#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCB5	340273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	20738174	20738174	+	Splice_Site	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr7:20738174G>A	ENST00000404938.2	+	17	2806		c.e17+1		ABCB5_ENST00000258738.6_Splice_Site	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5						antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						AATTATAACCGTAAGTAAAAT	0.368																																					.		.											.	ABCB5	158	0			c.2154+1G>A						.						46.0	45.0	45.0					7																	20738174		2202	4299	6501	SO:0001630	splice_region_variant	340273	exon17			ATAACCGTAAGTA	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2154+1G>A	7.37:g.20738174G>A		81.0	0.0		65.0	16.0	NM_001163941	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Splice_Site	SNP	ENST00000404938.2	37	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.953200	0.53293	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5882	0.84745	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABCB5	20704699	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	3.288000	0.51739	2.777000	0.95525	0.591000	0.81541	.	.		0.368	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	Intron
ACAN	176	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	89401573	89401573	+	Silent	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr15:89401573G>A	ENST00000561243.1	+	11	5757	c.5757G>A	c.(5755-5757)tcG>tcA	p.S1919S	ACAN_ENST00000559004.1_Silent_p.S1919S|ACAN_ENST00000352105.7_Silent_p.S1919S|ACAN_ENST00000439576.2_Silent_p.S1919S			P16112	PGCA_HUMAN	aggrecan	1909	CS-2.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GCCTGCCCTCGGGAGCATATT	0.527																																					p.S1919S		.											.	ACAN	25	0			c.G5757A						.						67.0	71.0	70.0					15																	89401573		1975	4154	6129	SO:0001819	synonymous_variant	176	exon12			GCCCTCGGGAGCA	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.5757G>A	15.37:g.89401573G>A		90.0	0.0		123.0	64.0	NM_001135	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	ENST00000561243.1	37	CCDS53970.1																																																																																			.		0.527	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
ADAM12	8038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	127797193	127797193	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr10:127797193C>T	ENST00000368679.4	-	8	1028	c.719G>A	c.(718-720)cGa>cAa	p.R240Q	ADAM12_ENST00000368676.4_Missense_Mutation_p.R240Q	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	240	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CTCTATTAATCGCTGCTTAAC	0.353																																					p.R240Q		.											.	ADAM12	716	0			c.G719A						.						194.0	172.0	179.0					10																	127797193		2203	4300	6503	SO:0001583	missense	8038	exon8			ATTAATCGCTGCT	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.719G>A	10.37:g.127797193C>T	ENSP00000357668:p.Arg240Gln	122.0	0.0		112.0	12.0	NM_021641	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	ENST00000368679.4	37	CCDS7653.1	.	.	.	.	.	.	.	.	.	.	C	35	5.544275	0.96488	.	.	ENSG00000148848	ENST00000368679;ENST00000368676;ENST00000448723	D;D;T	0.87256	-2.23;-2.23;-0.14	5.17	5.17	0.71159	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.64402	D	0.000001	D	0.95239	0.8456	M	0.92077	3.27	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.998;0.998;1.0	D	0.95922	0.8931	10	0.72032	D	0.01	.	18.8656	0.92290	0.0:1.0:0.0:0.0	.	237;240;237;240	O43184-3;O43184-2;O43184-4;O43184	.;.;.;ADA12_HUMAN	Q	240;240;237	ENSP00000357668:R240Q;ENSP00000357665:R240Q;ENSP00000391268:R237Q	ENSP00000357665:R240Q	R	-	2	0	ADAM12	127787183	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.651000	0.83577	2.678000	0.91216	0.655000	0.94253	CGA	.		0.353	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		
ADAMTS2	9509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	178562943	178562943	+	Silent	SNP	G	G	A	rs370799965		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr5:178562943G>A	ENST00000251582.7	-	13	2153	c.2052C>T	c.(2050-2052)gaC>gaT	p.D684D		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	684	Cys-rich.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.D684D(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GGCTGAAGGCGTCCTTGTAGG	0.637																																					p.D684D		.											ADAMTS2,NS,carcinoma,0	ADAMTS2	228	1	Substitution - coding silent(1)	large_intestine(1)	c.C2052T						.	G		1,4405	2.1+/-5.4	0,1,2202	86.0	78.0	80.0		2052	-1.9	1.0	5		80	0,8600		0,0,4300	no	coding-synonymous	ADAMTS2	NM_014244.4		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		684/1212	178562943	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9509	exon13			GAAGGCGTCCTTG	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2052C>T	5.37:g.178562943G>A		108.0	1.0		94.0	47.0	NM_014244		Silent	SNP	ENST00000251582.7	37	CCDS4444.1																																																																																			.		0.637	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
ADCK3	56997	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	227171267	227171267	+	Silent	SNP	C	C	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:227171267C>A	ENST00000366779.1	+	14	3866	c.1095C>A	c.(1093-1095)gcC>gcA	p.A365A	ADCK3_ENST00000366778.1_Silent_p.A313A|ADCK3_ENST00000366777.3_Silent_p.A365A|ADCK3_ENST00000478406.1_3'UTR|ADCK3_ENST00000433743.2_Silent_p.A39A|ADCK3_ENST00000458507.2_Silent_p.A86A			Q8NI60	ADCK3_HUMAN	aarF domain containing kinase 3	365	Protein kinase.				cell death (GO:0008219)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(2)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	9						CTGGCGTGGCCCAGAGCATCA	0.612																																					p.A365A		.											.	ADCK3	361	0			c.C1095A						.						85.0	70.0	75.0					1																	227171267		2203	4300	6503	SO:0001819	synonymous_variant	56997	exon9			CGTGGCCCAGAGC	AJ278126	CCDS1557.1	1q42.11	2011-05-03	2010-10-01	2010-10-01	ENSG00000163050	ENSG00000163050			16812	protein-coding gene	gene with protein product	"""coenzyme Q8 homolog (yeast)"""	606980	"""chaperone-ABC1 (activity of bc1 complex, S.pombe)-like"", ""chaperone, ABC1 activity of bc1 complex like (S. pombe)"", ""chaperone, ABC1 activity of bc1 complex homolog (S. pombe)"""	CABC1			Standard	NM_020247		Approved	COQ8, SCAR9	uc001hqn.1	Q8NI60	OTTHUMG00000037621	ENST00000366779.1:c.1095C>A	1.37:g.227171267C>A		92.0	1.0		96.0	57.0	NM_020247	Q5T7A5|Q63HK0|Q8NCJ6|Q9HBQ1|Q9NQ67	Silent	SNP	ENST00000366779.1	37	CCDS1557.1																																																																																			.		0.612	ADCK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091712.1	NM_020247	
AKT2	208	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	40746009	40746009	+	Silent	SNP	G	G	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:40746009G>T	ENST00000392038.2	-	7	880	c.582C>A	c.(580-582)gtC>gtA	p.V194V	AKT2_ENST00000424901.1_Silent_p.V194V|AKT2_ENST00000579047.1_Silent_p.V132V|AKT2_ENST00000311278.6_Silent_p.V194V	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2	194	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			CTGTGTGAGCGACTTCATCCT	0.622			A		"""ovarian, pancreatic """																																p.V194V		.		Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	.	AKT2	978	0			c.C582A						.						181.0	175.0	177.0					19																	40746009		2203	4300	6503	SO:0001819	synonymous_variant	208	exon7			GTGAGCGACTTCA	M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.582C>A	19.37:g.40746009G>T		90.0	0.0		158.0	123.0	NM_001626	B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Silent	SNP	ENST00000392038.2	37	CCDS12552.1																																																																																			.		0.622	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268029.1	NM_001626	
ANKRD30A	91074	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	37431161	37431161	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr10:37431161A>G	ENST00000602533.1	+	7	1267	c.1168A>G	c.(1168-1170)Aga>Gga	p.R390G	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.R390G|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.R390G			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	446					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GGAAAAAGGAAGATCTAAGAT	0.378																																					p.R390G		.											.	ANKRD30A	161	0			c.A1168G						.						59.0	58.0	58.0					10																	37431161		1884	4112	5996	SO:0001583	missense	91074	exon7			AAAGGAAGATCTA	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1168A>G	10.37:g.37431161A>G	ENSP00000473551:p.Arg390Gly	145.0	1.0		168.0	60.0	NM_052997	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37		.	.	.	.	.	.	.	.	.	.	.	1.078	-0.667898	0.03428	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.05447	3.44;3.44	0.358	0.358	0.16084	.	.	.	.	.	T	0.03011	0.0089	N	0.08118	0	0.09310	N	1	B	0.25105	0.118	B	0.21151	0.033	T	0.45687	-0.9244	8	0.32370	T	0.25	.	.	.	.	.	446	Q9BXX3	AN30A_HUMAN	G	390	ENSP00000354432:R390G;ENSP00000363792:R390G	ENSP00000354432:R390G	R	+	1	2	ANKRD30A	37471167	0.017000	0.18338	0.002000	0.10522	0.012000	0.07955	0.846000	0.27682	0.371000	0.24564	0.113000	0.15668	AGA	.		0.378	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
ARHGAP33	115703	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	36278734	36278734	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:36278734C>T	ENST00000007510.4	+	21	3411	c.3267C>T	c.(3265-3267)atC>atT	p.I1089I	ARHGAP33_ENST00000378944.5_Silent_p.I925I|ARHGAP33_ENST00000314737.5_Silent_p.I928I|AC002398.5_ENST00000433059.1_lincRNA			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	1089					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						ACTATGAGATCGGGGCAAGTG	0.652																																					p.I928I		.											.	ARHGAP33	229	0			c.C2784T						.						35.0	37.0	36.0					19																	36278734		2203	4299	6502	SO:0001819	synonymous_variant	115703	exon21			TGAGATCGGGGCA	AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.3267C>T	19.37:g.36278734C>T		225.0	0.0		638.0	30.0	NM_052948	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Silent	SNP	ENST00000007510.4	37																																																																																				.		0.652	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948	
ASB18	401036	broad.mit.edu;bcgsc.ca	37	2	237103519	237103519	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr2:237103519T>C	ENST00000409749.3	-	6	1396	c.1397A>G	c.(1396-1398)cAc>cGc	p.H466R	AC079135.1_ENST00000415226.1_RNA|ASB18_ENST00000330842.6_Missense_Mutation_p.H437R|AC079135.1_ENST00000483218.1_RNA	NM_212556.2	NP_997721.2	Q6ZVZ8	ASB18_HUMAN	ankyrin repeat and SOCS box containing 18	466					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					large_intestine(1)|lung(3)|ovary(1)|prostate(1)	6		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)|GBM - Glioblastoma multiforme(43;0.244)		TGCGTTTCAGTGCAAAACACC	0.532																																					p.H466R		.											.	ASB18	227	0			c.A1397G						.						57.0	67.0	64.0					2																	237103519		2087	4218	6305	SO:0001583	missense	401036	exon6			TTTCAGTGCAAAA	AK123854	CCDS46548.1	2q37.2	2013-01-10	2011-01-25		ENSG00000182177	ENSG00000182177		"""Ankyrin repeat domain containing"""	19770	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 18"""			12076535	Standard	NM_212556		Approved		uc010znh.2	Q6ZVZ8	OTTHUMG00000153086	ENST00000409749.3:c.1397A>G	2.37:g.237103519T>C	ENSP00000386532:p.His466Arg	171.0	0.0		124.0	7.0	NM_212556	B6ZDL7	Missense_Mutation	SNP	ENST00000409749.3	37	CCDS46548.1	.	.	.	.	.	.	.	.	.	.	T	9.077	0.998408	0.19121	.	.	ENSG00000182177	ENST00000330842;ENST00000409749	T;T	0.38401	1.14;1.19	4.65	0.718	0.18202	.	.	.	.	.	T	0.17746	0.0426	N	0.12182	0.205	0.19775	N	0.999957	B	0.06786	0.001	B	0.04013	0.001	T	0.20806	-1.0264	9	0.66056	D	0.02	.	2.8889	0.05670	0.2894:0.231:0.0:0.4796	.	466	Q6ZVZ8	ASB18_HUMAN	R	437;466	ENSP00000329970:H437R;ENSP00000386532:H466R	ENSP00000329970:H437R	H	-	2	0	ASB18	236768258	0.811000	0.29063	0.985000	0.45067	0.117000	0.20001	-0.263000	0.08670	0.315000	0.23110	0.459000	0.35465	CAC	.		0.532	ASB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329436.1	NM_212556	
ASXL3	80816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	31319066	31319066	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr18:31319066G>C	ENST00000269197.5	+	11	1698	c.1698G>C	c.(1696-1698)gaG>gaC	p.E566D		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	566					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CTGCAGTAGAGACCAGTACCC	0.418																																					p.E566D		.											.	ASXL3	49	0			c.G1698C						.						72.0	67.0	69.0					18																	31319066		1906	4133	6039	SO:0001583	missense	80816	exon11			AGTAGAGACCAGT	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.1698G>C	18.37:g.31319066G>C	ENSP00000269197:p.Glu566Asp	104.0	0.0		89.0	17.0	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.731791	0.30684	.	.	ENSG00000141431	ENST00000269197	T	0.25749	1.78	5.47	3.65	0.41850	.	0.428496	0.23638	N	0.046058	T	0.42063	0.1186	L	0.59436	1.845	0.33312	D	0.566174	D	0.69078	0.997	D	0.72625	0.978	T	0.53012	-0.8498	10	0.42905	T	0.14	.	8.8524	0.35208	0.2317:0.0:0.7683:0.0	.	566	Q9C0F0	ASXL3_HUMAN	D	566	ENSP00000269197:E566D	ENSP00000269197:E566D	E	+	3	2	ASXL3	29573064	1.000000	0.71417	0.995000	0.50966	0.218000	0.24690	3.182000	0.50910	0.760000	0.33108	0.467000	0.42956	GAG	.		0.418	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
ATR	545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	142232443	142232443	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr3:142232443C>A	ENST00000350721.4	-	26	4662	c.4541G>T	c.(4540-4542)tGt>tTt	p.C1514F	ATR_ENST00000383101.3_Missense_Mutation_p.C1450F	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1514					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						CATAATGCTACAGCAGGTGAA	0.363								Other conserved DNA damage response genes																													p.C1514F		.											.	ATR	1139	0			c.G4541T						.						106.0	95.0	98.0					3																	142232443		2203	4300	6503	SO:0001583	missense	545	exon26			ATGCTACAGCAGG	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.4541G>T	3.37:g.142232443C>A	ENSP00000343741:p.Cys1514Phe	297.0	0.0		209.0	65.0	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.549679	0.65311	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.20738	2.05;2.05	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.52386	0.1731	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57359	-0.7825	10	0.59425	D	0.04	-14.5197	18.9138	0.92496	0.0:1.0:0.0:0.0	.	1514	Q13535	ATR_HUMAN	F	1514;1450	ENSP00000343741:C1514F;ENSP00000372581:C1450F	ENSP00000343741:C1514F	C	-	2	0	ATR	143715133	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.472000	0.83506	0.491000	0.48974	TGT	.		0.363	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
BDNF	627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	27679589	27679589	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr11:27679589C>G	ENST00000525528.1	-	1	1616	c.523G>C	c.(523-525)Ggc>Cgc	p.G175R	BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000525950.1_Missense_Mutation_p.G175R|BDNF_ENST00000395981.3_Missense_Mutation_p.G175R|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000532997.1_Missense_Mutation_p.G175R|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000530861.1_Missense_Mutation_p.G175R|BDNF_ENST00000584049.1_5'UTR|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000533246.1_Missense_Mutation_p.G175R|BDNF_ENST00000439476.2_Missense_Mutation_p.G175R|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000418212.1_Missense_Mutation_p.G175R|BDNF_ENST00000314915.6_Missense_Mutation_p.G183R|BDNF_ENST00000533131.1_Missense_Mutation_p.G175R|BDNF_ENST00000438929.1_Missense_Mutation_p.G257R|BDNF_ENST00000420794.1_Missense_Mutation_p.G175R|BDNF_ENST00000356660.4_Missense_Mutation_p.G175R|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000395986.2_Missense_Mutation_p.G190R|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000395980.2_Missense_Mutation_p.G175R|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000395978.3_Missense_Mutation_p.G175R|BDNF_ENST00000395983.3_Missense_Mutation_p.G175R	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor	175					axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						TTCAGTTGGCCTTTTGATACA	0.498																																					p.G257R		.											.	BDNF	514	0			c.G769C						.						216.0	212.0	213.0					11																	27679589		2202	4299	6501	SO:0001583	missense	627	exon3			GTTGGCCTTTTGA	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.523G>C	11.37:g.27679589C>G	ENSP00000437138:p.Gly175Arg	95.0	0.0		63.0	18.0	NM_001143810	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	Missense_Mutation	SNP	ENST00000525528.1	37	CCDS7866.1	.	.	.	.	.	.	.	.	.	.	C	15.83	2.948306	0.53186	.	.	ENSG00000176697	ENST00000439476;ENST00000525528;ENST00000395986;ENST00000533131;ENST00000356660;ENST00000418212;ENST00000533246;ENST00000530861;ENST00000395983;ENST00000438929;ENST00000395980;ENST00000532997;ENST00000395981;ENST00000395978;ENST00000525950;ENST00000314915;ENST00000420794	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26	6.08	6.08	0.98989	Nerve growth factor-related (4);	0.000000	0.85682	D	0.000000	T	0.82213	0.4988	M	0.65498	2.005	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.991;1.0	D;D;D;P;D	0.97110	1.0;0.992;0.998;0.698;0.998	T	0.82043	-0.0653	10	0.87932	D	0	-11.5486	20.6721	0.99693	0.0:1.0:0.0:0.0	.	204;257;183;175;190	P23560-5;P23560-4;P23560-2;P23560;P23560-3	.;.;.;BDNF_HUMAN;.	R	175;175;190;175;175;175;175;175;175;257;175;175;175;175;175;183;175	ENSP00000389345:G175R;ENSP00000437138:G175R;ENSP00000379309:G190R;ENSP00000432727:G175R;ENSP00000349084:G175R;ENSP00000400502:G175R;ENSP00000432376:G175R;ENSP00000435564:G175R;ENSP00000379307:G175R;ENSP00000414303:G257R;ENSP00000379304:G175R;ENSP00000435805:G175R;ENSP00000379305:G175R;ENSP00000379302:G175R;ENSP00000432035:G175R;ENSP00000320002:G183R;ENSP00000389564:G175R	ENSP00000320002:G183R	G	-	1	0	BDNF	27636165	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.894000	0.99253	0.591000	0.81541	GGC	.		0.498	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388135.1	NM_170735	
CIART	148523	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	150255801	150255801	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:150255801C>A	ENST00000290363.5	+	1	573	c.124C>A	c.(124-126)Cat>Aat	p.H42N	C1orf51_ENST00000369094.1_Intron|C1orf51_ENST00000369095.1_Missense_Mutation_p.H42N|C1orf51_ENST00000469255.1_3'UTR	NM_144697.2	NP_653298.1	Q8N365	CIART_HUMAN		42					circadian regulation of gene expression (GO:0032922)|locomotor rhythm (GO:0045475)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|E-box binding (GO:0070888)			endometrium(3)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAAGGGGGCCCATGGGCCCAG	0.592																																					p.H42N		.											.	C1orf51	90	0			c.C124A						.						106.0	110.0	109.0					1																	150255801		2203	4300	6503	SO:0001583	missense	148523	exon1			GGGGCCCATGGGC																												ENST00000290363.5:c.124C>A	1.37:g.150255801C>A	ENSP00000290363:p.His42Asn	162.0	0.0		191.0	20.0	NM_144697	B2RD43|D3DV01|Q8N795|Q96MG6	Missense_Mutation	SNP	ENST00000290363.5	37	CCDS949.1	.	.	.	.	.	.	.	.	.	.	C	10.55	1.382243	0.24944	.	.	ENSG00000159208	ENST00000369095;ENST00000290363	.	.	.	4.57	0.571	0.17352	.	0.982616	0.08334	N	0.961898	T	0.13500	0.0327	L	0.47716	1.5	0.09310	N	1	B	0.29037	0.231	B	0.25405	0.06	T	0.30090	-0.9990	9	0.46703	T	0.11	2.389	3.3205	0.07048	0.1821:0.5235:0.0:0.2944	.	42	Q8N365	CA051_HUMAN	N	42	.	ENSP00000290363:H42N	H	+	1	0	C1orf51	148522425	0.000000	0.05858	0.000000	0.03702	0.893000	0.52053	0.316000	0.19469	-0.046000	0.13446	0.563000	0.77884	CAT	.		0.592	C1orf51-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035058.1		
C22orf34	348645	bcgsc.ca;mdanderson.org	37	22	50016813	50016813	+	Missense_Mutation	SNP	A	A	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr22:50016813A>C	ENST00000444628.1	-	5	2152	c.1081T>G	c.(1081-1083)Tgt>Ggt	p.C361G	C22orf34_ENST00000405854.1_Intron|C22orf34_ENST00000400023.1_Intron			Q6ZV56	CV034_HUMAN	chromosome 22 open reading frame 34	0										pancreas(1)	1						acctagacacagtgagataaa	0.527																																					.		.											.	.	.	0			.						.																																			SO:0001583	missense	348645	.			AGACACAGTGAGA	BC048207		22q13.33	2013-01-15			ENSG00000188511	ENSG00000188511			28010	other	unknown						12477932	Standard	NR_026997		Approved		uc003bit.3	Q6ZV56	OTTHUMG00000030424	ENST00000444628.1:c.1081T>G	22.37:g.50016813A>C	ENSP00000395549:p.Cys361Gly	107.0	0.0		98.0	26.0	.	Q147Y0|Q5R3D1|Q6ZTN8	RNA	SNP	ENST00000444628.1	37		.	.	.	.	.	.	.	.	.	.	A	0.476	-0.882013	0.02530	.	.	ENSG00000188511	ENST00000444628	.	.	.	0.881	-0.213	0.13165	.	.	.	.	.	T	0.42877	0.1222	.	.	.	0.44579	D	0.997546	.	.	.	.	.	.	T	0.21518	-1.0243	4	.	.	.	.	2.9983	0.06005	0.7006:0.0:0.2994:0.0	.	.	.	.	G	361	.	.	C	-	1	0	C22orf34	48402817	0.000000	0.05858	0.019000	0.16419	0.018000	0.09664	-1.554000	0.02172	-0.130000	0.11599	-0.587000	0.04127	TGT	.		0.527	C22orf34-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NR_026997	
