#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCD1	215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153001604	153001604	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:153001604G>C	ENST00000218104.3	+	3	1519	c.1120G>C	c.(1120-1122)Gag>Cag	p.E374Q	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	374	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGAAAAGAAGGAGGAGGAGCT	0.617																																					p.E374Q		.											.	ABCD1	130	0			c.G1120C						.						102.0	96.0	98.0					X																	153001604		2203	4300	6503	SO:0001583	missense	215	exon3			AAGAAGGAGGAGG	Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1120G>C	X.37:g.153001604G>C	ENSP00000218104:p.Glu374Gln	193.0	0.0		129.0	29.0	NM_000033	Q6GTZ2	Missense_Mutation	SNP	ENST00000218104.3	37	CCDS14728.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.61|15.61	2.883868|2.883868	0.51908|0.51908	.|.	.|.	ENSG00000101986|ENSG00000101986	ENST00000218104|ENST00000443684	D|.	0.94184|.	-3.37|.	4.85|4.85	3.08|3.08	0.35506|0.35506	.|.	0.221347|.	0.35585|.	N|.	0.003106|.	T|T	0.58595|0.58595	0.2133|0.2133	L|L	0.53249|0.53249	1.67|1.67	0.80722|0.80722	D|D	1|1	B|.	0.23128|.	0.08|.	B|.	0.20384|.	0.029|.	T|T	0.51403|0.51403	-0.8710|-0.8710	10|5	0.13853|.	T|.	0.58|.	-17.98|-17.98	9.3879|9.3879	0.38354|0.38354	0.1835:0.0:0.8165:0.0|0.1835:0.0:0.8165:0.0	.|.	374|.	P33897|.	ABCD1_HUMAN|.	Q|S	374|41	ENSP00000218104:E374Q|.	ENSP00000218104:E374Q|.	E|R	+|+	1|3	0|2	ABCD1|ABCD1	152654798|152654798	1.000000|1.000000	0.71417|0.71417	0.438000|0.438000	0.26821|0.26821	0.610000|0.610000	0.37248|0.37248	7.600000|7.600000	0.82769|0.82769	0.404000|0.404000	0.25506|0.25506	0.523000|0.523000	0.50628|0.50628	GAG|AGG	.		0.617	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061041.1	NM_000033	
ABHD14B	84836	broad.mit.edu;bcgsc.ca	37	3	52003453	52003453	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:52003453C>T	ENST00000483233.1	-	5	1128	c.622G>A	c.(622-624)Ggg>Agg	p.G208R	ABHD14B_ENST00000487005.1_5'UTR|RP11-155D18.12_ENST00000488257.1_RNA|PCBP4_ENST00000461554.1_5'Flank|ABHD14B_ENST00000315877.10_Missense_Mutation_p.G206R|RP11-155D18.14_ENST00000489595.2_Intron|PCBP4_ENST00000355852.2_5'Flank|ABHD14B_ENST00000395008.2_Missense_Mutation_p.G208R|ABHD14B_ENST00000525795.1_Missense_Mutation_p.G208R|PCBP4_ENST00000395013.3_5'Flank|ABHD14B_ENST00000461108.1_3'UTR|PCBP4_ENST00000428823.2_5'Flank|ABHD14B_ENST00000361143.5_Missense_Mutation_p.G208R|PCBP4_ENST00000484633.1_5'Flank			Q96IU4	ABHEB_HUMAN	abhydrolase domain containing 14B	208					metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			large_intestine(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000548)|KIRC - Kidney renal clear cell carcinoma(197;0.00072)		CACTGGAGCCCCTGCAGGAAG	0.637																																					p.G208R		.											.	ABHD14B	90	0			c.G622A						.						57.0	60.0	59.0					3																	52003453		2203	4299	6502	SO:0001583	missense	84836	exon4			GGAGCCCCTGCAG	AK075112	CCDS2842.1	3p21.2	2009-01-12			ENSG00000114779	ENSG00000114779		"""Abhydrolase domain containing"""	28235	protein-coding gene	gene with protein product							Standard	NM_032750		Approved	MGC15429, CIB	uc011bdy.2	Q96IU4	OTTHUMG00000157816	ENST00000483233.1:c.622G>A	3.37:g.52003453C>T	ENSP00000420065:p.Gly208Arg	129.0	0.0		86.0	5.0	NM_032750	Q86VK8|Q8N8W5	Missense_Mutation	SNP	ENST00000483233.1	37	CCDS2842.1	.	.	.	.	.	.	.	.	.	.	C	6.174	0.400253	0.11696	.	.	ENSG00000114779	ENST00000483233;ENST00000315877;ENST00000395008;ENST00000361143;ENST00000439982;ENST00000525795	.	.	.	5.45	4.58	0.56647	.	0.465752	0.25236	N	0.032137	T	0.18383	0.0441	N	0.20483	0.58	0.34106	D	0.6624	P;B	0.40681	0.727;0.108	B;B	0.24394	0.053;0.035	T	0.26985	-1.0087	9	0.29301	T	0.29	-4.9257	5.1832	0.15171	0.0:0.6133:0.1532:0.2335	.	128;208	B4DKK0;Q96IU4	.;ABHEB_HUMAN	R	208;206;208;208;183;208	.	ENSP00000318248:G206R	G	-	1	0	ABHD14B	51978493	0.983000	0.35010	0.951000	0.38953	0.379000	0.30106	1.698000	0.37794	1.315000	0.45114	0.491000	0.48974	GGG	.		0.637	ABHD14B-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349673.1	NM_032750	
ACACB	32	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	109637260	109637260	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr12:109637260C>T	ENST00000338432.7	+	18	2800	c.2681C>T	c.(2680-2682)cCt>cTt	p.P894L	ACACB_ENST00000377848.3_Missense_Mutation_p.P894L|ACACB_ENST00000377854.5_Missense_Mutation_p.P894L			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	894	Biotinyl-binding. {ECO:0000255|PROSITE- ProRule:PRU01066}.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	GAGAACGATCCTACAGTCCTG	0.557																																					p.P894L		.											.	ACACB	98	0			c.C2681T						.						147.0	135.0	139.0					12																	109637260		2203	4300	6503	SO:0001583	missense	32	exon17			ACGATCCTACAGT	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.2681C>T	12.37:g.109637260C>T	ENSP00000341044:p.Pro894Leu	91.0	0.0		83.0	15.0	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.367611	0.61513	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027	D;D;D	0.81908	-1.55;-1.55;-1.55	5.42	3.58	0.41010	Single hybrid motif (1);	0.049411	0.85682	D	0.000000	D	0.86121	0.5857	M	0.91510	3.215	0.80722	D	1	B	0.22080	0.064	B	0.27170	0.077	D	0.84232	0.0467	10	0.87932	D	0	.	11.3371	0.49511	0.0:0.8036:0.1266:0.0698	.	894	O00763	ACACB_HUMAN	L	894;894;894;125	ENSP00000341044:P894L;ENSP00000367079:P894L;ENSP00000367085:P894L	ENSP00000341044:P894L	P	+	2	0	ACACB	108121643	1.000000	0.71417	0.028000	0.17463	0.331000	0.28603	4.851000	0.62896	0.765000	0.33221	0.585000	0.79938	CCT	.		0.557	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
ACTR3	10096	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	114691952	114691952	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr2:114691952G>T	ENST00000263238.2	+	6	849	c.529G>T	c.(529-531)Gtc>Ttc	p.V177F	ACTR3_ENST00000536059.1_Missense_Mutation_p.V115F|ACTR3_ENST00000535589.2_Missense_Mutation_p.V126F	NM_001277140.1|NM_005721.3	NP_001264069.1|NP_005712.1	P61158	ARP3_HUMAN	ARP3 actin-related protein 3 homolog (yeast)	177					Arp2/3 complex-mediated actin nucleation (GO:0034314)|asymmetric cell division (GO:0008356)|cellular component movement (GO:0006928)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|meiotic chromosome movement towards spindle pole (GO:0016344)|meiotic cytokinesis (GO:0033206)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron differentiation (GO:0045666)|regulation of myosin II filament organization (GO:0043519)|response to antibiotic (GO:0046677)|response to carbohydrate (GO:0009743)|spindle localization (GO:0051653)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|hemidesmosome (GO:0030056)|lamellipodium (GO:0030027)|membrane (GO:0016020)|podosome (GO:0002102)	ATP binding (GO:0005524)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(2)	15						TGTCACTCATGTCATTCCTGT	0.398																																					p.D177Y		.											.	ACTR3	91	0			c.G529T						.						242.0	216.0	225.0					2																	114691952		2203	4300	6503	SO:0001583	missense	10096	exon6			ACTCATGTCATTC	AF006083	CCDS33277.1, CCDS63000.1	2q14.1	2010-07-20	2001-11-28		ENSG00000115091	ENSG00000115091			170	protein-coding gene	gene with protein product		604222	"""ARP3 (actin-related protein 3, yeast) homolog"""			9230079	Standard	NM_005721		Approved	ARP3	uc002tkx.2	P61158	OTTHUMG00000153497	ENST00000263238.2:c.529G>T	2.37:g.114691952G>T	ENSP00000263238:p.Val177Phe	86.0	1.0		40.0	8.0	NM_005721	P32391|Q53QM2	Missense_Mutation	SNP	ENST00000263238.2	37	CCDS33277.1	.	.	.	.	.	.	.	.	.	.	G	32	5.192778	0.94960	.	.	ENSG00000115091	ENST00000263238;ENST00000536059;ENST00000544784;ENST00000535589	T;T;T	0.14022	2.54;2.54;2.54	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.39358	0.1075	M	0.87456	2.885	0.80722	D	1	D;P	0.57899	0.981;0.922	P;P	0.55824	0.745;0.785	T	0.45848	-0.9233	10	0.87932	D	0	-25.9603	18.743	0.91780	0.0:0.0:1.0:0.0	.	115;177	F5H3P5;P61158	.;ARP3_HUMAN	F	177;115;48;126	ENSP00000263238:V177F;ENSP00000445257:V115F;ENSP00000444987:V126F	ENSP00000263238:V177F	V	+	1	0	ACTR3	114408422	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.721000	0.84768	2.651000	0.90000	0.585000	0.79938	GTC	.		0.398	ACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331366.2	NM_005721	
AKAP6	9472	broad.mit.edu;ucsc.edu;mdanderson.org	37	14	33165314	33165314	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr14:33165314A>T	ENST00000280979.4	+	9	3168	c.2998A>T	c.(2998-3000)Aag>Tag	p.K1000*	AKAP6_ENST00000557272.1_Nonsense_Mutation_p.K1000*|AKAP6_ENST00000557354.1_Nonsense_Mutation_p.K1000*	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1000					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GCATCTTTACAAGGTTAGAGC	0.473																																					p.K1000X	Melanoma(49;821 1200 7288 13647 42351)	.											.	AKAP6	733	0			c.A2998T						.						135.0	109.0	118.0					14																	33165314		2203	4300	6503	SO:0001587	stop_gained	9472	exon9			CTTTACAAGGTTA	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.2998A>T	14.37:g.33165314A>T	ENSP00000280979:p.Lys1000*	225.0	1.0		143.0	44.0	NM_004274	A7E242|A7E2D4|O15028	Nonsense_Mutation	SNP	ENST00000280979.4	37	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	A	43	10.399752	0.99398	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272	.	.	.	5.24	5.24	0.73138	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.3137	15.1219	0.72450	1.0:0.0:0.0:0.0	.	.	.	.	X	1000	.	ENSP00000280979:K1000X	K	+	1	0	AKAP6	32235065	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.829000	0.92055	1.980000	0.57719	0.528000	0.53228	AAG	.		0.473	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
ANKRD30A	91074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	37505198	37505198	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr10:37505198G>C	ENST00000602533.1	+	32	2890	c.2791G>C	c.(2791-2793)Gga>Cga	p.G931R	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.G1050R|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.G931R			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	987					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						ACAACGTACAGGAAAAATGGA	0.333																																					p.G931R		.											.	ANKRD30A	161	0			c.G2791C						.						77.0	73.0	74.0					10																	37505198		1815	4067	5882	SO:0001583	missense	91074	exon32			CGTACAGGAAAAA	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2791G>C	10.37:g.37505198G>C	ENSP00000473551:p.Gly931Arg	475.0	0.0		576.0	57.0	NM_052997	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37		.	.	.	.	.	.	.	.	.	.	g	0.052	-1.246677	0.01481	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.05258	3.47;3.47	2.63	1.71	0.24356	.	.	.	.	.	T	0.03564	0.0102	N	0.12961	0.28	0.09310	N	1	B	0.26081	0.141	B	0.20955	0.032	T	0.43245	-0.9403	9	0.41790	T	0.15	.	4.5817	0.12262	0.3205:0.0:0.6795:0.0	.	987	Q9BXX3	AN30A_HUMAN	R	931;1050	ENSP00000354432:G931R;ENSP00000363792:G1050R	ENSP00000354432:G931R	G	+	1	0	ANKRD30A	37545204	0.003000	0.15002	0.002000	0.10522	0.003000	0.03518	0.318000	0.19504	0.297000	0.22615	0.313000	0.20887	GGA	.		0.333	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
ARFGAP2	84364	broad.mit.edu;bcgsc.ca	37	11	47195386	47195387	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	-	-	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr11:47195386_47195387insG	ENST00000524782.1	-	6	713_714	c.485_486insC	c.(484-486)cctfs	p.P162fs	ARFGAP2_ENST00000395449.3_5'UTR|ARFGAP2_ENST00000426335.2_Intron|ARFGAP2_ENST00000419701.2_Frame_Shift_Ins_p.P55fs|ARFGAP2_ENST00000319543.6_Intron	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	162	Required for interaction with coatomer.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						CATCCCAGGCAGGGGGCTGAAA	0.594																																					p.P162fs		.											.	ARFGAP2	69	0			c.486_487insC						.																																			SO:0001589	frameshift_variant	84364	exon6			CCAGGCAGGGGGC	AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.486dupC	11.37:g.47195391_47195391dupG	ENSP00000434442:p.Pro162fs	39.0	0.0		28.0	14.0	NM_032389	B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Frame_Shift_Ins	INS	ENST00000524782.1	37	CCDS7926.1																																																																																			.		0.594	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391425.1	NM_032389	
ARNTL	406	ucsc.edu;bcgsc.ca	37	11	13398211	13398211	+	Silent	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr11:13398211C>T	ENST00000403290.1	+	16	1705	c.1350C>T	c.(1348-1350)gaC>gaT	p.D450D	ARNTL_ENST00000389707.4_Silent_p.D449D|ARNTL_ENST00000389708.3_Missense_Mutation_p.T482I|ARNTL_ENST00000361003.4_Silent_p.D332D|ARNTL_ENST00000403482.3_Silent_p.D448D|ARNTL_ENST00000401424.1_Silent_p.D407D|ARNTL_ENST00000403510.3_Silent_p.D406D|ARNTL_ENST00000396441.3_Silent_p.D449D			O00327	BMAL1_HUMAN	aryl hydrocarbon receptor nuclear translocator-like	450					circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of cell cycle (GO:0051726)|regulation of cellular senescence (GO:2000772)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|nuclear body (GO:0016604)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|Hsp90 protein binding (GO:0051879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|signal transducer activity (GO:0004871)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(2)|large_intestine(11)|lung(5)|upper_aerodigestive_tract(1)	20				Epithelial(150;0.0243)		AAGGCGGGGACCCAACCTTCC	0.592																																					p.D449D		.											.	ARNTL	90	0			c.C1347T						.						159.0	148.0	152.0					11																	13398211		2200	4294	6494	SO:0001819	synonymous_variant	406	exon15			CGGGGACCCAACC	D89722	CCDS31430.1, CCDS44543.1, CCDS73259.1	11p15	2013-05-21			ENSG00000133794	ENSG00000133794		"""Basic helix-loop-helix proteins"""	701	protein-coding gene	gene with protein product		602550				9144434, 9079689	Standard	XM_005252930		Approved	MOP3, JAP3, BMAL1, PASD3, bHLHe5	uc001mkp.3	O00327	OTTHUMG00000150623	ENST00000403290.1:c.1350C>T	11.37:g.13398211C>T		29.0	0.0		35.0	4.0	NM_001030272	A2I2N6|A8K645|B5ME11|B7WPG7|D3DQW6|O00313|O00314|O00315|O00316|O00317|Q4G136|Q8IUT4|Q99631|Q99649	Silent	SNP	ENST00000403290.1	37		.	.	.	.	.	.	.	.	.	.	C	14.28	2.488548	0.44249	.	.	ENSG00000133794	ENST00000389708	T	0.09255	3.0	4.78	3.84	0.44239	.	.	.	.	.	T	0.14399	0.0348	.	.	.	0.21861	N	0.999508	.	.	.	.	.	.	T	0.08351	-1.0726	6	0.52906	T	0.07	.	9.2312	0.37439	0.0:0.8346:0.0:0.1654	.	.	.	.	I	482	ENSP00000374358:T482I	ENSP00000374358:T482I	T	+	2	0	ARNTL	13354787	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.689000	0.25437	2.483000	0.83821	0.655000	0.94253	ACC	.		0.592	ARNTL-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000319173.1	NM_001178	
ATP8A1	10396	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	42580401	42580401	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr4:42580401C>T	ENST00000381668.5	-	12	1235	c.1004G>A	c.(1003-1005)gGt>gAt	p.G335D	ATP8A1_ENST00000264449.10_Missense_Mutation_p.G335D	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	335					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	ACTAGCGCCACCATCTGTTGG	0.358																																					p.G335D		.											.	ATP8A1	92	0			c.G1004A						.						131.0	130.0	131.0					4																	42580401		2203	4300	6503	SO:0001583	missense	10396	exon12			GCGCCACCATCTG	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.1004G>A	4.37:g.42580401C>T	ENSP00000371084:p.Gly335Asp	117.0	0.0		91.0	14.0	NM_001105529	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	ENST00000381668.5	37	CCDS3466.1	.	.	.	.	.	.	.	.	.	.	C	2.761	-0.257844	0.05791	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.74947	-0.89;-0.89	5.67	5.67	0.87782	ATPase, P-type, ATPase-associated domain (1);	0.064385	0.64402	D	0.000006	T	0.60599	0.2281	N	0.17764	0.52	0.80722	D	1	B;B;B	0.10296	0.003;0.0;0.0	B;B;B	0.13407	0.009;0.005;0.002	T	0.55296	-0.8163	10	0.16420	T	0.52	.	16.0524	0.80774	0.0:0.8659:0.1341:0.0	.	335;335;335	B4DII6;Q32M35;Q9Y2Q0	.;.;AT8A1_HUMAN	D	335	ENSP00000371084:G335D;ENSP00000264449:G335D	ENSP00000264449:G335D	G	-	2	0	ATP8A1	42275158	1.000000	0.71417	1.000000	0.80357	0.242000	0.25591	5.687000	0.68219	2.663000	0.90544	0.585000	0.79938	GGT	.		0.358	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095	
ATP9B	374868	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	77108133	77108134	+	Splice_Site	INS	-	-	TG			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr18:77108133_77108134insTG	ENST00000426216.2	+	25	2857_2858	c.2840_2841insTG	c.(2839-2844)gctgtg>gcTGtgtg	p.AV947fs	ATP9B_ENST00000307671.7_Splice_Site_p.AV947fs|ATP9B_ENST00000543761.1_Splice_Site_p.AV268fs	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	947					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		TCTCTCCAGGCTGTGTTTTCCT	0.564																																					p.A947fs		.											.	ATP9B	93	0			c.2840_2841insTG						.																																			SO:0001630	splice_region_variant	374868	exon25			TCCAGGCTGTGTT	R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.2839-1->TG	18.37:g.77108136_77108137dupTG		392.0	0.0		240.0	62.0	NM_198531	O60872|Q08AD8|Q08AD9	Frame_Shift_Ins	INS	ENST00000426216.2	37	CCDS12014.1																																																																																			.		0.564	ATP9B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256402.3	NM_198531	Frame_Shift_Ins
BAIAP2	10458	ucsc.edu;bcgsc.ca	37	17	79060379	79060379	+	Splice_Site	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:79060379A>G	ENST00000321300.6	+	6	581	c.488A>G	c.(487-489)cAg>cGg	p.Q163R	BAIAP2_ENST00000575712.1_Splice_Site_p.Q163R|BAIAP2_ENST00000392411.3_Splice_Site_p.Q85R|BAIAP2_ENST00000435091.3_Splice_Site_p.Q163R|BAIAP2_ENST00000575245.1_Splice_Site_p.Q196R|BAIAP2_ENST00000321280.7_Splice_Site_p.Q163R|BAIAP2_ENST00000573894.1_3'UTR|BAIAP2_ENST00000428708.2_Splice_Site_p.Q163R	NM_001144888.1|NM_017451.2	NP_001138360.1|NP_059345.1	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2	163	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of synaptic plasticity (GO:0048167)|response to bacterium (GO:0009617)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	cytoskeletal adaptor activity (GO:0008093)|identical protein binding (GO:0042802)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)	18	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			AAGGAGCTGCAGGTAGGCCCG	0.642																																					p.Q163R		.											.	BAIAP2	90	0			c.A488G						.						65.0	70.0	68.0					17																	79060379		2203	4300	6503	SO:0001630	splice_region_variant	10458	exon6			AGCTGCAGGTAGG	AB015019	CCDS11775.1, CCDS11776.1, CCDS11777.1, CCDS45806.1	17q25.3	2014-09-11			ENSG00000175866				947	protein-coding gene	gene with protein product		605475				10343108	Standard	NM_017451		Approved	BAP2	uc002jzg.2	Q9UQB8	OTTHUMG00000177698	ENST00000321300.6:c.489+1A>G	17.37:g.79060379A>G		92.0	1.0		49.0	6.0	NM_001144888	O43858|Q53HB1|Q86WC1|Q8N5C0|Q96CR7|Q9UBR3|Q9UQ43	Missense_Mutation	SNP	ENST00000321300.6	37	CCDS11775.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.023503	0.75390	.	.	ENSG00000175866	ENST00000321300;ENST00000428708;ENST00000435091;ENST00000321280;ENST00000392411	T;T;T;T;T	0.37752	1.61;1.64;1.18;1.18;1.76	3.8	3.8	0.43715	IRSp53/MIM homology domain (IMD) (3);	0.000000	0.85682	D	0.000000	T	0.52613	0.1745	L	0.59912	1.85	0.80722	D	1	D;D;D;P;P;D;D;P	0.76494	0.996;0.997;0.998;0.692;0.8;0.999;0.999;0.8	D;D;D;P;P;D;D;P	0.87578	0.992;0.995;0.998;0.653;0.558;0.998;0.998;0.738	T	0.48387	-0.9040	10	0.29301	T	0.29	-17.7109	12.7063	0.57061	1.0:0.0:0.0:0.0	.	85;164;163;163;163;163;163;163	F8W878;B3KPV9;Q9UQB8;Q9UQB8-2;Q9UQB8-3;Q9UQB8-5;Q9UQB8-6;Q9UQB8-4	.;.;BAIP2_HUMAN;.;.;.;.;.	R	163;163;163;163;85	ENSP00000316338:Q163R;ENSP00000401022:Q163R;ENSP00000413069:Q163R;ENSP00000315685:Q163R;ENSP00000376211:Q85R	ENSP00000315685:Q163R	Q	+	2	0	BAIAP2	76674974	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	8.534000	0.90620	1.570000	0.49709	0.459000	0.35465	CAG	.		0.642	BAIAP2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438553.1		Missense_Mutation
BAP1	8314	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	52436687	52436688	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:52436687_52436688insA	ENST00000460680.1	-	16	2457_2458	c.1986_1987insT	c.(1984-1989)attgatfs	p.D663fs	BAP1_ENST00000296288.5_Frame_Shift_Ins_p.D645fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CTCTGGTCATCAATCTGTAGGA	0.53			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.D663_D664delinsX	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	1032	0			c.1987_1988insT						.																																			SO:0001589	frameshift_variant	8314	exon16			GGTCATCAATCTG	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1987dupT	3.37:g.52436689_52436689dupA	ENSP00000417132:p.Asp663fs	226.0	0.0		89.0	65.0	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Nonsense_Mutation	INS	ENST00000460680.1	37	CCDS2853.1																																																																																			.		0.530	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
BLOC1S4	55330	broad.mit.edu;mdanderson.org	37	4	6718242	6718242	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr4:6718242G>T	ENST00000320776.3	+	1	401	c.306G>T	c.(304-306)atG>atT	p.M102I		NM_018366.2	NP_060836.1	Q9NUP1	BL1S4_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino	102					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|platelet aggregation (GO:0070527)|post-Golgi vesicle-mediated transport (GO:0006892)	BLOC-1 complex (GO:0031083)|cytoplasm (GO:0005737)|cytosol (GO:0005829)											TCGTGGGCATGCTGGACATGC	0.711																																					p.M102I		.											.	.	.	0			c.G306T						.						10.0	6.0	7.0					4																	6718242		2057	4056	6113	SO:0001583	missense	55330	exon1			GGGCATGCTGGAC	BC001818	CCDS3393.1	4p16.1	2012-08-01	2012-08-01	2012-08-01	ENSG00000186222	ENSG00000186222		"""Biogenesis of lysosomal organelles complex-1 subunits"""	24206	protein-coding gene	gene with protein product		605695	"""cappuccino homolog (mouse)"""	CNO		12576321, 11110696	Standard	NM_018366		Approved	FLJ11230, BCAS4L	uc003gjp.1	Q9NUP1	OTTHUMG00000125510	ENST00000320776.3:c.306G>T	4.37:g.6718242G>T	ENSP00000318128:p.Met102Ile	11.0	0.0		15.0	4.0	NM_018366	Q6NVY6|Q96G84	Missense_Mutation	SNP	ENST00000320776.3	37	CCDS3393.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.744373	0.89663	.	.	ENSG00000186222	ENST00000320776	T	0.48201	0.82	3.72	3.72	0.42706	.	0.039190	0.85682	D	0.000000	T	0.55529	0.1926	M	0.62016	1.91	0.58432	D	0.999996	D	0.56287	0.975	P	0.53649	0.731	T	0.60919	-0.7167	10	0.66056	D	0.02	-13.4319	11.721	0.51683	0.0:0.0:1.0:0.0	.	102	Q9NUP1	CNO_HUMAN	I	102	ENSP00000318128:M102I	ENSP00000318128:M102I	M	+	3	0	CNO	6769143	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.997000	0.70646	2.022000	0.59522	0.561000	0.74099	ATG	.		0.711	BLOC1S4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246837.1	NM_018366	
MISP	126353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	756999	756999	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:756999G>C	ENST00000215582.6	+	2	156	c.53G>C	c.(52-54)gGc>gCc	p.G18A		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	18					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											GCACACCGTGGCACCGGCCTG	0.657																																					p.G18A		.											.	C19orf21	91	0			c.G53C						.						25.0	24.0	24.0					19																	756999		2201	4297	6498	SO:0001583	missense	126353	exon2			ACCGTGGCACCGG	BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.53G>C	19.37:g.756999G>C	ENSP00000215582:p.Gly18Ala	113.0	0.0		116.0	15.0	NM_173481		Missense_Mutation	SNP	ENST00000215582.6	37	CCDS12042.1	.	.	.	.	.	.	.	.	.	.	G	1.285	-0.609135	0.03690	.	.	ENSG00000099812	ENST00000215582	D	0.91577	-2.87	4.27	0.897	0.19258	.	2.194520	0.02204	N	0.062565	T	0.68824	0.3043	N	0.00707	-1.245	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.71797	-0.4484	10	0.02654	T	1	-3.176	4.1001	0.10010	0.0:0.2111:0.3661:0.4227	.	18	Q8IVT2	CS021_HUMAN	A	18	ENSP00000215582:G18A	ENSP00000215582:G18A	G	+	2	0	C19orf21	707999	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	0.275000	0.18698	0.156000	0.19299	-1.277000	0.01392	GGC	.		0.657	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457600.2	NM_173481	
C19orf80	55908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11350899	11350899	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:11350899G>T	ENST00000252453.8	+	2	405	c.386G>T	c.(385-387)aGc>aTc	p.S129I	DOCK6_ENST00000319867.7_5'Flank|C19orf80_ENST00000591200.1_Missense_Mutation_p.S30I|DOCK6_ENST00000294618.7_Intron	NM_018687.6	NP_061157.3	Q6UXH0	BETAT_HUMAN	chromosome 19 open reading frame 80	129					cellular lipid metabolic process (GO:0044255)|glucose metabolic process (GO:0006006)|positive regulation of protein processing (GO:0010954)|regulation of lipoprotein metabolic process (GO:0050746)|triglyceride homeostasis (GO:0070328)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(1)|breast(1)|endometrium(2)	4						CTACGGGACAGCGTGCAGCGG	0.597																																					p.S129I		.											.	.	.	0			c.G386T						.						18.0	25.0	23.0					19																	11350899		2042	4195	6237	SO:0001583	missense	55908	exon2			GGGACAGCGTGCA		CCDS54220.1	19p13.2	2014-02-13			ENSG00000130173	ENSG00000130173			24933	protein-coding gene	gene with protein product	"""lipasin"", ""betatrophin"""					22809513, 23150577, 24262987	Standard	NM_018687		Approved	TD26, RIFL, ANGPTL8	uc021upg.1	Q6UXH0		ENST00000252453.8:c.386G>T	19.37:g.11350899G>T	ENSP00000252453:p.Ser129Ile	89.0	0.0		65.0	26.0	NM_018687	Q9NQZ1	Missense_Mutation	SNP	ENST00000252453.8	37	CCDS54220.1	.	.	.	.	.	.	.	.	.	.	G	9.127	1.010432	0.19277	.	.	ENSG00000130173	ENST00000397785;ENST00000252453	T	0.32515	1.45	4.42	-2.17	0.07059	.	0.787466	0.11293	N	0.579067	T	0.18759	0.0450	L	0.38175	1.15	0.09310	N	1	B	0.32467	0.372	B	0.30179	0.112	T	0.15206	-1.0445	10	0.52906	T	0.07	-13.0173	4.5847	0.12277	0.3975:0.1551:0.4473:0.0	.	129	Q6UXH0	TD26_HUMAN	I	54;129	ENSP00000252453:S129I	ENSP00000252453:S129I	S	+	2	0	C19orf80	11211899	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.108000	0.10857	-0.493000	0.06678	-0.391000	0.06502	AGC	.		0.597	C19orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453175.1	NM_018687	
C20orf27	54976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3735113	3735113	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr20:3735113C>T	ENST00000379772.3	-	5	1165	c.355G>A	c.(355-357)Gag>Aag	p.E119K	C20orf27_ENST00000217195.8_Missense_Mutation_p.E144K	NM_001258429.1	NP_001245358.1	Q9GZN8	CT027_HUMAN	chromosome 20 open reading frame 27	119										central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)|urinary_tract(1)	7						AGCAGTATCTCCTCTTTGAGG	0.632																																					p.E144K		.											.	C20orf27	90	0			c.G430A						.						128.0	104.0	112.0					20																	3735113		2203	4300	6503	SO:0001583	missense	54976	exon5			GTATCTCCTCTTT	AK000557	CCDS33436.1, CCDS58763.1	20p13	2011-01-25			ENSG00000101220	ENSG00000101220			15873	protein-coding gene	gene with protein product	"""hypothetical protein LOC54976"""					11780052	Standard	NM_001258429		Approved	FLJ20550	uc002wjh.2	Q9GZN8	OTTHUMG00000031753	ENST00000379772.3:c.355G>A	20.37:g.3735113C>T	ENSP00000369097:p.Glu119Lys	61.0	0.0		83.0	30.0	NM_001039140	A8K4J0|D3DVX8|Q5JX81|Q9NWX3	Missense_Mutation	SNP	ENST00000379772.3	37	CCDS58763.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.081242	0.76528	.	.	ENSG00000101220	ENST00000379772;ENST00000217195;ENST00000399672	.	.	.	4.82	4.82	0.62117	.	0.000000	0.64402	U	0.000002	T	0.56016	0.1957	L	0.55103	1.725	0.58432	D	0.999998	B;P	0.37731	0.23;0.607	B;B	0.40375	0.15;0.327	T	0.53851	-0.8380	9	0.29301	T	0.29	-7.2983	15.8093	0.78543	0.0:1.0:0.0:0.0	.	119;144	Q9GZN8;Q9GZN8-2	CT027_HUMAN;.	K	119;144;119	.	ENSP00000217195:E144K	E	-	1	0	C20orf27	3683113	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.276000	0.72601	2.677000	0.91161	0.561000	0.74099	GAG	.		0.632	C20orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077750.2	NM_001039140	
C5orf22	55322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	31534433	31534433	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr5:31534433G>C	ENST00000325366.9	+	2	263	c.136G>C	c.(136-138)Gta>Cta	p.V46L	DROSHA_ENST00000513349.1_5'Flank|DROSHA_ENST00000511367.2_5'Flank|DROSHA_ENST00000504361.1_5'Flank|C5orf22_ENST00000355907.3_5'UTR	NM_018356.2	NP_060826.2	Q49AR2	CE022_HUMAN	chromosome 5 open reading frame 22	46										kidney(3)|large_intestine(2)|lung(10)|ovary(2)|skin(1)	18						TGCCAGTAATGTAAGTTTTTT	0.408																																					p.V46L		.											.	C5orf22	92	0			c.G136C						.						168.0	155.0	160.0					5																	31534433		2203	4300	6503	SO:0001583	missense	55322	exon2			AGTAATGTAAGTT	AK002055	CCDS3895.1	5p13.3	2012-02-22			ENSG00000082213	ENSG00000082213			25639	protein-coding gene	gene with protein product							Standard	NM_018356		Approved	FLJ11193	uc003jhj.4	Q49AR2	OTTHUMG00000131067	ENST00000325366.9:c.136G>C	5.37:g.31534433G>C	ENSP00000326879:p.Val46Leu	505.0	0.0		328.0	64.0	NM_018356	Q8ND28|Q8WU61|Q9NUR1	Missense_Mutation	SNP	ENST00000325366.9	37	CCDS3895.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.291638	0.59976	.	.	ENSG00000082213	ENST00000325366;ENST00000507818	T;T	0.40756	1.02;1.02	5.41	4.25	0.50352	.	0.046947	0.85682	D	0.000000	T	0.20740	0.0499	N	0.04203	-0.255	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.03863	-1.0997	10	0.23302	T	0.38	-15.2709	11.4383	0.50081	0.9286:0.0:0.0714:0.0	.	46	Q49AR2	CE022_HUMAN	L	46	ENSP00000326879:V46L;ENSP00000430860:V46L	ENSP00000326879:V46L	V	+	1	0	C5orf22	31570190	1.000000	0.71417	0.933000	0.37362	0.873000	0.50193	4.504000	0.60414	0.869000	0.35703	-0.294000	0.09567	GTA	.		0.408	C5orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253726.2	NM_018356	
