#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA1	19	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	107584777	107584777	+	Splice_Site	SNP	A	A	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr9:107584777A>G	ENST00000374736.3	-	19	3222	c.2828T>C	c.(2827-2829)aTg>aCg	p.M943T		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	943	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CTCTTCTTACATGGTGGTCGT	0.527																																					p.M943T		.											.	ABCA1	1016	0			c.T2828C						.						126.0	117.0	120.0					9																	107584777		2203	4300	6503	SO:0001630	splice_region_variant	19	exon19			TCTTACATGGTGG	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.2828+1T>C	9.37:g.107584777A>G		107.0	0.0		86.0	43.0	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.401775	0.83120	.	.	ENSG00000165029	ENST00000374736	T	0.80738	-1.41	5.79	5.79	0.91817	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.035406	0.85682	D	0.000000	D	0.87892	0.6292	M	0.72479	2.2	0.80722	D	1	D	0.54964	0.969	P	0.62089	0.898	D	0.87747	0.2589	9	.	.	.	.	16.1224	0.81369	1.0:0.0:0.0:0.0	.	943	O95477	ABCA1_HUMAN	T	943	ENSP00000363868:M943T	.	M	-	2	0	ABCA1	106624598	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	9.339000	0.96797	2.208000	0.71279	0.533000	0.62120	ATG	.		0.527	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	Missense_Mutation
ABCA2	20	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	139904510	139904510	+	Silent	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr9:139904510G>A	ENST00000371605.3	-	41	6564	c.6417C>T	c.(6415-6417)ttC>ttT	p.F2139F	ABCA2_ENST00000265662.5_Silent_p.F2140F|ABCA2_ENST00000341511.6_Silent_p.F2140F			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	2139	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TGAGCTCGTCGAACAGCGCGT	0.692																																					p.F2170F		.											.	ABCA2	90	0			c.C6510T						.						11.0	15.0	14.0					9																	139904510		2124	4199	6323	SO:0001819	synonymous_variant	20	exon42			CTCGTCGAACAGC	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.6417C>T	9.37:g.139904510G>A		37.0	0.0		39.0	19.0	NM_212533	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Silent	SNP	ENST00000371605.3	37																																																																																				.		0.692	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		NM_001606	
ACOT2	10965	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	74036182	74036182	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr14:74036182C>A	ENST00000238651.5	+	1	420	c.238C>A	c.(238-240)Ccg>Acg	p.P80T	ACOT2_ENST00000538782.1_Intron	NM_006821.5	NP_006812.3	P49753	ACOT2_HUMAN	acyl-CoA thioesterase 2	80					acyl-CoA metabolic process (GO:0006637)|long-chain fatty acid metabolic process (GO:0001676)|very long-chain fatty acid metabolic process (GO:0000038)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.0639)		CTGGGACGAACCGGTGCGAAT	0.701																																					p.P80T		.											.	ACOT2	91	0			c.C238A						.						43.0	37.0	39.0					14																	74036182		2203	4299	6502	SO:0001583	missense	10965	exon1			GACGAACCGGTGC	AY005822, AK001939	CCDS9816.1	14q24.3	2013-09-20			ENSG00000119673	ENSG00000119673		"""Acyl CoA thioesterases"""	18431	protein-coding gene	gene with protein product	"""mitochondrial acyl-CoA thioesterase 1"""	609972				16103133, 16940157	Standard	NM_006821		Approved	Mte1, ZAP128	uc001xon.5	P49753	OTTHUMG00000171608	ENST00000238651.5:c.238C>A	14.37:g.74036182C>A	ENSP00000238651:p.Pro80Thr	61.0	0.0		47.0	41.0	NM_006821	Q3I5F8|Q53EK4|Q9NUX4	Missense_Mutation	SNP	ENST00000238651.5	37	CCDS9816.1	.	.	.	.	.	.	.	.	.	.	C	14.67	2.605985	0.46527	.	.	ENSG00000119673	ENST00000238651	T	0.70869	-0.52	3.81	2.91	0.33838	Acyl-CoA thioester hydrolase/bile acid-CoA amino acid N-acetyltransferase (1);	0.064498	0.64402	D	0.000008	D	0.86497	0.5947	H	0.94264	3.515	0.49582	D	0.999806	D	0.69078	0.997	D	0.70487	0.969	D	0.88288	0.2941	10	0.87932	D	0	-20.5873	11.4465	0.50127	0.0:0.9096:0.0:0.0904	.	80	P49753	ACOT2_HUMAN	T	80	ENSP00000238651:P80T	ENSP00000238651:P80T	P	+	1	0	ACOT2	73105935	1.000000	0.71417	0.348000	0.25681	0.012000	0.07955	2.796000	0.47869	0.705000	0.31890	0.467000	0.42956	CCG	.		0.701	ACOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414435.1	NM_006821	
ACP1	52	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	277266	277266	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:277266G>A	ENST00000272065.5	+	6	532	c.439G>A	c.(439-441)Gtc>Atc	p.V147I	ACP1_ENST00000272067.6_Missense_Mutation_p.V147I|ACP1_ENST00000484464.1_3'UTR	NM_004300.3	NP_004291.1	P24666	PPAC_HUMAN	acid phosphatase 1, soluble	147						cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|extracellular vesicular exosome (GO:0070062)	acid phosphatase activity (GO:0003993)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	12	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00175)|Lung NSC(108;0.216)|all_epithelial(98;0.236)		all cancers(51;0.000391)|Epithelial(75;0.00281)|OV - Ovarian serous cystadenocarcinoma(76;0.00542)|GBM - Glioblastoma multiforme(21;0.127)	Adenine(DB00173)	CCAGCAGTGTGTCAGGTGCTG	0.517																																					p.V147I		.											.	ACP1	523	0			c.G439A						.						147.0	140.0	142.0					2																	277266		2203	4300	6503	SO:0001583	missense	52	exon6			CAGTGTGTCAGGT	M87546	CCDS1639.1, CCDS1640.1, CCDS46217.1	2p25	2011-06-09			ENSG00000143727	ENSG00000143727	3.1.3.2	"""Protein tyrosine phosphatases / Class II Cys-based PTPs"""	122	protein-coding gene	gene with protein product		171500					Standard	NM_001040649		Approved		uc002qwf.3	P24666	OTTHUMG00000086933	ENST00000272065.5:c.439G>A	2.37:g.277266G>A	ENSP00000272065:p.Val147Ile	400.0	0.0		365.0	30.0	NM_007099	A8K1L9|B5MCC7|P24667|Q16035|Q16036|Q16725|Q3KQX8|Q53RU0	Missense_Mutation	SNP	ENST00000272065.5	37	CCDS1639.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.835149	0.50951	.	.	ENSG00000143727	ENST00000272067;ENST00000272065	T;T	0.30182	1.54;1.54	5.62	-6.39	0.01951	Phosphotyrosine protein phosphatase I superfamily (3);	0.749136	0.12667	N	0.449134	T	0.24236	0.0587	L	0.58925	1.835	0.25308	N	0.989222	B;B	0.02656	0.0;0.0	B;B	0.12156	0.005;0.007	T	0.15150	-1.0447	10	0.30854	T	0.27	-1.1228	11.0838	0.48074	0.2473:0.558:0.1947:0.0	.	147;147	P24666-2;P24666	.;PPAC_HUMAN	I	147	ENSP00000272067:V147I;ENSP00000272065:V147I	ENSP00000272065:V147I	V	+	1	0	ACP1	267266	0.003000	0.15002	0.001000	0.08648	0.989000	0.77384	-1.320000	0.02700	-1.433000	0.01977	0.655000	0.94253	GTC	.		0.517	ACP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195862.3		
ACTN1	87	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	69350972	69350972	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr14:69350972C>A	ENST00000193403.6	-	14	1931	c.1548G>T	c.(1546-1548)aaG>aaT	p.K516N	ACTN1_ENST00000438964.2_Missense_Mutation_p.K516N|ACTN1_ENST00000394419.4_Missense_Mutation_p.K516N|ACTN1_ENST00000538545.2_Missense_Mutation_p.K516N|ACTN1_ENST00000376839.3_Missense_Mutation_p.K451N	NM_001102.3	NP_001093.1	P12814	ACTN1_HUMAN	actinin, alpha 1	516	Interaction with DDN.				actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of apoptotic process (GO:0042981)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|double-stranded RNA binding (GO:0003725)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|vinculin binding (GO:0017166)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(9)|prostate(2)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		GTGCAGCCCGCTTGGCATACT	0.552																																					p.K516N		.											.	ACTN1	514	0			c.G1548T						.						115.0	94.0	101.0					14																	69350972		2203	4300	6503	SO:0001583	missense	87	exon14			AGCCCGCTTGGCA	M95178	CCDS9792.1, CCDS45129.1, CCDS45130.1	14q24.1	2014-08-08			ENSG00000072110	ENSG00000072110		"""EF-hand domain containing"""	163	protein-coding gene	gene with protein product		102575				2349951	Standard	NM_001102		Approved		uc001xkm.3	P12814	OTTHUMG00000171386	ENST00000193403.6:c.1548G>T	14.37:g.69350972C>A	ENSP00000193403:p.Lys516Asn	251.0	1.0		122.0	111.0	NM_001102	B3V8S3|B4DHH3|B7TY16|Q1HE25|Q9BTN1	Missense_Mutation	SNP	ENST00000193403.6	37	CCDS9792.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.989389|3.989389	0.74589|0.74589	.|.	.|.	ENSG00000072110|ENSG00000072110	ENST00000553290|ENST00000193403;ENST00000394419;ENST00000438964;ENST00000376839;ENST00000538545;ENST00000544964	.|T;T;T;T;T;T	.|0.68624	.|-0.34;-0.34;-0.34;-0.34;-0.34;-0.34	4.68|4.68	4.68|4.68	0.58851|0.58851	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.83968|0.83968	0.5369|0.5369	M|M	0.89785|0.89785	3.06|3.06	0.80722|0.80722	D|D	1|1	.|D;D;D;P;D	.|0.71674	.|0.998;0.981;0.972;0.946;0.958	.|D;D;P;D;D	.|0.85130	.|0.997;0.962;0.891;0.935;0.914	D|D	0.86937|0.86937	0.2077|0.2077	5|10	.|0.87932	.|D	.|0	.|.	13.5873|13.5873	0.61940|0.61940	0.0:0.9223:0.0:0.0777|0.0:0.9223:0.0:0.0777	.|.	.|147;516;516;516;163	.|B7Z2W3;P12814-2;Q1HE25;P12814;B4DFY0	.|.;.;.;ACTN1_HUMAN;.	S|N	17|516;516;516;451;516;106	.|ENSP00000193403:K516N;ENSP00000377941:K516N;ENSP00000414272:K516N;ENSP00000366035:K451N;ENSP00000439828:K516N;ENSP00000444422:K106N	.|ENSP00000193403:K516N	A|K	-|-	1|3	0|2	ACTN1|ACTN1	68420725|68420725	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.869000|0.869000	0.49853|0.49853	1.358000|1.358000	0.34102|0.34102	2.597000|2.597000	0.87782|0.87782	0.655000|0.655000	0.94253|0.94253	GCG|AAG	.		0.552	ACTN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413233.3	NM_001102	
ACTN1	87	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	69350974	69350974	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr14:69350974T>C	ENST00000193403.6	-	14	1929	c.1546A>G	c.(1546-1548)Aag>Gag	p.K516E	ACTN1_ENST00000438964.2_Missense_Mutation_p.K516E|ACTN1_ENST00000394419.4_Missense_Mutation_p.K516E|ACTN1_ENST00000538545.2_Missense_Mutation_p.K516E|ACTN1_ENST00000376839.3_Missense_Mutation_p.K451E	NM_001102.3	NP_001093.1	P12814	ACTN1_HUMAN	actinin, alpha 1	516	Interaction with DDN.				actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of apoptotic process (GO:0042981)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|double-stranded RNA binding (GO:0003725)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|vinculin binding (GO:0017166)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(9)|prostate(2)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		GCAGCCCGCTTGGCATACTCC	0.552																																					p.K516E		.											.	ACTN1	514	0			c.A1546G						.						115.0	95.0	102.0					14																	69350974		2203	4300	6503	SO:0001583	missense	87	exon14			CCCGCTTGGCATA	M95178	CCDS9792.1, CCDS45129.1, CCDS45130.1	14q24.1	2014-08-08			ENSG00000072110	ENSG00000072110		"""EF-hand domain containing"""	163	protein-coding gene	gene with protein product		102575				2349951	Standard	NM_001102		Approved		uc001xkm.3	P12814	OTTHUMG00000171386	ENST00000193403.6:c.1546A>G	14.37:g.69350974T>C	ENSP00000193403:p.Lys516Glu	260.0	0.0		122.0	110.0	NM_001102	B3V8S3|B4DHH3|B7TY16|Q1HE25|Q9BTN1	Missense_Mutation	SNP	ENST00000193403.6	37	CCDS9792.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	28.1|28.1	4.894292|4.894292	0.91889|0.91889	.|.	.|.	ENSG00000072110|ENSG00000072110	ENST00000193403;ENST00000394419;ENST00000438964;ENST00000376839;ENST00000538545;ENST00000544964|ENST00000553290	T;T;T;T;T;T|.	0.68025|.	-0.3;-0.3;-0.3;-0.3;-0.3;-0.3|.	4.68|4.68	4.68|4.68	0.58851|0.58851	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77968|0.77968	0.4210|0.4210	M|M	0.84683|0.84683	2.71|2.71	0.80722|0.80722	D|D	1|1	D;P;P;B;B|.	0.63880|.	0.993;0.687;0.547;0.383;0.448|.	D;P;B;B;B|.	0.75484|.	0.986;0.78;0.365;0.403;0.428|.	T|T	0.81040|0.81040	-0.1113|-0.1113	10|5	0.87932|.	D|.	0|.	.|.	14.5916|14.5916	0.68368|0.68368	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	147;516;516;516;163|.	B7Z2W3;P12814-2;Q1HE25;P12814;B4DFY0|.	.;.;.;ACTN1_HUMAN;.|.	E|R	516;516;516;451;516;106|16	ENSP00000193403:K516E;ENSP00000377941:K516E;ENSP00000414272:K516E;ENSP00000366035:K451E;ENSP00000439828:K516E;ENSP00000444422:K106E|.	ENSP00000193403:K516E|.	K|Q	-|-	1|2	0|0	ACTN1|ACTN1	68420727|68420727	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.914000|0.914000	0.54420|0.54420	7.825000|7.825000	0.86693|0.86693	2.100000|2.100000	0.63781|0.63781	0.533000|0.533000	0.62120|0.62120	AAG|CAA	.		0.552	ACTN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413233.3	NM_001102	
ACTN2	88	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	236881238	236881238	+	Silent	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr1:236881238C>A	ENST00000366578.4	+	2	373	c.207C>A	c.(205-207)ggC>ggA	p.G69G	ACTN2_ENST00000492634.1_3'UTR|ACTN2_ENST00000542672.1_Silent_p.G69G	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	69	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TCAGGAATGGCCTTAAGCTCA	0.443																																					p.G69G		.											.	ACTN2	95	0			c.C207A						.						181.0	157.0	165.0					1																	236881238		2203	4300	6503	SO:0001819	synonymous_variant	88	exon2			GAATGGCCTTAAG	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.207C>A	1.37:g.236881238C>A		392.0	0.0		345.0	155.0	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Silent	SNP	ENST00000366578.4	37	CCDS1613.1																																																																																			.		0.443	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
ADAM12	8038	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	127708372	127708372	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr10:127708372delG	ENST00000368679.4	-	22	2870	c.2561delC	c.(2560-2562)cctfs	p.P854fs		NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	854					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		AGGCTTCTGAGGGGGGTTTGG	0.612																																					p.P854fs		.											.	ADAM12	716	0			c.2561delC						.						37.0	38.0	38.0					10																	127708372		2203	4300	6503	SO:0001589	frameshift_variant	8038	exon22			TTCTGAGGGGGGT	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.2561delC	10.37:g.127708372delG	ENSP00000357668:p.Pro854fs	106.0	0.0		92.0	37.0	NM_003474	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Frame_Shift_Del	DEL	ENST00000368679.4	37	CCDS7653.1																																																																																			.		0.612	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		
ALK	238	hgsc.bcm.edu;bcgsc.ca	37	2	29443612	29443612	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:29443612delC	ENST00000389048.3	-	23	4511	c.3605delG	c.(3604-3606)ggafs	p.G1202fs	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	1202	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CTTGAGGTCTCCCCCCGCCAT	0.587			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.G1202fs		.	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	ALK	3833	0			c.3605delG						.						46.0	47.0	47.0					2																	29443612		2203	4300	6503	SO:0001589	frameshift_variant	238	exon23	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	AGGTCTCCCCCCG	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.3605delG	2.37:g.29443612delC	ENSP00000373700:p.Gly1202fs	89.0	0.0		115.0	42.0	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Frame_Shift_Del	DEL	ENST00000389048.3	37	CCDS33172.1																																																																																			.		0.587	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
AMHR2	269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53823987	53823987	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:53823987C>A	ENST00000257863.4	+	10	1426	c.1346C>A	c.(1345-1347)aCc>aAc	p.T449N	AMHR2_ENST00000550311.1_Missense_Mutation_p.P448T|AMHR2_ENST00000379791.3_Intron	NM_001164690.1|NM_020547.2	NP_001158162.1|NP_065434.1	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II	449	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		Missing (in PMDS2). {ECO:0000269|PubMed:8872466}.		Mullerian duct regression (GO:0001880)|negative regulation of anti-Mullerian hormone signaling pathway (GO:1902613)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	integral component of plasma membrane (GO:0005887)	anti-Mullerian hormone receptor activity (GO:1990272)|ATP binding (GO:0005524)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor activity, type II (GO:0005026)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|skin(2)	34					Adenosine triphosphate(DB00171)	AATACCCCTACCTCTGATGAG	0.587																																					p.T449N		.											.	AMHR2	628	0			c.C1346A						.						246.0	210.0	222.0					12																	53823987		2203	4300	6503	SO:0001583	missense	269	exon10			CCCCTACCTCTGA	AF172932	CCDS8858.1, CCDS53798.1, CCDS55829.1	12q13	2013-03-14							465	protein-coding gene	gene with protein product	"""Muellerian inhibiting substance type II receptor"""	600956				7493017	Standard	NM_001164690		Approved	MISR2, MISRII	uc001scx.2	Q16671	OTTHUMG00000170048	ENST00000257863.4:c.1346C>A	12.37:g.53823987C>A	ENSP00000257863:p.Thr449Asn	219.0	0.0		218.0	110.0	NM_020547	A0AVE1|B9EGB7|E9PGD2|F8W1D2|Q13762|Q647K2	Missense_Mutation	SNP	ENST00000257863.4	37	CCDS8858.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.028|8.028	0.761140|0.761140	0.15914|0.15914	.|.	.|.	ENSG00000135409|ENSG00000135409	ENST00000550311|ENST00000257863	D|D	0.93019|0.93488	-3.15|-3.23	5.09|5.09	3.1|3.1	0.35709|0.35709	.|Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.384005	.|0.19286	.|N	.|0.118025	D|D	0.91945|0.91945	0.7449|0.7449	L|L	0.43598|0.43598	1.365|1.365	0.80722|0.80722	D|D	1|1	B|P	0.30281|0.47484	0.275|0.896	B|P	0.28232|0.48270	0.087|0.572	D|D	0.91121|0.91121	0.4930|0.4930	9|10	0.72032|0.87932	D|D	0.01|0	.|.	13.1494|13.1494	0.59480|0.59480	0.0:0.599:0.401:0.0|0.0:0.599:0.401:0.0	.|.	448|449	F8W1D2|Q16671	.|AMHR2_HUMAN	T|N	448|449	ENSP00000446661:P448T|ENSP00000257863:T449N	ENSP00000446661:P448T|ENSP00000257863:T449N	P|T	+|+	1|2	0|0	AMHR2|AMHR2	52110254|52110254	0.234000|0.234000	0.23783|0.23783	0.272000|0.272000	0.24630|0.24630	0.478000|0.478000	0.33099|0.33099	0.589000|0.589000	0.23939|0.23939	0.708000|0.708000	0.31955|0.31955	0.557000|0.557000	0.71058|0.71058	CCT|ACC	.		0.587	AMHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407048.1	NM_020547	
ANKH	56172	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	14716830	14716832	+	In_Frame_Del	DEL	AGG	AGG	-	rs121908406		TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	AGG	AGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr5:14716830_14716832delAGG	ENST00000284268.6	-	9	1454_1456	c.1124_1126delCCT	c.(1123-1128)tccttc>ttc	p.S375del	ANKH_ENST00000535119.1_In_Frame_Del_p.S177del	NM_054027.4	NP_473368.1	Q9HCJ1	ANKH_HUMAN	ANKH inorganic pyrophosphate transport regulator	375			Missing (in CMDD). {ECO:0000269|PubMed:11326272, ECO:0000269|PubMed:11326338}.		locomotory behavior (GO:0007626)|regulation of bone mineralization (GO:0030500)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	inorganic diphosphate transmembrane transporter activity (GO:0030504)|inorganic phosphate transmembrane transporter activity (GO:0005315)|phosphate ion transmembrane transporter activity (GO:0015114)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						ACTGGGAAGAAGGAGAAGATCCG	0.399																																					p.375_376del		.											.	ANKH	91	0			c.1124_1126del	GRCh37	CD011582	ANKH	D		.																																			SO:0001651	inframe_deletion	56172	exon9			GGAAGAAGGAGAA	AF274753	CCDS3885.1	5p15.2	2013-06-19	2013-06-19		ENSG00000154122	ENSG00000154122			15492	protein-coding gene	gene with protein product		605145	"""ankylosis, progressive (mouse) homolog"", ""craniometaphyseal dysplasia, Jackson type (dominant)"", ""ankylosis, progressive homolog (mouse)"""	CCAL2, CMDJ		10894769, 12297989, 11326338	Standard	NM_054027		Approved	HANK, ANK, CPPDD	uc003jfm.4	Q9HCJ1	OTTHUMG00000090539	ENST00000284268.6:c.1124_1126delCCT	5.37:g.14716830_14716832delAGG	ENSP00000284268:p.Ser375del	137.0	0.0		149.0	41.0	NM_054027	B2RCA7|B3KMG4|D3DTD4|Q9NQW2	In_Frame_Del	DEL	ENST00000284268.6	37	CCDS3885.1																																																																																			.		0.399	ANKH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207063.1	NM_054027	
ANKRD46	157567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	101540171	101540171	+	Silent	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:101540171G>A	ENST00000520552.1	-	4	533	c.372C>T	c.(370-372)gtC>gtT	p.V124V	ANKRD46_ENST00000519316.1_Intron|ANKRD46_ENST00000520311.1_Silent_p.V124V|ANKRD46_ENST00000519597.1_Silent_p.V124V|ANKRD46_ENST00000335659.3_Silent_p.V124V	NM_001270379.1	NP_001257308.1	Q86W74	ANR46_HUMAN	ankyrin repeat domain 46	124						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(4)	7	all_cancers(14;5.07e-05)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000353)|all_lung(17;0.000998)		Epithelial(11;2.61e-11)|all cancers(13;5.03e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.49e-06)|STAD - Stomach adenocarcinoma(118;0.0957)			GCAATCGGATGACATCTTTAT	0.378																																					p.V124V		.											.	ANKRD46	22	0			c.C372T						.						133.0	131.0	132.0					8																	101540171		2203	4300	6503	SO:0001819	synonymous_variant	157567	exon4			TCGGATGACATCT	AB077205	CCDS6287.1, CCDS59109.1	8q22.3	2013-01-10						"""Ankyrin repeat domain containing"""	27229	protein-coding gene	gene with protein product							Standard	NM_001270377		Approved		uc003yjm.4	Q86W74		ENST00000520552.1:c.372C>T	8.37:g.101540171G>A		374.0	1.0		270.0	110.0	NM_001270378	Q6P9B7	Silent	SNP	ENST00000520552.1	37	CCDS59109.1																																																																																			.		0.378	ANKRD46-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000379899.1	NM_198401	
ANO4	121601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	101491695	101491695	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:101491695T>A	ENST00000392977.3	+	21	2188	c.1978T>A	c.(1978-1980)Tgg>Agg	p.W660R	ANO4_ENST00000392979.3_Missense_Mutation_p.W625R|ANO4_ENST00000299222.9_Missense_Mutation_p.W180R|ANO4_ENST00000550015.1_Missense_Mutation_p.W180R			Q32M45	ANO4_HUMAN	anoctamin 4	660					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						aaagcagacctggaataattt	0.413										HNSCC(74;0.22)																											p.W625R		.											.	ANO4	96	0			c.T1873A						.						167.0	153.0	158.0					12																	101491695		2203	4300	6503	SO:0001583	missense	121601	exon20			CAGACCTGGAATA	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.1978T>A	12.37:g.101491695T>A	ENSP00000376703:p.Trp660Arg	316.0	0.0		231.0	112.0	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	37		.	.	.	.	.	.	.	.	.	.	T	23.0	4.367818	0.82463	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.62498	0.02;0.02;0.02;0.02	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.76877	0.4049	M	0.65498	2.005	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.999;0.999	T	0.74481	-0.3651	10	0.29301	T	0.29	.	16.0993	0.81158	0.0:0.0:0.0:1.0	.	180;660;625	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	R	625;180;660;180	ENSP00000376705:W625R;ENSP00000299222:W180R;ENSP00000376703:W660R;ENSP00000450192:W180R	ENSP00000299222:W180R	W	+	1	0	ANO4	100015826	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.846000	0.86887	2.207000	0.71202	0.459000	0.35465	TGG	.		0.413	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
AP3M2	10947	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	42022613	42022614	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:42022613_42022614insG	ENST00000518421.1	+	6	899_900	c.608_609insG	c.(607-612)caggggfs	p.QG203fs	AP3M2_ENST00000520685.1_Intron|AP3M2_ENST00000396926.3_Frame_Shift_Ins_p.QG203fs|AP3M2_ENST00000174653.3_Frame_Shift_Ins_p.QG203fs|AP3M2_ENST00000517922.1_Frame_Shift_Ins_p.QG203fs	NM_001134296.1	NP_001127768.1	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	203	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|stomach(1)	17	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			GCTGAGATCCAGGGGGTGATTG	0.446																																					p.Q203fs		.											.	AP3M2	90	0			c.608_609insG						.																																			SO:0001589	frameshift_variant	10947	exon6			AGATCCAGGGGGT	D38293	CCDS6125.1	8p11.2	2008-07-07			ENSG00000070718	ENSG00000070718			570	protein-coding gene	gene with protein product		610469				7601449	Standard	NM_006803		Approved	CLA20, AP47B	uc003xoo.3	P53677	OTTHUMG00000164060	ENST00000518421.1:c.613dupG	8.37:g.42022618_42022618dupG	ENSP00000428787:p.Gln203fs	299.0	0.0		308.0	138.0	NM_001134296	B2RCR0|D3DSY2|Q7Z472	Frame_Shift_Ins	INS	ENST00000518421.1	37	CCDS6125.1																																																																																			.		0.446	AP3M2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376996.1		
APC	324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	112177044	112177044	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr5:112177044T>C	ENST00000457016.1	+	16	6133	c.5753T>C	c.(5752-5754)aTa>aCa	p.I1918T	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.I1918T|APC_ENST00000508376.2_Missense_Mutation_p.I1918T			P25054	APC_HUMAN	adenomatous polyposis coli	1918	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAGCAGCCAATAAATCGAGGT	0.418		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.I1918T	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	APC	12026	1	Unknown(1)	skin(1)	c.T5753C						.						103.0	97.0	99.0					5																	112177044		2202	4300	6502	SO:0001583	missense	324	exon17	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	AGCCAATAAATCG	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.5753T>C	5.37:g.112177044T>C	ENSP00000413133:p.Ile1918Thr	254.0	0.0		267.0	134.0	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	T	0.016	-1.530597	0.00951	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.89485	-2.52;-2.52;-2.52	5.91	0.891	0.19224	.	1.124860	0.06222	N	0.686948	T	0.75309	0.3832	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.61272	-0.7096	9	.	.	.	-0.0728	5.6114	0.17408	0.1243:0.3416:0.0:0.5341	.	1920;1918	Q4LE70;P25054	.;APC_HUMAN	T	1918	ENSP00000413133:I1918T;ENSP00000257430:I1918T;ENSP00000427089:I1918T	.	I	+	2	0	APC	112204943	0.000000	0.05858	0.082000	0.20525	0.252000	0.25951	0.603000	0.24149	0.463000	0.27118	0.528000	0.53228	ATA	.		0.418	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APOB	338	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	21228142	21228157	+	Frame_Shift_Del	DEL	GGAGGGAATCTCAATG	GGAGGGAATCTCAATG	-	rs553934960		TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	GGAGGGAATCTCAATG	GGAGGGAATCTCAATG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:21228142_21228157delGGAGGGAATCTCAATG	ENST00000233242.1	-	26	11710_11725	c.11583_11598delCATTGAGATTCCCTCC	c.(11581-11598)accattgagattccctccfs	p.TIEIPS3861fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3861					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAACTTAATGGAGGGAATCTCAATGGTCTGCTCAG	0.468																																					p.3861_3866del		.											.	APOB	175	0			c.11583_11598del						.																																			SO:0001589	frameshift_variant	338	exon26			CTTAATGGAGGGA	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.11583_11598delCATTGAGATTCCCTCC	2.37:g.21228142_21228157delGGAGGGAATCTCAATG	ENSP00000233242:p.Thr3861fs	244.0	0.0		150.0	33.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Del	DEL	ENST00000233242.1	37	CCDS1703.1																																																																																			.		0.468	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
AR	367	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	66766453	66766453	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chrX:66766453G>A	ENST00000374690.3	+	1	1989	c.1465G>A	c.(1465-1467)Ggg>Agg	p.G489R	AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.G489R|AR_ENST00000504326.1_Missense_Mutation_p.G489R	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	488	Modulating.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	GCCCCCTCAGGGGCTGGCGGG	0.731									Androgen Insensitivity Syndrome																												p.G489R		.											.	AR	661	0			c.G1465A						.						20.0	16.0	17.0					X																	66766453		2190	4266	6456	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	CCTCAGGGGCTGG	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1465G>A	X.37:g.66766453G>A	ENSP00000363822:p.Gly489Arg	48.0	0.0		54.0	21.0	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	37	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	g	24.7	4.561604	0.86335	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	D;D;D	0.93712	-2.55;-3.27;-2.75	5.06	5.06	0.68205	.	0.400730	0.25503	N	0.030237	D	0.96318	0.8799	M	0.78916	2.43	0.39176	D	0.962693	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.96683	0.9505	10	0.48119	T	0.1	.	14.701	0.69157	0.0:0.0:1.0:0.0	.	489;489;488	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	R	299;489;489;489;481	ENSP00000363822:G489R;ENSP00000421155:G489R;ENSP00000379359:G489R	ENSP00000363822:G489R	G	+	1	0	AR	66683178	1.000000	0.71417	0.996000	0.52242	0.877000	0.50540	4.056000	0.57448	2.349000	0.79799	0.509000	0.49947	GGG	.		0.731	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