CASR	846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121981009	121981009	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr3:121981009G>A	ENST00000490131.1	+	4	1499	c.1127G>A	c.(1126-1128)gGt>gAt	p.G376D	CASR_ENST00000296154.5_Missense_Mutation_p.G376D|CASR_ENST00000498619.1_Missense_Mutation_p.G376D	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	376					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TTTCTGAGAGGTCACGAAGAA	0.498																																					p.G376D		.											.	CASR	97	0			c.G1127A						.						95.0	88.0	90.0					3																	121981009		2203	4300	6503	SO:0001583	missense	846	exon4			TGAGAGGTCACGA	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.1127G>A	3.37:g.121981009G>A	ENSP00000418685:p.Gly376Asp	139.0	0.0		104.0	47.0	NM_001178065	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	G	5.693	0.312334	0.10789	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.89196	-2.48;-2.48;-2.48	5.93	1.63	0.23807	Extracellular ligand-binding receptor (1);	0.593444	0.17548	N	0.170270	T	0.69351	0.3101	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.56721	-0.7932	10	0.24483	T	0.36	.	3.6669	0.08260	0.1474:0.2317:0.5025:0.1184	.	376;376	E7ENE0;P41180	.;CASR_HUMAN	D	376	ENSP00000418685:G376D;ENSP00000420194:G376D;ENSP00000296154:G376D	ENSP00000296154:G376D	G	+	2	0	CASR	123463699	0.973000	0.33851	0.343000	0.25615	0.316000	0.28119	1.549000	0.36212	0.747000	0.32809	0.655000	0.94253	GGT	.		0.498	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
CASS4	57091	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	55012412	55012412	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr20:55012412G>C	ENST00000360314.3	+	3	454	c.229G>C	c.(229-231)Gac>Cac	p.D77H	CASS4_ENST00000434344.1_Missense_Mutation_p.D77H|CASS4_ENST00000371336.3_Missense_Mutation_p.D77H	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	77					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)			breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						GGTCGCTGCAGACAGGCCGTG	0.637																																					p.D77H		.											.	CASS4	25	0			c.G229C						.						33.0	35.0	34.0					20																	55012412		2203	4300	6503	SO:0001583	missense	57091	exon2			GCTGCAGACAGGC	AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.229G>C	20.37:g.55012412G>C	ENSP00000353462:p.Asp77His	140.0	1.0		149.0	55.0	NM_020356	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	ENST00000360314.3	37	CCDS33492.1	.	.	.	.	.	.	.	.	.	.	G	17.26	3.345197	0.61073	.	.	ENSG00000087589	ENST00000360314;ENST00000371336;ENST00000434344	T;T;T	0.41758	0.99;0.99;0.99	5.71	5.71	0.89125	Src homology-3 domain (1);	0.608948	0.16322	N	0.219502	T	0.64994	0.2649	M	0.65975	2.015	0.09310	N	1	D;D;D;D	0.76494	0.997;0.999;0.995;0.991	D;P;P;P	0.66979	0.948;0.871;0.874;0.707	T	0.58645	-0.7600	10	0.56958	D	0.05	-21.9796	19.8625	0.96789	0.0:0.0:1.0:0.0	.	77;77;77;77	B4DII4;Q9NQ75-3;Q9NQ75-2;Q9NQ75	.;.;.;CASS4_HUMAN	H	77	ENSP00000353462:D77H;ENSP00000360387:D77H;ENSP00000410027:D77H	ENSP00000353462:D77H	D	+	1	0	CASS4	54445819	0.006000	0.16342	0.347000	0.25668	0.054000	0.15201	1.632000	0.37102	2.689000	0.91719	0.655000	0.94253	GAC	.		0.637	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356	
CDC73	79577	broad.mit.edu;bcgsc.ca	37	1	193094335	193094335	+	Silent	SNP	C	C	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:193094335C>A	ENST00000367435.3	+	2	409	c.225C>A	c.(223-225)gtC>gtA	p.V75V		NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	75					cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						CTGTTTATGTCCGACGTGCAG	0.383																																					p.V75V		.											.	CDC73	1009	0			c.C225A						.						144.0	144.0	144.0					1																	193094335		2203	4300	6503	SO:0001819	synonymous_variant	79577	exon2			TTATGTCCGACGT	AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.225C>A	1.37:g.193094335C>A		160.0	0.0		119.0	8.0	NM_024529	A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Silent	SNP	ENST00000367435.3	37	CCDS1382.1																																																																																			.		0.383	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	NM_024529	
CFLAR	8837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	201994647	201994647	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr2:201994647T>C	ENST00000309955.3	+	2	574	c.59T>C	c.(58-60)aTg>aCg	p.M20T	CFLAR_ENST00000494258.1_5'Flank|CFLAR_ENST00000457277.1_Missense_Mutation_p.M20T|CFLAR_ENST00000423241.2_Missense_Mutation_p.M20T|CFLAR_ENST00000440180.1_Missense_Mutation_p.M20T|CFLAR_ENST00000395148.2_Missense_Mutation_p.M20T|CFLAR_ENST00000340870.5_Missense_Mutation_p.M20T|CFLAR_ENST00000342795.5_Missense_Mutation_p.M20T|CFLAR_ENST00000341582.6_Missense_Mutation_p.M20T|CFLAR_ENST00000341222.6_Missense_Mutation_p.M20T|CFLAR_ENST00000443227.1_Intron|CFLAR_ENST00000355558.4_Missense_Mutation_p.M20T	NM_001202515.1|NM_003879.5	NP_001189444.1|NP_003870.4	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator	20	DED 1. {ECO:0000255|PROSITE- ProRule:PRU00065}.|Interaction with FADD.|Interaction with caspase-8 propeptide.|Interaction with caspase-8.|Not proteolytically processed and involved in apoptosis inhibition.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of myoblast fusion (GO:1901740)|positive regulation of catalytic activity (GO:0043085)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of necroptotic process (GO:0060544)|regulation of satellite cell proliferation (GO:0014842)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|skeletal myofibril assembly (GO:0014866)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|ripoptosome (GO:0097342)	cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|enzyme activator activity (GO:0008047)|protease binding (GO:0002020)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|stomach(1)	13						GAGAAGGAGATGCTGCTCTTT	0.473																																					p.M20T	Pancreas(16;548 657 22190 32864 42338)	.											.	CFLAR	227	0			c.T59C						.						206.0	198.0	201.0					2																	201994647		2203	4300	6503	SO:0001583	missense	8837	exon2			AGGAGATGCTGCT	AF005774	CCDS2337.1, CCDS46487.1, CCDS56157.1, CCDS56158.1, CCDS59436.1	2q33-q34	2014-01-30			ENSG00000003402	ENSG00000003402		"""Endogenous ligands"""	1876	protein-coding gene	gene with protein product		603599		CASP8AP1		9208847, 9217161	Standard	NM_003879		Approved	CASH, Casper, CLARP, FLAME, FLIP, I-FLICE, MRIT, c-FLIP	uc002uxb.4	O15519	OTTHUMG00000132819	ENST00000309955.3:c.59T>C	2.37:g.201994647T>C	ENSP00000312455:p.Met20Thr	122.0	0.0		121.0	73.0	NM_001202516	B4DJE0|B7Z9F9|O14673|O14674|O14675|O15137|O15138|O15356|O15510|O43618|O43619|O43620|O60458|O60459|Q53TS6|Q54AF1|Q96TE4|Q9UEW1	Missense_Mutation	SNP	ENST00000309955.3	37	CCDS2337.1	.	.	.	.	.	.	.	.	.	.	T	2.837	-0.241379	0.05906	.	.	ENSG00000003402	ENST00000309955;ENST00000341222;ENST00000355558;ENST00000340870;ENST00000341582;ENST00000342795;ENST00000395148;ENST00000441224;ENST00000433445;ENST00000423241;ENST00000425030;ENST00000417748;ENST00000440180;ENST00000457277	T;T;T;T;T;T;T;T;T	0.40756	3.86;1.02;1.02;3.74;4.14;1.04;3.86;1.02;3.74	5.72	-4.07	0.03975	DEATH-like (2);Death effector (3);	0.839620	0.11140	N	0.595376	T	0.21062	0.0507	N	0.17082	0.46	0.09310	N	1	B;B;B;B;B;B;B	0.14012	0.002;0.007;0.007;0.009;0.001;0.001;0.002	B;B;B;B;B;B;B	0.17098	0.01;0.007;0.007;0.012;0.006;0.006;0.017	T	0.33420	-0.9869	10	0.13108	T	0.6	-0.4969	9.532	0.39200	0.0:0.5189:0.1257:0.3553	.	20;20;20;20;20;20;20	C9JK38;O15519-11;O15519-8;O15519;O15519-12;O15519-2;E9PAP3	.;.;.;CFLAR_HUMAN;.;.;.	T	20	ENSP00000312455:M20T;ENSP00000339335:M20T;ENSP00000347757:M20T;ENSP00000339326:M20T;ENSP00000345807:M20T;ENSP00000342809:M20T;ENSP00000399420:M20T;ENSP00000406775:M20T;ENSP00000411535:M20T	ENSP00000312455:M20T	M	+	2	0	CFLAR	201702892	0.008000	0.16893	0.001000	0.08648	0.621000	0.37620	-0.035000	0.12205	-0.768000	0.04626	0.460000	0.39030	ATG	.		0.473	CFLAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256276.3	NM_003879	
CHL1	10752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	443359	443359	+	Missense_Mutation	SNP	G	G	A	rs574347521		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr3:443359G>A	ENST00000256509.2	+	27	4078	c.3436G>A	c.(3436-3438)Gat>Aat	p.D1146N	CHL1_ENST00000397491.2_Missense_Mutation_p.D1130N	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		GTCAGTAAAAGATGAAACCTT	0.303																																					p.D1146N		.											.	CHL1	583	0			c.G3436A						.						90.0	94.0	93.0					3																	443359		2203	4300	6503	SO:0001583	missense	10752	exon27			GTAAAAGATGAAA	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.3436G>A	3.37:g.443359G>A	ENSP00000256509:p.Asp1146Asn	85.0	0.0		57.0	16.0	NM_006614	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.993571	0.93167	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	D;D	0.87887	-2.31;-2.31	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.93618	0.7962	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	0.995;1.0	D;D	0.83275	0.958;0.996	D	0.94110	0.7370	10	0.66056	D	0.02	.	18.7377	0.91761	0.0:0.0:1.0:0.0	.	1130;1146	O00533;O00533-2	CHL1_HUMAN;.	N	1146;1130	ENSP00000256509:D1146N;ENSP00000380628:D1130N	ENSP00000256509:D1146N	D	+	1	0	CHL1	418359	1.000000	0.71417	0.963000	0.40424	0.941000	0.58515	8.702000	0.91338	2.417000	0.82017	0.585000	0.79938	GAT	.		0.303	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
CHN2	1124	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	29407574	29407574	+	Missense_Mutation	SNP	C	C	T	rs373908314		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr7:29407574C>T	ENST00000222792.6	+	3	645	c.115C>T	c.(115-117)Cgt>Tgt	p.R39C	CHN2_ENST00000546235.1_Missense_Mutation_p.R24C|CHN2_ENST00000539389.1_Missense_Mutation_p.R39C|CHN2_ENST00000495789.2_Missense_Mutation_p.R52C|CHN2_ENST00000539406.1_Missense_Mutation_p.R114C|CHN2_ENST00000435288.2_Missense_Mutation_p.R39C	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2	39					positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)	p.R39C(1)		breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						AGAGGCACCTCGTCCCAAGAG	0.408																																					p.R39C	Ovarian(1;44 48 13232 18918 31480)	.											.	CHN2	229	1	Substitution - Missense(1)	breast(1)	c.C115T						.	C	CYS/ARG	0,4406		0,0,2203	113.0	110.0	111.0		115	4.2	1.0	7		111	1,8599	1.2+/-3.3	0,1,4299	no	missense	CHN2	NM_004067.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	39/469	29407574	1,13005	2203	4300	6503	SO:0001583	missense	1124	exon3			GCACCTCGTCCCA	L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.115C>T	7.37:g.29407574C>T	ENSP00000222792:p.Arg39Cys	32.0	0.0		37.0	14.0	NM_004067	A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Missense_Mutation	SNP	ENST00000222792.6	37	CCDS5420.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.345793	0.61073	0.0	1.16E-4	ENSG00000106069	ENST00000439384;ENST00000539406;ENST00000222792;ENST00000435288;ENST00000409350;ENST00000495789;ENST00000539389;ENST00000546235	T;T;T;T;T;T;T;T	0.71698	-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.59;-0.07	5.12	4.15	0.48705	.	0.122154	0.53938	D	0.000049	T	0.78323	0.4265	L	0.44542	1.39	0.80722	D	1	D;D;D;P;D	0.89917	0.999;1.0;1.0;0.844;1.0	P;D;D;B;D	0.83275	0.855;0.973;0.996;0.015;0.973	T	0.80226	-0.1470	10	0.66056	D	0.02	.	14.3293	0.66545	0.1581:0.8419:0.0:0.0	.	24;52;114;39;39	B7Z1W9;B7Z1V0;F5H003;B3VCG1;P52757	.;.;.;.;CHIO_HUMAN	C	114;114;39;39;52;52;39;24	ENSP00000409843:R114C;ENSP00000444063:R114C;ENSP00000222792:R39C;ENSP00000400282:R39C;ENSP00000386968:R52C;ENSP00000438587:R52C;ENSP00000440526:R39C;ENSP00000442812:R24C	ENSP00000222792:R39C	R	+	1	0	CHN2	29374099	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.756000	0.47549	2.388000	0.81334	0.585000	0.79938	CGT	.		0.408	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214228.2	NM_004067	
CNTNAP3B	728577	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	43816717	43816717	+	Missense_Mutation	SNP	G	G	A	rs201844561	byFrequency	TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr9:43816717G>A	ENST00000377564.3	+	6	1216	c.823G>A	c.(823-825)Gtc>Atc	p.V275I	CNTNAP3B_ENST00000276974.6_Missense_Mutation_p.V275I	NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	275	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						CTGGCATTCCGTCCTCATCGA	0.493																																					p.V275I		.											.	.	.	0			c.G823A						.																																			SO:0001583	missense	728577	exon6			CATTCCGTCCTCA	BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.823G>A	9.37:g.43816717G>A	ENSP00000366787:p.Val275Ile	638.0	1.0		551.0	183.0	NM_001201380	B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	ENST00000377564.3	37	CCDS55312.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.726335	0.69074	.	.	ENSG00000154529	ENST00000377564;ENST00000276974;ENST00000341990;ENST00000403166	D;D	0.84146	-1.81;-1.81	2.77	0.721	0.18219	.	.	.	.	.	D	0.87148	0.6105	M	0.81497	2.545	0.24520	N	0.994169	.	.	.	.	.	.	T	0.78685	-0.2108	7	0.66056	D	0.02	.	6.2273	0.20716	0.1159:0.1891:0.695:0.0	.	.	.	.	I	275	ENSP00000366787:V275I;ENSP00000276974:V275I	ENSP00000276974:V275I	V	+	1	0	CNTNAP3B	43756713	1.000000	0.71417	0.076000	0.20297	0.589000	0.36550	3.492000	0.53259	0.052000	0.16007	0.413000	0.27773	GTC	G|0.993;A|0.007		0.493	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036930.3		
COL15A1	1306	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	101748304	101748304	+	Silent	SNP	C	C	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr9:101748304C>A	ENST00000375001.3	+	3	981	c.558C>A	c.(556-558)ccC>ccA	p.P186P		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	186	Laminin G-like.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GCCGCATCCCCTTCCAGCGGT	0.572																																					p.P186P		.											.	COL15A1	96	0			c.C558A						.						51.0	51.0	51.0					9																	101748304		2203	4300	6503	SO:0001819	synonymous_variant	1306	exon3			CATCCCCTTCCAG	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.558C>A	9.37:g.101748304C>A		67.0	1.0		56.0	23.0	NM_001855	Q5T6J4|Q9UDC5|Q9Y4W4	Silent	SNP	ENST00000375001.3	37	CCDS35081.1																																																																																			.		0.572	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	
COL16A1	1307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	32133203	32133203	+	Silent	SNP	G	G	A	rs200246591		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:32133203G>A	ENST00000373672.3	-	52	3846	c.3330C>T	c.(3328-3330)acC>acT	p.T1110T	COL16A1_ENST00000271069.6_Silent_p.T1110T	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1110	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CCGCTGACCCGGTGTAGCCAC	0.622																																					p.T1110T	Colon(143;498 1786 21362 25193 36625)	.											.	COL16A1	98	0			c.C3330T						.						21.0	26.0	25.0					1																	32133203		2132	4255	6387	SO:0001819	synonymous_variant	1307	exon52			TGACCCGGTGTAG	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.3330C>T	1.37:g.32133203G>A		105.0	0.0		65.0	17.0	NM_001856	Q16593|Q59F89|Q71RG9	Silent	SNP	ENST00000373672.3	37	CCDS41297.1																																																																																			G|0.999;T|0.000		0.622	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
COPA	1314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160264344	160264344	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:160264344G>A	ENST00000241704.7	-	25	2835	c.2606C>T	c.(2605-2607)gCt>gTt	p.A869V	COPA_ENST00000368069.3_Missense_Mutation_p.A878V	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	869					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CTTGCCAAGAGCATCATCCCC	0.478																																					p.A878V		.											.	COPA	92	0			c.C2633T						.						171.0	157.0	162.0					1																	160264344		2203	4300	6503	SO:0001583	missense	1314	exon25			CCAAGAGCATCAT	U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.2606C>T	1.37:g.160264344G>A	ENSP00000241704:p.Ala869Val	212.0	0.0		234.0	133.0	NM_001098398	Q5T201|Q8IXZ9	Missense_Mutation	SNP	ENST00000241704.7	37	CCDS1202.1	.	.	.	.	.	.	.	.	.	.	G	12.43	1.936846	0.34189	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.41758	0.99;0.99	5.63	-0.861	0.10676	Coatomer, alpha subunit, C-terminal (1);	0.695420	0.14586	N	0.310560	T	0.05318	0.0141	N	0.04508	-0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.42258	-0.9462	10	0.19590	T	0.45	0.528	6.2016	0.20579	0.4413:0.1238:0.4348:0.0	.	869;878	P53621;P53621-2	COPA_HUMAN;.	V	878;869	ENSP00000357048:A878V;ENSP00000241704:A869V	ENSP00000241704:A869V	A	-	2	0	COPA	158530968	0.002000	0.14202	0.627000	0.29227	0.991000	0.79684	0.333000	0.19768	-0.149000	0.11215	0.555000	0.69702	GCT	.		0.478	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080638.1	NM_004371	
CR2	1380	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207651318	207651318	+	Silent	SNP	T	T	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:207651318T>A	ENST00000367058.3	+	15	3003	c.2814T>A	c.(2812-2814)acT>acA	p.T938T	CR2_ENST00000367059.3_Silent_p.T876T|CR2_ENST00000458541.2_Silent_p.T911T|CR2_ENST00000367057.3_Silent_p.T997T	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	938	Sushi 15. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CTGTTGTAACTCTGGAGTGTG	0.493																																					p.T997T		.											.	CR2	232	0			c.T2991A						.						125.0	113.0	117.0					1																	207651318		2203	4300	6503	SO:0001819	synonymous_variant	1380	exon16			TGTAACTCTGGAG	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.2814T>A	1.37:g.207651318T>A		196.0	0.0		163.0	40.0	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Silent	SNP	ENST00000367058.3	37	CCDS1478.1																																																																																			.		0.493	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
CRYZL1	9946	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	34994363	34994363	+	Missense_Mutation	SNP	T	T	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr21:34994363T>G	ENST00000381554.3	-	4	241	c.156A>C	c.(154-156)gaA>gaC	p.E52D	CRYZL1_ENST00000381540.3_Missense_Mutation_p.E52D|AP000304.12_ENST00000429238.1_Intron|CRYZL1_ENST00000445393.1_Missense_Mutation_p.E52D|CRYZL1_ENST00000361534.2_Missense_Mutation_p.E76D|CRYZL1_ENST00000290244.5_Missense_Mutation_p.E52D|CRYZL1_ENST00000413017.2_Missense_Mutation_p.E52D	NM_145858.2	NP_665857.2	O95825	QORL1_HUMAN	crystallin, zeta (quinone reductase)-like 1	52					quinone metabolic process (GO:1901661)	cytosol (GO:0005829)	NADP binding (GO:0050661)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)			lung(1)|prostate(1)|urinary_tract(1)	3						TCATCTTCATTTCTGCCAGAA	0.328																																					p.E52D		.											.	CRYZL1	90	0			c.A156C						.						78.0	82.0	81.0					21																	34994363		2202	4298	6500	SO:0001583	missense	9946	exon4			CTTCATTTCTGCC	AF029689	CCDS13633.2	21q22.1	2008-07-31			ENSG00000205758	ENSG00000205758			2420	protein-coding gene	gene with protein product	"""quinone reductase-like 1"""	603920				10191096	Standard	NM_145858		Approved	QOH-1, 4P11	uc021wio.1	O95825	OTTHUMG00000065954	ENST00000381554.3:c.156A>C	21.37:g.34994363T>G	ENSP00000370966:p.Glu52Asp	387.0	0.0		313.0	119.0	NM_145858	B2RDX1|B3KQ77|Q96DY0|Q9NVY7	Missense_Mutation	SNP	ENST00000381554.3	37	CCDS13633.2	.	.	.	.	.	.	.	.	.	.	T	10.78	1.446999	0.25987	.	.	ENSG00000205758	ENST00000381554;ENST00000290244;ENST00000381540;ENST00000445393;ENST00000361534;ENST00000452332;ENST00000431177;ENST00000413017	T;T;T;T;T;T;T	0.41400	3.61;1.0;3.61;1.0;3.61;3.61;3.61	4.95	2.52	0.30459	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.052099	0.85682	D	0.000000	T	0.24353	0.0590	L	0.27944	0.81	0.80722	D	1	B;B;B	0.16396	0.017;0.003;0.017	B;B;B	0.18263	0.021;0.021;0.021	T	0.06092	-1.0846	10	0.13853	T	0.58	-17.7987	6.8537	0.24028	0.0:0.1783:0.0:0.8217	.	52;52;76	O95825;A6NND8;A6NHJ8	QORL1_HUMAN;.;.	D	52;52;52;52;76;52;52;52	ENSP00000370966:E52D;ENSP00000290244:E52D;ENSP00000370951:E52D;ENSP00000399730:E52D;ENSP00000355075:E76D;ENSP00000405510:E52D;ENSP00000389209:E52D	ENSP00000290244:E52D	E	-	3	2	CRYZL1	33916233	1.000000	0.71417	0.994000	0.49952	0.929000	0.56500	2.117000	0.41939	0.237000	0.21200	0.383000	0.25322	GAA	.		0.328	CRYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141282.2	NM_145858	