CAMTA2	23125	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	4883278	4883278	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:4883278C>T	ENST00000348066.3	-	9	1462	c.1339G>A	c.(1339-1341)Gat>Aat	p.D447N	CAMTA2_ENST00000358183.4_Missense_Mutation_p.D447N|CAMTA2_ENST00000361571.5_Missense_Mutation_p.D446N|CAMTA2_ENST00000381311.5_Missense_Mutation_p.D449N|CAMTA2_ENST00000414043.3_Missense_Mutation_p.D470N|CAMTA2_ENST00000572543.1_Missense_Mutation_p.D452N|CAMTA2_ENST00000571831.1_5'Flank	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	447					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						CCACTGTCATCATCTTGGATG	0.642																																					p.D470N		.											.	CAMTA2	91	0			c.G1408A						.						63.0	63.0	63.0					17																	4883278		2202	4290	6492	SO:0001583	missense	23125	exon9			TGTCATCATCTTG	AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.1339G>A	17.37:g.4883278C>T	ENSP00000321813:p.Asp447Asn	49.0	0.0		29.0	9.0	NM_001171167	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	ENST00000348066.3	37	CCDS11063.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.274633	0.80580	.	.	ENSG00000108509	ENST00000414043;ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066	T;T;T;T;T	0.36699	2.46;1.5;1.24;1.51;1.28	4.72	4.72	0.59763	.	0.065739	0.56097	D	0.000022	T	0.45776	0.1359	N	0.24115	0.695	0.34803	D	0.7369	D;D;D;D;D	0.71674	0.997;0.997;0.998;0.997;0.996	D;D;D;D;D	0.78314	0.98;0.98;0.991;0.98;0.987	T	0.58070	-0.7701	10	0.54805	T	0.06	-11.3054	15.2164	0.73270	0.0:1.0:0.0:0.0	.	423;470;449;447;446	B7ZM30;E7EWU5;O94983-3;O94983;O94983-4	.;.;.;CMTA2_HUMAN;.	N	470;449;446;447;447	ENSP00000412886:D470N;ENSP00000370712:D449N;ENSP00000354828:D446N;ENSP00000350910:D447N;ENSP00000321813:D447N	ENSP00000321813:D447N	D	-	1	0	CAMTA2	4824002	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.631000	0.37092	2.468000	0.83385	0.561000	0.74099	GAT	.		0.642	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216876.1	NM_015099	
CASP9	842	broad.mit.edu;bcgsc.ca	37	1	15821775	15821775	+	Silent	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:15821775A>G	ENST00000333868.5	-	7	1135	c.1041T>C	c.(1039-1041)acT>acC	p.T347T	CASP9_ENST00000546424.1_Silent_p.T347T|CASP9_ENST00000348549.5_Silent_p.T197T|CASP9_ENST00000375890.4_Silent_p.T264T	NM_001229.3	NP_001220.2	P55211	CASP9_HUMAN	caspase 9, apoptosis-related cysteine peptidase	347					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell apoptotic process (GO:0034349)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of apoptotic process (GO:0042981)|regulation of response to DNA damage stimulus (GO:2001020)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|signal transduction in response to DNA damage (GO:0042770)	apoptosome (GO:0043293)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|enzyme activator activity (GO:0008047)|peptidase activity (GO:0008233)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|stomach(1)	18		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		CACCTGGGAAAGTAGAGTAGG	0.562																																					p.T347T		.											.	CASP9	1083	0			c.T1041C						.						87.0	63.0	71.0					1																	15821775		2203	4300	6503	SO:0001819	synonymous_variant	842	exon7			TGGGAAAGTAGAG	U60521	CCDS158.1, CCDS159.1, CCDS159.2, CCDS59995.1	1p36.21	2012-04-17	2005-08-17		ENSG00000132906	ENSG00000132906		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 56"""	602234	"""caspase 9, apoptosis-related cysteine protease"""			8663294, 9390557	Standard	NM_001229		Approved	MCH6, ICE-LAP6, APAF-3, PPP1R56	uc001awn.4	P55211	OTTHUMG00000002256	ENST00000333868.5:c.1041T>C	1.37:g.15821775A>G		151.0	0.0		110.0	6.0	NM_001229	B4E1A3|O95348|Q53Y70|Q5JRU9|Q5UGI1|Q92852|Q9BQ62|Q9UEQ3|Q9UIJ8	Silent	SNP	ENST00000333868.5	37	CCDS158.1																																																																																			.		0.562	CASP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006438.1	NM_032996	
CCDC39	339829	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	180332768	180332768	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:180332768T>C	ENST00000442201.2	-	20	2886	c.2767A>G	c.(2767-2769)Agg>Ggg	p.R923G	TTC14_ENST00000382584.4_Intron|CCDC39_ENST00000273654.4_3'UTR	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	923	Ser-rich.				axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CTAGATGGCCTAGAAGGGCTG	0.383																																					p.R923G		.											.	CCDC39	72	0			c.A2767G						.						47.0	44.0	45.0					3																	180332768		1820	4065	5885	SO:0001583	missense	339829	exon20			ATGGCCTAGAAGG	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.2767A>G	3.37:g.180332768T>C	ENSP00000405708:p.Arg923Gly	140.0	1.0		102.0	38.0	NM_181426	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	T	12.04	1.818632	0.32145	.	.	ENSG00000145075	ENST00000442201	.	.	.	4.84	0.61	0.17580	.	.	.	.	.	T	0.42177	0.1191	M	0.70595	2.14	0.09310	N	0.999993	B	0.06786	0.001	B	0.06405	0.002	T	0.39121	-0.9629	8	0.44086	T	0.13	.	5.0385	0.14447	0.0:0.0983:0.3613:0.5405	.	923	Q9UFE4	CCD39_HUMAN	G	923	.	ENSP00000405708:R923G	R	-	1	2	CCDC39	181815462	0.003000	0.15002	0.030000	0.17652	0.286000	0.27126	0.459000	0.21908	0.362000	0.24319	0.455000	0.32223	AGG	.		0.383	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028	
CDC5L	988	broad.mit.edu;bcgsc.ca	37	6	44397460	44397460	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr6:44397460T>C	ENST00000371477.3	+	14	2203	c.1904T>C	c.(1903-1905)gTt>gCt	p.V635A		NM_001253.3	NP_001244.1	Q99459	CDC5L_HUMAN	cell division cycle 5-like	635	Interaction with DAPK3. {ECO:0000250|UniProtKB:O08837}.				cell cycle (GO:0007049)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|WD40-repeat domain binding (GO:0071987)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(4)	29	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GCCCAGGATGTTTTGGTGCAG	0.398																																					p.V635A		.											.	CDC5L	229	0			c.T1904C						.						95.0	92.0	93.0					6																	44397460		2203	4300	6503	SO:0001583	missense	988	exon14			AGGATGTTTTGGT	D85423	CCDS4912.1	6p21.1	2013-01-17	2013-01-17		ENSG00000096401	ENSG00000096401			1743	protein-coding gene	gene with protein product		602868	"""CDC5 (cell division cycle 5, S. pombe, homolog)-like"", ""CDC5 cell division cycle 5-like (S. pombe)"""			9598309, 9038199	Standard	NM_001253		Approved	PCDC5RP, hCDC5, CEF1, CDC5	uc003oxl.3	Q99459	OTTHUMG00000014767	ENST00000371477.3:c.1904T>C	6.37:g.44397460T>C	ENSP00000360532:p.Val635Ala	182.0	0.0		113.0	6.0	NM_001253	Q76N46|Q99974	Missense_Mutation	SNP	ENST00000371477.3	37	CCDS4912.1	.	.	.	.	.	.	.	.	.	.	T	14.62	2.589744	0.46214	.	.	ENSG00000096401	ENST00000371477	T	0.40756	1.02	5.81	4.61	0.57282	.	0.436377	0.26855	N	0.022146	T	0.10895	0.0266	N	0.12471	0.22	0.30020	N	0.81441	B	0.10296	0.003	B	0.13407	0.009	T	0.14062	-1.0486	10	0.31617	T	0.26	-4.4693	12.1296	0.53936	0.0:0.0678:0.0:0.9322	.	635	Q99459	CDC5L_HUMAN	A	635	ENSP00000360532:V635A	ENSP00000360532:V635A	V	+	2	0	CDC5L	44505438	1.000000	0.71417	0.645000	0.29479	0.816000	0.46133	6.204000	0.72143	0.972000	0.38314	0.528000	0.53228	GTT	.		0.398	CDC5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040743.1		
CDHR1	92211	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	85955343	85955343	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr10:85955343T>C	ENST00000372117.3	+	2	252	c.149T>C	c.(148-150)gTa>gCa	p.V50A	CDHR1_ENST00000332904.3_Missense_Mutation_p.V50A	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	50	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						GACACCCCTGTAGGTGAGTAG	0.612																																					p.V50A		.											.	CDHR1	91	0			c.T149C						.						99.0	86.0	90.0					10																	85955343		2203	4300	6503	SO:0001583	missense	92211	exon2			CCCCTGTAGGTGA	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.149T>C	10.37:g.85955343T>C	ENSP00000361189:p.Val50Ala	96.0	0.0		66.0	17.0	NM_001171971	Q69YZ8|Q8IXY5	Missense_Mutation	SNP	ENST00000372117.3	37	CCDS7372.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.359078	0.82353	.	.	ENSG00000148600	ENST00000332904;ENST00000372117	T;T	0.53206	0.63;0.63	4.78	4.78	0.61160	Cadherin (3);Cadherin-like (1);	0.215283	0.39687	N	0.001291	T	0.61362	0.2341	M	0.62154	1.92	0.80722	D	1	D;D	0.69078	0.996;0.997	P;D	0.66497	0.907;0.944	T	0.58601	-0.7608	10	0.24483	T	0.36	-9.5748	13.3093	0.60370	0.0:0.0:0.0:1.0	.	50;50	Q96JP9-2;Q96JP9	.;CDHR1_HUMAN	A	50	ENSP00000331063:V50A;ENSP00000361189:V50A	ENSP00000331063:V50A	V	+	2	0	CDHR1	85945323	1.000000	0.71417	0.946000	0.38457	0.900000	0.52787	6.651000	0.74372	1.782000	0.52362	0.459000	0.35465	GTA	.		0.612	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100	
CENPJ	55835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	25459431	25459431	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr13:25459431T>A	ENST00000381884.4	-	13	3645	c.3460A>T	c.(3460-3462)Agt>Tgt	p.S1154C	CENPJ_ENST00000493190.1_5'UTR|CENPJ_ENST00000545981.1_3'UTR	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	1154					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		TCAGGATGACTGATTTCTCCC	0.363																																					p.S1154C		.											.	CENPJ	92	0			c.A3460T						.						143.0	144.0	144.0					13																	25459431		2203	4300	6503	SO:0001583	missense	55835	exon13			GATGACTGATTTC	AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.3460A>T	13.37:g.25459431T>A	ENSP00000371308:p.Ser1154Cys	258.0	0.0		115.0	31.0	NM_018451	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	37	CCDS9310.1	.	.	.	.	.	.	.	.	.	.	T	15.63	2.891335	0.52014	.	.	ENSG00000151849	ENST00000381884	T	0.37584	1.19	5.74	5.74	0.90152	.	0.573254	0.20095	N	0.099351	T	0.40719	0.1128	L	0.60455	1.87	0.80722	D	1	P	0.48503	0.911	B	0.43225	0.412	T	0.38993	-0.9635	10	0.62326	D	0.03	.	15.3236	0.74141	0.0:0.0:0.0:1.0	.	1154	Q9HC77	CENPJ_HUMAN	C	1154	ENSP00000371308:S1154C	ENSP00000371308:S1154C	S	-	1	0	CENPJ	24357431	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	4.665000	0.61547	2.317000	0.78254	0.460000	0.39030	AGT	.		0.363	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451	
CENPN	55839	ucsc.edu;bcgsc.ca	37	16	81058329	81058329	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr16:81058329A>G	ENST00000305850.5	+	8	1433	c.643A>G	c.(643-645)Act>Gct	p.T215A	RP11-303E16.3_ENST00000561808.1_RNA|RP11-303E16.3_ENST00000566390.1_RNA|CENPN_ENST00000428963.2_Missense_Mutation_p.T181A|CENPN_ENST00000439957.3_Missense_Mutation_p.T195A|RP11-303E16.3_ENST00000562315.1_RNA|CENPN_ENST00000393335.3_Missense_Mutation_p.T215A	NM_001100624.2|NM_001270474.1	NP_001094094.2|NP_001257403.1	Q96H22	CENPN_HUMAN	centromere protein N	215					CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|large_intestine(5)|lung(4)	10						GACCTTTGAAACTCACAACTC	0.299																																					p.T215A		.											.	CENPN	90	0			c.A643G						.						81.0	76.0	77.0					16																	81058329		1810	4071	5881	SO:0001583	missense	55839	exon8			TTTGAAACTCACA	AK026313	CCDS10931.1, CCDS42199.1, CCDS42200.1, CCDS58482.1, CCDS58483.1	16q23.2	2013-11-05	2006-06-15	2006-06-15	ENSG00000166451	ENSG00000166451			30873	protein-coding gene	gene with protein product		611509	"""chromosome 16 open reading frame 60"""	C16orf60		16622419	Standard	NM_001100625		Approved	FLJ13607, FLJ22660, BM039	uc002ffy.4	Q96H22	OTTHUMG00000137628	ENST00000305850.5:c.643A>G	16.37:g.81058329A>G	ENSP00000305608:p.Thr215Ala	91.0	0.0		38.0	4.0	NM_001100624	A8MZE6|B3KN53|B4DJD1|B4DPY7|C9JJM5|D3DUK8|E7ES30|E7ETS3|Q9NZ83	Missense_Mutation	SNP	ENST00000305850.5	37	CCDS42200.1	.	.	.	.	.	.	.	.	.	.	A	2.166	-0.390991	0.04932	.	.	ENSG00000166451	ENST00000305850;ENST00000439957;ENST00000393335;ENST00000428963	T;T;T;T	0.22134	2.22;2.22;2.22;1.97	5.4	4.3	0.51218	.	0.421195	0.26711	N	0.022896	T	0.22003	0.0530	L	0.56769	1.78	0.22378	N	0.999151	B;B;B;B	0.25390	0.125;0.015;0.053;0.015	B;B;B;B	0.30572	0.117;0.046;0.081;0.05	T	0.16958	-1.0385	10	0.62326	D	0.03	-11.3774	7.4247	0.27092	0.9043:0.0:0.0957:0.0	.	195;181;215;215	E7ETS3;E7ES30;A8MZE6;Q96H22	.;.;.;CENPN_HUMAN	A	215;195;215;181	ENSP00000305608:T215A;ENSP00000395235:T195A;ENSP00000377007:T215A;ENSP00000393991:T181A	ENSP00000305608:T215A	T	+	1	0	CENPN	79615830	0.997000	0.39634	0.992000	0.48379	0.018000	0.09664	2.563000	0.45922	2.158000	0.67659	0.533000	0.62120	ACT	.		0.299	CENPN-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269051.1	NM_018455	
CNOT4	4850	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	135107050	135107050	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr7:135107050T>C	ENST00000315544.5	-	3	506	c.227A>G	c.(226-228)cAa>cGa	p.Q76R	CNOT4_ENST00000451834.1_Missense_Mutation_p.Q76R|CNOT4_ENST00000361528.4_Missense_Mutation_p.Q76R|CNOT4_ENST00000423368.2_Missense_Mutation_p.Q76R|CNOT4_ENST00000356162.4_Missense_Mutation_p.Q76R|CNOT4_ENST00000428680.2_Missense_Mutation_p.Q76R|CNOT4_ENST00000541284.1_Missense_Mutation_p.Q76R|CNOT4_ENST00000414802.1_Missense_Mutation_p.Q76R	NM_001190848.1	NP_001177777.1	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	76					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|protein autoubiquitination (GO:0051865)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	22						CTTTATCCTTTGCAGCTCTTC	0.338																																					p.Q76R	Ovarian(51;766 1130 5502 35047 50875)	.											.	CNOT4	90	0			c.A227G						.						120.0	110.0	113.0					7																	135107050		1807	4082	5889	SO:0001583	missense	4850	exon3			ATCCTTTGCAGCT	AF180475	CCDS43650.1, CCDS47719.1, CCDS55164.1, CCDS55165.1, CCDS55166.1, CCDS55167.1	7q33	2013-09-19			ENSG00000080802	ENSG00000080802		"""RNA binding motif (RRM) containing"""	7880	protein-coding gene	gene with protein product		604911		NOT4		10637334	Standard	NM_013316		Approved	CLONE243, NOT4H	uc011kpy.2	O95628	OTTHUMG00000155568	ENST00000315544.5:c.227A>G	7.37:g.135107050T>C	ENSP00000326731:p.Gln76Arg	272.0	0.0		206.0	34.0	NM_001190850	B7Z6I4|E7ET38|F8VQP3|O95339|O95627|Q8IYM7|Q8NCL0|Q9NPQ1|Q9NZN6	Missense_Mutation	SNP	ENST00000315544.5	37	CCDS55166.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.305288	0.60305	.	.	ENSG00000080802	ENST00000541284;ENST00000451834;ENST00000423368;ENST00000262563;ENST00000361528;ENST00000414802;ENST00000356162;ENST00000428680;ENST00000315544	T;T;T;T;T;T;T;T	0.43688	0.95;0.94;0.95;0.95;0.95;0.95;0.94;0.94	5.97	5.97	0.96955	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.48223	0.1488	N	0.20328	0.56	0.80722	D	1	B;B;B;B;P;P	0.48294	0.038;0.022;0.012;0.021;0.908;0.908	B;B;B;B;P;P	0.61397	0.018;0.041;0.006;0.013;0.888;0.888	T	0.45760	-0.9239	10	0.40728	T	0.16	-5.4292	16.1343	0.81471	0.0:0.0:0.0:1.0	.	76;76;76;76;76;76	E7ET38;F8VQP3;O95628;O95628-2;O95628-4;O95628-8	.;.;CNOT4_HUMAN;.;.;.	R	76	ENSP00000445508:Q76R;ENSP00000388491:Q76R;ENSP00000406777:Q76R;ENSP00000354673:Q76R;ENSP00000416532:Q76R;ENSP00000348485:Q76R;ENSP00000399108:Q76R;ENSP00000326731:Q76R	ENSP00000262563:Q76R	Q	-	2	0	CNOT4	134757590	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.288000	0.76882	0.533000	0.62120	CAA	.		0.338	CNOT4-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_013316	
COL6A6	131873	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	130368255	130368255	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:130368255C>A	ENST00000358511.6	+	32	5613	c.5582C>A	c.(5581-5583)gCa>gAa	p.A1861E	COL6A6_ENST00000453409.2_Missense_Mutation_p.A1861E	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1861	Nonhelical region.|VWFA 8. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CTTCCGGGGGCACACACGAGA	0.527																																					p.A1861E		.											.	COL6A6	76	0			c.C5582A						.						25.0	26.0	26.0					3																	130368255		1976	4152	6128	SO:0001583	missense	131873	exon32			CGGGGGCACACAC	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.5582C>A	3.37:g.130368255C>A	ENSP00000351310:p.Ala1861Glu	115.0	1.0		139.0	21.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	C	3.349	-0.133056	0.06711	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.82344	-1.6;-1.6	5.45	3.31	0.37934	von Willebrand factor, type A (3);	.	.	.	.	T	0.70692	0.3253	L	0.43152	1.355	0.09310	N	1	B	0.28470	0.213	B	0.28465	0.09	T	0.57412	-0.7816	9	0.02654	T	1	.	6.3226	0.21227	0.0:0.6171:0.0:0.3829	.	1861	A6NMZ7	CO6A6_HUMAN	E	1861	ENSP00000351310:A1861E;ENSP00000399236:A1861E	ENSP00000351310:A1861E	A	+	2	0	COL6A6	131850945	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	0.305000	0.19254	1.291000	0.44653	0.462000	0.41574	GCA	.		0.527	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
COMMD3	23412	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	22606865	22606866	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr10:22606865_22606866insG	ENST00000376836.3	+	2	636_637	c.192_193insG	c.(193-195)gcafs	p.A65fs	COMMD3_ENST00000483684.1_3'UTR|COMMD3-BMI1_ENST00000463409.2_3'UTR|COMMD3-BMI1_ENST00000602390.1_Frame_Shift_Ins_p.A65fs	NM_012071.3	NP_036203.1	Q9UBI1	COMD3_HUMAN	COMM domain containing 3	65										kidney(2)|lung(2)|ovary(1)	5						ATTGTCATGCAGCAGCTGCAAC	0.347																																					p.A64fs		.											.	COMMD3	115	0			c.192_193insG						.																																			SO:0001589	frameshift_variant	23412	exon2			TCATGCAGCAGCT	AY542159	CCDS7137.1	10p12.2	2012-09-20	2004-02-13	2004-02-18	ENSG00000148444	ENSG00000148444			23332	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 8"""	C10orf8		11042152, 15799966	Standard	NM_012071		Approved	BUP		Q9UBI1	OTTHUMG00000017806	ENST00000376836.3:c.193dupG	10.37:g.22606866_22606866dupG	ENSP00000366032:p.Ala65fs	305.0	0.0		368.0	63.0	NM_012071	D3DRU7|Q5T8Y9	Frame_Shift_Ins	INS	ENST00000376836.3	37	CCDS7137.1																																																																																			.		0.347	COMMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047159.1	NM_012071	
CRMP1	1400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	5837733	5837733	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr4:5837733C>T	ENST00000397890.2	-	11	1404	c.1190G>A	c.(1189-1191)aGg>aAg	p.R397K	CRMP1_ENST00000324989.7_Missense_Mutation_p.R511K|CRMP1_ENST00000512574.1_Missense_Mutation_p.R395K|CRMP1_ENST00000511535.1_5'UTR	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	397					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CCGCCCTTTCCTTGGGTACAG	0.527																																					p.R511K		.											.	CRMP1	92	0			c.G1532A						.						145.0	133.0	137.0					4																	5837733		2203	4300	6503	SO:0001583	missense	1400	exon11			CCTTTCCTTGGGT	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.1190G>A	4.37:g.5837733C>T	ENSP00000380987:p.Arg397Lys	142.0	0.0		91.0	18.0	NM_001014809	A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	ENST00000397890.2	37	CCDS43207.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.719167	0.89205	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	D;D;D	0.89939	-2.59;-2.59;-2.59	4.33	4.33	0.51752	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.85643	0.5744	N	0.21508	0.67	0.80722	D	1	B;B;B;P	0.42357	0.062;0.214;0.011;0.777	B;B;B;P	0.47346	0.177;0.147;0.042;0.544	D	0.85496	0.1188	10	0.36615	T	0.2	-23.1461	16.3427	0.83092	0.0:1.0:0.0:0.0	.	511;395;397;334	A0EJG6;E9PD68;Q14194;B3KT07	.;.;DPYL1_HUMAN;.	K	511;397;397;395	ENSP00000321606:R511K;ENSP00000380987:R397K;ENSP00000425742:R395K	ENSP00000321606:R511K	R	-	2	0	CRMP1	5888634	0.954000	0.32549	0.972000	0.41901	0.949000	0.60115	7.309000	0.78937	2.418000	0.82041	0.508000	0.49915	AGG	.		0.527	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1	NM_001313	
CRTC2	200186	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	153924495	153924495	+	Splice_Site	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:153924495T>C	ENST00000368633.1	-	10	1123	c.996A>G	c.(994-996)ccA>ccG	p.P332P	CRTC2_ENST00000368630.3_Intron|CRTC2_ENST00000476883.1_5'Flank	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	332					gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)			NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GTCACTCACCTGGTGCATCAT	0.602																																					p.P332P		.											.	CRTC2	228	0			c.A996G						.						51.0	50.0	51.0					1																	153924495		2202	4299	6501	SO:0001630	splice_region_variant	200186	exon10			CTCACCTGGTGCA	AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.997+1A>G	1.37:g.153924495T>C		77.0	1.0		65.0	21.0	NM_181715	Q6UUV8|Q7Z3X7|Q8N332	Silent	SNP	ENST00000368633.1	37	CCDS30875.1																																																																																			.		0.602	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715	Silent
CSPG4	1464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	75968322	75968322	+	Missense_Mutation	SNP	C	C	T	rs370893364		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr15:75968322C>T	ENST00000308508.5	-	10	6630	c.6538G>A	c.(6538-6540)Gag>Aag	p.E2180K	AC105020.1_ENST00000435356.1_5'Flank|CTD-2026K11.1_ENST00000569467.1_RNA	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	2180	Cysteine-containing.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CGGGCGGCCTCGGGGACACTG	0.701																																					p.E2180K		.											.	CSPG4	229	0			c.G6538A						.	C	LYS/GLU	1,4389		0,1,2194	20.0	21.0	21.0		6538	4.3	0.9	15		21	0,8584		0,0,4292	no	missense	CSPG4	NM_001897.4	56	0,1,6486	TT,TC,CC		0.0,0.0228,0.0077	benign	2180/2323	75968322	1,12973	2195	4292	6487	SO:0001583	missense	1464	exon10			CGGCCTCGGGGAC	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.6538G>A	15.37:g.75968322C>T	ENSP00000312506:p.Glu2180Lys	23.0	0.0		33.0	12.0	NM_001897	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	C	5.218	0.225765	0.09916	2.28E-4	0.0	ENSG00000173546	ENST00000308508;ENST00000537176	T	0.19394	2.15	5.26	4.35	0.52113	.	0.516931	0.18538	N	0.138300	T	0.15609	0.0376	L	0.58101	1.795	0.09310	N	1	P	0.35155	0.487	B	0.16289	0.015	T	0.17561	-1.0365	10	0.25751	T	0.34	.	7.5514	0.27800	0.0:0.7283:0.1811:0.0906	.	2180	Q6UVK1	CSPG4_HUMAN	K	2180;212	ENSP00000312506:E2180K	ENSP00000312506:E2180K	E	-	1	0	CSPG4	73755377	0.015000	0.18098	0.866000	0.34008	0.380000	0.30137	0.295000	0.19065	1.228000	0.43614	0.511000	0.50034	GAG	.		0.701	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
CYP7A1	1581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	59409293	59409293	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr8:59409293G>A	ENST00000301645.3	-	3	915	c.778C>T	c.(778-780)Cgc>Tgc	p.R260C		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	260					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				AGAAACATGCGCAGGCTGATC	0.527									Neonatal Giant Cell Hepatitis																												p.R260C		.											.	CYP7A1	91	0			c.C778T						.						216.0	217.0	217.0					8																	59409293		2203	4300	6503	SO:0001583	missense	1581	exon3	Familial Cancer Database	Neonatal Hemochromatosis	ACATGCGCAGGCT	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.778C>T	8.37:g.59409293G>A	ENSP00000301645:p.Arg260Cys	203.0	0.0		172.0	41.0	NM_000780	P78454|Q3MIL8|Q7KZ19	Missense_Mutation	SNP	ENST00000301645.3	37	CCDS6171.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.185375	0.38609	.	.	ENSG00000167910	ENST00000301645	T	0.12361	2.69	4.16	4.16	0.48862	.	0.141832	0.64402	D	0.000007	T	0.41858	0.1177	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.46512	-0.9186	10	0.39692	T	0.17	-10.8183	16.8184	0.85739	0.0:0.0:1.0:0.0	.	260	P22680	CP7A1_HUMAN	C	260	ENSP00000301645:R260C	ENSP00000301645:R260C	R	-	1	0	CYP7A1	59571847	1.000000	0.71417	0.998000	0.56505	0.025000	0.11179	3.613000	0.54152	1.992000	0.58205	0.563000	0.77884	CGC	.		0.527	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378190.1	NM_000780	
DDB2	1643	ucsc.edu;bcgsc.ca	37	11	47260382	47260382	+	Silent	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr11:47260382A>G	ENST00000256996.4	+	10	1461	c.1266A>G	c.(1264-1266)gaA>gaG	p.E422E	DDB2_ENST00000378600.3_Silent_p.E233E|DDB2_ENST00000378601.3_3'UTR|DDB2_ENST00000378603.3_Silent_p.E358E|ACP2_ENST00000525230.1_5'Flank	NM_000107.2	NP_000098.1	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2, 48kDa	422					DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|pyrimidine dimer repair (GO:0006290)|response to UV (GO:0009411)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(1)	17						GCCAGGAGGAAGCCAGGACAC	0.542			"""Mis, N"""			"""skin basal cell, skin squamous cell, melanoma"""		Direct reversal of damage;Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.E422E		.	yes	Rec		Xeroderma pigmentosum (E)	11	11p12	1643	damage-specific DNA binding protein 2		E	.	DDB2	971	0			c.A1266G						.						83.0	72.0	76.0					11																	47260382		2201	4298	6499	SO:0001819	synonymous_variant	1643	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	GGAGGAAGCCAGG		CCDS7927.1, CCDS73284.1	11p12-p11	2014-09-17	2002-08-29			ENSG00000134574		"""WD repeat domain containing"""	2718	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group E protein"", ""UV-damaged DNA-binding protein 2"", ""DDB p48 subunit"""	600811	"""damage-specific DNA binding protein 2 (48kD)"""			8407967, 8530102	Standard	NM_000107		Approved	DDBB, UV-DDB2, FLJ34321	uc001neb.2	Q92466		ENST00000256996.4:c.1266A>G	11.37:g.47260382A>G		43.0	0.0		38.0	4.0	NM_000107	B2R875|Q76E54|Q76E55|Q76E56|Q76E57	Silent	SNP	ENST00000256996.4	37	CCDS7927.1																																																																																			.		0.542	DDB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000107	
DMD	1756	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	31496394	31496394	+	Silent	SNP	G	G	A	rs149776669		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:31496394G>A	ENST00000357033.4	-	59	8972	c.8766C>T	c.(8764-8766)tcC>tcT	p.S2922S	DMD_ENST00000541735.1_Silent_p.S462S|DMD_ENST00000343523.2_Silent_p.S462S|DMD_ENST00000445312.1_5'Flank|DMD_ENST00000359836.1_Silent_p.S462S|DMD_ENST00000474231.1_Silent_p.S462S|DMD_ENST00000378677.2_Silent_p.S2918S|DMD_ENST00000378707.3_Silent_p.S462S	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2922					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GCCAGTCAGCGGAGTGCAGGT	0.532																																					p.S2922S		.											.	DMD	265	0			c.C8766T						.	G	,,,,,,,,,,,,	1,3832		0,1,1630,571	71.0	64.0	66.0		8742,8766,8397,8754,8397,4743,4734,1386,579,1386,1386,1386,1386	-7.7	0.0	X	dbSNP_134	66	0,6728		0,0,2428,1872	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	DMD	NM_000109.3,NM_004006.2,NM_004007.2,NM_004009.3,NM_004010.3,NM_004011.3,NM_004012.3,NM_004013.2,NM_004014.2,NM_004020.3,NM_004021.2,NM_004022.2,NM_004023.2	,,,,,,,,,,,,	0,1,4058,2443	AA,AG,GG,G		0.0,0.0261,0.0095	,,,,,,,,,,,,	2914/3678,2922/3686,2799/3563,2918/3682,2799/3563,1581/2345,1578/2342,462/1226,193/957,462/1116,462/1244,462/1231,462/1134	31496394	1,10560	2202	4300	6502	SO:0001819	synonymous_variant	1756	exon59			GTCAGCGGAGTGC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8766C>T	X.37:g.31496394G>A		246.0	1.0		285.0	47.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	4.741	0.137851	0.09032	2.61E-4	0.0	ENSG00000198947	ENST00000465285	.	.	.	5.4	-7.67	0.01272	.	.	.	.	.	T	0.34513	0.0900	.	.	.	0.58432	D	0.99999	.	.	.	.	.	.	T	0.38693	-0.9649	4	.	.	.	.	1.7386	0.02947	0.3737:0.0995:0.3221:0.2048	.	.	.	.	C	651	.	.	R	-	1	0	DMD	31406315	0.833000	0.29383	0.047000	0.18901	0.750000	0.42670	0.135000	0.15952	-1.636000	0.01533	0.529000	0.55759	CGC	G|1.000;A|0.000		0.532	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
DUSP10	11221	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	221912367	221912367	+	Silent	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:221912367G>A	ENST00000366899.3	-	2	958	c.720C>T	c.(718-720)acC>acT	p.T240T	DUSP10_ENST00000323825.3_Intron|DUSP10_ENST00000468085.1_5'Flank|DUSP10_ENST00000544095.1_5'Flank	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10	240	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		TTGGTTCATTGGTATTCTCAT	0.458																																					p.T240T		.											.	DUSP10	659	0			c.C720T						.						129.0	134.0	132.0					1																	221912367		2203	4300	6503	SO:0001819	synonymous_variant	11221	exon2			TTCATTGGTATTC	AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.720C>T	1.37:g.221912367G>A		234.0	0.0		156.0	19.0	NM_007207	D3DTB4|Q6GSI4|Q9H9Z5	Silent	SNP	ENST00000366899.3	37	CCDS1528.1																																																																																			.		0.458	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090716.1	NM_007207	
EIF4G1	1981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	184039489	184039489	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:184039489G>T	ENST00000346169.2	+	10	1388	c.1117G>T	c.(1117-1119)Gag>Tag	p.E373*	EIF4G1_ENST00000382330.3_Nonsense_Mutation_p.E380*|EIF4G1_ENST00000411531.1_Nonsense_Mutation_p.E333*|EIF4G1_ENST00000434061.2_Nonsense_Mutation_p.E177*|EIF4G1_ENST00000427845.1_Nonsense_Mutation_p.E286*|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000435046.2_Nonsense_Mutation_p.E177*|EIF4G1_ENST00000424196.1_Nonsense_Mutation_p.E380*|EIF4G1_ENST00000319274.6_Nonsense_Mutation_p.E373*|EIF4G1_ENST00000342981.4_Nonsense_Mutation_p.E373*|EIF4G1_ENST00000441154.1_Nonsense_Mutation_p.E209*|EIF4G1_ENST00000392537.2_Nonsense_Mutation_p.E286*|EIF4G1_ENST00000352767.3_Nonsense_Mutation_p.E380*|EIF4G1_ENST00000350481.5_Nonsense_Mutation_p.E209*|EIF4G1_ENST00000414031.1_Nonsense_Mutation_p.E333*	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	373					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCTGGAACCAGAGGTGGAGTC	0.567																																					p.E380X		.											.	EIF4G1	344	0			c.G1138T						.						131.0	138.0	136.0					3																	184039489		2203	4300	6503	SO:0001587	stop_gained	1981	exon11			GAACCAGAGGTGG	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.1117G>T	3.37:g.184039489G>T	ENSP00000316879:p.Glu373*	163.0	0.0		135.0	21.0	NM_001194946	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Nonsense_Mutation	SNP	ENST00000346169.2	37	CCDS3259.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.974077	0.74246	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000450424;ENST00000421110;ENST00000382330;ENST00000426123;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000444861;ENST00000441154;ENST00000434061;ENST00000457456;ENST00000435046	.	.	.	5.37	5.37	0.77165	.	0.569134	0.17681	N	0.165603	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-21.7267	12.207	0.54358	0.0:0.171:0.829:0.0	.	.	.	.	X	373;333;286;373;380;380;314;209;380;286;373;373;380;333;209;209;177;177;177	.	ENSP00000323737:E373X	E	+	1	0	EIF4G1	185522183	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.483000	0.66838	2.793000	0.96121	0.563000	0.77884	GAG	.		0.567	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917	
