c.677_678insA	c.(676-678)aagfs	p.K226fs	ZXDC_ENST00000336332.5_Frame_Shift_Ins_p.K226fs	NM_025112.4	NP_079388.3	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C	226					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|LRR domain binding (GO:0030275)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(1)	17				GBM - Glioblastoma multiforme(114;0.155)		GCAGGTGCCGCTTGAGCTTGTA	0.634																																					p.K226fs		.											.	ZXDC	91	0			c.678_679insA						.																																			SO:0001589	frameshift_variant	79364	exon1			GTGCCGCTTGAGC	AK023923	CCDS43145.1, CCDS43146.1	3q21.3	2014-02-12			ENSG00000070476	ENSG00000070476		"""Zinc fingers, C2H2-type"""	28160	protein-coding gene	gene with protein product		615746				8619474, 9110174	Standard	XM_005247757		Approved	MGC11349, FLJ13861	uc003eiv.3	Q2QGD7	OTTHUMG00000162754	ENST00000389709.3:c.678dupA	3.37:g.126194033_126194033dupT	ENSP00000374359:p.Lys226fs	120.0	0.0		217.0	34.0	NM_025112	C5J0H9|Q6DKI8|Q7L3L1|Q8NAU2	Frame_Shift_Ins	INS	ENST00000389709.3	37	CCDS43145.1																																																																																			.		0.634	ZXDC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370327.2	NM_025112	
ZYG11A	440590	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	53352689	53352689	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr1:53352689G>A	ENST00000371528.1	+	13	2216	c.2068G>A	c.(2068-2070)Gca>Aca	p.A690T	ZYG11A_ENST00000371532.1_Missense_Mutation_p.A348T	NM_001004339.2	NP_001004339.2	Q6WRX3	ZY11A_HUMAN	zyg-11 family member A, cell cycle regulator	690								p.A690S(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	10						TCAGCTCTGGGCACTATGGGC	0.343																																					p.A690T		.											.	.	.	1	Substitution - Missense(1)	endometrium(1)	c.G2068A						.						189.0	145.0	158.0					1																	53352689		692	1591	2283	SO:0001583	missense	440590	exon13			CTCTGGGCACTAT		CCDS44148.1	1p32.3	2013-01-17	2012-12-10		ENSG00000203995	ENSG00000203995		"""ZYG11 cell cycle regulator family"""	32058	protein-coding gene	gene with protein product			"""zyg-11 homolog A (C. elegans)"""				Standard	NM_001004339		Approved	ZYG11	uc001cuk.2	Q6WRX3	OTTHUMG00000008923	ENST00000371528.1:c.2068G>A	1.37:g.53352689G>A	ENSP00000360583:p.Ala690Thr	59.0	0.0		87.0	12.0	NM_001004339	A6NCK5	Missense_Mutation	SNP	ENST00000371528.1	37	CCDS44148.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.040204	0.93630	.	.	ENSG00000203995	ENST00000371532;ENST00000371528	T;T	0.59224	0.28;0.28	4.74	4.74	0.60224	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78033	0.4220	M	0.79693	2.465	0.54753	D	0.999982	D	0.89917	1.0	D	0.87578	0.998	T	0.81446	-0.0929	10	0.87932	D	0	-11.2039	18.2877	0.90119	0.0:0.0:1.0:0.0	.	690	Q6WRX3	ZY11A_HUMAN	T	348;690	ENSP00000360587:A348T;ENSP00000360583:A690T	ENSP00000360583:A690T	A	+	1	0	ZYG11A	53125277	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.822000	0.86651	2.621000	0.88768	0.655000	0.94253	GCA	.		0.343	ZYG11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024856.3	NM_001004339	
KRT83	3889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	52715018	52715019	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr12:52715018_52715019GG>CT	ENST00000293670.3	-	1	163_164	c.101_102CC>AG	c.(100-102)gCC>gAG	p.A34E		NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	34	Head.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GGTAGGGGGCGGCGGTGATGCA	0.693																																					p.A34E	GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)	.											.	.	.	0			.						.																																			SO:0001583	missense	3889	.			GGGGGCGGCGGTG	X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.101_102delinsCT	12.37:g.52715018_52715019delinsCT	ENSP00000293670:p.Ala34Glu	44.0	0.0		103.0	26.0	.	A1A4S9|B2RC21|Q6NT21|Q9NSB3	Missense_Mutation	DNP	ENST00000293670.3	37	CCDS8823.1																																																																																			.		0.693	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405182.1	NM_002282	
ITGB4	3691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	73738729	73738730	+	Missense_Mutation	DNP	TC	TC	AG			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr17:73738729_73738730TC>AG	ENST00000200181.3	+	25	3036_3037	c.2849_2850TC>AG	c.(2848-2850)aTC>aAG	p.I950K	ITGB4_ENST00000579662.1_Missense_Mutation_p.I950K|ITGB4_ENST00000450894.3_Missense_Mutation_p.I950K|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000449880.2_Missense_Mutation_p.I950K|ITGB4_ENST00000339591.3_Missense_Mutation_p.I950K	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	950					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCCCTCTTTATCCGGCCTGAGG	0.663																																					p.I950K		.											.	.	.	0			.						.																																			SO:0001583	missense	3691	.			TCTTTATCCGGCC		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	Exception_encountered	17.37:g.73738729_73738730delinsAG	ENSP00000200181:p.Ile950Lys	85.0	0.0		144.0	24.0	.	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	DNP	ENST00000200181.3	37	CCDS11727.1																																																																																			.		0.663	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