PIEZO1	9780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	88781068	88781068	+	IGR	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr16:88781068G>C	ENST00000301015.9	-	0	8072				CTU2_ENST00000567949.1_Missense_Mutation_p.E496D|MIR4722_ENST00000578292.1_RNA|CTU2_ENST00000378384.3_Missense_Mutation_p.E338D|CTU2_ENST00000312060.5_Missense_Mutation_p.E425D|CTU2_ENST00000453996.2_Missense_Mutation_p.E425D	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CCCTGACTGAGACCCGGACAC	0.692																																					p.E425D		.											.	CTU2	23	0			c.G1275C						.						32.0	34.0	34.0					16																	88781068		2188	4292	6480	SO:0001628	intergenic_variant	348180	exon12			GACTGAGACCCGG	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776		16.37:g.88781068G>C		132.0	0.0		79.0	47.0	NM_001012759	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	.	.	.	.	.	.	.	.	.	.	G	9.722	1.159838	0.21454	.	.	ENSG00000174177	ENST00000378384;ENST00000312060;ENST00000453996	T;T;T	0.17854	2.25;2.52;2.52	4.21	3.22	0.36961	.	1.163850	0.06508	U	0.737540	T	0.13628	0.0330	L	0.43152	1.355	0.09310	N	1	P;P;P	0.38922	0.589;0.589;0.651	B;B;B	0.33392	0.163;0.163;0.115	T	0.10428	-1.0630	10	0.15952	T	0.53	.	8.4764	0.33016	0.1195:0.0:0.8805:0.0	.	338;425;425	Q2VPK5-3;Q2VPK5-5;Q2VPK5	.;.;CTU2_HUMAN	D	338;425;425	ENSP00000367635:E338D;ENSP00000308617:E425D;ENSP00000388320:E425D	ENSP00000308617:E425D	E	+	3	2	CTU2	87308569	0.004000	0.15560	0.006000	0.13384	0.012000	0.07955	0.121000	0.15667	2.053000	0.61076	0.462000	0.41574	GAG	.		0.692	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	
CUL3	8452	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	225367700	225367700	+	Silent	SNP	T	T	C	rs371616108		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr2:225367700T>C	ENST00000264414.4	-	10	1805	c.1467A>G	c.(1465-1467)caA>caG	p.Q489Q	CUL3_ENST00000409777.1_Silent_p.Q465Q|CUL3_ENST00000344951.4_Silent_p.Q423Q|CUL3_ENST00000409096.1_Silent_p.Q465Q	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	489					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CCTGTAGATGTTGCCTGAATT	0.383																																					p.Q495Q		.											.	CUL3	229	0			c.A1485G						.	T		1,4405	2.1+/-5.4	0,1,2202	298.0	276.0	283.0		1467	0.6	1.0	2		283	0,8600		0,0,4300	no	coding-synonymous	CUL3	NM_003590.3		0,1,6502	CC,CT,TT		0.0,0.0227,0.0077		489/769	225367700	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8452	exon10			TAGATGTTGCCTG	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.1467A>G	2.37:g.225367700T>C		94.0	0.0		61.0	11.0	NM_001257198	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Silent	SNP	ENST00000264414.4	37	CCDS2462.1																																																																																			.		0.383	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
CUL7	9820	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43005507	43005507	+	Silent	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr6:43005507G>A	ENST00000265348.3	-	26	5101	c.5016C>T	c.(5014-5016)acC>acT	p.T1672T	RN7SL403P_ENST00000481783.2_RNA|CUL7_ENST00000535468.1_Silent_p.T1756T			Q14999	CUL7_HUMAN	cullin 7	1672					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GGGTATGGAAGGTGAGGGGTG	0.622																																					p.T1756T		.											.	CUL7	229	0			c.C5268T						.						38.0	35.0	36.0					6																	43005507		2203	4299	6502	SO:0001819	synonymous_variant	9820	exon26			ATGGAAGGTGAGG	BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.5016C>T	6.37:g.43005507G>A		61.0	0.0		75.0	11.0	NM_001168370	B4DYZ0|F5H0L1|Q5T654	Silent	SNP	ENST00000265348.3	37	CCDS4881.1																																																																																			.		0.622	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780	
DCDC1	341019	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	30915799	30915799	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr11:30915799G>T	ENST00000597505.1	-	33	4888	c.4889C>A	c.(4888-4890)aCa>aAa	p.T1630K	DCDC1_ENST00000406071.2_Missense_Mutation_p.T368K			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					ACATACCTCTGTATGTCTTAT	0.378																																					p.T737K		.											.	DCDC5	23	0			c.C2210A						.						76.0	78.0	78.0					11																	30915799		1867	4104	5971	SO:0001583	missense	100506627	exon16			ACCTCTGTATGTC	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.4889C>A	11.37:g.30915799G>T	ENSP00000472625:p.Thr1630Lys	106.0	1.0		78.0	40.0	NM_020869	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000597505.1	37		.	.	.	.	.	.	.	.	.	.	G	8.523	0.869297	0.17322	.	.	ENSG00000170959	ENST00000406071	.	.	.	5.77	3.92	0.45320	.	.	.	.	.	T	0.60856	0.2301	L	0.55481	1.735	0.80722	D	1	.	.	.	.	.	.	T	0.58335	-0.7654	6	0.40728	T	0.16	.	10.6333	0.45549	0.1492:0.0:0.8508:0.0	.	.	.	.	K	368	.	ENSP00000385936:T368K	T	-	2	0	DCDC5	30872375	1.000000	0.71417	0.967000	0.41034	0.329000	0.28539	3.138000	0.50570	0.913000	0.36797	-0.136000	0.14681	ACA	.		0.378	DCDC1-010	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000463167.1	NM_181807	
DMGDH	29958	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	78320120	78320120	+	Silent	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr5:78320120G>A	ENST00000255189.3	-	14	2252	c.2224C>T	c.(2224-2226)Ctg>Ttg	p.L742L	DMGDH_ENST00000540686.1_Silent_p.L362L|DMGDH_ENST00000380311.4_Silent_p.L541L	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	742					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		AAATATTCCAGTCCAGCTTCC	0.318																																					p.L742L		.											.	DMGDH	94	0			c.C2224T						.						104.0	102.0	103.0					5																	78320120		2202	4297	6499	SO:0001819	synonymous_variant	29958	exon14			ATTCCAGTCCAGC	AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.2224C>T	5.37:g.78320120G>A		292.0	0.0		239.0	88.0	NM_013391	B2RBN0|B4E1J9	Silent	SNP	ENST00000255189.3	37	CCDS4044.1																																																																																			.		0.318	DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226963.3	NM_013391	
DMRTA2	63950	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	50886867	50886867	+	Silent	SNP	C	C	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:50886867C>G	ENST00000404795.3	-	2	734	c.342G>C	c.(340-342)gcG>gcC	p.A114A	DMRTA2_ENST00000418121.1_Silent_p.A114A	NM_032110.2	NP_115486.1	Q96SC8	DMTA2_HUMAN	DMRT-like family A2	114					cerebral cortex regionalization (GO:0021796)|dopaminergic neuron differentiation (GO:0071542)|neuron fate specification (GO:0048665)|positive regulation of neuroblast proliferation (GO:0002052)|skeletal muscle cell differentiation (GO:0035914)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(4)|pancreas(1)	6						GCCTGCGCAGCGCCACCTGCG	0.701																																					p.A114A	Colon(196;1651 2045 3292 36497 38236)|Esophageal Squamous(2;257 258 11567 27043 43804)	.											.	.	.	0			c.G342C						.						3.0	4.0	4.0					1																	50886867		1831	3584	5415	SO:0001819	synonymous_variant	63950	exon2			GCGCAGCGCCACC	AJ301580	CCDS44141.1	1p33	2008-08-04			ENSG00000142700	ENSG00000142700			13908	protein-coding gene	gene with protein product		614804				11863363	Standard	NM_032110		Approved		uc010onb.2	Q96SC8	OTTHUMG00000007884	ENST00000404795.3:c.342G>C	1.37:g.50886867C>G		31.0	0.0		30.0	14.0	NM_032110	Q5TFQ3	Silent	SNP	ENST00000404795.3	37	CCDS44141.1																																																																																			.		0.701	DMRTA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351074.1	NM_032110	
DOCK6	57572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11363512	11363512	+	Silent	SNP	C	C	A	rs370478141		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:11363512C>A	ENST00000294618.7	-	3	266	c.255G>T	c.(253-255)ctG>ctT	p.L85L		NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	85					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GCTGCAGCAGCAGCTCCAAGT	0.632																																					p.L85L		.											.	DOCK6	93	0			c.G255T						.						26.0	29.0	28.0					19																	11363512		1894	4109	6003	SO:0001819	synonymous_variant	57572	exon3			CAGCAGCAGCTCC		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.255G>T	19.37:g.11363512C>A		100.0	0.0		97.0	16.0	NM_020812	A6H8X5|Q7Z7P4|Q9P2F2	Silent	SNP	ENST00000294618.7	37	CCDS45975.1																																																																																			.		0.632	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
DOCK7	85440	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	63001217	63001217	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:63001217C>T	ENST00000340370.5	-	28	3482	c.3465G>A	c.(3463-3465)ttG>ttA	p.L1155L	DOCK7_ENST00000251157.5_Silent_p.L1186L	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1186					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						CAAGTCCTGCCAAATAATGCT	0.388																																					p.L1186L		.											.	DOCK7	92	0			c.G3558A						.						120.0	114.0	116.0					1																	63001217		2203	4300	6503	SO:0001819	synonymous_variant	85440	exon29			TCCTGCCAAATAA		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.3465G>A	1.37:g.63001217C>T		126.0	0.0		120.0	54.0	NM_001271999	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Silent	SNP	ENST00000340370.5	37	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	C	9.420	1.082775	0.20309	.	.	ENSG00000116641	ENST00000454575	.	.	.	5.05	4.14	0.48551	.	.	.	.	.	T	0.62502	0.2433	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61008	-0.7149	4	.	.	.	.	11.5973	0.50981	0.0:0.8512:0.0:0.1488	.	.	.	.	S	358	.	.	G	-	1	0	DOCK7	62773805	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.813000	0.55636	1.349000	0.45751	0.650000	0.86243	GGC	.		0.388	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
DRG2	1819	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	18003031	18003031	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr17:18003031T>C	ENST00000225729.3	+	5	599	c.461T>C	c.(460-462)gTg>gCg	p.V154A	DRG2_ENST00000395726.4_Missense_Mutation_p.V154A|DRG2_ENST00000583355.1_Intron	NM_001388.4	NP_001379.1	P55039	DRG2_HUMAN	developmentally regulated GTP binding protein 2	154	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	14	all_neural(463;0.228)					AAGGGAGAGGTGCAGAGGTCC	0.637																																					p.V154A		.											.	DRG2	91	0			c.T461C						.						45.0	35.0	38.0					17																	18003031		2201	4300	6501	SO:0001583	missense	1819	exon5			GAGAGGTGCAGAG	X80754	CCDS11191.1	17p13-p12	2008-07-18	2001-11-28		ENSG00000108591	ENSG00000108591			3030	protein-coding gene	gene with protein product		602986	"""developmentally regulated GTP-binding protein 2"""			9605870, 7929244	Standard	NM_001388		Approved		uc002gsh.2	P55039	OTTHUMG00000059399	ENST00000225729.3:c.461T>C	17.37:g.18003031T>C	ENSP00000225729:p.Val154Ala	101.0	0.0		153.0	65.0	NM_001388	B2R8G5|Q53Y50|Q9BWB2	Missense_Mutation	SNP	ENST00000225729.3	37	CCDS11191.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.859704	0.91433	.	.	ENSG00000108591	ENST00000395726;ENST00000225729	T;T	0.16196	2.36;2.36	5.6	5.6	0.85130	Small GTP-binding protein domain (1);GTP-binding domain, HSR1-related (1);	0.053371	0.64402	D	0.000001	T	0.09818	0.0241	N	0.02286	-0.61	0.80722	D	1	P;P	0.50066	0.931;0.879	P;P	0.48063	0.565;0.478	T	0.36720	-0.9736	10	0.09338	T	0.73	-11.3592	15.7656	0.78123	0.0:0.0:0.0:1.0	.	154;154	A8MZF9;P55039	.;DRG2_HUMAN	A	154	ENSP00000379076:V154A;ENSP00000225729:V154A	ENSP00000225729:V154A	V	+	2	0	DRG2	17943756	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.905000	0.87416	2.132000	0.65825	0.383000	0.25322	GTG	.		0.637	DRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132075.3	NM_001388	
DST	667	bcgsc.ca;mdanderson.org	37	6	56382403	56382403	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr6:56382403C>T	ENST00000361203.3	-	65	17192	c.17185G>A	c.(17185-17187)Gat>Aat	p.D5729N	DST_ENST00000446842.2_Missense_Mutation_p.D5514N|DST_ENST00000370788.2_Missense_Mutation_p.D3643N|DST_ENST00000370754.5_Missense_Mutation_p.D6018N|DST_ENST00000370769.4_Missense_Mutation_p.D5840N|DST_ENST00000312431.6_3'UTR|DST_ENST00000340834.4_5'UTR|DST_ENST00000244364.6_Missense_Mutation_p.D3426N|DST_ENST00000421834.2_Missense_Mutation_p.D3752N			Q03001	DYST_HUMAN	dystonin	5729					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AACTCAGCATCAGCTGCTTGG	0.398																																					p.D3426N		.											.	DST	523	0			c.G10276A						.						63.0	56.0	59.0					6																	56382403		1866	4090	5956	SO:0001583	missense	667	exon51			CAGCATCAGCTGC	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.17185G>A	6.37:g.56382403C>T	ENSP00000354508:p.Asp5729Asn	81.0	1.0		98.0	19.0	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	C	19.53	3.845770	0.71603	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23;1.23;1.23	5.44	5.44	0.79542	.	0.000000	0.53938	D	0.000049	T	0.30039	0.0752	L	0.55834	1.745	0.32212	N	0.576451	B;P;P;B;B	0.46395	0.04;0.877;0.768;0.107;0.193	B;P;B;B;B	0.46885	0.057;0.53;0.222;0.072;0.162	T	0.23511	-1.0186	9	0.66056	D	0.02	.	12.9163	0.58207	0.0:0.9254:0.0:0.0746	.	3752;5840;6018;5838;3426	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	N	3426;6018;5840;3752;5514;3643;5729	ENSP00000244364:D3426N;ENSP00000359790:D6018N;ENSP00000359805:D5840N;ENSP00000400883:D3752N;ENSP00000393645:D5514N;ENSP00000359824:D3643N;ENSP00000354508:D5729N	ENSP00000244364:D3426N	D	-	1	0	DST	56490362	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.737000	0.62066	2.706000	0.92434	0.650000	0.86243	GAT	.		0.398	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
DST	667	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	56382415	56382415	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr6:56382415C>T	ENST00000361203.3	-	65	17180	c.17173G>A	c.(17173-17175)Gac>Aac	p.D5725N	DST_ENST00000446842.2_Missense_Mutation_p.D5510N|DST_ENST00000370788.2_Missense_Mutation_p.D3639N|DST_ENST00000370754.5_Missense_Mutation_p.D6014N|DST_ENST00000370769.4_Missense_Mutation_p.D5836N|DST_ENST00000312431.6_3'UTR|DST_ENST00000340834.4_5'UTR|DST_ENST00000244364.6_Missense_Mutation_p.D3422N|DST_ENST00000421834.2_Missense_Mutation_p.D3748N			Q03001	DYST_HUMAN	dystonin	5725					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GCTGCTTGGTCAAACTAAACA	0.393																																					p.D3422N		.											.	DST	523	0			c.G10264A						.						57.0	51.0	53.0					6																	56382415		1875	4088	5963	SO:0001583	missense	667	exon51			CTTGGTCAAACTA	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.17173G>A	6.37:g.56382415C>T	ENSP00000354508:p.Asp5725Asn	72.0	1.0		104.0	21.0	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	C	19.16	3.774018	0.69992	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83	5.44	4.55	0.56014	.	0.110411	0.39341	N	0.001393	T	0.44117	0.1278	L	0.51422	1.61	0.27206	N	0.960039	P;P;P;B;P	0.50156	0.772;0.932;0.749;0.085;0.692	B;P;B;B;B	0.59221	0.329;0.854;0.434;0.133;0.433	T	0.36625	-0.9740	9	0.18276	T	0.48	.	14.7535	0.69546	0.0:0.7252:0.2748:0.0	.	3748;5836;6014;5834;3422	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	N	3422;6014;5836;3748;5510;3639;5725	ENSP00000244364:D3422N;ENSP00000359790:D6014N;ENSP00000359805:D5836N;ENSP00000400883:D3748N;ENSP00000393645:D5510N;ENSP00000359824:D3639N;ENSP00000354508:D5725N	ENSP00000244364:D3422N	D	-	1	0	DST	56490374	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.686000	0.61700	1.386000	0.46466	0.650000	0.86243	GAC	.		0.393	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
DYTN	391475	broad.mit.edu;ucsc.edu	37	2	207559510	207559510	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr2:207559510C>T	ENST00000452335.2	-	8	927	c.811G>A	c.(811-813)Gtc>Atc	p.V271I		NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	271						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		TGCTCAATGACAGGATGAGAC	0.408																																					p.V271I		.											.	DYTN	23	0			c.G811A						.						131.0	127.0	128.0					2																	207559510		1928	4157	6085	SO:0001583	missense	391475	exon8			CAATGACAGGATG	ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.811G>A	2.37:g.207559510C>T	ENSP00000396593:p.Val271Ile	52.0	0.0		49.0	5.0	NM_001093730		Missense_Mutation	SNP	ENST00000452335.2	37	CCDS46502.1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.700638	0.48307	.	.	ENSG00000232125	ENST00000452335	D	0.87256	-2.23	5.13	3.29	0.37713	.	.	.	.	.	T	0.77877	0.4196	L	0.27053	0.805	0.25600	N	0.986603	B	0.21225	0.053	B	0.17433	0.018	T	0.63616	-0.6597	9	0.25106	T	0.35	-7.2483	9.3899	0.38367	0.0:0.7681:0.0:0.2319	.	271	A2CJ06	DYTN_HUMAN	I	271	ENSP00000396593:V271I	ENSP00000396593:V271I	V	-	1	0	DYTN	207267755	0.222000	0.23652	0.875000	0.34327	0.731000	0.41821	1.310000	0.33551	1.304000	0.44892	-0.258000	0.10820	GTC	.		0.408	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336799.1		
DZANK1	55184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	18393405	18393405	+	Silent	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr20:18393405G>A	ENST00000358866.6	-	12	1339	c.1317C>T	c.(1315-1317)ttC>ttT	p.F439F	DZANK1_ENST00000262547.5_Silent_p.F439F|DZANK1_ENST00000357236.4_Silent_p.F325F|DZANK1_ENST00000329494.5_Silent_p.F441F|DZANK1_ENST00000487128.1_5'UTR			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	439							zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						CAGATGGGTAGAAGAGGCCAA	0.512																																					p.F439F		.											.	.	.	0			c.C1317T						.						179.0	168.0	171.0					20																	18393405		1931	4132	6063	SO:0001819	synonymous_variant	55184	exon13			TGGGTAGAAGAGG	AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.1317C>T	20.37:g.18393405G>A		98.0	0.0		159.0	42.0	NM_001099407	B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Silent	SNP	ENST00000358866.6	37	CCDS46582.1	.	.	.	.	.	.	.	.	.	.	G	7.067	0.567605	0.13560	.	.	ENSG00000089091	ENST00000358866	.	.	.	5.51	2.18	0.27775	.	.	.	.	.	T	0.58250	0.2109	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53180	-0.8475	4	.	.	.	-19.4079	9.2005	0.37256	0.3459:0.0:0.6541:0.0	.	.	.	.	F	238	.	.	S	-	2	0	C20orf12	18341405	1.000000	0.71417	1.000000	0.80357	0.627000	0.37826	1.389000	0.34453	0.703000	0.31848	-0.143000	0.13931	TCT	.		0.512	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471926.1	NM_001099407	
ELAC2	60528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	12905669	12905669	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr17:12905669C>T	ENST00000338034.4	-	14	1465	c.1226G>A	c.(1225-1227)gGc>gAc	p.G409D	ELAC2_ENST00000426905.3_Missense_Mutation_p.G369D|ELAC2_ENST00000395962.2_Missense_Mutation_p.G390D|ELAC2_ENST00000609345.1_5'Flank	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	409					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						GAGGGTGGGGCCCTCCTTCTG	0.562																																					p.G409D		.											.	ELAC2	90	0			c.G1226A						.						77.0	75.0	76.0					17																	12905669		2203	4300	6503	SO:0001583	missense	60528	exon14			GTGGGGCCCTCCT	AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.1226G>A	17.37:g.12905669C>T	ENSP00000337445:p.Gly409Asp	78.0	0.0		91.0	50.0	NM_018127	B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Missense_Mutation	SNP	ENST00000338034.4	37	CCDS11164.1	.	.	.	.	.	.	.	.	.	.	C	9.658	1.143353	0.21205	.	.	ENSG00000006744	ENST00000426905;ENST00000338034;ENST00000395962;ENST00000457438	T;T;T	0.63580	0.37;-0.05;-0.04	5.67	-3.94	0.04130	.	1.051740	0.07264	N	0.867941	T	0.44477	0.1295	L	0.48642	1.525	0.09310	N	1	B;B;B;B;B;B;B;B	0.23249	0.032;0.0;0.031;0.01;0.018;0.031;0.006;0.082	B;B;B;B;B;B;B;B	0.25140	0.013;0.002;0.047;0.017;0.021;0.013;0.014;0.058	T	0.30534	-0.9975	10	0.12430	T	0.62	-1.9754	1.6937	0.02857	0.3552:0.3366:0.095:0.2132	.	369;392;390;207;409;169;394;37	B4DPL9;E9PGJ0;G5E9D5;E7ES68;Q9BQ52;B3KSU9;B4DT15;Q9BQ52-3	.;.;.;.;RNZ2_HUMAN;.;.;.	D	369;409;390;87	ENSP00000405223:G369D;ENSP00000337445:G409D;ENSP00000379291:G390D	ENSP00000337445:G409D	G	-	2	0	ELAC2	12846394	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.194000	0.09559	-0.409000	0.07553	-0.224000	0.12420	GGC	.		0.562	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129934.5		
FAM47A	158724	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	34149696	34149696	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chrX:34149696G>A	ENST00000346193.3	-	1	751	c.700C>T	c.(700-702)Cat>Tat	p.H234Y		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	234	Pro-rich.									NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GGGCGGAGATGGGACACTCCA	0.642																																					p.H234Y		.											.	FAM47A	134	0			c.C700T						.						32.0	34.0	33.0					X																	34149696		2201	4298	6499	SO:0001583	missense	158724	exon1			GGAGATGGGACAC	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.700C>T	X.37:g.34149696G>A	ENSP00000345029:p.His234Tyr	101.0	0.0		101.0	22.0	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	G	4.051	0.007073	0.07866	.	.	ENSG00000185448	ENST00000346193	T	0.13538	2.58	0.235	-0.47	0.12131	.	.	.	.	.	T	0.13114	0.0318	N	0.19112	0.55	0.09310	N	1	D	0.62365	0.991	P	0.59115	0.852	T	0.29671	-1.0004	8	0.59425	D	0.04	.	.	.	.	.	234	Q5JRC9	FA47A_HUMAN	Y	234	ENSP00000345029:H234Y	ENSP00000345029:H234Y	H	-	1	0	FAM47A	34059617	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.342000	0.07801	-2.362000	0.00609	-2.407000	0.00222	CAT	.		0.642	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