ENPP7	339221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	77711821	77711821	+	Silent	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:77711821G>A	ENST00000328313.5	+	5	1574	c.1353G>A	c.(1351-1353)gtG>gtA	p.V451V		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7											breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TGGGGACCGTGATTCTTCTGT	0.642																																					p.V451V		.											.	ENPP7	92	0			c.G1353A						.						88.0	80.0	83.0					17																	77711821		2203	4300	6503	SO:0001819	synonymous_variant	339221	exon5			GACCGTGATTCTT	AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.1353G>A	17.37:g.77711821G>A		43.0	0.0		38.0	16.0	NM_178543		Silent	SNP	ENST00000328313.5	37	CCDS11763.1																																																																																			.		0.642	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	NM_178543	
FAHD2A	51011	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	96072737	96072737	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr2:96072737C>A	ENST00000233379.4	+	3	447	c.294C>A	c.(292-294)ttC>ttA	p.F98L	FAHD2A_ENST00000447036.1_Missense_Mutation_p.F98L	NM_016044.2	NP_057128.2	Q96GK7	FAH2A_HUMAN	fumarylacetoacetate hydrolase domain containing 2A	98							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)	8						AGGTAACCTTCCTGGCTCCAG	0.582																																					p.F98L		.											.	FAHD2A	91	0			c.C294A						.						109.0	85.0	93.0					2																	96072737		2203	4300	6503	SO:0001583	missense	51011	exon3			AACCTTCCTGGCT	AF151863	CCDS2014.1	2q11.2	2008-02-05			ENSG00000115042	ENSG00000115042			24252	protein-coding gene	gene with protein product							Standard	NM_016044		Approved	CGI-105	uc002sur.3	Q96GK7	OTTHUMG00000130397	ENST00000233379.4:c.294C>A	2.37:g.96072737C>A	ENSP00000233379:p.Phe98Leu	547.0	1.0		391.0	51.0	NM_016044	Q9Y3B0	Missense_Mutation	SNP	ENST00000233379.4	37	CCDS2014.1	.	.	.	.	.	.	.	.	.	.	C	1.725	-0.495545	0.04291	.	.	ENSG00000115042	ENST00000447036;ENST00000233379;ENST00000418606	D;D;D	0.96011	-3.88;-3.88;-3.88	3.35	1.49	0.22878	Fumarylacetoacetase, C-terminal-related (2);	0.143205	0.48767	N	0.000178	T	0.80171	0.4574	N	0.01405	-0.89	0.30896	N	0.729804	B	0.02656	0.0	B	0.01281	0.0	T	0.74124	-0.3766	10	0.02654	T	1	.	7.2151	0.25955	0.0:0.7569:0.0:0.2431	.	98	Q96GK7	FAH2A_HUMAN	L	98	ENSP00000406424:F98L;ENSP00000233379:F98L;ENSP00000390528:F98L	ENSP00000233379:F98L	F	+	3	2	FAHD2A	95436464	0.998000	0.40836	0.999000	0.59377	0.964000	0.63967	0.303000	0.19210	0.724000	0.32296	0.561000	0.74099	TTC	.		0.582	FAHD2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252778.1	NM_016044	
FAM133A	286499	broad.mit.edu;bcgsc.ca	37	X	92965114	92965114	+	Silent	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:92965114A>G	ENST00000355813.5	+	4	1222	c.696A>G	c.(694-696)aaA>aaG	p.K232K	FAM133A_ENST00000322139.4_Silent_p.K232K|FAM133A_ENST00000332647.4_Silent_p.K232K|FAM133A_ENST00000538690.1_Silent_p.K232K	NM_001171109.1|NM_173698.2	NP_001164580.1|NP_775969.1	Q8N9E0	F133A_HUMAN	family with sequence similarity 133, member A	232	Lys-rich.									breast(2)|endometrium(2)|large_intestine(8)|lung(7)|upper_aerodigestive_tract(1)	20						agcacaagaaacatagtaaga	0.373																																					p.K232K		.											.	FAM133A	130	0			c.A696G						.						24.0	24.0	24.0					X																	92965114		2183	4260	6443	SO:0001819	synonymous_variant	286499	exon4			CAAGAAACATAGT	AK094978	CCDS14466.1	Xq21.32	2010-05-04			ENSG00000179083	ENSG00000179083			26748	protein-coding gene	gene with protein product	"""cancer/testis antigen 115"""						Standard	NM_173698		Approved	RP1-32F7.2, FLJ37659, CT115	uc022bzv.1	Q8N9E0	OTTHUMG00000021975	ENST00000355813.5:c.696A>G	X.37:g.92965114A>G		238.0	0.0		91.0	4.0	NM_173698		Silent	SNP	ENST00000355813.5	37	CCDS14466.1																																																																																			.		0.373	FAM133A-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057452.1	NM_173698	
FAM134B	54463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	16474884	16474884	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr5:16474884G>A	ENST00000306320.9	-	9	1546	c.1460C>T	c.(1459-1461)tCa>tTa	p.S487L	FAM134B_ENST00000399793.2_Missense_Mutation_p.S346L	NM_001034850.2	NP_001030022.1	Q9H6L5	F134B_HUMAN	family with sequence similarity 134, member B	487					sensory perception of pain (GO:0019233)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(1)	16						AAGGAAACCTGAAGACTTCTT	0.383																																					p.S487L		.											.	FAM134B	137	0			c.C1460T						.						123.0	118.0	119.0					5																	16474884		1877	4111	5988	SO:0001583	missense	54463	exon9			AAACCTGAAGACT	BC053326	CCDS43304.1, CCDS43305.1	5p15.1	2014-09-17			ENSG00000154153	ENSG00000154153			25964	protein-coding gene	gene with protein product		613114				19838196, 24327336	Standard	NM_001034850		Approved	FLJ20152	uc003jfs.3	Q9H6L5	OTTHUMG00000161788	ENST00000306320.9:c.1460C>T	5.37:g.16474884G>A	ENSP00000304642:p.Ser487Leu	135.0	0.0		115.0	54.0	NM_001034850	Q69YN8|Q9H6K6|Q9H764|Q9NXM8	Missense_Mutation	SNP	ENST00000306320.9	37	CCDS43304.1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.317078	0.60524	.	.	ENSG00000154153	ENST00000399793;ENST00000306320	T;T	0.55052	0.63;0.54	5.82	4.96	0.65561	.	0.319926	0.34046	N	0.004312	T	0.50137	0.1598	L	0.55481	1.735	0.48830	D	0.999713	P;B	0.46395	0.877;0.421	B;B	0.40636	0.335;0.221	T	0.56098	-0.8035	10	0.62326	D	0.03	-1.5733	14.657	0.68841	0.0694:0.0:0.9306:0.0	.	487;346	Q9H6L5;Q9H6L5-2	F134B_HUMAN;.	L	346;487	ENSP00000382691:S346L;ENSP00000304642:S487L	ENSP00000304642:S487L	S	-	2	0	FAM134B	16527884	1.000000	0.71417	0.983000	0.44433	0.990000	0.78478	5.819000	0.69243	1.464000	0.47987	0.655000	0.94253	TCA	.		0.383	FAM134B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000366090.1	NM_001034850	
FAM160B2	64760	ucsc.edu;bcgsc.ca	37	8	21958157	21958157	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr8:21958157A>G	ENST00000289921.7	+	11	1440	c.1394A>G	c.(1393-1395)gAg>gGg	p.E465G		NM_022749.5	NP_073586.5	Q86V87	F16B2_HUMAN	family with sequence similarity 160, member B2	465										endometrium(2)|kidney(1)|lung(2)|prostate(3)|urinary_tract(1)	9						AAGCCCCACGAGGGGATCATC	0.632																																					p.E465G		.											.	.	.	0			c.A1394G						.						56.0	63.0	61.0					8																	21958157		2015	4178	6193	SO:0001583	missense	64760	exon11			CCCACGAGGGGAT	AK025454	CCDS6021.2	8p21.3	2012-11-30	2008-06-05	2008-06-05	ENSG00000158863	ENSG00000158863			16492	protein-coding gene	gene with protein product			"""retinoic acid induced 16"""	RAI16		22971576, 15626329	Standard	XR_247128		Approved	FLJ21801	uc011kyx.2	Q86V87	OTTHUMG00000097088	ENST00000289921.7:c.1394A>G	8.37:g.21958157A>G	ENSP00000289921:p.Glu465Gly	71.0	2.0		52.0	4.0	NM_022749	B2RDQ5|B3KNX1|Q2M211|Q71JB5|Q7L3J6|Q969T0|Q9H6W4	Missense_Mutation	SNP	ENST00000289921.7	37	CCDS6021.2	.	.	.	.	.	.	.	.	.	.	.	15.51	2.855351	0.51376	.	.	ENSG00000158863	ENST00000289921	T	0.35048	1.33	5.59	4.4	0.53042	.	0.218544	0.47852	D	0.000216	T	0.58323	0.2114	M	0.77103	2.36	0.47698	D	0.999491	D	0.71674	0.998	D	0.74023	0.982	T	0.61098	-0.7131	10	0.72032	D	0.01	-27.5559	10.8331	0.46671	0.8413:0.1587:0.0:0.0	.	465	Q86V87	F16B2_HUMAN	G	465	ENSP00000289921:E465G	ENSP00000289921:E465G	E	+	2	0	FAM160B2	22014102	1.000000	0.71417	0.017000	0.16124	0.175000	0.22909	3.938000	0.56583	0.912000	0.36772	0.533000	0.62120	GAG	.		0.632	FAM160B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375334.2		
FBXO40	51725	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121341432	121341432	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:121341432A>T	ENST00000338040.4	+	3	1570	c.1156A>T	c.(1156-1158)Act>Tct	p.T386S		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	386					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		TTTGGGGATCACTGTGGAGGA	0.493																																					p.T386S		.											.	FBXO40	273	0			c.A1156T						.						117.0	108.0	111.0					3																	121341432		2203	4300	6503	SO:0001583	missense	51725	exon3			GGGATCACTGTGG	AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.1156A>T	3.37:g.121341432A>T	ENSP00000337510:p.Thr386Ser	130.0	0.0		99.0	8.0	NM_016298	B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	ENST00000338040.4	37	CCDS33835.1	.	.	.	.	.	.	.	.	.	.	A	1.432	-0.569853	0.03910	.	.	ENSG00000163833	ENST00000338040	T	0.42131	0.98	5.73	0.286	0.15710	.	0.714729	0.14513	N	0.315012	T	0.18467	0.0443	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.17107	-1.0380	10	0.11182	T	0.66	-3.7042	0.7414	0.00974	0.2981:0.3222:0.2113:0.1684	.	386	Q9UH90	FBX40_HUMAN	S	386	ENSP00000337510:T386S	ENSP00000337510:T386S	T	+	1	0	FBXO40	122824122	0.000000	0.05858	0.527000	0.27925	0.971000	0.66376	0.325000	0.19628	0.067000	0.16545	0.533000	0.62120	ACT	.		0.493	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355158.1	NM_016298	
FBXO9	26268	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	52957296	52957296	+	Silent	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr6:52957296C>T	ENST00000244426.6	+	7	925	c.753C>T	c.(751-753)taC>taT	p.Y251Y	FBXO9_ENST00000370939.3_Silent_p.Y207Y|FBXO9_ENST00000323557.7_Silent_p.Y241Y|RN7SL244P_ENST00000493405.2_RNA	NM_012347.4	NP_036479.1	Q9UK97	FBX9_HUMAN	F-box protein 9	251					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|protein ubiquitination (GO:0016567)|regulation of TOR signaling (GO:0032006)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(4)|lung(1)|pancreas(2)|skin(1)	9	Lung NSC(77;0.103)					TTGTTCCGTACACGTCCTGGA	0.418																																					p.Y251Y		.											.	FBXO9	227	0			c.C753T						.						181.0	171.0	174.0					6																	52957296		1869	4107	5976	SO:0001819	synonymous_variant	26268	exon7			TCCGTACACGTCC	AF155114	CCDS55022.1, CCDS55023.1, CCDS55024.1	6p12.3-p11.2	2004-06-15	2004-06-15		ENSG00000112146	ENSG00000112146		"""F-boxes /  ""other"""""	13588	protein-coding gene	gene with protein product		609091	"""F-box only protein 9"""			10531035, 10531037	Standard	NM_012347		Approved	FBX9, NY-REN-57	uc021zao.1	Q9UK97	OTTHUMG00000014869	ENST00000244426.6:c.753C>T	6.37:g.52957296C>T		398.0	2.0		257.0	49.0	NM_012347	A6NFW3|B3KMM6|O75986|Q59EH8|Q6PKH7|Q9NT57|Q9Y593	Silent	SNP	ENST00000244426.6	37	CCDS55023.1																																																																																			.		0.418	FBXO9-002	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040950.3		
FLNA	2316	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153595782	153595782	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:153595782G>A	ENST00000369850.3	-	5	1087	c.851C>T	c.(850-852)gCc>gTc	p.A284V	FLNA_ENST00000360319.4_Missense_Mutation_p.A284V|FLNA_ENST00000422373.1_Missense_Mutation_p.A284V|FLNA_ENST00000344736.4_Missense_Mutation_p.A284V	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	284					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GTAGGCACGGGCTTTCTTCGG	0.622																																					p.A284V		.											.	FLNA	599	0			c.C851T						.						49.0	53.0	52.0					X																	153595782		2183	4275	6458	SO:0001583	missense	2316	exon5			GCACGGGCTTTCT	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.851C>T	X.37:g.153595782G>A	ENSP00000358866:p.Ala284Val	60.0	0.0		35.0	9.0	NM_001456	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652338	0.47362	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65	5.19	5.19	0.71726	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	U	0.000002	T	0.70272	0.3205	N	0.01789	-0.72	0.80722	D	1	P;B	0.40230	0.708;0.007	P;B	0.45794	0.493;0.028	T	0.74902	-0.3506	10	0.29301	T	0.29	.	17.8253	0.88664	0.0:0.0:1.0:0.0	.	284;284	P21333-2;P21333	.;FLNA_HUMAN	V	284;257;284;284;284	ENSP00000353467:A284V;ENSP00000416926:A284V;ENSP00000358866:A284V;ENSP00000358863:A284V	ENSP00000358863:A284V	A	-	2	0	FLNA	153248976	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.883000	0.87264	2.140000	0.66376	0.597000	0.82753	GCC	.		0.622	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3		
FLNC	2318	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	128489494	128489494	+	Silent	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr7:128489494G>A	ENST00000325888.8	+	30	5322	c.5061G>A	c.(5059-5061)ggG>ggA	p.G1687G	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Silent_p.G1687G	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1687					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CGCCGGATGGGGCAGAGCTCG	0.602																																					p.G1687G		.											.	FLNC	141	0			c.G5061A						.						93.0	111.0	105.0					7																	128489494		2191	4275	6466	SO:0001819	synonymous_variant	2318	exon30			GGATGGGGCAGAG	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5061G>A	7.37:g.128489494G>A		94.0	0.0		73.0	10.0	NM_001127487	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	ENST00000325888.8	37	CCDS43644.1																																																																																			.		0.602	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
FOXH1	8928	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	145700607	145700607	+	Missense_Mutation	SNP	C	C	A	rs150426097		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr8:145700607C>A	ENST00000377317.4	-	2	790	c.212G>T	c.(211-213)aGg>aTg	p.R71M	FOXH1_ENST00000525197.1_Splice_Site	NM_003923.2	NP_003914.1	O75593	FOXH1_HUMAN	forkhead box H1	71					aorta morphogenesis (GO:0035909)|axial mesoderm development (GO:0048318)|cardiac right ventricle morphogenesis (GO:0003215)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|heart looping (GO:0001947)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|secondary heart field specification (GO:0003139)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular trabecula myocardium morphogenesis (GO:0003222)	activin responsive factor complex (GO:0032444)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|bHLH transcription factor binding (GO:0043425)|co-SMAD binding (GO:0070410)|enhancer binding (GO:0035326)|protein domain specific binding (GO:0019904)|R-SMAD binding (GO:0070412)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.76e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GTAGTCTTCCCTGAAGAAGGG	0.677																																					p.R71M		.											.	FOXH1	226	0			c.G212T						.						43.0	42.0	43.0					8																	145700607		2202	4299	6501	SO:0001583	missense	8928	exon2			TCTTCCCTGAAGA	AF076292	CCDS6428.1	8q24.3	2014-08-12			ENSG00000160973			"""Forkhead boxes"""	3814	protein-coding gene	gene with protein product		603621				9702198	Standard	NM_003923		Approved	FAST1	uc003zdc.3	O75593	OTTHUMG00000165172	ENST00000377317.4:c.212G>T	8.37:g.145700607C>A	ENSP00000366534:p.Arg71Met	59.0	0.0		58.0	13.0	NM_003923	D3DWM4	Missense_Mutation	SNP	ENST00000377317.4	37	CCDS6428.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.886553	0.51908	.	.	ENSG00000160973	ENST00000377317;ENST00000292541	D	0.96427	-4.01	5.09	0.612	0.17591	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.239729	0.39985	N	0.001219	D	0.94804	0.8322	M	0.89968	3.075	0.36732	D	0.881752	P	0.38617	0.64	B	0.33620	0.167	D	0.92021	0.5626	10	0.87932	D	0	-22.7546	5.9088	0.19016	0.141:0.5887:0.0:0.2703	.	71	O75593	FOXH1_HUMAN	M	71;98	ENSP00000366534:R71M	ENSP00000292541:R98M	R	-	2	0	FOXH1	145671415	0.326000	0.24669	0.999000	0.59377	0.971000	0.66376	0.255000	0.18333	0.177000	0.19895	0.563000	0.77884	AGG	C|1.000;T|0.000		0.677	FOXH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382451.1		
FZD10	11211	broad.mit.edu;bcgsc.ca	37	12	130648989	130648989	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr12:130648989T>C	ENST00000229030.4	+	1	1986	c.1502T>C	c.(1501-1503)gTg>gCg	p.V501A	FZD10-AS1_ENST00000505807.2_RNA|FZD10_ENST00000539839.1_3'UTR			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	501					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		ATCCCCGCCGTGGAGATCTTC	0.552																																					p.V501A		.											.	FZD10	658	0			c.T1502C						.						41.0	42.0	42.0					12																	130648989		2203	4300	6503	SO:0001583	missense	11211	exon1			CCGCCGTGGAGAT	AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.1502T>C	12.37:g.130648989T>C	ENSP00000229030:p.Val501Ala	73.0	0.0		55.0	7.0	NM_007197		Missense_Mutation	SNP	ENST00000229030.4	37	CCDS9267.1	.	.	.	.	.	.	.	.	.	.	T	17.09	3.300489	0.60195	.	.	ENSG00000111432	ENST00000229030	D	0.82711	-1.64	4.66	4.66	0.58398	GPCR, family 2-like (1);	0.076407	0.51477	U	0.000100	T	0.81240	0.4781	L	0.41906	1.305	0.53688	D	0.999973	P	0.37370	0.592	P	0.44422	0.449	T	0.81684	-0.0821	10	0.48119	T	0.1	.	14.1068	0.65096	0.0:0.0:0.0:1.0	.	501	Q9ULW2	FZD10_HUMAN	A	501	ENSP00000229030:V501A	ENSP00000229030:V501A	V	+	2	0	FZD10	129214942	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.515000	0.81761	1.726000	0.51525	0.459000	0.35465	GTG	.		0.552	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
GABRA5	2558	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	27114447	27114447	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr15:27114447T>G	ENST00000335625.5	+	3	940	c.52T>G	c.(52-54)Ttt>Gtt	p.F18V	GABRB3_ENST00000541819.2_Intron|GABRA5_ENST00000400081.3_Missense_Mutation_p.F18V|GABRA5_ENST00000355395.5_Missense_Mutation_p.F18V|GABRA5_ENST00000557449.1_3'UTR	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	18					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	CCTCCTTCTCTTTTGTATTTC	0.373																																					p.F18V		.											.	GABRA5	91	0			c.T52G						.						211.0	204.0	206.0					15																	27114447		1890	4111	6001	SO:0001583	missense	2558	exon3			CTTCTCTTTTGTA		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.52T>G	15.37:g.27114447T>G	ENSP00000335592:p.Phe18Val	409.0	1.0		234.0	48.0	NM_001165037	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	ENST00000335625.5	37	CCDS45194.1	.	.	.	.	.	.	.	.	.	.	T	14.69	2.611593	0.46631	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000557484;ENST00000400081;ENST00000554038;ENST00000554596;ENST00000554599	T;T;T;T;T;T	0.81415	-0.49;-0.49;-0.49;-1.16;-1.17;-1.49	5.82	3.52	0.40303	.	0.319851	0.30723	N	0.009004	T	0.58424	0.2121	N	0.08118	0	0.30420	N	0.778185	B	0.02656	0.0	B	0.01281	0.0	T	0.53322	-0.8455	10	0.44086	T	0.13	.	4.664	0.12657	0.1681:0.087:0.0:0.7449	.	18	P31644	GBRA5_HUMAN	V	18	ENSP00000335592:F18V;ENSP00000347557:F18V;ENSP00000382953:F18V;ENSP00000451527:F18V;ENSP00000450806:F18V;ENSP00000450717:F18V	ENSP00000335592:F18V	F	+	1	0	GABRA5	24665540	0.996000	0.38824	0.999000	0.59377	0.998000	0.95712	0.989000	0.29629	1.006000	0.39211	0.533000	0.62120	TTT	.		0.373	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1		
GALNT5	11227	ucsc.edu;bcgsc.ca	37	2	158167786	158167786	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr2:158167786A>T	ENST00000259056.4	+	10	3234	c.2749A>T	c.(2749-2751)Atc>Ttc	p.I917F		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	917	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						TTCTCAAAAGATCCTGAAAGT	0.358																																					p.I917F		.											.	GALNT5	290	0			c.A2749T						.						64.0	72.0	69.0					2																	158167786		2203	4300	6503	SO:0001583	missense	11227	exon10			CAAAAGATCCTGA	AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.2749A>T	2.37:g.158167786A>T	ENSP00000259056:p.Ile917Phe	88.0	2.0		58.0	9.0	NM_014568	A5PKZ1|Q9UGK7|Q9UHL6	Missense_Mutation	SNP	ENST00000259056.4	37	CCDS2203.1	.	.	.	.	.	.	.	.	.	.	A	13.37	2.215886	0.39201	.	.	ENSG00000136542	ENST00000259056	T	0.26518	1.73	5.93	3.49	0.39957	Ricin B-related lectin (1);Ricin B lectin (3);	0.367899	0.22842	N	0.054974	T	0.11410	0.0278	N	0.08118	0	0.26698	N	0.971212	B	0.09022	0.002	B	0.09377	0.004	T	0.17440	-1.0369	10	0.44086	T	0.13	.	4.6879	0.12767	0.6041:0.0:0.079:0.3169	.	917	Q7Z7M9	GALT5_HUMAN	F	917	ENSP00000259056:I917F	ENSP00000259056:I917F	I	+	1	0	GALNT5	157876032	0.976000	0.34144	0.893000	0.35052	0.707000	0.40811	1.624000	0.37018	0.456000	0.26937	0.533000	0.62120	ATC	.		0.358	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254925.2	NM_014568	
GJA8	2703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	147380863	147380863	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:147380863C>T	ENST00000369235.1	+	1	781	c.781C>T	c.(781-783)Cag>Tag	p.Q261*	GJA8_ENST00000240986.4_Nonsense_Mutation_p.Q261*			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	261					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					CTCCTCCATCCAGAAAGCCAA	0.567																																					p.Q261X	Melanoma(76;1255 1795 8195 52096)	.											.	GJA8	138	0			c.C781T						.						50.0	52.0	52.0					1																	147380863		2203	4300	6503	SO:0001587	stop_gained	2703	exon2			TCCATCCAGAAAG	U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.781C>T	1.37:g.147380863C>T	ENSP00000358238:p.Gln261*	74.0	0.0		66.0	31.0	NM_005267	A7L5M5|Q5VVN9|Q9NP25	Nonsense_Mutation	SNP	ENST00000369235.1	37	CCDS30834.1	.	.	.	.	.	.	.	.	.	.	c	34	5.391246	0.95988	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	.	.	.	4.4	4.4	0.53042	.	0.501871	0.14206	U	0.334393	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	17.1387	0.86747	0.0:1.0:0.0:0.0	.	.	.	.	X	261	.	ENSP00000240986:Q261X	Q	+	1	0	GJA8	145847487	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.798000	0.69095	2.267000	0.75376	0.313000	0.20887	CAG	.		0.567	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1	NM_005267	
GLO1	2739	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	38670784	38670784	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr6:38670784G>A	ENST00000373365.4	-	1	133	c.47C>T	c.(46-48)gCc>gTc	p.A16V		NM_006708.2	NP_006699.2	Q04760	LGUL_HUMAN	glyoxalase I	16					carbohydrate metabolic process (GO:0005975)|glutathione metabolic process (GO:0006749)|methylglyoxal metabolic process (GO:0009438)|negative regulation of apoptotic process (GO:0043066)|osteoclast differentiation (GO:0030316)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	lactoylglutathione lyase activity (GO:0004462)|zinc ion binding (GO:0008270)			lung(2)|ovary(2)|prostate(1)|urinary_tract(1)	6					Glutathione(DB00143)|Indomethacin(DB00328)	GCAACTGAGGGCGGCCTCGTC	0.701																																					p.A16V		.											.	GLO1	227	0			c.C47T						.						14.0	17.0	16.0					6																	38670784		2194	4288	6482	SO:0001583	missense	2739	exon1			CTGAGGGCGGCCT	L07837	CCDS4837.1	6p21.3-p21.1	2012-10-02			ENSG00000124767	ENSG00000124767	4.4.1.5		4323	protein-coding gene	gene with protein product	"""glyoxalase domain containing 1"""	138750				8449929, 7684374	Standard	NM_006708		Approved	GLOD1	uc003ooc.3	Q04760	OTTHUMG00000014636	ENST00000373365.4:c.47C>T	6.37:g.38670784G>A	ENSP00000362463:p.Ala16Val	76.0	0.0		51.0	9.0	NM_006708	B2R6P7|B4DDV0|P78375|Q59EL0|Q5TZW3|Q96FC0|Q96J41	Missense_Mutation	SNP	ENST00000373365.4	37	CCDS4837.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.903425	0.52333	.	.	ENSG00000124767	ENST00000373365	T	0.32272	1.46	5.65	5.65	0.86999	.	0.104479	0.64402	D	0.000003	T	0.08492	0.0211	N	0.08118	0	0.46167	D	0.998904	B	0.19935	0.04	B	0.17098	0.017	T	0.13845	-1.0494	10	0.23891	T	0.37	-21.9862	15.093	0.72211	0.0:0.0:1.0:0.0	.	16	Q04760	LGUL_HUMAN	V	16	ENSP00000362463:A16V	ENSP00000362463:A16V	A	-	2	0	GLO1	38778762	0.700000	0.27796	0.361000	0.25849	0.712000	0.41017	4.140000	0.58031	2.941000	0.99782	0.655000	0.94253	GCC	.		0.701	GLO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040438.2	NM_006708	
GON4L	54856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155723018	155723018	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:155723018C>T	ENST00000368331.1	-	29	5867	c.5819G>A	c.(5818-5820)aGa>aAa	p.R1940K	GON4L_ENST00000271883.5_Missense_Mutation_p.R1940K|GON4L_ENST00000437809.1_Missense_Mutation_p.R1940K	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1940					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CTCTCCCTTTCTGGTGGTCCT	0.567																																					p.R1940K		.											.	GON4L	93	0			c.G5819A						.						89.0	98.0	95.0					1																	155723018		2070	4196	6266	SO:0001583	missense	54856	exon29			CCCTTTCTGGTGG	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.5819G>A	1.37:g.155723018C>T	ENSP00000357315:p.Arg1940Lys	264.0	0.0		223.0	28.0	NM_001037533	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	37		.	.	.	.	.	.	.	.	.	.	C	11.91	1.780102	0.31502	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883	T;T;T	0.12879	2.64;2.64;2.64	5.32	4.41	0.53225	.	0.374424	0.25708	N	0.028831	T	0.03564	0.0102	L	0.29908	0.895	0.09310	N	1	B;B	0.29988	0.172;0.264	B;B	0.31101	0.058;0.124	T	0.37197	-0.9716	10	0.19147	T	0.46	.	11.8523	0.52417	0.0:0.9191:0.0:0.0809	.	1940;1940	Q3T8J9;Q3T8J9-3	GON4L_HUMAN;.	K	1940	ENSP00000396117:R1940K;ENSP00000357315:R1940K;ENSP00000271883:R1940K	ENSP00000271883:R1940K	R	-	2	0	GON4L	153989642	0.051000	0.20477	0.026000	0.17262	0.260000	0.26232	1.482000	0.35486	1.479000	0.48272	0.650000	0.86243	AGA	.		0.567	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
GRN	2896	ucsc.edu;bcgsc.ca	37	17	42428482	42428482	+	Silent	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:42428482C>T	ENST00000053867.3	+	8	848	c.786C>T	c.(784-786)tcC>tcT	p.S262S	GRN_ENST00000589265.1_Intron|GRN_ENST00000589923.1_Intron	NM_002087.2	NP_002078.1	P28799	GRN_HUMAN	granulin	262					blastocyst hatching (GO:0001835)|cell death (GO:0008219)|embryo implantation (GO:0007566)|positive regulation of epithelial cell proliferation (GO:0050679)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	growth factor activity (GO:0008083)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		AGTGCCTCTCCAAGGAGAACG	0.617											OREG0024459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S262S		.											.	GRN	517	0			c.C786T						.						112.0	104.0	107.0					17																	42428482		2203	4300	6503	SO:0001819	synonymous_variant	2896	exon8			CCTCTCCAAGGAG	M75161	CCDS11483.1	17q21.32	2014-09-17				ENSG00000030582			4601	protein-coding gene	gene with protein product	"""progranulin"""	138945				1417868, 9826678	Standard	XM_005257253		Approved	PCDGF, PGRN, CLN11	uc002igp.1	P28799		ENST00000053867.3:c.786C>T	17.37:g.42428482C>T		73.0	0.0	908	42.0	4.0	NM_002087	D3DX55|P23781|P23782|P23783|P23784|Q53HQ8|Q53Y88|Q540U8|Q9BWE7|Q9H8S1|Q9UCH0	Silent	SNP	ENST00000053867.3	37	CCDS11483.1																																																																																			.		0.617	GRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457766.1	NM_002087	
GSTK1	373156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	142964755	142964755	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr7:142964755C>A	ENST00000358406.5	+	6	537	c.466C>A	c.(466-468)Ctg>Atg	p.L156M	GSTK1_ENST00000443571.2_Missense_Mutation_p.L113M|GSTK1_ENST00000479303.1_Missense_Mutation_p.L212M|AC073342.12_ENST00000427392.1_RNA|GSTK1_ENST00000409500.3_Missense_Mutation_p.L144M	NM_015917.2	NP_057001.1	Q9Y2Q3	GSTK1_HUMAN	glutathione S-transferase kappa 1	156					epithelial cell differentiation (GO:0030855)|glutathione metabolic process (GO:0006749)|oxidation-reduction process (GO:0055114)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|peroxisome (GO:0005777)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|protein disulfide oxidoreductase activity (GO:0015035)|receptor binding (GO:0005102)			lung(4)	4	Melanoma(164;0.059)				Glutathione(DB00143)	CCAGGGACTTCTGGAAAAGAT	0.507																																					p.L212M		.											.	GSTK1	90	0			c.C634A						.						133.0	124.0	127.0					7																	142964755		2203	4300	6503	SO:0001583	missense	373156	exon5			GGACTTCTGGAAA		CCDS5877.1, CCDS47730.1, CCDS47731.1, CCDS47732.1	7q34	2012-06-21			ENSG00000197448	ENSG00000197448	2.5.1.18	"""Glutathione S-transferases / Mitochondrial (kappa)"""	16906	protein-coding gene	gene with protein product		602321				12720545, 14742434	Standard	NM_015917		Approved	GST13	uc003wcj.3	Q9Y2Q3	OTTHUMG00000152637	ENST00000358406.5:c.466C>A	7.37:g.142964755C>A	ENSP00000351181:p.Leu156Met	103.0	0.0		108.0	42.0	NM_001143679	B4DIH1|B4DSY2|Q6P4H0|Q7Z520|Q9P1S4	Missense_Mutation	SNP	ENST00000358406.5	37	CCDS5877.1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.823752	0.50739	.	.	ENSG00000197448	ENST00000409500;ENST00000443571;ENST00000358406;ENST00000479303	.	.	.	5.28	2.42	0.29668	Protein disulphide isomerase, central domain (1);DSBA-like thioredoxin domain (1);Thioredoxin-like fold (1);	0.140610	0.49305	N	0.000147	T	0.56558	0.1993	M	0.78285	2.405	0.09310	N	0.999999	D;D;D;D	0.89917	0.997;0.999;1.0;0.999	D;D;D;D	0.80764	0.988;0.979;0.994;0.988	T	0.46527	-0.9185	9	0.44086	T	0.13	-10.1516	3.6875	0.08334	0.2986:0.4751:0.1449:0.0813	.	144;113;212;156	Q9Y2Q3-3;Q9Y2Q3-4;Q9Y2Q3-2;Q9Y2Q3	.;.;.;GSTK1_HUMAN	M	144;113;156;212	.	ENSP00000351181:L156M	L	+	1	2	GSTK1	142674877	0.860000	0.29831	0.015000	0.15790	0.090000	0.18270	1.852000	0.39348	0.219000	0.20840	-0.310000	0.09108	CTG	.		0.507	GSTK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327091.1	NM_015917	