ARHGEF10L	55160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	17991069	17991069	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr1:17991069A>C	ENST00000361221.3	+	26	3147	c.2988A>C	c.(2986-2988)gaA>gaC	p.E996D	ARHGEF10L_ENST00000375408.3_Missense_Mutation_p.E769D|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.E957D|ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.E957D|ARHGEF10L_ENST00000167825.4_Missense_Mutation_p.E699D|ARHGEF10L_ENST00000434513.1_Missense_Mutation_p.E991D	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	996						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		CTGTCCTGGAAGCCACCACCC	0.647																																					p.E996D		.											.	ARHGEF10L	292	0			c.A2988C						.						50.0	46.0	47.0					1																	17991069		2203	4300	6503	SO:0001583	missense	55160	exon26			CCTGGAAGCCACC	AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.2988A>C	1.37:g.17991069A>C	ENSP00000355060:p.Glu996Asp	62.0	0.0		60.0	28.0	NM_018125	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	ENST00000361221.3	37	CCDS182.1	.	.	.	.	.	.	.	.	.	.	A	0.565	-0.843565	0.02671	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375408;ENST00000457829;ENST00000167825	T;T;T;T;T;T	0.49432	2.04;2.04;0.78;2.04;2.04;2.04	4.22	-2.71	0.05986	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.248271	0.38005	N	0.001848	T	0.12050	0.0293	N	0.02960	-0.455	0.20821	N	0.999841	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.04013	0.0;0.001;0.001;0.0;0.0;0.001;0.001	T	0.20371	-1.0277	10	0.02654	T	1	-10.507	0.3757	0.00387	0.2841:0.263:0.135:0.3179	.	769;991;699;757;952;957;996	Q5VXI4;Q9HCE6-5;Q9HCE6-4;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;.;ARGAL_HUMAN	D	996;957;991;957;769;769;699	ENSP00000355060:E996D;ENSP00000399401:E957D;ENSP00000394621:E991D;ENSP00000364564:E957D;ENSP00000364557:E769D;ENSP00000167825:E699D	ENSP00000167825:E699D	E	+	3	2	ARHGEF10L	17863656	0.060000	0.20803	0.979000	0.43373	0.608000	0.37181	-1.115000	0.03289	-0.487000	0.06735	-0.695000	0.03696	GAA	.		0.647	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125	
ARSG	22901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	66303755	66303755	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr17:66303755A>G	ENST00000448504.2	+	2	917	c.121A>G	c.(121-123)Att>Gtt	p.I41V	ARSG_ENST00000452479.2_Intron	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	41					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTTTGTGATTATTTTGGCCGA	0.478																																					p.I41V		.											.	ARSG	91	0			c.A121G						.						98.0	96.0	96.0					17																	66303755		2203	4300	6503	SO:0001583	missense	22901	exon2			GTGATTATTTTGG	AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.121A>G	17.37:g.66303755A>G	ENSP00000407193:p.Ile41Val	519.0	0.0		753.0	240.0	NM_001267727	Q6UXF2|Q9Y2K4	Missense_Mutation	SNP	ENST00000448504.2	37	CCDS11676.1	.	.	.	.	.	.	.	.	.	.	A	17.88	3.498412	0.64298	.	.	ENSG00000141337	ENST00000452479	.	.	.	5.59	4.52	0.55395	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	T	0.63283	0.2498	M	0.68593	2.085	0.80722	D	1	P	0.49862	0.929	P	0.52309	0.695	T	0.66208	-0.5981	9	0.56958	D	0.05	.	9.0431	0.36329	0.9143:0.0:0.0857:0.0	.	41	Q96EG1	ARSG_HUMAN	V	41	.	ENSP00000413953:I41V	I	+	1	0	ARSG	63815350	1.000000	0.71417	1.000000	0.80357	0.616000	0.37450	2.653000	0.46691	2.120000	0.65058	0.460000	0.39030	ATT	.		0.478	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448369.1	NM_014960	
BAG4	9530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	38067967	38067967	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:38067967A>C	ENST00000287322.4	+	5	1601	c.1330A>C	c.(1330-1332)Aag>Cag	p.K444Q	BAG4_ENST00000432471.2_Missense_Mutation_p.K408Q	NM_004874.3	NP_004865.1	O95429	BAG4_HUMAN	BCL2-associated athanogene 4	444	BAG. {ECO:0000255|PROSITE- ProRule:PRU00369}.				cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to tumor necrosis factor (GO:0071356)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA modification (GO:0090367)|negative regulation of phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:2001145)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell adhesion (GO:0045785)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein localization to plasma membrane (GO:0072659)|ruffle assembly (GO:0097178)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|urinary_tract(1)	11	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)				GGCTGTTTGTAAGATTCAGGC	0.408																																					p.K444Q		.											.	BAG4	228	0			c.A1330C						.						31.0	34.0	33.0					8																	38067967		2201	4295	6496	SO:0001583	missense	9530	exon5			GTTTGTAAGATTC	AF095194	CCDS6104.1, CCDS56533.1	8p11.23	2008-08-07			ENSG00000156735	ENSG00000156735			940	protein-coding gene	gene with protein product	"""silencer of death domains"""	603884				9873016, 9915703	Standard	NM_004874		Approved	SODD	uc003xky.2	O95429	OTTHUMG00000164064	ENST00000287322.4:c.1330A>C	8.37:g.38067967A>C	ENSP00000287322:p.Lys444Gln	168.0	0.0		135.0	54.0	NM_004874	B4E217|O95818	Missense_Mutation	SNP	ENST00000287322.4	37	CCDS6104.1	.	.	.	.	.	.	.	.	.	.	A	12.24	1.877832	0.33162	.	.	ENSG00000156735	ENST00000432471;ENST00000287322	D;D	0.89123	-2.47;-2.47	5.27	4.12	0.48240	BAG domain (3);	0.055372	0.64402	D	0.000002	D	0.90160	0.6925	L	0.47716	1.5	0.40867	D	0.983889	D;D	0.64830	0.989;0.994	P;P	0.59643	0.701;0.861	D	0.90105	0.4187	10	0.66056	D	0.02	-15.6272	10.5295	0.44969	0.9239:0.0:0.0761:0.0	.	408;444	B4E217;O95429	.;BAG4_HUMAN	Q	408;444	ENSP00000393298:K408Q;ENSP00000287322:K444Q	ENSP00000287322:K444Q	K	+	1	0	BAG4	38187124	1.000000	0.71417	1.000000	0.80357	0.001000	0.01503	5.619000	0.67729	0.966000	0.38159	-0.394000	0.06481	AAG	.		0.408	BAG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377038.2	NM_004874	
BCL11B	64919	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	99640713	99640713	+	Silent	SNP	G	G	C	rs373169869		TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr14:99640713G>C	ENST00000357195.3	-	4	2469	c.2460C>G	c.(2458-2460)ggC>ggG	p.G820G	BCL11B_ENST00000443726.2_Silent_p.G626G|BCL11B_ENST00000345514.2_Silent_p.G749G	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	820					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		AAGGCCGCTCGCCGGTGTGGC	0.647			T	TLX3	T-ALL																																p.G820G		.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	.	BCL11B	1147	0			c.C2460G						.						41.0	33.0	36.0					14																	99640713		2203	4300	6503	SO:0001819	synonymous_variant	64919	exon4			CCGCTCGCCGGTG	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.2460C>G	14.37:g.99640713G>C		71.0	1.0		85.0	38.0	NM_138576	Q9H162	Silent	SNP	ENST00000357195.3	37	CCDS9950.1																																																																																			.		0.647	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
BTBD1	53339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	83687553	83687553	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr15:83687553C>T	ENST00000261721.4	-	7	1398	c.1196G>A	c.(1195-1197)aGt>aAt	p.S399N	RP11-382A20.5_ENST00000566841.1_RNA|RP11-382A20.7_ENST00000570202.1_RNA|BTBD1_ENST00000379403.2_Missense_Mutation_p.V370I	NM_001011885.1|NM_025238.3	NP_001011885.1|NP_079514.1	Q9H0C5	BTBD1_HUMAN	BTB (POZ) domain containing 1	399					protein ubiquitination (GO:0016567)|regulation of protein binding (GO:0043393)	cytoplasmic mRNA processing body (GO:0000932)|protein complex (GO:0043234)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	10				all cancers(203;0.000186)		CCCATCACAACTAAAGCCGGT	0.393																																					p.S399N		.											.	BTBD1	91	0			c.G1196A						.						175.0	144.0	154.0					15																	83687553		2203	4300	6503	SO:0001583	missense	53339	exon7			TCACAACTAAAGC	AF355402	CCDS10322.1, CCDS32313.1	15q24	2013-01-08			ENSG00000064726	ENSG00000064726		"""BTB/POZ domain containing"""	1120	protein-coding gene	gene with protein product		608530					Standard	XM_006720573		Approved		uc002bjn.3	Q9H0C5	OTTHUMG00000147364	ENST00000261721.4:c.1196G>A	15.37:g.83687553C>T	ENSP00000261721:p.Ser399Asn	388.0	0.0		332.0	166.0	NM_025238	A6NMI8|Q9BX71|Q9NWN4	Missense_Mutation	SNP	ENST00000261721.4	37	CCDS10322.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.32|18.32	3.598166|3.598166	0.66332|0.66332	.|.	.|.	ENSG00000064726|ENSG00000064726	ENST00000261721|ENST00000379403	T|T	0.77489|0.75589	-1.1|-0.95	5.23|5.23	5.23|5.23	0.72850|0.72850	PHR (1);|.	0.044312|.	0.85682|.	D|.	0.000000|.	T|T	0.70868|0.70868	0.3273|0.3273	L|L	0.48877|0.48877	1.53|1.53	0.28154|0.28154	N|N	0.929289|0.929289	B|B	0.06786|0.30741	0.001|0.293	B|B	0.12156|0.25140	0.007|0.058	T|T	0.68462|0.68462	-0.5402|-0.5402	10|9	0.27785|0.87932	T|D	0.31|0	-19.6963|-19.6963	18.8027|18.8027	0.92025|0.92025	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	399|370	Q9H0C5|A6NMI8	BTBD1_HUMAN|.	N|I	399|370	ENSP00000261721:S399N|ENSP00000368713:V370I	ENSP00000261721:S399N|ENSP00000368713:V370I	S|V	-|-	2|1	0|0	BTBD1|BTBD1	81478557|81478557	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	6.020000|6.020000	0.70826|0.70826	2.450000|2.450000	0.82876|0.82876	0.563000|0.563000	0.77884|0.77884	AGT|GTT	.		0.393	BTBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304008.1		
C8orf31	286122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	144124680	144124680	+	Splice_Site	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:144124680G>A	ENST00000395172.1	+	3	538		c.e3+1		C8orf31_ENST00000517653.1_Splice_Site	NM_173687.2	NP_775958.1	Q8N9H6	CH031_HUMAN	chromosome 8 open reading frame 31											breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10	all_cancers(97;1.89e-10)|all_epithelial(106;8.73e-09)|Lung NSC(106;0.000161)|all_lung(105;0.000447)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					AACGGCACTTGTAAGTTTCAG	0.612																																					.		.											.	C8orf31	91	0			c.186+1G>A						.						29.0	31.0	30.0					8																	144124680		2203	4300	6503	SO:0001630	splice_region_variant	286122	exon3			GCACTTGTAAGTT		CCDS6395.1	8q24.3	2012-04-11			ENSG00000177335	ENSG00000177335			26731	protein-coding gene	gene with protein product							Standard	NM_173687		Approved	FLJ37131	uc003yxp.1	Q8N9H6	OTTHUMG00000164771	ENST00000395172.1:c.186+1G>A	8.37:g.144124680G>A		27.0	0.0		29.0	11.0	NM_173687	Q6GMU7	Splice_Site	SNP	ENST00000395172.1	37	CCDS6395.1	.	.	.	.	.	.	.	.	.	.	G	0.036	-1.304949	0.01353	.	.	ENSG00000177335	ENST00000395172	.	.	.	1.85	-3.7	0.04437	.	.	.	.	.	.	.	.	.	.	.	0.21064	N	0.999794	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.0882	0.00037	0.2694:0.2595:0.1974:0.2737	.	.	.	.	.	-1	.	.	.	+	.	.	C8orf31	144196055	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.393000	0.02521	-1.955000	0.01023	0.391000	0.25812	.	.		0.612	C8orf31-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380167.1	NM_173687	Intron
CABIN1	23523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	24472172	24472172	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr22:24472172A>T	ENST00000398319.2	+	19	3072	c.2687A>T	c.(2686-2688)cAc>cTc	p.H896L	CABIN1_ENST00000405822.2_Missense_Mutation_p.H846L|CABIN1_ENST00000263119.5_Missense_Mutation_p.H896L	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	896					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AACACAGCCCACGAGTATTTG	0.572																																					p.H896L		.											.	CABIN1	94	0			c.A2687T						.						124.0	94.0	104.0					22																	24472172		2203	4300	6503	SO:0001583	missense	23523	exon19			CAGCCCACGAGTA	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.2687A>T	22.37:g.24472172A>T	ENSP00000381364:p.His896Leu	270.0	0.0		297.0	147.0	NM_001199281	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	37	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	A	28.0	4.885211	0.91814	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	T;T;T	0.51071	0.72;0.72;0.72	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.68559	0.3014	M	0.77313	2.365	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.986	T	0.73655	-0.3914	10	0.87932	D	0	.	14.0721	0.64865	1.0:0.0:0.0:0.0	.	846;896	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	L	896;846;896	ENSP00000263119:H896L;ENSP00000384694:H846L;ENSP00000381364:H896L	ENSP00000263119:H896L	H	+	2	0	CABIN1	22802172	1.000000	0.71417	0.988000	0.46212	0.988000	0.76386	9.334000	0.96470	1.988000	0.58038	0.529000	0.55759	CAC	.		0.572	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
CACNA1S	779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	201046155	201046155	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr1:201046155C>T	ENST00000362061.3	-	12	1946	c.1720G>A	c.(1720-1722)Gcc>Acc	p.A574T	CACNA1S_ENST00000367338.3_Missense_Mutation_p.A574T	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	574				A -> R (in Ref. 1; AAA51902 and 2; AAB37235). {ECO:0000305}.	axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCCAGGAGGGCGAAGATGACG	0.562																																					p.A574T		.											.	CACNA1S	94	0			c.G1720A						.						155.0	137.0	143.0					1																	201046155		2203	4300	6503	SO:0001583	missense	779	exon12			GGAGGGCGAAGAT	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.1720G>A	1.37:g.201046155C>T	ENSP00000355192:p.Ala574Thr	420.0	1.0		646.0	400.0	NM_000069	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	37	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.425577	0.62733	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.98400	-4.91;-4.91	4.45	3.45	0.39498	Ion transport (1);	0.176123	0.49305	D	0.000152	D	0.97823	0.9285	M	0.87180	2.865	0.43010	D	0.994549	P	0.43662	0.814	B	0.44315	0.446	D	0.98423	1.0578	10	0.87932	D	0	.	11.5339	0.50626	0.3126:0.6874:0.0:0.0	.	574	Q13698	CAC1S_HUMAN	T	574	ENSP00000355192:A574T;ENSP00000356307:A574T	ENSP00000355192:A574T	A	-	1	0	CACNA1S	199312778	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	2.632000	0.46511	2.189000	0.69895	0.549000	0.68633	GCC	.		0.562	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
CALR	811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	13054680	13054680	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:13054680G>T	ENST00000316448.5	+	9	1280	c.1207G>T	c.(1207-1209)Gaa>Taa	p.E403*	RAD23A_ENST00000316856.3_5'Flank|RAD23A_ENST00000592268.1_5'Flank|CTC-425F1.4_ENST00000589120.1_RNA|RAD23A_ENST00000541222.1_5'Flank|RAD23A_ENST00000586534.1_5'Flank	NM_004343.3	NP_004334.1	P27797	CALR_HUMAN	calreticulin	403	Asp/Glu/Lys-rich.|C-domain.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|chaperone-mediated protein folding (GO:0061077)|cortical actin cytoskeleton organization (GO:0030866)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucocorticoid receptor signaling pathway (GO:0042921)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|peptide antigen assembly with MHC class I protein complex (GO:0002502)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of phagocytosis (GO:0050766)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein localization to nucleus (GO:0034504)|protein maturation by protein folding (GO:0022417)|protein N-linked glycosylation via asparagine (GO:0018279)|protein stabilization (GO:0050821)|regulation of apoptotic process (GO:0042981)|regulation of meiosis (GO:0040020)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to testosterone (GO:0033574)|sequestering of calcium ion (GO:0051208)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|intracellular (GO:0005622)|membrane (GO:0016020)|MHC class I peptide loading complex (GO:0042824)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasmic reticulum (GO:0016529)	androgen receptor binding (GO:0050681)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|chaperone binding (GO:0051087)|complement component C1q binding (GO:0001849)|DNA binding (GO:0003677)|glycoprotein binding (GO:0001948)|hormone binding (GO:0042562)|integrin binding (GO:0005178)|iron ion binding (GO:0005506)|mRNA binding (GO:0003729)|peptide binding (GO:0042277)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)	10					Antihemophilic Factor(DB00025)|Melatonin(DB01065)|Tenecteplase(DB00031)	ggacaaggaggaagatgagga	0.587																																					p.E403X		.											.	CALR	91	0			c.G1207T						.						251.0	193.0	213.0					19																	13054680		2203	4300	6503	SO:0001587	stop_gained	811	exon9			AAGGAGGAAGATG	M84739	CCDS12288.1	19p13.3-p13.2	2014-09-17				ENSG00000179218			1455	protein-coding gene	gene with protein product	"""Sicca syndrome antigen A (autoantigen Ro; calreticulin)"", ""autoantigen Ro"""	109091				2365822	Standard	NM_004343		Approved	RO, SSA, cC1qR, CRT, FLJ26680	uc002mvu.2	P27797		ENST00000316448.5:c.1207G>T	19.37:g.13054680G>T	ENSP00000320866:p.Glu403*	424.0	1.0		388.0	192.0	NM_004343	Q6IAT4|Q9UDG2	Nonsense_Mutation	SNP	ENST00000316448.5	37	CCDS12288.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.808459	0.70797	.	.	ENSG00000179218	ENST00000316448;ENST00000539083	.	.	.	5.4	5.4	0.78164	.	0.251665	0.36409	N	0.002611	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-20.8665	12.1195	0.53883	0.0833:0.0:0.9167:0.0	.	.	.	.	X	403;282	.	ENSP00000320866:E403X	E	+	1	0	CALR	12915680	1.000000	0.71417	0.122000	0.21767	0.183000	0.23260	5.663000	0.68038	2.526000	0.85167	0.555000	0.69702	GAA	.		0.587	CALR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451952.1	NM_004343	
CARD11	84433	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	2979547	2979547	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr7:2979547G>A	ENST00000396946.4	-	6	1103	c.700C>T	c.(700-702)Cac>Tac	p.H234Y		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	234					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.K226_H227>N(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TTCAACCGGTGCTTTAGCTGA	0.498			Mis		DLBCL																																p.H234Y		.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	CARD11	870	1	Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(1)	c.C700T						.						130.0	119.0	123.0					7																	2979547		2203	4300	6503	SO:0001583	missense	84433	exon6			ACCGGTGCTTTAG	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.700C>T	7.37:g.2979547G>A	ENSP00000380150:p.His234Tyr	422.0	0.0		350.0	169.0	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	G	18.16	3.561707	0.65538	.	.	ENSG00000198286	ENST00000396946	T	0.34072	1.38	5.67	5.67	0.87782	.	0.098627	0.64402	D	0.000001	T	0.45034	0.1322	M	0.64404	1.975	0.58432	D	0.999999	D	0.57257	0.979	P	0.51079	0.658	T	0.38156	-0.9674	10	0.05436	T	0.98	-32.5575	19.836	0.96658	0.0:0.0:1.0:0.0	.	234	Q9BXL7	CAR11_HUMAN	Y	234	ENSP00000380150:H234Y	ENSP00000380150:H234Y	H	-	1	0	CARD11	2946073	1.000000	0.71417	0.990000	0.47175	0.981000	0.71138	9.146000	0.94640	2.690000	0.91761	0.579000	0.79373	CAC	.		0.498	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
CC2D1A	54862	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	14038069	14038069	+	Silent	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:14038069G>A	ENST00000318003.7	+	22	2548	c.2307G>A	c.(2305-2307)gaG>gaA	p.E769E	CC2D1A_ENST00000589606.1_Silent_p.E769E	NM_017721.4	NP_060191.3	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	769					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	27			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			AGGTCCGGGAGATCCTTGAGG	0.537																																					p.E769E		.											.	CC2D1A	90	0			c.G2307A						.						102.0	123.0	116.0					19																	14038069		2163	4252	6415	SO:0001819	synonymous_variant	54862	exon22			CCGGGAGATCCTT	AF536205	CCDS42512.1	19p13.12	2007-01-08				ENSG00000132024			30237	protein-coding gene	gene with protein product	"""mental retardation, nonsyndromic, autosomal recessive, 3"""	610055				12761501, 16033914	Standard	NM_017721		Approved	FLJ20241, MRT3	uc002mxo.2	Q6P1N0		ENST00000318003.7:c.2307G>A	19.37:g.14038069G>A		217.0	0.0		221.0	9.0	NM_017721	Q7Z435|Q86XV0|Q8NF89|Q9H603|Q9NXI1	Silent	SNP	ENST00000318003.7	37	CCDS42512.1																																																																																			.		0.537	CC2D1A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457954.1	NM_017721	
CCBE1	147372	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	57364549	57364549	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr18:57364549C>A	ENST00000439986.4	-	1	63	c.26G>T	c.(25-27)gGa>gTa	p.G9V	RP11-2N1.2_ENST00000588946.1_RNA	NM_133459.3	NP_597716.1	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1	9					lymphangiogenesis (GO:0001946)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of protein processing (GO:0010954)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|positive regulation vascular endothelial growth factor production (GO:0010575)|sprouting angiogenesis (GO:0002040)|venous blood vessel morphogenesis (GO:0048845)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|protease binding (GO:0002020)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(3)	24		Colorectal(73;0.175)				GGCAGCTCCTCCCCGGCTCGG	0.731											OREG0025022	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G9V	NSCLC(137;1340 1860 15773 39604 51087)|Esophageal Squamous(139;339 1777 2926 19691 38524)	.											.	CCBE1	93	0			c.G26T						.						6.0	7.0	7.0					18																	57364549		2015	4006	6021	SO:0001583	missense	147372	exon1			GCTCCTCCCCGGC	AB075863	CCDS32838.1	18q21.32	2005-01-18				ENSG00000183287			29426	protein-coding gene	gene with protein product		612753				11853319, 12975309	Standard	NM_133459		Approved	FLJ30681, KIAA1983	uc002lib.3	Q6UXH8		ENST00000439986.4:c.26G>T	18.37:g.57364549C>A	ENSP00000404464:p.Gly9Val	32.0	0.0	1022	52.0	25.0	NM_133459	Q6MZX5|Q86SS2|Q8TF19	Missense_Mutation	SNP	ENST00000439986.4	37	CCDS32838.1	.	.	.	.	.	.	.	.	.	.	C	12.79	2.045007	0.36085	.	.	ENSG00000183287	ENST00000439986	D	0.86497	-2.13	4.14	1.15	0.20763	.	0.969120	0.08413	U	0.949473	T	0.73361	0.3577	N	0.08118	0	0.80722	D	1	B	0.20052	0.041	B	0.17098	0.017	T	0.61033	-0.7144	10	0.87932	D	0	-0.1761	5.7568	0.18178	0.0:0.5021:0.387:0.1109	.	9	Q6UXH8	CCBE1_HUMAN	V	9	ENSP00000404464:G9V	ENSP00000404464:G9V	G	-	2	0	CCBE1	55515529	1.000000	0.71417	0.672000	0.29872	0.952000	0.60782	1.467000	0.35321	0.027000	0.15297	0.655000	0.94253	GGA	.		0.731	CCBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449685.2	NM_133459	
CCDC102A	92922	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	57549306	57549306	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr16:57549306C>A	ENST00000258214.2	-	8	1716	c.1470G>T	c.(1468-1470)gaG>gaT	p.E490D		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	490										endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						GCTCCGTCTGCTCGTCCAGCG	0.657																																					p.E490D		.											.	CCDC102A	91	0			c.G1470T						.						58.0	46.0	50.0					16																	57549306		2198	4300	6498	SO:0001583	missense	92922	exon8			CGTCTGCTCGTCC	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.1470G>T	16.37:g.57549306C>A	ENSP00000258214:p.Glu490Asp	92.0	1.0		60.0	57.0	NM_033212	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380801	0.61845	.	.	ENSG00000135736	ENST00000258214	T	0.81247	-1.47	3.96	0.81	0.18732	.	0.131379	0.49916	D	0.000130	T	0.68165	0.2971	L	0.36672	1.1	0.47659	D	0.999481	P	0.51791	0.948	P	0.45276	0.475	T	0.61898	-0.6968	10	0.14252	T	0.57	-13.6836	7.5774	0.27944	0.0:0.6355:0.0:0.3645	.	490	Q96A19	C102A_HUMAN	D	490	ENSP00000258214:E490D	ENSP00000258214:E490D	E	-	3	2	CCDC102A	56106807	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.790000	0.26900	0.344000	0.23847	-0.424000	0.05967	GAG	.		0.657	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
CCDC129	223075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	31683115	31683115	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr7:31683115C>A	ENST00000407970.3	+	11	2169	c.2131C>A	c.(2131-2133)Cag>Aag	p.Q711K	CCDC129_ENST00000409210.1_Missense_Mutation_p.Q619K|CCDC129_ENST00000451887.2_Missense_Mutation_p.Q737K|CCDC129_ENST00000319386.3_Missense_Mutation_p.Q563K	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	711										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						TGTAATGACCCAGATGTCCTC	0.522																																					p.Q737K		.											.	.	.	0			c.C2209A						.						64.0	67.0	66.0					7																	31683115		2203	4300	6503	SO:0001583	missense	223075	exon11			ATGACCCAGATGT	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.2131C>A	7.37:g.31683115C>A	ENSP00000384416:p.Gln711Lys	190.0	0.0		189.0	88.0	NM_001257968	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	ENST00000407970.3	37	CCDS5435.2	.	.	.	.	.	.	.	.	.	.	C	19.80	3.895603	0.72639	.	.	ENSG00000180347	ENST00000319386;ENST00000407970;ENST00000451887;ENST00000538406;ENST00000409210	T;T;T;T	0.32753	1.44;1.79;1.78;1.5	5.9	5.9	0.94986	.	0.611986	0.15036	N	0.284192	T	0.50565	0.1623	M	0.66939	2.045	0.32531	N	0.535011	D;P;P;D	0.63880	0.99;0.908;0.908;0.993	P;P;P;P	0.60789	0.864;0.492;0.492;0.879	T	0.52808	-0.8526	10	0.27082	T	0.32	0.7037	15.7701	0.78162	0.0:1.0:0.0:0.0	.	737;721;711;563	F5H3V5;F5H2J8;Q6ZRS4;Q6ZRS4-2	.;.;CC129_HUMAN;.	K	563;711;737;721;619	ENSP00000313062:Q563K;ENSP00000384416:Q711K;ENSP00000395835:Q737K;ENSP00000387214:Q619K	ENSP00000313062:Q563K	Q	+	1	0	CCDC129	31649640	0.995000	0.38212	0.953000	0.39169	0.528000	0.34623	3.798000	0.55522	2.804000	0.96469	0.655000	0.94253	CAG	.		0.522	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300	
CCDC59	29080	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	82752141	82752141	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:82752141C>A	ENST00000256151.7	-	1	426	c.15G>T	c.(13-15)agG>agT	p.R5S	CCDC59_ENST00000548126.1_Intron|METTL25_ENST00000248306.3_5'Flank	NM_014167.4	NP_054886.2	Q9P031	TAP26_HUMAN	coiled-coil domain containing 59	5					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)	5						TCGCGGACCGCCTCACCGGCG	0.577											OREG0022008	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R5S		.											.	CCDC59	90	0			c.G15T						.						33.0	34.0	34.0					12																	82752141		2203	4300	6503	SO:0001583	missense	29080	exon1			GGACCGCCTCACC	AF213377	CCDS9023.1	12q21.31	2007-10-17				ENSG00000133773			25005	protein-coding gene	gene with protein product						16630564, 12882447	Standard	NM_014167		Approved	HSPC128, TAP26, BR22	uc001szp.4	Q9P031		ENST00000256151.7:c.15G>T	12.37:g.82752141C>A	ENSP00000256151:p.Arg5Ser	38.0	0.0	1216	53.0	24.0	NM_014167	Q9H2V5|Q9NW62	Missense_Mutation	SNP	ENST00000256151.7	37	CCDS9023.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.528422	0.44969	.	.	ENSG00000133773	ENST00000552377;ENST00000256151	.	.	.	5.13	2.25	0.28309	.	0.509953	0.19603	N	0.110325	T	0.27866	0.0686	L	0.34521	1.04	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.16453	-1.0402	9	0.38643	T	0.18	-1.7965	6.1651	0.20386	0.0:0.6759:0.1534:0.1707	.	5	Q9P031	TAP26_HUMAN	S	5	.	ENSP00000256151:R5S	R	-	3	2	CCDC59	81276272	0.000000	0.05858	0.033000	0.17914	0.154000	0.21943	-0.066000	0.11598	0.174000	0.19809	-0.225000	0.12378	AGG	.		0.577	CCDC59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408186.1	NM_014167	
CDIPT	10423	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	29873915	29873915	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr16:29873915A>G	ENST00000219789.6	-	2	1048	c.170T>C	c.(169-171)cTt>cCt	p.L57P	CDIPT_ENST00000566113.1_Intron|CDIPT-AS1_ENST00000565014.1_RNA|CDIPT-AS1_ENST00000398859.3_RNA|CDIPT_ENST00000563415.1_Missense_Mutation_p.L57P|CDIPT_ENST00000570016.1_Missense_Mutation_p.L57P|CDIPT_ENST00000569956.1_Missense_Mutation_p.L57P|CDIPT_ENST00000561555.1_5'Flank	NM_006319.3	NP_006310.1	O14735	CDIPT_HUMAN	CDP-diacylglycerol--inositol 3-phosphatidyltransferase	57					CDP-diacylglycerol metabolic process (GO:0046341)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alcohol binding (GO:0043178)|carbohydrate binding (GO:0030246)|CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity (GO:0003881)|diacylglycerol binding (GO:0019992)|manganese ion binding (GO:0030145)			endometrium(1)|lung(3)	4						ACCTTGATTAAGAGCGCGAGC	0.602																																					p.L57P		.											.	CDIPT	90	0			c.T170C						.						37.0	39.0	39.0					16																	29873915		2186	4288	6474	SO:0001583	missense	10423	exon2			TGATTAAGAGCGC	AF014807	CCDS10657.1, CCDS67002.1	16p11.2	2012-11-19	2010-04-29		ENSG00000103502	ENSG00000103502	2.7.8.11		1769	protein-coding gene	gene with protein product	"""phosphatidylinositol synthase"""	605893	"""CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)"""			9407135	Standard	NM_006319		Approved	PIS1, PIS	uc002dum.3	O14735	OTTHUMG00000177144	ENST00000219789.6:c.170T>C	16.37:g.29873915A>G	ENSP00000219789:p.Leu57Pro	124.0	0.0		138.0	63.0	NM_006319	B4DUV0|H3BTV1|Q6FGU1|Q6ZN70	Missense_Mutation	SNP	ENST00000219789.6	37	CCDS10657.1	.	.	.	.	.	.	.	.	.	.	A	31	5.067577	0.93898	.	.	ENSG00000103502	ENST00000219789;ENST00000403894	T	0.47528	0.84	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.77177	0.4092	H	0.95574	3.69	0.80722	D	1	D	0.60160	0.987	D	0.70016	0.967	D	0.84012	0.0349	10	0.72032	D	0.01	-11.135	14.2679	0.66133	1.0:0.0:0.0:0.0	.	57	O14735	CDIPT_HUMAN	P	57;110	ENSP00000219789:L57P	ENSP00000219789:L57P	L	-	2	0	CDIPT	29781416	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.651000	0.83577	2.254000	0.74563	0.533000	0.62120	CTT	.		0.602	CDIPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255147.3	NM_006319	
CENPE	1062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	104079539	104079539	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr4:104079539T>A	ENST00000265148.3	-	24	3040	c.2951A>T	c.(2950-2952)aAa>aTa	p.K984I	CENPE_ENST00000380026.3_Missense_Mutation_p.K959I	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	984					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		AATTTTCGATTTTAGTGTATT	0.294																																					p.K984I		.											.	CENPE	277	0			c.A2951T						.						58.0	58.0	58.0					4																	104079539		2201	4291	6492	SO:0001583	missense	1062	exon24			TTCGATTTTAGTG	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.2951A>T	4.37:g.104079539T>A	ENSP00000265148:p.Lys984Ile	279.0	0.0		90.0	77.0	NM_001813	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	T	8.551	0.875574	0.17395	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026;ENST00000503705	T;T;T	0.72167	-0.63;-0.61;-0.16	4.15	1.71	0.24356	.	.	.	.	.	T	0.72415	0.3457	M	0.61703	1.905	0.09310	N	1	D;P	0.55385	0.971;0.926	P;P	0.52481	0.7;0.459	T	0.61407	-0.7069	9	0.66056	D	0.02	.	6.5698	0.22533	0.0:0.2044:0.0:0.7956	.	959;984	Q02224-3;Q02224	.;CENPE_HUMAN	I	984;984;959;984	ENSP00000265148:K984I;ENSP00000369365:K959I;ENSP00000423981:K984I	ENSP00000265148:K984I	K	-	2	0	CENPE	104298988	0.140000	0.22579	0.012000	0.15200	0.014000	0.08584	1.350000	0.34010	0.247000	0.21414	0.528000	0.53228	AAA	.		0.294	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