TRAK1	22906	hgsc.bcm.edu;bcgsc.ca	37	3	42243975	42243976	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:42243975_42243976CC>AA	ENST00000327628.5	+	13	1875_1876	c.1475_1476CC>AA	c.(1474-1476)tCC>tAA	p.S492*	TRAK1_ENST00000396175.1_Nonsense_Mutation_p.S434*|TRAK1_ENST00000341421.3_Nonsense_Mutation_p.S434*|TRAK1_ENST00000487159.1_3'UTR|TRAK1_ENST00000449246.1_Nonsense_Mutation_p.S418*	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	492	Interaction with HGS.				endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						ACCCCAGGCTCCCACGACCTGG	0.639																																					p.S492*	GBM(44;195 884 22595 31865 41850)	.											.	.	.	0			.						.																																			SO:0001587	stop_gained	22906	.			CAGGCTCCCACGA		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	Exception_encountered	3.37:g.42243975_42243976delinsAA	ENSP00000328998:p.Ser492*	126.0	0.0		207.0	25.0	.	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Nonsense_Mutation	DNP	ENST00000327628.5	37	CCDS43072.1																																																																																			.		0.639	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
HHATL	57467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	42735224	42735225	+	Missense_Mutation	DNP	AG	AG	TT	rs566301459		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:42735224_42735225AG>TT	ENST00000441594.1	-	10	1393_1394	c.1132_1133CT>AA	c.(1132-1134)CTg>AAg	p.L378K	HHATL_ENST00000310417.5_Missense_Mutation_p.L378K	NM_020707.3	NP_065758.3	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like	378					negative regulation of N-terminal protein palmitoylation (GO:0060262)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(3)	19				KIRC - Kidney renal clear cell carcinoma(284;0.215)		CCCAAGCCACAGTGTGGTGATG	0.53																																					p.L378K		.											.	.	.	0			.						.																																			SO:0001583	missense	57467	.			AGCCACAGTGTGG	AB042554	CCDS2704.1	3p22	2009-10-06	2007-02-06	2007-02-06	ENSG00000010282	ENSG00000010282			13242	protein-coding gene	gene with protein product	"""membrane bound O-acyltransferase domain containing 3"""	608116	"""chromosome 3 open reading frame 3"", ""GUP1, glycerol uptake/transporter homolog (yeast)"""	C3orf3, GUP1		11374908	Standard	NM_020707		Approved	KIAA1173, OACT3, MSTP002, MBOAT3	uc003clx.3	Q9HCP6	OTTHUMG00000133043	ENST00000441594.1:c.1132_1133delinsTT	3.37:g.42735224_42735225delinsTT	ENSP00000405423:p.Leu378Lys	60.0	0.0		101.0	19.0	.	Q8TBG3|Q9ULP7	Missense_Mutation	DNP	ENST00000441594.1	37	CCDS2704.1																																																																																			.		0.530	HHATL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343627.1	NM_020707	
FILIP1L	11259	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	99567271	99567272	+	Missense_Mutation	DNP	AG	AG	GT	rs36118713		TCGA-MI-A75G-01A-11D-A32G-10	TCGA-MI-A75G-10A-01D-A32G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	451ee39d-272a-47c5-9b55-cc1613bb6d2e	5d7b05ce-69de-4444-9baf-bb330ccce549	g.chr3:99567271_99567272AG>GT	ENST00000354552.3	-	5	3718_3719	c.3248_3249CT>AC	c.(3247-3249)cCT>cAC	p.P1083H	FILIP1L_ENST00000471562.1_Missense_Mutation_p.P843H|FILIP1L_ENST00000383694.2_Missense_Mutation_p.P843H|FILIP1L_ENST00000331335.5_Missense_Mutation_p.P1083H|CMSS1_ENST00000496116.1_Intron|CMSS1_ENST00000421999.2_Intron|FILIP1L_ENST00000476723.1_Intron|FILIP1L_ENST00000487087.1_Missense_Mutation_p.P659H	NM_182909.2	NP_878913.2	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like	1083						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	35						GTGGTGCTGAAGGGCTGGCAGG	0.441																																					p.P1083H		.											.	.	.	0			.						.																																			SO:0001583	missense	11259	.			TGCTGAAGGGCTG		CCDS43117.1, CCDS43118.1, CCDS43119.1, CCDS63700.1, CCDS74969.1	3q12.1	2011-10-21			ENSG00000168386	ENSG00000168386			24589	protein-coding gene	gene with protein product	"""downregulated in ovarian cancer 1"", ""GPBP-interacting protein of 130 kDa"""	612993				8314147, 15935955, 21832087	Standard	NM_001282793		Approved	DOC-1, GIP130	uc003dtm.3	Q4L180	OTTHUMG00000159055	ENST00000354552.3:c.3248_3249delinsGT	3.37:g.99567271_99567272delinsGT	ENSP00000346560:p.Pro1083His	149.0	0.0		228.0	38.0	.	B2CNV7|B2CNV8|Q13597|Q2YDY5|Q6KFX5|Q6KFX6|Q6KFX7|Q8IUM3|Q8N6Z0	Missense_Mutation	DNP	ENST00000354552.3	37	CCDS43117.1																																																																																			.		0.441	FILIP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353069.1	NM_014890	