HPD	3242	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	122284995	122284995	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr12:122284995T>C	ENST00000289004.4	-	10	757	c.722A>G	c.(721-723)aAt>aGt	p.N241S	HPD_ENST00000543869.2_5'UTR|HPD_ENST00000543163.1_Missense_Mutation_p.N202S	NM_002150.2	NP_002141	P32754	HPPD_HUMAN	4-hydroxyphenylpyruvate dioxygenase	241					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	4-hydroxyphenylpyruvate dioxygenase activity (GO:0003868)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|urinary_tract(1)	18	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000105)|Epithelial(86;0.000352)|BRCA - Breast invasive adenocarcinoma(302;0.225)	Nitisinone(DB00348)	CGCTGGCTCATTGATGGGCAT	0.592																																					p.N241S		.											.	HPD	90	0			c.A722G						.						134.0	129.0	131.0					12																	122284995		2203	4300	6503	SO:0001583	missense	3242	exon10			GGCTCATTGATGG	BC014790	CCDS9224.1, CCDS53839.1	12q24.31	2013-09-19			ENSG00000158104	ENSG00000158104	1.13.11.27		5147	protein-coding gene	gene with protein product	"""glyoxalase domain containing 3"""	609695		PPD			Standard	NM_001171993		Approved	4-HPPD, 4HPPD, GLOD3	uc001ubj.3	P32754	OTTHUMG00000169081	ENST00000289004.4:c.722A>G	12.37:g.122284995T>C	ENSP00000289004:p.Asn241Ser	125.0	0.0		105.0	14.0	NM_002150	A8K461|B3KQ63|Q13234	Missense_Mutation	SNP	ENST00000289004.4	37	CCDS9224.1	.	.	.	.	.	.	.	.	.	.	T	18.82	3.705334	0.68615	.	.	ENSG00000158104	ENST00000289004;ENST00000545969;ENST00000543163	T;T	0.66638	-0.22;-0.22	5.6	4.44	0.53790	Glyoxalase/fosfomycin resistance/dioxygenase (1);	0.043491	0.85682	D	0.000000	D	0.85048	0.5608	H	0.94582	3.555	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	D	0.87778	0.2610	10	0.87932	D	0	-39.5295	12.0552	0.53531	0.1292:0.0:0.0:0.8708	.	241	P32754	HPPD_HUMAN	S	241;238;202	ENSP00000289004:N241S;ENSP00000441677:N202S	ENSP00000289004:N241S	N	-	2	0	HPD	120769378	1.000000	0.71417	0.788000	0.31933	0.567000	0.35839	7.676000	0.84012	0.927000	0.37143	0.533000	0.62120	AAT	.		0.592	HPD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402184.1	NM_002150	
IFNW1	3467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	21141286	21141286	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr9:21141286C>A	ENST00000380229.2	-	1	858	c.284G>T	c.(283-285)cGc>cTc	p.R95L		NM_002177.1	NP_002168.1	P05000	IFNW1_HUMAN	interferon, omega 1	95			R -> S (in dbSNP:rs2230055).		adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|cell cycle arrest (GO:0007050)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			endometrium(1)|kidney(1)|lung(2)|ovary(1)	5				GBM - Glioblastoma multiforme(5;2.35e-185)|Lung(24;2.24e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		AGCAGAGGAGCGCTCTGTGTG	0.557																																					p.R95L		.											.	IFNW1	90	0			c.G284T						.						89.0	86.0	87.0					9																	21141286		2203	4300	6503	SO:0001583	missense	3467	exon1			GAGGAGCGCTCTG		CCDS6496.1	9p22	2010-12-10			ENSG00000177047	ENSG00000177047		"""Interferons"""	5448	protein-coding gene	gene with protein product	"""IFN-omega 1, interferon omega-1"""	147553				1385305	Standard	NM_002177		Approved		uc003zol.1	P05000	OTTHUMG00000019656	ENST00000380229.2:c.284G>T	9.37:g.21141286C>A	ENSP00000369578:p.Arg95Leu	113.0	0.0		30.0	9.0	NM_002177	Q13168|Q5U802|Q5VWD0|Q7M4P5	Missense_Mutation	SNP	ENST00000380229.2	37	CCDS6496.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.948608	0.34377	.	.	ENSG00000177047	ENST00000380229	T	0.03413	3.94	4.54	-6.97	0.01616	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.767260	0.02616	N	0.102690	T	0.03871	0.0109	L	0.48642	1.525	0.09310	N	1	B	0.27166	0.17	B	0.29716	0.106	T	0.39121	-0.9629	10	0.48119	T	0.1	.	3.0022	0.06017	0.1055:0.1575:0.2256:0.5113	.	95	P05000	IFNW1_HUMAN	L	95	ENSP00000369578:R95L	ENSP00000369578:R95L	R	-	2	0	IFNW1	21131286	0.000000	0.05858	0.000000	0.03702	0.540000	0.34992	-2.191000	0.01246	-1.121000	0.02949	-1.446000	0.01064	CGC	.		0.557	IFNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051885.1	NM_002177	
IMPG2	50939	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	100972618	100972618	+	Silent	SNP	T	T	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:100972618T>A	ENST00000193391.7	-	11	1348	c.1161A>T	c.(1159-1161)ggA>ggT	p.G387G		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	387					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	GACGCAAAACTCCTCTCACTG	0.388																																					p.G387G		.											.	IMPG2	93	0			c.A1161T						.						72.0	66.0	68.0					3																	100972618		2203	4300	6503	SO:0001819	synonymous_variant	50939	exon11			CAAAACTCCTCTC	AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.1161A>T	3.37:g.100972618T>A		74.0	1.0		57.0	18.0	NM_016247	A8MWT5|Q9UKD4|Q9UKK5	Silent	SNP	ENST00000193391.7	37	CCDS2940.1																																																																																			.		0.388	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3		
INADL	10207	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	62330235	62330235	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:62330235A>C	ENST00000371158.2	+	20	2879	c.2765A>C	c.(2764-2766)cAa>cCa	p.Q922P	INADL_ENST00000316485.6_Missense_Mutation_p.Q922P	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	922					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						TCCGAGTCTCAAGAGGCAAGA	0.478																																					p.Q922P		.											.	INADL	94	0			c.A2765C						.						100.0	105.0	103.0					1																	62330235		2203	4300	6503	SO:0001583	missense	10207	exon20			AGTCTCAAGAGGC	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.2765A>C	1.37:g.62330235A>C	ENSP00000360200:p.Gln922Pro	83.0	0.0		35.0	19.0	NM_176877	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	.	.	.	.	.	.	.	.	.	.	A	9.052	0.992376	0.18966	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.12984	2.76;2.63	5.18	-4.18	0.03846	.	1.149560	0.06529	N	0.741001	T	0.12603	0.0306	L	0.57536	1.79	0.09310	N	1	B;B;B	0.10296	0.003;0.001;0.003	B;B;B	0.08055	0.003;0.001;0.003	T	0.36601	-0.9741	10	0.30078	T	0.28	.	6.9089	0.24325	0.2472:0.5722:0.0687:0.1119	.	922;922;922	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	P	922	ENSP00000360200:Q922P;ENSP00000326199:Q922P	ENSP00000255202:Q922P	Q	+	2	0	INADL	62102823	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.038000	0.13862	-0.974000	0.03550	-0.501000	0.04562	CAA	.		0.478	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
INF2	64423	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	105175658	105175658	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr14:105175658A>G	ENST00000392634.4	+	11	2102	c.1990A>G	c.(1990-1992)Acc>Gcc	p.T664A	INF2_ENST00000330634.7_Missense_Mutation_p.T664A	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	664	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		GGCTGGAGATACCACCAAGTT	0.587											OREG0022959	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T664A		.											.	INF2	492	0			c.A1990G						.						73.0	79.0	77.0					14																	105175658		1983	4147	6130	SO:0001583	missense	64423	exon11			GGAGATACCACCA	AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.1990A>G	14.37:g.105175658A>G	ENSP00000376410:p.Thr664Ala	63.0	0.0	1387	37.0	4.0	NM_022489	Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Missense_Mutation	SNP	ENST00000392634.4	37	CCDS9989.2	.	.	.	.	.	.	.	.	.	.	A	4.739	0.137482	0.09032	.	.	ENSG00000203485	ENST00000330634;ENST00000392634	T;T	0.17528	2.27;2.27	4.47	3.23	0.37069	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.208089	0.41001	U	0.000975	T	0.10165	0.0249	N	0.21240	0.645	0.80722	D	1	B;P	0.34462	0.4;0.454	B;B	0.34931	0.121;0.192	T	0.18650	-1.0330	10	0.14252	T	0.57	.	9.7206	0.40300	0.5725:0.4274:0.0:0.0	.	664;664	Q27J81-2;Q27J81	.;INF2_HUMAN	A	664	ENSP00000376406:T664A;ENSP00000376410:T664A	ENSP00000252527:T132A	T	+	1	0	INF2	104246703	1.000000	0.71417	0.799000	0.32177	0.105000	0.19272	2.105000	0.41825	1.640000	0.50565	0.459000	0.35465	ACC	.		0.587	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000074371.4	NM_022489	
INO80	54617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	41377743	41377743	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr15:41377743C>T	ENST00000361937.3	-	7	1121	c.697G>A	c.(697-699)Gaa>Aaa	p.E233K	INO80_ENST00000401393.3_Missense_Mutation_p.E233K			Q9ULG1	INO80_HUMAN	INO80 complex subunit	233	Assembles INO80 complex module consisting of conserved components ACTR8, ACTL6A and YY1.|Assembles INO80 complex module with putative regulatory components INO80E, INO80F, UCHL5, NFRKB, MCRS1 and IN80D.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						GAAAGTTCTTCATCTCTTCGT	0.443																																					p.E233K		.											.	INO80	72	0			c.G697A						.						112.0	110.0	111.0					15																	41377743		2203	4300	6503	SO:0001583	missense	54617	exon7			GTTCTTCATCTCT	AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.697G>A	15.37:g.41377743C>T	ENSP00000355205:p.Glu233Lys	548.0	0.0		315.0	62.0	NM_017553	A6H8X4|Q9NTG6	Missense_Mutation	SNP	ENST00000361937.3	37	CCDS10071.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.735157	0.89482	.	.	ENSG00000128908	ENST00000361937;ENST00000401393	D;D	0.90563	-2.69;-2.69	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.90669	0.7073	N	0.24115	0.695	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	D	0.84695	0.0725	10	0.05525	T	0.97	.	20.1143	0.97922	0.0:1.0:0.0:0.0	.	233	Q9ULG1	INO80_HUMAN	K	233	ENSP00000355205:E233K;ENSP00000384686:E233K	ENSP00000355205:E233K	E	-	1	0	INO80	39165035	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.765000	0.95021	0.650000	0.86243	GAA	.		0.443	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252527.2	NM_017553	
KCNA5	3741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	5154891	5154891	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr12:5154891A>T	ENST00000252321.3	+	1	1807	c.1578A>T	c.(1576-1578)gaA>gaT	p.E526D		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	526					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	ACCACCGGGAAACGGATCACG	0.632																																					p.E526D		.											.	KCNA5	715	0			c.A1578T						.						75.0	70.0	71.0					12																	5154891		2203	4300	6503	SO:0001583	missense	3741	exon1			CCGGGAAACGGAT	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1578A>T	12.37:g.5154891A>T	ENSP00000252321:p.Glu526Asp	114.0	0.0		64.0	14.0	NM_002234	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	ENST00000252321.3	37	CCDS8536.1	.	.	.	.	.	.	.	.	.	.	A	16.63	3.177095	0.57692	.	.	ENSG00000130037	ENST00000252321	D	0.97850	-4.57	4.94	3.13	0.36017	.	0.000000	0.85682	U	0.000000	D	0.97408	0.9152	M	0.90483	3.12	0.51482	D	0.999925	P	0.42161	0.772	B	0.43809	0.432	D	0.96105	0.9072	10	0.87932	D	0	.	8.0911	0.30801	0.2461:0.0:0.7539:0.0	.	526	P22460	KCNA5_HUMAN	D	526	ENSP00000252321:E526D	ENSP00000252321:E526D	E	+	3	2	KCNA5	5025152	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.129000	0.31381	0.682000	0.31407	-0.252000	0.11476	GAA	.		0.632	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234	
KLF8	11279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	56291629	56291629	+	Missense_Mutation	SNP	G	G	A	rs144407506		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:56291629G>A	ENST00000468660.1	+	3	386	c.98G>A	c.(97-99)cGg>cAg	p.R33Q	KLF8_ENST00000374928.3_Missense_Mutation_p.R33Q	NM_007250.4	NP_009181.2	O95600	KLF8_HUMAN	Kruppel-like factor 8	33					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(4)|large_intestine(6)|lung(5)|ovary(1)	16						GCTTCTGTTCGGAACAGAGAT	0.408																																					p.R33Q		.											.	KLF8	131	0			c.G98A						.	G	GLN/ARG,GLN/ARG	0,3835		0,0,1632,571	31.0	28.0	29.0		98,98	-2.2	0.0	X	dbSNP_134	29	1,6727		0,1,2427,1872	yes	missense,missense	KLF8	NM_001159296.1,NM_007250.4	43,43	0,1,4059,2443	AA,AG,GG,G		0.0149,0.0,0.0095	benign,benign	33/258,33/360	56291629	1,10562	2203	4300	6503	SO:0001583	missense	11279	exon4			CTGTTCGGAACAG	U28282	CCDS14373.1, CCDS55428.1	Xp11.21	2013-01-08			ENSG00000102349	ENSG00000102349		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	6351	protein-coding gene	gene with protein product		300286					Standard	NM_007250		Approved	BKLF3, ZNF741, DXS741	uc004dur.3	O95600	OTTHUMG00000021666	ENST00000468660.1:c.98G>A	X.37:g.56291629G>A	ENSP00000417303:p.Arg33Gln	175.0	0.0		108.0	17.0	NM_001159296	B4DJN3|E7EQQ8|L0R3U8|L0R4U2|Q2M246|Q59GV5|Q5HYQ5|Q5JXP7|Q6MZJ7|Q9UGC4	Missense_Mutation	SNP	ENST00000468660.1	37	CCDS14373.1	.	.	.	.	.	.	.	.	.	.	G	2.472	-0.321634	0.05386	0.0	1.49E-4	ENSG00000102349	ENST00000374928;ENST00000468660	T	0.05258	3.47	4.68	-2.22	0.06952	.	0.710568	0.12845	N	0.434498	T	0.01523	0.0049	N	0.01874	-0.695	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.43426	-0.9392	10	0.07990	T	0.79	.	1.1714	0.01826	0.4887:0.1919:0.1821:0.1372	.	33;33;33	E7EQQ8;B4DJN3;O95600	.;.;KLF8_HUMAN	Q	33	ENSP00000417303:R33Q	ENSP00000431911:R33Q	R	+	2	0	KLF8	56308354	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	-0.020000	0.12525	-0.482000	0.06782	-1.468000	0.01013	CGG	G|1.000;A|0.000		0.408	KLF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056887.2	NM_007250	
KNDC1	85442	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	135025036	135025036	+	Missense_Mutation	SNP	G	G	T	rs151235501		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr10:135025036G>T	ENST00000304613.3	+	22	4040	c.4019G>T	c.(4018-4020)gGg>gTg	p.G1340V	KNDC1_ENST00000368572.2_Missense_Mutation_p.G1342V			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1340	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CGGAACAGCGGGCTGCTGGGG	0.667																																					p.G1340V		.											.	KNDC1	229	0			c.G4019T						.						88.0	91.0	90.0					10																	135025036		2203	4300	6503	SO:0001583	missense	85442	exon22			ACAGCGGGCTGCT	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.4019G>T	10.37:g.135025036G>T	ENSP00000304437:p.Gly1340Val	74.0	0.0		65.0	23.0	NM_152643	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	G	10.99	1.507447	0.27036	.	.	ENSG00000171798	ENST00000304613;ENST00000368572	T;T	0.46451	0.87;0.87	3.96	0.693	0.18056	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.803958	0.11184	U	0.590657	T	0.33089	0.0851	L	0.43152	1.355	0.21147	N	0.999776	P	0.49559	0.925	P	0.44732	0.459	T	0.14282	-1.0478	10	0.33940	T	0.23	-15.4731	4.3895	0.11334	0.229:0.358:0.413:0.0	.	1340	Q76NI1	VKIND_HUMAN	V	1340;1342	ENSP00000304437:G1340V;ENSP00000357561:G1342V	ENSP00000304437:G1340V	G	+	2	0	KNDC1	134875026	0.014000	0.17966	0.080000	0.20451	0.173000	0.22820	0.575000	0.23729	-0.084000	0.12595	0.297000	0.19635	GGG	G|1.000;A|0.000		0.667	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
LMTK3	114783	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49013717	49013717	+	Splice_Site	SNP	T	T	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:49013717T>G	ENST00000600059.1	-	2	436	c.209A>C	c.(208-210)aAg>aCg	p.K70T	LMTK3_ENST00000270238.3_Splice_Site_p.K99T|CTC-273B12.10_ENST00000598924.1_lincRNA			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	70					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		GCACCTCACCTTGAAGCCGAC	0.592																																					p.K99T		.											.	LMTK3	1357	0			c.A296C						.						31.0	40.0	37.0					19																	49013717		2050	4197	6247	SO:0001630	splice_region_variant	114783	exon3			CTCACCTTGAAGC	AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.210+1A>C	19.37:g.49013717T>G		143.0	0.0		125.0	19.0	NM_001080434	Q4G0U1	Missense_Mutation	SNP	ENST00000600059.1	37		.	.	.	.	.	.	.	.	.	.	t	17.24	3.340348	0.60963	.	.	ENSG00000142235	ENST00000270238	T	0.80653	-1.4	3.95	3.95	0.45737	.	0.071329	0.52532	U	0.000063	T	0.77605	0.4155	L	0.47190	1.495	0.41341	D	0.987301	P	0.51791	0.948	P	0.46975	0.533	T	0.80688	-0.1271	10	0.87932	D	0	.	11.1411	0.48402	0.0:0.0:0.0:1.0	.	70	Q96Q04	LMTK3_HUMAN	T	99	ENSP00000270238:K99T	ENSP00000270238:K99T	K	-	2	0	LMTK3	53705529	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.232000	0.78116	1.803000	0.52742	0.235000	0.17854	AAG	.		0.592	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000466137.1	NM_052895	Missense_Mutation
LILRB4	11006	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55175343	55175343	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:55175343C>G	ENST00000391736.1	+	5	517	c.202C>G	c.(202-204)Ccc>Gcc	p.P68A	LILRB4_ENST00000391734.3_Missense_Mutation_p.P68A|LILRB4_ENST00000430952.2_Missense_Mutation_p.P68A|LILRB4_ENST00000270452.2_Missense_Mutation_p.P68A|LILRB4_ENST00000391733.3_Missense_Mutation_p.P68A	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	68	Ig-like C2-type 1.				immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		AAGCCCAGCACCCTGGGACAG	0.572																																					p.P68A		.											.	LILRB4	93	0			c.C202G						.						257.0	231.0	240.0					19																	55175343		2203	4300	6503	SO:0001583	missense	11006	exon3			CCAGCACCCTGGG	U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.202C>G	19.37:g.55175343C>G	ENSP00000375616:p.Pro68Ala	397.0	1.0		351.0	69.0	NM_006847	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Missense_Mutation	SNP	ENST00000391736.1	37	CCDS12902.1	.	.	.	.	.	.	.	.	.	.	C	0.083	-1.180226	0.01633	.	.	ENSG00000186818	ENST00000420271;ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391734;ENST00000391733;ENST00000434286	T;T;T;T;T;T	0.12879	2.64;2.64;2.64;2.64;2.64;2.64	2.43	-4.87	0.03123	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.08537	0.0212	L	0.47016	1.485	0.09310	N	1	B;B;B;B;B;B	0.22800	0.05;0.05;0.041;0.001;0.019;0.075	B;B;B;B;B;B	0.24006	0.05;0.02;0.008;0.006;0.011;0.039	T	0.42413	-0.9453	9	0.11485	T	0.65	.	3.0672	0.06218	0.3953:0.2278:0.0:0.3769	.	68;68;68;68;68;109	A8MUE1;C9JST2;Q8NHJ6-3;Q8NHJ6-2;Q8NHJ6;C9JHA6	.;.;.;.;LIRB4_HUMAN;.	A	109;68;68;68;68;68;68	ENSP00000375616:P68A;ENSP00000270452:P68A;ENSP00000408995:P68A;ENSP00000375614:P68A;ENSP00000375613:P68A;ENSP00000401962:P68A	ENSP00000270452:P68A	P	+	1	0	LILRB4	59867155	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.966000	0.00324	-2.311000	0.00649	-1.441000	0.01070	CCC	.		0.572	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3		
MAK16	84549	ucsc.edu;bcgsc.ca	37	8	33354202	33354202	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr8:33354202G>T	ENST00000360128.6	+	8	1039	c.582G>T	c.(580-582)gaG>gaT	p.E194D	TTI2_ENST00000519356.1_Intron	NM_032509.3	NP_115898.2	Q9BXY0	MAK16_HUMAN	MAK16 homolog (S. cerevisiae)	194						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|urinary_tract(1)	8						AACAACAGGAGGCAGAGAGTG	0.403																																					p.E194D		.											.	MAK16	69	0			c.G582T						.						129.0	109.0	116.0					8																	33354202		2203	4300	6503	SO:0001583	missense	84549	exon8			ACAGGAGGCAGAG	AF251062	CCDS6089.1	8p12	2011-10-13	2008-06-04	2008-06-04	ENSG00000198042	ENSG00000198042		"""RNA binding motif (RRM) containing"""	13703	protein-coding gene	gene with protein product			"""RNA binding motif protein 13"""	RBM13			Standard	NM_032509		Approved	MAK16L	uc003xjj.3	Q9BXY0	OTTHUMG00000163957	ENST00000360128.6:c.582G>T	8.37:g.33354202G>T	ENSP00000353246:p.Glu194Asp	83.0	0.0		41.0	4.0	NM_032509	B2RB44|Q5U5T1|Q86UC4|Q96SY6	Missense_Mutation	SNP	ENST00000360128.6	37	CCDS6089.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.500557	0.44455	.	.	ENSG00000198042	ENST00000360128	T	0.50548	0.74	5.8	3.99	0.46301	.	0.299670	0.39909	N	0.001239	T	0.30198	0.0757	L	0.27944	0.81	0.44175	D	0.996989	B	0.12630	0.006	B	0.16289	0.015	T	0.13495	-1.0507	10	0.42905	T	0.14	-16.4739	4.8253	0.13412	0.2351:0.0:0.61:0.1549	.	194	Q9BXY0	MAK16_HUMAN	D	194	ENSP00000353246:E194D	ENSP00000353246:E194D	E	+	3	2	MAK16	33473744	0.229000	0.23729	1.000000	0.80357	0.976000	0.68499	-0.501000	0.06398	1.441000	0.47550	0.563000	0.77884	GAG	.		0.403	MAK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376559.3	NM_032509	
MCM10	55388	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	13212934	13212934	+	Missense_Mutation	SNP	A	A	G	rs571506868		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr10:13212934A>G	ENST00000484800.2	+	3	123	c.20A>G	c.(19-21)aAt>aGt	p.N7S	MCM10_ENST00000378694.1_Missense_Mutation_p.N7S|MCM10_ENST00000378714.3_Missense_Mutation_p.N7S			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	7	N-terminal domain. {ECO:0000250}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						GAGGAAGACAATCTGTCTCTG	0.453													A|||	1	0.000199681	0.0	0.0	5008	,	,		20580	0.0		0.001	False		,,,				2504	0.0				p.N7S		.											.	MCM10	653	0			c.A20G						.						57.0	59.0	58.0					10																	13212934		2203	4300	6503	SO:0001583	missense	55388	exon3			AAGACAATCTGTC	AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.20A>G	10.37:g.13212934A>G	ENSP00000418268:p.Asn7Ser	168.0	0.0		247.0	127.0	NM_018518	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	37	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	A	15.27	2.784078	0.49997	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.14144	2.53;2.53;2.53	5.91	4.77	0.60923	.	0.140827	0.64402	D	0.000007	T	0.09379	0.0231	N	0.14661	0.345	0.32618	N	0.523713	B;B;B	0.23937	0.094;0.082;0.049	B;B;B	0.21708	0.026;0.036;0.016	T	0.05370	-1.0889	10	0.56958	D	0.05	-0.4625	12.1524	0.54057	0.9332:0.0:0.0668:0.0	.	7;7;7	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	S	7	ENSP00000367986:N7S;ENSP00000418268:N7S;ENSP00000367966:N7S	ENSP00000354945:N7S	N	+	2	0	MCM10	13252940	0.999000	0.42202	0.993000	0.49108	0.943000	0.58893	4.456000	0.60081	1.046000	0.40249	0.533000	0.62120	AAT	.		0.453	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751	
MED24	9862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	38189358	38189358	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:38189358C>T	ENST00000394128.2	-	8	854	c.773G>A	c.(772-774)gGc>gAc	p.G258D	MED24_ENST00000394127.2_Missense_Mutation_p.G245D|MED24_ENST00000479829.1_5'Flank|MED24_ENST00000394126.1_Missense_Mutation_p.G283D|MED24_ENST00000501516.3_Missense_Mutation_p.G277D|MED24_ENST00000356271.3_Missense_Mutation_p.G245D	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	258					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					CTGCGTCTCGCCTGTCAGGTT	0.637																																					p.G258D		.											.	MED24	187	0			c.G773A						.						60.0	51.0	54.0					17																	38189358		2203	4300	6503	SO:0001583	missense	9862	exon8			GTCTCGCCTGTCA	AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.773G>A	17.37:g.38189358C>T	ENSP00000377686:p.Gly258Asp	87.0	0.0		37.0	18.0	NM_014815	A8K4S5|B3KMR9|Q14143|Q9NNY5	Missense_Mutation	SNP	ENST00000394128.2	37	CCDS11359.1	.	.	.	.	.	.	.	.	.	.	C	14.54	2.567240	0.45694	.	.	ENSG00000008838	ENST00000394126;ENST00000356271;ENST00000394128;ENST00000535071;ENST00000394127;ENST00000536318;ENST00000543759;ENST00000535508;ENST00000431269;ENST00000428757	T;T;T	0.47177	0.85;0.85;0.85	5.68	5.68	0.88126	Mediator complex, subunit Med24, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.66752	0.2821	L	0.54323	1.7	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.99;1.0;0.988;1.0;0.996;0.997;1.0	D;D;D;P;D;D;D;D	0.97110	0.996;0.921;1.0;0.871;0.99;0.953;0.972;0.99	T	0.65269	-0.6209	10	0.52906	T	0.07	-24.9058	19.807	0.96535	0.0:1.0:0.0:0.0	.	245;208;187;208;168;245;258;200	B9TX65;B4DV99;B4DDR8;F5H5K2;F8W9R9;O75448-2;O75448;F5H0K1	.;.;.;.;.;.;MED24_HUMAN;.	D	258;258;258;208;245;200;232;232;168;277	ENSP00000377686:G258D;ENSP00000443344:G208D;ENSP00000377685:G245D	ENSP00000348610:G258D	G	-	2	0	MED24	35442884	1.000000	0.71417	0.943000	0.38184	0.601000	0.36947	5.999000	0.70665	2.690000	0.91761	0.655000	0.94253	GGC	.		0.637	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	
METTL2A	339175	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	60501620	60501620	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:60501620G>A	ENST00000311506.5	+	2	187	c.151G>A	c.(151-153)Gag>Aag	p.E51K		NM_181725.3	NP_859076.3	Q96IZ6	MET2A_HUMAN	methyltransferase like 2A	51					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(2)|central_nervous_system(1)|endometrium(1)|upper_aerodigestive_tract(2)	6			BRCA - Breast invasive adenocarcinoma(2;1.08e-10)			CGCGGCGGCGGAGAGAAAAGT	0.582											OREG0024635	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E51K		.											.	METTL2A	248	0			c.G151A						.						66.0	92.0	84.0					17																	60501620		692	1590	2282	SO:0001583	missense	339175	exon2			GCGGCGGAGAGAA	AK000991	CCDS45752.1	17q23.3	2012-12-20		2006-02-10	ENSG00000087995	ENSG00000087995			25755	protein-coding gene	gene with protein product						12477932	Standard	NM_181725		Approved	FLJ12760, METTL2	uc002izv.2	Q96IZ6	OTTHUMG00000164527	ENST00000311506.5:c.151G>A	17.37:g.60501620G>A	ENSP00000309610:p.Glu51Lys	127.0	0.0	1046	76.0	20.0	NM_181725	A6NNC4|Q9H9G9|Q9NUI8|Q9P0B5	Missense_Mutation	SNP	ENST00000311506.5	37	CCDS45752.1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.110154	0.37242	.	.	ENSG00000087995	ENST00000311506;ENST00000333483	D	0.82255	-1.59	5.14	3.09	0.35607	.	0.568252	0.21244	N	0.077764	T	0.68705	0.3030	L	0.33189	0.99	0.27932	N	0.937828	B	0.02656	0.0	B	0.08055	0.003	T	0.51387	-0.8712	10	0.14656	T	0.56	-4.2637	5.6823	0.17782	0.1401:0.353:0.5069:0.0	.	51	Q96IZ6	MTL2A_HUMAN	K	51	ENSP00000309610:E51K	ENSP00000309610:E51K	E	+	1	0	METTL2A	57855352	0.698000	0.27777	0.990000	0.47175	0.893000	0.52053	1.356000	0.34079	1.263000	0.44181	0.555000	0.69702	GAG	.		0.582	METTL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445130.1	NM_181725	
MICAL3	57553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	18358243	18358243	+	Intron	SNP	G	G	A	rs201286172	byFrequency	TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr22:18358243G>A	ENST00000441493.2	-	17	2594				MICAL3_ENST00000400561.2_Intron|MICAL3_ENST00000585038.1_Silent_p.P825P|MICAL3_ENST00000444520.1_Intron|MICAL3_ENST00000207726.7_Intron|MICAL3_ENST00000414725.2_Intron|MICAL3_ENST00000429452.1_Silent_p.P825P|MICAL3_ENST00000383094.3_Intron	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3						actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		AGGGAGAGGCGGGGCGGGCAG	0.557													G|||	2	0.000399361	0.0008	0.0	5008	,	,		13614	0.0		0.001	False		,,,				2504	0.0				p.P825P		.											.	MICAL3	68	0			c.C2475T						.						24.0	34.0	31.0					22																	18358243		1561	3562	5123	SO:0001627	intron_variant	57553	exon19			AGAGGCGGGGCGG	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.2242-3454C>T	22.37:g.18358243G>A		73.0	0.0		59.0	12.0	NM_001136004	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Silent	SNP	ENST00000441493.2	37	CCDS46659.1																																																																																			.		0.557	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
MROH2B	133558	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	41055918	41055918	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr5:41055918T>G	ENST00000399564.4	-	10	1409	c.959A>C	c.(958-960)gAa>gCa	p.E320A	MROH2B_ENST00000506092.2_Intron	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	320																	TCTTACTTGTTCATCAAAAAA	0.398																																					p.E320A		.											.	.	.	0			c.A959C						.						108.0	105.0	106.0					5																	41055918		1838	4094	5932	SO:0001583	missense	133558	exon10			ACTTGTTCATCAA		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.959A>C	5.37:g.41055918T>G	ENSP00000382476:p.Glu320Ala	157.0	1.0		122.0	12.0	NM_173489	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	T	15.10	2.733050	0.48939	.	.	ENSG00000171495	ENST00000296803;ENST00000399564	T	0.07800	3.16	4.87	3.68	0.42216	Armadillo-type fold (1);	0.000000	0.52532	D	0.000075	T	0.16642	0.0400	L	0.54323	1.7	0.31909	N	0.614965	D	0.64830	0.994	D	0.68039	0.955	T	0.05649	-1.0872	10	0.10636	T	0.68	.	8.4317	0.32761	0.0:0.0:0.1979:0.8021	.	320	Q7Z745	HTRB2_HUMAN	A	24;320	ENSP00000382476:E320A	ENSP00000296803:E24A	E	-	2	0	HEATR7B2	41091675	0.999000	0.42202	1.000000	0.80357	0.751000	0.42716	1.487000	0.35540	0.866000	0.35629	0.379000	0.24179	GAA	.		0.398	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489	
MRPS22	56945	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	139062905	139062905	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:139062905C>T	ENST00000495075.1	+	3	469	c.37C>T	c.(37-39)Ctc>Ttc	p.L13F	MRPS22_ENST00000465056.1_Missense_Mutation_p.L13F|MRPS22_ENST00000478464.1_5'Flank|MRPS22_ENST00000310776.4_Missense_Mutation_p.L13F			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	13						mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						GCTGTGGAGCCTCTTGAGGAG	0.587																																					p.L13F		.											.	MRPS22	93	0			c.C37T						.						52.0	53.0	52.0					3																	139062905		2203	4300	6503	SO:0001583	missense	56945	exon1			TGGAGCCTCTTGA	AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.37C>T	3.37:g.139062905C>T	ENSP00000418008:p.Leu13Phe	49.0	0.0		54.0	16.0	NM_020191	Q9H3I1	Missense_Mutation	SNP	ENST00000495075.1	37	CCDS3107.1	.	.	.	.	.	.	.	.	.	.	C	7.061	0.566305	0.13560	.	.	ENSG00000175110	ENST00000495075;ENST00000310776;ENST00000465056;ENST00000465373	D;D;D;T	0.83250	-1.7;-1.7;-1.7;-1.12	4.01	-2.38	0.06622	.	1.136100	0.06728	N	0.776041	T	0.65481	0.2695	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.46076	-0.9217	10	0.30078	T	0.28	2.9972	4.8869	0.13708	0.0:0.3398:0.1622:0.4979	.	13;13	G5E9V5;P82650	.;RT22_HUMAN	F	13;13;13;9	ENSP00000418008:L13F;ENSP00000310785:L13F;ENSP00000418233:L13F;ENSP00000419920:L9F	ENSP00000310785:L13F	L	+	1	0	MRPS22	140545595	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.295000	0.02764	-0.680000	0.05211	-0.282000	0.10007	CTC	.		0.587	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358120.1	NM_020191	