CHD9	80205	hgsc.bcm.edu;bcgsc.ca	37	16	53352155	53352156	+	Frame_Shift_Ins	INS	-	-	AAAAAGAC			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr16:53352155_53352156insAAAAAGAC	ENST00000398510.3	+	36	7703_7704	c.7616_7617insAAAAAGAC	c.(7615-7620)caaaaafs	p.-2540fs	CHD9_ENST00000447540.1_Frame_Shift_Ins_p.-2525fs|CHD9_ENST00000564845.1_Frame_Shift_Ins_p.-2524fs|CHD9_ENST00000566029.1_Frame_Shift_Ins_p.-2524fs			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9						cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				AGACCCAAACAAAAAAGACACC	0.327																																					p.Q2523fs		.											.	CHD9	272	0			c.7568_7569insAAAAAGAC						.																																			SO:0001589	frameshift_variant	80205	exon37			CCAAACAAAAAAG	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.7617_7624dupAAAAAGAC	16.37:g.53352156_53352163dupAAAAAGAC	ENSP00000381522:p.Lys2540fs	370.0	0.0		50.0	26.0	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Frame_Shift_Ins	INS	ENST00000398510.3	37																																																																																				.		0.327	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
CHL1	10752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	430967	430967	+	Silent	SNP	C	C	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr3:430967C>G	ENST00000256509.2	+	20	2922	c.2280C>G	c.(2278-2280)ggC>ggG	p.G760G	CHL1_ENST00000397491.2_Silent_p.G744G	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		atggaccaggcctagagtaca	0.498																																					p.G760G		.											.	CHL1	583	0			c.C2280G						.						81.0	74.0	76.0					3																	430967		2203	4300	6503	SO:0001819	synonymous_variant	10752	exon18			ACCAGGCCTAGAG	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.2280C>G	3.37:g.430967C>G		187.0	0.0		159.0	69.0	NM_001253388	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Silent	SNP	ENST00000256509.2	37	CCDS2556.1																																																																																			.		0.498	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
CHRM2	1129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	136699983	136699983	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr7:136699983G>T	ENST00000445907.2	+	3	899	c.371G>T	c.(370-372)tGt>tTt	p.C124F	CHRM2_ENST00000397608.3_Missense_Mutation_p.C124F|hsa-mir-490_ENST00000592183.1_RNA|CHRM2_ENST00000401861.1_Missense_Mutation_p.C124F|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000593789.1_RNA|CHRM2_ENST00000402486.3_Missense_Mutation_p.C124F|hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000453373.1_Missense_Mutation_p.C124F|CHRM2_ENST00000320658.5_Missense_Mutation_p.C124F	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	124					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	AGGTACTTCTGTGTCACAAAA	0.507																																					p.C124F		.											.	CHRM2	94	0			c.G371T						.						116.0	110.0	112.0					7																	136699983		2203	4300	6503	SO:0001583	missense	1129	exon3			ACTTCTGTGTCAC		CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.371G>T	7.37:g.136699983G>T	ENSP00000399745:p.Cys124Phe	389.0	1.0		315.0	160.0	NM_001006632	Q4VBK6|Q9P1X9	Missense_Mutation	SNP	ENST00000445907.2	37	CCDS5843.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559013	0.65538	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23;1.23	5.61	5.61	0.85477	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.65709	0.2717	M	0.83118	2.625	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.69840	-0.5036	10	0.87932	D	0	-14.1208	19.7047	0.96068	0.0:0.0:1.0:0.0	.	124	P08172	ACM2_HUMAN	F	124	ENSP00000399745:C124F;ENSP00000415386:C124F;ENSP00000319984:C124F;ENSP00000380733:C124F;ENSP00000384937:C124F;ENSP00000384401:C124F	ENSP00000319984:C124F	C	+	2	0	CHRM2	136350523	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.817000	0.86213	2.655000	0.90218	0.650000	0.86243	TGT	.		0.507	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1		
CHSY1	22856	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	101718497	101718497	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr15:101718497C>A	ENST00000254190.3	-	3	1980	c.1505G>T	c.(1504-1506)gGa>gTa	p.G502V	CHSY1_ENST00000543813.1_5'UTR	NM_014918.4	NP_055733.2	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	502					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of ossification (GO:0030279)|response to nutrient levels (GO:0031667)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(5)|skin(1)	24	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GGACAAGGATCCAGATTCCTG	0.468																																					p.G502V		.											.	CHSY1	90	0			c.G1505T						.						76.0	79.0	78.0					15																	101718497		2203	4300	6503	SO:0001583	missense	22856	exon3			AAGGATCCAGATT	AB023207	CCDS10390.1	15q26.3	2013-02-19	2008-01-24	2008-01-24	ENSG00000131873	ENSG00000131873	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	17198	protein-coding gene	gene with protein product		608183	"""carbohydrate (chondroitin) synthase 1"""			11514575	Standard	NM_014918		Approved	KIAA0990, CSS1	uc021sxt.1	Q86X52	OTTHUMG00000149873	ENST00000254190.3:c.1505G>T	15.37:g.101718497C>A	ENSP00000254190:p.Gly502Val	146.0	1.0		106.0	48.0	NM_014918	Q6UX38|Q7LFU5|Q9Y2J5	Missense_Mutation	SNP	ENST00000254190.3	37	CCDS10390.1	.	.	.	.	.	.	.	.	.	.	C	10.76	1.441537	0.25900	.	.	ENSG00000131873	ENST00000254190;ENST00000543813	T	0.36157	1.27	5.8	5.8	0.92144	.	0.058203	0.64402	D	0.000002	T	0.29256	0.0728	N	0.19112	0.55	0.80722	D	1	B	0.18166	0.026	B	0.20384	0.029	T	0.03750	-1.1007	10	0.30078	T	0.28	-33.2544	20.063	0.97692	0.0:1.0:0.0:0.0	.	502	Q86X52	CHSS1_HUMAN	V	502;230	ENSP00000254190:G502V	ENSP00000254190:G502V	G	-	2	0	CHSY1	99536020	1.000000	0.71417	0.708000	0.30435	0.836000	0.47400	5.775000	0.68915	2.735000	0.93741	0.655000	0.94253	GGA	.		0.468	CHSY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313624.1	NM_014918	
CNKSR2	22866	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	21627708	21627708	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chrX:21627708G>T	ENST00000379510.3	+	20	2701	c.2665G>T	c.(2665-2667)Gca>Tca	p.A889S	CNKSR2_ENST00000425654.2_Missense_Mutation_p.A859S|CNKSR2_ENST00000543067.1_Missense_Mutation_p.A840S|CNKSR2_ENST00000279451.4_Missense_Mutation_p.A889S	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	889					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						ggaaggggaggCAGCAGGGGA	0.483																																					p.A889S		.											.	CNKSR2	625	0			c.G2665T						.						30.0	22.0	24.0					X																	21627708		2198	4286	6484	SO:0001583	missense	22866	exon20			GGGGAGGCAGCAG	AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2665G>T	X.37:g.21627708G>T	ENSP00000368824:p.Ala889Ser	22.0	0.0		29.0	21.0	NM_014927	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	G	9.358	1.067308	0.20067	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.18338	2.52;2.22;2.22;2.52	5.38	5.38	0.77491	.	0.466636	0.22677	N	0.056985	T	0.07728	0.0194	N	0.03608	-0.345	0.32442	N	0.546594	B;B;B;B	0.10296	0.001;0.003;0.003;0.001	B;B;B;B	0.06405	0.001;0.001;0.002;0.001	T	0.14924	-1.0455	10	0.12103	T	0.63	-24.7324	13.3527	0.60611	0.0:0.0:0.8425:0.1575	.	859;840;481;889	B7ZLJ1;B4DGR4;B3KPN2;Q8WXI2	.;.;.;CNKR2_HUMAN	S	859;840;889;889	ENSP00000397906:A859S;ENSP00000444633:A840S;ENSP00000279451:A889S;ENSP00000368824:A889S	ENSP00000279451:A889S	A	+	1	0	CNKSR2	21537629	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.914000	0.63348	2.365000	0.80145	0.513000	0.50165	GCA	.		0.483	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
CPNE7	27132	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	89661808	89661808	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr16:89661808G>T	ENST00000268720.5	+	16	1691	c.1561G>T	c.(1561-1563)Gtg>Ttg	p.V521L	CPNE7_ENST00000319518.8_Missense_Mutation_p.V446L|CPNE7_ENST00000566398.1_3'UTR	NM_014427.4	NP_055242.1	Q9UBL6	CPNE7_HUMAN	copine VII	521	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				lipid metabolic process (GO:0006629)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)	17		all_hematologic(23;0.0748)		all cancers(4;3.63e-08)|OV - Ovarian serous cystadenocarcinoma(4;1.7e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0147)		GACGGACGGCGTGGTGACCGA	0.627																																					p.V521L		.											.	CPNE7	90	0			c.G1561T						.						75.0	53.0	60.0					16																	89661808		2197	4296	6493	SO:0001583	missense	27132	exon16			GACGGCGTGGTGA	AJ133798	CCDS10980.1, CCDS10981.1	16q24.3	2008-07-03			ENSG00000178773	ENSG00000178773			2320	protein-coding gene	gene with protein product		605689					Standard	NM_014427		Approved		uc002fnq.3	Q9UBL6	OTTHUMG00000138051	ENST00000268720.5:c.1561G>T	16.37:g.89661808G>T	ENSP00000268720:p.Val521Leu	132.0	1.0		114.0	63.0	NM_014427		Missense_Mutation	SNP	ENST00000268720.5	37	CCDS10980.1	.	.	.	.	.	.	.	.	.	.	G	16.25	3.070593	0.55539	.	.	ENSG00000178773	ENST00000319518;ENST00000268720;ENST00000529800	T;T;T	0.23147	1.92;1.92;1.92	3.56	2.58	0.30949	von Willebrand factor, type A (2);Copine (1);	0.065499	0.64402	N	0.000011	T	0.53286	0.1787	M	0.90705	3.14	0.41571	D	0.988683	D;D	0.69078	0.997;0.962	D;P	0.63957	0.92;0.839	T	0.63625	-0.6595	10	0.72032	D	0.01	-2.9532	12.5672	0.56316	0.0:0.1696:0.8304:0.0	.	446;521	Q9UBL6-2;Q9UBL6	.;CPNE7_HUMAN	L	446;521;166	ENSP00000317374:V446L;ENSP00000268720:V521L;ENSP00000435876:V166L	ENSP00000268720:V521L	V	+	1	0	CPNE7	88189309	1.000000	0.71417	0.966000	0.40874	0.954000	0.61252	7.335000	0.79234	0.590000	0.29694	0.555000	0.69702	GTG	.		0.627	CPNE7-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269929.2		
CR1	1378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207760833	207760833	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr1:207760833C>T	ENST00000367049.4	+	34	5633	c.5633C>T	c.(5632-5634)cCt>cTt	p.P1878L	CR1_ENST00000400960.2_Missense_Mutation_p.P1428L|CR1_ENST00000367053.1_Missense_Mutation_p.P1428L|CR1_ENST00000367051.1_Missense_Mutation_p.P1428L|RP11-78B10.2_ENST00000597497.1_RNA|RP11-78B10.2_ENST00000596003.1_RNA|CR1_ENST00000367052.1_Missense_Mutation_p.P1428L	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1428	Sushi 29. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GAATGCCGTCCTGGGTATTTT	0.453																																					p.P1878L		.											.	CR1	93	0			c.C5633T						.						143.0	131.0	135.0					1																	207760833		1835	4087	5922	SO:0001583	missense	1378	exon34			GCCGTCCTGGGTA	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.5633C>T	1.37:g.207760833C>T	ENSP00000356016:p.Pro1878Leu	647.0	1.0		534.0	241.0	NM_000651	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	C	12.03	1.817015	0.32145	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049	T;T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19;-0.19	3.11	2.19	0.27852	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.80428	0.4621	M	0.93720	3.45	0.37949	D	0.932606	P;D;D	0.89917	0.594;1.0;1.0	B;D;D	0.91635	0.094;0.998;0.999	T	0.80879	-0.1185	9	0.62326	D	0.03	.	6.2079	0.20613	0.0:0.8601:0.0:0.1399	.	1428;1428;1878	Q5SR44;P17927;E9PDY4	.;CR1_HUMAN;.	L	1428;1428;1428;1428;978;1878	ENSP00000356019:P1428L;ENSP00000356018:P1428L;ENSP00000356020:P1428L;ENSP00000383744:P1428L;ENSP00000436139:P978L;ENSP00000356016:P1878L	ENSP00000356016:P1878L	P	+	2	0	CR1	205827456	0.984000	0.35163	0.876000	0.34364	0.186000	0.23388	0.968000	0.29357	0.852000	0.35287	0.655000	0.94253	CCT	.		0.453	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
CSPP1	79848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	68105731	68105731	+	Silent	SNP	T	T	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:68105731T>G	ENST00000262210.5	+	28	3379	c.3348T>G	c.(3346-3348)ggT>ggG	p.G1116G	CSPP1_ENST00000521168.1_Intron|ARFGEF1_ENST00000520381.1_Intron|CSPP1_ENST00000412460.1_Silent_p.G771G	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	1151					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			CACCAGATGGTCTCTCTCTAA	0.358																																					p.G1116G		.											.	CSPP1	138	0			c.T3348G						.						141.0	135.0	137.0					8																	68105731		1877	4102	5979	SO:0001819	synonymous_variant	79848	exon28			AGATGGTCTCTCT	AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.3348T>G	8.37:g.68105731T>G		221.0	0.0		213.0	98.0	NM_024790	A6ND63|Q70F00|Q8TBC1	Silent	SNP	ENST00000262210.5	37	CCDS43744.1																																																																																			.		0.358	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	113519006	113519006	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:113519006G>T	ENST00000297405.5	-	29	5053	c.4809C>A	c.(4807-4809)aaC>aaA	p.N1603K	CSMD3_ENST00000343508.3_Missense_Mutation_p.N1563K|CSMD3_ENST00000352409.3_Missense_Mutation_p.N1603K|CSMD3_ENST00000455883.2_Missense_Mutation_p.N1499K	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1603	CUB 9. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GATGAGGGAAGTTTGGTGAAA	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.N1603K		.											.	CSMD3	1132	0			c.C4809A						.						121.0	114.0	116.0					8																	113519006		2203	4300	6503	SO:0001583	missense	114788	exon29			AGGGAAGTTTGGT	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4809C>A	8.37:g.113519006G>T	ENSP00000297405:p.Asn1603Lys	290.0	0.0		280.0	112.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	17.55	3.416390	0.62511	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82	4.99	1.17	0.20885	CUB (5);	0.000000	0.85682	D	0.000000	T	0.51415	0.1673	M	0.90309	3.105	0.29106	N	0.881177	D;D;P	0.67145	0.995;0.996;0.938	D;D;P	0.69307	0.938;0.963;0.794	T	0.51888	-0.8648	10	0.44086	T	0.13	.	10.2855	0.43564	0.2528:0.0:0.7472:0.0	.	1499;1603;1563	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	K	1563;1603;943;1499;1603	ENSP00000345799:N1563K;ENSP00000297405:N1603K;ENSP00000341558:N943K;ENSP00000412263:N1499K;ENSP00000343124:N1603K	ENSP00000297405:N1603K	N	-	3	2	CSMD3	113588182	1.000000	0.71417	0.998000	0.56505	0.925000	0.55904	2.365000	0.44196	0.031000	0.15407	0.557000	0.71058	AAC	.		0.373	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CYP26B1	56603	ucsc.edu;bcgsc.ca;mdanderson.org	37	2	72371121	72371121	+	Silent	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:72371121G>A	ENST00000001146.2	-	2	629	c.426C>T	c.(424-426)cgC>cgT	p.R142R	CYP26B1_ENST00000412253.1_5'Flank|CYP26B1_ENST00000546307.1_Intron	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	142					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						ttctTACCTTGCGCTTGTTGC	0.622																																					p.R142R		.											.	CYP26B1	92	0			c.C426T						.						48.0	49.0	49.0					2																	72371121		2203	4300	6503	SO:0001819	synonymous_variant	56603	exon2			TACCTTGCGCTTG		CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.426C>T	2.37:g.72371121G>A		257.0	2.0		185.0	76.0	NM_019885	B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Silent	SNP	ENST00000001146.2	37	CCDS1919.1																																																																																			.		0.622	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1	NM_019885	
DEFA4	1669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	6793612	6793612	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:6793612G>C	ENST00000297435.2	-	3	348	c.224C>G	c.(223-225)aCa>aGa	p.T75R		NM_001925.1	NP_001916.1	P12838	DEF4_HUMAN	defensin, alpha 4, corticostatin	75					antibacterial humoral response (GO:0019731)|defense response to fungus (GO:0050832)|innate immune response (GO:0045087)|killing of cells of other organism (GO:0031640)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)	10				COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)		ACGAAGTTCTGTTCGCCGGCA	0.507																																					p.T75R		.											.	DEFA4	153	0			c.C224G						.						120.0	103.0	109.0					8																	6793612		2203	4300	6503	SO:0001583	missense	1669	exon3			AGTTCTGTTCGCC	X65977	CCDS5961.1	8p23.1	2007-02-20			ENSG00000164821	ENSG00000164821		"""Defensins, alpha"""	2763	protein-coding gene	gene with protein product		601157		DEF4		8469233	Standard	NM_001925		Approved	HP-4	uc003wqu.1	P12838	OTTHUMG00000090382	ENST00000297435.2:c.224C>G	8.37:g.6793612G>C	ENSP00000297435:p.Thr75Arg	67.0	0.0		102.0	45.0	NM_001925	Q6EZF8	Missense_Mutation	SNP	ENST00000297435.2	37	CCDS5961.1	.	.	.	.	.	.	.	.	.	.	.	0.273	-0.991689	0.02162	.	.	ENSG00000164821	ENST00000297435	T	0.36699	1.24	1.54	-3.08	0.05347	Beta defensin/Neutrophil defensin (1);Mammalian defensins (2);	.	.	.	.	T	0.22975	0.0555	.	.	.	0.09310	N	1	P	0.48589	0.912	P	0.46850	0.529	T	0.07102	-1.0790	8	0.19590	T	0.45	.	0.5216	0.00613	0.1813:0.3034:0.202:0.3134	.	75	P12838	DEF4_HUMAN	R	75	ENSP00000297435:T75R	ENSP00000297435:T75R	T	-	2	0	DEFA4	6781022	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.742000	0.04850	-1.929000	0.01057	-0.502000	0.04539	ACA	.		0.507	DEFA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206754.1	NM_001925	
DLG3	1741	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	69669639	69669639	+	Silent	SNP	A	A	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chrX:69669639A>G	ENST00000374360.3	+	4	866	c.633A>G	c.(631-633)cgA>cgG	p.R211R	RNU4-81P_ENST00000363561.1_RNA|DLG3_ENST00000374355.3_5'Flank|DLG3_ENST00000194900.4_Silent_p.R229R	NM_021120.3	NP_066943.2	Q92796	DLG3_HUMAN	discs, large homolog 3 (Drosophila)	211	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axon guidance (GO:0007411)|establishment of planar polarity (GO:0001736)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphatase activity (GO:0010923)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)|tight junction (GO:0005923)	phosphatase binding (GO:0019902)			endometrium(4)|kidney(1)|large_intestine(10)|lung(5)|pancreas(1)|urinary_tract(1)	22	Renal(35;0.156)					CTGTGGTGCGATTGGTGGTGC	0.647													A|||	1	0.000264901	0.0	0.0014	3775	,	,		9939	0.0		0.0	False		,,,				2504	0.0				p.R211R		.											.	DLG3	219	0			c.A633G						.						62.0	45.0	51.0					X																	69669639		2203	4295	6498	SO:0001819	synonymous_variant	1741	exon4			GGTGCGATTGGTG	U49089	CCDS14403.1, CCDS43967.1, CCDS55439.1	Xq13.1	2014-06-12	2008-12-15		ENSG00000082458	ENSG00000082458			2902	protein-coding gene	gene with protein product	"""neuroendocrine-dlg"", ""protein phosphatase 1, regulatory subunit 82"""	300189	"""discs, large homolog 3 (neuroendocrine-dlg, Drosophila)"""			9598320	Standard	NM_021120		Approved	NE-Dlg, SAP102, SAP-102, NEDLG, KIAA1232, MRX90, PPP1R82	uc004dyi.2	Q92796	OTTHUMG00000021778	ENST00000374360.3:c.633A>G	X.37:g.69669639A>G		111.0	1.0		101.0	49.0	NM_021120	B4E0H1|D3DVU5|Q5JUW6|Q5JUW7|Q9ULI8	Silent	SNP	ENST00000374360.3	37	CCDS14403.1																																																																																			.		0.647	DLG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057074.2	NM_021120	
DOT1L	84444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	2217053	2217053	+	Silent	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:2217053G>A	ENST00000398665.3	+	21	2544	c.2508G>A	c.(2506-2508)ggG>ggA	p.G836G	AC004490.1_ENST00000585593.1_RNA	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	836					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTCCCCTGGGGCCTTGCAGC	0.682																																					p.G836G		.											.	DOT1L	132	0			c.G2508A						.						25.0	28.0	27.0					19																	2217053		1978	4154	6132	SO:0001819	synonymous_variant	84444	exon21			CCCTGGGGCCTTG	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.2508G>A	19.37:g.2217053G>A		39.0	0.0		43.0	17.0	NM_032482	O60379|Q96JL1	Silent	SNP	ENST00000398665.3	37	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	G	0.674	-0.800634	0.02841	.	.	ENSG00000104885	ENST00000440640	T	0.39406	1.08	5.32	1.81	0.25067	.	0.933118	0.09169	N	0.839146	T	0.17916	0.0430	.	.	.	0.18873	N	0.999981	.	.	.	.	.	.	T	0.23833	-1.0177	7	0.07030	T	0.85	-5.3005	6.27	0.20949	0.1634:0.0:0.6881:0.1486	.	.	.	.	E	623	ENSP00000388276:G623E	ENSP00000388276:G623E	G	+	2	0	DOT1L	2168053	0.001000	0.12720	0.004000	0.12327	0.098000	0.18820	-0.027000	0.12371	0.604000	0.29930	-0.258000	0.10820	GGG	.		0.682	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
DOT1L	84444	broad.mit.edu;mdanderson.org	37	19	2226716	2226716	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:2226716C>G	ENST00000398665.3	+	27	4232	c.4196C>G	c.(4195-4197)cCc>cGc	p.P1399R		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	1399					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGTGCGGGCCCACGGACAAG	0.701																																					p.P1399R		.											.	DOT1L	132	0			c.C4196G						.						9.0	14.0	13.0					19																	2226716		2009	4125	6134	SO:0001583	missense	84444	exon27			GCGGGCCCACGGA	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.4196C>G	19.37:g.2226716C>G	ENSP00000381657:p.Pro1399Arg	11.0	0.0		15.0	6.0	NM_032482	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.813732	0.32053	.	.	ENSG00000104885	ENST00000398665;ENST00000221482;ENST00000457590	T;T	0.35421	1.71;1.31	4.53	4.53	0.55603	.	0.136568	0.33591	N	0.004758	T	0.44746	0.1308	M	0.62723	1.935	0.09310	N	1	B;P	0.44429	0.062;0.835	B;P	0.48400	0.022;0.576	T	0.43245	-0.9403	10	0.87932	D	0	-17.4533	12.1964	0.54300	0.0:0.8279:0.1721:0.0	.	1399;1399	Q8TEK3;Q8TEK3-2	DOT1L_HUMAN;.	R	1399;1399;279	ENSP00000381657:P1399R;ENSP00000407411:P279R	ENSP00000221482:P1399R	P	+	2	0	DOT1L	2177716	0.130000	0.22417	0.005000	0.12908	0.013000	0.08279	4.372000	0.59530	2.075000	0.62263	0.561000	0.74099	CCC	.		0.701	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
DSCAM	1826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	41505791	41505791	+	Silent	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr21:41505791G>T	ENST00000400454.1	-	19	4029	c.3552C>A	c.(3550-3552)acC>acA	p.T1184T		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1184	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CATCCTCTTTGGTCCGGGTGA	0.602																																					p.T1184T	Melanoma(134;970 1778 1785 21664 32388)	.											.	DSCAM	101	0			c.C3552A						.						78.0	83.0	81.0					21																	41505791		2055	4220	6275	SO:0001819	synonymous_variant	1826	exon19			CTCTTTGGTCCGG	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.3552C>A	21.37:g.41505791G>T		159.0	0.0		146.0	59.0	NM_001271534	O60468	Silent	SNP	ENST00000400454.1	37	CCDS42929.1																																																																																			.		0.602	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
DUS4L	11062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	107216972	107216972	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr7:107216972T>C	ENST00000265720.3	+	7	1003	c.641T>C	c.(640-642)aTt>aCt	p.I214T	DUS4L_ENST00000402620.1_Missense_Mutation_p.I93T	NM_001270419.1|NM_181581.2	NP_001257348.1|NP_853559.1	O95620	DUS4L_HUMAN	dihydrouridine synthase 4-like (S. cerevisiae)	214							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8						ATACCTGTAATTGCTAATGGA	0.378																																					p.I214T		.											.	DUS4L	90	0			c.T641C						.						61.0	63.0	62.0					7																	107216972		2203	4300	6503	SO:0001583	missense	11062	exon7			CTGTAATTGCTAA	U62767	CCDS5745.1	7q22-q31	2007-12-04			ENSG00000105865	ENSG00000105865			21517	protein-coding gene	gene with protein product	"""protein similar to E.coli yhdg and R. capsulatus nifR3"""						Standard	NM_181581		Approved	PP35, DUS4	uc031syv.1	O95620	OTTHUMG00000154763	ENST00000265720.3:c.641T>C	7.37:g.107216972T>C	ENSP00000265720:p.Ile214Thr	246.0	0.0		179.0	81.0	NM_001270419	B4DLX0|Q2NKK1	Missense_Mutation	SNP	ENST00000265720.3	37	CCDS5745.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.496590	0.85069	.	.	ENSG00000105865	ENST00000265720;ENST00000402620	T;T	0.29917	1.55;1.55	6.01	6.01	0.97437	Aldolase-type TIM barrel (1);	0.291974	0.39759	N	0.001266	T	0.54532	0.1864	M	0.86268	2.805	0.53005	D	0.999962	P;P	0.36909	0.573;0.573	P;P	0.49012	0.598;0.598	T	0.59059	-0.7525	10	0.87932	D	0	.	16.5285	0.84344	0.0:0.0:0.0:1.0	.	214;214	A4D0R5;O95620	.;DUS4L_HUMAN	T	214;93	ENSP00000265720:I214T;ENSP00000385274:I93T	ENSP00000265720:I214T	I	+	2	0	DUS4L	107004208	1.000000	0.71417	0.986000	0.45419	0.992000	0.81027	7.606000	0.82863	2.307000	0.77673	0.528000	0.53228	ATT	.		0.378	DUS4L-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336967.2	NM_181581	
DUSP6	1848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	89744457	89744457	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:89744457T>C	ENST00000279488.7	-	2	1977	c.746A>G	c.(745-747)aAc>aGc	p.N249S	DUSP6_ENST00000547291.1_Missense_Mutation_p.N124S|DUSP6_ENST00000308385.6_Intron|DUSP6_ENST00000547140.1_5'UTR	NM_001946.2	NP_001937.2	Q16828	DUS6_HUMAN	dual specificity phosphatase 6	249	Tyrosine-protein phosphatase.				cell differentiation (GO:0030154)|dorsal/ventral pattern formation (GO:0009953)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|regulation of endodermal cell fate specification (GO:0042663)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of heart growth (GO:0060420)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			large_intestine(5)|lung(8)|skin(2)|urinary_tract(1)	16						CTCTCCTGCGTTCTCAAAGAG	0.478																																					p.N249S	Colon(132;3456 5224)	.											.	DUSP6	846	0			c.A746G						.						155.0	165.0	161.0					12																	89744457		2203	4300	6503	SO:0001583	missense	1848	exon2			CCTGCGTTCTCAA	BC037236	CCDS9033.1, CCDS9034.1	12q22-q23	2011-06-09				ENSG00000139318		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3072	protein-coding gene	gene with protein product		602748				8626780, 9205128	Standard	NM_001946		Approved	MKP-3, PYST1	uc001tay.3	Q16828		ENST00000279488.7:c.746A>G	12.37:g.89744457T>C	ENSP00000279488:p.Asn249Ser	206.0	0.0		165.0	72.0	NM_001946	O75109|Q53Y75|Q9BSH6	Missense_Mutation	SNP	ENST00000279488.7	37	CCDS9033.1	.	.	.	.	.	.	.	.	.	.	T	13.14	2.148449	0.37923	.	.	ENSG00000139318	ENST00000279488;ENST00000547291	T;T	0.59638	0.25;0.25	5.64	5.64	0.86602	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.39600	0.1084	N	0.15975	0.35	0.80722	D	1	B	0.09022	0.002	B	0.11329	0.006	T	0.30297	-0.9983	10	0.09338	T	0.73	.	15.8683	0.79084	0.0:0.0:0.0:1.0	.	249	Q16828	DUS6_HUMAN	S	249;124	ENSP00000279488:N249S;ENSP00000449838:N124S	ENSP00000279488:N249S	N	-	2	0	DUSP6	88268588	1.000000	0.71417	0.996000	0.52242	0.923000	0.55619	7.970000	0.88000	2.148000	0.66965	0.533000	0.62120	AAC	.		0.478	DUSP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406534.2	NM_001946, NM_022652	
DYNC1H1	1778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	102478246	102478246	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr14:102478246A>T	ENST00000360184.4	+	33	6817	c.6653A>T	c.(6652-6654)cAt>cTt	p.H2218L		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2218	AAA 2. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CAGATCAATCATGGCCTGATG	0.602																																					p.H2218L		.											.	DYNC1H1	98	0			c.A6653T						.						92.0	77.0	82.0					14																	102478246		2203	4300	6503	SO:0001583	missense	1778	exon33			TCAATCATGGCCT	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.6653A>T	14.37:g.102478246A>T	ENSP00000348965:p.His2218Leu	131.0	0.0		118.0	61.0	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	A	34	5.332562	0.95733	.	.	ENSG00000197102	ENST00000360184	T	0.39406	1.08	5.8	5.8	0.92144	ATPase, AAA+ type, core (1);	0.044125	0.85682	D	0.000000	T	0.77525	0.4143	H	0.97635	4.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85982	0.1483	10	0.87932	D	0	.	16.1547	0.81649	1.0:0.0:0.0:0.0	.	2218	Q14204	DYHC1_HUMAN	L	2218	ENSP00000348965:H2218L	ENSP00000348965:H2218L	H	+	2	0	DYNC1H1	101547999	1.000000	0.71417	0.937000	0.37676	0.957000	0.61999	9.281000	0.95811	2.221000	0.72209	0.528000	0.53228	CAT	.		0.602	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
EBF2	64641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	25715971	25715971	+	Silent	SNP	G	G	A	rs151033193	byFrequency	TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:25715971G>A	ENST00000520164.1	-	14	1929	c.1392C>T	c.(1390-1392)agC>agT	p.S464S	EBF2_ENST00000535548.1_Silent_p.S195S|EBF2_ENST00000408929.3_Silent_p.S316S	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	464	Pro/Ser/Thr-rich.				adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		GAGGCGTGGAGCTGGAAGAGT	0.517													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17145	0.0		0.0	False		,,,				2504	0.0				p.S464S	Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	.											.	EBF2	26	0			c.C1392T						.	G		1,4105		0,1,2052	168.0	170.0	169.0		1392	4.5	1.0	8	dbSNP_134	169	0,8408		0,0,4204	no	coding-synonymous	EBF2	NM_022659.2		0,1,6256	AA,AG,GG		0.0,0.0244,0.0080		464/576	25715971	1,12513	2053	4204	6257	SO:0001819	synonymous_variant	64641	exon14			CGTGGAGCTGGAA	AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.1392C>T	8.37:g.25715971G>A		467.0	0.0		400.0	185.0	NM_022659	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Silent	SNP	ENST00000520164.1	37	CCDS43726.1																																																																																			G|0.999;A|0.001		0.517	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375886.2	NM_022659	