FRYL	285527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	48512111	48512111	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr4:48512111C>T	ENST00000503238.1	-	56	8358	c.8359G>A	c.(8359-8361)Gat>Aat	p.D2787N	FRYL_ENST00000264319.7_Missense_Mutation_p.D183N|FRYL_ENST00000358350.4_Missense_Mutation_p.D2787N|FRYL_ENST00000507873.2_Missense_Mutation_p.D183N|FRYL_ENST00000537810.1_Missense_Mutation_p.D2787N			O94915	FRYL_HUMAN	FRY-like	2787					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.D2787N(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TTGTATGTATCCAGGTGTTCT	0.438																																					p.D2787N		.											.	FRYL	69	1	Substitution - Missense(1)	lung(1)	c.G8359A						.						80.0	80.0	80.0					4																	48512111		1863	4113	5976	SO:0001583	missense	285527	exon59			ATGTATCCAGGTG	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.8359G>A	4.37:g.48512111C>T	ENSP00000426064:p.Asp2787Asn	70.0	0.0		58.0	25.0	NM_015030	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	37	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.740223	0.89573	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000264319;ENST00000507873	T;T;T	0.30182	1.55;1.55;1.54	5.93	5.93	0.95920	.	0.000000	0.64402	U	0.000001	T	0.61800	0.2376	M	0.80028	2.48	0.80722	D	1	D;D;D	0.89917	0.997;0.999;1.0	D;D;D	0.91635	0.928;0.967;0.999	T	0.63800	-0.6555	10	0.87932	D	0	.	20.3397	0.98756	0.0:1.0:0.0:0.0	.	2787;2787;183	O94915;F5GX82;O94915-2	FRYL_HUMAN;.;.	N	2787;2787;2787;183;183	ENSP00000426064:D2787N;ENSP00000351113:D2787N;ENSP00000441114:D2787N	ENSP00000264319:D183N	D	-	1	0	FRYL	48206868	1.000000	0.71417	1.000000	0.80357	0.270000	0.26580	7.407000	0.80029	2.803000	0.96430	0.585000	0.79938	GAT	.		0.438	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
FXYD4	53828	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	43870995	43870995	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr10:43870995C>A	ENST00000476166.1	+	6	480	c.146C>A	c.(145-147)gCc>gAc	p.A49D	FXYD4_ENST00000480834.1_3'UTR	NM_173160.2	NP_775183.1	P59646	FXYD4_HUMAN	FXYD domain containing ion transport regulator 4	49					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)			NS(1)|large_intestine(1)|lung(3)	5						GGGCTCCTGGCCATTGCTGGG	0.632																																					p.A49D	GBM(173;880 2047 13035 42390 49655)	.											.	FXYD4	90	0			c.C146A						.						75.0	75.0	75.0					10																	43870995		2203	4300	6503	SO:0001583	missense	53828	exon6			TCCTGGCCATTGC		CCDS7203.1	10q11.21	2008-02-01	2002-01-14		ENSG00000150201	ENSG00000150201			4028	protein-coding gene	gene with protein product			"""FXYD domain-containing ion transport regulator 4"""			10950925, 12763854	Standard	NM_001184963		Approved	CHIF	uc001jaq.1	P59646	OTTHUMG00000018027	ENST00000476166.1:c.146C>A	10.37:g.43870995C>A	ENSP00000473361:p.Ala49Asp	96.0	1.0		128.0	38.0	NM_001184963	Q6UWZ1|Q7Z4M5	Missense_Mutation	SNP	ENST00000476166.1	37	CCDS7203.1	.	.	.	.	.	.	.	.	.	.	C	13.63	2.295201	0.40594	.	.	ENSG00000150201	ENST00000374451;ENST00000458363	.	.	.	4.11	2.24	0.28232	.	0.222906	0.46442	D	0.000299	T	0.29061	0.0722	.	.	.	0.09310	N	1	P	0.37176	0.586	B	0.39531	0.302	T	0.12785	-1.0534	8	0.52906	T	0.07	3.8493	6.9707	0.24646	0.0:0.2039:0.6067:0.1894	.	49	P59646	FXYD4_HUMAN	D	49	.	ENSP00000363575:A49D	A	+	2	0	FXYD4	43191001	0.979000	0.34478	0.067000	0.19924	0.005000	0.04900	1.920000	0.40025	0.681000	0.31386	-1.437000	0.01076	GCC	.		0.632	FXYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047698.2	NM_173160	
GGT5	2687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	24628913	24628913	+	Silent	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr22:24628913G>C	ENST00000327365.4	-	4	890	c.474C>G	c.(472-474)ccC>ccG	p.P158P	GGT5_ENST00000418439.2_Missense_Mutation_p.L83V|GGT5_ENST00000263112.7_Silent_p.P126P|GGT5_ENST00000398292.3_Silent_p.P158P	NM_001099781.1|NM_004121.2	NP_001093251.1|NP_004112.2	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5	158					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(3)|skin(3)	28						GCTGCGCCCAGGGCAGGCGGC	0.701																																					p.P158P		.											.	GGT5	71	0			c.C474G						.						20.0	22.0	21.0					22																	24628913		2182	4269	6451	SO:0001819	synonymous_variant	2687	exon4			CGCCCAGGGCAGG	M64099	CCDS13825.1, CCDS42989.1, CCDS42990.1	22q11.23	2008-03-25	2008-03-10	2008-03-10	ENSG00000099998	ENSG00000099998		"""Gamma-glutamyltransferases"""	4260	protein-coding gene	gene with protein product		137168	"""gamma-glutamyltransferase-like activity 1"""	GGTLA1		1676842, 8095916, 18357469	Standard	NM_004121		Approved	GGT-REL	uc002zzp.4	P36269	OTTHUMG00000150796	ENST00000327365.4:c.474C>G	22.37:g.24628913G>C		84.0	0.0		78.0	36.0	NM_001099781	Q53XM9|Q6GMP0|Q96FC1|Q9UFM5	Silent	SNP	ENST00000327365.4	37	CCDS13825.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.738833	0.49045	.	.	ENSG00000099998	ENST00000418439	T	0.25912	1.77	4.32	0.819	0.18785	.	.	.	.	.	T	0.11623	0.0283	.	.	.	0.23704	N	0.997069	P	0.43094	0.799	B	0.37731	0.257	T	0.13469	-1.0508	8	0.17369	T	0.5	-37.4935	3.3472	0.07140	0.2141:0.0:0.4922:0.2937	.	83	E7EUG3	.	V	83	ENSP00000392146:L83V	ENSP00000392146:L83V	L	-	1	2	GGT5	22958913	0.051000	0.20477	1.000000	0.80357	0.997000	0.91878	-0.958000	0.03857	0.570000	0.29347	0.585000	0.79938	CTG	.		0.701	GGT5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320119.1	NM_004121	
GLUD1	2746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	88818994	88818994	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr10:88818994A>G	ENST00000277865.4	-	10	1411	c.1315T>C	c.(1315-1317)Tac>Cac	p.Y439H	GLUD1_ENST00000544149.1_Missense_Mutation_p.Y306H|GLUD1_ENST00000465164.1_5'Flank|GLUD1_ENST00000537649.1_Missense_Mutation_p.Y272H	NM_005271.3	NP_005262.1	P00367	DHE3_HUMAN	glutamate dehydrogenase 1	439					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamine metabolic process (GO:0006541)|positive regulation of insulin secretion (GO:0032024)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|tricarboxylic acid metabolic process (GO:0072350)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|identical protein binding (GO:0042802)|leucine binding (GO:0070728)|NAD+ binding (GO:0070403)			endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(11)|prostate(1)	22					Hexachlorophene(DB00756)	CACTCAAAGTAAGATACTGTC	0.373																																					p.Y439H		.											.	GLUD1	90	0			c.T1315C						.						184.0	179.0	181.0					10																	88818994		2203	4299	6502	SO:0001583	missense	2746	exon10			CAAAGTAAGATAC	M20867	CCDS7382.1	10q23.2	2010-03-17			ENSG00000148672	ENSG00000148672	1.4.1.3		4335	protein-coding gene	gene with protein product		138130		GLUD		2757358	Standard	NM_005271		Approved	GDH	uc001keh.3	P00367	OTTHUMG00000018666	ENST00000277865.4:c.1315T>C	10.37:g.88818994A>G	ENSP00000277865:p.Tyr439His	165.0	0.0		141.0	15.0	NM_005271	B3KV55|B4DGN5|Q5TBU3	Missense_Mutation	SNP	ENST00000277865.4	37	CCDS7382.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.644235	0.87859	.	.	ENSG00000148672	ENST00000277865;ENST00000394415;ENST00000537649;ENST00000535802;ENST00000513510;ENST00000544149	D;D;D	0.96830	-4.14;-4.14;-4.14	5.66	5.66	0.87406	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.98548	0.9515	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.99719	1.1009	10	0.87932	D	0	-9.0102	16.3294	0.83004	1.0:0.0:0.0:0.0	.	306;439	B4DGN5;P00367	.;DHE3_HUMAN	H	439;396;272;138;371;306	ENSP00000277865:Y439H;ENSP00000439291:Y272H;ENSP00000444732:Y306H	ENSP00000277865:Y439H	Y	-	1	0	GLUD1	88808974	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	8.957000	0.93082	2.317000	0.78254	0.524000	0.50904	TAC	.		0.373	GLUD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049188.1	NM_005271	
GPR50	9248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	150348392	150348392	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chrX:150348392G>T	ENST00000218316.3	+	2	406	c.337G>T	c.(337-339)Gtc>Ttc	p.V113F	GPR50-AS1_ENST00000454196.1_RNA|AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	113					cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					GCTGAGTGTGGTCGGCTCCAT	0.542																																					p.V113F		.											.	GPR50	176	0			c.G337T						.						179.0	173.0	175.0					X																	150348392		2202	4298	6500	SO:0001583	missense	9248	exon2			AGTGTGGTCGGCT	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.337G>T	X.37:g.150348392G>T	ENSP00000218316:p.Val113Phe	223.0	0.0		193.0	93.0	NM_004224	Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	ENST00000218316.3	37	CCDS44012.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.873626	0.33069	.	.	ENSG00000102195	ENST00000535473;ENST00000218316	T	0.71817	-0.6	4.21	3.32	0.38043	GPCR, rhodopsin-like superfamily (1);	0.058042	0.64402	D	0.000002	T	0.72036	0.3411	L	0.42245	1.32	0.43724	D	0.996202	D;D	0.54397	0.957;0.966	P;D	0.63877	0.852;0.919	T	0.71185	-0.4667	10	0.48119	T	0.1	-23.3117	5.317	0.15860	0.2498:0.0:0.7502:0.0	.	66;113	F5H1S3;Q13585	.;MTR1L_HUMAN	F	66;113	ENSP00000218316:V113F	ENSP00000218316:V113F	V	+	1	0	GPR50	150099050	1.000000	0.71417	0.994000	0.49952	0.158000	0.22134	5.070000	0.64376	1.838000	0.53458	0.523000	0.50628	GTC	.		0.542	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	89990343	89990343	+	Silent	SNP	C	C	T	rs201767905	byFrequency	TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr5:89990343C>T	ENST00000405460.2	+	33	7866	c.7770C>T	c.(7768-7770)tcC>tcT	p.S2590S		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2590	Calx-beta 18. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CCAATACTTCCGAAGATGGCT	0.453													C|||	2	0.000399361	0.0008	0.0	5008	,	,		19127	0.0		0.001	False		,,,				2504	0.0				p.S2590S		.											.	GPR98	103	0			c.C7770T						.						260.0	257.0	258.0					5																	89990343		1957	4159	6116	SO:0001819	synonymous_variant	84059	exon33			TACTTCCGAAGAT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.7770C>T	5.37:g.89990343C>T		66.0	0.0		64.0	29.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	ENST00000405460.2	37	CCDS47246.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	6.280	0.419819	0.11928	.	.	ENSG00000164199	ENST00000509621	.	.	.	5.88	-5.22	0.02806	.	.	.	.	.	T	0.37839	0.1018	.	.	.	0.58432	D	0.999993	.	.	.	.	.	.	T	0.40040	-0.9584	4	.	.	.	.	2.2397	0.04017	0.2455:0.3936:0.1247:0.2361	.	.	.	.	L	156	.	.	P	+	2	0	GPR98	90026099	0.000000	0.05858	0.969000	0.41365	0.868000	0.49771	-2.707000	0.00820	-0.737000	0.04824	-1.072000	0.02254	CCG	C|0.999;T|0.000		0.453	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
GRAMD1B	57476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	123474218	123474218	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr11:123474218G>A	ENST00000529750.1	+	8	1033	c.706G>A	c.(706-708)Gtg>Atg	p.V236M	GRAMD1B_ENST00000456860.2_Missense_Mutation_p.V243M|GRAMD1B_ENST00000322282.7_Missense_Mutation_p.V236M	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	236						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CGAGGACTACGTGCCCCCTGA	0.597																																					p.V236M		.											.	GRAMD1B	69	0			c.G706A						.						84.0	79.0	80.0					11																	123474218		2004	4179	6183	SO:0001583	missense	57476	exon8			GACTACGTGCCCC	AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.706G>A	11.37:g.123474218G>A	ENSP00000436500:p.Val236Met	101.0	0.0		59.0	11.0	NM_020716	Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	37	CCDS53720.1	.	.	.	.	.	.	.	.	.	.	G	31	5.078155	0.94000	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764	T;T;T;T;T	0.36699	1.63;1.65;1.65;1.67;1.24	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.58250	0.2109	M	0.65498	2.005	0.80722	D	1	D;D;D;D	0.71674	0.998;0.998;0.997;0.997	P;D;P;P	0.67231	0.892;0.95;0.743;0.836	T	0.55140	-0.8187	10	0.35671	T	0.21	.	18.8312	0.92141	0.0:0.0:1.0:0.0	.	196;243;236;243	B7Z4N9;F5H572;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	M	243;243;236;236;196;232	ENSP00000402457:V243M;ENSP00000325628:V236M;ENSP00000436500:V236M;ENSP00000432987:V196M;ENSP00000434214:V232M	ENSP00000325628:V236M	V	+	1	0	GRAMD1B	122979428	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.617000	0.98361	2.436000	0.82500	0.491000	0.48974	GTG	.		0.597	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660	
GRIA3	2892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	122598767	122598767	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chrX:122598767G>A	ENST00000371251.1	+	13	2180	c.2128G>A	c.(2128-2130)Gag>Aag	p.E710K	AL356213.1_ENST00000577653.1_RNA|GRIA3_ENST00000371256.5_Missense_Mutation_p.E710K|GRIA3_ENST00000264357.5_Missense_Mutation_p.E710K|GRIA3_ENST00000542149.1_Missense_Mutation_p.E710K			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	710					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	GAAATCAGCGGAGCCATCTGT	0.463																																					p.E710K		.											.	GRIA3	134	0			c.G2128A						.						82.0	76.0	78.0					X																	122598767		2203	4300	6503	SO:0001583	missense	2892	exon13			TCAGCGGAGCCAT	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.2128G>A	X.37:g.122598767G>A	ENSP00000360297:p.Glu710Lys	317.0	0.0		233.0	104.0	NM_000828	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	ENST00000371251.1	37	CCDS14604.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.473484	0.43942	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.12	5.12	0.69794	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.40322	0.1112	N	0.05510	-0.035	0.80722	D	1	D;D	0.63046	0.992;0.99	D;D	0.76071	0.987;0.979	T	0.47407	-0.9120	10	0.36615	T	0.2	.	16.5308	0.84357	0.0:0.0:1.0:0.0	.	710;710	P42263;P42263-2	GRIA3_HUMAN;.	K	710	ENSP00000264357:E710K;ENSP00000446146:E710K;ENSP00000360302:E710K;ENSP00000360297:E710K	ENSP00000264357:E710K	E	+	1	0	GRIA3	122426448	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.864000	0.99589	2.104000	0.64026	0.415000	0.27848	GAG	.		0.463	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828	
HAO1	54363	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	7915180	7915180	+	Silent	SNP	C	C	A	rs200105698		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr20:7915180C>A	ENST00000378789.3	-	2	291	c.240G>T	c.(238-240)acG>acT	p.T80T		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	80	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						GCTGCATGGCCGTAGCCCCCA	0.532																																					p.T80T		.											.	HAO1	93	0			c.G240T						.						106.0	95.0	99.0					20																	7915180		2203	4300	6503	SO:0001819	synonymous_variant	54363	exon2			CATGGCCGTAGCC	AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.240G>T	20.37:g.7915180C>A		89.0	0.0		92.0	17.0	NM_017545	Q14CQ0|Q9UPZ0|Q9Y3I7	Silent	SNP	ENST00000378789.3	37	CCDS13100.1																																																																																			C|0.999;G|0.001		0.532	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2		
HIST1H1C	3006	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26056402	26056402	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr6:26056402C>G	ENST00000343677.2	-	1	297	c.255G>C	c.(253-255)aaG>aaC	p.K85N		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	85	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						TCACCAGGCTCTTGAGACCAA	0.542																																					p.K85N		.											.	HIST1H1C	231	0			c.G255C						.						114.0	118.0	117.0					6																	26056402		2203	4300	6503	SO:0001583	missense	3006	exon1			CAGGCTCTTGAGA	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.255G>C	6.37:g.26056402C>G	ENSP00000339566:p.Lys85Asn	87.0	0.0		127.0	15.0	NM_005319	A8K4I2	Missense_Mutation	SNP	ENST00000343677.2	37	CCDS4577.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.680689	0.47886	.	.	ENSG00000187837	ENST00000343677	T	0.28255	1.62	5.63	2.93	0.34026	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.050070	0.85682	D	0.000000	T	0.50394	0.1613	M	0.91406	3.205	0.47214	D	0.999353	D	0.89917	1.0	D	0.87578	0.998	T	0.59941	-0.7359	10	0.87932	D	0	-6.336	10.4421	0.44472	0.0:0.7895:0.0:0.2105	.	85	P16403	H12_HUMAN	N	85	ENSP00000339566:K85N	ENSP00000339566:K85N	K	-	3	2	HIST1H1C	26164381	0.997000	0.39634	0.993000	0.49108	0.233000	0.25261	0.622000	0.24433	0.435000	0.26365	-0.136000	0.14681	AAG	.		0.542	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319	
HIVEP3	59269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	42041241	42041241	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:42041241C>T	ENST00000372583.1	-	5	6066	c.5181G>A	c.(5179-5181)ccG>ccA	p.P1727P	HIVEP3_ENST00000429157.2_Silent_p.P1727P|HIVEP3_ENST00000247584.5_Silent_p.P1727P|HIVEP3_ENST00000460604.1_5'UTR|HIVEP3_ENST00000372584.1_Silent_p.P1727P	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1727					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				TGATCCTCGCCGGCTCCCCTC	0.557																																					p.P1727P		.											.	HIVEP3	157	0			c.G5181A						.						151.0	161.0	158.0					1																	42041241		2203	4300	6503	SO:0001819	synonymous_variant	59269	exon5			CCTCGCCGGCTCC	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.5181G>A	1.37:g.42041241C>T		64.0	0.0		27.0	15.0	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	37	CCDS463.1																																																																																			.		0.557	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
IVL	3713	ucsc.edu;bcgsc.ca	37	1	152884007	152884007	+	Silent	SNP	G	G	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:152884007G>T	ENST00000368764.3	+	2	1798	c.1734G>T	c.(1732-1734)gtG>gtT	p.V578V	IVL_ENST00000392667.2_Silent_p.V432V			P07476	INVO_HUMAN	involucrin	578					isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGCAGGAGGTGCAGTGGCCAC	0.557																																					p.V578V		.											.	IVL	93	0			c.G1734T						.						64.0	65.0	64.0					1																	152884007		2203	4300	6503	SO:0001819	synonymous_variant	3713	exon2			GGAGGTGCAGTGG	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.1734G>T	1.37:g.152884007G>T		211.0	2.0		398.0	78.0	NM_005547	Q5T7P4	Silent	SNP	ENST00000368764.3	37	CCDS1030.1																																																																																			.		0.557	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547	
JAM3	83700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	134014848	134014848	+	Missense_Mutation	SNP	C	C	T	rs549604639		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr11:134014848C>T	ENST00000299106.4	+	5	730	c.571C>T	c.(571-573)Cgc>Tgc	p.R191C	JAM3_ENST00000524969.1_3'UTR|JAM3_ENST00000441717.3_Missense_Mutation_p.R140C|JAM3_ENST00000529443.2_Missense_Mutation_p.R236C			Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3	191	Ig-like C2-type.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|establishment of cell polarity (GO:0030010)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|myelination (GO:0042552)|myeloid progenitor cell differentiation (GO:0002318)|neutrophil homeostasis (GO:0001780)|regulation of actin cytoskeleton organization by cell-cell adhesion (GO:0090138)|regulation of neutrophil chemotaxis (GO:0090022)|spermatid development (GO:0007286)|transmission of nerve impulse (GO:0019226)	cell-cell contact zone (GO:0044291)|desmosome (GO:0030057)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	integrin binding (GO:0005178)	p.R236C(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)	10	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		TCCCAGATTTCGCAATTCTTC	0.502																																					p.R191C		.											.	JAM3	91	1	Substitution - Missense(1)	endometrium(1)	c.C571T						.						128.0	108.0	115.0					11																	134014848		2201	4297	6498	SO:0001583	missense	83700	exon5			AGATTTCGCAATT	AF356518	CCDS8494.1, CCDS55799.1, CCDS8494.2	11q25	2013-01-29			ENSG00000166086	ENSG00000166086		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15532	protein-coding gene	gene with protein product		606871					Standard	NM_032801		Approved	JAM-C, JAMC	uc001qhb.3	Q9BX67	OTTHUMG00000167130	ENST00000299106.4:c.571C>T	11.37:g.134014848C>T	ENSP00000299106:p.Arg191Cys	200.0	0.0		71.0	22.0	NM_032801	B3KWG9|Q8WWL8|Q96FL1	Missense_Mutation	SNP	ENST00000299106.4	37	CCDS8494.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.41|12.41	1.929059|1.929059	0.34002|0.34002	.|.	.|.	ENSG00000166086|ENSG00000166086	ENST00000299106;ENST00000441717;ENST00000532165|ENST00000529443	T|T	0.63580|0.70045	-0.05|-0.45	5.06|5.06	4.16|4.16	0.48862|0.48862	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.799060|.	0.11759|.	N|.	0.532275|.	T|T	0.58481|0.58481	0.2125|0.2125	N|N	0.24115|0.24115	0.695|0.695	0.34201|0.34201	D|D	0.673119|0.673119	D;D|.	0.65815|.	0.995;0.995|.	P;P|.	0.54706|.	0.759;0.759|.	T|T	0.65059|0.65059	-0.6260|-0.6260	10|6	0.37606|.	T|.	0.19|.	.|.	13.4923|13.4923	0.61402|0.61402	0.0:0.9249:0.0:0.075|0.0:0.9249:0.0:0.075	.|.	140;191|.	B3KWG9;Q9BX67|.	.;JAM3_HUMAN|.	C|L	236;140;37|144	ENSP00000395742:R140C|ENSP00000431883:S144L	ENSP00000299106:R236C|.	R|S	+|+	1|2	0|0	JAM3|JAM3	133520058|133520058	0.014000|0.014000	0.17966|0.17966	0.853000|0.853000	0.33588|0.33588	0.074000|0.074000	0.17049|0.17049	0.586000|0.586000	0.23894|0.23894	1.155000|1.155000	0.42497|0.42497	-0.142000|-0.142000	0.14014|0.14014	CGC|TCG	.		0.502	JAM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393303.4	NM_032801	