MTMR4	9110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	56582147	56582147	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:56582147G>A	ENST00000323456.5	-	12	1416	c.1292C>T	c.(1291-1293)aCg>aTg	p.T431M	MTMR4_ENST00000579925.1_Missense_Mutation_p.T431M	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	431	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TACCTCCAACGTCCTGTAATA	0.552																																					p.T431M		.											.	MTMR4	91	0			c.C1292T						.						136.0	137.0	137.0					17																	56582147		2203	4300	6503	SO:0001583	missense	9110	exon12			TCCAACGTCCTGT	AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.1292C>T	17.37:g.56582147G>A	ENSP00000325285:p.Thr431Met	81.0	0.0		47.0	12.0	NM_004687	D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	ENST00000323456.5	37	CCDS11608.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.962917	0.92791	.	.	ENSG00000108389	ENST00000323456	D	0.96554	-4.05	5.4	5.4	0.78164	Myotubularin phosphatase domain (1);	0.000000	0.85682	D	0.000000	D	0.99174	0.9714	H	0.99764	4.76	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98660	1.0683	10	0.87932	D	0	.	18.5101	0.90913	0.0:0.0:1.0:0.0	.	431	Q9NYA4	MTMR4_HUMAN	M	431	ENSP00000325285:T431M	ENSP00000325285:T431M	T	-	2	0	MTMR4	53937146	1.000000	0.71417	0.961000	0.40146	0.964000	0.63967	9.813000	0.99286	2.688000	0.91661	0.591000	0.81541	ACG	.		0.552	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444721.1	NM_004687	
MYBPC2	4606	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	50957533	50957533	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:50957533C>A	ENST00000357701.5	+	18	1972	c.1921C>A	c.(1921-1923)Ccc>Acc	p.P641T		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	641	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		TGTCCCAGACCCCCCGGAGGC	0.647																																					p.P641T		.											.	MYBPC2	67	0			c.C1921A						.						36.0	38.0	37.0					19																	50957533		1984	4152	6136	SO:0001583	missense	4606	exon18			CCAGACCCCCCGG		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.1921C>A	19.37:g.50957533C>A	ENSP00000350332:p.Pro641Thr	59.0	1.0		74.0	15.0	NM_004533	A1L4G9	Missense_Mutation	SNP	ENST00000357701.5	37	CCDS46152.1	.	.	.	.	.	.	.	.	.	.	c	17.50	3.405761	0.62288	.	.	ENSG00000086967	ENST00000357701	T	0.59502	0.26	3.18	3.18	0.36537	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.35320	U	0.003297	T	0.80565	0.4647	H	0.94658	3.565	0.45250	D	0.998251	D	0.71674	0.998	D	0.74023	0.982	D	0.85433	0.1150	10	0.51188	T	0.08	.	13.6178	0.62120	0.0:1.0:0.0:0.0	.	641	Q14324	MYPC2_HUMAN	T	641	ENSP00000350332:P641T	ENSP00000350332:P641T	P	+	1	0	MYBPC2	55649345	1.000000	0.71417	1.000000	0.80357	0.689000	0.40095	4.011000	0.57124	1.822000	0.53115	0.450000	0.29827	CCC	.		0.647	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533	
MYH6	4624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	23851737	23851737	+	Missense_Mutation	SNP	C	C	A	rs61731171		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr14:23851737C>A	ENST00000356287.3	-	37	5725	c.5696G>T	c.(5695-5697)cGc>cTc	p.R1899L	MYH6_ENST00000405093.3_Missense_Mutation_p.R1899L			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1899					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.R1899H(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CTGCACCTTGCGGAACTTGGA	0.582																																					p.R1899L		.											.	MYH6	94	1	Substitution - Missense(1)	stomach(1)	c.G5696T						.						190.0	160.0	170.0					14																	23851737		2203	4300	6503	SO:0001583	missense	4624	exon38			ACCTTGCGGAACT	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.5696G>T	14.37:g.23851737C>A	ENSP00000348634:p.Arg1899Leu	199.0	0.0		132.0	26.0	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	C	32	5.105714	0.94292	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.85171	-1.95;-1.95	4.05	4.05	0.47172	Myosin tail (1);	.	.	.	.	D	0.95121	0.8419	H	0.97265	3.97	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97038	0.9755	9	0.87932	D	0	.	16.3671	0.83335	0.0:1.0:0.0:0.0	.	1899	P13533	MYH6_HUMAN	L	1899	ENSP00000386041:R1899L;ENSP00000348634:R1899L	ENSP00000348634:R1899L	R	-	2	0	MYH6	22921577	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.644000	0.83416	2.256000	0.74724	0.561000	0.74099	CGC	C|0.986;T|0.014		0.582	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
MYOCD	93649	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	12666487	12666487	+	Silent	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:12666487C>T	ENST00000343344.4	+	13	2343	c.2343C>T	c.(2341-2343)ccC>ccT	p.P781P	MYOCD_ENST00000425538.1_Silent_p.P829P|RP11-1090M7.1_ENST00000584772.1_RNA			Q8IZQ8	MYCD_HUMAN	myocardin	781					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		TCACCAAGCCCTCGGCTTCCT	0.493																																					p.P829P		.											.	MYOCD	93	0			c.C2487T						.						106.0	101.0	103.0					17																	12666487		2203	4300	6503	SO:0001819	synonymous_variant	93649	exon14			CAAGCCCTCGGCT	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.2343C>T	17.37:g.12666487C>T		121.0	0.0		56.0	34.0	NM_001146312	Q5UBU5|Q8N7Q1	Silent	SNP	ENST00000343344.4	37	CCDS11163.1																																																																																			.		0.493	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604	
MYO18A	399687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27449219	27449219	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:27449219T>G	ENST00000527372.1	-	3	1232	c.1052A>C	c.(1051-1053)aAg>aCg	p.K351T	MYO18A_ENST00000533112.1_Missense_Mutation_p.K351T|MYO18A_ENST00000354329.4_Missense_Mutation_p.K351T|MYO18A_ENST00000531253.1_Missense_Mutation_p.K351T	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	351	Mediates nucleotide-independent binding to F-actin and interaction with GOLPH3.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CAGCCACACCTTCTCCGTCTC	0.557																																					p.K351T	Esophageal Squamous(182;472 2015 7001 15270 22562)	.											.	MYO18A	22	0			c.A1052C						.						67.0	79.0	75.0					17																	27449219		2012	4183	6195	SO:0001583	missense	399687	exon3			CACACCTTCTCCG	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.1052A>C	17.37:g.27449219T>G	ENSP00000437073:p.Lys351Thr	262.0	0.0		126.0	74.0	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	CCDS45642.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.2|27.2	4.808029|4.808029	0.90707|0.90707	.|.	.|.	ENSG00000196535|ENSG00000196535	ENST00000528564|ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000531686	T|D;D;D;D	0.77489|0.88741	-1.1|-2.31;-2.42;-2.31;-2.31	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93871|0.93871	0.8039|0.8039	M|M	0.79123|0.79123	2.44|2.44	0.45464|0.45464	D|D	0.998438|0.998438	.|D;D;D;D	.|0.89917	.|0.959;0.999;0.999;1.0	.|P;D;D;D	.|0.87578	.|0.749;0.994;0.994;0.998	D|D	0.93890|0.93890	0.7179|0.7179	7|10	0.48119|0.49607	T|T	0.1|0.09	.|.	14.0293|14.0293	0.64606|0.64606	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|20;351;351;351	.|Q92614-2;Q92614-3;Q92614-4;Q92614	.|.;.;.;MY18A_HUMAN	D|T	56|351;351;351;351;351;31	ENSP00000436660:E56D|ENSP00000346291:K351T;ENSP00000435932:K351T;ENSP00000434228:K351T;ENSP00000437073:K351T	ENSP00000436660:E56D|ENSP00000346291:K351T	E|K	-|-	3|2	2|0	MYO18A|MYO18A	24473345|24473345	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	5.565000|5.565000	0.67365|0.67365	2.145000|2.145000	0.66743|0.66743	0.533000|0.533000	0.62120|0.62120	GAA|AAG	.		0.557	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
N4BP2L1	90634	ucsc.edu;bcgsc.ca	37	13	32981893	32981893	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr13:32981893A>G	ENST00000380133.2	-	2	246	c.196T>C	c.(196-198)Ttt>Ctt	p.F66L	N4BP2L1_ENST00000459716.1_5'UTR|N4BP2L1_ENST00000380130.2_Missense_Mutation_p.F66L|N4BP2L1_ENST00000530622.2_5'UTR|N4BP2L1_ENST00000380139.4_Missense_Mutation_p.F66L			Q5TBK1	N42L1_HUMAN	NEDD4 binding protein 2-like 1	66										large_intestine(1)|lung(2)|ovary(1)|skin(1)	5		Lung SC(185;0.0262)		all cancers(112;6.3e-06)|Epithelial(112;3.51e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00607)|BRCA - Breast invasive adenocarcinoma(63;0.0171)		GCCCTGGGAAAGTCATGCTGC	0.408																																					p.F66L		.											.	N4BP2L1	91	0			c.T196C						.						114.0	111.0	112.0					13																	32981893		1842	4084	5926	SO:0001583	missense	90634	exon2			TGGGAAAGTCATG	U50527	CCDS9345.2, CCDS41877.1	13q13.1	2008-11-05			ENSG00000139597	ENSG00000139597			25037	protein-coding gene	gene with protein product	"""hypothetical gene CG018"""					8812419	Standard	NM_052818		Approved	CG018	uc001uuc.3	Q5TBK1	OTTHUMG00000016697	ENST00000380133.2:c.196T>C	13.37:g.32981893A>G	ENSP00000369476:p.Phe66Leu	47.0	0.0		33.0	4.0	NM_052818	A4QN21|Q5TBK0	Missense_Mutation	SNP	ENST00000380133.2	37	CCDS9345.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.16|10.16	1.273486|1.273486	0.23221|0.23221	.|.	.|.	ENSG00000139597|ENSG00000139597	ENST00000380130;ENST00000380139;ENST00000380133|ENST00000343281	T;T;T|.	0.33654|.	1.4;1.4;1.4|.	5.41|5.41	4.2|4.2	0.49525|0.49525	Zeta toxin domain (1);|.	0.594085|.	0.16462|.	N|.	0.213381|.	T|T	0.21307|0.21307	0.0513|0.0513	N|N	0.02192|0.02192	-0.645|-0.645	0.80722|0.80722	D|D	1|1	P;B;B|.	0.46859|.	0.885;0.054;0.201|.	P;B;B|.	0.48770|.	0.589;0.061;0.197|.	T|T	0.05683|0.05683	-1.0870|-1.0870	10|5	0.11485|.	T|.	0.65|.	.|.	8.2809|8.2809	0.31900|0.31900	0.7953:0.1337:0.0709:0.0|0.7953:0.1337:0.0709:0.0	.|.	43;66;66|.	Q5TBJ9;Q5TBK1-2;Q5TBK1|.	.;.;N42L1_HUMAN|.	L|P	66|43	ENSP00000369473:F66L;ENSP00000369484:F66L;ENSP00000369476:F66L|.	ENSP00000369473:F66L|.	F|L	-|-	1|2	0|0	N4BP2L1|N4BP2L1	31879893|31879893	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.991000|0.991000	0.79684|0.79684	3.835000|3.835000	0.55805|0.55805	0.874000|0.874000	0.35823|0.35823	0.454000|0.454000	0.30748|0.30748	TTT|CTT	.		0.408	N4BP2L1-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044412.2	NM_052818	
NOL6	65083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	33468831	33468831	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr9:33468831C>G	ENST00000379471.2	-	8	1153	c.1066G>C	c.(1066-1068)Gtt>Ctt	p.V356L	NOL6_ENST00000464829.1_5'UTR|NOL6_ENST00000455041.2_Missense_Mutation_p.V296L			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	356					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		AGGAAGACAACCAGCATGGAG	0.562																																					p.V356L		.											.	NOL6	92	0			c.G1066C						.						181.0	181.0	181.0					9																	33468831		2203	4300	6503	SO:0001583	missense	65083	exon8			AGACAACCAGCAT	AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.1066G>C	9.37:g.33468831C>G	ENSP00000368784:p.Val356Leu	114.0	0.0		63.0	22.0	NM_022917	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Missense_Mutation	SNP	ENST00000379471.2	37		.	.	.	.	.	.	.	.	.	.	C	9.620	1.133691	0.21123	.	.	ENSG00000165271	ENST00000353159;ENST00000297990;ENST00000379471;ENST00000325914;ENST00000455041	T;T;T;T	0.37915	1.17;1.17;1.17;1.17	4.88	3.03	0.35002	.	0.354004	0.29579	N	0.011752	T	0.20129	0.0484	L	0.31664	0.95	0.41365	D	0.987458	B;B;B;B;B	0.12013	0.001;0.001;0.001;0.005;0.001	B;B;B;B;B	0.14578	0.011;0.004;0.005;0.011;0.007	T	0.12837	-1.0532	10	0.02654	T	1	.	8.2247	0.31562	0.0:0.751:0.0:0.249	.	296;356;356;356;356	B4DF80;Q9H6R4-4;Q9H6R4-2;Q9H6R4-3;Q9H6R4	.;.;.;.;NOL6_HUMAN	L	356;356;356;356;296	ENSP00000313978:V356L;ENSP00000297990:V356L;ENSP00000368784:V356L;ENSP00000395915:V296L	ENSP00000297990:V356L	V	-	1	0	NOL6	33458831	0.999000	0.42202	1.000000	0.80357	0.941000	0.58515	0.690000	0.25451	0.489000	0.27749	-0.258000	0.10820	GTT	.		0.562	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	protein_coding	OTTHUMT00000001019.2	NM_022917	
NPLOC4	55666	ucsc.edu;bcgsc.ca	37	17	79567437	79567437	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:79567437C>T	ENST00000331134.6	-	9	1066	c.851G>A	c.(850-852)aGc>aAc	p.S284N	NPLOC4_ENST00000374747.5_Missense_Mutation_p.S284N|NPLOC4_ENST00000539314.1_Missense_Mutation_p.S123N	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	284					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			AAGCTCCAAGCTGTTCTGTGT	0.542																																					p.S284N		.											.	NPLOC4	24	0			c.G851A						.						46.0	44.0	45.0					17																	79567437		1946	4145	6091	SO:0001583	missense	55666	exon9			TCCAAGCTGTTCT	AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.851G>A	17.37:g.79567437C>T	ENSP00000331487:p.Ser284Asn	62.0	0.0		25.0	4.0	NM_017921	Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Missense_Mutation	SNP	ENST00000331134.6	37	CCDS45812.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.771770	0.90108	.	.	ENSG00000182446	ENST00000331134;ENST00000374747;ENST00000539314	.	.	.	5.73	5.73	0.89815	Nuclear pore localisation protein NPL4 (1);	0.000000	0.85682	D	0.000000	T	0.73682	0.3618	M	0.64676	1.99	0.58432	D	0.999999	P;D;D	0.58620	0.886;0.983;0.965	P;P;P	0.59825	0.827;0.864;0.825	T	0.72221	-0.4356	9	0.41790	T	0.15	-34.7686	16.2336	0.82360	0.0:0.8673:0.1327:0.0	.	123;284;284	B4DG89;Q8TAT6-2;Q8TAT6	.;.;NPL4_HUMAN	N	284;283;123	.	ENSP00000331487:S284N	S	-	2	0	NPLOC4	77177875	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.794000	0.69067	2.723000	0.93209	0.650000	0.86243	AGC	.		0.542	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440140.1		
OR2G6	391211	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248684959	248684959	+	Silent	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:248684959C>T	ENST00000343414.4	+	1	44	c.12C>T	c.(10-12)acC>acT	p.T4T		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T4T(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGGAGGAAACCAACAACAGCT	0.398																																					p.T4T		.											.	OR2G6	71	1	Substitution - coding silent(1)	lung(1)	c.C12T						.						126.0	119.0	122.0					1																	248684959		2203	4300	6503	SO:0001819	synonymous_variant	391211	exon1			GGAAACCAACAAC		CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.12C>T	1.37:g.248684959C>T		250.0	0.0		215.0	74.0	NM_001013355	B2RP33	Silent	SNP	ENST00000343414.4	37	CCDS31119.1																																																																																			.		0.398	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842	
OR2T4	127074	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	248525606	248525606	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:248525606C>A	ENST00000366475.1	+	1	724	c.724C>A	c.(724-726)Cct>Act	p.P242T		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCTCCTCATCCCTGTGGTGAT	0.488																																					p.P242T		.											.	OR2T4	68	0			c.C724A						.						159.0	150.0	153.0					1																	248525606		2203	4300	6503	SO:0001583	missense	127074	exon1			CTCATCCCTGTGG	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.724C>A	1.37:g.248525606C>A	ENSP00000355431:p.Pro242Thr	1155.0	0.0		1004.0	67.0	NM_001004696	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	C	8.392	0.839896	0.16891	.	.	ENSG00000196944	ENST00000366475	T	0.56103	0.48	3.09	2.12	0.27331	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000279	T	0.56187	0.1968	L	0.52759	1.655	0.09310	N	1	D	0.58620	0.983	P	0.58013	0.831	T	0.43343	-0.9397	10	0.87932	D	0	.	7.3606	0.26744	0.0:0.7778:0.0:0.2222	.	242	Q8NH00	OR2T4_HUMAN	T	242	ENSP00000355431:P242T	ENSP00000355431:P242T	P	+	1	0	OR2T4	246592229	0.000000	0.05858	0.028000	0.17463	0.130000	0.20726	-1.205000	0.03014	1.543000	0.49345	0.585000	0.79938	CCT	.		0.488	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
OR2T6	254879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248551626	248551626	+	Silent	SNP	C	C	T	rs148186126		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:248551626C>T	ENST00000355728.2	+	1	717	c.717C>T	c.(715-717)gcC>gcT	p.A239A		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A239A(1)		endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGGCCTTTGCCACCTGCTCTT	0.507																																					p.A239A		.											OR2T6,arm,malignant_melanoma,0	OR2T6	71	1	Substitution - coding silent(1)	skin(1)	c.C717T						.						271.0	226.0	242.0					1																	248551626		2203	4300	6503	SO:0001819	synonymous_variant	254879	exon1			CTTTGCCACCTGC	AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.717C>T	1.37:g.248551626C>T		307.0	0.0		310.0	86.0	NM_001005471	A6NE36	Silent	SNP	ENST00000355728.2	37	CCDS31114.1																																																																																			.		0.507	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471	
OR2T10	127069	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248756794	248756794	+	Silent	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:248756794G>T	ENST00000330500.2	-	1	306	c.276C>A	c.(274-276)atC>atA	p.I92I	Y_RNA_ENST00000364732.1_RNA	NM_001004693.1	NP_001004693.1	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T, member 10	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(17)|skin(3)|upper_aerodigestive_tract(1)	26	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAAGGACCGAGATGGTCTTGT	0.502																																					p.I92I		.											.	OR2T10	69	0			c.C276A						.						64.0	75.0	71.0					1																	248756794		2040	4235	6275	SO:0001819	synonymous_variant	127069	exon1			GACCGAGATGGTC		CCDS31121.1	1q44	2012-08-09			ENSG00000184022	ENSG00000184022		"""GPCR / Class A : Olfactory receptors"""	19573	protein-coding gene	gene with protein product							Standard	NM_001004693		Approved		uc010pzn.2	Q8NGZ9	OTTHUMG00000040388	ENST00000330500.2:c.276C>A	1.37:g.248756794G>T		219.0	0.0		175.0	30.0	NM_001004693	B2RNK7	Silent	SNP	ENST00000330500.2	37	CCDS31121.1																																																																																			.		0.502	OR2T10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097139.1	NM_001004693	
OR52E8	390079	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5878726	5878726	+	Silent	SNP	C	C	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr11:5878726C>A	ENST00000537935.1	-	1	238	c.207G>T	c.(205-207)ctG>ctT	p.L69L	TRIM5_ENST00000380027.1_Intron	NM_001005168.1	NP_001005168.1	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E, member 8	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCAACATGGCCAGGAAGTAGT	0.453																																					p.L69L		.											.	OR52E8	70	0			c.G207T						.						126.0	143.0	137.0					11																	5878726		2152	4296	6448	SO:0001819	synonymous_variant	390079	exon1			CATGGCCAGGAAG	BK004301	CCDS31400.1	11p15.4	2012-08-09	2003-12-15		ENSG00000183269	ENSG00000183269		"""GPCR / Class A : Olfactory receptors"""	15217	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily E, member 8 pseudogene"""				Standard	NM_001005168		Approved		uc010qzr.2	Q6IFG1	OTTHUMG00000168803	ENST00000537935.1:c.207G>T	11.37:g.5878726C>A		235.0	1.0		111.0	21.0	NM_001005168	B9EH38	Silent	SNP	ENST00000537935.1	37	CCDS31400.1																																																																																			.		0.453	OR52E8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401145.1	NM_001005168	
OR5R1	219479	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	56185374	56185374	+	Missense_Mutation	SNP	C	C	G	rs372445913		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr11:56185374C>G	ENST00000312253.1	-	1	334	c.335G>C	c.(334-336)tGt>tCt	p.C112S		NM_001004744.1	NP_001004744.1	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R, member 1	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(17)|ovary(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(21;0.00448)					TAGAAGGAAACACTCAGTGAT	0.463																																					p.C112S		.											.	OR5R1	70	0			c.G335C						.						105.0	100.0	102.0					11																	56185374		2201	4296	6497	SO:0001583	missense	219479	exon1			AGGAAACACTCAG	AB065504	CCDS31530.1	11q11	2012-08-09		2004-03-10	ENSG00000174942	ENSG00000174942		"""GPCR / Class A : Olfactory receptors"""	14841	protein-coding gene	gene with protein product				OR5R1P			Standard	NM_001004744		Approved		uc010rji.2	Q8NH85	OTTHUMG00000154219	ENST00000312253.1:c.335G>C	11.37:g.56185374C>G	ENSP00000308595:p.Cys112Ser	67.0	1.0		23.0	7.0	NM_001004744		Missense_Mutation	SNP	ENST00000312253.1	37	CCDS31530.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.500407	0.26861	.	.	ENSG00000174942	ENST00000312253	T	0.01821	4.62	5.78	3.88	0.44766	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35615	U	0.003082	T	0.01976	0.0062	L	0.41961	1.31	0.09310	N	1	B	0.16396	0.017	B	0.15484	0.013	T	0.45614	-0.9249	10	0.25751	T	0.34	-12.4746	8.0438	0.30536	0.1318:0.7273:0.0:0.1409	.	112	Q8NH85	OR5R1_HUMAN	S	112	ENSP00000308595:C112S	ENSP00000308595:C112S	C	-	2	0	OR5R1	55941950	0.000000	0.05858	0.399000	0.26333	0.726000	0.41606	0.194000	0.17135	0.761000	0.33130	0.478000	0.44815	TGT	.		0.463	OR5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334444.1	NM_001004744	
OTOGL	283310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	80732951	80732951	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr12:80732951G>A	ENST00000547103.1	+	42	4900	c.4894G>A	c.(4894-4896)Gga>Aga	p.G1632R	OTOGL_ENST00000458043.2_Missense_Mutation_p.G1644R			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1632	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TACTCCAGCTGGACTAATCAT	0.418																																					p.G1644R		.											.	.	.	0			c.G4930A						.						205.0	203.0	204.0					12																	80732951		1885	4097	5982	SO:0001583	missense	283310	exon42			CCAGCTGGACTAA	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.4894G>A	12.37:g.80732951G>A	ENSP00000447211:p.Gly1632Arg	186.0	0.0		105.0	14.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	37		.	.	.	.	.	.	.	.	.	.	G	17.34	3.363714	0.61513	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.61859	0.07;0.07	5.72	4.82	0.62117	.	.	.	.	.	T	0.63438	0.2511	L	0.46670	1.46	0.33889	D	0.637099	.	.	.	.	.	.	T	0.72994	-0.4122	7	0.56958	D	0.05	.	14.9976	0.71446	0.0693:0.0:0.9307:0.0	.	.	.	.	R	1632;1644	ENSP00000447211:G1632R;ENSP00000400895:G1644R	ENSP00000400895:G1644R	G	+	1	0	OTOGL	79257082	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.410000	0.66381	2.695000	0.91970	0.650000	0.86243	GGA	.		0.418	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
PABPC4L	132430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	135121364	135121364	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr4:135121364G>A	ENST00000421491.3	-	2	1067	c.811C>T	c.(811-813)Cga>Tga	p.R271*	PABPC4L_ENST00000529122.2_Nonsense_Mutation_p.R329*			P0CB38	PAB4L_HUMAN	poly(A) binding protein, cytoplasmic 4-like	271							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)	3						TCAGCCTGTCGCTCGACTTTC	0.453																																					p.R329X		.											.	.	.	0			c.C985T						.						78.0	65.0	69.0					4																	135121364		692	1591	2283	SO:0001587	stop_gained	132430	exon2			CCTGTCGCTCGAC	AY672099		4q28.3	2013-02-12				ENSG00000254535		"""RNA binding motif (RRM) containing"""	31955	protein-coding gene	gene with protein product							Standard	NM_001114734		Approved		uc010ioe.3	P0CB38		ENST00000421491.3:c.811C>T	4.37:g.135121364G>A	ENSP00000463233:p.Arg271*	94.0	0.0		41.0	7.0	NM_001114734		Nonsense_Mutation	SNP	ENST00000421491.3	37																																																																																				.		0.453	PABPC4L-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364399.2	NM_001114734	
PARP2	10038	ucsc.edu;bcgsc.ca	37	14	20820418	20820418	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr14:20820418C>T	ENST00000250416.5	+	7	578	c.551C>T	c.(550-552)aCg>aTg	p.T184M	PARP2_ENST00000527915.1_Missense_Mutation_p.T184M|PARP2_ENST00000429687.3_Missense_Mutation_p.T171M	NM_001042618.1|NM_005484.3	NP_001036083.1|NP_005475.2	Q9UGN5	PARP2_HUMAN	poly (ADP-ribose) polymerase 2	184					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway (GO:0097191)|protein ADP-ribosylation (GO:0006471)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)	15	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;5.34e-07)|all cancers(55;3.7e-06)	GBM - Glioblastoma multiforme(265;0.00888)|READ - Rectum adenocarcinoma(17;0.0649)		CTTGACAAAACGAAAAACAAT	0.368								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																													p.T184M		.											.	PARP2	661	0			c.C551T						.						104.0	93.0	97.0					14																	20820418		1830	4088	5918	SO:0001583	missense	10038	exon7			ACAAAACGAAAAA	AF085734	CCDS41910.1, CCDS45077.1	14q11.2-q12	2010-02-16	2008-07-28	2004-08-26	ENSG00000129484	ENSG00000129484		"""Poly (ADP-ribose) polymerases"""	272	protein-coding gene	gene with protein product		607725	"""ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2"", ""poly (ADP-ribose) polymerase family, member 2"""	ADPRTL2		10329013, 18353725	Standard	NM_005484		Approved		uc001vxc.3	Q9UGN5	OTTHUMG00000166106	ENST00000250416.5:c.551C>T	14.37:g.20820418C>T	ENSP00000250416:p.Thr184Met	34.0	0.0		25.0	4.0	NM_005484	Q8TEU4|Q9NUV2|Q9UMR4|Q9Y6C8	Missense_Mutation	SNP	ENST00000250416.5	37	CCDS41910.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.399447	0.83120	.	.	ENSG00000129484	ENST00000429687;ENST00000250416;ENST00000527915	T;T;T	0.22539	1.95;1.95;1.95	5.53	5.53	0.82687	WGR domain (4);	0.000000	0.85682	D	0.000000	T	0.62295	0.2416	H	0.96080	3.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.75288	-0.3370	10	0.87932	D	0	-11.9704	18.2252	0.89915	0.0:1.0:0.0:0.0	.	171;184	Q9UGN5-2;Q9UGN5	.;PARP2_HUMAN	M	171;184;184	ENSP00000392972:T171M;ENSP00000250416:T184M;ENSP00000432283:T184M	ENSP00000250416:T184M	T	+	2	0	PARP2	19890258	1.000000	0.71417	0.995000	0.50966	0.905000	0.53344	6.377000	0.73145	2.606000	0.88127	0.563000	0.77884	ACG	.		0.368	PARP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000387847.2		
PCDH19	57526	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	99658623	99658623	+	Silent	SNP	T	T	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:99658623T>A	ENST00000373034.4	-	2	3862	c.2187A>T	c.(2185-2187)atA>atT	p.I729I	PCDH19_ENST00000255531.7_Intron|PCDH19_ENST00000420881.2_Intron	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	729					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						TTTGTCCTTTTATAAAACAGC	0.423																																					p.I729I		.											.	PCDH19	110	0			c.A2187T						.						26.0	26.0	26.0					X																	99658623		876	1991	2867	SO:0001819	synonymous_variant	57526	exon2			TCCTTTTATAAAA	AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.2187A>T	X.37:g.99658623T>A		278.0	1.0		169.0	42.0	NM_001184880	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Silent	SNP	ENST00000373034.4	37	CCDS55462.1																																																																																			.		0.423	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766	
PCDHA10	56139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140237874	140237874	+	Silent	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr5:140237874T>C	ENST00000307360.5	+	1	2241	c.2241T>C	c.(2239-2241)tcT>tcC	p.S747S	PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	747	6 X 4 AA repeats of P-X-X-P.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGCTGGTCTTACTCGCAGC	0.672																																					p.S747S		.											.	PCDHA10	99	0			c.T2241C						.						44.0	49.0	47.0					5																	140237874		1322	2289	3611	SO:0001819	synonymous_variant	56139	exon1			CTGGTCTTACTCG	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.2241T>C	5.37:g.140237874T>C		285.0	0.0		134.0	29.0	NM_031859	A1L493|O75280|Q9NRU2	Silent	SNP	ENST00000307360.5	37	CCDS54921.1																																																																																			.		0.672	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901	
PCDHGA5	56110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140746244	140746244	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr5:140746244G>A	ENST00000518069.1	+	1	2347	c.2347G>A	c.(2347-2349)Gag>Aag	p.E783K	PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	783					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTAGTGAAGAGAGCTGTGA	0.512																																					p.E783K		.											.	PCDHGA5	35	0			c.G2347A						.						108.0	121.0	117.0					5																	140746244		2203	4299	6502	SO:0001583	missense	56110	exon1			AGTGAAGAGAGCT	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.2347G>A	5.37:g.140746244G>A	ENSP00000429834:p.Glu783Lys	161.0	0.0		81.0	16.0	NM_032054	Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	37	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	14.26	2.481816	0.44147	.	.	ENSG00000253485	ENST00000518069	D	0.94613	-3.47	5.3	3.39	0.38822	.	.	.	.	.	D	0.94159	0.8126	M	0.88181	2.935	0.09310	N	1	B;B	0.22541	0.071;0.042	B;B	0.29663	0.105;0.049	D	0.86697	0.1927	9	0.37606	T	0.19	.	6.673	0.23078	0.0963:0.2763:0.6274:0.0	.	783;783	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	K	783	ENSP00000429834:E783K	ENSP00000429834:E783K	E	+	1	0	PCDHGA5	140726428	0.929000	0.31497	0.431000	0.26735	0.736000	0.42039	1.204000	0.32296	2.630000	0.89119	0.655000	0.94253	GAG	.		0.512	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918	
PCNXL4	64430	ucsc.edu;bcgsc.ca	37	14	60592539	60592539	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr14:60592539A>G	ENST00000406854.1	+	10	3819	c.3265A>G	c.(3265-3267)Atg>Gtg	p.M1089V	PCNXL4_ENST00000406949.1_Missense_Mutation_p.M855V|PCNXL4_ENST00000317623.4_Missense_Mutation_p.M855V|PCNXL4_ENST00000404681.2_Missense_Mutation_p.M1089V|PCNXL4_ENST00000535349.1_Missense_Mutation_p.M296V			Q63HM2	PCX4_HUMAN	pecanex-like 4 (Drosophila)	1089						integral component of membrane (GO:0016021)											TGATTCTAATATGGTAAGGTT	0.289																																					p.M855V		.											.	.	.	0			c.A2563G						.						36.0	40.0	39.0					14																	60592539		2196	4293	6489	SO:0001583	missense	64430	exon9			TCTAATATGGTAA	AK022861		14q23.1	2012-07-18	2012-07-18	2012-07-18	ENSG00000126773	ENSG00000126773			20349	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 135"""	C14orf135			Standard	NM_022495		Approved		uc001xer.4	Q63HM2	OTTHUMG00000150361	ENST00000406854.1:c.3265A>G	14.37:g.60592539A>G	ENSP00000384801:p.Met1089Val	115.0	0.0		39.0	4.0	NM_022495	A8MXM2|Q9BQG8|Q9H9F2	Missense_Mutation	SNP	ENST00000406854.1	37		.	.	.	.	.	.	.	.	.	.	A	18.78	3.696240	0.68386	.	.	ENSG00000126773	ENST00000317623;ENST00000406854;ENST00000406949;ENST00000404681;ENST00000535349	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;1.0	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.62048	0.2396	M	0.72118	2.19	0.80722	D	1	D;D	0.65815	0.995;0.992	P;D	0.76071	0.877;0.987	T	0.60637	-0.7224	10	0.30078	T	0.28	.	14.776	0.69732	1.0:0.0:0.0:0.0	.	1089;855	Q63HM2;B5MC47	CN135_HUMAN;.	V	855;1089;855;1089;296	ENSP00000317396:M855V;ENSP00000384801:M1089V;ENSP00000385201:M855V;ENSP00000385713:M1089V;ENSP00000445644:M296V	ENSP00000317396:M855V	M	+	1	0	C14orf135	59662292	1.000000	0.71417	0.976000	0.42696	0.839000	0.47603	7.124000	0.77185	1.904000	0.55121	0.455000	0.32223	ATG	.		0.289	PCNXL4-005	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000317847.1	NM_022495	