EFCAB5	374786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	28295950	28295950	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr17:28295950A>G	ENST00000394835.3	+	4	524	c.332A>G	c.(331-333)gAg>gGg	p.E111G	EFCAB5_ENST00000378738.3_Missense_Mutation_p.E111G|EFCAB5_ENST00000394832.2_Missense_Mutation_p.E111G|EFCAB5_ENST00000534836.2_Intron|EFCAB5_ENST00000536908.2_Missense_Mutation_p.E55G|EFCAB5_ENST00000541045.1_Intron|EFCAB5_ENST00000320856.5_Missense_Mutation_p.E111G	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	111							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						TCAAAGCCAGAGCACACATGG	0.353																																					p.E111G		.											.	EFCAB5	70	0			c.A332G						.						28.0	26.0	26.0					17																	28295950		1831	4093	5924	SO:0001583	missense	374786	exon4			AGCCAGAGCACAC	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.332A>G	17.37:g.28295950A>G	ENSP00000378312:p.Glu111Gly	242.0	1.0		213.0	113.0	NM_198529	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Missense_Mutation	SNP	ENST00000394835.3	37	CCDS11254.2	.	.	.	.	.	.	.	.	.	.	A	11.99	1.804495	0.31869	.	.	ENSG00000176927	ENST00000448319;ENST00000536908;ENST00000421238;ENST00000394835;ENST00000320856;ENST00000394832;ENST00000378738;ENST00000423598	T;T;T;T;T	0.27402	1.72;2.71;2.7;2.0;1.67	5.43	3.05	0.35203	.	.	.	.	.	T	0.22666	0.0547	L	0.40543	1.245	0.09310	N	1	P;P	0.42908	0.793;0.617	B;B	0.36666	0.23;0.173	T	0.11518	-1.0584	9	0.72032	D	0.01	-5.1217	7.5505	0.27793	0.5174:0.3584:0.0:0.1242	.	55;111	F5GYL2;A4FU69	.;EFCB5_HUMAN	G	55;55;55;111;111;111;111;55	ENSP00000440619:E55G;ENSP00000378312:E111G;ENSP00000322003:E111G;ENSP00000378309:E111G;ENSP00000368012:E111G	ENSP00000322003:E111G	E	+	2	0	EFCAB5	25320076	0.020000	0.18652	0.020000	0.16555	0.129000	0.20672	2.523000	0.45580	0.978000	0.38470	-0.313000	0.08912	GAG	.		0.353	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529	
EHBP1	23301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	63092103	63092103	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:63092103A>T	ENST00000263991.5	+	10	1582	c.1100A>T	c.(1099-1101)gAt>gTt	p.D367V	EHBP1_ENST00000405289.1_Missense_Mutation_p.D332V|EHBP1_ENST00000405015.3_Missense_Mutation_p.D332V|EHBP1_ENST00000431489.1_Missense_Mutation_p.D332V|EHBP1_ENST00000354487.3_Missense_Mutation_p.D332V	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	367						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			GAAGAATTGGATGAGTAAGTA	0.343																																					p.D367V		.											.	EHBP1	154	0			c.A1100T						.						66.0	65.0	65.0					2																	63092103		2203	4298	6501	SO:0001583	missense	23301	exon10			AATTGGATGAGTA	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.1100A>T	2.37:g.63092103A>T	ENSP00000263991:p.Asp367Val	138.0	0.0		86.0	36.0	NM_015252	O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	ENST00000263991.5	37	CCDS1872.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.549318	0.86127	.	.	ENSG00000115504	ENST00000405015;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289	T;T;T;T;T	0.78003	-1.14;-1.14;-1.06;-1.11;-1.11	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.86343	0.5910	M	0.61703	1.905	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.87873	0.2672	10	0.87932	D	0	.	15.4926	0.75619	1.0:0.0:0.0:0.0	.	332;332;367	Q8NDI1-2;Q8NDI1-3;Q8NDI1	.;.;EHBP1_HUMAN	V	332;332;367;332;332	ENSP00000384143:D332V;ENSP00000403783:D332V;ENSP00000263991:D367V;ENSP00000346482:D332V;ENSP00000385524:D332V	ENSP00000263991:D367V	D	+	2	0	EHBP1	62945607	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.254000	0.89844	2.114000	0.64651	0.455000	0.32223	GAT	.		0.343	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251616.1	NM_015252	
ELAVL1	1994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	8028565	8028565	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:8028565C>A	ENST00000407627.2	-	6	912	c.783G>T	c.(781-783)tgG>tgT	p.W261C	ELAVL1_ENST00000351593.5_Missense_Mutation_p.W288C|ELAVL1_ENST00000596459.1_Missense_Mutation_p.W261C|ELAVL1_ENST00000593807.1_3'UTR	NM_001419.2	NP_001410.2	Q15717	ELAV1_HUMAN	ELAV like RNA binding protein 1	261	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA stabilization (GO:0048255)|multicellular organismal development (GO:0007275)|positive regulation of translation (GO:0045727)|regulation of stem cell maintenance (GO:2000036)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|double-stranded RNA binding (GO:0003725)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						CAAACATCTGCCAGAGGATCC	0.557																																					p.W261C		.											.	ELAVL1	90	0			c.G783T						.						112.0	96.0	101.0					19																	8028565		2203	4300	6503	SO:0001583	missense	1994	exon6			CATCTGCCAGAGG	U38175	CCDS12193.1	19p13.2	2013-10-03	2013-10-03			ENSG00000066044		"""RNA binding motif (RRM) containing"""	3312	protein-coding gene	gene with protein product	"""embryonic lethal, abnormal vision, drosophila, homolog-like 1"", ""Hu antigen R"""	603466	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)"""	HUR		8626503, 9003489	Standard	NM_001419		Approved	HuR, Hua, MelG	uc002mjb.3	Q15717		ENST00000407627.2:c.783G>T	19.37:g.8028565C>A	ENSP00000385269:p.Trp261Cys	247.0	0.0		194.0	105.0	NM_001419	B4DVB8|Q53XN6|Q9BTT1	Missense_Mutation	SNP	ENST00000407627.2	37	CCDS12193.1	.	.	.	.	.	.	.	.	.	.	C	17.95	3.513873	0.64522	.	.	ENSG00000066044	ENST00000407627;ENST00000351593	T;T	0.15952	2.38;2.38	5.66	5.66	0.87406	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.28532	0.0706	N	0.17345	0.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.08827	-1.0703	10	0.87932	D	0	.	17.2498	0.87039	0.0:1.0:0.0:0.0	.	261	Q15717	ELAV1_HUMAN	C	261;288	ENSP00000385269:W261C;ENSP00000264073:W288C	ENSP00000264073:W288C	W	-	3	0	ELAVL1	7934565	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.665000	0.90641	0.655000	0.94253	TGG	.		0.557	ELAVL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461494.3	NM_001419	
ELTD1	64123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	79412048	79412048	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr1:79412048T>C	ENST00000370742.3	-	3	299	c.236A>G	c.(235-237)gAa>gGa	p.E79G		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	79	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		ATAACTTCCTTCTGTGTTAGT	0.353																																					p.E79G		.											.	ELTD1	24	0			c.A236G						.						88.0	83.0	84.0					1																	79412048		1887	4120	6007	SO:0001583	missense	64123	exon3			CTTCCTTCTGTGT	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.236A>G	1.37:g.79412048T>C	ENSP00000359778:p.Glu79Gly	443.0	0.0		401.0	197.0	NM_022159	B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	37	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	T	13.51	2.258033	0.39896	.	.	ENSG00000162618	ENST00000370742	D	0.92348	-3.02	5.03	0.966	0.19667	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.662208	0.15084	N	0.281499	T	0.81945	0.4930	L	0.52364	1.645	0.27218	N	0.959743	B	0.33883	0.43	B	0.37198	0.243	T	0.71925	-0.4445	9	.	.	.	.	11.0916	0.48119	0.5071:0.0:0.0:0.4929	.	79	Q9HBW9	ELTD1_HUMAN	G	79	ENSP00000359778:E79G	.	E	-	2	0	ELTD1	79184636	0.958000	0.32768	0.934000	0.37439	0.969000	0.65631	0.475000	0.22164	0.211000	0.20683	0.528000	0.53228	GAA	.		0.353	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
EPC2	26122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	149519486	149519486	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:149519486G>T	ENST00000258484.6	+	5	836	c.802G>T	c.(802-804)Gtt>Ttt	p.V268F		NM_015630.3	NP_056445.3	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2 (Drosophila)	268					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0516)		AACCTTAGAAGTTGTGGAGAA	0.353																																					p.V268F		.											.	EPC2	137	0			c.G802T						.						78.0	73.0	74.0					2																	149519486		1836	4075	5911	SO:0001583	missense	26122	exon5			TTAGAAGTTGTGG	AF286904	CCDS46422.1	2q23	2008-02-05			ENSG00000135999	ENSG00000135999			24543	protein-coding gene	gene with protein product		611000					Standard	NM_015630		Approved	DKFZP566F2124	uc010zbt.2	Q52LR7	OTTHUMG00000153739	ENST00000258484.6:c.802G>T	2.37:g.149519486G>T	ENSP00000258484:p.Val268Phe	538.0	0.0		347.0	143.0	NM_015630	B3KWT7|D3DP89|Q7L9J1|Q96RR7|Q9NUT8|Q9NVR1|Q9UFM9	Missense_Mutation	SNP	ENST00000258484.6	37	CCDS46422.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.958703	0.74016	.	.	ENSG00000135999	ENST00000258484	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.81983	0.4938	M	0.81802	2.56	0.80722	D	1	D	0.62365	0.991	P	0.60949	0.881	D	0.84109	0.0400	9	0.87932	D	0	-3.4451	19.5983	0.95549	0.0:0.0:1.0:0.0	.	268	Q52LR7	EPC2_HUMAN	F	268	.	ENSP00000258484:V268F	V	+	1	0	EPC2	149235956	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.401000	0.66326	2.640000	0.89533	0.585000	0.79938	GTT	.		0.353	EPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332278.1	NM_015630	
EPHA4	2043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	222347238	222347238	+	Silent	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:222347238G>T	ENST00000281821.2	-	5	1193	c.1152C>A	c.(1150-1152)gtC>gtA	p.V384V	EPHA4_ENST00000409938.1_Silent_p.V384V|EPHA4_ENST00000392071.4_Silent_p.V333V|EPHA4_ENST00000409854.1_Silent_p.V384V	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	384	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GGGTGTAGTGGACCCCACTTC	0.512																																					p.V384V		.											.	EPHA4	1441	0			c.C1152A						.						240.0	247.0	245.0					2																	222347238		2203	4300	6503	SO:0001819	synonymous_variant	2043	exon5			GTAGTGGACCCCA	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.1152C>A	2.37:g.222347238G>T		363.0	0.0		293.0	133.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Silent	SNP	ENST00000281821.2	37	CCDS2447.1	.	.	.	.	.	.	.	.	.	.	G	8.141	0.785290	0.16189	.	.	ENSG00000116106	ENST00000441679	.	.	.	6.06	3.1	0.35709	.	.	.	.	.	T	0.47116	0.1428	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35968	-0.9767	4	.	.	.	.	3.8226	0.08842	0.0722:0.2114:0.3317:0.3847	.	.	.	.	Y	121	.	.	S	-	2	0	EPHA4	222055482	0.995000	0.38212	1.000000	0.80357	0.822000	0.46500	0.301000	0.19174	0.860000	0.35481	0.655000	0.94253	TCC	.		0.512	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
EPHA6	285220	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	96706423	96706423	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr3:96706423T>G	ENST00000389672.5	+	3	738	c.700T>G	c.(700-702)Ttc>Gtc	p.F234V	EPHA6_ENST00000542517.1_Missense_Mutation_p.F140V|EPHA6_ENST00000470610.2_Missense_Mutation_p.F234V	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	140						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						CGGAATTAAATTCAAGCCAAA	0.408																																					p.F234V		.											.	EPHA6	1561	0			c.T700G						.						155.0	158.0	157.0					3																	96706423		1872	4125	5997	SO:0001583	missense	285220	exon3			ATTAAATTCAAGC	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.700T>G	3.37:g.96706423T>G	ENSP00000374323:p.Phe234Val	190.0	0.0		153.0	80.0	NM_001080448	D6RAL5	Missense_Mutation	SNP	ENST00000389672.5	37	CCDS46876.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.06|16.06	3.016963|3.016963	0.54576|0.54576	.|.	.|.	ENSG00000080224|ENSG00000080224	ENST00000470610;ENST00000389672;ENST00000542517|ENST00000506569	T;T;T|.	0.03386|.	3.95;3.95;3.95|.	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	0.719649|.	0.12467|.	U|.	0.466381|.	T|T	0.75989|0.75989	0.3925|0.3925	M|M	0.77820|0.77820	2.39|2.39	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.999|.	T|T	0.76969|0.76969	-0.2762|-0.2762	10|5	0.40728|.	T|.	0.16|.	.|.	15.2298|15.2298	0.73378|0.73378	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	234;234|.	B3KS12;E7EU71|.	.;.|.	V|S	234;234;140|178	ENSP00000420598:F234V;ENSP00000374323:F234V;ENSP00000439758:F140V|.	ENSP00000374323:F234V|.	F|I	+|+	1|2	0|0	EPHA6|EPHA6	98189113|98189113	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	8.040000|8.040000	0.89188|0.89188	2.183000|2.183000	0.69458|0.69458	0.533000|0.533000	0.62120|0.62120	TTC|ATT	.		0.408	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448	
FAH	2184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	80465405	80465405	+	Silent	SNP	G	G	A	rs202041382		TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr15:80465405G>A	ENST00000407106.1	+	10	911	c.756G>A	c.(754-756)ggG>ggA	p.G252G	FAH_ENST00000261755.5_Silent_p.G252G|FAH_ENST00000558627.1_3'UTR|FAH_ENST00000561421.1_Silent_p.G252G|FAH_ENST00000539156.1_Silent_p.G182G			P16930	FAAA_HUMAN	fumarylacetoacetate hydrolase (fumarylacetoacetase)	252					arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	fumarylacetoacetase activity (GO:0004334)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CATTCCTTGGGAAGAGTTTTG	0.557									Tyrosinemia, type 1		OREG0023354	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0	0.0	5008	,	,		22743	0.0		0.001	False		,,,				2504	0.0				p.G252G		.											.	FAH	90	0			c.G756A						.	G		0,4406		0,0,2203	186.0	158.0	167.0		756	2.6	1.0	15		167	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FAH	NM_000137.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		252/420	80465405	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2184	exon9	Familial Cancer Database	Fumarylacetoacetase Deficiency, Hepatorenal Tyrosinemia, Hereditary Tyrosinemia 1, HT1	CCTTGGGAAGAGT	M55150	CCDS10314.1	15q25.1	2012-08-30			ENSG00000103876	ENSG00000103876	3.7.1.2		3579	protein-coding gene	gene with protein product		613871				1998338, 2336361	Standard	NM_000137		Approved		uc002bfm.2	P16930	OTTHUMG00000144187	ENST00000407106.1:c.756G>A	15.37:g.80465405G>A		271.0	0.0	1198	217.0	103.0	NM_000137	B2R9X1|D3DW95|Q53XA7	Silent	SNP	ENST00000407106.1	37	CCDS10314.1																																																																																			G|0.999;A|0.000		0.557	FAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291392.2		
FAM102B	284611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	109148855	109148855	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr1:109148855G>C	ENST00000370035.3	+	3	609	c.269G>C	c.(268-270)gGt>gCt	p.G90A	FAM102B_ENST00000405454.1_Missense_Mutation_p.G90A	NM_001010883.2	NP_001010883.2	Q5T8I3	F102B_HUMAN	family with sequence similarity 102, member B	90										autonomic_ganglia(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	5		all_epithelial(167;5.52e-05)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0217)|Lung(183;0.109)|COAD - Colon adenocarcinoma(174;0.141)|Epithelial(280;0.182)		GAATTAAAAGGTGGAAAAGCT	0.264																																					p.G90A		.											.	FAM102B	135	0			c.G269C						.						93.0	95.0	94.0					1																	109148855		2203	4298	6501	SO:0001583	missense	284611	exon3			TAAAAGGTGGAAA	CR749397	CCDS30786.2	1p13.3	2012-11-05			ENSG00000162636	ENSG00000162636			27637	protein-coding gene	gene with protein product	"""sym-3 homolog B (C. elegans)"""						Standard	NM_001010883		Approved	DKFZp779B126, SYM-3B	uc010ouy.2	Q5T8I3	OTTHUMG00000010967	ENST00000370035.3:c.269G>C	1.37:g.109148855G>C	ENSP00000359052:p.Gly90Ala	361.0	0.0		283.0	121.0	NM_001010883	A1L1A1|B0QZ46|B0QZ47|Q68DH7	Missense_Mutation	SNP	ENST00000370035.3	37	CCDS30786.2	.	.	.	.	.	.	.	.	.	.	G	27.5	4.836359	0.91117	.	.	ENSG00000162636	ENST00000370035;ENST00000405454;ENST00000437902	T;T	0.41758	0.99;0.99	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.69663	0.3136	M	0.91140	3.18	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73930	-0.3827	10	0.54805	T	0.06	-20.0134	19.8512	0.96741	0.0:0.0:1.0:0.0	.	90	Q5T8I3	F102B_HUMAN	A	90	ENSP00000359052:G90A;ENSP00000386084:G90A	ENSP00000359052:G90A	G	+	2	0	FAM102B	108950378	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.061000	0.93913	2.797000	0.96272	0.563000	0.77884	GGT	.		0.264	FAM102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030188.3	NM_001010883	
FBN1	2200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48796007	48796007	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr15:48796007T>G	ENST00000316623.5	-	17	2545	c.2090A>C	c.(2089-2091)cAg>cCg	p.Q697P		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	697	TB 3.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		AGGACACGGCTGGCAAGGTTC	0.493																																					p.Q697P		.											.	FBN1	92	0			c.A2090C						.						151.0	128.0	136.0					15																	48796007		2197	4296	6493	SO:0001583	missense	2200	exon17			CACGGCTGGCAAG	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.2090A>C	15.37:g.48796007T>G	ENSP00000325527:p.Gln697Pro	259.0	0.0		223.0	96.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.539958	0.85917	.	.	ENSG00000166147	ENST00000316623	D	0.93307	-3.2	6.06	6.06	0.98353	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.85682	D	0.000000	D	0.95806	0.8635	M	0.79805	2.47	0.80722	D	1	D	0.61697	0.99	P	0.56343	0.796	D	0.95878	0.8896	10	0.59425	D	0.04	.	15.4333	0.75121	0.0:0.0:0.0:1.0	.	697	P35555	FBN1_HUMAN	P	697	ENSP00000325527:Q697P	ENSP00000325527:Q697P	Q	-	2	0	FBN1	46583299	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.139000	0.71728	2.324000	0.78689	0.533000	0.62120	CAG	.		0.493	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
FBXO47	494188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	37093476	37093476	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr17:37093476G>T	ENST00000378079.2	-	11	1510	c.1311C>A	c.(1309-1311)ttC>ttA	p.F437L		NM_001008777.2	NP_001008777.2	Q5MNV8	FBX47_HUMAN	F-box protein 47	437										NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	20						CCTCCTTATGGAAGTTAGCCT	0.413																																					p.F437L		.											.	FBXO47	90	0			c.C1311A						.						131.0	113.0	119.0					17																	37093476		2203	4300	6503	SO:0001583	missense	494188	exon11			CTTATGGAAGTTA		CCDS32639.1	17q12	2014-08-12			ENSG00000204952	ENSG00000204952		"""F-boxes /  ""other"""""	31969	protein-coding gene	gene with protein product		609498				15723337	Standard	NM_001008777		Approved		uc002hrc.2	Q5MNV8	OTTHUMG00000178945	ENST00000378079.2:c.1311C>A	17.37:g.37093476G>T	ENSP00000367319:p.Phe437Leu	183.0	0.0		278.0	165.0	NM_001008777	B2RTZ4	Missense_Mutation	SNP	ENST00000378079.2	37	CCDS32639.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.015781	0.75161	.	.	ENSG00000204952	ENST00000378079	T	0.59224	0.28	5.88	2.85	0.33270	.	0.096875	0.64402	D	0.000001	T	0.61009	0.2313	L	0.29908	0.895	0.41365	D	0.987454	D	0.69078	0.997	D	0.70716	0.97	T	0.62982	-0.6738	10	0.87932	D	0	-2.3123	9.711	0.40245	0.225:0.0:0.775:0.0	.	437	Q5MNV8	FBX47_HUMAN	L	437	ENSP00000367319:F437L	ENSP00000367319:F437L	F	-	3	2	FBXO47	34347002	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	1.909000	0.39917	0.832000	0.34804	0.650000	0.86243	TTC	.		0.413	FBXO47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444073.1	NM_001008777	
FDX1L	112812	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	10426560	10426560	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:10426560G>A	ENST00000393708.3	-	1	131	c.113C>T	c.(112-114)gCg>gTg	p.A38V	CTD-2369P2.10_ENST00000452032.2_Missense_Mutation_p.A38V|FDX1L_ENST00000541276.1_Missense_Mutation_p.A41V|FDX1L_ENST00000494368.1_Intron|FDX1L_ENST00000492239.1_5'Flank|CTD-2369P2.12_ENST00000586529.1_Intron	NM_001031734.2	NP_001026904.1	Q6P4F2	ADXL_HUMAN	ferredoxin 1-like	38					oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			NS(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)			TGTCCCCAGCGCCACCCCCTC	0.706																																					p.A38V		.											.	FDX1L	23	0			c.C113T						.						18.0	22.0	21.0					19																	10426560		2193	4292	6485	SO:0001583	missense	112812	exon1			CCCAGCGCCACCC	AK097022	CCDS32905.1	19p13.2	2012-10-09			ENSG00000267673	ENSG00000267673			30546	protein-coding gene	gene with protein product		614585				12477932	Standard	NM_001031734		Approved	MGC19604	uc002mny.1	Q6P4F2	OTTHUMG00000141299	ENST00000393708.3:c.113C>T	19.37:g.10426560G>A	ENSP00000377311:p.Ala38Val	79.0	0.0		71.0	28.0	NM_001031734	Q8N8B8	Missense_Mutation	SNP	ENST00000393708.3	37	CCDS32905.1	.	.	.	.	.	.	.	.	.	.	G	13.61	2.289113	0.40494	.	.	ENSG00000167807	ENST00000541276;ENST00000393708	.	.	.	4.59	2.46	0.29980	.	0.900133	0.09629	N	0.776469	T	0.28366	0.0701	N	0.24115	0.695	0.19300	N	0.999972	B	0.06786	0.001	B	0.01281	0.0	T	0.25257	-1.0137	9	0.66056	D	0.02	-16.7108	6.2373	0.20770	0.2326:0.0:0.7674:0.0	.	38	Q6P4F2	ADXL_HUMAN	V	41;38	.	ENSP00000341665:A38V	A	-	2	0	FDX1L	10287560	0.000000	0.05858	0.004000	0.12327	0.003000	0.03518	0.136000	0.15974	0.547000	0.28938	0.455000	0.32223	GCG	.		0.706	FDX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280567.2		
FREM1	158326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	14816837	14816837	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr9:14816837T>C	ENST00000380880.3	-	15	3362	c.2579A>G	c.(2578-2580)gAt>gGt	p.D860G	FREM1_ENST00000380881.4_Missense_Mutation_p.D861G|FREM1_ENST00000422223.2_Missense_Mutation_p.D860G			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	860					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		gagtaggtcatcctgaagaac	0.418																																					p.D860G		.											.	FREM1	138	0			c.A2579G						.						66.0	69.0	69.0					9																	14816837		1871	4095	5966	SO:0001583	missense	158326	exon16			AGGTCATCCTGAA	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.2579A>G	9.37:g.14816837T>C	ENSP00000370262:p.Asp860Gly	63.0	0.0		69.0	20.0	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.051220	0.75960	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.51817	0.69;0.69;0.69	5.65	5.65	0.86999	.	0.085714	0.85682	D	0.000000	T	0.74794	0.3763	M	0.93550	3.43	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	T	0.79640	-0.1719	10	0.48119	T	0.1	-20.9429	12.1892	0.54261	0.0:0.0:0.0:1.0	.	860	Q5H8C1	FREM1_HUMAN	G	861;860;860	ENSP00000370263:D861G;ENSP00000412940:D860G;ENSP00000370262:D860G	ENSP00000370257:D863G	D	-	2	0	FREM1	14806837	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	5.150000	0.64869	2.371000	0.80710	0.533000	0.62120	GAT	.		0.418	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
GABRG1	2565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	46060339	46060339	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr4:46060339C>A	ENST00000295452.4	-	7	978	c.811G>T	c.(811-813)Gga>Tga	p.G271*		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	271					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTGAAATATCCCATTCTTCTG	0.333																																					p.G271X		.											.	GABRG1	92	0			c.G811T						.						107.0	109.0	108.0					4																	46060339		2203	4300	6503	SO:0001587	stop_gained	2565	exon7			AATATCCCATTCT	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.811G>T	4.37:g.46060339C>A	ENSP00000295452:p.Gly271*	645.0	1.0		445.0	192.0	NM_173536	Q5H9T8	Nonsense_Mutation	SNP	ENST00000295452.4	37	CCDS3470.1	.	.	.	.	.	.	.	.	.	.	C	38	7.231907	0.98150	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.1446	0.93459	0.0:1.0:0.0:0.0	.	.	.	.	X	271	.	ENSP00000295452:G271X	G	-	1	0	GABRG1	45755096	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.705000	0.84606	2.771000	0.95319	0.644000	0.83932	GGA	.		0.333	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536	
GADL1	339896	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	30827849	30827849	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr3:30827849C>A	ENST00000282538.5	-	13	1450	c.1300G>T	c.(1300-1302)Gaa>Taa	p.E434*		NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	434					carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						TCACTTACTTCCATCAGTAAC	0.299																																					p.E434X		.											.	GADL1	90	0			c.G1300T						.						167.0	152.0	157.0					3																	30827849		2196	4300	6496	SO:0001587	stop_gained	339896	exon13			TTACTTCCATCAG	AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.1300G>T	3.37:g.30827849C>A	ENSP00000282538:p.Glu434*	313.0	0.0		292.0	127.0	NM_207359		Nonsense_Mutation	SNP	ENST00000282538.5	37	CCDS2649.2	.	.	.	.	.	.	.	.	.	.	C	39	7.560775	0.98358	.	.	ENSG00000144644	ENST00000282538	.	.	.	5.96	5.96	0.96718	.	0.053589	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-4.7869	18.1922	0.89810	0.0:1.0:0.0:0.0	.	.	.	.	X	434	.	ENSP00000282538:E434X	E	-	1	0	GADL1	30802853	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.187000	0.65087	2.831000	0.97527	0.650000	0.86243	GAA	.		0.299	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253106.2	NM_207359	
GLB1	2720	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	33099714	33099714	+	Silent	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr3:33099714C>T	ENST00000399402.3	-	6	641	c.510G>A	c.(508-510)ctG>ctA	p.L170L	GLB1_ENST00000307363.5_Silent_p.L200L|GLB1_ENST00000307377.8_Intron|GLB1_ENST00000445488.2_Silent_p.L248L	NM_001079811.1	NP_001073279	P16278	BGAL_HUMAN	galactosidase, beta 1	200					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				GCAGGAAGCGCAGGTAGTCAA	0.478																																					p.L200L		.											.	GLB1	135	0			c.G600A						.						33.0	36.0	35.0					3																	33099714		1859	4104	5963	SO:0001819	synonymous_variant	2720	exon6			GAAGCGCAGGTAG	M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000399402.3:c.510G>A	3.37:g.33099714C>T		323.0	2.0		246.0	91.0	NM_000404	B2R7H8|B7Z6B0|P16279	Silent	SNP	ENST00000399402.3	37	CCDS43062.1																																																																																			.		0.478	GLB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000341570.2	NM_000404	
GNB2L1	10399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	180666567	180666567	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr5:180666567C>G	ENST00000512805.1	-	4	853	c.445G>C	c.(445-447)Gag>Cag	p.E149Q	GNB2L1_ENST00000505461.1_5'Flank|SNORD96A_ENST00000606577.1_RNA|GNB2L1_ENST00000511566.1_Missense_Mutation_p.E149Q|GNB2L1_ENST00000504726.1_Intron|GNB2L1_ENST00000376817.4_Missense_Mutation_p.E105Q|GNB2L1_ENST00000511900.1_Missense_Mutation_p.E101Q|GNB2L1_ENST00000514455.1_5'Flank	NM_006098.4	NP_006089.1	P63244	GBLP_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1	149					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cell cycle (GO:0007049)|gastrulation (GO:0007369)|negative regulation of cell growth (GO:0030308)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron death (GO:1903208)|negative regulation of phagocytosis (GO:0050765)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of translation (GO:0017148)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of cell migration (GO:0030335)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of gastrulation (GO:2000543)|positive regulation of GTPase activity (GO:0043547)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein phosphorylation (GO:0001934)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein localization (GO:0032880)|rhythmic process (GO:0048511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|phagocytic cup (GO:0001891)|small ribosomal subunit (GO:0015935)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|ion channel inhibitor activity (GO:0008200)|poly(A) RNA binding (GO:0044822)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase inhibitor activity (GO:0030292)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)			lung(3)|skin(2)	5	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.101)|all cancers(165;0.11)		GACACCCACTCTGAGTGGCTC	0.537																																					p.E149Q		.											.	GNB2L1	227	0			c.G445C						.						104.0	103.0	103.0					5																	180666567		2203	4300	6503	SO:0001583	missense	10399	exon4			CCCACTCTGAGTG	M24194	CCDS34324.1	5q35.3	2013-01-10				ENSG00000204628		"""WD repeat domain containing"""	4399	protein-coding gene	gene with protein product	"""Receptor for Activated C Kinase 1"""	176981				8302854, 2499885	Standard	NM_006098		Approved	Gnb2-rs1, RACK1, H12.3	uc003mni.1	P63244		ENST00000512805.1:c.445G>C	5.37:g.180666567C>G	ENSP00000426909:p.Glu149Gln	106.0	0.0		94.0	43.0	NM_006098	B3KTJ0|D3DWS0|P25388|P99049|Q53HU2|Q5J8M6|Q5VLR4|Q6FH47	Missense_Mutation	SNP	ENST00000512805.1	37	CCDS34324.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	34|34|34	5.358137|5.358137|5.358137	0.95854|0.95854|0.95854	.|.|.	.|.|.	ENSG00000204628|ENSG00000204628|ENSG00000204628	ENST00000511566;ENST00000376817;ENST00000512805;ENST00000511900;ENST00000512968;ENST00000510199;ENST00000502844;ENST00000507000;ENST00000503081;ENST00000513027|ENST00000507756;ENST00000509535|ENST00000502905;ENST00000504128	T;T;T;T;T;T;T;T;T;T|.|.	0.81163|.|.	0.22;-1.46;0.22;-1.46;-1.46;0.22;0.22;0.22;0.22;-1.45|.|.	5.9|5.9|5.9	5.9|5.9|5.9	0.94986|0.94986|0.94986	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.54886|0.54886|0.54886	0.1886|0.1886|0.1886	N|N|N	0.21097|0.21097|0.21097	0.63|0.63|0.63	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;B;P;P;P|.|.	0.53745|.|.	0.962;0.324;0.6;0.936;0.6|.|.	P;B;P;P;P|.|.	0.59643|.|.	0.861;0.421;0.647;0.799;0.647|.|.	T|T|T	0.47573|0.47573|0.47573	-0.9107|-0.9107|-0.9107	10|5|5	0.66056|.|.	D|.|.	0.02|.|.	-32.7101|-32.7101|-32.7101	17.7642|17.7642|17.7642	0.88473|0.88473|0.88473	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	120;197;149;101;149|.|.	B4DVD2;D6R9L0;E9KL35;D6RAC2;P63244|.|.	.;.;.;.;GBLP_HUMAN|.|.	Q|H|T	149;105;149;101;167;197;135;108;125;189|79;6|66;55	ENSP00000426101:E149Q;ENSP00000366013:E105Q;ENSP00000426909:E149Q;ENSP00000422768:E101Q;ENSP00000425008:E167Q;ENSP00000423569:E197Q;ENSP00000422029:E135Q;ENSP00000421416:E108Q;ENSP00000424237:E125Q;ENSP00000421356:E189Q|.|.	ENSP00000366013:E105Q|.|.	E|Q|R	-|-|-	1|3|2	0|2|0	GNB2L1|GNB2L1|GNB2L1	180599173|180599173|180599173	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.973000|0.973000|0.973000	0.42090|0.42090|0.42090	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	5.977000|5.977000|5.977000	0.70492|0.70492|0.70492	2.793000|2.793000|2.793000	0.96121|0.96121|0.96121	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GAG|CAG|AGA	.		0.537	GNB2L1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372943.2	NM_006098	
GPR141	353345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	37780403	37780403	+	Silent	SNP	T	T	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr7:37780403T>C	ENST00000447769.1	+	4	697	c.408T>C	c.(406-408)agT>agC	p.S136S	GPR141_ENST00000334425.1_Silent_p.S136S|GPR141_ENST00000461610.1_Intron|EPDR1_ENST00000476620.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TGGCTGCCAGTGCTGGCATGT	0.463																																					p.S136S		.											.	GPR141	93	0			c.T408C						.						151.0	147.0	149.0					7																	37780403		2203	4300	6503	SO:0001819	synonymous_variant	353345	exon1			TGCCAGTGCTGGC	AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.408T>C	7.37:g.37780403T>C		314.0	1.0		258.0	108.0	NM_181791	A4D1X7|Q0VAR5|Q86SP3	Silent	SNP	ENST00000447769.1	37	CCDS5451.1																																																																																			.		0.463	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219943.2	NM_181791	