JUND	3727	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	18391859	18391859	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:18391859C>T	ENST00000252818.3	-	1	573	c.436G>A	c.(436-438)Gat>Aat	p.D146N	MIR3188_ENST00000583494.1_RNA	NM_005354.4	NP_005345.3	P17535	JUND_HUMAN	jun D proto-oncogene	146					aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|circadian rhythm (GO:0007623)|osteoblast development (GO:0002076)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	chromatin (GO:0000785)|nucleus (GO:0005634)|protein complex (GO:0043234)	double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			lung(2)|prostate(1)	3						TTGTGTAAATCCTCCAGGGCC	0.746																																					p.D146N		.											.	JUND	846	0			c.G436A						.						14.0	15.0	15.0					19																	18391859		2197	4290	6487	SO:0001583	missense	3727	exon1			GTAAATCCTCCAG		CCDS32959.1	19p13.2	2013-01-10				ENSG00000130522		"""basic leucine zipper proteins"""	6206	protein-coding gene	gene with protein product	"""transcription factor jun-D"", ""JunD-FL isoform"", ""activator protein 1"""	165162				2112242, 1903194	Standard	NM_005354		Approved	AP-1	uc002nip.2	P17535		ENST00000252818.3:c.436G>A	19.37:g.18391859C>T	ENSP00000252818:p.Asp146Asn	16.0	0.0		44.0	9.0	NM_005354	Q53EK9	Missense_Mutation	SNP	ENST00000252818.3	37	CCDS32959.1	.	.	.	.	.	.	.	.	.	.	.	31	5.098638	0.94197	.	.	ENSG00000130522	ENST00000252818	T	0.36878	1.23	3.06	3.06	0.35304	Jun-like transcription factor (1);	0.072212	0.52532	U	0.000073	T	0.43433	0.1247	L	0.34521	1.04	0.58432	D	0.999998	D	0.76494	0.999	D	0.67900	0.954	T	0.20874	-1.0262	10	0.32370	T	0.25	.	11.9982	0.53216	0.0:1.0:0.0:0.0	.	146	P17535	JUND_HUMAN	N	146	ENSP00000252818:D146N	ENSP00000252818:D146N	D	-	1	0	JUND	18252859	1.000000	0.71417	0.979000	0.43373	0.966000	0.64601	5.015000	0.64035	1.741000	0.51731	0.537000	0.68136	GAT	.		0.746	JUND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466318.2	NM_005354	
KCNE4	23704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	223917618	223917618	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr2:223917618C>T	ENST00000281830.3	+	2	554	c.223C>T	c.(223-225)Cgt>Tgt	p.R75C	KCNE4_ENST00000488477.2_Intron|KCNE4_ENST00000604125.1_Missense_Mutation_p.R24C			Q8WWG9	KCNE4_HUMAN	potassium voltage-gated channel, Isk-related family, member 4	75						apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	voltage-gated potassium channel activity (GO:0005249)			large_intestine(2)|lung(5)|ovary(2)|skin(1)	10		Renal(207;0.0183)|Lung NSC(271;0.137)|all_lung(227;0.175)		Epithelial(121;4.48e-11)|all cancers(144;2.88e-08)|Lung(261;0.00688)|LUSC - Lung squamous cell carcinoma(224;0.008)		CCTGGAGTCCCGTGCGGCCGG	0.612																																					p.R75C		.											.	KCNE4	91	0			c.C223T						.						50.0	47.0	48.0					2																	223917618		2203	4298	6501	SO:0001583	missense	23704	exon2			GAGTCCCGTGCGG	AY065987	CCDS2456.1, CCDS2456.2	2q36.1	2008-02-05			ENSG00000152049	ENSG00000152049		"""Potassium channels"""	6244	protein-coding gene	gene with protein product		607775				10219239, 12670483	Standard	NM_080671		Approved	MiRP3	uc002vnl.5	Q8WWG9	OTTHUMG00000133161	ENST00000281830.3:c.223C>T	2.37:g.223917618C>T	ENSP00000281830:p.Arg75Cys	46.0	0.0		41.0	32.0	NM_080671	B7Z275|Q53SM4|Q96CC4	Missense_Mutation	SNP	ENST00000281830.3	37		.	.	.	.	.	.	.	.	.	.	C	16.82	3.229551	0.58777	.	.	ENSG00000152049	ENST00000281830	.	.	.	6.17	6.17	0.99709	.	0.814657	0.11678	N	0.540137	T	0.36026	0.0952	N	0.14661	0.345	0.24173	N	0.99562	B	0.06786	0.001	B	0.06405	0.002	T	0.26950	-1.0088	9	0.66056	D	0.02	-3.963	14.9567	0.71120	0.0:0.9326:0.0:0.0674	.	24	Q8WWG9	KCNE4_HUMAN	C	24	.	ENSP00000281830:R24C	R	+	1	0	KCNE4	223625862	0.495000	0.26051	0.058000	0.19502	0.281000	0.26958	3.636000	0.54317	2.941000	0.99782	0.655000	0.94253	CGT	.		0.612	KCNE4-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000330997.2	NM_080671	
KIAA1217	56243	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	24809143	24809143	+	Missense_Mutation	SNP	C	C	T	rs560134199		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr10:24809143C>T	ENST00000376454.3	+	11	2299	c.2269C>T	c.(2269-2271)Ctc>Ttc	p.L757F	KIAA1217_ENST00000396445.1_Missense_Mutation_p.L440F|KIAA1217_ENST00000396446.1_Missense_Mutation_p.L440F|KIAA1217_ENST00000376451.2_Missense_Mutation_p.L440F|KIAA1217_ENST00000430453.2_Intron|KIAA1217_ENST00000458595.1_Missense_Mutation_p.L722F|KIAA1217_ENST00000307544.6_Missense_Mutation_p.L440F|KIAA1217_ENST00000376462.1_Missense_Mutation_p.L677F|KIAA1217_ENST00000376452.3_Missense_Mutation_p.L722F	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	757					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						CGGGGCTTTCCTCCTGCGTCA	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		16822	0.001		0.0	False		,,,				2504	0.0				p.L757F		.											.	KIAA1217	98	0			c.C2269T						.						150.0	151.0	150.0					10																	24809143		2203	4300	6503	SO:0001583	missense	56243	exon11			GCTTTCCTCCTGC	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.2269C>T	10.37:g.24809143C>T	ENSP00000365637:p.Leu757Phe	101.0	0.0		121.0	12.0	NM_019590	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	37	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.190937	0.78789	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	4.87	4.87	0.63330	.	0.392231	0.27821	N	0.017702	T	0.63768	0.2539	L	0.59436	1.845	0.42647	D	0.993437	D;D;D;D;D;D;D;D	0.89917	0.999;0.982;0.999;0.995;1.0;0.999;1.0;0.986	D;P;D;D;D;D;D;P	0.87578	0.945;0.741;0.978;0.938;0.989;0.978;0.998;0.839	T	0.65483	-0.6157	10	0.59425	D	0.04	.	13.2171	0.59867	0.1589:0.8411:0.0:0.0	.	722;722;440;440;440;440;757;757	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	F	677;722;722;440;757;722;572;440;440;440;440;440	ENSP00000365645:L677F;ENSP00000365639:L722F;ENSP00000392625:L722F;ENSP00000365637:L757F;ENSP00000365635:L722F;ENSP00000404798:L572F;ENSP00000302343:L440F;ENSP00000379722:L440F;ENSP00000365634:L440F;ENSP00000379723:L440F	ENSP00000302343:L440F	L	+	1	0	KIAA1217	24849149	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	3.542000	0.53625	2.513000	0.84729	0.655000	0.94253	CTC	.		0.532	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
LRIT1	26103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	85994095	85994095	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr10:85994095T>C	ENST00000372105.3	-	3	650	c.629A>G	c.(628-630)tAt>tGt	p.Y210C		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	210	LRRCT.					integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						AACCAGGTCATAGAGTCGGCA	0.537																																					p.Y210C		.											.	LRIT1	90	0			c.A629G						.						84.0	86.0	85.0					10																	85994095		2203	4300	6503	SO:0001583	missense	26103	exon3			AGGTCATAGAGTC	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.629A>G	10.37:g.85994095T>C	ENSP00000361177:p.Tyr210Cys	163.0	0.0		168.0	46.0	NM_015613	Q0QD41|Q9Y4N7	Missense_Mutation	SNP	ENST00000372105.3	37	CCDS7373.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.983868	0.74474	.	.	ENSG00000148602	ENST00000372105	T	0.52754	0.65	5.91	5.91	0.95273	Cysteine-rich flanking region, C-terminal (1);	0.123192	0.56097	D	0.000022	T	0.62829	0.2460	M	0.69248	2.105	0.80722	D	1	D	0.69078	0.997	P	0.58928	0.848	T	0.63024	-0.6729	10	0.42905	T	0.14	.	15.3309	0.74208	0.0:0.0:0.0:1.0	.	210	Q9P2V4	LRIT1_HUMAN	C	210	ENSP00000361177:Y210C	ENSP00000361177:Y210C	Y	-	2	0	LRIT1	85984075	1.000000	0.71417	0.999000	0.59377	0.948000	0.59901	3.167000	0.50793	2.254000	0.74563	0.533000	0.62120	TAT	.		0.537	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	NM_015613	
MAP3K5	4217	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	137041704	137041704	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr6:137041704C>T	ENST00000359015.4	-	2	832	c.472G>A	c.(472-474)Gat>Aat	p.D158N		NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	158					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		CGGAAGGCATCGCTCATCTCC	0.463																																					p.D158N		.											.	MAP3K5	982	0			c.G472A						.						153.0	124.0	134.0					6																	137041704		2203	4300	6503	SO:0001583	missense	4217	exon2			AGGCATCGCTCAT	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.472G>A	6.37:g.137041704C>T	ENSP00000351908:p.Asp158Asn	84.0	0.0		70.0	14.0	NM_005923	A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	ENST00000359015.4	37	CCDS5179.1	.	.	.	.	.	.	.	.	.	.	C	19.11	3.763269	0.69763	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	T	0.69926	-0.44	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.69975	0.3171	L	0.43923	1.385	0.80722	D	1	B;D;D	0.89917	0.325;1.0;1.0	B;D;D	0.83275	0.085;0.996;0.99	T	0.60890	-0.7173	10	0.14252	T	0.57	.	20.3495	0.98807	0.0:1.0:0.0:0.0	.	238;3;158	Q59GL6;B4DF67;Q99683	.;.;M3K5_HUMAN	N	158;238	ENSP00000351908:D158N	ENSP00000351908:D158N	D	-	1	0	MAP3K5	137083397	1.000000	0.71417	0.988000	0.46212	0.981000	0.71138	7.487000	0.81328	2.814000	0.96858	0.591000	0.81541	GAT	.		0.463	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1		
MARK2	2011	broad.mit.edu;bcgsc.ca	37	11	63662806	63662819	+	Splice_Site	DEL	AAGAGGTGAGCACT	AAGAGGTGAGCACT	-			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	AAGAGGTGAGCACT	AAGAGGTGAGCACT	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr11:63662806_63662819delAAGAGGTGAGCACT	ENST00000509502.2	+	2	594_598	c.131_135delAAGAGGTGAGCACT	c.(130-135)aaagag>a	p.KE44fs	MARK2_ENST00000513765.2_Splice_Site_p.KE44fs|MARK2_ENST00000350490.7_Splice_Site_p.KE77fs|MARK2_ENST00000361128.5_Splice_Site_p.KE77fs|MARK2_ENST00000402010.2_Splice_Site_p.KE77fs|MARK2_ENST00000508192.1_Splice_Site_p.KE77fs|MARK2_ENST00000502399.3_Splice_Site_p.KE77fs|MARK2_ENST00000377810.3_Splice_Site_p.KE44fs|MARK2_ENST00000315032.8_Splice_Site_p.KE77fs|MARK2_ENST00000377809.4_Splice_Site_p.KE77fs|MARK2_ENST00000413835.2_Splice_Site_p.KE77fs|MARK2_ENST00000408948.3_Splice_Site_p.KE44fs|MARK2_ENST00000425897.2_Splice_Site_p.KE44fs	NM_017490.3	NP_059672.2			MAP/microtubule affinity-regulating kinase 2											autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33						CTGACTGGGAAAGAGGTGAGCACTGGGACTGGGG	0.551																																					p.77_78del		.											.	MARK2	766	0			c.230_234del						.																																			SO:0001630	splice_region_variant	2011	exon2			CTGGGAAAGAGGT	BC008771	CCDS8051.1, CCDS41665.1, CCDS8051.2, CCDS53649.1, CCDS53650.1, CCDS53651.1	11q13.1	2013-06-27	2002-07-26	2002-08-01	ENSG00000072518	ENSG00000072518			3332	protein-coding gene	gene with protein product	"""ELKL motif kinase 1"", ""serine/threonine kinase"", ""protein-serine/threonine kinase"", ""Ser/Thr protein kinase PAR-1B"""	600526	"""ELKL motif kinase"""	EMK1		9730619, 10516437	Standard	NM_017490		Approved	PAR-1, Par1b, PAR-1B	uc001nxw.3	Q7KZI7	OTTHUMG00000160504	ENST00000509502.2:c.135+1AAGAGGTGAGCACT>-	11.37:g.63662806_63662819delAAGAGGTGAGCACT		124.0	0.0		62.0	7.0	NM_001163296		Frame_Shift_Del	DEL	ENST00000509502.2	37	CCDS41665.1																																																																																			.		0.551	MARK2-003	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360862.2	NM_017490	Frame_Shift_Del
MBTPS1	8720	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	84118638	84118638	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr16:84118638C>T	ENST00000343411.3	-	10	1731	c.1236G>A	c.(1234-1236)ggG>ggA	p.G412G	MBTPS1_ENST00000569770.1_5'UTR	NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	412	Peptidase S8.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CAACACTGGTCCCTGAGAGGG	0.602											OREG0023982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G412G		.											.	MBTPS1	92	0			c.G1236A						.						89.0	75.0	80.0					16																	84118638		2200	4300	6500	SO:0001819	synonymous_variant	8720	exon10			ACTGGTCCCTGAG	D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.1236G>A	16.37:g.84118638C>T		206.0	0.0	1226	153.0	39.0	NM_003791	A8K6V8|Q24JQ2|Q9UF67	Silent	SNP	ENST00000343411.3	37	CCDS10941.1																																																																																			.		0.602	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269080.2	NM_003791	
MIA	8190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	41281480	41281480	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:41281480C>T	ENST00000263369.3	+	1	199	c.33C>T	c.(31-33)atC>atT	p.I11I	RAB4B_ENST00000357052.2_5'Flank|MIA_ENST00000597784.1_Silent_p.I11I|RAB4B_ENST00000594800.1_5'Flank|MIA_ENST00000594436.1_Silent_p.I11I|MIA-RAB4B_ENST00000600729.1_Silent_p.I11I|RAB4B-EGLN2_ENST00000594136.1_5'Flank	NM_006533.3	NP_006524.1	Q16674	MIA_HUMAN	melanoma inhibitory activity	11					cell proliferation (GO:0008283)	extracellular space (GO:0005615)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	4			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)	GBM - Glioblastoma multiforme(1328;0.0199)		TTGGTGTCATCATCTTGCTGT	0.612																																					p.I11I		.											.	MIA	651	0			c.C33T						.						185.0	157.0	166.0					19																	41281480		2203	4300	6503	SO:0001819	synonymous_variant	8190	exon2			TGTCATCATCTTG	X75450	CCDS12566.1	19q13.2	2012-10-15			ENSG00000261857	ENSG00000261857			7076	protein-coding gene	gene with protein product		601340				7923218, 8661134	Standard	NM_006533		Approved	CD-RAP	uc021uuu.1	Q16674		ENST00000263369.3:c.33C>T	19.37:g.41281480C>T		62.0	0.0		122.0	74.0	NM_001202553	Q6FHV3	Silent	SNP	ENST00000263369.3	37	CCDS12566.1																																																																																			.		0.612	MIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463162.1		
MOCS1	4337	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	39895145	39895145	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr6:39895145G>A	ENST00000340692.5	-	2	176	c.173C>T	c.(172-174)tCc>tTc	p.S58F	MOCS1_ENST00000373186.4_Missense_Mutation_p.S58F|MOCS1_ENST00000373188.2_Missense_Mutation_p.S58F|MOCS1_ENST00000308559.7_Missense_Mutation_p.S58F|MOCS1_ENST00000425303.2_Missense_Mutation_p.S58F|MOCS1_ENST00000373195.3_Intron|MOCS1_ENST00000373175.4_Missense_Mutation_p.S29F|MOCS1_ENST00000432280.2_Missense_Mutation_p.S29F			Q9NZB8	MOCS1_HUMAN	molybdenum cofactor synthesis 1	58	Molybdenum cofactor biosynthesis protein A.				Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|molybdopterin synthase complex (GO:0019008)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|cyclic pyranopterin monophosphate synthase activity (GO:0061597)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	21	Ovarian(28;0.0355)|Colorectal(47;0.196)					GAGGAAGGCGGAGAAGGGGGC	0.652																																					p.S58F	NSCLC(84;861 1413 23785 24908 42279)|Melanoma(182;611 2047 9114 11847 26639)	.											.	MOCS1	92	0			c.C173T						.						30.0	31.0	31.0					6																	39895145		2203	4299	6502	SO:0001583	missense	4337	exon1			AAGGCGGAGAAGG	AJ224328	CCDS4846.1, CCDS43460.1	6p21.2	2012-05-08			ENSG00000124615	ENSG00000124615			7190	protein-coding gene	gene with protein product		603707				9731530, 10053004	Standard	NM_001075098		Approved	MOCOD	uc003opb.3	Q9NZB8	OTTHUMG00000014656	ENST00000340692.5:c.173C>T	6.37:g.39895145G>A	ENSP00000344794:p.Ser58Phe	56.0	0.0		49.0	20.0	NM_005943	B3KPT7|B4DTP1|O14940|O14941|O75710|Q5J7W0|Q5TCE1|Q5TCE2|Q5TCE6|Q5TCE9|Q5TCF0|Q5TCF1|Q8N418|Q9NZB7|Q9UEM1	Missense_Mutation	SNP	ENST00000340692.5	37		.	.	.	.	.	.	.	.	.	.	G	25.7	4.668156	0.88348	.	.	ENSG00000124615	ENST00000373186;ENST00000308559;ENST00000373175;ENST00000373188;ENST00000340692;ENST00000425303;ENST00000432280	T;T;T	0.34859	1.34;1.35;1.35	5.44	5.44	0.79542	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	T	0.36524	0.0970	N	0.19112	0.55	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.79784	0.993;0.976;0.987;0.986	T	0.10706	-1.0618	9	.	.	.	-23.7002	19.2062	0.93730	0.0:0.0:1.0:0.0	.	58;58;58;58	Q9NZB8-5;Q9NZB8;Q9NZB8-8;Q9NZB8-6	.;MOCS1_HUMAN;.;.	F	58;58;29;58;58;58;29	ENSP00000309843:S58F;ENSP00000344794:S58F;ENSP00000416478:S58F	.	S	-	2	0	MOCS1	40003123	1.000000	0.71417	0.969000	0.41365	0.632000	0.37999	8.594000	0.90836	2.703000	0.92315	0.591000	0.81541	TCC	.		0.652	MOCS1-005	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000040476.2	NM_005943	
MRPL21	219927	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	68658837	68658837	+	Silent	SNP	G	G	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr11:68658837G>T	ENST00000362034.2	-	7	589	c.580C>A	c.(580-582)Cgg>Agg	p.R194R	MRPL21_ENST00000450904.2_Silent_p.R109R	NM_181514.1|NM_181515.1	NP_852615.1|NP_852616.1	Q7Z2W9	RM21_HUMAN	mitochondrial ribosomal protein L21	194					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(6)|prostate(1)	8			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CTGTTTATCCGGAGGACAGTC	0.473																																					p.R194R		.											.	MRPL21	90	0			c.C580A						.						198.0	195.0	196.0					11																	68658837		2200	4294	6494	SO:0001819	synonymous_variant	219927	exon7			TTATCCGGAGGAC	AK096756	CCDS8186.1, CCDS44662.1	11q13.3	2012-09-13			ENSG00000197345	ENSG00000197345		"""Mitochondrial ribosomal proteins / large subunits"""	14479	protein-coding gene	gene with protein product		611834				11551941	Standard	NM_181514		Approved		uc001ooi.3	Q7Z2W9	OTTHUMG00000167893	ENST00000362034.2:c.580C>A	11.37:g.68658837G>T		88.0	0.0		47.0	12.0	NM_181514	A6NKU0|C9JPR2	Silent	SNP	ENST00000362034.2	37	CCDS8186.1																																																																																			.		0.473	MRPL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396856.1	NM_181512	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	8999473	8999473	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:8999473A>G	ENST00000397910.4	-	56	40905	c.40702T>C	c.(40702-40704)Tac>Cac	p.Y13568H	MUC16_ENST00000380951.5_Missense_Mutation_p.Y209H	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13570	SEA 10. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGCTCCCAGTATAGCTGCTCT	0.587																																					p.Y13568H		.											.	MUC16	566	0			c.T40702C						.						185.0	156.0	165.0					19																	8999473		2010	4189	6199	SO:0001583	missense	94025	exon56			CCCAGTATAGCTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40702T>C	19.37:g.8999473A>G	ENSP00000381008:p.Tyr13568His	100.0	0.0		104.0	17.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	12.09	1.833078	0.32421	.	.	ENSG00000181143	ENST00000397910;ENST00000380951	T;T	0.52057	0.68;0.68	3.48	3.48	0.39840	SEA (2);	.	.	.	.	T	0.69637	0.3133	M	0.89287	3.02	.	.	.	D;D	0.89917	1.0;0.984	D;D	0.91635	0.999;0.946	T	0.79193	-0.1904	8	0.87932	D	0	-11.9353	8.5336	0.33349	1.0:0.0:0.0:0.0	.	21213;13568	Q8WXI7;B5ME49	MUC16_HUMAN;.	H	13568;209	ENSP00000381008:Y13568H;ENSP00000370338:Y209H	ENSP00000370338:Y209H	Y	-	1	0	MUC16	8860473	0.989000	0.36119	0.658000	0.29665	0.071000	0.16799	2.729000	0.47327	1.599000	0.50093	0.454000	0.30748	TAC	.		0.587	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYBPC2	4606	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50957538	50957538	+	Silent	SNP	G	G	A	rs558923030	byFrequency	TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:50957538G>A	ENST00000357701.5	+	18	1977	c.1926G>A	c.(1924-1926)ccG>ccA	p.P642P		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	642	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		CAGACCCCCCGGAGGCTGTGC	0.647													g|||	7	0.00139776	0.0	0.0	5008	,	,		14805	0.0		0.0	False		,,,				2504	0.0072				p.P642P		.											.	MYBPC2	67	0			c.G1926A						.						38.0	40.0	39.0					19																	50957538		1994	4154	6148	SO:0001819	synonymous_variant	4606	exon18			CCCCCCGGAGGCT		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.1926G>A	19.37:g.50957538G>A		103.0	0.0		44.0	31.0	NM_004533	A1L4G9	Silent	SNP	ENST00000357701.5	37	CCDS46152.1																																																																																			.		0.647	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533	