PCSK4	54760	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	1484101	1484101	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:1484101C>T	ENST00000300954.5	-	9	1155	c.1094G>A	c.(1093-1095)tGc>tAc	p.C365Y	CTB-25B13.6_ENST00000585643.1_RNA	NM_017573.3	NP_060043.2			proprotein convertase subtilisin/kexin type 4											cervix(2)|endometrium(2)|kidney(1)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGTCTGTGCACCCGTGATG	0.662																																					p.C365Y		.											.	PCSK4	90	0			c.G1094A						.						10.0	12.0	11.0					19																	1484101		2180	4268	6448	SO:0001583	missense	54760	exon9			TCTGTGCACCCGT	AK057235	CCDS12069.2	19p13.3	2008-02-05			ENSG00000115257	ENSG00000115257			8746	protein-coding gene	gene with protein product		600487				7782070	Standard	XM_005259586		Approved	PC4, SPC5, DKFZp434B217, MGC34749	uc002ltb.1	Q6UW60	OTTHUMG00000128541	ENST00000300954.5:c.1094G>A	19.37:g.1484101C>T	ENSP00000300954:p.Cys365Tyr	68.0	0.0		128.0	71.0	NM_017573		Missense_Mutation	SNP	ENST00000300954.5	37	CCDS12069.2	.	.	.	.	.	.	.	.	.	.	-	14.46	2.543283	0.45280	.	.	ENSG00000115257	ENST00000300954;ENST00000441747	T	0.80566	-1.39	2.76	2.76	0.32466	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.552403	0.16865	N	0.196378	D	0.88228	0.6380	M	0.75447	2.3	0.53688	D	0.999977	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.993	D	0.88770	0.3263	10	0.87932	D	0	.	12.4425	0.55634	0.0:1.0:0.0:0.0	.	365;177	Q6UW60;B3KQ28	PCSK4_HUMAN;.	Y	365;177	ENSP00000300954:C365Y	ENSP00000300954:C365Y	C	-	2	0	PCSK4	1435101	1.000000	0.71417	0.996000	0.52242	0.115000	0.19883	7.590000	0.82653	1.286000	0.44565	0.274000	0.19336	TGC	.		0.662	PCSK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449703.1	NM_017573	
PDE6B	5158	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	651215	651215	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr4:651215A>G	ENST00000496514.1	+	10	1354	c.1333A>G	c.(1333-1335)Aag>Gag	p.K445E	PDE6B_ENST00000429163.2_Missense_Mutation_p.K166E|PDE6B_ENST00000255622.6_Missense_Mutation_p.K445E|RP11-1191J2.2_ENST00000468356.1_RNA|RP11-1191J2.2_ENST00000489312.1_RNA			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	445					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	GGAGAACCGCAAGGACATCGC	0.597																																					p.K445E	GBM(71;463 1194 9848 25922 46834)	.											.	PDE6B	90	0			c.A1333G						.						216.0	132.0	161.0					4																	651215		2203	4300	6503	SO:0001583	missense	5158	exon10			AACCGCAAGGACA	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.1333A>G	4.37:g.651215A>G	ENSP00000420295:p.Lys445Glu	173.0	0.0		192.0	32.0	NM_001145291	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	37	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.727402	0.89390	.	.	ENSG00000133256	ENST00000255622;ENST00000496514;ENST00000429163	T;T;T	0.69561	-0.41;-0.41;-0.41	4.85	3.62	0.41486	.	0.052152	0.64402	D	0.000001	T	0.81437	0.4822	M	0.88640	2.97	0.53005	D	0.999969	D;D	0.71674	0.997;0.998	P;D	0.68192	0.905;0.956	T	0.81846	-0.0745	10	0.87932	D	0	.	8.9054	0.35521	0.8327:0.0:0.0:0.1673	.	445;445	P35913;P35913-2	PDE6B_HUMAN;.	E	445;445;166	ENSP00000255622:K445E;ENSP00000420295:K445E;ENSP00000406334:K166E	ENSP00000255622:K445E	K	+	1	0	PDE6B	641215	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.695000	0.91298	0.653000	0.30826	0.367000	0.22151	AAG	.		0.597	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	
PDE8A	5151	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	85666356	85666356	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr15:85666356C>T	ENST00000310298.4	+	20	2269	c.2017C>T	c.(2017-2019)Cac>Tac	p.H673Y	PDE8A_ENST00000339708.5_Missense_Mutation_p.H627Y|PDE8A_ENST00000557957.1_Missense_Mutation_p.H601Y|PDE8A_ENST00000394553.1_Missense_Mutation_p.H673Y			O60658	PDE8A_HUMAN	phosphodiesterase 8A	673	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	AATGACAAAGCACTTTGAGCA	0.418																																					p.H673Y		.											.	PDE8A	94	0			c.C2017T						.						124.0	107.0	113.0					15																	85666356		2203	4299	6502	SO:0001583	missense	5151	exon19			ACAAAGCACTTTG	AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.2017C>T	15.37:g.85666356C>T	ENSP00000311453:p.His673Tyr	138.0	2.0		86.0	17.0	NM_002605	B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Missense_Mutation	SNP	ENST00000310298.4	37	CCDS10336.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.884419	0.91814	.	.	ENSG00000073417	ENST00000310298;ENST00000394553;ENST00000339708	D;D;D	0.83837	-1.77;-1.77;-1.77	5.46	5.46	0.80206	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.93171	0.7825	M	0.92507	3.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.94221	0.7467	10	0.87932	D	0	.	16.8609	0.86018	0.0:1.0:0.0:0.0	.	627;673	O60658-2;O60658	.;PDE8A_HUMAN	Y	673;673;627	ENSP00000311453:H673Y;ENSP00000378056:H673Y;ENSP00000340679:H627Y	ENSP00000311453:H673Y	H	+	1	0	PDE8A	83467360	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.371000	0.79600	2.840000	0.97914	0.655000	0.94253	CAC	.		0.418	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309018.1	NM_002605	
PHKA2	5256	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	18972509	18972509	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:18972509A>C	ENST00000379942.4	-	2	765	c.100T>G	c.(100-102)Tca>Gca	p.S34A		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	34					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					TGGCTGGCTGACAGCAGCCCC	0.557																																					p.S34A		.											.	PHKA2	131	0			c.T100G						.						77.0	58.0	64.0					X																	18972509		2203	4300	6503	SO:0001583	missense	5256	exon2			TGGCTGACAGCAG		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.100T>G	X.37:g.18972509A>C	ENSP00000369274:p.Ser34Ala	95.0	0.0		60.0	14.0	NM_000292	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	ENST00000379942.4	37	CCDS14190.1	.	.	.	.	.	.	.	.	.	.	A	15.28	2.786777	0.49997	.	.	ENSG00000044446	ENST00000379942	D	0.88354	-2.37	5.65	5.65	0.86999	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.058731	0.64402	D	0.000001	D	0.83101	0.5181	L	0.39020	1.185	0.40299	D	0.978581	B	0.18166	0.026	B	0.19666	0.026	T	0.79264	-0.1875	10	0.45353	T	0.12	-8.5786	9.4666	0.38817	0.9205:0.0:0.0795:0.0	.	34	P46019	KPB2_HUMAN	A	34	ENSP00000369274:S34A	ENSP00000369274:S34A	S	-	1	0	PHKA2	18882430	1.000000	0.71417	0.997000	0.53966	0.946000	0.59487	4.211000	0.58507	1.904000	0.55121	0.486000	0.48141	TCA	.		0.557	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292	
PLA2R1	22925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	160807990	160807990	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr2:160807990G>T	ENST00000283243.7	-	24	3607	c.3401C>A	c.(3400-3402)aCt>aAt	p.T1134N	PLA2R1_ENST00000392771.1_Missense_Mutation_p.T1134N	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	1134	C-type lectin 7. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						TGCATACCAAGTCATATTTGC	0.408																																					p.T1134N		.											.	PLA2R1	93	0			c.C3401A						.						240.0	220.0	227.0					2																	160807990		2203	4300	6503	SO:0001583	missense	22925	exon24			TACCAAGTCATAT	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.3401C>A	2.37:g.160807990G>T	ENSP00000283243:p.Thr1134Asn	574.0	0.0		434.0	137.0	NM_001195641	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	37	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.951658	0.53186	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.56275	0.47;0.47	5.67	5.67	0.87782	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.057219	0.64402	D	0.000002	T	0.61211	0.2329	L	0.41027	1.25	0.47737	D	0.999507	D;D;D	0.61080	0.989;0.987;0.987	D;P;P	0.68039	0.955;0.843;0.857	T	0.52697	-0.8541	10	0.19147	T	0.46	.	15.2627	0.73637	0.0:0.1399:0.8601:0.0	.	1134;1134;1134	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	N	1134	ENSP00000283243:T1134N;ENSP00000376524:T1134N	ENSP00000283243:T1134N	T	-	2	0	PLA2R1	160516236	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.245000	0.65405	2.680000	0.91292	0.557000	0.71058	ACT	.		0.408	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
PRICKLE2	166336	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	64145681	64145681	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:64145681C>T	ENST00000295902.6	-	4	916	c.331G>A	c.(331-333)Gaa>Aaa	p.E111K	PRICKLE2_ENST00000564377.1_Missense_Mutation_p.E167K	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	111	PET. {ECO:0000255|PROSITE- ProRule:PRU00636}.				establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		CCCAAGTTTTCGCGTTTCCTC	0.502																																					p.E111K		.											.	PRICKLE2	95	0			c.G331A						.						155.0	155.0	155.0					3																	64145681		2203	4300	6503	SO:0001583	missense	166336	exon4			AGTTTTCGCGTTT	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.331G>A	3.37:g.64145681C>T	ENSP00000295902:p.Glu111Lys	224.0	2.0		146.0	35.0	NM_198859	Q0VF44	Missense_Mutation	SNP	ENST00000295902.6	37	CCDS2902.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.604747	0.87157	.	.	ENSG00000163637	ENST00000295902;ENST00000498162	D;D	0.86769	-2.17;-2.17	5.74	5.74	0.90152	PET domain (2);	0.000000	0.64402	D	0.000001	D	0.88757	0.6523	M	0.78456	2.415	0.80722	D	1	P	0.51057	0.941	B	0.41691	0.364	D	0.90366	0.4377	10	0.87932	D	0	-33.0296	20.2825	0.98528	0.0:1.0:0.0:0.0	.	111	Q7Z3G6	PRIC2_HUMAN	K	111	ENSP00000295902:E111K;ENSP00000419951:E111K	ENSP00000295902:E111K	E	-	1	0	PRICKLE2	64120721	1.000000	0.71417	0.502000	0.27614	0.132000	0.20833	7.776000	0.85560	2.873000	0.98535	0.561000	0.74099	GAA	.		0.502	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
PLS1	5357	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	142388293	142388293	+	Silent	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:142388293C>T	ENST00000337777.3	+	3	345	c.132C>T	c.(130-132)agC>agT	p.S44S	PLS1_ENST00000497002.1_Silent_p.S44S|PLS1_ENST00000457734.2_Silent_p.S44S	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	44	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						AGGAAGCAAGCCTTCCTCTGC	0.368																																					p.S44S		.											.	PLS1	91	0			c.C132T						.						148.0	148.0	148.0					3																	142388293		2203	4300	6503	SO:0001819	synonymous_variant	5357	exon3			AGCAAGCCTTCCT	L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.132C>T	3.37:g.142388293C>T		107.0	0.0		79.0	9.0	NM_001172312	A8K2Q1|D3DNG3|Q8NEG6	Silent	SNP	ENST00000337777.3	37	CCDS3125.1																																																																																			.		0.368	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354435.1	NM_002670	
PRICKLE3	4007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	49032070	49032070	+	Silent	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:49032070G>A	ENST00000376317.3	-	9	1894	c.1800C>T	c.(1798-1800)cgC>cgT	p.R600R	PRICKLE3_ENST00000538114.1_Silent_p.R424R|PRICKLE3_ENST00000540849.1_Silent_p.R532R|PRICKLE3_ENST00000536904.1_Silent_p.R519R	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)	600							zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						GCATCCCTGCGCGAGAGTCCC	0.602																																					p.R600R		.											.	PRICKLE3	193	0			c.C1800T						.						50.0	48.0	49.0					X																	49032070		2203	4300	6503	SO:0001819	synonymous_variant	4007	exon9			CCCTGCGCGAGAG	BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.1800C>T	X.37:g.49032070G>A		102.0	0.0		94.0	19.0	NM_006150	B7Z8F2|O76007|Q53XR5	Silent	SNP	ENST00000376317.3	37	CCDS14320.1	.	.	.	.	.	.	.	.	.	.	-	5.377	0.254793	0.10185	.	.	ENSG00000012211	ENST00000453382	T	0.70399	-0.48	4.44	0.988	0.19796	.	0.826858	0.10174	N	0.706741	T	0.65606	0.2707	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.54735	-0.8249	6	.	.	.	-4.7242	11.6302	0.51168	0.0:0.6556:0.3444:0.0	.	.	.	.	C	613	ENSP00000388599:R613C	.	R	-	1	0	PRICKLE3	48919014	0.029000	0.19370	0.002000	0.10522	0.123000	0.20343	0.358000	0.20216	0.241000	0.21283	0.455000	0.32223	CGC	.		0.602	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060811.1	NM_006150	
PSG11	5680	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	43529064	43529064	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:43529064C>T	ENST00000401740.1	-	2	312	c.209G>A	c.(208-210)gGg>gAg	p.G70E	PSG11_ENST00000403486.1_Intron|PSG11_ENST00000306322.7_Intron|PSG11_ENST00000320078.7_Missense_Mutation_p.G70E			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	70	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				CCTGATTTGCCCTTTGTACCA	0.438																																					p.G70E		.											.	.	.	0			c.G209A						.						130.0	130.0	130.0					19																	43529064		2199	4294	6493	SO:0001583	missense	5680	exon2			ATTTGCCCTTTGT	U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.209G>A	19.37:g.43529064C>T	ENSP00000384995:p.Gly70Glu	250.0	0.0		203.0	27.0	NM_002785	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000401740.1	37	CCDS12614.2	.	.	.	.	.	.	.	.	.	.	c	11.49	1.653235	0.29425	.	.	ENSG00000243130	ENST00000320078;ENST00000401740	T;T	0.01705	4.68;4.68	0.929	0.929	0.19449	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.10594	0.0259	M	0.90870	3.155	0.09310	N	0.999992	D	0.89917	1.0	D	0.97110	1.0	T	0.06320	-1.0833	9	0.87932	D	0	.	5.2086	0.15304	0.0:1.0:0.0:0.0	.	70	Q9UQ72	PSG11_HUMAN	E	70	ENSP00000319140:G70E;ENSP00000384995:G70E	ENSP00000319140:G70E	G	-	2	0	PSG11	48220904	0.121000	0.22262	0.139000	0.22197	0.032000	0.12392	0.542000	0.23222	0.795000	0.33922	0.184000	0.17185	GGG	.		0.438	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323079.1	NM_002785	
PSG9	5678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	43763032	43763032	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:43763032T>G	ENST00000270077.3	-	4	1061	c.965A>C	c.(964-966)aAc>aCc	p.N322T	PSG9_ENST00000244293.7_Intron|PSG9_ENST00000596730.1_Intron|PSG9_ENST00000291752.5_Intron|PSG9_ENST00000593948.1_Intron|PSG9_ENST00000443718.3_Missense_Mutation_p.N229T|PSG9_ENST00000418820.2_Missense_Mutation_p.N229T	NM_002784.3	NP_002775.3	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	322	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				GATGACTGGGTTACTGCGGAG	0.493																																					p.N322T		.											.	PSG9	92	0			c.A965C						.						105.0	108.0	107.0					19																	43763032		2136	4281	6417	SO:0001583	missense	5678	exon4			ACTGGGTTACTGC	M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000270077.3:c.965A>C	19.37:g.43763032T>G	ENSP00000270077:p.Asn322Thr	96.0	0.0		124.0	29.0	NM_002784	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000270077.3	37	CCDS12618.1	.	.	.	.	.	.	.	.	.	.	N	7.137	0.581148	0.13686	.	.	ENSG00000183668	ENST00000270077;ENST00000443718;ENST00000435220	T;T	0.12774	2.65;2.65	1.39	1.39	0.22231	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.10981	0.0268	L	0.39245	1.2	0.09310	N	1	B;B	0.32893	0.389;0.263	B;B	0.41894	0.266;0.369	T	0.32214	-0.9915	9	0.02654	T	1	.	4.833	0.13451	0.0:0.0:0.0:1.0	.	229;322	E7EW65;Q00887	.;PSG9_HUMAN	T	322;229;283	ENSP00000270077:N322T;ENSP00000396753:N229T	ENSP00000270077:N322T	N	-	2	0	PSG9	48454872	0.848000	0.29623	0.036000	0.18154	0.006000	0.05464	1.721000	0.38032	0.620000	0.30215	0.163000	0.16589	AAC	.		0.493	PSG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323065.1	NM_002784	
PRR12	57479	broad.mit.edu;mdanderson.org	37	19	50124861	50124861	+	Silent	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:50124861G>A	ENST00000418929.2	+	11	5715	c.5703G>A	c.(5701-5703)tcG>tcA	p.S1901S		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	1080							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		AGCGGCTGTCGCTAAGCCCAG	0.622																																					p.S1901S		.											.	PRR12	70	0			c.G5703A						.						22.0	23.0	23.0					19																	50124861		1925	4113	6038	SO:0001819	synonymous_variant	57479	exon11			GCTGTCGCTAAGC	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.5703G>A	19.37:g.50124861G>A		26.0	0.0		31.0	5.0	NM_020719	E9PB06|Q8N4J6	Silent	SNP	ENST00000418929.2	37	CCDS46143.1																																																																																			.		0.622	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
PTPN22	26191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	114380695	114380695	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:114380695G>T	ENST00000359785.5	-	13	1462	c.1327C>A	c.(1327-1329)Cca>Aca	p.P443T	PTPN22_ENST00000460620.1_Intron|PTPN22_ENST00000538253.1_Missense_Mutation_p.P199T|PTPN22_ENST00000420377.2_Missense_Mutation_p.P443T|PTPN22_ENST00000525799.1_Missense_Mutation_p.P316T|PTPN22_ENST00000528414.1_Missense_Mutation_p.P388T	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	443					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGTGTTATTGGCACCTTTGAA	0.383																																					p.P443T		.											.	PTPN22	227	0			c.C1327A						.						82.0	83.0	83.0					1																	114380695		2203	4300	6503	SO:0001583	missense	26191	exon13			TTATTGGCACCTT	AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.1327C>A	1.37:g.114380695G>T	ENSP00000352833:p.Pro443Thr	129.0	0.0		38.0	14.0	NM_015967	A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	ENST00000359785.5	37	CCDS863.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.970819	0.53614	.	.	ENSG00000134242	ENST00000359785;ENST00000528414;ENST00000538253;ENST00000420377;ENST00000525799;ENST00000354605	T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7	5.82	3.91	0.45181	.	0.193747	0.37012	N	0.002281	T	0.30103	0.0754	M	0.71581	2.175	0.19300	N	0.999976	D;D;D;D;D;D	0.89917	1.0;0.999;0.958;0.972;0.99;0.991	D;D;P;P;P;P	0.91635	0.999;0.952;0.776;0.573;0.888;0.856	T	0.11717	-1.0576	10	0.40728	T	0.16	.	8.098	0.30840	0.0803:0.0:0.7616:0.1582	.	199;316;443;388;443;443	F5H2S8;E9PPI1;E9PMT0;E9PLD8;G5E984;Q9Y2R2	.;.;.;.;.;PTN22_HUMAN	T	443;388;199;443;316;443	ENSP00000352833:P443T;ENSP00000435176:P388T;ENSP00000439372:P199T;ENSP00000388229:P443T;ENSP00000432674:P316T	ENSP00000346621:P443T	P	-	1	0	PTPN22	114182218	0.954000	0.32549	0.007000	0.13788	0.852000	0.48524	2.823000	0.48081	0.770000	0.33336	0.655000	0.94253	CCA	.		0.383	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033015.1	NM_015967	
RAPGEF3	10411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	48135289	48135289	+	Splice_Site	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr12:48135289A>G	ENST00000449771.2	-	19	2010	c.1922T>C	c.(1921-1923)cTg>cCg	p.L641P	RAPGEF3_ENST00000405493.2_Splice_Site_p.L599P|RAPGEF3_ENST00000549151.1_Splice_Site_p.L599P|RAPGEF3_ENST00000548919.1_Splice_Site_p.L550P|RP1-197B17.3_ENST00000547799.1_lincRNA|RAPGEF3_ENST00000171000.4_Splice_Site_p.L599P|RAPGEF3_ENST00000389212.3_Splice_Site_p.L641P			O95398	RPGF3_HUMAN	Rap guanine nucleotide exchange factor (GEF) 3	641					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of stress fiber assembly (GO:0051496)|Rap protein signal transduction (GO:0032486)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(7)	25	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		GGTCCCTACCAGCTCATGCAC	0.602																																					p.L641P		.											.	RAPGEF3	660	0			c.T1922C						.						80.0	80.0	80.0					12																	48135289		2203	4300	6503	SO:0001630	splice_region_variant	10411	exon19			CCTACCAGCTCAT	AK092448	CCDS31784.1, CCDS41775.1	12q13.1	2006-04-12	2004-03-26		ENSG00000079337	ENSG00000079337			16629	protein-coding gene	gene with protein product	"""exchange protein directly activated by cAMP 1"""	606057	"""RAP guanine-nucleotide-exchange factor (GEF) 3"""			10777494, 9856955	Standard	NM_001098531		Approved	cAMP-GEFI, EPAC, bcm910	uc001rpz.4	O95398	OTTHUMG00000133667	ENST00000449771.2:c.1923+1T>C	12.37:g.48135289A>G		141.0	0.0		143.0	30.0	NM_001098531	A8K2G5|E7EQC8|O95634|Q8WVN0	Missense_Mutation	SNP	ENST00000449771.2	37	CCDS41775.1	.	.	.	.	.	.	.	.	.	.	A	12.92	2.081437	0.36758	.	.	ENSG00000079337	ENST00000405493;ENST00000449771;ENST00000541821;ENST00000549151;ENST00000171000;ENST00000389211;ENST00000389212;ENST00000397089;ENST00000548919	T;T;T;T;T;T	0.74737	-0.87;-0.86;-0.87;-0.87;-0.86;-0.87	5.13	3.99	0.46301	Ras guanine nucleotide exchange factor, domain (1);	0.091635	0.45867	D	0.000338	T	0.71736	0.3375	L	0.34521	1.04	0.80722	D	1	D	0.55800	0.973	P	0.53689	0.732	T	0.72877	-0.4159	10	0.87932	D	0	.	9.2448	0.37518	0.913:0.0:0.087:0.0	.	641	O95398	RPGF3_HUMAN	P	599;641;288;599;599;599;641;604;550	ENSP00000384521:L599P;ENSP00000395708:L641P;ENSP00000448619:L599P;ENSP00000171000:L599P;ENSP00000373864:L641P;ENSP00000448480:L550P	ENSP00000171000:L599P	L	-	2	0	RAPGEF3	46421556	1.000000	0.71417	0.995000	0.50966	0.001000	0.01503	3.342000	0.52159	0.919000	0.36945	-0.250000	0.11733	CTG	.		0.602	RAPGEF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257848.1	NM_006105	Missense_Mutation
RNASEL	6041	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	182554500	182554500	+	Missense_Mutation	SNP	T	T	C	rs200144732		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:182554500T>C	ENST00000367559.3	-	2	1695	c.1442A>G	c.(1441-1443)tAc>tGc	p.Y481C	RNASEL_ENST00000444138.1_Missense_Mutation_p.Y481C|RNASEL_ENST00000539397.1_Missense_Mutation_p.Y481C	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	481	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						CTGGTGGGTGTATCCACAGGA	0.413																																					p.Y481C		.											.	RNASEL	336	0			c.A1442G						.						132.0	130.0	130.0					1																	182554500		2203	4300	6503	SO:0001583	missense	6041	exon2			TGGGTGTATCCAC	L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.1442A>G	1.37:g.182554500T>C	ENSP00000356530:p.Tyr481Cys	374.0	1.0		223.0	42.0	NM_021133	Q5W0L2|Q6AI46	Missense_Mutation	SNP	ENST00000367559.3	37	CCDS1347.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.098314	0.76870	.	.	ENSG00000135828	ENST00000367559;ENST00000444138;ENST00000543858;ENST00000539397	T;T;T	0.64803	-0.12;-0.12;-0.12	5.95	3.48	0.39840	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.108809	0.41294	D	0.000914	T	0.72732	0.3497	M	0.64676	1.99	0.09310	N	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.993;0.993	T	0.62431	-0.6856	10	0.62326	D	0.03	-23.9881	9.0105	0.36137	0.4239:0.0:0.0:0.5761	.	481;481;481	Q5W0L2;Q6AI46;Q05823	.;.;RN5A_HUMAN	C	481;481;125;481	ENSP00000356530:Y481C;ENSP00000411147:Y481C;ENSP00000440844:Y481C	ENSP00000356530:Y481C	Y	-	2	0	RNASEL	180821123	0.809000	0.29036	0.052000	0.19188	0.778000	0.44026	1.748000	0.38308	1.046000	0.40249	0.528000	0.53228	TAC	T|0.999;C|0.001		0.413	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085189.1	NM_021133	
RPL13	6137	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	89629361	89629361	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr16:89629361C>T	ENST00000393099.3	+	5	796	c.547C>T	c.(547-549)Cgt>Tgt	p.R183C	RPL13_ENST00000452368.3_Missense_Mutation_p.R136C|RPL13_ENST00000311528.5_Missense_Mutation_p.R183C|RPL13_ENST00000567815.1_Missense_Mutation_p.R183C|SNORD68_ENST00000363214.1_RNA	NM_033251.2	NP_150254.1	P26373	RL13_HUMAN	ribosomal protein L13	183					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|cytosolic ribosome (GO:0022626)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(3)|skin(1)|upper_aerodigestive_tract(2)	6		all_hematologic(23;0.0748)		all cancers(4;1.15e-07)|OV - Ovarian serous cystadenocarcinoma(4;7.8e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0139)		CGCTAGTCTCCGTATGGCCCG	0.488																																					p.R183C		.											.	RPL13	90	0			c.C547T						.						38.0	42.0	40.0					16																	89629361		2198	4298	6496	SO:0001583	missense	6137	exon6			AGTCTCCGTATGG	AB007172	CCDS10979.1, CCDS58492.1	16q24.3	2011-04-06			ENSG00000167526	ENSG00000167526		"""L ribosomal proteins"""	10303	protein-coding gene	gene with protein product		113703				9582194	Standard	NM_000977		Approved	D16S444E, BBC1, L13	uc002fnm.2	P26373	OTTHUMG00000133770	ENST00000393099.3:c.547C>T	16.37:g.89629361C>T	ENSP00000376811:p.Arg183Cys	165.0	0.0		120.0	13.0	NM_000977	B4DLX3|F5H1S2|Q3KQT8|Q567Q8|Q9BPX0	Missense_Mutation	SNP	ENST00000393099.3	37	CCDS10979.1	.	.	.	.	.	.	.	.	.	.	C	14.84	2.656118	0.47467	.	.	ENSG00000167526	ENST00000311528;ENST00000452368;ENST00000393099	T;T;T	0.51071	0.72;0.72;0.72	4.52	3.57	0.40892	.	0.000000	0.85682	U	0.000000	T	0.47377	0.1442	M	0.75447	2.3	0.80722	D	1	B;B	0.32543	0.375;0.027	B;B	0.29785	0.107;0.063	T	0.53158	-0.8478	10	0.62326	D	0.03	-9.6763	12.6145	0.56569	0.0:0.9187:0.0:0.0813	.	136;183	F5H1S2;P26373	.;RL13_HUMAN	C	183;136;183	ENSP00000307889:R183C;ENSP00000438959:R136C;ENSP00000376811:R183C	ENSP00000307889:R183C	R	+	1	0	RPL13	88156862	1.000000	0.71417	0.768000	0.31515	0.452000	0.32318	7.678000	0.84035	1.041000	0.40125	0.462000	0.41574	CGT	.		0.488	RPL13-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258294.2	NM_000977	
RTFDC1	51507	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	55048453	55048453	+	Splice_Site	SNP	T	T	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr20:55048453T>A	ENST00000023939.4	+	2	271		c.e2+2		RTFDC1_ENST00000395881.3_Splice_Site|RTFDC1_ENST00000357348.5_Splice_Site|snoU13_ENST00000459416.1_RNA	NM_001283035.1|NM_001283036.1|NM_016407.3	NP_001269964.1|NP_001269965.1|NP_057491.2	Q9BY42	RTF2_HUMAN	replication termination factor 2 domain containing 1																		ACTTGGCAGGTATGGTTTTTA	0.373																																					.		.											.	.	.	0			c.164+2T>A						.						95.0	94.0	94.0					20																	55048453		2203	4300	6503	SO:0001630	splice_region_variant	51507	exon2			GGCAGGTATGGTT	AF161513	CCDS13453.1, CCDS63316.1, CCDS63317.1	20q13	2012-10-29	2012-10-29	2012-10-29	ENSG00000022277	ENSG00000022277			15890	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 43"""	C20orf43			Standard	NM_001283035		Approved	HSPC164, CDAO5	uc002xxt.2	Q9BY42	OTTHUMG00000032801	ENST00000023939.4:c.164+2T>A	20.37:g.55048453T>A		84.0	0.0		48.0	11.0	NM_016407	E1P5Z9|Q9BYL7|Q9HCV9|Q9NX29|Q9NZZ8|Q9P002|Q9UHW3	Splice_Site	SNP	ENST00000023939.4	37	CCDS13453.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.174589	0.78452	.	.	ENSG00000022277	ENST00000023939;ENST00000395881;ENST00000357348;ENST00000449062	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9824	0.71321	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	C20orf43	54481860	1.000000	0.71417	0.998000	0.56505	0.916000	0.54674	7.134000	0.77268	2.016000	0.59253	0.477000	0.44152	.	.		0.373	RTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079817.2	NM_016407	Intron
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	237948157	237948157	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:237948157T>A	ENST00000366574.2	+	90	13462	c.13145T>A	c.(13144-13146)cTg>cAg	p.L4382Q	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.L4366Q|RYR2_ENST00000360064.6_Missense_Mutation_p.L4388Q	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4382					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATCTTTGGCCTGGATCTGAAG	0.537																																					p.L4382Q		.											.	RYR2	158	0			c.T13145A						.						43.0	42.0	42.0					1																	237948157		1937	4131	6068	SO:0001583	missense	6262	exon90			TTGGCCTGGATCT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.13145T>A	1.37:g.237948157T>A	ENSP00000355533:p.Leu4382Gln	84.0	0.0		77.0	23.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	17.27	3.348097	0.61183	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.95001	-3.58;-3.58;-3.58	5.56	5.56	0.83823	Ryanodine Receptor TM 4-6 (1);	0.241031	0.26582	N	0.023565	D	0.95056	0.8399	L	0.29908	0.895	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.69824	0.958;0.966	D	0.95781	0.8817	10	0.66056	D	0.02	-10.7165	15.7141	0.77655	0.0:0.0:0.0:1.0	.	1356;4382	B4DGV4;Q92736	.;RYR2_HUMAN	Q	4382;4388;4366;1356	ENSP00000355533:L4382Q;ENSP00000353174:L4388Q;ENSP00000443798:L4366Q	ENSP00000353174:L4388Q	L	+	2	0	RYR2	236014780	1.000000	0.71417	1.000000	0.80357	0.510000	0.34073	7.842000	0.86851	2.112000	0.64535	0.533000	0.62120	CTG	.		0.537	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
RYR3	6263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	34105063	34105063	+	Splice_Site	SNP	G	G	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr15:34105063G>C	ENST00000389232.4	+	73	10327		c.e73-1		RYR3_ENST00000415757.3_Splice_Site	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3						calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TCAATTTTCAGTCTGATGACC	0.428																																					.		.											.	RYR3	520	0			c.10243-1G>C						.						78.0	75.0	76.0					15																	34105063		1876	4112	5988	SO:0001630	splice_region_variant	6263	exon72			TTTTCAGTCTGAT		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.10258-1G>C	15.37:g.34105063G>C		87.0	0.0		56.0	11.0	NM_001243996	O15175|Q15412	Splice_Site	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477012	0.84640	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1742	0.89756	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RYR3	31892355	1.000000	0.71417	0.997000	0.53966	0.958000	0.62258	9.601000	0.98297	2.581000	0.87130	0.655000	0.94253	.	.		0.428	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		Intron