GSDMD	79792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	144644198	144644198	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:144644198C>G	ENST00000526406.1	+	11	1776	c.893C>G	c.(892-894)tCc>tGc	p.S298C	GSDMD_ENST00000262580.4_Missense_Mutation_p.S298C|GSDMD_ENST00000533063.1_Missense_Mutation_p.S346C	NM_001166237.1	NP_001159709.1	P57764	GSDMD_HUMAN	gasdermin D	298					cellular response to extracellular stimulus (GO:0031668)					breast(1)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	12						GAGACCATCTCCAAGGAACTG	0.652																																					p.S298C		.											.	GSDMD	90	0			c.C893G						.						55.0	57.0	56.0					8																	144644198		2202	4300	6502	SO:0001583	missense	79792	exon11			CCATCTCCAAGGA	AK096216	CCDS34956.1	8q24.3	2008-07-31	2008-07-31	2008-07-31		ENSG00000104518			25697	protein-coding gene	gene with protein product			"""gasdermin domain containing 1"""	GSDMDC1		15289881, 17350798	Standard	NM_024736		Approved	FLJ12150, DF5L	uc003yyg.3	P57764		ENST00000526406.1:c.893C>G	8.37:g.144644198C>G	ENSP00000433209:p.Ser298Cys	26.0	0.0		35.0	17.0	NM_001166237	D3DWJ9|Q96Q98	Missense_Mutation	SNP	ENST00000526406.1	37	CCDS34956.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.122698	0.37436	.	.	ENSG00000104518	ENST00000526406;ENST00000533063;ENST00000262580	T;T;T	0.22539	1.95;1.95;1.95	4.39	0.448	0.16614	.	1.726280	0.02499	N	0.090281	T	0.38081	0.1027	L	0.60455	1.87	0.09310	N	1	D;D;D	0.76494	0.999;0.999;0.998	P;P;P	0.62740	0.905;0.905;0.906	T	0.09207	-1.0685	10	0.46703	T	0.11	-7.8434	5.0637	0.14570	0.0:0.4856:0.3268:0.1876	.	298;298;346	A8K702;P57764;G3V1A6	.;GSDMD_HUMAN;.	C	298;346;298	ENSP00000433209:S298C;ENSP00000433958:S346C;ENSP00000262580:S298C	ENSP00000262580:S298C	S	+	2	0	GSDMD	144715341	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.152000	0.16302	0.066000	0.16515	0.549000	0.68633	TCC	.		0.652	GSDMD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382046.3	NM_024736	
GUCY2C	2984	broad.mit.edu;bcgsc.ca	37	12	14767834	14767834	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:14767834T>C	ENST00000261170.3	-	26	3150	c.3014A>G	c.(3013-3015)gAc>gGc	p.D1005G	RP11-695J4.2_ENST00000545424.1_RNA|RP11-695J4.2_ENST00000542401.1_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	1005					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	GAATTTCTGGTCCTTCATCCC	0.483																																					p.D1005G		.											.	GUCY2C	338	0			c.A3014G						.						140.0	92.0	108.0					12																	14767834		2203	4300	6503	SO:0001583	missense	2984	exon26			TTCTGGTCCTTCA		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.3014A>G	12.37:g.14767834T>C	ENSP00000261170:p.Asp1005Gly	202.0	0.0		210.0	9.0	NM_004963	B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	37	CCDS8664.1	.	.	.	.	.	.	.	.	.	.	T	8.764	0.924295	0.18056	.	.	ENSG00000070019	ENST00000261170	D	0.81499	-1.5	6.08	3.74	0.42951	Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.254749	0.45606	N	0.000344	T	0.65144	0.2663	N	0.16478	0.41	0.44619	D	0.997593	B	0.02656	0.0	B	0.04013	0.001	T	0.54529	-0.8280	10	0.29301	T	0.29	.	10.4999	0.44800	0.0:0.1304:0.0:0.8696	.	1005	P25092	GUC2C_HUMAN	G	1005	ENSP00000261170:D1005G	ENSP00000261170:D1005G	D	-	2	0	GUCY2C	14659101	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.514000	0.53422	0.543000	0.28864	0.533000	0.62120	GAC	.		0.483	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
HID1	283987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	72949120	72949120	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr17:72949120C>T	ENST00000425042.2	-	16	2110	c.2033G>A	c.(2032-2034)tGg>tAg	p.W678*		NM_030630.2	NP_085133.1	Q8IV36	HID1_HUMAN	HID1 domain containing	678					intracellular protein transport (GO:0006886)|response to brefeldin A (GO:0031001)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)											CGTTGGGCTCCACTGCCCACT	0.692																																					p.W678X		.											.	.	.	0			c.G2033A						.						26.0	22.0	23.0					17																	72949120		2202	4296	6498	SO:0001587	stop_gained	283987	exon16			GGGCTCCACTGCC		CCDS32726.1	17q25.1	2012-10-10	2012-10-10	2012-10-10	ENSG00000167861	ENSG00000167861			15736	protein-coding gene	gene with protein product	"""downregulated in multiple cancer 1"""	605752	"""chromosome 17 open reading frame 28"""	C17orf28		11281419, 21337012	Standard	NM_030630		Approved	DMC1, HID-1	uc002jmj.4	Q8IV36	OTTHUMG00000166490	ENST00000425042.2:c.2033G>A	17.37:g.72949120C>T	ENSP00000413520:p.Trp678*	124.0	0.0		256.0	83.0	NM_030630	Q8N5L6|Q8TE83|Q9NT34	Nonsense_Mutation	SNP	ENST00000425042.2	37	CCDS32726.1	.	.	.	.	.	.	.	.	.	.	C	36	5.968936	0.97156	.	.	ENSG00000167861	ENST00000525426;ENST00000425042;ENST00000318565	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.9882	18.4895	0.90842	0.0:1.0:0.0:0.0	.	.	.	.	X	450;678;450	.	ENSP00000317795:W450X	W	-	2	0	C17orf28	70460715	1.000000	0.71417	1.000000	0.80357	0.092000	0.18411	6.156000	0.71840	2.372000	0.80975	0.561000	0.74099	TGG	.		0.692	HID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390011.2	NM_030630	
HK1	3098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	71136836	71136836	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr10:71136836C>T	ENST00000359426.6	+	8	1126	c.1022C>T	c.(1021-1023)gCc>gTc	p.A341V	HK1_ENST00000494253.1_3'UTR|HK1_ENST00000448642.2_Missense_Mutation_p.A376V|HK1_ENST00000404387.2_Missense_Mutation_p.A345V|HK1_ENST00000360289.2_Missense_Mutation_p.A329V|HK1_ENST00000298649.3_Missense_Mutation_p.A340V	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	341	Hexokinase type-2 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						GATGTGTCAGCCATCGAAAAG	0.527																																					p.A345V		.											.	HK1	252	0			c.C1034T						.						108.0	102.0	104.0					10																	71136836		2203	4300	6503	SO:0001583	missense	3098	exon11			TGTCAGCCATCGA	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.1022C>T	10.37:g.71136836C>T	ENSP00000352398:p.Ala341Val	127.0	0.0		95.0	36.0	NM_033498	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	ENST00000359426.6	37	CCDS7292.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497760	0.85069	.	.	ENSG00000156515	ENST00000360289;ENST00000448642;ENST00000404387;ENST00000298649;ENST00000359426;ENST00000405407	D;D;D;D;D	0.96427	-4.01;-4.01;-4.01;-4.01;-4.01	4.87	4.87	0.63330	Hexokinase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96071	0.8720	M	0.64997	1.995	0.80722	D	1	P;P;P;P;P;B	0.46912	0.885;0.886;0.505;0.704;0.458;0.268	P;B;B;B;B;B	0.46659	0.523;0.328;0.226;0.26;0.121;0.026	D	0.96480	0.9355	10	0.59425	D	0.04	-12.4398	18.0069	0.89212	0.0:1.0:0.0:0.0	.	341;341;340;376;345;329	A8K7J7;P19367;P19367-2;E7ENR4;P19367-3;P19367-4	.;HXK1_HUMAN;.;.;.;.	V	329;376;345;340;341;341	ENSP00000353433:A329V;ENSP00000402103:A376V;ENSP00000384774:A345V;ENSP00000298649:A340V;ENSP00000352398:A341V	ENSP00000298649:A340V	A	+	2	0	HK1	70806842	1.000000	0.71417	0.997000	0.53966	0.924000	0.55760	7.782000	0.85680	2.252000	0.74401	0.585000	0.79938	GCC	.		0.527	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188	
HMGCS1	3157	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	43298941	43298941	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr5:43298941C>A	ENST00000325110.6	-	3	333	c.127G>T	c.(127-129)Gat>Tat	p.D43Y	HMGCS1_ENST00000433297.2_Missense_Mutation_p.D43Y	NM_001098272.2	NP_001091742.1	Q01581	HMCS1_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)	43					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|lipid metabolic process (GO:0006629)|liver development (GO:0001889)|male gonad development (GO:0008584)|response to acid chemical (GO:0001101)|response to drug (GO:0042493)|response to lipoprotein particle (GO:0055094)|response to low light intensity stimulus (GO:0009645)|response to purine-containing compound (GO:0014074)|response to tellurium ion (GO:0046690)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hydroxymethylglutaryl-CoA synthase activity (GO:0004421)|isomerase activity (GO:0016853)|organic acid binding (GO:0043177)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|stomach(1)|urinary_tract(1)	15						TTTCCAGCATCTACACCATCA	0.423																																					p.D43Y		.											.	HMGCS1	90	0			c.G127T						.						120.0	113.0	115.0					5																	43298941		2203	4300	6503	SO:0001583	missense	3157	exon3			CAGCATCTACACC		CCDS34154.1	5p14-p13	2012-10-02	2010-04-30			ENSG00000112972	2.3.3.10		5007	protein-coding gene	gene with protein product	"""3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase"""	142940	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)"""	HMGCS			Standard	NM_001098272		Approved		uc003jnq.5	Q01581		ENST00000325110.6:c.127G>T	5.37:g.43298941C>A	ENSP00000322706:p.Asp43Tyr	152.0	1.0		143.0	73.0	NM_001098272	B2RDL8	Missense_Mutation	SNP	ENST00000325110.6	37	CCDS34154.1	.	.	.	.	.	.	.	.	.	.	C	19.39	3.818091	0.71028	.	.	ENSG00000112972	ENST00000325110;ENST00000433297;ENST00000545275;ENST00000511774	D;D;D	0.89343	-2.5;-2.5;-2.5	6.02	6.02	0.97574	Hydroxymethylglutaryl-coenzyme A synthase, N-terminal (1);Thiolase-like, subgroup (1);Thiolase-like (1);	0.398011	0.30201	N	0.010166	D	0.89870	0.6840	M	0.68593	2.085	0.43179	D	0.994994	P	0.47106	0.89	P	0.46917	0.531	D	0.90706	0.4624	10	0.87932	D	0	-10.9911	13.6966	0.62582	0.0:0.93:0.0:0.07	.	43	Q01581	HMCS1_HUMAN	Y	43	ENSP00000322706:D43Y;ENSP00000399402:D43Y;ENSP00000427339:D43Y	ENSP00000322706:D43Y	D	-	1	0	HMGCS1	43334698	0.502000	0.26107	1.000000	0.80357	0.997000	0.91878	1.282000	0.33226	2.857000	0.98124	0.650000	0.86243	GAT	.		0.423	HMGCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368022.1		
HOXC10	3226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54382961	54382961	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:54382961A>G	ENST00000303460.4	+	2	834	c.760A>G	c.(760-762)Aag>Gag	p.K254E	MIR196A2_ENST00000385189.1_RNA|HOXC10_ENST00000511575.1_3'UTR|RP11-834C11.12_ENST00000513209.1_Intron	NM_017409.3	NP_059105.2	Q9NYD6	HXC10_HUMAN	homeobox C10	254					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|neuromuscular process (GO:0050905)|positive regulation of cell proliferation (GO:0008284)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(3)|lung(14)|pancreas(1)	20						AGAGGAGATAAAGGCAGAAAA	0.468											OREG0021882	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K254E		.											.	HOXC10	91	0			c.A760G						.						55.0	53.0	54.0					12																	54382961		2203	4300	6503	SO:0001583	missense	3226	exon2			GAGATAAAGGCAG		CCDS8868.1	12q13.13	2011-06-20	2005-12-22		ENSG00000180818	ENSG00000180818		"""Homeoboxes / ANTP class : HOXL subclass"""	5122	protein-coding gene	gene with protein product		605560	"""homeo box C10"""	HOX3I		1358459	Standard	NM_017409		Approved		uc001sen.3	Q9NYD6	OTTHUMG00000160031	ENST00000303460.4:c.760A>G	12.37:g.54382961A>G	ENSP00000307321:p.Lys254Glu	174.0	0.0	999	127.0	61.0	NM_017409	O15219|O15220|Q9BVD5	Missense_Mutation	SNP	ENST00000303460.4	37	CCDS8868.1	.	.	.	.	.	.	.	.	.	.	A	14.30	2.494829	0.44352	.	.	ENSG00000180818	ENST00000303460	D	0.92199	-2.99	3.97	3.97	0.46021	Homeodomain-like (1);	0.055946	0.64402	D	0.000002	D	0.91855	0.7422	M	0.81497	2.545	0.80722	D	1	B	0.22276	0.067	B	0.27076	0.076	D	0.91285	0.5054	10	0.87932	D	0	.	12.5235	0.56073	1.0:0.0:0.0:0.0	.	254	Q9NYD6	HXC10_HUMAN	E	254	ENSP00000307321:K254E	ENSP00000307321:K254E	K	+	1	0	HOXC10	52669228	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.434000	0.59935	1.743000	0.51761	0.374000	0.22700	AAG	.		0.468	HOXC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358952.2		
IGLON5	402665	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	51830117	51830117	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:51830117C>T	ENST00000270642.8	+	5	611	c.611C>T	c.(610-612)gCg>gTg	p.A204V		NM_001101372.1	NP_001094842.1	A6NGN9	IGLO5_HUMAN	IgLON family member 5	204	Ig-like C2-type 2.					extracellular region (GO:0005576)				large_intestine(5)|lung(6)|prostate(1)	12						GTTAACTCGGCGCCCGACAGC	0.667																																					p.A204V		.											.	.	.	0			c.C611T						.						8.0	11.0	10.0					19																	51830117		1846	4067	5913	SO:0001583	missense	402665	exon5			ACTCGGCGCCCGA		CCDS46158.1	19q13.33	2013-01-29			ENSG00000142549	ENSG00000142549		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	34550	protein-coding gene	gene with protein product							Standard	NM_001101372		Approved	LOC402665	uc002pwc.2	A6NGN9	OTTHUMG00000154422	ENST00000270642.8:c.611C>T	19.37:g.51830117C>T	ENSP00000270642:p.Ala204Val	69.0	1.0		79.0	32.0	NM_001101372		Missense_Mutation	SNP	ENST00000270642.8	37	CCDS46158.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.980865	0.53827	.	.	ENSG00000142549	ENST00000270642	T	0.36520	1.25	4.36	4.36	0.52297	Immunoglobulin I-set (1);Immunoglobulin-like (1);	0.241411	0.41938	D	0.000792	T	0.27205	0.0667	L	0.31157	0.91	0.32272	N	0.568751	B	0.24368	0.102	B	0.31245	0.126	T	0.28332	-1.0047	10	0.45353	T	0.12	-23.5762	8.1063	0.30887	0.0:0.8929:0.0:0.1071	.	204	A6NGN9	IGLO5_HUMAN	V	204	ENSP00000270642:A204V	ENSP00000270642:A204V	A	+	2	0	IGLON5	56521929	0.010000	0.17322	0.997000	0.53966	0.956000	0.61745	0.702000	0.25631	2.278000	0.76064	0.563000	0.77884	GCG	.		0.667	IGLON5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335149.1	NM_001101372	
IL36B	27177	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	113788640	113788640	+	Missense_Mutation	SNP	G	G	T	rs34754959	byFrequency	TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:113788640G>T	ENST00000259213.4	-	3	213	c.106C>A	c.(106-108)Cgc>Agc	p.R36S	IL36B_ENST00000327407.2_Missense_Mutation_p.R36S	NM_014438.3	NP_055253.2	Q9NZH7	IL36B_HUMAN	interleukin 36, beta	36			R -> C (in dbSNP:rs34754959). {ECO:0000269|Ref.4}.		immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-1 receptor binding (GO:0005149)			kidney(1)|ovary(1)|pancreas(1)	3						TTAATGCTGCGGCTAAGAGGA	0.512																																					p.R36S		.											.	IL36B	23	0			c.C106A						.						105.0	93.0	97.0					2																	113788640		2203	4300	6503	SO:0001583	missense	27177	exon3			TGCTGCGGCTAAG	AF201833	CCDS2109.1, CCDS2110.1	2q14	2011-07-14	2011-06-06	2011-06-06	ENSG00000136696	ENSG00000136696		"""Interleukins and interleukin receptors"""	15564	protein-coding gene	gene with protein product		605508	"""interleukin 1 family, member 8 (eta)"""	IL1F8		10625660, 10512743, 16646978	Standard	NM_173178		Approved	FIL1, IL-1H2, IL-1F8, FILI-(ETA), IL1-ETA, IL1H2, MGC126880, MGC126882	uc002tiq.1	Q9NZH7	OTTHUMG00000131338	ENST00000259213.4:c.106C>A	2.37:g.113788640G>T	ENSP00000259213:p.Arg36Ser	134.0	0.0		129.0	64.0	NM_173178	Q3MIH0|Q53SR6|Q7RTZ7|Q9UHA5	Missense_Mutation	SNP	ENST00000259213.4	37	CCDS2109.1	.	.	.	.	.	.	.	.	.	.	g	3.130	-0.178604	0.06380	.	.	ENSG00000136696	ENST00000259213;ENST00000327407	T;T	0.16196	2.36;2.36	3.04	0.651	0.17817	.	1.093160	0.07044	N	0.830755	T	0.05914	0.0154	N	0.02916	-0.46	0.09310	N	1	B;B	0.25850	0.001;0.136	B;B	0.23852	0.005;0.049	T	0.40384	-0.9566	10	0.17369	T	0.5	.	2.9288	0.05793	0.0:0.1474:0.2715:0.5811	.	36;36	Q9NZH7-2;Q9NZH7	.;IL36B_HUMAN	S	36	ENSP00000259213:R36S;ENSP00000328420:R36S	ENSP00000259213:R36S	R	-	1	0	IL36B	113505111	0.000000	0.05858	0.002000	0.10522	0.006000	0.05464	-0.027000	0.12371	0.401000	0.25424	-0.459000	0.05422	CGC	G|0.989;A|0.011		0.512	IL36B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254110.1	NM_014438	
IL4I1	259307	hgsc.bcm.edu;broad.mit.edu	37	19	50393089	50393089	+	Silent	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:50393089C>T	ENST00000391826.2	-	8	1684	c.1542G>A	c.(1540-1542)acG>acA	p.T514T	IL4I1_ENST00000595948.1_Silent_p.T536T|IL4I1_ENST00000341114.3_Silent_p.T536T|MIR4750_ENST00000584564.1_RNA	NM_152899.1	NP_690863.1	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1	514						extracellular region (GO:0005576)|lysosome (GO:0005764)	L-amino-acid oxidase activity (GO:0001716)			endometrium(3)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	Flavin adenine dinucleotide(DB03147)	CGGGGCTGGCCGTGTCCGATG	0.687																																					p.T536T		.											.	IL4I1	523	0			c.G1608A						.						46.0	46.0	46.0					19																	50393089		2202	4299	6501	SO:0001819	synonymous_variant	259307	exon10			GCTGGCCGTGTCC	AF293462	CCDS12786.1, CCDS12787.1	19q13.3-q13.4	2014-06-26				ENSG00000104951			19094	protein-coding gene	gene with protein product		609742				12031486	Standard	NM_152899		Approved	FIG1	uc002pqt.1	Q96RQ9		ENST00000391826.2:c.1542G>A	19.37:g.50393089C>T		156.0	0.0		147.0	6.0	NM_172374	Q1WMJ3|Q4GZN1|Q4GZN2|Q6P2Q3|Q8TEM5|Q96RQ8	Silent	SNP	ENST00000391826.2	37	CCDS12787.1																																																																																			.		0.687	IL4I1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466413.1		
INPP5D	3635	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	234112784	234112784	+	Silent	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:234112784G>A	ENST00000359570.5	+	28	2952	c.2952G>A	c.(2950-2952)ctG>ctA	p.L984L	RN7SL32P_ENST00000580514.1_RNA|INPP5D_ENST00000450745.1_Silent_p.L748L|INPP5D_ENST00000455936.2_Silent_p.L748L			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	996	Pro-rich.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)			central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		CCAGTGACCTGGGGAAGAACG	0.587																																					.	NSCLC(82;1215 1426 16163 20348 41018)	.											.	INPP5D	652	0			.						.						16.0	23.0	21.0					2																	234112784		2051	4175	6226	SO:0001819	synonymous_variant	3635	.			TGACCTGGGGAAG	U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.2952G>A	2.37:g.234112784G>A		85.0	0.0		116.0	37.0	.	O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Missense_Mutation	SNP	ENST00000359570.5	37																																																																																				.		0.587	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001017915	
ISL2	64843	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	76632729	76632729	+	Silent	SNP	C	C	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr15:76632729C>G	ENST00000290759.4	+	4	784	c.624C>G	c.(622-624)acC>acG	p.T208T	RP11-685G9.2_ENST00000559539.1_RNA	NM_145805.1	NP_665804.1	Q96A47	ISL2_HUMAN	ISL LIM homeobox 2	208					negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|peripheral nervous system neuron development (GO:0048935)|regulation of transcription, DNA-templated (GO:0006355)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord motor neuron cell fate specification (GO:0021520)|visceral motor neuron differentiation (GO:0021524)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6						CTCTGCGGACCTGCTACGCCG	0.677																																					p.T208T	GBM(97;953 1391 16164 31496 36951)	.											.	ISL2	90	0			c.C624G						.						41.0	44.0	43.0					15																	76632729		2197	4292	6489	SO:0001819	synonymous_variant	64843	exon4			GCGGACCTGCTAC	AK001022	CCDS10290.1	15q24.3	2012-03-09	2007-07-13		ENSG00000159556	ENSG00000159556		"""Homeoboxes / LIM class"""	18524	protein-coding gene	gene with protein product		609481	"""ISL2 transcription factor, LIM/homeodomain, (islet-2)"""				Standard	NM_145805		Approved	FLJ10160	uc002bbw.1	Q96A47	OTTHUMG00000143723	ENST00000290759.4:c.624C>G	15.37:g.76632729C>G		77.0	0.0		125.0	28.0	NM_145805	B3KM37	Silent	SNP	ENST00000290759.4	37	CCDS10290.1																																																																																			.		0.677	ISL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289779.1		
IYD	389434	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	150713484	150713493	+	Frame_Shift_Del	DEL	CAGCCCCGAG	CAGCCCCGAG	-	rs151181823|rs372196319	byFrequency	TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	CAGCCCCGAG	CAGCCCCGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr6:150713484_150713493delCAGCCCCGAG	ENST00000344419.3	+	3	514_523	c.374_383delCAGCCCCGAG	c.(373-384)acagccccgagtfs	p.TAPS125fs	IYD_ENST00000500320.3_Frame_Shift_Del_p.TAPS125fs|IYD_ENST00000229447.5_Frame_Shift_Del_p.TAPS125fs|IYD_ENST00000392256.2_Frame_Shift_Del_p.TAPS125fs|IYD_ENST00000392255.3_Frame_Shift_Del_p.TAPS125fs|IYD_ENST00000425615.3_Frame_Shift_Del_p.TAPS70fs	NM_203395.2	NP_981932.1	Q6PHW0	IYD1_HUMAN	iodotyrosine deiodinase	125					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	iodide peroxidase activity (GO:0004447)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	15		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		GTGACAGGAACAGCCCCGAGTGGGGCTCAC	0.486																																					p.125_128del		.											.	IYD	92	0			c.374_383del						.																																			SO:0001589	frameshift_variant	389434	exon3			CAGGAACAGCCCC	AK129950	CCDS5227.1, CCDS55066.1, CCDS55067.1	6q25.1	2006-08-24	2006-08-24	2006-08-24	ENSG00000009765	ENSG00000009765			21071	protein-coding gene	gene with protein product		612025	"""chromosome 6 open reading frame 71"""	C6orf71		16316988, 15289438	Standard	NM_001164694		Approved	dJ422F24.1, DEHAL1	uc003qnx.2	Q6PHW0	OTTHUMG00000016347	ENST00000344419.3:c.374_383delCAGCCCCGAG	6.37:g.150713484_150713493delCAGCCCCGAG	ENSP00000343763:p.Thr125fs	65.0	0.0		51.0	12.0	NM_001164695	C9JFW2|Q2VPW0|Q2VPW1|Q5F1L5|Q5F1L6|Q5THM4|Q6ZP69|Q7Z7D7|Q7Z7D8	Frame_Shift_Del	DEL	ENST00000344419.3	37	CCDS5227.1																																																																																			.		0.486	IYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043754.3	NM_203395	
IZUMO1	284359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49248991	49248991	+	Silent	SNP	A	A	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:49248991A>G	ENST00000332955.2	-	2	673	c.126T>C	c.(124-126)ccT>ccC	p.P42P		NM_182575.2	NP_872381.2	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1	42					cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(4)|kidney(3)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	17		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		CCAGGTGGCCAGGCAGGTAAT	0.547																																					p.P42P		.											.	IZUMO1	91	0			c.T126C						.						143.0	139.0	140.0					19																	49248991		2203	4300	6503	SO:0001819	synonymous_variant	284359	exon2			GTGGCCAGGCAGG	BC034769	CCDS12732.1	19q13.33	2014-07-23			ENSG00000182264	ENSG00000182264		"""-"""	28539	protein-coding gene	gene with protein product	"""oocyte binding/fusion factor"""	609278				15759005, 18952059, 19658160, 22957301	Standard	NM_182575		Approved	IZUMO, MGC34799, OBF	uc002pkj.3	Q8IYV9	OTTHUMG00000183324	ENST00000332955.2:c.126T>C	19.37:g.49248991A>G		378.0	0.0		356.0	161.0	NM_182575	Q6Q8P6|Q6Q8P7	Silent	SNP	ENST00000332955.2	37	CCDS12732.1																																																																																			.		0.547	IZUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466189.1	NM_182575	
JPH4	84502	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	14	24040535	24040535	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr14:24040535G>A	ENST00000397118.3	-	6	2307	c.1405C>T	c.(1405-1407)Caa>Taa	p.Q469*	JPH4_ENST00000544177.1_Nonsense_Mutation_p.Q134*|JPH4_ENST00000356300.4_Nonsense_Mutation_p.Q469*	NM_032452.2	NP_115828.2	Q96JJ6	JPH4_HUMAN	junctophilin 4	469					calcium ion transport into cytosol (GO:0060402)|learning (GO:0007612)|neuromuscular process controlling balance (GO:0050885)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic plasticity (GO:0048167)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)				endometrium(1)|large_intestine(2)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		CGCCAGGGTTGGCGGGAGGAG	0.687																																					p.Q469X		.											.	JPH4	92	0			c.C1405T						.						34.0	38.0	37.0					14																	24040535		2203	4300	6503	SO:0001587	stop_gained	84502	exon5			AGGGTTGGCGGGA	AB058734	CCDS9603.1	14q11	2004-05-28	2004-05-28	2004-05-28	ENSG00000092051	ENSG00000092051			20156	protein-coding gene	gene with protein product			"""junctophilin like 1"""	JPHL1		11347906	Standard	NM_032452		Approved	KIAA1831	uc001wkr.2	Q96JJ6	OTTHUMG00000028769	ENST00000397118.3:c.1405C>T	14.37:g.24040535G>A	ENSP00000380307:p.Gln469*	51.0	0.0		48.0	21.0	NM_001146028	D3DS53|Q8ND44|Q96DQ0	Nonsense_Mutation	SNP	ENST00000397118.3	37	CCDS9603.1	.	.	.	.	.	.	.	.	.	.	G	40	8.115515	0.98662	.	.	ENSG00000092051	ENST00000356300;ENST00000397118;ENST00000543864;ENST00000267407;ENST00000544177	.	.	.	5.17	4.22	0.49857	.	0.000000	0.29073	U	0.013231	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	10.4703	0.44633	0.0:0.0:0.8061:0.1939	.	.	.	.	X	469;469;469;470;134	.	ENSP00000267407:Q470X	Q	-	1	0	JPH4	23110375	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.703000	0.54808	2.575000	0.86900	0.655000	0.94253	CAA	.		0.687	JPH4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413853.1	NM_032452	
KCNU1	157855	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	36691164	36691173	+	Frame_Shift_Del	DEL	TGAGGCGAGT	TGAGGCGAGT	-	rs369258362		TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	TGAGGCGAGT	TGAGGCGAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:36691164_36691173delTGAGGCGAGT	ENST00000399881.3	+	11	1236_1245	c.1199_1208delTGAGGCGAGT	c.(1198-1209)ctgaggcgagttfs	p.LRRV400fs		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	400	RCK N-terminal.				multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TGGGAGGATCTGAGGCGAGTTGCGGTAAGA	0.371																																					p.400_403del		.											.	KCNU1	23	0			c.1199_1208del						.																																			SO:0001589	frameshift_variant	157855	exon11			AGGATCTGAGGCG	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.1199_1208delTGAGGCGAGT	8.37:g.36691164_36691173delTGAGGCGAGT	ENSP00000382770:p.Leu400fs	692.0	0.0		393.0	116.0	NM_001031836		Frame_Shift_Del	DEL	ENST00000399881.3	37	CCDS55220.1																																																																																			.		0.371	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836	
KIF19	124602	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	72345442	72345442	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr17:72345442delC	ENST00000389916.4	+	10	1305	c.1167delC	c.(1165-1167)ggcfs	p.G389fs		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	389					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						CTGGGCGGGGCCAGGCCCGGG	0.662																																					p.G389fs		.											.	KIF19	90	0			c.1167delC						.						32.0	31.0	31.0					17																	72345442		2202	4300	6502	SO:0001589	frameshift_variant	124602	exon10			GCGGGGCCAGGCC	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.1167delC	17.37:g.72345442delC	ENSP00000374566:p.Gly389fs	129.0	0.0		168.0	96.0	NM_153209	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Frame_Shift_Del	DEL	ENST00000389916.4	37	CCDS32718.2																																																																																			.		0.662	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209	
KIF9	64147	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47307360	47307360	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr3:47307360C>T	ENST00000265529.3	-	9	1456	c.776G>A	c.(775-777)gGc>gAc	p.G259D	KIF9_ENST00000335044.2_Missense_Mutation_p.G259D|KIF9_ENST00000487440.1_5'UTR|KIF9_ENST00000352910.4_Missense_Mutation_p.G166D|KIF9_ENST00000452770.2_Missense_Mutation_p.G259D|KIF9_ENST00000444589.2_Missense_Mutation_p.G259D			Q9HAQ2	KIF9_HUMAN	kinesin family member 9	259	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle disassembly (GO:1903008)|regulation of podosome assembly (GO:0071801)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|podosome (GO:0002102)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein dimerization activity (GO:0046983)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(15)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)	34		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		CAGGACTTGGCCCTCAGACTA	0.502																																					p.G259D	Colon(44;962 1147 15977 24541)	.											.	KIF9	91	0			c.G776A						.						159.0	141.0	147.0					3																	47307360		2203	4300	6503	SO:0001583	missense	64147	exon8			ACTTGGCCCTCAG	AF311212	CCDS2751.1, CCDS2752.1	3p21.31	2008-03-03			ENSG00000088727	ENSG00000088727		"""Kinesins"""	16666	protein-coding gene	gene with protein product		607910				11483511	Standard	NM_022342		Approved	MGC104186	uc003cqx.3	Q9HAQ2	OTTHUMG00000133512	ENST00000265529.3:c.776G>A	3.37:g.47307360C>T	ENSP00000265529:p.Gly259Asp	192.0	1.0		144.0	66.0	NM_182902	Q86Z28|Q9H8A4	Missense_Mutation	SNP	ENST00000265529.3	37	CCDS2752.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.760356	0.89932	.	.	ENSG00000088727	ENST00000335044;ENST00000265529;ENST00000444589;ENST00000452770;ENST00000352910	T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07	5.0	5.0	0.66597	Kinesin, motor domain (4);	0.060422	0.64402	D	0.000005	D	0.86053	0.5841	M	0.78285	2.405	0.51482	D	0.999922	D;D	0.71674	0.988;0.998	P;D	0.69479	0.861;0.964	D	0.87064	0.2155	10	0.87932	D	0	.	10.5916	0.45312	0.0:0.9117:0.0:0.0883	.	259;259	Q9HAQ2-2;Q9HAQ2	.;KIF9_HUMAN	D	259;259;259;259;166	ENSP00000333942:G259D;ENSP00000265529:G259D;ENSP00000414987:G259D;ENSP00000391100:G259D;ENSP00000292334:G166D	ENSP00000265529:G259D	G	-	2	0	KIF9	47282364	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	4.380000	0.59581	2.615000	0.88500	0.650000	0.86243	GGC	.		0.502	KIF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257475.2		