MYCBPAP	84073	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	48586029	48586029	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr17:48586029C>T	ENST00000323776.5	+	1	285	c.123C>T	c.(121-123)ggC>ggT	p.G41G	RP11-94C24.6_ENST00000502300.1_lincRNA|MYCBPAP_ENST00000436259.2_Silent_p.G4G|MYCBPAP_ENST00000419930.1_Silent_p.G41G	NM_032133.4	NP_115509.4			MYCBP associated protein											breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			TGGTGCCGGGCGGCACCATGA	0.617																																					p.G41G		.											.	MYCBPAP	230	0			c.C123T						.						14.0	15.0	14.0					17																	48586029		2200	4292	6492	SO:0001819	synonymous_variant	84073	exon1			GCCGGGCGGCACC	BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.123C>T	17.37:g.48586029C>T		158.0	0.0		242.0	39.0	NM_032133		Silent	SNP	ENST00000323776.5	37	CCDS32680.2																																																																																			.		0.617	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347814.1	NM_032133	
NCKAP5	344148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	133554289	133554289	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr2:133554289C>T	ENST00000409261.1	-	12	1194	c.821G>A	c.(820-822)cGt>cAt	p.R274H	NCKAP5_ENST00000405974.3_Missense_Mutation_p.R274H|NCKAP5_ENST00000409213.1_Missense_Mutation_p.R274H|NCKAP5_ENST00000317721.6_Missense_Mutation_p.R274H	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	274										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						ATCCAAGAGACGTGAGTGAAG	0.403																																					p.R274H		.											.	.	.	0			c.G821A						.						62.0	59.0	60.0					2																	133554289		1851	4103	5954	SO:0001583	missense	344148	exon12			AAGAGACGTGAGT	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.821G>A	2.37:g.133554289C>T	ENSP00000387128:p.Arg274His	62.0	0.0		48.0	10.0	NM_207481	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	C	13.58	2.278775	0.40294	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661	T;T;T;T	0.51071	2.67;0.72;2.67;0.72	5.35	-0.767	0.11016	.	.	.	.	.	T	0.26955	0.0660	N	0.19112	0.55	0.09310	N	1	B;B	0.28667	0.017;0.219	B;B	0.22880	0.004;0.042	T	0.15321	-1.0441	9	0.59425	D	0.04	.	4.9132	0.13833	0.1321:0.5078:0.0:0.3601	.	274;274	O14513-2;O14513	.;NCKP5_HUMAN	H	274	ENSP00000387128:R274H;ENSP00000386952:R274H;ENSP00000380603:R274H;ENSP00000385692:R274H	ENSP00000380603:R274H	R	-	2	0	NCKAP5	133270759	0.994000	0.37717	0.023000	0.16930	0.875000	0.50365	1.593000	0.36686	-0.245000	0.09625	0.655000	0.94253	CGT	.		0.403	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
NCKAP5	344148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	133721442	133721442	+	Splice_Site	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr2:133721442C>T	ENST00000409261.1	-	8	803	c.430G>A	c.(430-432)Gaa>Aaa	p.E144K	NCKAP5_ENST00000405974.3_Splice_Site_p.E144K|NCKAP5_ENST00000409213.1_Splice_Site_p.E144K|NCKAP5_ENST00000317721.6_Splice_Site_p.E144K	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	144										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GACAGCTTTTCCTGAAGCAAG	0.418																																					p.E144K		.											.	.	.	0			c.G430A						.						136.0	130.0	132.0					2																	133721442		1859	4093	5952	SO:0001630	splice_region_variant	344148	exon8			GCTTTTCCTGAAG	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.430-1G>A	2.37:g.133721442C>T		64.0	0.0		50.0	32.0	NM_207481	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	C	19.18	3.777863	0.70107	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661;ENST00000542834	T;T;T;T	0.50813	2.71;0.73;2.71;0.73	5.0	5.0	0.66597	.	.	.	.	.	T	0.52108	0.1714	N	0.19112	0.55	0.32317	N	0.562927	B;P;D	0.67145	0.361;0.72;0.996	B;B;P	0.61874	0.308;0.423;0.895	T	0.61008	-0.7149	9	0.87932	D	0	.	15.4984	0.75677	0.0:1.0:0.0:0.0	.	119;144;144	O14513-3;O14513-2;O14513	.;.;NCKP5_HUMAN	K	144;144;144;144;144;119	ENSP00000387128:E144K;ENSP00000386952:E144K;ENSP00000380603:E144K;ENSP00000385692:E144K	ENSP00000380603:E144K	E	-	1	0	NCKAP5	133437912	1.000000	0.71417	0.993000	0.49108	0.621000	0.37620	4.934000	0.63491	2.765000	0.95021	0.650000	0.86243	GAA	.		0.418	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	Missense_Mutation
NCOA3	8202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	46268408	46268408	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr20:46268408C>G	ENST00000371998.3	+	15	2986	c.2795C>G	c.(2794-2796)cCt>cGt	p.P932R	NCOA3_ENST00000372004.3_Missense_Mutation_p.P932R|NCOA3_ENST00000371997.3_Missense_Mutation_p.P927R|NCOA3_ENST00000341724.6_Missense_Mutation_p.P862R			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	932					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						AGAATGGAACCTATGAATTCA	0.493																																					p.P932R		.											.	NCOA3	229	0			c.C2795G						.						126.0	135.0	132.0					20																	46268408		2203	4300	6503	SO:0001583	missense	8202	exon15			TGGAACCTATGAA	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.2795C>G	20.37:g.46268408C>G	ENSP00000361066:p.Pro932Arg	102.0	0.0		161.0	46.0	NM_181659	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	ENST00000371998.3	37	CCDS13407.1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.801183	0.31869	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997	T;T;T;T	0.02525	4.26;4.62;4.63;4.31	5.89	4.88	0.63580	.	0.240010	0.36409	N	0.002616	T	0.05823	0.0152	M	0.61703	1.905	0.21897	N	0.999481	B;B;B;B;B;B	0.14805	0.005;0.006;0.011;0.005;0.008;0.005	B;B;B;B;B;B	0.15870	0.005;0.01;0.014;0.006;0.014;0.006	T	0.14448	-1.0472	10	0.51188	T	0.08	-8.9246	17.7823	0.88527	0.1305:0.8695:0.0:0.0	.	932;927;936;932;932;932	A8K0W8;Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;.;NCOA3_HUMAN	R	932;862;932;932;927	ENSP00000342123:P862R;ENSP00000361073:P932R;ENSP00000361066:P932R;ENSP00000361065:P927R	ENSP00000345671:P932R	P	+	2	0	NCOA3	45701815	0.076000	0.21285	0.381000	0.26106	0.795000	0.44927	3.505000	0.53356	2.782000	0.95742	0.557000	0.71058	CCT	.		0.493	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
NEU2	4759	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	233899058	233899058	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr2:233899058C>T	ENST00000233840.3	+	2	434	c.434C>T	c.(433-435)gCg>gTg	p.A145V		NM_005383.2	NP_005374.2	Q9Y3R4	NEUR2_HUMAN	sialidase 2 (cytosolic sialidase)	145			A -> T (in dbSNP:rs2233390).		ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)			endometrium(3)|large_intestine(2)|lung(10)|skin(2)|urinary_tract(1)	18		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)	Oseltamivir(DB00198)|Zanamivir(DB00558)	CTCACTGATGCGGCCATCGGC	0.667																																					p.A145V		.											.	NEU2	90	0			c.C434T						.						49.0	52.0	51.0					2																	233899058		2203	4300	6503	SO:0001583	missense	4759	exon2			CTGATGCGGCCAT	Y16535	CCDS2501.1	2q37	2008-05-27			ENSG00000115488	ENSG00000115488			7759	protein-coding gene	gene with protein product	"""N-acetyl-alpha-neuraminidase 2"""	605528				10191093, 14613940	Standard	NM_005383		Approved	SIAL2	uc010zmn.2	Q9Y3R4	OTTHUMG00000133274	ENST00000233840.3:c.434C>T	2.37:g.233899058C>T	ENSP00000233840:p.Ala145Val	81.0	1.0		45.0	30.0	NM_005383	Q3KNW4|Q6NTB4	Missense_Mutation	SNP	ENST00000233840.3	37	CCDS2501.1	.	.	.	.	.	.	.	.	.	.	C	4.070	0.010843	0.07912	.	.	ENSG00000115488	ENST00000233840	T	0.09538	2.97	4.88	4.0	0.46444	Neuraminidase (2);	1.189050	0.05969	N	0.642044	T	0.05181	0.0138	N	0.04508	-0.205	0.09310	N	1	B	0.23891	0.093	B	0.09377	0.004	T	0.36212	-0.9757	10	0.29301	T	0.29	-11.8089	4.0385	0.09740	0.1528:0.588:0.1693:0.09	.	145	Q9Y3R4	NEUR2_HUMAN	V	145	ENSP00000233840:A145V	ENSP00000233840:A145V	A	+	2	0	NEU2	233607302	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	0.305000	0.19254	1.036000	0.39998	0.561000	0.74099	GCG	.		0.667	NEU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257053.2	NM_005383	
NINL	22981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	25434223	25434223	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr20:25434223G>C	ENST00000278886.6	-	24	4086	c.4013C>G	c.(4012-4014)gCc>gGc	p.A1338G	NINL_ENST00000422516.1_Missense_Mutation_p.A989G|NINL_ENST00000464285.1_5'UTR	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1338					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CACCAGGTGGGCGTTCTCCAC	0.557																																					p.A1338G		.											.	NINL	94	0			c.C4013G						.						96.0	85.0	89.0					20																	25434223		2203	4300	6503	SO:0001583	missense	22981	exon24			AGGTGGGCGTTCT		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.4013C>G	20.37:g.25434223G>C	ENSP00000278886:p.Ala1338Gly	126.0	0.0		115.0	26.0	NM_025176	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	37	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.309595	0.60414	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.48201	0.82;0.82	4.89	3.92	0.45320	.	0.152963	0.41823	N	0.000808	T	0.67477	0.2897	M	0.80183	2.485	0.24110	N	0.995841	B;D;D	0.69078	0.412;0.983;0.997	B;D;D	0.66716	0.104;0.943;0.946	T	0.62364	-0.6870	10	0.49607	T	0.09	-12.3693	14.0661	0.64831	0.0:0.1525:0.8475:0.0	.	989;1338;129	Q9Y2I6-2;Q9Y2I6;Q9HAD5	.;NINL_HUMAN;.	G	1338;989	ENSP00000278886:A1338G;ENSP00000410431:A989G	ENSP00000278886:A1338G	A	-	2	0	NINL	25382223	1.000000	0.71417	0.962000	0.40283	0.113000	0.19764	5.303000	0.65738	1.263000	0.44181	0.655000	0.94253	GCC	.		0.557	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
NOG	9241	broad.mit.edu;mdanderson.org	37	17	54671633	54671633	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr17:54671633G>A	ENST00000332822.4	+	1	574	c.49G>A	c.(49-51)Gtc>Atc	p.V17I		NM_005450.4	NP_005441.1	Q13253	NOGG_HUMAN	noggin	17					axial mesoderm development (GO:0048318)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cell differentiation in hindbrain (GO:0021533)|cellular response to BMP stimulus (GO:0071773)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal system development (GO:0048706)|endoderm formation (GO:0001706)|epithelial to mesenchymal transition (GO:0001837)|face morphogenesis (GO:0060325)|fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060825)|in utero embryonic development (GO:0001701)|limb development (GO:0060173)|lung morphogenesis (GO:0060425)|mesoderm formation (GO:0001707)|middle ear morphogenesis (GO:0042474)|motor neuron axon guidance (GO:0008045)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell migration (GO:0030336)|negative regulation of cytokine activity (GO:0060302)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of glomerulus development (GO:0090193)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostatic bud formation (GO:0060513)|regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000313)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|somite development (GO:0061053)|spinal cord development (GO:0021510)|ureteric bud formation (GO:0060676)|wound healing (GO:0042060)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine binding (GO:0019955)|protein homodimerization activity (GO:0042803)			ovary(1)	1	Breast(9;5.24e-08)					CCTGGTGGTGGTCCTGGGGCT	0.726																																					p.V17I		.											.	NOG	90	0			c.G49A						.						12.0	14.0	13.0					17																	54671633		2199	4296	6495	SO:0001583	missense	9241	exon1			GTGGTGGTCCTGG	U31202	CCDS11589.1	17q22	2006-04-25	2003-03-12		ENSG00000183691	ENSG00000183691			7866	protein-coding gene	gene with protein product		602991	"""synostoses (multiple) syndrome 1"", ""symphalangism 1 (proximal)"""	SYNS1, SYM1		7666191, 10080184, 11545688	Standard	NM_005450		Approved		uc002iup.2	Q13253	OTTHUMG00000151770	ENST00000332822.4:c.49G>A	17.37:g.54671633G>A	ENSP00000328181:p.Val17Ile	41.0	0.0		52.0	11.0	NM_005450		Missense_Mutation	SNP	ENST00000332822.4	37	CCDS11589.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.078092	0.00375	.	.	ENSG00000183691	ENST00000332822	D	0.98060	-4.69	4.13	0.746	0.18365	.	0.638134	0.15290	N	0.270206	D	0.90338	0.6977	N	0.03608	-0.345	0.09310	N	1	B	0.16396	0.017	B	0.17098	0.017	T	0.82772	-0.0292	10	0.23302	T	0.38	-13.4118	8.2833	0.31913	0.0:0.3911:0.2536:0.3553	.	17	Q13253	NOGG_HUMAN	I	17	ENSP00000328181:V17I	ENSP00000328181:V17I	V	+	1	0	NOG	52026632	1.000000	0.71417	0.276000	0.24689	0.098000	0.18820	1.566000	0.36396	0.089000	0.17243	0.650000	0.86243	GTC	.		0.726	NOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323857.1	NM_005450	
PCDHA3	56145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140181914	140181914	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr5:140181914G>A	ENST00000522353.2	+	1	1132	c.1132G>A	c.(1132-1134)Gac>Aac	p.D378N	PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.D378N|PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	378	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.D378N(2)		NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCCGACCGCGACTCAGGAGT	0.493																																					p.D378N		.											.	PCDHA3	98	2	Substitution - Missense(2)	large_intestine(2)	c.G1132A						.						122.0	116.0	118.0					5																	140181914		2203	4300	6503	SO:0001583	missense	56145	exon1			GACCGCGACTCAG	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1132G>A	5.37:g.140181914G>A	ENSP00000429808:p.Asp378Asn	116.0	0.0		81.0	10.0	NM_031497	O75286	Missense_Mutation	SNP	ENST00000522353.2	37	CCDS54915.1	.	.	.	.	.	.	.	.	.	.	g	16.27	3.075079	0.55646	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.74002	-0.8;-0.8	4.79	4.79	0.61399	Cadherin (4);Cadherin-like (1);	0.000000	0.43579	U	0.000559	D	0.92721	0.7686	H	0.99391	4.545	0.46874	D	0.999235	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96159	0.9114	10	0.87932	D	0	.	18.1862	0.89793	0.0:0.0:1.0:0.0	.	378;378	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	N	378	ENSP00000429808:D378N;ENSP00000434086:D378N	ENSP00000429808:D378N	D	+	1	0	PCDHA3	140162098	1.000000	0.71417	0.656000	0.29637	0.011000	0.07611	9.869000	0.99810	2.378000	0.81104	0.467000	0.42956	GAC	.		0.493	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906	
PCNX	22990	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	71514665	71514666	+	Frame_Shift_Ins	INS	-	-	T	rs374611988		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr14:71514665_71514666insT	ENST00000304743.2	+	22	4748_4749	c.4302_4303insT	c.(4303-4305)ttgfs	p.L1435fs	PCNX_ENST00000439984.3_Frame_Shift_Ins_p.L1324fs|PCNX_ENST00000238570.5_Frame_Shift_Ins_p.L1435fs	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1435						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		AGACCATGCTGTTGGATCTCTT	0.356																																					p.L1434fs		.											.	PCNX	91	0			c.4302_4303insT						.																																			SO:0001589	frameshift_variant	22990	exon22			CATGCTGTTGGAT	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.4304dupT	14.37:g.71514667_71514667dupT	ENSP00000304192:p.Leu1435fs	63.0	0.0		74.0	13.0	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Frame_Shift_Ins	INS	ENST00000304743.2	37	CCDS9806.1																																																																																			.		0.356	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
PDE10A	10846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	165827145	165827145	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr6:165827145C>T	ENST00000366882.1	-	14	1246	c.1092G>A	c.(1090-1092)acG>acA	p.T364T	PDE10A_ENST00000354448.4_Silent_p.T364T|PDE10A_ENST00000539869.2_Silent_p.T374T			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	364	GAF 2.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	GGATGTTCCGCGTGGTGTAGC	0.483																																					p.T374T	Esophageal Squamous(22;308 615 5753 12038 40624)	.											.	PDE10A	519	0			c.G1122A						.						88.0	71.0	76.0					6																	165827145		2203	4300	6503	SO:0001819	synonymous_variant	10846	exon13			GTTCCGCGTGGTG	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1092G>A	6.37:g.165827145C>T		125.0	0.0		90.0	57.0	NM_001130690	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Silent	SNP	ENST00000366882.1	37																																																																																				.		0.483	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		
PDE8B	8622	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	76633096	76633096	+	Silent	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr5:76633096G>C	ENST00000264917.5	+	6	798	c.753G>C	c.(751-753)ctG>ctC	p.L251L	PDE8B_ENST00000333194.4_Silent_p.L251L|PDE8B_ENST00000340978.3_Silent_p.L251L|PDE8B_ENST00000342343.4_Silent_p.L231L|PDE8B_ENST00000346042.3_Silent_p.L251L	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B	251					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)		GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	ATAATGAACTGATTCAAATAG	0.318																																					p.L251L		.											.	PDE8B	90	0			c.G753C						.						66.0	66.0	66.0					5																	76633096		2203	4299	6502	SO:0001819	synonymous_variant	8622	exon6			TGAACTGATTCAA	AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.753G>C	5.37:g.76633096G>C		162.0	0.0		130.0	18.0	NM_001029852	Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	Silent	SNP	ENST00000264917.5	37	CCDS4037.1																																																																																			.		0.318	PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000220015.3	NM_003719	
POLA2	23649	ucsc.edu;bcgsc.ca	37	11	65062035	65062035	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr11:65062035G>A	ENST00000265465.3	+	15	1903	c.1372G>A	c.(1372-1374)Gag>Aag	p.E458K	POLA2_ENST00000541089.1_Missense_Mutation_p.E250K|POLA2_ENST00000534785.1_3'UTR	NM_002689.2	NP_002680.2	Q14181	DPOA2_HUMAN	polymerase (DNA directed), alpha 2, accessory subunit	458					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|protein import into nucleus, translocation (GO:0000060)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|protein heterodimerization activity (GO:0046982)			endometrium(1)|large_intestine(2)|lung(7)|urinary_tract(1)	11					Dacarbazine(DB00851)	GTTTGTGTCCGAGCCCTGCAG	0.483																																					p.E458K		.											.	POLA2	227	0			c.G1372A						.						115.0	106.0	110.0					11																	65062035		2201	4297	6498	SO:0001583	missense	23649	exon15			GTGTCCGAGCCCT	BC002990	CCDS8098.1	11q13	2012-05-18	2012-05-18		ENSG00000014138	ENSG00000014138		"""DNA polymerases"""	30073	protein-coding gene	gene with protein product	"""DNA polymerase alpha subunit B"", ""DNA polymerase alpha 70 kDa subunit"""		"""polymerase (DNA directed), alpha 2 (70kD subunit)"""			8223465, 11433027	Standard	NM_002689		Approved	FLJ21662	uc001odj.3	Q14181	OTTHUMG00000165951	ENST00000265465.3:c.1372G>A	11.37:g.65062035G>A	ENSP00000265465:p.Glu458Lys	70.0	0.0		43.0	5.0	NM_002689	B4DNB4|Q9BPV3	Missense_Mutation	SNP	ENST00000265465.3	37	CCDS8098.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.724763	0.68959	.	.	ENSG00000014138	ENST00000265465;ENST00000541089	T;T	0.30448	1.53;1.53	5.58	5.58	0.84498	DNA polymerase alpha/epsilon, subunit B (1);	0.092641	0.64402	D	0.000001	T	0.24509	0.0594	N	0.22421	0.69	0.58432	D	0.999998	P;P	0.52061	0.915;0.95	B;B	0.40864	0.254;0.342	T	0.03555	-1.1025	10	0.62326	D	0.03	-14.135	17.0613	0.86548	0.0:0.0:1.0:0.0	.	250;458	B4DNB4;Q14181	.;DPOA2_HUMAN	K	458;250	ENSP00000265465:E458K;ENSP00000443222:E250K	ENSP00000265465:E458K	E	+	1	0	POLA2	64818611	1.000000	0.71417	0.953000	0.39169	0.284000	0.27059	8.772000	0.91757	2.640000	0.89533	0.561000	0.74099	GAG	.		0.483	POLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387223.1	NM_002689	
POU6F2	11281	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	39472733	39472733	+	Missense_Mutation	SNP	G	G	A	rs535259814		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr7:39472733G>A	ENST00000403058.1	+	8	1238	c.1084G>A	c.(1084-1086)Ggc>Agc	p.G362S	POU6F2_ENST00000559001.1_Missense_Mutation_p.G307S|POU6F2_ENST00000518318.2_Missense_Mutation_p.G362S	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	362	Gln-rich.				central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						AGCAGCAAGCGGCACTCAGGG	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		16509	0.0		0.0	False		,,,				2504	0.001				p.G362S		.											.	POU6F2	90	0			c.G1084A						.						111.0	90.0	97.0					7																	39472733		2203	4300	6503	SO:0001583	missense	11281	exon8			GCAAGCGGCACTC	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.1084G>A	7.37:g.39472733G>A	ENSP00000384004:p.Gly362Ser	186.0	1.0		110.0	28.0	NM_007252	A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Missense_Mutation	SNP	ENST00000403058.1	37	CCDS34620.2	.	.	.	.	.	.	.	.	.	.	G	13.85	2.361248	0.41801	.	.	ENSG00000106536	ENST00000403058;ENST00000518318	D;D	0.85013	-1.91;-1.93	5.97	1.19	0.21007	.	0.521868	0.17393	N	0.175853	T	0.77598	0.4154	L	0.47716	1.5	0.35109	D	0.765987	B	0.18166	0.026	B	0.10450	0.005	T	0.68503	-0.5391	10	0.19590	T	0.45	.	10.6284	0.45521	0.3096:0.0:0.6904:0.0	.	362	P78424	PO6F2_HUMAN	S	362	ENSP00000384004:G362S;ENSP00000430514:G362S	ENSP00000384004:G362S	G	+	1	0	POU6F2	39439258	1.000000	0.71417	0.055000	0.19348	0.386000	0.30323	4.191000	0.58372	-0.053000	0.13289	-0.133000	0.14855	GGC	.		0.597	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252	