SCML2	10389	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	18283818	18283818	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:18283818G>C	ENST00000251900.4	-	8	994	c.835C>G	c.(835-837)Cag>Gag	p.Q279E	SCML2_ENST00000398048.3_Missense_Mutation_p.Q15E	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	279					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					CTCCTGACCTGCTGTGTTGGT	0.408																																					p.Q279E	Esophageal Squamous(100;1252 1965 19021 35517)	.											.	SCML2	226	0			c.C835G						.						162.0	147.0	152.0					X																	18283818		2203	4300	6503	SO:0001583	missense	10389	exon8			TGACCTGCTGTGT	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.835C>G	X.37:g.18283818G>C	ENSP00000251900:p.Gln279Glu	461.0	0.0		289.0	62.0	NM_006089	Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Missense_Mutation	SNP	ENST00000251900.4	37	CCDS14185.1	.	.	.	.	.	.	.	.	.	.	G	2.142	-0.396585	0.04899	.	.	ENSG00000102098	ENST00000251900;ENST00000398048;ENST00000442000	T;T	0.42513	2.3;0.97	5.5	2.7	0.31948	.	2.455680	0.01472	N	0.016315	T	0.39835	0.1093	L	0.57536	1.79	0.09310	N	1	B;B;B	0.29716	0.01;0.255;0.147	B;B;B	0.27262	0.004;0.078;0.029	T	0.10636	-1.0621	10	0.23891	T	0.37	.	5.0075	0.14295	0.161:0.0:0.54:0.299	.	247;15;279	B4DZR9;B4DRC2;Q9UQR0	.;.;SCML2_HUMAN	E	279;15;247	ENSP00000251900:Q279E;ENSP00000381126:Q15E	ENSP00000251900:Q279E	Q	-	1	0	SCML2	18193739	0.750000	0.28316	0.000000	0.03702	0.070000	0.16714	1.650000	0.37292	0.131000	0.18576	0.468000	0.43344	CAG	.		0.408	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055941.1	NM_006089	
SEMA3D	223117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	84666319	84666319	+	Silent	SNP	C	C	G	rs143217112		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr7:84666319C>G	ENST00000284136.6	-	10	1120	c.1077G>C	c.(1075-1077)gtG>gtC	p.V359V	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	359	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						CCATGCTATACACACAAACAG	0.398																																					p.V359V	Ovarian(63;442 1191 17318 29975 31528)	.											.	SEMA3D	138	0			c.G1077C						.						104.0	93.0	97.0					7																	84666319		2203	4300	6503	SO:0001819	synonymous_variant	223117	exon10			GCTATACACACAA	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1077G>C	7.37:g.84666319C>G		117.0	0.0		66.0	15.0	NM_152754	A6NK46|Q6UW77|Q8NCQ1	Silent	SNP	ENST00000284136.6	37	CCDS34676.1																																																																																			C|1.000;T|0.000		0.398	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
SEMA3F	6405	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	50220186	50220186	+	Silent	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:50220186G>T	ENST00000002829.3	+	9	1357	c.873G>T	c.(871-873)gcG>gcT	p.A291A	SEMA3F_ENST00000413852.1_Silent_p.A192A|SEMA3F_ENST00000434342.1_Silent_p.A260A	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	291	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		AGAGCCCCGCGGTGTACGCCC	0.607																																					p.A291A		.											.	SEMA3F	279	0			c.G873T						.						51.0	58.0	56.0					3																	50220186		2203	4300	6503	SO:0001819	synonymous_variant	6405	exon9			CCCCGCGGTGTAC	U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.873G>T	3.37:g.50220186G>T		47.0	0.0		24.0	11.0	NM_004186	C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Silent	SNP	ENST00000002829.3	37	CCDS2811.1																																																																																			.		0.607	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345929.1	NM_004186	
SFMBT2	57713	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	7285628	7285628	+	Silent	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr10:7285628G>A	ENST00000361972.4	-	9	1102	c.1012C>T	c.(1012-1014)Cta>Tta	p.L338L	SFMBT2_ENST00000397167.1_Silent_p.L338L	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	338					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						TCAGGTCTTAGGTCATCAATA	0.383																																					p.L338L		.											.	SFMBT2	141	0			c.C1012T						.						68.0	64.0	65.0					10																	7285628		2203	4300	6503	SO:0001819	synonymous_variant	57713	exon9			GTCTTAGGTCATC	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1012C>T	10.37:g.7285628G>A		93.0	0.0		104.0	11.0	NM_001029880	A7MD09|Q9HCF5	Silent	SNP	ENST00000361972.4	37	CCDS31138.1																																																																																			.		0.383	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
SIPA1L1	26037	ucsc.edu;bcgsc.ca	37	14	72139334	72139334	+	Silent	SNP	G	G	T	rs144855084		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr14:72139334G>T	ENST00000555818.1	+	9	3447	c.3099G>T	c.(3097-3099)ccG>ccT	p.P1033P	SIPA1L1_ENST00000381232.3_Silent_p.P1033P|SIPA1L1_ENST00000358550.2_Silent_p.P1033P|SIPA1L1_ENST00000537413.1_Silent_p.P508P	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1033	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		ACTGCACCCCGCGGAGGTAGG	0.552																																					p.P1033P		.											.	SIPA1L1	156	0			c.G3099T						.						49.0	44.0	46.0					14																	72139334		2203	4300	6503	SO:0001819	synonymous_variant	26037	exon9			CACCCCGCGGAGG	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.3099G>T	14.37:g.72139334G>T		74.0	0.0		41.0	4.0	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	Silent	SNP	ENST00000555818.1	37	CCDS9807.1																																																																																			G|0.999;A|0.000		0.552	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
SIRPG	55423	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	1629885	1629885	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr20:1629885T>G	ENST00000303415.3	-	2	307	c.243A>C	c.(241-243)aaA>aaC	p.K81N	SIRPG_ENST00000344103.4_Missense_Mutation_p.K81N|SIRPG_ENST00000216927.4_Missense_Mutation_p.K81N|SIRPG_ENST00000381580.1_Missense_Mutation_p.K48N|RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000381583.2_Missense_Mutation_p.K81N	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	81	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						AGTGGCCTTCTTTTTGATTGT	0.527																																					p.K81N		.											.	SIRPG	23	0			c.A243C						.						224.0	198.0	207.0					20																	1629885		2203	4300	6503	SO:0001583	missense	55423	exon2			GCCTTCTTTTTGA	AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.243A>C	20.37:g.1629885T>G	ENSP00000305529:p.Lys81Asn	1118.0	2.0		816.0	294.0	NM_001039508	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	ENST00000303415.3	37	CCDS13020.2	.	.	.	.	.	.	.	.	.	.	.	9.742	1.165088	0.21538	.	.	ENSG00000089012	ENST00000381580;ENST00000344103;ENST00000303415;ENST00000381583;ENST00000216927	T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13	1.93	0.812	0.18744	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65678	0.2714	L	0.60957	1.885	0.09310	N	1	D;B;P	0.61697	0.99;0.288;0.537	P;B;B	0.59288	0.855;0.043;0.113	T	0.53337	-0.8453	9	0.51188	T	0.08	.	3.5695	0.07912	0.0:0.2117:0.0:0.7883	.	81;81;81	Q9P1W8-3;Q9P1W8-4;Q9P1W8	.;.;SIRPG_HUMAN	N	48;81;81;81;81	ENSP00000370992:K48N;ENSP00000342759:K81N;ENSP00000305529:K81N;ENSP00000370995:K81N;ENSP00000216927:K81N	ENSP00000216927:K81N	K	-	3	2	SIRPG	1577885	0.002000	0.14202	0.005000	0.12908	0.188000	0.23474	0.394000	0.20834	0.212000	0.20703	0.164000	0.16699	AAA	.		0.527	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077566.2	NM_018556	
SLC17A9	63910	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	61588131	61588131	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr20:61588131C>T	ENST00000370351.4	+	2	205	c.74C>T	c.(73-75)gCa>gTa	p.A25V	SLC17A9_ENST00000488738.1_3'UTR|SLC17A9_ENST00000370349.3_Missense_Mutation_p.A19V	NM_022082.3	NP_071365	Q9BYT1	S17A9_HUMAN	solute carrier family 17 (vesicular nucleotide transporter), member 9	25					exocytosis (GO:0006887)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	23						GAGTGCCAGGCATGGACGGGG	0.657																																					p.A25V		.											.	SLC17A9	92	0			c.C74T						.						20.0	23.0	22.0					20																	61588131		2080	4207	6287	SO:0001583	missense	63910	exon2			GCCAGGCATGGAC	AK027065	CCDS42901.1	20q13.33	2013-07-18	2013-07-18	2009-01-22	ENSG00000101194	ENSG00000101194		"""Solute carriers"""	16192	protein-coding gene	gene with protein product		612107	"""chromosome 20 open reading frame 59"", ""solute carrier family 17, member 9"""	C20orf59		18375752	Standard	NM_022082		Approved	FLJ23412, VNUT	uc002yea.4	Q9BYT1	OTTHUMG00000032951	ENST00000370351.4:c.74C>T	20.37:g.61588131C>T	ENSP00000359376:p.Ala25Val	47.0	0.0		28.0	9.0	NM_022082	B3KTF2|Q5W198|Q8TB07|Q8TBP4|Q8TEL5|Q9BYT0|Q9BYT2	Missense_Mutation	SNP	ENST00000370351.4	37	CCDS42901.1	.	.	.	.	.	.	.	.	.	.	C	0.019	-1.448460	0.01080	.	.	ENSG00000101194	ENST00000370351;ENST00000370349;ENST00000411611	T;T;D	0.82433	0.35;0.19;-1.61	4.91	-3.11	0.05299	Major facilitator superfamily domain, general substrate transporter (1);	0.650894	0.15895	N	0.239369	T	0.53562	0.1804	N	0.02296	-0.605	0.21064	N	0.999792	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.51663	-0.8677	10	0.02654	T	1	.	12.1812	0.54214	0.0:0.2954:0.0:0.7046	.	45;25;19	B4DPU8;Q9BYT1;Q9BYT1-2	.;S17A9_HUMAN;.	V	25;19;45	ENSP00000359376:A25V;ENSP00000359374:A19V;ENSP00000388215:A45V	ENSP00000359374:A19V	A	+	2	0	SLC17A9	61058576	0.000000	0.05858	0.016000	0.15963	0.070000	0.16714	-0.020000	0.12525	-0.397000	0.07691	0.655000	0.94253	GCA	.		0.657	SLC17A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080100.1	NM_022082	
SLC9A5	6553	broad.mit.edu;mdanderson.org	37	16	67282983	67282983	+	Silent	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr16:67282983G>A	ENST00000299798.11	+	1	131	c.66G>A	c.(64-66)caG>caA	p.Q22Q	SLC9A5_ENST00000561472.2_3'UTR|FHOD1_ENST00000258201.4_5'Flank	NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5	22					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		AGCCCACCCAGAAGCCAGAGT	0.746																																					p.Q22Q		.											.	SLC9A5	92	0			c.G66A						.						12.0	18.0	16.0					16																	67282983		1763	3918	5681	SO:0001819	synonymous_variant	6553	exon1			CACCCAGAAGCCA		CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740		"""Solute carriers"""	11078	protein-coding gene	gene with protein product		600477	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 5"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 5"""			7759094, 9933642	Standard	NM_004594		Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.66G>A	16.37:g.67282983G>A		13.0	0.0		10.0	6.0	NM_004594	A5PKY7|Q9Y626	Silent	SNP	ENST00000299798.11	37	CCDS42178.1																																																																																			.		0.746	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421386.1		
SMARCA4	6597	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	11143994	11143994	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:11143994G>A	ENST00000429416.3	+	27	3856	c.3575G>A	c.(3574-3576)cGc>cAc	p.R1192H	SMARCA4_ENST00000358026.2_Missense_Mutation_p.R1192H|SMARCA4_ENST00000444061.3_Missense_Mutation_p.R1192H|SMARCA4_ENST00000413806.3_Missense_Mutation_p.R1192H|SMARCA4_ENST00000344626.4_Missense_Mutation_p.R1192H|SMARCA4_ENST00000590574.1_Missense_Mutation_p.R1192H|SMARCA4_ENST00000589677.1_Missense_Mutation_p.R1192H|SMARCA4_ENST00000541122.2_Missense_Mutation_p.R1192H|SMARCA4_ENST00000450717.3_Missense_Mutation_p.R1192H	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1192	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CGAGCCCACCGCATCGGGCAG	0.612			"""F, N, Mis"""		NSCLC																																p.R1192H		.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4	1523	1	Unknown(1)	lung(1)	c.G3575A						.						63.0	62.0	62.0					19																	11143994		2203	4300	6503	SO:0001583	missense	6597	exon26			CCCACCGCATCGG	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3575G>A	19.37:g.11143994G>A	ENSP00000395654:p.Arg1192His	90.0	0.0		77.0	15.0	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769759	0.90020	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.97850	-4.57;-4.57;-4.57;-4.57;-4.57;-4.57;-4.57	4.74	4.74	0.60224	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99426	0.9797	H	0.99863	4.86	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97804	1.0246	10	0.87932	D	0	-34.1151	16.7067	0.85374	0.0:0.0:1.0:0.0	.	1192;1192;1192;1192;1192;412;1192	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	H	1192;1192;1256;1192;1192;1192;1192;1192	ENSP00000395654:R1192H;ENSP00000350720:R1192H;ENSP00000343896:R1192H;ENSP00000445036:R1192H;ENSP00000392837:R1192H;ENSP00000397783:R1192H;ENSP00000414727:R1192H	ENSP00000343896:R1192H	R	+	2	0	SMARCA4	11004994	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.319000	0.96338	2.488000	0.83962	0.558000	0.71614	CGC	.		0.612	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
SMPD4	55627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	130930247	130930247	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr2:130930247G>T	ENST00000409031.1	-	7	1723	c.575C>A	c.(574-576)cCg>cAg	p.P192Q	SMPD4_ENST00000443958.2_Intron|SMPD4_ENST00000339679.7_Missense_Mutation_p.P79Q|SMPD4_ENST00000431183.2_Missense_Mutation_p.P119Q|SMPD4_ENST00000473720.1_Intron|SMPD4_ENST00000426662.2_Intron|SMPD4_ENST00000351288.6_Missense_Mutation_p.P192Q|SMPD4_ENST00000452225.2_Intron|SMPD4_ENST00000453750.1_Intron	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)	153					cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	atactcGAACGGATCTGAGAG	0.587																																					p.P192Q		.											.	SMPD4	90	0			c.C575A						.						98.0	104.0	102.0					2																	130930247		2203	4300	6503	SO:0001583	missense	55627	exon7			TCGAACGGATCTG	AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.575C>A	2.37:g.130930247G>T	ENSP00000386531:p.Pro192Gln	184.0	0.0		158.0	34.0	NM_017751	B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	Missense_Mutation	SNP	ENST00000409031.1	37	CCDS42751.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	14.71|14.71	2.617956|2.617956	0.46736|0.46736	.|.	.|.	ENSG00000136699|ENSG00000136699	ENST00000351288;ENST00000409031;ENST00000431183;ENST00000339679|ENST00000439886	.|.	.|.	.|.	3.5|3.5	3.5|3.5	0.40072|0.40072	.|.	0.199707|.	0.43579|.	D|.	0.000547|.	T|T	0.69593|0.69593	0.3128|0.3128	M|M	0.67953|0.67953	2.075|2.075	0.80722|0.80722	D|D	1|1	D;D;P;P;D|.	0.58268|.	0.982;0.968;0.955;0.915;0.98|.	P;P;P;P;P|.	0.57960|.	0.708;0.77;0.567;0.801;0.83|.	T|T	0.69939|0.69939	-0.5009|-0.5009	9|5	0.56958|.	D|.	0.05|.	.|.	12.5618|12.5618	0.56286|0.56286	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	119;79;153;153;192|.	E7ESA2;B4E0T5;Q9NXE4-2;Q9NXE4;B1PBA3|.	.;.;.;NSMA3_HUMAN;.|.	Q|S	192;192;119;79|21	.|.	ENSP00000339721:P79Q|.	P|R	-|-	2|1	0|0	SMPD4|SMPD4	130646717|130646717	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.921000|0.921000	0.55340|0.55340	6.881000|6.881000	0.75584|0.75584	1.793000|1.793000	0.52555|0.52555	0.455000|0.455000	0.32223|0.32223	CCG|CGT	.		0.587	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254516.3	NM_017751	
SOCS6	9306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	67992724	67992724	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr18:67992724G>C	ENST00000397942.3	+	2	1136	c.820G>C	c.(820-822)Gtt>Ctt	p.V274L	SOCS6_ENST00000582322.1_Missense_Mutation_p.V274L	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	274					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				CCAGGACCTAGTTGTCGCCCC	0.572																																					p.V274L	Melanoma(84;1024 1361 24382 36583 42651)	.											.	SOCS6	721	0			c.G820C						.						161.0	140.0	147.0					18																	67992724		2203	4300	6503	SO:0001583	missense	9306	exon2			GACCTAGTTGTCG	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.820G>C	18.37:g.67992724G>C	ENSP00000381034:p.Val274Leu	279.0	0.0		164.0	55.0	NM_004232	Q8WUM3	Missense_Mutation	SNP	ENST00000397942.3	37	CCDS11998.1	.	.	.	.	.	.	.	.	.	.	G	6.742	0.505609	0.12822	.	.	ENSG00000170677	ENST00000397942	T	0.27104	1.69	5.0	5.0	0.66597	.	0.808617	0.10957	N	0.615438	T	0.24353	0.0590	L	0.29908	0.895	0.39481	D	0.967887	B	0.06786	0.001	B	0.04013	0.001	T	0.06588	-1.0818	10	0.33940	T	0.23	-4.9182	18.3063	0.90182	0.0:0.0:1.0:0.0	.	274	O14544	SOCS6_HUMAN	L	274	ENSP00000381034:V274L	ENSP00000381034:V274L	V	+	1	0	SOCS6	66143704	1.000000	0.71417	0.016000	0.15963	0.209000	0.24338	5.769000	0.68865	2.309000	0.77851	0.561000	0.74099	GTT	.		0.572	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2		
SPTBN4	57731	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	41073984	41073984	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:41073984G>A	ENST00000352632.3	+	31	6838	c.6752G>A	c.(6751-6753)cGg>cAg	p.R2251Q	SPTBN4_ENST00000392025.1_Missense_Mutation_p.R994Q|SPTBN4_ENST00000598249.1_Missense_Mutation_p.R2251Q			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2251					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CGGCCTGAGCGGCAAGAGTCA	0.746																																					p.R2251Q		.											.	SPTBN4	94	0			c.G6752A						.						12.0	12.0	12.0					19																	41073984		2102	4131	6233	SO:0001583	missense	57731	exon31			CTGAGCGGCAAGA	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.6752G>A	19.37:g.41073984G>A	ENSP00000263373:p.Arg2251Gln	41.0	0.0		50.0	15.0	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	12.17	1.858181	0.32791	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000392025	T;T	0.77620	-1.11;0.26	4.36	3.32	0.38043	.	0.158713	0.28772	U	0.014193	T	0.55433	0.1920	N	0.14661	0.345	0.21184	N	0.999766	B;B	0.23058	0.079;0.079	B;B	0.10450	0.002;0.005	T	0.40757	-0.9546	10	0.44086	T	0.13	.	4.0106	0.09621	0.2037:0.2073:0.589:0.0	.	994;2251	C9JY79;Q9H254	.;SPTN4_HUMAN	Q	2251;2251;994	ENSP00000263373:R2251Q;ENSP00000375879:R994Q	ENSP00000263373:R2251Q	R	+	2	0	SPTBN4	45765824	0.975000	0.34042	0.935000	0.37517	0.023000	0.10783	3.248000	0.51430	1.955000	0.56771	0.561000	0.74099	CGG	.		0.746	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
SSX7	280658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	52677345	52677345	+	Silent	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:52677345T>C	ENST00000298181.5	-	6	590	c.432A>G	c.(430-432)aaA>aaG	p.K144K		NM_173358.2	NP_775494.1	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|skin(1)	16	Ovarian(276;0.236)					AGGTACTTGGTTTTCCTGGAG	0.507																																					p.K144K		.											.	SSX7	91	0			c.A432G						.						199.0	172.0	181.0					X																	52677345		2203	4300	6503	SO:0001819	synonymous_variant	280658	exon6			ACTTGGTTTTCCT	BK000687	CCDS14343.1	Xp11.23	2011-02-10			ENSG00000187754	ENSG00000187754			19653	protein-coding gene	gene with protein product		300542				12216073	Standard	NM_173358		Approved		uc004dqx.1	Q7RTT5	OTTHUMG00000021572	ENST00000298181.5:c.432A>G	X.37:g.52677345T>C		1399.0	1.0		1049.0	178.0	NM_173358		Silent	SNP	ENST00000298181.5	37	CCDS14343.1																																																																																			.		0.507	SSX7-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056671.1	NM_173358	
ST18	9705	ucsc.edu;bcgsc.ca	37	8	53124658	53124658	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr8:53124658A>G	ENST00000276480.7	-	8	750	c.67T>C	c.(67-69)Tca>Cca	p.S23P		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	23					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGGATTAGTGAATCCATTGGC	0.338																																					p.S23P		.											.	ST18	95	0			c.T67C						.						88.0	96.0	94.0					8																	53124658		2203	4300	6503	SO:0001583	missense	9705	exon8			TTAGTGAATCCAT	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.67T>C	8.37:g.53124658A>G	ENSP00000276480:p.Ser23Pro	48.0	0.0		36.0	4.0	NM_014682	Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	37	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	A	14.27	2.485733	0.44147	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.45668	0.89;0.89	5.27	4.03	0.46877	.	0.548755	0.18403	N	0.142294	T	0.27798	0.0684	N	0.19112	0.55	0.27126	N	0.962029	P	0.41041	0.736	B	0.38803	0.282	T	0.10636	-1.0621	10	0.39692	T	0.17	-0.2614	11.3054	0.49332	0.8637:0.0:0.0:0.1363	.	23	O60284	ST18_HUMAN	P	23	ENSP00000276480:S23P;ENSP00000428521:S23P	ENSP00000276480:S23P	S	-	1	0	ST18	53287211	1.000000	0.71417	1.000000	0.80357	0.215000	0.24574	3.362000	0.52314	2.109000	0.64355	0.460000	0.39030	TCA	.		0.338	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
STAG3	10734	broad.mit.edu;ucsc.edu;mdanderson.org	37	7	99800188	99800188	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr7:99800188C>A	ENST00000426455.1	+	25	3082	c.2675C>A	c.(2674-2676)tCa>tAa	p.S892*	GATS_ENST00000543273.1_RNA|STAG3_ENST00000394018.2_Nonsense_Mutation_p.S834*|STAG3_ENST00000317296.5_Nonsense_Mutation_p.S892*|GATS_ENST00000436886.2_3'UTR|STAG3_ENST00000440830.1_3'UTR	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	892					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GATGCAGCCTCAGATGTTTTC	0.498																																					p.S892X		.											.	STAG3	543	0			c.C2675A						.						162.0	169.0	167.0					7																	99800188		2203	4300	6503	SO:0001587	stop_gained	10734	exon25			CAGCCTCAGATGT	AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.2675C>A	7.37:g.99800188C>A	ENSP00000400359:p.Ser892*	71.0	0.0		46.0	6.0	NM_012447	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Nonsense_Mutation	SNP	ENST00000426455.1	37	CCDS34703.1	.	.	.	.	.	.	.	.	.	.	.	43	10.031122	0.99321	.	.	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000317296	.	.	.	5.18	5.18	0.71444	.	0.172194	0.28042	N	0.016827	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-9.0723	16.2332	0.82358	0.0:1.0:0.0:0.0	.	.	.	.	X	892;834;892	.	ENSP00000319318:S892X	S	+	2	0	STAG3	99638124	0.999000	0.42202	1.000000	0.80357	0.980000	0.70556	5.388000	0.66249	2.697000	0.92050	0.563000	0.77884	TCA	.		0.498	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338734.2	NM_012447	
SYNJ1	8867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	34022586	34022586	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr21:34022586C>T	ENST00000322229.7	-	22	2944	c.2945G>A	c.(2944-2946)aGt>aAt	p.S982N	SYNJ1_ENST00000382499.2_Missense_Mutation_p.S1021N|SYNJ1_ENST00000382491.3_Missense_Mutation_p.S977N|SYNJ1_ENST00000357345.3_Missense_Mutation_p.S982N|SYNJ1_ENST00000433931.2_Missense_Mutation_p.S1021N			O43426	SYNJ1_HUMAN	synaptojanin 1	982	Pro-rich.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						TTTCTCTAAACTCATTTCTTC	0.353																																					p.S1021N		.											.	SYNJ1	232	0			c.G3062A						.						158.0	160.0	160.0					21																	34022586		2203	4300	6503	SO:0001583	missense	8867	exon23			TCTAAACTCATTT	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.2945G>A	21.37:g.34022586C>T	ENSP00000322234:p.Ser982Asn	406.0	0.0		237.0	77.0	NM_203446	O43425|O94984|Q4KMR1	Missense_Mutation	SNP	ENST00000322229.7	37	CCDS54484.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.313093	0.23908	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229	D;D;D;D;D	0.93859	-2.42;-3.28;-3.3;-2.49;-2.46	5.65	3.52	0.40303	Domain of unknown function DUF1866 (1);	0.115478	0.85682	D	0.000000	D	0.82898	0.5137	N	0.11201	0.11	0.38489	D	0.947926	B;B;B;B;B	0.12013	0.001;0.001;0.001;0.005;0.0	B;B;B;B;B	0.15484	0.01;0.008;0.002;0.013;0.002	T	0.76085	-0.3088	10	0.13853	T	0.58	.	9.138	0.36886	0.0:0.7065:0.0:0.2935	.	977;1021;982;982;982	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4	.;.;.;SYNJ1_HUMAN;.	N	977;982;1021;1021;982	ENSP00000371931:S977N;ENSP00000349903:S982N;ENSP00000371939:S1021N;ENSP00000409667:S1021N;ENSP00000322234:S982N	ENSP00000322234:S982N	S	-	2	0	SYNJ1	32944457	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.780000	0.38634	1.400000	0.46741	0.650000	0.86243	AGT	.		0.353	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
SYT2	127833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	202572235	202572235	+	Silent	SNP	G	G	A	rs141305662		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:202572235G>A	ENST00000367267.1	-	4	549	c.357C>T	c.(355-357)gaC>gaT	p.D119D	RP11-569A11.1_ENST00000428573.1_RNA|SYT2_ENST00000367268.4_Silent_p.D119D	NM_001136504.1	NP_001129976.1	Q8N9I0	SYT2_HUMAN	synaptotagmin II	119					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	29			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	CTGTCTCTGCGTCGTCGTCAT	0.567													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19190	0.0		0.0	False		,,,				2504	0.0				p.D119D		.											.	SYT2	93	0			c.C357T						.	G	,	0,4406		0,0,2203	115.0	100.0	105.0		357,357	-10.0	0.1	1	dbSNP_134	105	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous,coding-synonymous	SYT2	NM_001136504.1,NM_177402.4	,	0,5,6498	AA,AG,GG		0.0581,0.0,0.0384	,	119/420,119/420	202572235	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	127833	exon4			CTCTGCGTCGTCG	AK090672	CCDS1427.1	1q32.1	2013-01-21			ENSG00000143858	ENSG00000143858		"""Synaptotagmins"""	11510	protein-coding gene	gene with protein product		600104				7749232	Standard	NM_177402		Approved		uc010pqb.2	Q8N9I0	OTTHUMG00000041388	ENST00000367267.1:c.357C>T	1.37:g.202572235G>A		115.0	0.0		95.0	19.0	NM_177402	Q496K5|Q8NBE5	Silent	SNP	ENST00000367267.1	37	CCDS1427.1																																																																																			G|0.999;A|0.001		0.567	SYT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099157.1	NM_177402	
TCF20	6942	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	42606748	42606748	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr22:42606748A>T	ENST00000359486.3	-	1	4700	c.4564T>A	c.(4564-4566)Tca>Aca	p.S1522T	TCF20_ENST00000404876.1_5'Flank|TCF20_ENST00000335626.4_Missense_Mutation_p.S1522T	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1522					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						TGCTTCGGTGAAATCGTCACT	0.468																																					p.S1522T		.											.	TCF20	95	0			c.T4564A						.						108.0	93.0	98.0					22																	42606748		2203	4300	6503	SO:0001583	missense	6942	exon1			TCGGTGAAATCGT	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.4564T>A	22.37:g.42606748A>T	ENSP00000352463:p.Ser1522Thr	352.0	0.0		323.0	22.0	NM_181492	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	37	CCDS14033.1	.	.	.	.	.	.	.	.	.	.	A	6.147	0.395309	0.11638	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.59772	0.24;0.24	5.85	5.85	0.93711	.	0.101011	0.44285	D	0.000462	T	0.39655	0.1086	N	0.17082	0.46	0.80722	D	1	B;B	0.12630	0.006;0.003	B;B	0.12156	0.007;0.003	T	0.27331	-1.0077	10	0.29301	T	0.29	-12.5995	10.0749	0.42355	0.7415:0.0:0.0:0.2585	.	1522;1522	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	T	1522	ENSP00000352463:S1522T;ENSP00000335561:S1522T	ENSP00000335561:S1522T	S	-	1	0	TCF20	40936692	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	2.252000	0.43196	2.233000	0.73108	0.533000	0.62120	TCA	.		0.468	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492	
TDRD9	122402	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	104488538	104488538	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr14:104488538C>T	ENST00000409874.4	+	24	2525	c.2477C>T	c.(2476-2478)aCc>aTc	p.T826I	TDRD9_ENST00000339063.5_Missense_Mutation_p.T826I	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	826					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				AGATTTAAAACCCTTCCTGCA	0.363																																					p.T826I		.											.	TDRD9	70	0			c.C2477T						.						33.0	31.0	31.0					14																	104488538		2203	4296	6499	SO:0001583	missense	122402	exon24			TTAAAACCCTTCC	AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.2477C>T	14.37:g.104488538C>T	ENSP00000387303:p.Thr826Ile	268.0	0.0		123.0	39.0	NM_153046	A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Missense_Mutation	SNP	ENST00000409874.4	37	CCDS9987.2	.	.	.	.	.	.	.	.	.	.	C	7.544	0.661388	0.14645	.	.	ENSG00000156414	ENST00000409874;ENST00000339063	T;T	0.03212	4.02;4.01	5.6	3.78	0.43462	.	0.382936	0.24688	N	0.036418	T	0.03608	0.0103	L	0.38531	1.155	0.23361	N	0.997832	B;B	0.22003	0.063;0.004	B;B	0.19946	0.027;0.003	T	0.36138	-0.9760	10	0.40728	T	0.16	.	7.8325	0.29351	0.0:0.7265:0.0:0.2735	.	826;826	Q8NDG6-2;Q8NDG6	.;TDRD9_HUMAN	I	826	ENSP00000387303:T826I;ENSP00000343545:T826I	ENSP00000343545:T826I	T	+	2	0	TDRD9	103558291	0.018000	0.18449	0.014000	0.15608	0.832000	0.47134	0.971000	0.29396	1.370000	0.46153	0.650000	0.86243	ACC	.		0.363	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328325.3	NM_153046	
TECR	9524	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	14676612	14676612	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:14676612C>A	ENST00000215567.5	+	13	993	c.856C>A	c.(856-858)Cac>Aac	p.H286N	TECR_ENST00000436007.2_Missense_Mutation_p.H301N|TECR_ENST00000600083.1_Missense_Mutation_p.H131N|TECR_ENST00000596073.1_Missense_Mutation_p.H131N	NM_138501.5	NP_612510.1	Q9NZ01	TECR_HUMAN	trans-2,3-enoyl-CoA reductase	286					cellular lipid metabolic process (GO:0044255)|fatty acid elongation (GO:0030497)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|nucleus (GO:0005634)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|large_intestine(1)|ovary(1)	3						CAAGGGCAAGCACCGCAGCTA	0.667																																					p.H286N		.											.	TECR	90	0			c.C856A						.						16.0	16.0	16.0					19																	14676612		2194	4290	6484	SO:0001583	missense	9524	exon13			GGCAAGCACCGCA	AK001416	CCDS12313.1	19p13.12	2014-05-27	2009-07-21	2009-07-21	ENSG00000099797	ENSG00000099797			4551	protein-coding gene	gene with protein product		610057	"""glycoprotein, synaptic 2"""	SC2, GPSN2		9653160, 12482854	Standard	NM_138501		Approved	TER, MRT14	uc002mza.3	Q9NZ01		ENST00000215567.5:c.856C>A	19.37:g.14676612C>A	ENSP00000215567:p.His286Asn	104.0	1.0		104.0	11.0	NM_138501	B2RD55|O75350|Q6IBB2|Q9BWK3|Q9Y6P0	Missense_Mutation	SNP	ENST00000215567.5	37	CCDS12313.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.540910	0.85917	.	.	ENSG00000099797	ENST00000215567;ENST00000436007	T;T	0.41758	0.99;0.99	4.67	4.67	0.58626	3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.69531	0.3121	M	0.88704	2.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.77035	-0.2737	10	0.87932	D	0	-16.8908	15.0436	0.71811	0.0:1.0:0.0:0.0	.	286;301;286	B3KM97;B3KSQ1;Q9NZ01	.;.;TECR_HUMAN	N	286;301	ENSP00000215567:H286N;ENSP00000397206:H301N	ENSP00000215567:H286N	H	+	1	0	TECR	14537612	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.151000	0.77411	2.158000	0.67659	0.289000	0.19496	CAC	.		0.667	TECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466000.1	NM_138501	