KLK6	5653	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51465087	51465087	+	Silent	SNP	A	A	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:51465087A>T	ENST00000376851.3	-	5	934	c.495T>A	c.(493-495)cgT>cgA	p.R165R	KLK6_ENST00000310157.2_Silent_p.R165R|KLK6_ENST00000391808.1_Silent_p.R58R|CTB-147C22.8_ENST00000601506.1_RNA|KLK6_ENST00000376853.4_Intron|KLK6_ENST00000594641.1_Silent_p.R165R|KLK6_ENST00000456750.2_Silent_p.R58R	NM_001012964.1	NP_001012982.1	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6	165	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amyloid precursor protein metabolic process (GO:0042982)|central nervous system development (GO:0007417)|collagen catabolic process (GO:0030574)|hormone metabolic process (GO:0042445)|myelination (GO:0042552)|neuron death (GO:0070997)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|protein autoprocessing (GO:0016540)|regulation of cell differentiation (GO:0045595)|regulation of neuron projection development (GO:0010975)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|skin(4)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		CACACTCCTCACGGGACACCA	0.582																																					p.R165R		.											.	KLK6	650	0			c.T495A						.						161.0	124.0	136.0					19																	51465087		2203	4300	6503	SO:0001819	synonymous_variant	5653	exon5			CTCCTCACGGGAC	U62801	CCDS12811.1, CCDS42599.1	19q13.3	2011-09-07	2006-10-27			ENSG00000167755		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6367	protein-coding gene	gene with protein product		602652	"""protease, serine, 18"", ""kallikrein 6 (neurosin, zyme)"""	PRSS9, PRSS18		9003450, 16800724, 16800723	Standard	NM_002774		Approved	Bssp, Klk7, neurosin	uc002pui.3	Q92876		ENST00000376851.3:c.495T>A	19.37:g.51465087A>T		121.0	0.0		149.0	65.0	NM_001012964	A6NJA1|A8MW09|Q6H301	Silent	SNP	ENST00000376851.3	37	CCDS12811.1																																																																																			.		0.582	KLK6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465060.1	NM_002774	
KLK8	11202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51503358	51503358	+	Silent	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:51503358C>T	ENST00000600767.1	-	5	876	c.387G>A	c.(385-387)caG>caA	p.Q129Q	KLK8_ENST00000391806.2_Silent_p.Q174Q|KLK8_ENST00000598195.1_5'Flank|KLK8_ENST00000320838.5_Intron|KLK8_ENST00000347619.4_Intron|KLK8_ENST00000593490.1_Intron|CTB-147C22.9_ENST00000594512.1_RNA|KLK8_ENST00000291726.7_Silent_p.Q129Q			O60259	KLK8_HUMAN	kallikrein-related peptidase 8	129	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell death (GO:0008219)|keratinocyte proliferation (GO:0043616)|memory (GO:0007613)|negative regulation of axon regeneration (GO:0048681)|negative regulation of myelination (GO:0031642)|neuron projection morphogenesis (GO:0048812)|regulation of synapse organization (GO:0050807)|response to wounding (GO:0009611)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|prostate(1)	15		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.0033)|GBM - Glioblastoma multiforme(134;0.00888)		CCAGGGATGCCTGGTCACGCA	0.567																																					p.Q174Q		.											.	KLK8	604	0			c.G522A						.						136.0	124.0	128.0					19																	51503358		2203	4300	6503	SO:0001819	synonymous_variant	11202	exon4			GGATGCCTGGTCA	AB008390	CCDS12813.1, CCDS12814.1, CCDS12815.1, CCDS42600.1, CCDS74433.1	19q13	2011-09-07	2006-10-27			ENSG00000129455		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6369	protein-coding gene	gene with protein product		605644	"""kallikrein 8 (neuropsin/ovasin)"""	PRSS19		10102990, 9714609, 16800724, 16800723	Standard	NM_144505		Approved	HNP, TADG14, neuropsin, ovasin	uc002pur.1	O60259		ENST00000600767.1:c.387G>A	19.37:g.51503358C>T		108.0	0.0		97.0	53.0	NM_144505	Q5V9X1|Q5V9X2|Q8IW69|Q9HCB3|Q9NR68|Q9NR69|Q9UIL9|Q9UQ47	Silent	SNP	ENST00000600767.1	37	CCDS12813.1																																																																																			.		0.567	KLK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465032.2	NM_007196	
KRT34	3885	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	17	39534380	39534380	+	Nonsense_Mutation	SNP	G	G	T	rs138365209	byFrequency	TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr17:39534380G>T	ENST00000394001.1	-	7	1272	c.1242C>A	c.(1240-1242)tgC>tgA	p.C414*		NM_021013.3	NP_066293.2	O76011	KRT34_HUMAN	keratin 34	414	Tail.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Breast(137;0.000496)				TGGTGGTGGCGCATGGGTTGC	0.478																																					p.C414X		.											.	KRT34	90	0			c.C1242A						.						108.0	103.0	105.0					17																	39534380		2203	4300	6503	SO:0001587	stop_gained	3885	exon7			GGTGGCGCATGGG	Y16790	CCDS11390.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131737	ENSG00000131737		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6452	protein-coding gene	gene with protein product	"""hard keratin type I 4"""	602763	"""keratin, hair, acidic, 4"""	KRTHA4		2431943, 9756910, 16831889	Standard	NM_021013		Approved	Ha-4	uc002hwm.3	O76011	OTTHUMG00000133436	ENST00000394001.1:c.1242C>A	17.37:g.39534380G>T	ENSP00000377570:p.Cys414*	114.0	0.0		175.0	60.0	NM_021013	Q8IUT8|Q8N4W2	Nonsense_Mutation	SNP	ENST00000394001.1	37	CCDS11390.1	.	.	.	.	.	.	.	.	.	.	-	25.1	4.600806	0.87055	.	.	ENSG00000131737	ENST00000394001;ENST00000251648	.	.	.	5.54	1.95	0.26073	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.48511	D	0.999668	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.6019	0.28081	0.7444:0.0:0.2556:0.0	.	.	.	.	X	372;414	.	ENSP00000251648:C414X	C	-	3	2	KRT34	36787906	0.907000	0.30839	0.993000	0.49108	0.912000	0.54170	-0.267000	0.08619	0.059000	0.16252	-0.331000	0.08364	TGC	G|0.999;A|0.001		0.478	KRT34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257304.3	NM_021013	
KRT75	9119	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	52822123	52822123	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:52822123C>A	ENST00000252245.5	-	7	1519	c.1299G>T	c.(1297-1299)gaG>gaT	p.E433D	RP11-1020M18.10_ENST00000548135.1_RNA	NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	433	Coil 2.|Rod.				hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		GCTCCTGGTACTCACGCAGGA	0.622																																					p.E433D		.											.	KRT75	90	0			c.G1299T						.						60.0	48.0	52.0					12																	52822123		2203	4300	6503	SO:0001583	missense	9119	exon7			CTGGTACTCACGC	Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.1299G>T	12.37:g.52822123C>A	ENSP00000252245:p.Glu433Asp	108.0	0.0		104.0	50.0	NM_004693	B4DQU4|Q9NSA9	Missense_Mutation	SNP	ENST00000252245.5	37	CCDS8827.1	.	.	.	.	.	.	.	.	.	.	C	16.53	3.149869	0.57151	.	.	ENSG00000170454	ENST00000252245	D	0.92805	-3.11	5.63	3.8	0.43715	Filament (1);	0.000000	0.53938	D	0.000042	D	0.89406	0.6706	L	0.38733	1.17	0.39639	D	0.97029	B	0.31705	0.336	P	0.44921	0.464	D	0.86838	0.2015	10	0.46703	T	0.11	.	6.1396	0.20253	0.1305:0.6619:0.0:0.2076	.	433	O95678	K2C75_HUMAN	D	433	ENSP00000252245:E433D	ENSP00000252245:E433D	E	-	3	2	KRT75	51108390	0.934000	0.31675	1.000000	0.80357	0.988000	0.76386	0.132000	0.15891	1.382000	0.46385	0.561000	0.74099	GAG	.		0.622	KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404968.1	NM_004693	
KRT6B	3854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	52841356	52841356	+	Splice_Site	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:52841356G>A	ENST00000252252.3	-	8	1473	c.1426C>T	c.(1426-1428)Ctg>Ttg	p.L476L		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	476	Tail.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		TCGCCATTCAGCCTGTGGAGA	0.557																																					p.L476L		.											.	KRT6B	92	0			c.C1426T						.						126.0	101.0	109.0					12																	52841356		2203	4300	6503	SO:0001630	splice_region_variant	3854	exon8			CATTCAGCCTGTG	BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.1425-1C>T	12.37:g.52841356G>A		219.0	0.0		205.0	90.0	NM_005555	P48669	Silent	SNP	ENST00000252252.3	37	CCDS8828.1																																																																																			.		0.557	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555	Silent
KRTDAP	388533	ucsc.edu;bcgsc.ca	37	19	35979362	35979362	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:35979362T>C	ENST00000338897.3	-	4	282	c.194A>G	c.(193-195)aAc>aGc	p.N65S	KRTDAP_ENST00000479340.1_5'UTR|KRTDAP_ENST00000484218.2_Missense_Mutation_p.N51S	NM_207392.2	NP_997275.1	P60985	KTDAP_HUMAN	keratinocyte differentiation-associated protein	65					cell differentiation (GO:0030154)	extracellular region (GO:0005576)				breast(1)|lung(4)|prostate(1)	6	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GGCGTGCCAGTTCAGGAACTC	0.587																																					p.N65S		.											.	KRTDAP	90	0			c.A194G						.						39.0	34.0	35.0					19																	35979362		2203	4300	6503	SO:0001583	missense	388533	exon4			TGCCAGTTCAGGA	AA297512	CCDS12462.1, CCDS59377.1	19q13.12	2013-06-20			ENSG00000188508	ENSG00000188508			16313	protein-coding gene	gene with protein product						11054531	Standard	NM_207392		Approved	KDAP, UNQ467	uc002nzh.3	P60985	OTTHUMG00000155449	ENST00000338897.3:c.194A>G	19.37:g.35979362T>C	ENSP00000339251:p.Asn65Ser	55.0	0.0		54.0	5.0	NM_207392	A1L4D7	Missense_Mutation	SNP	ENST00000338897.3	37	CCDS12462.1	.	.	.	.	.	.	.	.	.	.	T	15.16	2.751539	0.49257	.	.	ENSG00000188508	ENST00000338897	.	.	.	5.47	5.47	0.80525	.	0.079530	0.53938	D	0.000048	T	0.70046	0.3179	.	.	.	0.34122	D	0.664255	D	0.60160	0.987	P	0.59056	0.851	T	0.81317	-0.0987	8	0.87932	D	0	-8.3157	11.923	0.52803	0.0:0.0:0.0:1.0	.	65	P60985	KTDAP_HUMAN	S	65	.	ENSP00000339251:N65S	N	-	2	0	KRTDAP	40671202	1.000000	0.71417	1.000000	0.80357	0.219000	0.24729	3.574000	0.53863	2.081000	0.62600	0.459000	0.35465	AAC	.		0.587	KRTDAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340164.1		
LNPEP	4012	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	96332096	96332096	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr5:96332096G>T	ENST00000231368.5	+	7	2102	c.1410G>T	c.(1408-1410)tgG>tgT	p.W470C	LNPEP_ENST00000395770.3_Missense_Mutation_p.W456C	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	470					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		CCCCCCAGTGGTTTGGCAATC	0.358																																					p.W470C		.											.	LNPEP	229	0			c.G1410T						.						106.0	104.0	105.0					5																	96332096		2203	4300	6503	SO:0001583	missense	4012	exon7			CCAGTGGTTTGGC	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.1410G>T	5.37:g.96332096G>T	ENSP00000231368:p.Trp470Cys	456.0	0.0		345.0	178.0	NM_005575	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	ENST00000231368.5	37	CCDS4087.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.132835	0.77662	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.47528	0.84;0.84	5.24	5.24	0.73138	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.82426	0.5034	H	0.99042	4.41	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89791	0.3968	10	0.87932	D	0	.	18.7851	0.91951	0.0:0.0:1.0:0.0	.	470	Q9UIQ6	LCAP_HUMAN	C	470;456	ENSP00000231368:W470C;ENSP00000379117:W456C	ENSP00000231368:W470C	W	+	3	0	LNPEP	96357852	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	9.729000	0.98795	2.598000	0.87819	0.563000	0.77884	TGG	.		0.358	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250624.1	NM_005575	
CCDC180	100499483	broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	100056292	100056292	+	Silent	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr9:100056292C>T	ENST00000357054.1	+	13	1085	c.150C>T	c.(148-150)gcC>gcT	p.A50A	RP11-23J9.5_ENST00000375204.2_RNA|CCDC180_ENST00000375205.2_Silent_p.A90A|CCDC180_ENST00000411667.2_5'UTR|CCDC180_ENST00000395220.1_Silent_p.A50A|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_5'UTR			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	50						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GCCTGGGTGCCTGCCTTTCCA	0.552																																					.		.											.	.	.	0			.						.						146.0	131.0	136.0					9																	100056292		2203	4300	6503	SO:0001819	synonymous_variant	0	.			GGGTGCCTGCCTT	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.150C>T	9.37:g.100056292C>T		161.0	1.0		151.0	57.0	.	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	RNA	SNP	ENST00000357054.1	37																																																																																				.		0.552	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	142567848	142567848	+	Splice_Site	SNP	A	A	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:142567848A>T	ENST00000389484.3	-	2	1176	c.205T>A	c.(205-207)Tgt>Agt	p.C69S	LRP1B_ENST00000486364.1_5'UTR	NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	69	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTCTACTCACAGGTATCTAAA	0.438										TSP Lung(27;0.18)																											p.C69S	Colon(99;50 2074 2507 20106)	.											.	LRP1B	311	0			c.T205A						.						58.0	55.0	56.0					2																	142567848		2203	4300	6503	SO:0001630	splice_region_variant	53353	exon2			ACTCACAGGTATC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.205+1T>A	2.37:g.142567848A>T		554.0	0.0		385.0	171.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.0|22.0	4.227139|4.227139	0.79576|0.79576	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000389484|ENST00000434794	D|D	0.99919|0.91011	-8.0|-2.77	5.62|5.62	5.62|5.62	0.85841|0.85841	Low-density lipoprotein (LDL) receptor class A, conserved site (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.92851|0.92851	0.7726|0.7726	M|M	0.93638|0.93638	3.44|3.44	0.58432|0.58432	D|D	0.999999|0.999999	D|B	0.62365|0.13145	0.991|0.007	D|B	0.78314|0.10450	0.991|0.005	D|D	0.90607|0.90607	0.4549|0.4549	9|8	.|.	.|.	.|.	.|.	15.4882|15.4882	0.75584|0.75584	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	69|107	Q9NZR2|Q96NT6	LRP1B_HUMAN|.	S|T	69|69	ENSP00000374135:C69S|ENSP00000413239:S69T	.|.	C|S	-|-	1|1	0|0	LRP1B|LRP1B	142284318|142284318	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.287000|8.287000	0.89918|0.89918	2.141000|2.141000	0.66446|0.66446	0.528000|0.528000	0.53228|0.53228	TGT|TCC	.		0.438	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	Missense_Mutation
LRP4	4038	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	46896621	46896621	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr11:46896621C>T	ENST00000378623.1	-	28	4201	c.3959G>A	c.(3958-3960)tGc>tAc	p.C1320Y	LRP4-AS1_ENST00000502049.2_RNA|LRP4-AS1_ENST00000531719.1_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1320					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		GAGGTGGGAGCAGCCGCCATT	0.547																																					p.C1320Y		.											.	LRP4	94	0			c.G3959A						.						30.0	33.0	32.0					11																	46896621		2201	4299	6500	SO:0001583	missense	4038	exon28			TGGGAGCAGCCGC	AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.3959G>A	11.37:g.46896621C>T	ENSP00000367888:p.Cys1320Tyr	52.0	0.0		51.0	15.0	NM_002334	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	ENST00000378623.1	37	CCDS31478.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.309071	0.81247	.	.	ENSG00000134569	ENST00000378623	D	0.99818	-6.92	5.67	5.67	0.87782	Epidermal growth factor-like (1);	0.096722	0.64402	D	0.000001	D	0.99896	0.9950	H	0.97077	3.935	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96485	0.9359	10	0.87932	D	0	.	17.9629	0.89091	0.0:1.0:0.0:0.0	.	1320	O75096	LRP4_HUMAN	Y	1320	ENSP00000367888:C1320Y	ENSP00000367888:C1320Y	C	-	2	0	LRP4	46853197	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	7.805000	0.86005	2.677000	0.91161	0.561000	0.74099	TGC	.		0.547	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334	
LRRIQ1	84125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	85546125	85546125	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:85546125C>A	ENST00000393217.2	+	20	4458	c.4397C>A	c.(4396-4398)tCa>tAa	p.S1466*		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1466										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		CTGCTTCTTTCAAACCAGCTG	0.383																																					p.S1466X		.											.	LRRIQ1	95	0			c.C4397A						.						132.0	126.0	128.0					12																	85546125		1892	4114	6006	SO:0001587	stop_gained	84125	exon20			TTCTTTCAAACCA	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.4397C>A	12.37:g.85546125C>A	ENSP00000376910:p.Ser1466*	253.0	0.0		225.0	102.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Nonsense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	C	43	10.329874	0.99384	.	.	ENSG00000133640	ENST00000393217	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.8375	0.92168	0.0:1.0:0.0:0.0	.	.	.	.	X	1466	.	ENSP00000376910:S1466X	S	+	2	0	LRRIQ1	84070256	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	6.010000	0.70753	2.471000	0.83476	0.586000	0.80456	TCA	.		0.383	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
LYZL6	57151	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	34261843	34261843	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr17:34261843C>A	ENST00000585556.1	-	5	738	c.404G>T	c.(403-405)gGc>gTc	p.G135V	LYZL6_ENST00000293274.4_Missense_Mutation_p.G135V|LYZL6_ENST00000492340.2_5'Flank|LYZL6_ENST00000394523.3_Missense_Mutation_p.G135V			O75951	LYZL6_HUMAN	lysozyme-like 6	135					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			breast(1)|endometrium(1)|large_intestine(1)|lung(8)|stomach(1)	12				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GAGTGGCCGGCCTGAACAGTG	0.537																																					p.G135V		.											.	LYZL6	90	0			c.G404T						.						90.0	83.0	85.0					17																	34261843		2203	4300	6503	SO:0001583	missense	57151	exon4			GGCCGGCCTGAAC	AF088219, AY742214	CCDS11302.1	17q11.2	2014-04-10			ENSG00000161572	ENSG00000275722			29614	protein-coding gene	gene with protein product		612751				10213461	Standard	NM_020426		Approved	LYC1, PRO1485, TKAL754	uc002hkj.2	O75951	OTTHUMG00000188400	ENST00000585556.1:c.404G>T	17.37:g.34261843C>A	ENSP00000468094:p.Gly135Val	65.0	0.0		115.0	69.0	NM_020426	Q6UW30	Missense_Mutation	SNP	ENST00000585556.1	37	CCDS11302.1	.	.	.	.	.	.	.	.	.	.	C	14.22	2.469314	0.43839	.	.	ENSG00000161572	ENST00000293274;ENST00000394523	T;T	0.54071	0.59;0.59	4.65	3.68	0.42216	Lysozyme-like domain (1);	0.000000	0.64402	D	0.000004	T	0.72534	0.3472	H	0.94808	3.585	0.58432	D	0.999997	D	0.57257	0.979	P	0.56088	0.791	T	0.78254	-0.2275	10	0.72032	D	0.01	-0.303	9.362	0.38201	0.0:0.8977:0.0:0.1023	.	135	O75951	LYZL6_HUMAN	V	135	ENSP00000293274:G135V;ENSP00000378031:G135V	ENSP00000293274:G135V	G	-	2	0	LYZL6	31285956	0.054000	0.20591	0.933000	0.37362	0.105000	0.19272	0.852000	0.27764	1.272000	0.44329	0.563000	0.77884	GGC	.		0.537	LYZL6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256578.2	NM_020426	
MAP2	4133	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	210559239	210559239	+	Missense_Mutation	SNP	C	C	A	rs184529696	byFrequency	TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:210559239C>A	ENST00000360351.4	+	7	2851	c.2345C>A	c.(2344-2346)gCg>gAg	p.A782E	MAP2_ENST00000361559.4_Intron|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.A778E|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	782					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AGTACTCAAGCGGAGATATCA	0.448																																					p.A782E	Pancreas(27;423 979 28787 29963)	.											.	MAP2	591	0			c.C2345A						.						91.0	91.0	91.0					2																	210559239		2203	4300	6503	SO:0001583	missense	4133	exon7			CTCAAGCGGAGAT		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.2345C>A	2.37:g.210559239C>A	ENSP00000353508:p.Ala782Glu	110.0	0.0		87.0	45.0	NM_002374	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	c	6.755	0.508134	0.12883	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.18960	2.18;2.18	5.79	2.14	0.27477	MAP2/Tau projection (1);	0.753411	0.12103	N	0.499317	T	0.15262	0.0368	N	0.14661	0.345	0.09310	N	1	P;P	0.35821	0.467;0.523	B;B	0.40444	0.221;0.329	T	0.23547	-1.0185	10	0.87932	D	0	-1.3603	9.134	0.36863	0.0:0.3339:0.0:0.6661	.	778;782	P11137-3;P11137	.;MAP2_HUMAN	E	782;778	ENSP00000353508:A782E;ENSP00000392164:A778E	ENSP00000353508:A782E	A	+	2	0	MAP2	210267484	0.531000	0.26338	0.004000	0.12327	0.411000	0.31082	1.419000	0.34793	0.144000	0.18951	-0.295000	0.09555	GCG	C|0.994;T|0.006		0.448	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
MAST2	23139	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	46500283	46500283	+	Silent	SNP	A	A	G	rs139679191	byFrequency	TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr1:46500283A>G	ENST00000361297.2	+	29	4225	c.3942A>G	c.(3940-3942)acA>acG	p.T1314T	MAST2_ENST00000372009.2_Intron	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					CTGGGCACACACGGCCCAGCT	0.637																																					p.T1314T		.											.	MAST2	581	0			c.A3942G						.						60.0	69.0	66.0					1																	46500283		2168	4252	6420	SO:0001819	synonymous_variant	23139	exon29			GCACACACGGCCC	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.3942A>G	1.37:g.46500283A>G		193.0	0.0		300.0	20.0	NM_015112		Silent	SNP	ENST00000361297.2	37	CCDS41326.1																																																																																			A|0.999;T|0.001		0.637	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112	
MGAM	8972	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	141731507	141731507	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr7:141731507G>T	ENST00000549489.2	+	13	1593	c.1498G>T	c.(1498-1500)Gat>Tat	p.D500Y	MGAM_ENST00000475668.2_Missense_Mutation_p.D500Y	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	500	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGTGTTTCCTGATTATACCAA	0.363																																					p.D500Y		.											.	MGAM	70	0			c.G1498T						.						162.0	149.0	153.0					7																	141731507		1833	4092	5925	SO:0001583	missense	8972	exon13			TTTCCTGATTATA	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.1498G>T	7.37:g.141731507G>T	ENSP00000447378:p.Asp500Tyr	463.0	0.0		396.0	171.0	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.651125	0.88056	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.97850	-4.57	5.14	5.14	0.70334	Glycoside hydrolase, superfamily (1);	0.000000	0.64402	D	0.000011	D	0.99345	0.9770	H	0.98980	4.39	0.49915	D	0.999836	D	0.89917	1.0	D	0.97110	1.0	D	0.98376	1.0556	10	0.87932	D	0	.	17.8981	0.88895	0.0:0.0:1.0:0.0	.	500	O43451	MGA_HUMAN	Y	500;500;377	ENSP00000447378:D500Y	ENSP00000316431:D377Y	D	+	1	0	MGAM	141377976	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.748000	0.91615	2.837000	0.97791	0.655000	0.94253	GAT	.		0.363	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
MRVI1	10335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	10651167	10651167	+	Silent	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr11:10651167C>A	ENST00000436272.1	-	4	543	c.465G>T	c.(463-465)ctG>ctT	p.L155L	MRVI1_ENST00000424001.1_5'UTR|MRVI1_ENST00000423302.2_Silent_p.L164L|MRVI1_ENST00000558540.1_5'UTR|MRVI1_ENST00000527509.2_Silent_p.L73L|MRVI1_ENST00000421747.1_Silent_p.L155L|MRVI1_ENST00000541483.1_Silent_p.L164L|MRVI1_ENST00000547195.1_Silent_p.L73L|MRVI1_ENST00000531107.1_Silent_p.L155L|MRVI1_ENST00000532037.1_5'Flank|MRVI1_ENST00000545852.1_5'UTR|MRVI1_ENST00000552103.1_Silent_p.L73L|MRVI1_ENST00000534266.2_5'UTR			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	155	Interaction with PRKG1. {ECO:0000250}.				blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		TGGCTTCTTCCAGCAGCGCCA	0.587																																					p.L164L		.											.	MRVI1	25	0			c.G492T						.						77.0	83.0	81.0					11																	10651167		2057	4186	6243	SO:0001819	synonymous_variant	10335	exon5			TTCTTCCAGCAGC	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.465G>T	11.37:g.10651167C>A		353.0	0.0		340.0	158.0	NM_001206880	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Silent	SNP	ENST00000436272.1	37																																																																																				.		0.587	MRVI1-203	KNOWN	basic	protein_coding	protein_coding		NM_001098579	
MUC16	94025	hgsc.bcm.edu;bcgsc.ca	37	19	9045850	9045853	+	Frame_Shift_Del	DEL	AGTT	AGTT	-	rs577410182		TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	AGTT	AGTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:9045850_9045853delAGTT	ENST00000397910.4	-	5	35981_35984	c.35778_35781delAACT	c.(35776-35781)gtaactfs	p.VT11926fs		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11928	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTCCAACTGAAGTTACAGATGGTG	0.49																																					p.11926_11927del		.											.	MUC16	566	0			c.35778_35781del						.																																			SO:0001589	frameshift_variant	94025	exon5			AACTGAAGTTACA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.35778_35781delAACT	19.37:g.9045850_9045853delAGTT	ENSP00000381008:p.Val11926fs	320.0	0.0		241.0	89.0	NM_024690	Q6ZQW5|Q96RK2	Frame_Shift_Del	DEL	ENST00000397910.4	37	CCDS54212.1																																																																																			.		0.490	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MXRA8	54587	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	1289296	1289296	+	Missense_Mutation	SNP	T	T	A	rs532502120		TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr1:1289296T>A	ENST00000309212.6	-	9	1265	c.1235A>T	c.(1234-1236)aAc>aTc	p.N412I	MXRA8_ENST00000477278.2_Missense_Mutation_p.N403I|MXRA8_ENST00000342753.4_Missense_Mutation_p.N311I|MXRA8_ENST00000445648.2_Missense_Mutation_p.N418I	NM_001282582.1|NM_032348.2	NP_001269511.1|NP_115724.1	Q9BRK3	MXRA8_HUMAN	matrix-remodelling associated 8	412					establishment of glial blood-brain barrier (GO:0060857)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(3)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CTTCAGGATGTTGTTTTTGTA	0.647																																					p.N412I		.											.	MXRA8	90	0			c.A1235T						.						36.0	35.0	35.0					1																	1289296		2199	4296	6495	SO:0001583	missense	54587	exon9			AGGATGTTGTTTT	BC006213	CCDS24.1, CCDS59950.1, CCDS59951.1, CCDS59952.1	1p36.33	2013-01-11			ENSG00000162576	ENSG00000162576		"""Immunoglobulin superfamily / V-set domain containing"""	7542	protein-coding gene	gene with protein product	"""limitrin"""					14603461	Standard	XM_005244758		Approved	DKFZp586E2023	uc001aew.3	Q9BRK3	OTTHUMG00000002973	ENST00000309212.6:c.1235A>T	1.37:g.1289296T>A	ENSP00000307887:p.Asn412Ile	80.0	0.0		83.0	43.0	NM_032348	B3KTR6|B4DE34|Q5TA39|Q96KC3	Missense_Mutation	SNP	ENST00000309212.6	37	CCDS24.1	.	.	.	.	.	.	.	.	.	.	.	16.80	3.221887	0.58560	.	.	ENSG00000162576	ENST00000309212;ENST00000378864;ENST00000342753;ENST00000445648	T;T;T	0.30182	1.58;1.72;1.54	3.85	3.85	0.44370	.	0.112986	0.64402	U	0.000018	T	0.53594	0.1806	M	0.74881	2.28	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.998;0.999;0.997	T	0.59096	-0.7518	10	0.87932	D	0	-20.6303	12.1349	0.53966	0.0:0.0:0.0:1.0	.	403;311;418;412	B3KTR6;B4DE34;Q9BRK3-2;Q9BRK3	.;.;.;MXRA8_HUMAN	I	412;403;311;418	ENSP00000307887:N412I;ENSP00000344998:N311I;ENSP00000399229:N418I	ENSP00000307887:N412I	N	-	2	0	MXRA8	1279159	1.000000	0.71417	1.000000	0.80357	0.597000	0.36814	3.913000	0.56394	1.520000	0.48965	0.459000	0.35465	AAC	.		0.647	MXRA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008282.2	NM_032348	
MYC	4609	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	128751001	128751001	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:128751001G>A	ENST00000259523.6	+	2	1698	c.493G>A	c.(493-495)Gcc>Acc	p.A165T	MYC_ENST00000377970.2_Missense_Mutation_p.A180T|MYC_ENST00000524013.1_Missense_Mutation_p.A179T			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	165					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	CCCGAACCCCGCCCGCGGCCA	0.677		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A180T		.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	.	MYC	2002	0			c.G538A						.						19.0	22.0	21.0					8																	128751001		2202	4297	6499	SO:0001583	missense	4609	exon2			AACCCCGCCCGCG		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.493G>A	8.37:g.128751001G>A	ENSP00000259523:p.Ala165Thr	29.0	0.0	1567	44.0	27.0	NM_002467	A8WFE7|P01107|Q14026	Missense_Mutation	SNP	ENST00000259523.6	37		.	.	.	.	.	.	.	.	.	.	G	15.88	2.963005	0.53507	.	.	ENSG00000136997	ENST00000259523;ENST00000517291;ENST00000377970;ENST00000524013;ENST00000454617	T;T;T;T	0.18657	2.2;2.23;2.2;2.2	4.78	3.9	0.45041	Transcription regulator Myc, N-terminal (1);	0.382752	0.26321	N	0.025050	T	0.37489	0.1005	L	0.49640	1.575	0.26174	N	0.97982	D	0.89917	1.0	D	0.79108	0.992	T	0.10314	-1.0635	10	0.40728	T	0.16	-26.6013	11.9855	0.53145	0.0861:0.0:0.9138:0.0	.	165	P01106	MYC_HUMAN	T	165;179;180;179;146	ENSP00000259523:A165T;ENSP00000429441:A179T;ENSP00000367207:A180T;ENSP00000430235:A179T	ENSP00000259523:A165T	A	+	1	0	MYC	128820183	0.000000	0.05858	1.000000	0.80357	0.840000	0.47671	0.291000	0.18994	1.127000	0.42034	0.561000	0.74099	GCC	.		0.677	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
MYO18B	84700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	26423432	26423432	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr22:26423432C>T	ENST00000407587.2	+	43	7664	c.7495C>T	c.(7495-7497)Ccc>Tcc	p.P2499S	MYO18B_ENST00000335473.7_Missense_Mutation_p.P2498S|MYO18B_ENST00000536101.1_Missense_Mutation_p.P2498S			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2498						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GAGCCCGGAGCCCAAGGAGGA	0.537																																					p.P2498S		.											.	MYO18B	142	0			c.C7492T						.						62.0	65.0	64.0					22																	26423432		2009	4151	6160	SO:0001583	missense	84700	exon43			CCGGAGCCCAAGG	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.7495C>T	22.37:g.26423432C>T	ENSP00000386096:p.Pro2499Ser	68.0	0.0		66.0	33.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	C	7.796	0.712680	0.15306	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.86030	-2.04;-2.04;-2.06	5.17	-6.48	0.01896	.	0.923307	0.09057	N	0.854978	T	0.47060	0.1425	N	0.00677	-1.265	0.09310	N	1	B;B;B;B;B	0.09022	0.002;0.001;0.001;0.001;0.001	B;B;B;B;B	0.08055	0.003;0.001;0.001;0.002;0.002	T	0.54002	-0.8358	10	0.07030	T	0.85	.	2.2834	0.04120	0.1081:0.1833:0.321:0.3877	.	2011;2500;2498;2499;2498	Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7	.;.;MY18B_HUMAN;.;.	S	2498;2498;2499	ENSP00000441229:P2498S;ENSP00000334563:P2498S;ENSP00000386096:P2499S	ENSP00000334563:P2498S	P	+	1	0	MYO18B	24753432	0.000000	0.05858	0.026000	0.17262	0.775000	0.43874	-1.064000	0.03461	-1.266000	0.02446	0.561000	0.74099	CCC	.		0.537	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