PPM1E	22843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	57046925	57046925	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr17:57046925C>T	ENST00000308249.2	+	4	938	c.809C>T	c.(808-810)gCa>gTa	p.A270V	RP11-579O24.3_ENST00000582080.1_RNA	NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0					protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			GCTTACTTTGCAGTGTTTGAT	0.468																																					p.A270V		.											.	PPM1E	291	0			c.C809T						.						180.0	147.0	158.0					17																	57046925		2203	4300	6503	SO:0001583	missense	22843	exon4			ACTTTGCAGTGTT	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.809C>T	17.37:g.57046925C>T	ENSP00000312411:p.Ala270Val	141.0	0.0		175.0	27.0	NM_014906	Q8N8J9|Q96DB8	Missense_Mutation	SNP	ENST00000308249.2	37	CCDS11613.1	.	.	.	.	.	.	.	.	.	.	C	31	5.077124	0.94000	.	.	ENSG00000175175	ENST00000308249;ENST00000443121	T	0.11277	2.79	5.49	5.49	0.81192	.	0.046830	0.85682	D	0.000000	T	0.45975	0.1369	M	0.92738	3.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	T	0.57294	-0.7836	10	0.87932	D	0	-22.1143	19.7268	0.96166	0.0:1.0:0.0:0.0	.	279;270	Q8WY54-3;Q8WY54-2	.;.	V	270;121	ENSP00000312411:A270V	ENSP00000312411:A270V	A	+	2	0	PPM1E	54401707	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.017000	0.70805	2.727000	0.93392	0.563000	0.77884	GCA	.		0.468	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
PSMF1	9491	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	1145687	1145687	+	Missense_Mutation	SNP	A	A	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr20:1145687A>C	ENST00000335877.6	+	7	955	c.779A>C	c.(778-780)cAt>cCt	p.H260P	PSMF1_ENST00000333082.3_Missense_Mutation_p.H260P|PSMF1_ENST00000484891.1_3'UTR|PSMF1_ENST00000438768.2_Intron|PSMF1_ENST00000246015.4_Intron|PSMF1_ENST00000381898.4_Intron	NM_006814.3	NP_006805.2	Q92530	PSMF1_HUMAN	proteasome (prosome, macropain) inhibitor subunit 1 (PI31)	260	Pro-rich.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteasomal protein catabolic process (GO:1901799)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome core complex (GO:0005839)	endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)	13						AACCCAGACCATCTCCCCCCG	0.582																																					p.H260P		.											.	PSMF1	90	0			c.A779C						.						191.0	163.0	172.0					20																	1145687		2203	4300	6503	SO:0001583	missense	9491	exon7			CAGACCATCTCCC	D88378	CCDS13010.1	20p13	2008-07-02			ENSG00000125818	ENSG00000125818		"""Proteasome (prosome, macropain) subunits"""	9571	protein-coding gene	gene with protein product	"""proteasome inhibitor hP131 subunit"""					10363639	Standard	NM_006814		Approved	PI31	uc002wen.4	Q92530	OTTHUMG00000031656	ENST00000335877.6:c.779A>C	20.37:g.1145687A>C	ENSP00000338039:p.His260Pro	75.0	1.0		111.0	66.0	NM_006814	A0AVQ9|D3DVW3|Q9H4I1	Missense_Mutation	SNP	ENST00000335877.6	37	CCDS13010.1	.	.	.	.	.	.	.	.	.	.	A	16.13	3.035769	0.54896	.	.	ENSG00000125818	ENST00000333082;ENST00000454500;ENST00000335877	T;T	0.40476	1.03;1.03	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.61825	0.2378	M	0.67569	2.06	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.994;0.998	T	0.64377	-0.6422	10	0.62326	D	0.03	-11.4847	13.0559	0.58980	1.0:0.0:0.0:0.0	.	172;260	B4DUJ0;Q92530	.;PSMF1_HUMAN	P	260;154;260	ENSP00000327704:H260P;ENSP00000338039:H260P	ENSP00000327704:H260P	H	+	2	0	PSMF1	1093687	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.960000	0.76036	2.271000	0.75665	0.459000	0.35465	CAT	.		0.582	PSMF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077504.2	NM_178578	
PVR	5817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	45150523	45150523	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:45150523G>C	ENST00000425690.3	+	2	407	c.108G>C	c.(106-108)caG>caC	p.Q36H	PVR_ENST00000403059.4_Missense_Mutation_p.Q36H|PVR_ENST00000344956.4_Missense_Mutation_p.Q36H|CTB-171A8.1_ENST00000590796.1_RNA|PVR_ENST00000406449.4_Missense_Mutation_p.Q36H	NM_006505.3	NP_006496.3	P15151	PVR_HUMAN	poliovirus receptor	36	Ig-like V-type.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|receptor activity (GO:0004872)			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	6	Lung NSC(12;0.00608)|all_lung(12;0.0148)	Medulloblastoma(540;0.0425)|Ovarian(192;0.0728)|Prostate(69;0.081)|all_neural(266;0.112)		Epithelial(262;0.000601)		CGCCCACCCAGGTGCCCGGCT	0.652																																					p.Q36H		.											.	PVR	90	0			c.G108C						.						12.0	12.0	12.0					19																	45150523		2179	4262	6441	SO:0001583	missense	5817	exon2			CACCCAGGTGCCC	BC015542	CCDS12640.1, CCDS46105.1, CCDS46106.1, CCDS46107.1	19q13.2	2013-01-29			ENSG00000073008	ENSG00000073008		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9705	protein-coding gene	gene with protein product	"""nectin-like 5"""	173850		PVS		2170108	Standard	XM_005259120		Approved	CD155, HVED, Necl-5, NECL5, Tage4	uc002ozm.3	P15151	OTTHUMG00000151527	ENST00000425690.3:c.108G>C	19.37:g.45150523G>C	ENSP00000402060:p.Gln36His	67.0	0.0		83.0	12.0	NM_001135769	B4DTS9|P15152|Q15267|Q15268|Q96BJ1	Missense_Mutation	SNP	ENST00000425690.3	37	CCDS12640.1	.	.	.	.	.	.	.	.	.	.	G	15.16	2.752036	0.49362	.	.	ENSG00000073008	ENST00000344956;ENST00000425690;ENST00000406449;ENST00000403059	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	4.79	-1.49	0.08718	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.438380	0.04845	N	0.441376	T	0.70579	0.3240	M	0.66939	2.045	0.09310	N	1	D;D;D;D	0.76494	0.999;0.991;0.991;0.992	D;D;D;D	0.71870	0.972;0.972;0.958;0.975	T	0.54918	-0.8221	10	0.40728	T	0.16	.	0.7982	0.01070	0.2916:0.1557:0.3815:0.1713	.	36;36;36;36	P15151-2;P15151-3;P15151-4;P15151	.;.;.;PVR_HUMAN	H	36	ENSP00000340870:Q36H;ENSP00000402060:Q36H;ENSP00000383907:Q36H;ENSP00000385344:Q36H	ENSP00000340870:Q36H	Q	+	3	2	PVR	49842363	0.107000	0.21998	0.000000	0.03702	0.054000	0.15201	0.374000	0.20501	-0.475000	0.06852	-0.373000	0.07131	CAG	.		0.652	PVR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323017.2	NM_006505	
RNF213	57674	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	78319225	78319225	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr17:78319225G>A	ENST00000582970.1	+	29	7233	c.7090G>A	c.(7090-7092)Gac>Aac	p.D2364N	RNF213_ENST00000508628.2_Missense_Mutation_p.D2413N|RNF213_ENST00000336301.6_Missense_Mutation_p.D437N	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	2364					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D2413N(1)|p.D437N(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CTTCAATGTCGACTTTGATAA	0.552																																					p.D2364N		.											.	RNF213	577	2	Substitution - Missense(2)	large_intestine(2)	c.G7090A						.						68.0	67.0	68.0					17																	78319225		2203	4300	6503	SO:0001583	missense	57674	exon29			AATGTCGACTTTG	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.7090G>A	17.37:g.78319225G>A	ENSP00000464087:p.Asp2364Asn	67.0	1.0		82.0	31.0	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	G	5.617	0.298637	0.10622	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.21361	2.01	5.01	0.769	0.18492	.	0.211870	0.38548	N	0.001643	T	0.10465	0.0256	L	0.28054	0.825	0.20926	N	0.99982	B	0.16166	0.016	B	0.20767	0.031	T	0.26258	-1.0108	10	0.16896	T	0.51	.	3.5721	0.07921	0.2694:0.106:0.5163:0.1084	.	437	Q63HN8	RN213_HUMAN	N	2364;2413;437	ENSP00000338218:D437N	ENSP00000338218:D437N	D	+	1	0	RNF213	75933820	0.096000	0.21769	0.361000	0.25849	0.086000	0.17979	0.370000	0.20433	0.372000	0.24591	0.655000	0.94253	GAC	.		0.552	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	237540701	237540702	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:237540701_237540702insCA	ENST00000366574.2	+	8	859_860	c.542_543insCA	c.(541-546)ctcatcfs	p.I182fs	RYR2_ENST00000542537.1_Frame_Shift_Ins_p.I166fs|RYR2_ENST00000360064.6_Frame_Shift_Ins_p.I180fs	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	182	MIR 2. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGAGATGACCTCATCTTAGTTA	0.436																																					p.L181fs		.											.	RYR2	158	0			c.542_543insCA						.																																			SO:0001589	frameshift_variant	6262	exon8			ATGACCTCATCTT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.543_544dupCA	1.37:g.237540702_237540703dupCA	ENSP00000355533:p.Ile182fs	74.0	0.0		87.0	18.0	NM_001035	Q15411|Q546N8|Q5T3P2	Frame_Shift_Ins	INS	ENST00000366574.2	37	CCDS55691.1																																																																																			.		0.436	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
SEMA5B	54437	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	122632773	122632773	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr3:122632773C>T	ENST00000357599.3	-	15	2450	c.2064G>A	c.(2062-2064)caG>caA	p.Q688Q	SEMA5B_ENST00000195173.4_Silent_p.Q688Q|SEMA5B_ENST00000451055.2_Silent_p.Q742Q	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	688	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		TGCAACTTCGCTGGCGGACCT	0.682																																					p.Q742Q		.											.	SEMA5B	157	0			c.G2226A						.						39.0	43.0	42.0					3																	122632773		2203	4299	6502	SO:0001819	synonymous_variant	54437	exon15			ACTTCGCTGGCGG	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2064G>A	3.37:g.122632773C>T		36.0	0.0		37.0	5.0	NM_001256347	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Silent	SNP	ENST00000357599.3	37	CCDS35491.1																																																																																			.		0.682	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
SORCS3	22986	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	106976760	106976760	+	Missense_Mutation	SNP	T	T	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr10:106976760T>G	ENST00000369701.3	+	19	2841	c.2614T>G	c.(2614-2616)Ttc>Gtc	p.F872V	SORCS3_ENST00000369699.4_Missense_Mutation_p.F158V	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	872	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CTACGCAAACTTCAGCCCCAT	0.512																																					p.F872V	NSCLC(116;1497 1690 7108 13108 14106)	.											.	SORCS3	99	0			c.T2614G						.						164.0	124.0	137.0					10																	106976760		2203	4300	6503	SO:0001583	missense	22986	exon19			GCAAACTTCAGCC	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2614T>G	10.37:g.106976760T>G	ENSP00000358715:p.Phe872Val	82.0	0.0		104.0	19.0	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	T	15.42	2.828444	0.50845	.	.	ENSG00000156395	ENST00000369701;ENST00000369699	T;T	0.60299	0.2;0.2	5.87	5.87	0.94306	PKD domain (4);	0.058143	0.64402	D	0.000001	T	0.44286	0.1286	N	0.19112	0.55	0.50039	D	0.999841	B	0.14012	0.009	B	0.20577	0.03	T	0.31779	-0.9931	9	.	.	.	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	872	Q9UPU3	SORC3_HUMAN	V	872;158	ENSP00000358715:F872V;ENSP00000358713:F158V	.	F	+	1	0	SORCS3	106966750	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.669000	0.46825	2.371000	0.80710	0.533000	0.62120	TTC	.		0.512	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
SORCS1	114815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	108412294	108412294	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr10:108412294G>A	ENST00000263054.6	-	18	2328	c.2321C>T	c.(2320-2322)tCc>tTc	p.S774F	SORCS1_ENST00000369698.1_Missense_Mutation_p.S309F|SORCS1_ENST00000344440.6_Missense_Mutation_p.S774F	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	774					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GCAATTATTGGAAACCACCTT	0.468																																					p.S774F		.											.	SORCS1	153	0			c.C2321T						.						112.0	106.0	108.0					10																	108412294		2203	4300	6503	SO:0001583	missense	114815	exon18			TTATTGGAAACCA	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2321C>T	10.37:g.108412294G>A	ENSP00000263054:p.Ser774Phe	84.0	0.0		100.0	49.0	NM_001206572	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482881	0.84747	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.67523	-0.27;-0.27;-0.27	5.74	5.74	0.90152	VPS10 (1);PKD domain (1);	0.000000	0.85682	D	0.000000	T	0.81735	0.4885	M	0.75777	2.31	0.45979	D	0.998792	D;D;D;D;D	0.58620	0.972;0.983;0.983;0.972;0.983	P;D;D;P;D	0.65684	0.825;0.937;0.915;0.866;0.937	T	0.80571	-0.1323	9	.	.	.	-16.8758	19.9145	0.97053	0.0:0.0:1.0:0.0	.	774;774;774;774;774	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	F	309;774;774	ENSP00000358712:S309F;ENSP00000263054:S774F;ENSP00000345964:S774F	.	S	-	2	0	SORCS1	108402284	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.448000	0.80631	2.709000	0.92574	0.655000	0.94253	TCC	.		0.468	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
ST6GALNAC3	256435	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	77093235	77093235	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:77093235delC	ENST00000328299.3	+	4	870	c.722delC	c.(721-723)accfs	p.T241fs		NM_152996.2	NP_694541.2	Q8NDV1	SIA7C_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3	241					glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sialyltransferase activity (GO:0008373)	p.T241I(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|ovary(3)|prostate(1)|skin(2)	36						ATAAATGACACCTACTGCAAG	0.403																																					p.T241fs		.											.	ST6GALNAC3	95	1	Substitution - Missense(1)	lung(1)	c.722delC						.						155.0	149.0	151.0					1																	77093235		2203	4300	6503	SO:0001589	frameshift_variant	256435	exon4			ATGACACCTACTG		CCDS672.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000184005	ENSG00000184005		"""Sialyltransferases"""	19343	protein-coding gene	gene with protein product	"""ST6GALNAC III"""	610133	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) C"""	SIAT7C			Standard	NM_152996		Approved		uc001dhh.2	Q8NDV1	OTTHUMG00000009615	ENST00000328299.3:c.722delC	1.37:g.77093235delC	ENSP00000329214:p.Thr241fs	31.0	0.0		31.0	11.0	NM_152996	Q6PCE0|Q6UX29|Q8N259	Frame_Shift_Del	DEL	ENST00000328299.3	37	CCDS672.1																																																																																			.		0.403	ST6GALNAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026501.1	NM_152996	
SPTA1	6708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158637739	158637739	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr1:158637739C>T	ENST00000368147.4	-	15	2127	c.1947G>A	c.(1945-1947)gaG>gaA	p.E649E		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	649					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AGTGACCACCCTCAATCATCT	0.468																																					p.E649E		.											.	SPTA1	142	0			c.G1947A						.						150.0	144.0	146.0					1																	158637739		1871	4099	5970	SO:0001819	synonymous_variant	6708	exon15			ACCACCCTCAATC	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1947G>A	1.37:g.158637739C>T		79.0	0.0		106.0	72.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	CCDS41423.1																																																																																			.		0.468	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
SUGP2	10147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19136612	19136612	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr19:19136612T>C	ENST00000601879.1	-	3	842	c.545A>G	c.(544-546)gAg>gGg	p.E182G	SUGP2_ENST00000598202.1_5'UTR|SUGP2_ENST00000600377.1_Missense_Mutation_p.E196G|SUGP2_ENST00000456085.2_Intron|SUGP2_ENST00000452918.2_Missense_Mutation_p.E182G|SUGP2_ENST00000337018.6_Missense_Mutation_p.E182G			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	182					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CTCCAAACACTCTTTCTCAAT	0.537																																					p.E182G		.											.	SUGP2	91	0			c.A545G						.						104.0	92.0	96.0					19																	19136612		2203	4300	6503	SO:0001583	missense	10147	exon3			AAACACTCTTTCT	AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.545A>G	19.37:g.19136612T>C	ENSP00000472286:p.Glu182Gly	140.0	0.0		561.0	96.0	NM_014884	C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Missense_Mutation	SNP	ENST00000601879.1	37	CCDS12392.1	.	.	.	.	.	.	.	.	.	.	T	17.61	3.432609	0.62844	.	.	ENSG00000064607	ENST00000337018;ENST00000330854;ENST00000452918	T;T;T	0.12255	2.7;2.7;2.7	4.93	4.93	0.64822	.	0.522677	0.17456	N	0.173602	T	0.23611	0.0571	N	0.24115	0.695	0.80722	D	1	D;D	0.71674	0.998;0.964	D;P	0.78314	0.991;0.637	T	0.02728	-1.1118	10	0.87932	D	0	-15.9326	12.3088	0.54918	0.0:0.0:0.0:1.0	.	182;182	A8K5G0;Q8IX01	.;SUGP2_HUMAN	G	182	ENSP00000337926:E182G;ENSP00000332373:E182G;ENSP00000389380:E182G	ENSP00000332373:E182G	E	-	2	0	SUGP2	18997612	0.996000	0.38824	0.988000	0.46212	0.920000	0.55202	4.243000	0.58721	1.860000	0.53959	0.260000	0.18958	GAG	.		0.537	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464627.1	NM_001017392	
TBX1	6899	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	19751710	19751710	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr22:19751710C>T	ENST00000329705.7	+	5	674	c.545C>T	c.(544-546)gCg>gTg	p.A182V	TBX1_ENST00000359500.3_Missense_Mutation_p.A182V|TBX1_ENST00000332710.4_Missense_Mutation_p.A182V	NM_080646.1	NP_542377.1	O43435	TBX1_HUMAN	T-box 1	182					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|aorta morphogenesis (GO:0035909)|artery morphogenesis (GO:0048844)|blood vessel development (GO:0001568)|blood vessel morphogenesis (GO:0048514)|blood vessel remodeling (GO:0001974)|cell fate specification (GO:0001708)|cell proliferation (GO:0008283)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|coronary artery morphogenesis (GO:0060982)|determination of left/right symmetry (GO:0007368)|ear morphogenesis (GO:0042471)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic viscerocranium morphogenesis (GO:0048703)|enamel mineralization (GO:0070166)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|lymph vessel development (GO:0001945)|mesenchymal cell apoptotic process (GO:0097152)|mesoderm development (GO:0007498)|middle ear morphogenesis (GO:0042474)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle organ morphogenesis (GO:0048644)|muscle tissue morphogenesis (GO:0060415)|negative regulation of cell differentiation (GO:0045596)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|parathyroid gland development (GO:0060017)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of tongue muscle cell differentiation (GO:2001037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of organ morphogenesis (GO:2000027)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retinoic acid receptor signaling pathway (GO:0048384)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|social behavior (GO:0035176)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|tongue morphogenesis (GO:0043587)|transcription, DNA-templated (GO:0006351)|vagus nerve morphogenesis (GO:0021644)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|lung(3)|ovary(2)	8	Colorectal(54;0.0993)	all_lung(157;3.05e-06)				TGGCTGGTGGCGGGGAAGGCC	0.677																																					p.A182V		.											.	TBX1	154	0			c.C545T						.						42.0	33.0	36.0					22																	19751710		2198	4291	6489	SO:0001583	missense	6899	exon5			TGGTGGCGGGGAA	AF012131	CCDS13765.1, CCDS13766.1, CCDS13767.1	22q11.21	2014-09-17			ENSG00000184058	ENSG00000184058		"""T-boxes"""	11592	protein-coding gene	gene with protein product		602054	"""velocardiofacial syndrome"""	VCF		9268629, 23000736	Standard	NM_080646		Approved	CATCH22	uc002zqa.1	O43435	OTTHUMG00000150421	ENST00000329705.7:c.545C>T	22.37:g.19751710C>T	ENSP00000331176:p.Ala182Val	63.0	2.0		55.0	28.0	NM_080647	C6G493|C6G494|O43436|Q96RJ2	Missense_Mutation	SNP	ENST00000329705.7	37	CCDS13766.1	.	.	.	.	.	.	.	.	.	.	C	35	5.537795	0.96460	.	.	ENSG00000184058	ENST00000332710;ENST00000329705;ENST00000359500	D;D;D	0.89681	-2.55;-2.55;-2.55	4.75	4.75	0.60458	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.94978	0.8375	M	0.87617	2.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.70227	0.968;0.956;0.879	D	0.95940	0.8946	10	0.87932	D	0	.	17.418	0.87506	0.0:1.0:0.0:0.0	.	182;182;182	Q152R5;O43435;D9ZGG0	.;TBX1_HUMAN;.	V	182	ENSP00000331791:A182V;ENSP00000331176:A182V;ENSP00000352483:A182V	ENSP00000331176:A182V	A	+	2	0	TBX1	18131710	1.000000	0.71417	0.932000	0.37286	0.791000	0.44710	5.873000	0.69644	2.206000	0.71126	0.558000	0.71614	GCG	.		0.677	TBX1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318033.1	NM_080647	