TFPT	29844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54611472	54611472	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:54611472G>A	ENST00000391759.1	-	5	908	c.503C>T	c.(502-504)cCg>cTg	p.P168L	NDUFA3_ENST00000391764.3_Intron|TFPT_ENST00000391758.1_Missense_Mutation_p.P159L|TFPT_ENST00000391757.1_Missense_Mutation_p.R156C	NM_013342.3	NP_037474.1	P0C1Z6	TFPT_HUMAN	TCF3 (E2A) fusion partner (in childhood Leukemia)	168					apoptotic signaling pathway (GO:0097190)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(2)|lung(2)	4	all_cancers(19;0.004)|all_epithelial(19;0.00195)|all_lung(19;0.0193)|Lung NSC(19;0.0358)|Breast(117;0.137)|Ovarian(34;0.19)					CCTTCTGGGCGGGGACAGTGT	0.701			T	TCF3	pre-B ALL																																p.P168L		.		Dom	yes		19	19q13	29844	TCF3 (E2A) fusion partner (in childhood Leukemia)		L	.	TFPT	658	0			c.C503T						.						24.0	27.0	26.0					19																	54611472		2202	4298	6500	SO:0001583	missense	29844	exon5			CTGGGCGGGGACA	AF052052	CCDS12878.1	19q13	2011-07-06			ENSG00000105619	ENSG00000105619		"""INO80 complex subunits"""	13630	protein-coding gene	gene with protein product	"""amida, partner of the E2A"", ""INO80 complex subunit F"""	609519				10644725, 16230350	Standard	NM_013342		Approved	FB1, amida, INO80F	uc010yej.1	P0C1Z6	OTTHUMG00000065906	ENST00000391759.1:c.503C>T	19.37:g.54611472G>A	ENSP00000375639:p.Pro168Leu	106.0	0.0		93.0	16.0	NM_013342		Missense_Mutation	SNP	ENST00000391759.1	37	CCDS12878.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.44|13.44	2.237797|2.237797	0.39598|0.39598	.|.	.|.	ENSG00000105619|ENSG00000105619	ENST00000391759;ENST00000391758|ENST00000391757	.|.	.|.	.|.	5.04|5.04	5.04|5.04	0.67666|0.67666	.|.	0.424346|.	0.24927|.	N|.	0.034489|.	T|T	0.42223|0.42223	0.1193|0.1193	L|L	0.36672|0.36672	1.1|1.1	0.24947|0.24947	N|N	0.991819|0.991819	B|.	0.20459|.	0.045|.	B|.	0.11329|.	0.006|.	T|T	0.37033|0.37033	-0.9723|-0.9723	9|6	0.38643|0.62326	T|D	0.18|0.03	-14.0125|-14.0125	11.1157|11.1157	0.48259|0.48259	0.0867:0.0:0.9133:0.0|0.0867:0.0:0.9133:0.0	.|.	168|.	P0C1Z6|.	TFPT_HUMAN|.	L|C	168;159|156	.|.	ENSP00000375638:P159L|ENSP00000375637:R156C	P|R	-|-	2|1	0|0	TFPT|TFPT	59303284|59303284	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.637000|0.637000	0.38172|0.38172	2.972000|2.972000	0.49256|0.49256	2.512000|2.512000	0.84698|0.84698	0.655000|0.655000	0.94253|0.94253	CCG|CGC	.		0.701	TFPT-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141215.4	NM_013342	
TM2D2	83877	ucsc.edu;bcgsc.ca	37	8	38851171	38851171	+	Silent	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr8:38851171A>G	ENST00000456397.2	-	3	417	c.324T>C	c.(322-324)ggT>ggC	p.G108G	TM2D2_ENST00000522434.1_5'UTR|TM2D2_ENST00000456845.2_Silent_p.G65G|TM2D2_ENST00000397070.2_Silent_p.G65G|TM2D2_ENST00000412303.1_Silent_p.G65G	NM_078473.2	NP_510882.1	Q9BX73	TM2D2_HUMAN	TM2 domain containing 2	108						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6		all_lung(54;0.00338)|Lung NSC(58;0.0133)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			TGTAGGCCTGACCGCCGAACT	0.448																																					p.G108G		.											.	TM2D2	90	0			c.T324C						.						66.0	56.0	60.0					8																	38851171		2203	4300	6503	SO:0001819	synonymous_variant	83877	exon3			GGCCTGACCGCCG	AF353991	CCDS6111.1, CCDS43733.1	8p11.23	2005-08-09				ENSG00000169490			24127	protein-coding gene	gene with protein product		610081				11278849	Standard	XM_005273657		Approved	BLP1	uc003xmk.3	Q9BX73		ENST00000456397.2:c.324T>C	8.37:g.38851171A>G		64.0	0.0		29.0	4.0	NM_078473	B2RBK4|D3DSX8|Q8N0X9	Silent	SNP	ENST00000456397.2	37	CCDS6111.1																																																																																			.		0.448	TM2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377280.1	NM_031940	
TMEM173	340061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	138855859	138855859	+	Missense_Mutation	SNP	G	G	T	rs370381358		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr5:138855859G>T	ENST00000330794.4	-	8	1460	c.1127C>A	c.(1126-1128)aCg>aAg	p.T376K	TMEM173_ENST00000511850.1_5'Flank	NM_198282.2	NP_938023.1	Q86WV6	STING_HUMAN	transmembrane protein 173	376	C-terminal tail (CTT).				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	cyclic-di-GMP binding (GO:0035438)|cyclic-GMP-AMP binding (GO:0061507)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(6)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AGAGAAATCCGTGCGGAGAGG	0.602																																					p.T376K		.											.	TMEM173	69	0			c.C1127A						.						43.0	43.0	43.0					5																	138855859		2203	4300	6503	SO:0001583	missense	340061	exon8			AAATCCGTGCGGA		CCDS4215.1	5q31.2	2009-11-06			ENSG00000184584	ENSG00000184584			27962	protein-coding gene	gene with protein product		612374				12477932	Standard	XM_005268445		Approved	FLJ38577, NET23	uc003lep.3	Q86WV6	OTTHUMG00000129239	ENST00000330794.4:c.1127C>A	5.37:g.138855859G>T	ENSP00000331288:p.Thr376Lys	116.0	0.0		67.0	30.0	NM_198282	A8K3P6|B6EB35|D6RBX0|D6RE01|D6RID9	Missense_Mutation	SNP	ENST00000330794.4	37	CCDS4215.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892396	0.33442	.	.	ENSG00000184584	ENST00000330794	T	0.24908	1.83	5.36	4.48	0.54585	.	0.782790	0.11811	N	0.527174	T	0.24470	0.0593	L	0.34521	1.04	0.09310	N	1	P	0.40638	0.725	B	0.40165	0.321	T	0.10776	-1.0615	10	0.72032	D	0.01	-2.6099	13.2827	0.60224	0.0:0.3784:0.6215:0.0	.	376	Q86WV6	TM173_HUMAN	K	376	ENSP00000331288:T376K	ENSP00000331288:T376K	T	-	2	0	TMEM173	138836043	0.031000	0.19500	0.079000	0.20413	0.099000	0.18886	1.556000	0.36288	1.230000	0.43646	0.462000	0.41574	ACG	.		0.602	TMEM173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251338.1	NM_198282	
TNRC18	84629	ucsc.edu;bcgsc.ca	37	7	5391483	5391483	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr7:5391483A>G	ENST00000430969.1	-	17	5785	c.5437T>C	c.(5437-5439)Ttc>Ctc	p.F1813L	TNRC18_ENST00000399537.4_Missense_Mutation_p.F1813L	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1813							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GAGTCGCTGAAGGAGGAACGC	0.597																																					p.F1813L		.											.	TNRC18	46	0			c.T5437C						.						18.0	16.0	17.0					7																	5391483		1568	3580	5148	SO:0001583	missense	84629	exon17			CGCTGAAGGAGGA	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5437T>C	7.37:g.5391483A>G	ENSP00000395538:p.Phe1813Leu	65.0	0.0		47.0	5.0	NM_001080495	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	a	14.97	2.695470	0.48202	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544	T;T	0.12465	2.69;2.68	5.03	5.03	0.67393	.	0.000000	0.38217	N	0.001766	T	0.16557	0.0398	M	0.69823	2.125	0.38237	D	0.941215	B;P	0.35745	0.178;0.518	B;B	0.34418	0.182;0.138	T	0.09015	-1.0694	10	0.11794	T	0.64	.	14.7525	0.69536	1.0:0.0:0.0:0.0	.	868;1813	A8MSW5;O15417	.;TNC18_HUMAN	L	1813;1813;868	ENSP00000382452:F1813L;ENSP00000395538:F1813L	ENSP00000382452:F1813L	F	-	1	0	TNRC18	5358009	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.891000	0.56227	1.902000	0.55061	0.459000	0.35465	TTC	.		0.597	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	7578524	7578524	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:7578524G>A	ENST00000269305.4	-	5	595	c.406C>T	c.(406-408)Caa>Taa	p.Q136*	TP53_ENST00000413465.2_Nonsense_Mutation_p.Q136*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q136*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q136*|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q136*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q136*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	136	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> E (in sporadic cancers; somatic mutation).|Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in a sporadic cancer; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q136*(34)|p.0?(8)|p.C135fs*9(3)|p.Q136E(3)|p.N131fs*27(2)|p.F134_T140>S(1)|p.K132_A138delKMFCQLA(1)|p.Q136K(1)|p.S127_Q136del10(1)|p.V73fs*9(1)|p.Q43*(1)|p.Y126fs*11(1)|p.Q4*(1)|p.C3fs*9(1)|p.C42fs*9(1)|p.C135_A138delCQLA(1)|p.Q136_K139delQLAK(1)|p.Q136fs*34(1)|p.C135_T140delCQLAKT(1)|p.Q136fs*13(1)|p.C135_Q136insXXXXXX(1)|p.C135_Q136insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTGGCCAGTTGGCAAAACATC	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.Q136X	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,head_neck,carcinoma,+2	TP53	70225	67	Substitution - Nonsense(36)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(5)|Substitution - Missense(4)|Insertion - In frame(2)|Insertion - Frameshift(1)|Complex - deletion inframe(1)	upper_aerodigestive_tract(9)|ovary(9)|urinary_tract(8)|central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(6)|stomach(5)|breast(4)|bone(4)|large_intestine(3)|oesophagus(3)|skin(3)|lung(3)|soft_tissue(1)|endometrium(1)|pancreas(1)	c.C406T	GRCh37	CM971503	TP53	M		.						52.0	52.0	52.0					17																	7578524		2203	4300	6503	SO:0001587	stop_gained	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CCAGTTGGCAAAA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.406C>T	17.37:g.7578524G>A	ENSP00000269305:p.Gln136*	48.0	0.0		35.0	21.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	34	5.349260	0.95830	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-25.5387	17.2272	0.86973	0.0:0.0:1.0:0.0	.	.	.	.	X	136;136;136;136;136;136;125;43;4;43;4;136	.	ENSP00000269305:Q136X	Q	-	1	0	TP53	7519249	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	9.809000	0.99208	2.733000	0.93635	0.655000	0.94253	CAA	.		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TOP3A	7156	ucsc.edu;bcgsc.ca	37	17	18206022	18206022	+	Missense_Mutation	SNP	T	T	C	rs368048718		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:18206022T>C	ENST00000321105.5	-	6	729	c.515A>G	c.(514-516)cAg>cGg	p.Q172R	TOP3A_ENST00000542570.1_Missense_Mutation_p.Q77R	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	172	Toprim. {ECO:0000255|PROSITE- ProRule:PRU00995}.				DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						TCGCAACACCTGCAGATTGGG	0.507																																					p.Q172R		.											.	TOP3A	228	0			c.A515G						.						81.0	68.0	73.0					17																	18206022		2203	4300	6503	SO:0001583	missense	7156	exon6			AACACCTGCAGAT	U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.515A>G	17.37:g.18206022T>C	ENSP00000321636:p.Gln172Arg	75.0	0.0		35.0	5.0	NM_004618	A8KA61|B4DK80|D3DXC7|Q13473	Missense_Mutation	SNP	ENST00000321105.5	37	CCDS11194.1	.	.	.	.	.	.	.	.	.	.	T	13.73	2.322992	0.41096	.	.	ENSG00000177302	ENST00000321105;ENST00000542570	T;T	0.21191	2.02;3.19	6.07	-0.686	0.11324	DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, domain 2 (1);Toprim domain (1);	0.302405	0.42053	N	0.000780	T	0.05640	0.0148	N	0.02830	-0.485	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.002	T	0.43972	-0.9358	10	0.02654	T	1	-1.9977	7.2444	0.26114	0.0:0.1955:0.2239:0.5806	.	77;172	B4DK80;Q13472	.;TOP3A_HUMAN	R	172;77	ENSP00000321636:Q172R;ENSP00000442336:Q77R	ENSP00000321636:Q172R	Q	-	2	0	TOP3A	18146747	0.799000	0.28903	0.626000	0.29213	0.973000	0.67179	1.142000	0.31540	-0.056000	0.13221	0.533000	0.62120	CAG	.		0.507	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132052.2		
TRAF3IP1	26146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	239237694	239237694	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr2:239237694G>T	ENST00000373327.4	+	5	848	c.626G>T	c.(625-627)gGa>gTa	p.G209V	TRAF3IP1_ENST00000391993.3_Missense_Mutation_p.G209V|TRAF3IP1_ENST00000391994.2_Missense_Mutation_p.G209V	NM_015650.3	NP_056465.2	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting protein 1	209	Abolishes microtubules-binding when missing.				cilium assembly (GO:0042384)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic heart tube development (GO:0035050)|intraciliary transport (GO:0042073)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube patterning (GO:0021532)|post-anal tail morphogenesis (GO:0036342)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(2)	23		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		gagaatggcggaaacagacac	0.527																																					p.G209V		.											.	TRAF3IP1	228	0			c.G626T						.						78.0	63.0	68.0					2																	239237694		2043	3941	5984	SO:0001583	missense	26146	exon5			ATGGCGGAAACAG	AF230877	CCDS33415.1, CCDS46557.1	2q37.3	2014-02-21			ENSG00000204104	ENSG00000204104		"""Intraflagellar transport homologs"""	17861	protein-coding gene	gene with protein product	"""microtubule interacting protein that associates with TRAF3"""	607380				10791955, 12935900	Standard	NM_015650		Approved	MIP-T3, DKFZP434F124, MIPT3, IFT54	uc002vye.3	Q8TDR0	OTTHUMG00000152872	ENST00000373327.4:c.626G>T	2.37:g.239237694G>T	ENSP00000362424:p.Gly209Val	217.0	0.0		203.0	34.0	NM_015650	Q6PCT1|Q7L8N9|Q9NRD6|Q9Y4Q1	Missense_Mutation	SNP	ENST00000373327.4	37	CCDS33415.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756275	0.49362	.	.	ENSG00000204104	ENST00000391993;ENST00000373327;ENST00000391994;ENST00000440998	T;T;T	0.13778	2.56;2.56;2.56	4.48	3.6	0.41247	.	0.673120	0.13966	N	0.350493	T	0.08088	0.0202	N	0.14661	0.345	0.28470	N	0.915444	B;B	0.33919	0.378;0.432	B;B	0.34093	0.109;0.175	T	0.26087	-1.0113	10	0.28530	T	0.3	-11.7677	8.465	0.32951	0.1804:0.0:0.8196:0.0	.	209;209	Q8TDR0-2;Q8TDR0	.;MIPT3_HUMAN	V	209	ENSP00000375851:G209V;ENSP00000362424:G209V;ENSP00000375852:G209V	ENSP00000362424:G209V	G	+	2	0	TRAF3IP1	238902433	0.603000	0.26924	0.055000	0.19348	0.349000	0.29174	1.046000	0.30354	1.018000	0.39521	0.655000	0.94253	GGA	.		0.527	TRAF3IP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000328312.1	NM_015650	
TRPM1	4308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	31295063	31295063	+	Silent	SNP	A	A	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr15:31295063A>C	ENST00000256552.6	-	28	3987	c.3840T>G	c.(3838-3840)ctT>ctG	p.L1280L	TRPM1_ENST00000542188.1_Silent_p.L1297L|RP11-348B17.1_ENST00000561299.1_RNA|TRPM1_ENST00000397795.2_Silent_p.L1258L	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TTTGCCGGAGAAGATACGTTG	0.468																																					p.L1297L		.											.	TRPM1	94	0			c.T3891G						.						93.0	94.0	93.0					15																	31295063		2080	4211	6291	SO:0001819	synonymous_variant	4308	exon27			CCGGAGAAGATAC	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.3840T>G	15.37:g.31295063A>C		138.0	0.0		82.0	17.0	NM_001252020		Silent	SNP	ENST00000256552.6	37	CCDS58346.1																																																																																			.		0.468	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
TTC5	91875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20763925	20763925	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr14:20763925T>C	ENST00000258821.3	-	7	841	c.785A>G	c.(784-786)cAa>cGa	p.Q262R		NM_138376.2	NP_612385.2	Q8N0Z6	TTC5_HUMAN	tetratricopeptide repeat domain 5	262					DNA repair (GO:0006281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)		TTGCTCTCGTTGCCGGGGCTC	0.488																																					p.Q262R		.											.	TTC5	91	0			c.A785G						.						77.0	89.0	85.0					14																	20763925		2203	4300	6503	SO:0001583	missense	91875	exon7			TCTCGTTGCCGGG	BC008647	CCDS9546.1	14q11.2	2013-01-11			ENSG00000136319	ENSG00000136319		"""Tetratricopeptide (TTC) repeat domain containing"""	19274	protein-coding gene	gene with protein product						11511361	Standard	NM_138376		Approved	Strap	uc001vwt.3	Q8N0Z6	OTTHUMG00000029506	ENST00000258821.3:c.785A>G	14.37:g.20763925T>C	ENSP00000258821:p.Gln262Arg	138.0	0.0		106.0	18.0	NM_138376	A8MQ18|Q96HF9	Missense_Mutation	SNP	ENST00000258821.3	37	CCDS9546.1	.	.	.	.	.	.	.	.	.	.	T	9.972	1.225632	0.22542	.	.	ENSG00000136319	ENST00000258821	T	0.73469	-0.75	4.83	3.68	0.42216	Tetratricopeptide-like helical (1);	0.386187	0.28290	N	0.015895	T	0.53498	0.1800	N	0.22421	0.69	0.26438	N	0.975829	B	0.09022	0.002	B	0.06405	0.002	T	0.25328	-1.0135	10	0.16420	T	0.52	.	5.6527	0.17625	0.0:0.09:0.1738:0.7361	.	262	Q8N0Z6	TTC5_HUMAN	R	262	ENSP00000258821:Q262R	ENSP00000258821:Q262R	Q	-	2	0	TTC5	19833765	0.929000	0.31497	0.837000	0.33122	0.995000	0.86356	0.992000	0.29667	1.946000	0.56461	0.533000	0.62120	CAA	.		0.488	TTC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073529.4	NM_138376	
UNC79	57578	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	94052959	94052959	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr14:94052959G>A	ENST00000393151.2	+	21	2821	c.2821G>A	c.(2821-2823)Gaa>Aaa	p.E941K	UNC79_ENST00000553484.1_Missense_Mutation_p.E941K|UNC79_ENST00000256339.4_Missense_Mutation_p.E764K|UNC79_ENST00000555664.1_Missense_Mutation_p.E941K			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	941					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						GAATGATACCGAAAGAAAATT	0.338																																					p.E764K		.											.	.	.	0			c.G2290A						.						53.0	52.0	53.0					14																	94052959		2202	4299	6501	SO:0001583	missense	57578	exon21			GATACCGAAAGAA	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.2821G>A	14.37:g.94052959G>A	ENSP00000376858:p.Glu941Lys	208.0	0.0		69.0	19.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	G	20.0	3.930849	0.73327	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.17528	2.27;2.27;2.27;2.27	5.94	5.94	0.96194	.	0.061494	0.64402	D	0.000002	T	0.08268	0.0206	N	0.08118	0	0.49687	D	0.999811	P	0.49253	0.921	B	0.33960	0.173	T	0.34502	-0.9826	10	0.09843	T	0.71	-19.9303	20.3736	0.98901	0.0:0.0:1.0:0.0	.	941	C9JQL1	.	K	764;941;941;941;941	ENSP00000256339:E764K;ENSP00000450868:E941K;ENSP00000451360:E941K;ENSP00000376858:E941K	ENSP00000256339:E764K	E	+	1	0	KIAA1409	93122712	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.198000	0.94994	2.820000	0.97059	0.650000	0.86243	GAA	.		0.338	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
UNC80	285175	broad.mit.edu;bcgsc.ca	37	2	210752981	210752981	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr2:210752981A>G	ENST00000439458.1	+	26	4359	c.4279A>G	c.(4279-4281)Aaa>Gaa	p.K1427E	UNC80_ENST00000272845.6_Missense_Mutation_p.K1422E	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1427					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						CGAGGAGAAGAAAGGTATGGA	0.428																																					p.K1427E		.											.	UNC80	90	0			c.A4279G						.						35.0	33.0	34.0					2																	210752981		692	1591	2283	SO:0001583	missense	285175	exon26			GAGAAGAAAGGTA	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.4279A>G	2.37:g.210752981A>G	ENSP00000391088:p.Lys1427Glu	199.0	0.0		142.0	6.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	A	15.42	2.828463	0.50845	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.33216	1.42;1.42	5.87	5.87	0.94306	.	0.051182	0.85682	D	0.000000	T	0.20414	0.0491	N	0.20986	0.625	0.80722	D	1	B	0.30605	0.287	B	0.27380	0.079	T	0.05683	-1.0870	10	0.08179	T	0.78	-19.5258	16.5764	0.84681	1.0:0.0:0.0:0.0	.	1427	Q8N2C7	UNC80_HUMAN	E	1427;1422	ENSP00000391088:K1427E;ENSP00000272845:K1422E	ENSP00000272845:K1422E	K	+	1	0	UNC80	210461226	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.238000	0.78173	2.371000	0.80710	0.533000	0.62120	AAA	.		0.428	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
URM1	81605	ucsc.edu;bcgsc.ca	37	9	131151971	131151971	+	Silent	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr9:131151971C>T	ENST00000372853.4	+	5	326	c.264C>T	c.(262-264)gaC>gaT	p.D88D	URM1_ENST00000483206.1_3'UTR|RP11-339B21.11_ENST00000609303.1_lincRNA|URM1_ENST00000452446.1_3'UTR|URM1_ENST00000372850.1_3'UTR|MIR219-2_ENST00000385220.1_lincRNA	NM_001265582.1|NM_030914.3	NP_001252511.1|NP_112176.1			ubiquitin related modifier 1											cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	5						AGCTTCAGGACCAGGACAGCG	0.637																																					p.D88D		.											.	URM1	90	0			c.C264T						.						60.0	52.0	55.0					9																	131151971		2203	4300	6503	SO:0001819	synonymous_variant	81605	exon5			TCAGGACCAGGAC	AK097029	CCDS6900.1, CCDS48035.1, CCDS59148.1	9q34.13	2010-06-24	2010-06-24	2006-11-28	ENSG00000167118	ENSG00000167118			28378	protein-coding gene	gene with protein product		612693	"""chromosome 9 open reading frame 74"", ""ubiquitin related modifier 1 homolog (S. cerevisiae)"""	C9orf74		16046629, 16864801	Standard	NM_030914		Approved	MGC2668	uc011may.2	Q9BTM9	OTTHUMG00000020742	ENST00000372853.4:c.264C>T	9.37:g.131151971C>T		57.0	0.0		29.0	4.0	NM_030914		Silent	SNP	ENST00000372853.4	37	CCDS6900.1																																																																																			.		0.637	URM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054422.1	NM_030914	
WBP11	51729	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	14947913	14947913	+	Silent	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr12:14947913T>C	ENST00000261167.2	-	6	746	c.513A>G	c.(511-513)tcA>tcG	p.S171S		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	171	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						ACCCATAGGCTGAGGTTTTCT	0.448																																					p.S171S		.											.	WBP11	92	0			c.A513G						.						157.0	154.0	155.0					12																	14947913		2203	4300	6503	SO:0001819	synonymous_variant	51729	exon6			ATAGGCTGAGGTT	AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.513A>G	12.37:g.14947913T>C		272.0	1.0		160.0	36.0	NM_016312	Q96AY8	Silent	SNP	ENST00000261167.2	37	CCDS8666.1																																																																																			.		0.448	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400850.1	NM_016312	
WDR87	83889	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38377028	38377028	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:38377028G>T	ENST00000303868.5	-	6	7390	c.7166C>A	c.(7165-7167)cCt>cAt	p.P2389H	WDR87_ENST00000447313.2_Missense_Mutation_p.P2428H	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	2389										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TTTCTTCAAAGGGCTTTTTAG	0.438																																					p.P2389H		.											.	.	.	0			c.C7166A						.						66.0	52.0	56.0					19																	38377028		692	1591	2283	SO:0001583	missense	83889	exon6			TTCAAAGGGCTTT	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.7166C>A	19.37:g.38377028G>T	ENSP00000368025:p.Pro2389His	427.0	1.0		276.0	61.0	NM_031951	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	37	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	G	5.316	0.243669	0.10077	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.41400	1.01;1.0	3.7	-1.14	0.09741	.	.	.	.	.	T	0.33265	0.0857	N	0.19112	0.55	0.09310	N	1	D;D	0.69078	0.997;0.997	P;P	0.55545	0.778;0.778	T	0.17653	-1.0362	9	0.35671	T	0.21	.	3.6862	0.08329	0.3359:0.1886:0.4755:0.0	.	2389;2428	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	H	2428;2389	ENSP00000405012:P2428H;ENSP00000368025:P2389H	ENSP00000368025:P2389H	P	-	2	0	WDR87	43068868	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.083000	0.14871	-0.084000	0.12595	0.650000	0.86243	CCT	.		0.438	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
ZNF263	10127	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3335685	3335685	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr16:3335685A>T	ENST00000219069.5	+	3	1449	c.573A>T	c.(571-573)ttA>ttT	p.L191F	ZNF263_ENST00000574253.1_Intron|ZNF263_ENST00000538765.1_Intron|ZNF263_ENST00000573578.1_Missense_Mutation_p.Y131F	NM_005741.4	NP_005732.2	O14978	ZN263_HUMAN	zinc finger protein 263	191					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(4)|urinary_tract(3)	20						CTTCAGCATTATCTGCTCCCT	0.468																																					p.L191F		.											.	ZNF263	94	0			c.A573T						.						120.0	107.0	111.0					16																	3335685		2197	4300	6497	SO:0001583	missense	10127	exon3			AGCATTATCTGCT	AC004232	CCDS10499.1	16p13.3	2013-01-09			ENSG00000006194	ENSG00000006194		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13056	protein-coding gene	gene with protein product		604191				9256059	Standard	NM_005741		Approved	FPM315, ZKSCAN12, ZSCAN44	uc002cuq.3	O14978	OTTHUMG00000129323	ENST00000219069.5:c.573A>T	16.37:g.3335685A>T	ENSP00000219069:p.Leu191Phe	209.0	1.0		179.0	32.0	NM_005741	B2R634|O43387|Q96H95	Missense_Mutation	SNP	ENST00000219069.5	37	CCDS10499.1	.	.	.	.	.	.	.	.	.	.	A	8.936	0.964542	0.18583	.	.	ENSG00000006194	ENST00000219069	T	0.06933	3.24	5.07	-1.91	0.07641	.	0.746995	0.11499	N	0.557930	T	0.03477	0.0100	N	0.08118	0	0.80722	D	1	B	0.16802	0.019	B	0.09377	0.004	T	0.48031	-0.9070	10	0.09843	T	0.71	.	9.7888	0.40692	0.5198:0.0:0.4802:0.0	.	191	O14978	ZN263_HUMAN	F	191	ENSP00000219069:L191F	ENSP00000219069:L191F	L	+	3	2	ZNF263	3275686	0.991000	0.36638	0.989000	0.46669	0.938000	0.57974	0.087000	0.14958	-0.248000	0.09583	-0.290000	0.09829	TTA	.		0.468	ZNF263-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251463.2		
ZNF57	126295	ucsc.edu;bcgsc.ca	37	19	2917541	2917541	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:2917541T>A	ENST00000306908.5	+	4	1070	c.922T>A	c.(922-924)Tat>Aat	p.Y308N	ZNF57_ENST00000523428.1_Missense_Mutation_p.Y276N|AC006277.2_ENST00000520090.2_RNA	NM_173480.2	NP_775751.1	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	308					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		AGAGAAGCCCTATGAATGCAA	0.483																																					p.Y308N	NSCLC(150;910 1964 4303 10464 26498)	.											.	ZNF57	71	0			c.T922A						.						73.0	76.0	75.0					19																	2917541		2203	4300	6503	SO:0001583	missense	126295	exon4			AAGCCCTATGAAT	M88368	CCDS12098.1	19p13.3	2013-01-08			ENSG00000171970	ENSG00000171970		"""Zinc fingers, C2H2-type"", ""-"""	13125	protein-coding gene	gene with protein product			"""zinc finger protein 424"""	ZNF424		1505991	Standard	NM_173480		Approved		uc002lwr.3	Q68EA5	OTTHUMG00000164485	ENST00000306908.5:c.922T>A	19.37:g.2917541T>A	ENSP00000303696:p.Tyr308Asn	107.0	0.0		41.0	4.0	NM_173480	Q8N6R9	Missense_Mutation	SNP	ENST00000306908.5	37	CCDS12098.1	.	.	.	.	.	.	.	.	.	.	T	12.51	1.958879	0.34565	.	.	ENSG00000171970	ENST00000306908;ENST00000395204;ENST00000523428	T;T	0.25749	1.78;1.78	2.25	2.25	0.28309	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.51618	0.1685	M	0.86805	2.84	0.09310	N	0.999993	D	0.89917	1.0	D	0.80764	0.994	T	0.30504	-0.9976	9	0.87932	D	0	.	8.0503	0.30575	0.0:0.0:0.0:1.0	.	308	Q68EA5	ZNF57_HUMAN	N	308;310;276	ENSP00000303696:Y308N;ENSP00000430223:Y276N	ENSP00000303696:Y308N	Y	+	1	0	ZNF57	2868541	0.000000	0.05858	0.026000	0.17262	0.023000	0.10783	0.532000	0.23067	1.038000	0.40049	0.418000	0.28097	TAT	.		0.483	ZNF57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378969.1	NM_173480	
HOXA4	3201	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	27168891	27168892	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	GA	GA	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr7:27168891_27168892GA>AT	ENST00000360046.5	-	2	980_981	c.915_916TC>AT	c.(913-918)caTCcc>caATcc	p.305_306HP>QS	RP1-170O19.22_ENST00000467897.2_RNA|HOXA3_ENST00000317201.2_5'Flank|HOXA3_ENST00000521401.1_Intron|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS2_ENST00000521159.1_RNA|HOXA-AS2_ENST00000521687.1_RNA|HOXA4_ENST00000428284.2_Missense_Mutation_p.305_306HP>QS|HOXA-AS2_ENST00000517550.1_RNA	NM_002141.4	NP_002132.3	Q00056	HXA4_HUMAN	homeobox A4	305					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)	12						tgggggtggggatggaggtgtg	0.545																																					p.HP305QS		.											.	.	.	0			.						.																																			SO:0001583	missense	3201	.			GGTGGGGATGGAG		CCDS5405.1	7p15.2	2011-06-20	2005-12-22		ENSG00000197576	ENSG00000197576		"""Homeoboxes / ANTP class : HOXL subclass"""	5105	protein-coding gene	gene with protein product		142953	"""homeo box A4"""	HOX1D, HOX1		1973146, 1358459	Standard	NM_002141		Approved		uc003sym.4	Q00056	OTTHUMG00000023213	ENST00000360046.5:c.915_916delinsAT	7.37:g.27168891_27168892delinsAT	ENSP00000353151:p.H305_P306delinsQS	321.0	1.0		343.0	56.0	.	A4D180|O43366	Missense_Mutation	DNP	ENST00000360046.5	37	CCDS5405.1																																																																																			.		0.545	HOXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059534.4		
ZSCAN25	221785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99227217	99227217	+	Silent	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr7:99227217C>T	ENST00000394152.2	+	8	1536	c.1209C>T	c.(1207-1209)taC>taT	p.Y403Y	ZSCAN25_ENST00000466948.1_Intron|ZSCAN25_ENST00000334715.3_Silent_p.Y403Y|ZSCAN25_ENST00000262941.6_Silent_p.Y331Y	NM_145115.2	NP_660090.2	Q6NSZ9	ZSC25_HUMAN	zinc finger and SCAN domain containing 25	403					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AGAGGCCCTACGTGTGCAGCG	0.572																																					p.Y403Y		.											.	.	.	0			c.C1209T						.						66.0	63.0	64.0					7																	99227217		2203	4300	6503	SO:0001819	synonymous_variant	221785	exon8			GCCCTACGTGTGC	AK057030	CCDS5671.2	7q22.1	2013-01-09	2013-01-09	2013-01-09	ENSG00000197037	ENSG00000197037		"""-"", ""Zinc fingers, C2H2-type"""	21961	protein-coding gene	gene with protein product			"""zinc finger protein 498"""	ZNF498		11179890	Standard	XM_005250194		Approved	FLJ32468	uc003url.1	Q6NSZ9	OTTHUMG00000074055	ENST00000394152.2:c.1209C>T	7.37:g.99227217C>T		77.0	0.0		46.0	11.0	NM_145115	A4D290|D6W5T5|Q14C82|Q14C99|Q5EBM9|Q6DJZ0|Q6N032|Q6ZML3	Silent	SNP	ENST00000394152.2	37	CCDS5671.2																																																																																			.		0.572	ZSCAN25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157203.4	NM_145115	