MYT1	4661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	62839764	62839764	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr20:62839764G>T	ENST00000328439.1	+	7	1579	c.1215G>T	c.(1213-1215)caG>caT	p.Q405H	MYT1_ENST00000360149.4_Intron|MYT1_ENST00000536311.1_Missense_Mutation_p.Q405H	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Interaction with PIN1.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					CTGCCGAGCAGAGCCAGCTGG	0.662																																					p.Q405H	GBM(59;481 1041 20555 21139 33705)	.											.	MYT1	704	0			c.G1215T						.						21.0	23.0	22.0					20																	62839764		2202	4294	6496	SO:0001583	missense	4661	exon7			CGAGCAGAGCCAG	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.1215G>T	20.37:g.62839764G>T	ENSP00000327465:p.Gln405His	53.0	0.0		63.0	25.0	NM_004535	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	g	0.398	-0.919828	0.02396	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.42513	0.97;0.97	4.03	-1.15	0.09709	.	0.738237	0.12756	N	0.441789	T	0.24005	0.0581	L	0.40543	1.245	0.09310	N	0.999994	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.0	T	0.17289	-1.0374	10	0.25751	T	0.34	-2.8734	0.0439	0.00009	0.3183:0.2156:0.1788:0.2872	.	405;405	F5H7M8;Q01538	.;MYT1_HUMAN	H	405	ENSP00000327465:Q405H;ENSP00000442412:Q405H	ENSP00000327465:Q405H	Q	+	3	2	MYT1	62310208	0.015000	0.18098	0.423000	0.26634	0.187000	0.23431	-0.972000	0.03802	0.176000	0.19873	0.450000	0.29827	CAG	.		0.662	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
N4BP2L2	10443	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	33017687	33017687	+	Silent	SNP	T	T	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr13:33017687T>C	ENST00000504114.1	-	6	1033	c.942A>G	c.(940-942)aaA>aaG	p.K314K	N4BP2L2_ENST00000357505.6_Silent_p.K314K|N4BP2L2_ENST00000446957.2_Intron|N4BP2L2_ENST00000399396.3_Silent_p.K329K|N4BP2L2_ENST00000380121.3_5'UTR			Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	0					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)			kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		GTGAGAGATTTTTATCTACTA	0.348																																					p.K329K		.											.	N4BP2L2	68	0			c.A987G						.						47.0	44.0	45.0					13																	33017687		1826	4074	5900	SO:0001819	synonymous_variant	10443	exon7			GAGATTTTTATCT	U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000504114.1:c.942A>G	13.37:g.33017687T>C		379.0	0.0		331.0	175.0	NM_033111	A3KME8	Silent	SNP	ENST00000504114.1	37																																																																																				.		0.348	N4BP2L2-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000361380.1	NM_014887	
NAA25	80018	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	112499100	112499100	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:112499100A>T	ENST00000261745.4	-	12	1490	c.1242T>A	c.(1240-1242)caT>caA	p.H414Q	RP1-267L14.3_ENST00000551125.1_RNA	NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	414						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						CCACACACAAATGTTGCTGCA	0.448																																					p.H414Q		.											.	NAA25	155	0			c.T1242A						.						112.0	102.0	106.0					12																	112499100		2203	4300	6503	SO:0001583	missense	80018	exon12			ACACAAATGTTGC	AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.1242T>A	12.37:g.112499100A>T	ENSP00000261745:p.His414Gln	163.0	0.0		202.0	95.0	NM_024953	A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Missense_Mutation	SNP	ENST00000261745.4	37	CCDS9159.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.123296	0.77436	.	.	ENSG00000111300	ENST00000261745	T	0.44083	0.93	5.84	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.63414	0.2509	M	0.84585	2.705	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.64706	-0.6344	10	0.38643	T	0.18	-17.2825	8.4538	0.32886	0.7962:0.0:0.2038:0.0	.	414;414	A8K8X0;Q14CX7	.;NAA25_HUMAN	Q	414	ENSP00000261745:H414Q	ENSP00000261745:H414Q	H	-	3	2	NAA25	110983483	0.987000	0.35691	1.000000	0.80357	0.996000	0.88848	0.911000	0.28584	2.234000	0.73211	0.528000	0.53228	CAT	.		0.448	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405205.1	NM_024953	
ICE2	79664	broad.mit.edu;ucsc.edu;mdanderson.org	37	15	60758888	60758888	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr15:60758888C>A	ENST00000261520.4	-	5	667	c.433G>T	c.(433-435)Gaa>Taa	p.E145*	NARG2_ENST00000558654.1_5'UTR|NARG2_ENST00000561114.1_Nonsense_Mutation_p.E145*|NARG2_ENST00000439632.1_Nonsense_Mutation_p.E8*	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						TCAGTAACTTCTTCGTTCACA	0.323																																					p.E145X		.											.	NARG2	227	0			c.G433T						.						74.0	77.0	76.0					15																	60758888		2203	4300	6503	SO:0001587	stop_gained	79664	exon5			TAACTTCTTCGTT																												ENST00000261520.4:c.433G>T	15.37:g.60758888C>A	ENSP00000261520:p.Glu145*	114.0	1.0		82.0	32.0	NM_024611		Nonsense_Mutation	SNP	ENST00000261520.4	37	CCDS10176.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647395	0.87958	.	.	ENSG00000128915	ENST00000261520;ENST00000439632	.	.	.	6.11	6.11	0.99139	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-27.0314	18.9147	0.92501	0.0:1.0:0.0:0.0	.	.	.	.	X	145;8	.	ENSP00000261520:E145X	E	-	1	0	NARG2	58546180	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.958000	0.63660	2.906000	0.99361	0.655000	0.94253	GAA	.		0.323	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256136.1		
NAV3	89795	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	78513202	78513202	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:78513202T>G	ENST00000397909.2	+	15	3399	c.3226T>G	c.(3226-3228)Tct>Gct	p.S1076A	NAV3_ENST00000266692.7_Missense_Mutation_p.S1076A|NAV3_ENST00000228327.6_Missense_Mutation_p.S1076A|NAV3_ENST00000536525.2_Missense_Mutation_p.S1076A			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1076	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						AGTAGGGTCATCTGCCATGAT	0.498										HNSCC(70;0.22)																											p.S1076A		.											.	NAV3	279	0			c.T3226G						.						66.0	67.0	67.0					12																	78513202		1952	4161	6113	SO:0001583	missense	89795	exon15			GGGTCATCTGCCA	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3226T>G	12.37:g.78513202T>G	ENSP00000381007:p.Ser1076Ala	201.0	1.0		149.0	55.0	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.375|0.375	-0.931946|-0.931946	0.02359|0.02359	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000552895|ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	.|T;T;T;T	.|0.28454	.|1.61;1.61;1.61;1.61	5.81|5.81	4.67|4.67	0.58626|0.58626	.|.	.|0.181397	.|0.26387	.|U	.|0.024667	T|T	0.13500|0.13500	0.0327|0.0327	N|N	0.04508|0.04508	-0.205|-0.205	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.29805	.|0.0;0.257;0.015;0.184	.|B;B;B;B	.|0.27500	.|0.001;0.063;0.019;0.08	T|T	0.12477|0.12477	-1.0546|-1.0546	5|10	.|0.24483	.|T	.|0.36	-13.0824|-13.0824	9.1702|9.1702	0.37076|0.37076	0.0:0.1396:0.0:0.8604|0.0:0.1396:0.0:0.8604	.|.	.|1076;1076;1076;1076	.|E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2	.|.;.;NAV3_HUMAN;.	S|A	147|1076	.|ENSP00000446132:S1076A;ENSP00000381007:S1076A;ENSP00000228327:S1076A;ENSP00000266692:S1076A	.|ENSP00000228327:S1076A	I|S	+|+	2|1	0|0	NAV3|NAV3	77037333|77037333	0.985000|0.985000	0.35326|0.35326	0.025000|0.025000	0.17156|0.17156	0.019000|0.019000	0.09904|0.09904	1.689000|1.689000	0.37700|0.37700	1.018000|1.018000	0.39521|0.39521	-0.264000|-0.264000	0.10439|0.10439	ATC|TCT	.		0.498	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
NCOR1	9611	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	15973499	15973499	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr17:15973499delA	ENST00000268712.3	-	31	4750	c.4493delT	c.(4492-4494)atgfs	p.M1499fs	NCOR1_ENST00000395857.3_Frame_Shift_Del_p.M83fs|NCOR1_ENST00000395851.1_Frame_Shift_Del_p.M1515fs	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1499	Interaction with ETO.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TCTGTTCATCATGGGTGAGCC	0.398																																					p.M1514fs		.											.	NCOR1	229	0			c.4541delT						.						204.0	198.0	200.0					17																	15973499		2203	4300	6503	SO:0001589	frameshift_variant	9611	exon30			TTCATCATGGGTG	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.4493delT	17.37:g.15973499delA	ENSP00000268712:p.Met1499fs	150.0	0.0		82.0	69.0	NM_001190440	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Frame_Shift_Del	DEL	ENST00000268712.3	37	CCDS11175.1																																																																																			.		0.398	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
NCOR1	9611	hgsc.bcm.edu;bcgsc.ca	37	17	15973501	15973501	+	Silent	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr17:15973501G>T	ENST00000268712.3	-	31	4748	c.4491C>A	c.(4489-4491)ccC>ccA	p.P1497P	NCOR1_ENST00000395857.3_Silent_p.P81P|NCOR1_ENST00000395851.1_Silent_p.P1513P	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1497	Interaction with ETO.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TGTTCATCATGGGTGAGCCTC	0.398																																					p.P1513P		.											.	NCOR1	229	0			c.C4539A						.						207.0	202.0	203.0					17																	15973501		2203	4300	6503	SO:0001819	synonymous_variant	9611	exon30			CATCATGGGTGAG	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.4491C>A	17.37:g.15973501G>T		154.0	0.0		84.0	68.0	NM_001190440	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Silent	SNP	ENST00000268712.3	37	CCDS11175.1																																																																																			.		0.398	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
NECAB1	64168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	91946573	91946573	+	Silent	SNP	G	G	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:91946573G>C	ENST00000417640.2	+	9	1072	c.735G>C	c.(733-735)ggG>ggC	p.G245G		NM_022351.4	NP_071746.1	Q8N987	NECA1_HUMAN	N-terminal EF-hand calcium binding protein 1	245						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)	12			BRCA - Breast invasive adenocarcinoma(11;0.0499)			TTATTGAAGGGAATACTAAAT	0.244																																					p.G245G		.											.	NECAB1	23	0			c.G735C						.						17.0	16.0	16.0					8																	91946573		1479	3337	4816	SO:0001819	synonymous_variant	64168	exon9			TGAAGGGAATACT	AF414126	CCDS47889.1	8q21.3	2013-01-10	2007-12-06	2007-12-06	ENSG00000123119	ENSG00000123119		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	20983	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 1"""	EFCBP1			Standard	NM_022351		Approved		uc011lgg.2	Q8N987	OTTHUMG00000164009	ENST00000417640.2:c.735G>C	8.37:g.91946573G>C		581.0	0.0		341.0	126.0	NM_022351	Q6NUS7|Q96AZ7|Q9HBW8	Silent	SNP	ENST00000417640.2	37	CCDS47889.1																																																																																			.		0.244	NECAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376728.1	NM_022351	
NGEF	25791	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	233759548	233759548	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:233759548C>T	ENST00000264051.3	-	6	1185	c.907G>A	c.(907-909)Gag>Aag	p.E303K	NGEF_ENST00000409079.1_Missense_Mutation_p.E211K|NGEF_ENST00000539537.1_Missense_Mutation_p.E26K|NGEF_ENST00000373552.4_Missense_Mutation_p.E211K	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	303	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		CTTATCCGCTCGTTCTCCATG	0.602																																					p.E303K		.											.	NGEF	313	0			c.G907A						.						125.0	108.0	114.0					2																	233759548		2203	4300	6503	SO:0001583	missense	25791	exon6			TCCGCTCGTTCTC	AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.907G>A	2.37:g.233759548C>T	ENSP00000264051:p.Glu303Lys	98.0	1.0		104.0	51.0	NM_019850	B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Missense_Mutation	SNP	ENST00000264051.3	37	CCDS2500.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.09|13.09	2.133921|2.133921	0.37630|0.37630	.|.	.|.	ENSG00000066248|ENSG00000066248	ENST00000264051;ENST00000373552;ENST00000541023;ENST00000539537;ENST00000416114;ENST00000458735;ENST00000409079|ENST00000420650	T;T;T;T;T;T|.	0.28895|.	1.59;1.59;1.59;1.59;1.59;1.59|.	5.22|5.22	5.22|5.22	0.72569|0.72569	Dbl homology (DH) domain (5);|.	0.121926|.	0.56097|.	D|.	0.000026|.	T|T	0.52370|0.52370	0.1730|0.1730	N|N	0.17278|0.17278	0.47|0.47	0.48452|0.48452	D|D	0.999651|0.999651	B;P;D|.	0.67145|.	0.307;0.903;0.996|.	B;B;P|.	0.52881|.	0.112;0.387;0.712|.	T|T	0.48115|0.48115	-0.9063|-0.9063	10|5	0.07644|.	T|.	0.81|.	-32.3328|-32.3328	18.7943|18.7943	0.91988|0.91988	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	211;211;303|.	E9PC42;B4DMB8;Q8N5V2|.	.;.;NGEF_HUMAN|.	K|Q	303;211;193;26;26;26;211|95	ENSP00000264051:E303K;ENSP00000362653:E211K;ENSP00000439035:E26K;ENSP00000401063:E26K;ENSP00000412614:E26K;ENSP00000387033:E211K|.	ENSP00000264051:E303K|.	E|R	-|-	1|2	0|0	NGEF|NGEF	233467792|233467792	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.718000|0.718000	0.41266|0.41266	3.736000|3.736000	0.55052|0.55052	2.440000|2.440000	0.82611|0.82611	0.655000|0.655000	0.94253|0.94253	GAG|CGA	.		0.602	NGEF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257051.2	XM_044799	
NHS	4810	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	17710579	17710579	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chrX:17710579delC	ENST00000380060.3	+	3	1181	c.843delC	c.(841-843)cacfs	p.H281fs	NHS_ENST00000398097.3_Frame_Shift_Del_p.H104fs	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	281					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					AGGACCGTCACTTTTTAACGG	0.557																																					p.H281fs		.											.	NHS	197	0			c.843delC						.						97.0	76.0	83.0					X																	17710579		2203	4300	6503	SO:0001589	frameshift_variant	4810	exon3			CCGTCACTTTTTA		CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.843delC	X.37:g.17710579delC	ENSP00000369400:p.His281fs	272.0	0.0		196.0	88.0	NM_198270	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Frame_Shift_Del	DEL	ENST00000380060.3	37	CCDS14181.1																																																																																			.		0.557	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	NM_198270	
NLGN1	22871	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	173993239	173993239	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr3:173993239delG	ENST00000457714.1	+	5	1210	c.781delG	c.(781-783)ggtfs	p.G261fs	NLGN1_ENST00000545397.1_Frame_Shift_Del_p.G261fs|NLGN1_ENST00000361589.4_Frame_Shift_Del_p.G261fs|NLGN1_ENST00000401917.3_Frame_Shift_Del_p.G301fs|NLGN1_ENST00000466350.1_3'UTR	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	278					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TTTTGGATCTGGTGCTGGGGG	0.413																																					p.G261fs		.											.	NLGN1	231	0			c.781delG						.						95.0	92.0	93.0					3																	173993239		2203	4299	6502	SO:0001589	frameshift_variant	22871	exon5			GGATCTGGTGCTG	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.781delG	3.37:g.173993239delG	ENSP00000392500:p.Gly261fs	266.0	0.0		324.0	96.0	NM_014932	Q9UPT2	Frame_Shift_Del	DEL	ENST00000457714.1	37	CCDS3222.1																																																																																			.		0.413	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
NOD2	64127	ucsc.edu;bcgsc.ca;mdanderson.org	37	16	50744820	50744820	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr16:50744820G>C	ENST00000300589.2	+	4	1103	c.998G>C	c.(997-999)tGc>tCc	p.C333S	RP11-327F22.6_ENST00000602304.1_RNA|NOD2_ENST00000526417.2_3'UTR	NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	333	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				CCATTCAGCTGCCGGCAGCTG	0.562																																					p.C333S		.											.	NOD2	231	0			c.G998C						.						54.0	48.0	50.0					16																	50744820		2198	4300	6498	SO:0001583	missense	64127	exon4			TCAGCTGCCGGCA	AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.998G>C	16.37:g.50744820G>C	ENSP00000300589:p.Cys333Ser	126.0	2.0		134.0	64.0	NM_022162	E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Missense_Mutation	SNP	ENST00000300589.2	37	CCDS10746.1	.	.	.	.	.	.	.	.	.	.	G	13.43	2.234886	0.39498	.	.	ENSG00000167207	ENST00000526417;ENST00000300589	T	0.79141	-1.24	5.75	4.8	0.61643	NACHT nucleoside triphosphatase (1);	0.079417	0.56097	D	0.000033	D	0.89546	0.6746	M	0.91663	3.23	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	D	0.90562	0.4516	10	0.49607	T	0.09	.	12.6058	0.56523	0.0803:0.0:0.9197:0.0	.	117;306;333	D6CHF9;Q9HC29-2;Q9HC29	.;.;NOD2_HUMAN	S	306;333	ENSP00000300589:C333S	ENSP00000300589:C333S	C	+	2	0	NOD2	49302321	1.000000	0.71417	1.000000	0.80357	0.001000	0.01503	5.176000	0.65026	1.442000	0.47568	-0.266000	0.10368	TGC	.		0.562	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256876.2	NM_022162	
NPC1L1	29881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44579861	44579861	+	Silent	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr7:44579861C>T	ENST00000289547.4	-	2	190	c.135G>A	c.(133-135)ctG>ctA	p.L45L	NPC1L1_ENST00000423141.1_Silent_p.L45L|NPC1L1_ENST00000546276.1_Silent_p.L45L|NPC1L1_ENST00000381160.3_Silent_p.L45L	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	45					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	GGCTTCCAGACAGCTCTGGGT	0.557																																					p.L45L		.											.	NPC1L1	94	0			c.G135A						.						85.0	80.0	82.0					7																	44579861		2203	4300	6503	SO:0001819	synonymous_variant	29881	exon2			TCCAGACAGCTCT		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.135G>A	7.37:g.44579861C>T		115.0	0.0		122.0	49.0	NM_001101648	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	37	CCDS5491.1																																																																																			.		0.557	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
OR1L8	138881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	125329852	125329852	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr9:125329852C>A	ENST00000304865.2	-	1	986	c.905G>T	c.(904-906)aGg>aTg	p.R302M		NM_001004454.1	NP_001004454.1	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L, member 8	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						CATAAGCTTCCTCAGGCCCTG	0.443																																					p.R302M		.											.	OR1L8	70	0			c.G905T						.						89.0	90.0	89.0					9																	125329852		2203	4300	6503	SO:0001583	missense	138881	exon1			AGCTTCCTCAGGC		CCDS35124.1	9q33.2	2013-09-20			ENSG00000171496	ENSG00000171496		"""GPCR / Class A : Olfactory receptors"""	15110	protein-coding gene	gene with protein product							Standard	NM_001004454		Approved		uc004bmp.1	Q8NGR8	OTTHUMG00000020609	ENST00000304865.2:c.905G>T	9.37:g.125329852C>A	ENSP00000306607:p.Arg302Met	156.0	0.0		102.0	46.0	NM_001004454	A3KFM3|B9EIR6|Q6IF15|Q96R79	Missense_Mutation	SNP	ENST00000304865.2	37	CCDS35124.1	.	.	.	.	.	.	.	.	.	.	C	9.087	1.000885	0.19121	.	.	ENSG00000171496	ENST00000304865	T	0.39997	1.05	4.64	1.77	0.24775	.	0.642146	0.13432	N	0.388371	T	0.40546	0.1121	M	0.74546	2.27	0.09310	N	1	B	0.25563	0.129	B	0.23018	0.043	T	0.34800	-0.9814	10	0.49607	T	0.09	-0.2245	7.7336	0.28802	0.0:0.6556:0.0:0.3444	.	302	Q8NGR8	OR1L8_HUMAN	M	302	ENSP00000306607:R302M	ENSP00000306607:R302M	R	-	2	0	OR1L8	124369673	0.000000	0.05858	0.008000	0.14137	0.876000	0.50452	-1.066000	0.03454	0.311000	0.23014	0.449000	0.29647	AGG	.		0.443	OR1L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053939.1		
OR51V1	283111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5221902	5221902	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr11:5221902G>A	ENST00000321255.1	-	1	28	c.29C>T	c.(28-30)tCa>tTa	p.S10L		NM_001004760.2	NP_001004760.2	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V, member 1	10					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(13)|lung(19)|skin(2)|upper_aerodigestive_tract(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGGCTTACTGAAGTAATCAT	0.388																																					p.S10L		.											.	OR51V1	69	0			c.C29T						.						76.0	75.0	76.0					11																	5221902		2201	4298	6499	SO:0001583	missense	283111	exon1			CTTACTGAAGTAA	BK004432	CCDS31375.1	11p15.4	2012-08-09			ENSG00000176742	ENSG00000176742		"""GPCR / Class A : Olfactory receptors"""	19597	protein-coding gene	gene with protein product				OR51A12			Standard	NM_001004760		Approved		uc010qyz.2	Q9H2C8	OTTHUMG00000066671	ENST00000321255.1:c.29C>T	11.37:g.5221902G>A	ENSP00000321729:p.Ser10Leu	164.0	0.0		121.0	54.0	NM_001004760		Missense_Mutation	SNP	ENST00000321255.1	37	CCDS31375.1	.	.	.	.	.	.	.	.	.	.	G	10.38	1.335556	0.24253	.	.	ENSG00000176742	ENST00000321255	T	0.00566	6.55	3.73	0.695	0.18070	.	12.234700	0.02867	U	0.131040	T	0.00468	0.0015	L	0.31526	0.94	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.50524	-0.8818	10	0.09843	T	0.71	.	5.9734	0.19365	0.3661:0.0:0.6339:0.0	.	10	Q9H2C8	O51V1_HUMAN	L	10	ENSP00000321729:S10L	ENSP00000321729:S10L	S	-	2	0	OR51V1	5178478	0.009000	0.17119	0.001000	0.08648	0.013000	0.08279	-0.514000	0.06298	0.280000	0.22209	0.585000	0.79938	TCA	.		0.388	OR51V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142965.1	NM_001004760	
OR4C3	256144	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	48346884	48346884	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr11:48346884T>G	ENST00000319856.4	+	1	413	c.392T>G	c.(391-393)tTt>tGt	p.F131C		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						GGAGCTCATTTTTTGGGAGGT	0.463																																					p.F131C		.											.	OR4C3	69	0			c.T392G						.						262.0	249.0	253.0					11																	48346884		2201	4298	6499	SO:0001583	missense	256144	exon1			CTCATTTTTTGGG	AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.392T>G	11.37:g.48346884T>G	ENSP00000321419:p.Phe131Cys	992.0	1.0		857.0	163.0	NM_001004702	B2RNF2|Q6IFB3	Missense_Mutation	SNP	ENST00000319856.4	37	CCDS31489.1	.	.	.	.	.	.	.	.	.	.	T	19.30	3.801430	0.70682	.	.	ENSG00000176547	ENST00000319856	T	0.00902	5.56	5.78	5.78	0.91487	GPCR, rhodopsin-like superfamily (1);	0.510284	0.18247	N	0.147075	T	0.05090	0.0136	M	0.80183	2.485	0.30797	N	0.740272	D	0.58970	0.984	P	0.60345	0.873	T	0.00893	-1.1524	10	0.87932	D	0	.	14.2031	0.65716	0.0:0.0:0.0:1.0	.	104	Q8NH37	OR4C3_HUMAN	C	131	ENSP00000321419:F131C	ENSP00000321419:F131C	F	+	2	0	OR4C3	48303460	0.001000	0.12720	0.944000	0.38274	0.965000	0.64279	1.072000	0.30678	2.245000	0.73994	0.391000	0.25812	TTT	.		0.463	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390557.1	NM_001004702	
OR4A5	81318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	51412172	51412172	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr11:51412172A>G	ENST00000319760.6	-	1	276	c.224T>C	c.(223-225)aTt>aCt	p.I75T		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				CTTGGGAGAAATGGTAGTGGA	0.423																																					p.I75T		.											.	OR4A5	92	0			c.T224C						.						58.0	59.0	59.0					11																	51412172		2201	4296	6497	SO:0001583	missense	81318	exon1			GGAGAAATGGTAG	AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.224T>C	11.37:g.51412172A>G	ENSP00000367664:p.Ile75Thr	482.0	0.0		430.0	188.0	NM_001005272	Q6IF84	Missense_Mutation	SNP	ENST00000319760.6	37	CCDS31497.1	.	.	.	.	.	.	.	.	.	.	.	0.032	-1.327600	0.01309	.	.	ENSG00000221840	ENST00000319760	T	0.01139	5.28	1.93	1.93	0.25924	GPCR, rhodopsin-like superfamily (1);	1.173960	0.06502	N	0.736428	T	0.00784	0.0026	N	0.05050	-0.12	0.09310	N	1	B	0.16802	0.019	B	0.21151	0.033	T	0.42085	-0.9472	10	0.10636	T	0.68	.	7.8263	0.29318	1.0:0.0:0.0:0.0	.	75	Q8NH83	OR4A5_HUMAN	T	75	ENSP00000367664:I75T	ENSP00000367664:I75T	I	-	2	0	OR4A5	51268748	0.000000	0.05858	0.589000	0.28718	0.032000	0.12392	-0.025000	0.12413	1.143000	0.42306	0.136000	0.15936	ATT	.		0.423	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272	
OR5B17	219965	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	58125852	58125852	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr11:58125852C>G	ENST00000357377.3	-	1	690	c.691G>C	c.(691-693)Gga>Cga	p.G231R		NM_001005489.1	NP_001005489.1	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B, member 17	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TTCTGGTATCCCTTACCTGTG	0.358																																					p.G231R		.											.	OR5B17	71	0			c.G691C						.						99.0	95.0	96.0					11																	58125852		2201	4295	6496	SO:0001583	missense	219965	exon1			GGTATCCCTTACC	AB065849	CCDS31548.1	11q12.1	2012-08-09			ENSG00000197786	ENSG00000197786		"""GPCR / Class A : Olfactory receptors"""	15267	protein-coding gene	gene with protein product				OR5B20P			Standard	NM_001005489		Approved		uc010rke.2	Q8NGF7	OTTHUMG00000167465	ENST00000357377.3:c.691G>C	11.37:g.58125852C>G	ENSP00000349945:p.Gly231Arg	147.0	0.0		91.0	43.0	NM_001005489	Q6IEX1	Missense_Mutation	SNP	ENST00000357377.3	37	CCDS31548.1	.	.	.	.	.	.	.	.	.	.	c	13.45	2.241382	0.39598	.	.	ENSG00000197786	ENST00000357377	T	0.00295	8.25	3.27	3.27	0.37495	GPCR, rhodopsin-like superfamily (1);	0.210963	0.23587	N	0.046588	T	0.00637	0.0021	M	0.83012	2.62	0.22330	N	0.999195	D	0.65815	0.995	D	0.63877	0.919	T	0.34976	-0.9807	10	0.87932	D	0	-0.8625	13.3041	0.60342	0.0:1.0:0.0:0.0	.	231	Q8NGF7	OR5BH_HUMAN	R	231	ENSP00000349945:G231R	ENSP00000349945:G231R	G	-	1	0	OR5B17	57882428	0.000000	0.05858	0.013000	0.15412	0.008000	0.06430	0.301000	0.19174	1.667000	0.50832	0.461000	0.40582	GGA	.		0.358	OR5B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394708.2	NM_001005489	
PCM1	5108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	17794745	17794745	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:17794745G>A	ENST00000519253.1	+	4	450	c.199G>A	c.(199-201)Gag>Aag	p.E67K	PCM1_ENST00000518936.1_3'UTR|PCM1_ENST00000524226.1_Missense_Mutation_p.E67K|PCM1_ENST00000518537.1_Missense_Mutation_p.E67K|PCM1_ENST00000325083.8_Missense_Mutation_p.E67K			Q15154	PCM1_HUMAN	pericentriolar material 1	67					centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		TATTTCTCCGGAGTCGTCACC	0.423			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																p.E67K		.		Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	.	PCM1	742	0			c.G199A						.						55.0	56.0	55.0					8																	17794745		2048	4175	6223	SO:0001583	missense	5108	exon4			TCTCCGGAGTCGT		CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.199G>A	8.37:g.17794745G>A	ENSP00000431099:p.Glu67Lys	345.0	0.0		281.0	130.0	NM_006197	Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Missense_Mutation	SNP	ENST00000519253.1	37		.	.	.	.	.	.	.	.	.	.	G	36	5.862437	0.97036	.	.	ENSG00000078674	ENST00000325083;ENST00000325126;ENST00000517730;ENST00000518537;ENST00000523055;ENST00000519253;ENST00000524226	T;T;T;T;T;T	0.28454	3.29;2.44;1.62;1.61;3.29;3.05	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.46964	0.1420	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.76494	0.999;0.992;0.999;0.999	D;D;D;D	0.74674	0.973;0.984;0.973;0.973	T	0.43702	-0.9375	10	0.87932	D	0	-17.6915	20.0691	0.97712	0.0:0.0:1.0:0.0	.	67;67;67;67	E7ETA6;E7EV93;E7EV56;Q15154	.;.;.;PCM1_HUMAN	K	67	ENSP00000327077:E67K;ENSP00000428131:E67K;ENSP00000428123:E67K;ENSP00000429941:E67K;ENSP00000431099:E67K;ENSP00000430521:E67K	ENSP00000327077:E67K	E	+	1	0	PCM1	17839025	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.847000	0.99503	2.819000	0.97034	0.585000	0.79938	GAG	.		0.423	PCM1-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374800.1	NM_006197	
PDS5A	23244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	39928476	39928476	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr4:39928476T>C	ENST00000303538.8	-	4	887	c.348A>G	c.(346-348)atA>atG	p.I116M	PDS5A_ENST00000503396.1_Missense_Mutation_p.I116M	NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						TAAACAAAAATATGTCCTGTT	0.239																																					p.I116M		.											.	.	.	0			c.A348G						.						19.0	19.0	19.0					4																	39928476		1235	2808	4043	SO:0001583	missense	23244	exon4			CAAAAATATGTCC	AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.348A>G	4.37:g.39928476T>C	ENSP00000303427:p.Ile116Met	278.0	0.0		180.0	79.0	NM_001100399		Missense_Mutation	SNP	ENST00000303538.8	37	CCDS47045.1	.	.	.	.	.	.	.	.	.	.	T	16.79	3.221376	0.58560	.	.	ENSG00000121892	ENST00000303538;ENST00000503396	T;T	0.70399	-0.37;-0.48	5.73	4.48	0.54585	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80105	0.4562	M	0.69823	2.125	0.54753	D	0.999985	D;D	0.76494	0.997;0.999	D;D	0.91635	0.946;0.999	T	0.79841	-0.1633	9	.	.	.	-22.3401	7.9066	0.29765	0.1358:0.0:0.1418:0.7223	.	116;116	Q29RF7-3;Q29RF7	.;PDS5A_HUMAN	M	116	ENSP00000303427:I116M;ENSP00000426749:I116M	.	I	-	3	3	PDS5A	39604871	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.915000	0.28638	2.187000	0.69744	0.533000	0.62120	ATA	.		0.239	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361287.1	NM_015200	
PITPNM2	57605	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	12	123474487	123474487	+	Missense_Mutation	SNP	C	C	A	rs563437854		TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:123474487C>A	ENST00000542749.1	-	16	2641	c.2578G>T	c.(2578-2580)Gat>Tat	p.D860Y	PITPNM2_ENST00000392428.1_Missense_Mutation_p.D581Y|PITPNM2_ENST00000280562.5_Intron|PITPNM2_ENST00000320201.4_Missense_Mutation_p.D860Y			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	860	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		CTGAGCGCATCGGGGGCCTCT	0.701																																					p.D860Y		.											.	PITPNM2	228	0			c.G2578T						.						4.0	4.0	4.0					12																	123474487		1755	3485	5240	SO:0001583	missense	57605	exon17			GCGCATCGGGGGC	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.2578G>T	12.37:g.123474487C>A	ENSP00000437611:p.Asp860Tyr	15.0	0.0		20.0	9.0	NM_020845	Q9P271	Missense_Mutation	SNP	ENST00000542749.1	37	CCDS9242.1	.	.	.	.	.	.	.	.	.	.	c	5.685	0.310961	0.10733	.	.	ENSG00000090975	ENST00000320201;ENST00000392428;ENST00000542749	T;T;T	0.42900	1.29;0.96;1.29	4.66	-2.26	0.06867	DDHD (2);	2.637130	0.01909	U	0.039711	T	0.18341	0.0440	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.07139	-1.0788	10	0.15066	T	0.55	0.0	0.3664	0.00372	0.3334:0.2117:0.1245:0.3303	.	860	Q9BZ72	PITM2_HUMAN	Y	860;581;860	ENSP00000322218:D860Y;ENSP00000376223:D581Y;ENSP00000437611:D860Y	ENSP00000322218:D860Y	D	-	1	0	PITPNM2	122040440	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.318000	0.02705	-0.080000	0.12685	-0.370000	0.07254	GAT	.		0.701	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