TCF20	6942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	42610029	42610029	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr22:42610029G>C	ENST00000359486.3	-	1	1419	c.1283C>G	c.(1282-1284)cCt>cGt	p.P428R	TCF20_ENST00000335626.4_Missense_Mutation_p.P428R	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	428					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						ATGAGAATTAGGACTGGGCAT	0.478																																					p.P428R		.											.	TCF20	95	0			c.C1283G						.						129.0	128.0	128.0					22																	42610029		2203	4300	6503	SO:0001583	missense	6942	exon1			GAATTAGGACTGG	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.1283C>G	22.37:g.42610029G>C	ENSP00000352463:p.Pro428Arg	119.0	0.0		111.0	26.0	NM_181492	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	37	CCDS14033.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.006874	0.54361	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.32988	1.43;1.43	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000005	T	0.50548	0.1622	L	0.46157	1.445	0.80722	D	1	D;D	0.71674	0.998;0.996	D;P	0.67382	0.951;0.895	T	0.38415	-0.9662	10	0.66056	D	0.02	-14.8461	19.0599	0.93085	0.0:0.0:1.0:0.0	.	428;428	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	R	428	ENSP00000352463:P428R;ENSP00000335561:P428R	ENSP00000335561:P428R	P	-	2	0	TCF20	40939973	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.227000	0.65305	2.941000	0.99782	0.655000	0.94253	CCT	.		0.478	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492	
TEX15	56154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	30705184	30705184	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr8:30705184C>A	ENST00000256246.2	-	1	1424	c.1350G>T	c.(1348-1350)agG>agT	p.R450S	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	450					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GATCCTGACCCCTATCTTCAA	0.333																																					p.R450S		.											.	TEX15	97	0			c.G1350T						.						178.0	176.0	177.0					8																	30705184		2203	4299	6502	SO:0001583	missense	56154	exon1			CTGACCCCTATCT	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1350G>T	8.37:g.30705184C>A	ENSP00000256246:p.Arg450Ser	101.0	0.0		64.0	47.0	NM_031271		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.664268	0.29604	.	.	ENSG00000133863	ENST00000256246	T	0.10192	2.9	5.51	-4.84	0.03151	.	1.145370	0.06457	N	0.728725	T	0.04272	0.0118	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.42732	-0.9434	10	0.87932	D	0	.	0.5054	0.00587	0.3815:0.1853:0.2462:0.187	.	450	Q9BXT5	TEX15_HUMAN	S	450	ENSP00000256246:R450S	ENSP00000256246:R450S	R	-	3	2	TEX15	30824726	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.172000	0.09868	-0.498000	0.06632	-0.300000	0.09419	AGG	.		0.333	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
TFAP2D	83741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	50683121	50683121	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr6:50683121C>T	ENST00000008391.3	+	2	560	c.332C>T	c.(331-333)aCc>aTc	p.T111I		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					GGGGAGCCCACCGACTTTATT	0.632																																					p.T111I		.											.	TFAP2D	159	0			c.C332T						.						106.0	98.0	100.0					6																	50683121		2203	4300	6503	SO:0001583	missense	83741	exon2			AGCCCACCGACTT	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.332C>T	6.37:g.50683121C>T	ENSP00000008391:p.Thr111Ile	113.0	0.0		91.0	55.0	NM_172238		Missense_Mutation	SNP	ENST00000008391.3	37	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	C	13.25	2.180237	0.38511	.	.	ENSG00000008197	ENST00000008391	D	0.97232	-4.3	5.21	5.21	0.72293	.	0.163968	0.56097	D	0.000039	D	0.88716	0.6512	N	0.08118	0	0.48135	D	0.99959	B	0.19583	0.037	B	0.17098	0.017	D	0.85264	0.1052	10	0.39692	T	0.17	-19.3103	15.4919	0.75611	0.0:0.8614:0.1386:0.0	.	111	Q7Z6R9	AP2D_HUMAN	I	111	ENSP00000008391:T111I	ENSP00000008391:T111I	T	+	2	0	TFAP2D	50791080	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.833000	0.69349	2.590000	0.87494	0.655000	0.94253	ACC	.		0.632	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238	
TLL1	7092	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	166976398	166976398	+	Silent	SNP	A	A	G			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr4:166976398A>G	ENST00000061240.2	+	13	2342	c.1695A>G	c.(1693-1695)gcA>gcG	p.A565A	TLL1_ENST00000507499.1_Silent_p.A588A|RNA5SP170_ENST00000517150.1_RNA	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	565	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TGAACAAAGCAGGGTTTGCTG	0.358																																					p.A565A		.											.	TLL1	158	0			c.A1695G						.						105.0	102.0	103.0					4																	166976398		2203	4300	6503	SO:0001819	synonymous_variant	7092	exon13			CAAAGCAGGGTTT	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.1695A>G	4.37:g.166976398A>G		119.0	1.0		106.0	44.0	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Silent	SNP	ENST00000061240.2	37	CCDS3811.1																																																																																			.		0.358	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
TMEM246	84302	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	104238798	104238798	+	Missense_Mutation	SNP	A	A	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr9:104238798A>C	ENST00000374851.1	-	4	1724	c.577T>G	c.(577-579)Tat>Gat	p.Y193D	TMEM246_ENST00000374847.1_Missense_Mutation_p.Y193D|RP11-490D19.6_ENST00000425734.1_RNA|RP11-490D19.6_ENST00000424154.1_RNA|TMEM246_ENST00000374848.3_Missense_Mutation_p.Y193D|RP11-490D19.6_ENST00000450109.1_RNA|RP11-490D19.6_ENST00000431507.1_RNA			Q9BRR3	TM246_HUMAN	transmembrane protein 246	193						integral component of membrane (GO:0016021)											TCCAGGCAATAGACATAGTCC	0.502																																					p.Y193D		.											.	.	.	0			c.T577G						.						100.0	80.0	87.0					9																	104238798		2203	4300	6503	SO:0001583	missense	84302	exon2			GGCAATAGACATA	BC006115	CCDS6757.1	9q31.1	2012-04-02	2012-04-02	2012-04-02	ENSG00000165152	ENSG00000165152			28180	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 125"""	C9orf125		12477932	Standard	NM_032342		Approved	MGC12992	uc004bbm.3	Q9BRR3	OTTHUMG00000020381	ENST00000374851.1:c.577T>G	9.37:g.104238798A>C	ENSP00000363984:p.Tyr193Asp	94.0	0.0		81.0	19.0	NM_032342	Q49AQ4	Missense_Mutation	SNP	ENST00000374851.1	37	CCDS6757.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.211481	0.79240	.	.	ENSG00000165152	ENST00000374848;ENST00000374847;ENST00000374851	.	.	.	5.95	5.95	0.96441	.	0.059762	0.64402	D	0.000002	T	0.62085	0.2399	L	0.43152	1.355	0.48452	D	0.999653	D	0.60160	0.987	P	0.52217	0.693	T	0.65849	-0.6068	9	0.87932	D	0	-11.3887	15.587	0.76491	1.0:0.0:0.0:0.0	.	193	Q9BRR3	CI125_HUMAN	D	193	.	ENSP00000363980:Y193D	Y	-	1	0	C9orf125	103278619	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.005000	0.93587	2.266000	0.75297	0.528000	0.53228	TAT	.		0.502	TMEM246-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053444.1	NM_032342	
TRIM60	166655	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	165962556	165962556	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr4:165962556C>T	ENST00000512596.1	+	3	1548	c.1332C>T	c.(1330-1332)ttC>ttT	p.F444F	TRIM60_ENST00000508504.1_Silent_p.F444F|TRIM60_ENST00000341062.5_Silent_p.F444F	NM_152620.2	NP_689833.1	Q495X7	TRI60_HUMAN	tripartite motif containing 60	444	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	29	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		ACGATTGTTTCACAGAAGCCG	0.348																																					p.F444F		.											.	TRIM60	226	0			c.C1332T						.						63.0	69.0	67.0					4																	165962556		2202	4300	6502	SO:0001819	synonymous_variant	166655	exon4			TTGTTTCACAGAA	AK093201	CCDS3808.1	4q32.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000176979	ENSG00000176979		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21162	protein-coding gene	gene with protein product			"""ring finger protein 129"", ""tripartite motif-containing 60"""	RNF129, RNF33			Standard	NM_152620		Approved	FLJ35882	uc003iqy.1	Q495X7	OTTHUMG00000161262	ENST00000512596.1:c.1332C>T	4.37:g.165962556C>T		82.0	1.0		82.0	18.0	NM_001258025	Q8NA35	Silent	SNP	ENST00000512596.1	37	CCDS3808.1																																																																																			.		0.348	TRIM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364325.1	NM_152620	
TRIM60	166655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	165962559	165962559	+	Silent	SNP	A	A	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr4:165962559A>T	ENST00000512596.1	+	3	1551	c.1335A>T	c.(1333-1335)acA>acT	p.T445T	TRIM60_ENST00000508504.1_Silent_p.T445T|TRIM60_ENST00000341062.5_Silent_p.T445T	NM_152620.2	NP_689833.1	Q495X7	TRI60_HUMAN	tripartite motif containing 60	445	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.			T -> I (in Ref. 2; AAI00986). {ECO:0000305}.		intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	29	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		ATTGTTTCACAGAAGCCGTTT	0.348																																					p.T445T		.											.	TRIM60	226	0			c.A1335T						.						63.0	68.0	66.0					4																	165962559		2202	4300	6502	SO:0001819	synonymous_variant	166655	exon4			TTTCACAGAAGCC	AK093201	CCDS3808.1	4q32.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000176979	ENSG00000176979		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21162	protein-coding gene	gene with protein product			"""ring finger protein 129"", ""tripartite motif-containing 60"""	RNF129, RNF33			Standard	NM_152620		Approved	FLJ35882	uc003iqy.1	Q495X7	OTTHUMG00000161262	ENST00000512596.1:c.1335A>T	4.37:g.165962559A>T		84.0	0.0		82.0	20.0	NM_001258025	Q8NA35	Silent	SNP	ENST00000512596.1	37	CCDS3808.1																																																																																			.		0.348	TRIM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364325.1	NM_152620	
UNC79	57578	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	94155051	94155051	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr14:94155051C>A	ENST00000393151.2	+	45	7067	c.7067C>A	c.(7066-7068)aCc>aAc	p.T2356N	UNC79_ENST00000553484.1_Missense_Mutation_p.T2378N|UNC79_ENST00000555664.1_Missense_Mutation_p.T2317N|UNC79_ENST00000256339.4_Missense_Mutation_p.T2179N			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2356					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CATGAAGATACCTTTGGGGGA	0.502																																					p.T2179N		.											.	.	.	0			c.C6536A						.						88.0	83.0	85.0					14																	94155051		2203	4300	6503	SO:0001583	missense	57578	exon45			AAGATACCTTTGG	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.7067C>A	14.37:g.94155051C>A	ENSP00000376858:p.Thr2356Asn	109.0	0.0		32.0	10.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	C	29.6	5.021160	0.93462	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.27402	1.67;1.72;1.67;1.67	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.56761	0.2007	M	0.67397	2.05	0.58432	D	0.999999	D	0.65815	0.995	D	0.73708	0.981	T	0.57470	-0.7806	10	0.87932	D	0	-9.4875	19.7917	0.96461	0.0:1.0:0.0:0.0	.	2378	C9JQL1	.	N	2179;2317;2378;2356;2378	ENSP00000256339:T2179N;ENSP00000450868:T2317N;ENSP00000451360:T2378N;ENSP00000376858:T2356N	ENSP00000256339:T2179N	T	+	2	0	KIAA1409	93224804	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.756000	0.85195	2.755000	0.94549	0.561000	0.74099	ACC	.		0.502	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
XIRP2	129446	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	168105658	168105658	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr2:168105658G>C	ENST00000409195.1	+	9	7845	c.7756G>C	c.(7756-7758)Gaa>Caa	p.E2586Q	XIRP2_ENST00000409273.1_Missense_Mutation_p.E2364Q|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.E2586Q|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2411					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GGTGGAAAAGGAAATGCCATT	0.383																																					p.E2586Q		.											.	XIRP2	104	0			c.G7756C						.						97.0	91.0	93.0					2																	168105658		1838	4082	5920	SO:0001583	missense	129446	exon9			GAAAAGGAAATGC	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.7756G>C	2.37:g.168105658G>C	ENSP00000386840:p.Glu2586Gln	219.0	1.0		260.0	42.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.153195	0.38021	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02812	4.15;4.15;4.15	5.4	0.0316	0.14171	.	0.671360	0.14930	N	0.290142	T	0.03564	0.0102	L	0.57536	1.79	0.09310	N	1	B;B;B	0.12013	0.003;0.005;0.005	B;B;B	0.12156	0.003;0.007;0.007	T	0.33523	-0.9865	10	0.51188	T	0.08	-8.973	6.4753	0.22033	0.2352:0.3672:0.3976:0.0	.	2411;2411;2364	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	Q	2586;2586;2364	ENSP00000386840:E2586Q;ENSP00000295237:E2586Q;ENSP00000387255:E2364Q	ENSP00000295237:E2586Q	E	+	1	0	XIRP2	167813904	0.087000	0.21565	0.618000	0.29105	0.359000	0.29487	0.311000	0.19380	0.087000	0.17167	-0.136000	0.14681	GAA	.		0.383	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
XKR7	343702	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	30584708	30584708	+	Silent	SNP	C	C	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr20:30584708C>T	ENST00000562532.2	+	3	1362	c.1188C>T	c.(1186-1188)gcC>gcT	p.A396A		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	396						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TGGAGAACGCCGCGCTCACCG	0.597																																					p.A396A		.											.	XKR7	137	0			c.C1188T						.						62.0	56.0	58.0					20																	30584708		2203	4300	6503	SO:0001819	synonymous_variant	343702	exon3			GAACGCCGCGCTC	AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.1188C>T	20.37:g.30584708C>T		69.0	0.0		78.0	17.0	NM_001011718	Q9NUG5	Silent	SNP	ENST00000562532.2	37	CCDS33459.1																																																																																			.		0.597	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078597.3	NM_001011718	
ZAN	7455	ucsc.edu;bcgsc.ca	37	7	100361668	100361668	+	RNA	SNP	G	G	T			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr7:100361668G>T	ENST00000348028.3	+	0	4281				ZAN_ENST00000449052.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000538115.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TGCTGCACGTGAAGGCCGCTT	0.602																																					.		.											.	ZAN	142	0			.						.						67.0	67.0	67.0					7																	100361668		2154	4244	6398			7455	.			GCACGTGAAGGCC	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100361668G>T		41.0	0.0		42.0	5.0	.	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Silent	SNP	ENST00000348028.3	37																																																																																				.		0.602	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
ZBED5	58486	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	10874768	10874768	+	Silent	SNP	T	T	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr11:10874768T>C	ENST00000432999.2	-	3	2223	c.1725A>G	c.(1723-1725)agA>agG	p.R575R	ZBED5_ENST00000413761.2_Silent_p.R575R|ZBED5_ENST00000525350.1_Intron	NM_001143667.1|NM_021211.3	NP_001137139.1|NP_067034.2	Q49AG3	ZBED5_HUMAN	zinc finger, BED-type containing 5	575							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)	4						taaatggatttctaacccaag	0.373																																					p.R575R		.											.	.	.	0			c.A1725G						.						57.0	51.0	53.0					11																	10874768		692	1591	2283	SO:0001819	synonymous_variant	58486	exon3			TGGATTTCTAACC	AF205601		11p15.3	2013-05-03			ENSG00000236287	ENSG00000236287		"""Zinc fingers, BED-type"""	30803	protein-coding gene	gene with protein product		615251				10607616, 23533661	Standard	NM_021211		Approved	Buster1	uc009ygh.3	Q49AG3	OTTHUMG00000150341	ENST00000432999.2:c.1725A>G	11.37:g.10874768T>C		87.0	0.0		41.0	14.0	NM_021211	B2RCC1|Q05D82|Q86WW3|Q9NT24|Q9UBJ4	Silent	SNP	ENST00000432999.2	37																																																																																				.		0.373	ZBED5-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000317691.1	NM_021211	
ZFPL1	7542	broad.mit.edu;bcgsc.ca	37	11	64854466	64854466	+	Frame_Shift_Del	DEL	C	C	-	rs138586249		TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr11:64854466delC	ENST00000294258.3	+	6	700	c.548delC	c.(547-549)gccfs	p.A183fs	CDCA5_ENST00000404147.3_5'Flank|CDCA5_ENST00000275517.3_5'Flank|AP003068.6_ENST00000525544.2_5'Flank	NM_006782.3	NP_006773.2	O95159	ZFPL1_HUMAN	zinc finger protein-like 1	183					regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11						TACAGCCAGGCCCCCCGGCCC	0.647																																					p.A183fs		.											.	ZFPL1	91	0			c.548delC						.						25.0	28.0	27.0					11																	64854466		2200	4297	6497	SO:0001589	frameshift_variant	7542	exon6			GCCAGGCCCCCCG		CCDS8092.1	11q13	2013-01-08			ENSG00000162300	ENSG00000162300			12868	protein-coding gene	gene with protein product	"""zinc-finger protein in MEN1 region"""					9653652	Standard	NM_006782		Approved	D11S750, MCG4	uc001ocq.1	O95159	OTTHUMG00000165597	ENST00000294258.3:c.548delC	11.37:g.64854466delC	ENSP00000294258:p.Ala183fs	63.0	0.0		45.0	9.0	NM_006782	A8K7E9|O14616|Q9UID0	Frame_Shift_Del	DEL	ENST00000294258.3	37	CCDS8092.1																																																																																			.		0.647	ZFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385196.1	NM_006782	
ZKSCAN3	80317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	28333341	28333341	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr6:28333341G>A	ENST00000377255.3	+	7	1193	c.896G>A	c.(895-897)gGc>gAc	p.G299D	ZKSCAN3_ENST00000252211.2_Missense_Mutation_p.G299D|ZKSCAN3_ENST00000341464.5_Missense_Mutation_p.G151D	NM_001242894.1	NP_001229823.1	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	299					autophagy (GO:0006914)|lysosome organization (GO:0007040)|negative regulation of autophagy (GO:0010507)|negative regulation of cellular senescence (GO:2000773)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(4)|large_intestine(3)|lung(8)|pancreas(1)|skin(2)|stomach(2)|urinary_tract(1)	21						GAACAGGAGGGCAGGCTACAA	0.507																																					p.G299D		.											.	ZKSCAN3	92	0			c.G896A						.						96.0	89.0	92.0					6																	28333341		2203	4300	6503	SO:0001583	missense	80317	exon6			AGGAGGGCAGGCT	U71601	CCDS4650.1, CCDS56408.1	6p22.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000189298		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13853	protein-coding gene	gene with protein product		612791	"""zinc finger protein 306"", ""zinc finger protein 309"""	ZNF306, ZNF309		10520746, 22531714	Standard	NM_024493		Approved	Zfp47, ZF47, ZSCAN35	uc003nle.4	Q9BRR0	OTTHUMG00000014521	ENST00000377255.3:c.896G>A	6.37:g.28333341G>A	ENSP00000366465:p.Gly299Asp	103.0	0.0		148.0	56.0	NM_024493	B2R8W2|B3KVC0|H7BXX1|Q5VXH3|Q92972|Q9H4T3	Missense_Mutation	SNP	ENST00000377255.3	37	CCDS4650.1	.	.	.	.	.	.	.	.	.	.	.	14.20	2.463493	0.43736	.	.	ENSG00000189298	ENST00000252211;ENST00000341464;ENST00000377255	T;T;T	0.06218	3.43;3.33;3.43	3.26	0.255	0.15561	.	.	.	.	.	T	0.01222	0.0040	N	0.12831	0.26	0.22081	N	0.999379	B	0.22541	0.071	B	0.23716	0.048	T	0.46952	-0.9154	9	0.56958	D	0.05	.	8.0074	0.30334	0.0975:0.4585:0.444:0.0	.	299	Q9BRR0	ZKSC3_HUMAN	D	299;151;299	ENSP00000252211:G299D;ENSP00000341883:G151D;ENSP00000366465:G299D	ENSP00000252211:G299D	G	+	2	0	ZKSCAN3	28441320	0.000000	0.05858	0.965000	0.40720	0.906000	0.53458	-0.682000	0.05185	-0.088000	0.12506	0.555000	0.69702	GGC	.		0.507	ZKSCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040189.3	NM_024493	
ZNF334	55713	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	45130323	45130323	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MA-01A-11D-A33Q-10	TCGA-UB-A7MA-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efb3b274-562e-4ba8-908d-6343e61e5ea8	ee2cfb72-22e3-4676-be79-889217d8dc2b	g.chr20:45130323G>C	ENST00000347606.4	-	5	1837	c.1655C>G	c.(1654-1656)aCc>aGc	p.T552S	ZNF334_ENST00000593880.1_Missense_Mutation_p.T575S|ZNF334_ENST00000457685.2_Missense_Mutation_p.T514S	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	552					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				CCTGCAGTAGGTTCTCCCACA	0.458																																					p.T552S		.											.	ZNF334	92	0			c.C1655G						.						167.0	158.0	161.0					20																	45130323		2203	4300	6503	SO:0001583	missense	55713	exon5			CAGTAGGTTCTCC	AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.1655C>G	20.37:g.45130323G>C	ENSP00000255129:p.Thr552Ser	60.0	0.0		77.0	15.0	NM_018102	Q5T6U2|Q9NVW4	Missense_Mutation	SNP	ENST00000347606.4	37	CCDS33480.1	.	.	.	.	.	.	.	.	.	.	G	8.084	0.773123	0.16051	.	.	ENSG00000198185	ENST00000457685;ENST00000347606	T;T	0.27402	1.67;1.67	2.88	0.567	0.17325	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17789	0.0427	N	0.16016	0.355	0.09310	N	1	B;B;B	0.14438	0.01;0.01;0.01	B;B;B	0.10450	0.005;0.005;0.005	T	0.24368	-1.0162	9	0.44086	T	0.13	.	9.7278	0.40342	0.0:0.5911:0.4089:0.0	.	514;552;575	B3KQ93;Q9HCZ1;Q8N3P8	.;ZN334_HUMAN;.	S	514;552	ENSP00000402582:T514S;ENSP00000255129:T552S	ENSP00000255129:T552S	T	-	2	0	ZNF334	44563730	0.000000	0.05858	0.957000	0.39632	0.912000	0.54170	-0.370000	0.07523	0.522000	0.28464	0.491000	0.48974	ACC	.		0.458	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079575.1		