PITPNM2	57605	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	123497236	123497236	+	Silent	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:123497236G>A	ENST00000542749.1	-	3	402	c.339C>T	c.(337-339)acC>acT	p.T113T	PITPNM2_ENST00000392428.1_Intron|PITPNM2_ENST00000280562.5_Silent_p.T113T|PITPNM2_ENST00000320201.4_Silent_p.T113T|PITPNM2_ENST00000546049.1_Silent_p.T113T|MIR4304_ENST00000580964.1_RNA|PITPNM2_ENST00000451868.2_5'UTR			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	113					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)	p.T113T(1)		NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		TTTTATAAAAGGTTTCAATGT	0.507																																					p.T113T		.											.	PITPNM2	228	1	Substitution - coding silent(1)	ovary(1)	c.C339T						.						154.0	166.0	162.0					12																	123497236		2203	4300	6503	SO:0001819	synonymous_variant	57605	exon4			ATAAAAGGTTTCA	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.339C>T	12.37:g.123497236G>A		145.0	0.0		116.0	48.0	NM_020845	Q9P271	Silent	SNP	ENST00000542749.1	37	CCDS9242.1																																																																																			.		0.507	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
PLXNA4	91584	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	131825502	131825502	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr7:131825502C>T	ENST00000359827.3	-	30	6256	c.5294G>A	c.(5293-5295)aGc>aAc	p.S1765N	PLXNA4_ENST00000321063.4_Missense_Mutation_p.S1765N			Q9HCM2	PLXA4_HUMAN	plexin A4	1765					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GTCTGTGATGCTGTTCTTATG	0.557																																					p.S1765N		.											.	PLXNA4	91	0			c.G5294A						.						116.0	125.0	122.0					7																	131825502		2203	4300	6503	SO:0001583	missense	91584	exon30			GTGATGCTGTTCT	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.5294G>A	7.37:g.131825502C>T	ENSP00000352882:p.Ser1765Asn	216.0	2.0		165.0	75.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442264	0.83993	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.17854	2.25;2.25	5.22	5.22	0.72569	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.34658	0.0905	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.03008	-1.1083	10	0.15066	T	0.55	.	18.7854	0.91952	0.0:1.0:0.0:0.0	.	1765	Q9HCM2	PLXA4_HUMAN	N	1765	ENSP00000323194:S1765N;ENSP00000352882:S1765N	ENSP00000323194:S1765N	S	-	2	0	PLXNA4	131476042	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.729000	0.84864	2.439000	0.82584	0.591000	0.81541	AGC	.		0.557	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
PMEPA1	56937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	56227370	56227370	+	Silent	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr20:56227370C>T	ENST00000341744.3	-	4	922	c.603G>A	c.(601-603)agG>agA	p.R201R	PMEPA1_ENST00000347215.4_Silent_p.R166R|PMEPA1_ENST00000265626.4_Silent_p.R151R|PMEPA1_ENST00000395814.1_Silent_p.R151R|PMEPA1_ENST00000395816.3_Silent_p.R151R	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	201					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						GGCCGCCCAGCCTGGCACTAT	0.687																																					p.R201R		.											.	PMEPA1	227	0			c.G603A						.						33.0	37.0	36.0					20																	56227370		2203	4300	6503	SO:0001819	synonymous_variant	56937	exon4			GCCCAGCCTGGCA	AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.603G>A	20.37:g.56227370C>T		17.0	0.0		34.0	20.0	NM_020182	Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Silent	SNP	ENST00000341744.3	37	CCDS13463.1																																																																																			.		0.687	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079858.2	NM_020182	
POLQ	10721	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121251856	121251856	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr3:121251856T>C	ENST00000264233.5	-	6	1069	c.941A>G	c.(940-942)gAg>gGg	p.E314G	POLQ_ENST00000488282.1_5'UTR	NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	314					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TAGCATGGGCTCAAATTCCCT	0.358								DNA polymerases (catalytic subunits)																													p.E314G	Pancreas(152;907 1925 26081 31236 36904)	.											.	POLQ	664	0			c.A941G						.						70.0	74.0	72.0					3																	121251856		2203	4300	6503	SO:0001583	missense	10721	exon6			ATGGGCTCAAATT	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.941A>G	3.37:g.121251856T>C	ENSP00000264233:p.Glu314Gly	523.0	0.0		495.0	228.0	NM_199420	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	T	10.29	1.309163	0.23821	.	.	ENSG00000051341	ENST00000264233;ENST00000393672	T	0.71461	-0.57	5.29	5.29	0.74685	.	0.506627	0.21426	N	0.074729	T	0.65913	0.2737	L	0.46157	1.445	0.27916	N	0.938442	B	0.19200	0.034	B	0.22386	0.039	T	0.58532	-0.7620	10	0.35671	T	0.21	.	15.5172	0.75833	0.0:0.0:0.0:1.0	.	314	O75417	DPOLQ_HUMAN	G	314;449	ENSP00000264233:E314G	ENSP00000264233:E314G	E	-	2	0	POLQ	122734546	1.000000	0.71417	0.994000	0.49952	0.505000	0.33919	4.620000	0.61226	2.126000	0.65437	0.377000	0.23210	GAG	.		0.358	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
POSTN	10631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	38164531	38164531	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr13:38164531T>A	ENST00000379747.4	-	4	536	c.419A>T	c.(418-420)gAg>gTg	p.E140V	POSTN_ENST00000541179.1_Missense_Mutation_p.E140V|POSTN_ENST00000541481.1_Missense_Mutation_p.E140V|POSTN_ENST00000379749.4_Missense_Mutation_p.E140V|POSTN_ENST00000379743.4_Missense_Mutation_p.E140V|POSTN_ENST00000379742.4_Missense_Mutation_p.E140V	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	140	FAS1 1. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		GTCCCAAGCCTCATTACTCGG	0.388																																					p.E140V		.											.	POSTN	516	0			c.A419T						.						100.0	84.0	89.0					13																	38164531		2203	4300	6503	SO:0001583	missense	10631	exon4			CAAGCCTCATTAC	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.419A>T	13.37:g.38164531T>A	ENSP00000369071:p.Glu140Val	93.0	0.0		57.0	23.0	NM_006475	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	ENST00000379747.4	37	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.577221	0.86645	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481;ENST00000538347	D;D;D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11;-3.11;-3.11	5.36	5.36	0.76844	FAS1 domain (5);	0.261736	0.43579	D	0.000555	D	0.96519	0.8864	M	0.90369	3.11	0.58432	D	0.999997	D;D;D;D;D;D;D	0.76494	0.994;0.987;0.996;0.987;0.999;0.999;0.999	D;P;D;P;D;D;D	0.68621	0.91;0.854;0.93;0.854;0.911;0.953;0.959	D	0.97283	0.9919	10	0.72032	D	0.01	-4.8692	15.3597	0.74460	0.0:0.0:0.0:1.0	.	140;140;140;140;140;140;140	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	V	140;140;140;140;140;140;57	ENSP00000437959:E140V;ENSP00000369073:E140V;ENSP00000369071:E140V;ENSP00000369067:E140V;ENSP00000369066:E140V;ENSP00000437953:E140V	ENSP00000369066:E140V	E	-	2	0	POSTN	37062531	1.000000	0.71417	0.981000	0.43875	0.970000	0.65996	7.698000	0.84413	2.036000	0.60181	0.528000	0.53228	GAG	.		0.388	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
POU2F2	5452	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42636560	42636560	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:42636560C>A	ENST00000526816.2	-	1	19	c.4G>T	c.(4-6)Gtt>Ttt	p.V2F	MIR4323_ENST00000582929.1_RNA|POU2F2_ENST00000560558.1_Missense_Mutation_p.V2F|POU2F2_ENST00000389341.5_Missense_Mutation_p.V2F|POU2F2_ENST00000524801.2_Intron|POU2F2_ENST00000560398.1_Missense_Mutation_p.V2F|CTC-378H22.1_ENST00000527895.1_RNA|POU2F2_ENST00000342301.4_Missense_Mutation_p.V2F|POU2F2_ENST00000533720.1_Missense_Mutation_p.V2F|POU2F2_ENST00000529952.1_Missense_Mutation_p.V2F|POU2F2_ENST00000529067.1_Missense_Mutation_p.V2F|CTC-378H22.1_ENST00000531517.1_RNA			P09086	PO2F2_HUMAN	POU class 2 homeobox 2	2					cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	CTGGAGTGAACCATGCTGCCC	0.657																																					p.V2F		.											.	POU2F2	227	0			c.G4T						.						37.0	36.0	36.0					19																	42636560		2203	4300	6503	SO:0001583	missense	5452	exon1			AGTGAACCATGCT		CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.4G>T	19.37:g.42636560C>A	ENSP00000431603:p.Val2Phe	69.0	0.0		92.0	42.0	NM_002698	Q16648|Q7M4M8|Q9BRS4	Missense_Mutation	SNP	ENST00000526816.2	37	CCDS56095.1	.	.	.	.	.	.	.	.	.	.	C	18.07	3.542156	0.65198	.	.	ENSG00000028277	ENST00000389341;ENST00000342301;ENST00000292077;ENST00000533720;ENST00000526816;ENST00000529067;ENST00000529952	D;D;D;D;D	0.83755	-1.69;-1.74;-1.76;-1.5;-1.67	4.09	4.09	0.47781	.	4.384240	0.00780	N	0.001278	T	0.81805	0.4900	N	0.08118	0	0.29510	N	0.854286	B;P;B	0.50156	0.087;0.932;0.213	B;P;B	0.55391	0.086;0.775;0.141	T	0.74990	-0.3475	10	0.59425	D	0.04	.	12.011	0.53286	0.0:1.0:0.0:0.0	.	2;2;2	P09086-4;P09086;P09086-3	.;PO2F2_HUMAN;.	F	2;2;2;2;1;2;2	ENSP00000373992:V2F;ENSP00000339369:V2F;ENSP00000437221:V2F;ENSP00000437224:V2F;ENSP00000436988:V2F	ENSP00000292077:V2F	V	-	1	0	POU2F2	47328400	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.610000	0.46325	2.296000	0.77279	0.313000	0.20887	GTT	.		0.657	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387329.3		
POU5F2	134187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	93076516	93076516	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr5:93076516C>G	ENST00000510627.4	-	1	827	c.754G>C	c.(754-756)Gat>Cat	p.D252H	POU5F2_ENST00000606183.1_5'UTR|FAM172A_ENST00000505869.1_Intron|RP11-185E12.2_ENST00000606528.1_RNA|FAM172A_ENST00000509739.1_Intron|FAM172A_ENST00000395965.3_Intron|FAM172A_ENST00000509163.1_Intron	NM_153216.1	NP_694948.1	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	252					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)						all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)		CGAACCACATCCTTCTGCAGC	0.572																																					p.D252H		.											.	.	.	0			c.G754C						.						48.0	50.0	49.0					5																	93076516		2012	4178	6190	SO:0001583	missense	134187	exon1			CCACATCCTTCTG		CCDS59489.1	5q15	2011-06-20				ENSG00000248483		"""Homeoboxes / POU class"""	26367	protein-coding gene	gene with protein product						7908264	Standard	NM_153216		Approved	SPRM-1, FLJ25680	uc003kkl.1	Q8N7G0		ENST00000510627.4:c.754G>C	5.37:g.93076516C>G	ENSP00000464890:p.Asp252His	257.0	0.0		250.0	117.0	NM_153216	Q15169|Q6MZL7|Q8N748	Missense_Mutation	SNP	ENST00000510627.4	37	CCDS59489.1																																																																																			.		0.572	POU5F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369873.5	NM_153216	
PRKG1	5592	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	54048601	54048601	+	Silent	SNP	C	C	T	rs541150590		TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr10:54048601C>T	ENST00000401604.2	+	15	1974	c.1780C>T	c.(1780-1782)Cta>Tta	p.L594L	PRKG1_ENST00000373980.4_Silent_p.L609L|PRKG1-AS1_ENST00000452247.2_RNA|PRKG1_ENST00000373975.2_Silent_p.L312L|PRKG1_ENST00000373985.1_Silent_p.L582L|PRKG1-AS1_ENST00000426785.2_RNA			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	594	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		AATTAAAAAACTATGCAGGTA	0.279													C|||	1	0.000199681	0.0	0.0	5008	,	,		16677	0.0		0.0	False		,,,				2504	0.001				p.L609L		.											.	PRKG1	523	0			c.C1825T						.						50.0	53.0	52.0					10																	54048601		2201	4300	6501	SO:0001819	synonymous_variant	5592	exon15			AAAAAACTATGCA		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.1780C>T	10.37:g.54048601C>T		229.0	0.0		135.0	64.0	NM_006258	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Silent	SNP	ENST00000401604.2	37	CCDS44399.1																																																																																			.		0.279	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PSD2	84249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	139189077	139189077	+	Missense_Mutation	SNP	C	C	T	rs146689892		TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr5:139189077C>T	ENST00000274710.3	+	2	257	c.52C>T	c.(52-54)Cgt>Tgt	p.R18C		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	18					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGATGCCACCCGTGACCCCGG	0.642																																					p.R18C		.											.	PSD2	91	0			c.C52T						.	C	CYS/ARG	0,4406		0,0,2203	19.0	22.0	21.0		52	-5.0	0.0	5	dbSNP_134	21	2,8598		0,2,4298	no	missense	PSD2	NM_032289.2	180	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	18/772	139189077	2,13004	2203	4300	6503	SO:0001583	missense	84249	exon2			GCCACCCGTGACC	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.52C>T	5.37:g.139189077C>T	ENSP00000274710:p.Arg18Cys	122.0	0.0		139.0	63.0	NM_032289	D3DQD3|Q8N3J8	Missense_Mutation	SNP	ENST00000274710.3	37	CCDS4216.1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.709654	0.30322	0.0	2.33E-4	ENSG00000146005	ENST00000274710	T	0.12569	2.67	4.45	-5.02	0.02982	.	2.275110	0.01786	N	0.032041	T	0.08935	0.0221	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37865	-0.9687	10	0.52906	T	0.07	.	9.6634	0.39969	0.0:0.637:0.1532:0.2098	.	18	Q9BQI7	PSD2_HUMAN	C	18	ENSP00000274710:R18C	ENSP00000274710:R18C	R	+	1	0	PSD2	139169261	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.938000	0.03938	-0.907000	0.03862	-0.367000	0.07326	CGT	C|1.000;T|0.000		0.642	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
PTPN3	5774	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	112185130	112185130	+	Missense_Mutation	SNP	G	G	A	rs376647767		TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr9:112185130G>A	ENST00000374541.2	-	13	1108	c.1004C>T	c.(1003-1005)tCg>tTg	p.S335L	PTPN3_ENST00000262539.3_Intron|PTPN3_ENST00000446349.1_Intron|PTPN3_ENST00000412145.1_Missense_Mutation_p.S204L	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	335					negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						GTTATTTACCGACCTGAAAAA	0.443																																					p.S335L		.											.	PTPN3	229	0			c.C1004T						.	G	,LEU/SER,,LEU/SER,,LEU/SER	0,4406		0,0,2203	190.0	175.0	180.0		,611,,143,,1004	4.5	1.0	9		180	1,8599	2.2+/-6.3	0,1,4299	no	intron,missense,intron,missense,intron,missense	PTPN3	NM_001145368.1,NM_001145369.1,NM_001145370.1,NM_001145371.1,NM_001145372.1,NM_002829.3	,145,,145,,145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,benign,,benign,,benign	,204/783,,48/627,,335/914	112185130	1,13005	2203	4300	6503	SO:0001583	missense	5774	exon13			TTTACCGACCTGA		CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.1004C>T	9.37:g.112185130G>A	ENSP00000363667:p.Ser335Leu	193.0	0.0		169.0	54.0	NM_002829	A0AUW9|E7EN99|E9PGU7	Missense_Mutation	SNP	ENST00000374541.2	37	CCDS6776.1	.	.	.	.	.	.	.	.	.	.	G	18.13	3.555894	0.65425	0.0	1.16E-4	ENSG00000070159	ENST00000394831;ENST00000412145;ENST00000374541	D;D	0.82526	-1.62;-1.62	5.43	4.52	0.55395	.	0.200478	0.42172	D	0.000752	T	0.76126	0.3944	L	0.38531	1.155	0.80722	D	1	B	0.29253	0.239	B	0.24394	0.053	T	0.74300	-0.3710	10	0.52906	T	0.07	.	15.3342	0.74238	0.0:0.0:0.8591:0.1409	.	335	P26045	PTN3_HUMAN	L	335;204;335	ENSP00000416654:S204L;ENSP00000363667:S335L	ENSP00000363667:S335L	S	-	2	0	PTPN3	111224951	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.033000	0.76504	1.266000	0.44231	0.650000	0.86243	TCG	.		0.443	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4		
RBPMS2	348093	ucsc.edu;bcgsc.ca	37	15	65041670	65041670	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr15:65041670T>C	ENST00000300069.4	-	4	494	c.227A>G	c.(226-228)gAc>gGc	p.D76G	RBPMS2_ENST00000560606.1_5'UTR	NM_194272.1	NP_919248.1	Q6ZRY4	RBPS2_HUMAN	RNA binding protein with multiple splicing 2	76	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)			breast(1)|large_intestine(3)|lung(3)|prostate(1)	8						TGCACGGCTGTCAAAGATCAC	0.483																																					p.D76G		.											.	RBPMS2	90	0			c.A227G						.						151.0	147.0	148.0					15																	65041670		2202	4299	6501	SO:0001583	missense	348093	exon4			CGGCTGTCAAAGA	AY369207	CCDS32271.1	15q22.31	2014-05-15			ENSG00000166831	ENSG00000166831		"""RNA binding motif (RRM) containing"""	19098	protein-coding gene	gene with protein product							Standard	NM_194272		Approved		uc002anq.3	Q6ZRY4	OTTHUMG00000172423	ENST00000300069.4:c.227A>G	15.37:g.65041670T>C	ENSP00000300069:p.Asp76Gly	47.0	0.0		39.0	4.0	NM_194272	A2RRG0	Missense_Mutation	SNP	ENST00000300069.4	37	CCDS32271.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.617362	0.87359	.	.	ENSG00000166831	ENST00000300069	T	0.17854	2.25	5.26	5.26	0.73747	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.28830	0.0715	L	0.38531	1.155	0.80722	D	1	D	0.60160	0.987	P	0.62089	0.898	T	0.01136	-1.1440	10	0.42905	T	0.14	-7.0387	14.2992	0.66334	0.0:0.0:0.0:1.0	.	76	Q6ZRY4	RBPS2_HUMAN	G	76	ENSP00000300069:D76G	ENSP00000300069:D76G	D	-	2	0	RBPMS2	62828723	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.603000	0.82811	2.122000	0.65172	0.460000	0.39030	GAC	.		0.483	RBPMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418466.1		
RFX6	222546	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	117198538	117198538	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr6:117198538G>A	ENST00000332958.2	+	1	116	c.100G>A	c.(100-102)Ggc>Agc	p.G34S		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	34					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						GCAGCTCCTGGGCAAGGGCTT	0.667																																					p.G34S		.											.	RFX6	93	0			c.G100A						.						21.0	23.0	23.0					6																	117198538		2203	4299	6502	SO:0001583	missense	222546	exon1			CTCCTGGGCAAGG	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.100G>A	6.37:g.117198538G>A	ENSP00000332208:p.Gly34Ser	63.0	0.0		108.0	49.0	NM_173560	Q5T6B3	Missense_Mutation	SNP	ENST00000332958.2	37	CCDS5113.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.680894	0.47886	.	.	ENSG00000185002	ENST00000332958	T	0.57595	0.39	5.03	2.0	0.26442	.	1.875720	0.02080	N	0.052237	T	0.21022	0.0506	N	0.19112	0.55	0.32374	N	0.55548	B	0.06786	0.001	B	0.06405	0.002	T	0.01062	-1.1464	10	0.66056	D	0.02	-2.8757	8.4723	0.32993	0.265:0.0:0.735:0.0	.	34	Q8HWS3	RFX6_HUMAN	S	34	ENSP00000332208:G34S	ENSP00000332208:G34S	G	+	1	0	RFX6	117305231	1.000000	0.71417	0.997000	0.53966	0.873000	0.50193	0.765000	0.26546	0.214000	0.20742	0.591000	0.81541	GGC	.		0.667	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560	
RGPD4	285190	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	108487515	108487515	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:108487515delG	ENST00000408999.3	+	20	3132	c.3055delG	c.(3055-3057)ggtfs	p.G1019fs	RGPD4_ENST00000354986.4_Frame_Shift_Del_p.G1019fs	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1019					protein targeting to Golgi (GO:0000042)			p.G1019S(1)		breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						AAACACTTCCGGTGACTTTGA	0.388																																					p.G1019fs		.											.	RGPD4	2	1	Substitution - Missense(1)	endometrium(1)	c.3055delG						.						1.0	2.0	2.0					2																	108487515		250	756	1006	SO:0001589	frameshift_variant	285190	exon20			ACTTCCGGTGACT	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3055delG	2.37:g.108487515delG	ENSP00000386810:p.Gly1019fs	405.0	0.0		317.0	121.0	NM_182588	B9A029	Frame_Shift_Del	DEL	ENST00000408999.3	37	CCDS46381.1																																																																																			.		0.388	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
RHPN1	114822	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	144460480	144460480	+	Silent	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:144460480C>T	ENST00000289013.6	+	5	524	c.423C>T	c.(421-423)taC>taT	p.Y141Y		NM_052924.2	NP_443156.2	Q8TCX5	RHPN1_HUMAN	rhophilin, Rho GTPase binding protein 1	141	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)		small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(1)|lung(7)	9	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			GCGCCTCCTACGAGGCAGAAA	0.652																																					p.Y141Y		.											.	RHPN1	67	0			c.C423T						.						32.0	38.0	36.0					8																	144460480		1969	4132	6101	SO:0001819	synonymous_variant	114822	exon5			CTCCTACGAGGCA	AB067516	CCDS47927.1	8q24.3	2003-02-06			ENSG00000158106	ENSG00000158106			19973	protein-coding gene	gene with protein product		601031				11572484	Standard	NM_052924		Approved	KIAA1929, RHPN, ODF5	uc003yyb.3	Q8TCX5	OTTHUMG00000165006	ENST00000289013.6:c.423C>T	8.37:g.144460480C>T		59.0	0.0		77.0	37.0	NM_052924	Q8TAV1|Q96PV9	Silent	SNP	ENST00000289013.6	37	CCDS47927.1																																																																																			.		0.652	RHPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381417.1		
RIN2	54453	ucsc.edu;bcgsc.ca	37	20	19870240	19870240	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr20:19870240G>T	ENST00000255006.6	+	2	291	c.142G>T	c.(142-144)Ggg>Tgg	p.G48W	RIN2_ENST00000440354.2_5'UTR	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	0					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						AGCCTCGCTGGGGGAAATGAC	0.527																																					p.G48W		.											.	RIN2	660	0			c.G142T						.						20.0	24.0	23.0					20																	19870240		1847	4048	5895	SO:0001583	missense	54453	exon2			TCGCTGGGGGAAA	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.142G>T	20.37:g.19870240G>T	ENSP00000255006:p.Gly48Trp	64.0	0.0		35.0	4.0	NM_001242581	Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	ENST00000255006.6	37	CCDS56182.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648427	0.67358	.	.	ENSG00000132669	ENST00000255006	T	0.06449	3.3	6.08	4.14	0.48551	.	0.308595	0.23704	N	0.045400	T	0.04227	0.0117	N	0.08118	0	0.80722	D	1	.	.	.	.	.	.	T	0.55692	-0.8101	7	.	.	.	-9.4079	9.5951	0.39569	0.0712:0.2686:0.6602:0.0	.	.	.	.	W	48	ENSP00000255006:G48W	.	G	+	1	0	RIN2	19818240	0.950000	0.32346	0.990000	0.47175	0.928000	0.56348	1.482000	0.35486	0.912000	0.36772	0.655000	0.94253	GGG	.		0.527	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078212.1		
RNF145	153830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	158603765	158603766	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr5:158603765_158603766CC>AA	ENST00000424310.2	-	5	854_855	c.495_496GG>TT	c.(493-498)ttGGag>ttTTag	p.165_166LE>F*	RNF145_ENST00000520638.1_Nonsense_Mutation_p.179_180LE>F*|RNF145_ENST00000274542.2_Nonsense_Mutation_p.193_194LE>F*|RNF145_ENST00000521606.2_Nonsense_Mutation_p.182_183LE>F*|RNF145_ENST00000518802.1_Nonsense_Mutation_p.195_196LE>F*|RNF145_ENST00000519865.1_Nonsense_Mutation_p.165_166LE>F*	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145	165						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACAATTGTCTCCAAAGGAACAA	0.381																																					p.E196X|p.L195F		.											.	RNF145	525	0			c.G586T|c.G585T						.																																			SO:0001587	stop_gained	153830	exon5			TTGTCTCCAAAGG|TGTCTCCAAAGGA	BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.495_496delinsAA	5.37:g.158603765_158603766delinsAA	ENSP00000409064:p.L165_E166delinsF*	873.0|868.0	1.0|2.0		788.0|785.0	317.0	NM_001199380	B7Z903|B7Z949|E7EVI7|Q8IVP7	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000424310.2	37	CCDS56390.1																																																																																			.		0.381	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374048.1	NM_144726	
SDS	10993	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	113835135	113835135	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:113835135A>G	ENST00000257549.4	-	6	610	c.488T>C	c.(487-489)aTc>aCc	p.I163T		NM_006843.2	NP_006834.2	P20132	SDHL_HUMAN	serine dehydratase	163					gluconeogenesis (GO:0006094)|L-serine catabolic process (GO:0006565)|pyruvate biosynthetic process (GO:0042866)|response to amino acid (GO:0043200)|response to cobalamin (GO:0033590)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	L-serine ammonia-lyase activity (GO:0003941)|L-threonine ammonia-lyase activity (GO:0004794)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			large_intestine(2)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(1)	11					L-Serine(DB00133)	TGACAGCGCGATGGCCCCCGG	0.662																																					p.I163T		.											.	SDS	91	0			c.T488C						.						60.0	60.0	60.0					12																	113835135		2203	4300	6503	SO:0001583	missense	10993	exon6			AGCGCGATGGCCC	J05037	CCDS9169.1	12q24.13	2014-06-24			ENSG00000135094	ENSG00000135094	4.3.1.17		10691	protein-coding gene	gene with protein product	"""L-serine ammonia-lyase"""	182128				2674117	Standard	NM_006843		Approved	SDH	uc001tvg.3	P20132	OTTHUMG00000169554	ENST00000257549.4:c.488T>C	12.37:g.113835135A>G	ENSP00000257549:p.Ile163Thr	151.0	1.0		163.0	75.0	NM_006843	A8K9P5	Missense_Mutation	SNP	ENST00000257549.4	37	CCDS9169.1	.	.	.	.	.	.	.	.	.	.	A	17.84	3.486882	0.63962	.	.	ENSG00000135094	ENST00000257549;ENST00000446302	D	0.97303	-4.33	4.45	4.45	0.53987	Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.052536	0.64402	D	0.000001	D	0.98921	0.9634	H	0.97158	3.95	0.51767	D	0.999936	D;D	0.69078	0.997;0.991	D;D	0.85130	0.995;0.997	D	0.99346	1.0913	10	0.87932	D	0	-34.4501	13.5643	0.61807	1.0:0.0:0.0:0.0	.	163;163	Q8WW81;P20132	.;SDHL_HUMAN	T	163	ENSP00000257549:I163T	ENSP00000257549:I163T	I	-	2	0	SDS	112319518	1.000000	0.71417	1.000000	0.80357	0.381000	0.30169	8.890000	0.92477	1.877000	0.54381	0.459000	0.35465	ATC	.		0.662	SDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404790.1	NM_006843	
SERTAD1	29950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	40929016	40929016	+	Silent	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:40929016C>A	ENST00000357949.4	-	2	596	c.438G>T	c.(436-438)ggG>ggT	p.G146G		NM_013376.3	NP_037508.2	Q9UHV2	SRTD1_HUMAN	SERTA domain containing 1	146					positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription, DNA-templated (GO:0006351)					endometrium(2)|lung(1)|prostate(1)|skin(1)	5			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCGCTGCTCCCCCGATGCTAC	0.652																																					p.G146G		.											.	SERTAD1	226	0			c.G438T						.						15.0	14.0	14.0					19																	40929016		2193	4297	6490	SO:0001819	synonymous_variant	29950	exon2			TGCTCCCCCGATG	AF117959	CCDS12557.1	19q13.1-q13.2	2008-02-05				ENSG00000197019			17932	protein-coding gene	gene with protein product	"""CDK4-binding protein p34SEI"", ""transcriptional regulator interacting with the PHD-bromodomain 1"""					6434876, 10580009	Standard	NM_013376		Approved	SEI1, TRIP-Br1	uc002ont.4	Q9UHV2		ENST00000357949.4:c.438G>T	19.37:g.40929016C>A		56.0	0.0		40.0	19.0	NM_013376	Q9BUE7	Silent	SNP	ENST00000357949.4	37	CCDS12557.1																																																																																			.		0.652	SERTAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462571.1	NM_013376	
SGK223	157285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	8185737	8185737	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:8185737G>T	ENST00000520004.1	-	5	2819	c.2555C>A	c.(2554-2556)aCc>aAc	p.T852N	SGK223_ENST00000330777.4_Missense_Mutation_p.T852N			Q86YV5	SG223_HUMAN		854							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GTGGACGTTGGTTTCCGAGTG	0.572																																					p.T852N	GBM(34;731 755 10259 33573 33867)	.											.	.	.	0			c.C2555A						.						169.0	181.0	177.0					8																	8185737		2009	4157	6166	SO:0001583	missense	0	exon4			ACGTTGGTTTCCG																												ENST00000520004.1:c.2555C>A	8.37:g.8185737G>T	ENSP00000428054:p.Thr852Asn	72.0	0.0		88.0	43.0	NM_001080826	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	37	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.635444	0.29068	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.57107	0.42;0.42	4.97	3.16	0.36331	.	0.470089	0.20037	N	0.100589	T	0.33265	0.0857	L	0.38531	1.155	0.34078	D	0.659273	B	0.23316	0.083	B	0.16289	0.015	T	0.26916	-1.0089	10	0.10902	T	0.67	.	4.4414	0.11575	0.0822:0.3041:0.4735:0.1402	.	852	Q86YV5	SG223_HUMAN	N	852	ENSP00000330930:T852N;ENSP00000428054:T852N	ENSP00000330930:T852N	T	-	2	0	AC068353.1	8223147	1.000000	0.71417	0.998000	0.56505	0.943000	0.58893	2.129000	0.42055	0.793000	0.33875	0.563000	0.77884	ACC	.		0.572	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
SH2D4A	63898	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	19250999	19250999	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr8:19250999G>T	ENST00000265807.3	+	9	1630	c.1219G>T	c.(1219-1221)Ggc>Tgc	p.G407C	SH2D4A_ENST00000519207.1_Missense_Mutation_p.G407C|SH2D4A_ENST00000518040.1_Missense_Mutation_p.G362C	NM_001174160.1|NM_022071.3	NP_001167631.1|NP_071354.2	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	407	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				negative regulation of phosphatase activity (GO:0010923)	cytoplasm (GO:0005737)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|stomach(1)	16				Colorectal(111;0.0732)		CAGCTTCCTGGGCGTGGACCA	0.498																																					p.G407C		.											.	SH2D4A	90	0			c.G1219T						.						78.0	68.0	72.0					8																	19250999		2203	4300	6503	SO:0001583	missense	63898	exon9			TTCCTGGGCGTGG	AY190323	CCDS6009.1, CCDS55206.1	8p21	2013-02-14			ENSG00000104611	ENSG00000104611		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	26102	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 38"""	614968					Standard	NM_022071		Approved	FLJ20967, SH2A, PPP1R38	uc003wzc.3	Q9H788	OTTHUMG00000097005	ENST00000265807.3:c.1219G>T	8.37:g.19250999G>T	ENSP00000265807:p.Gly407Cys	205.0	2.0		194.0	111.0	NM_022071	B4DDR1|Q5XKC1|Q6NXE9|Q86YM2|Q96C88|Q9H7F7	Missense_Mutation	SNP	ENST00000265807.3	37	CCDS6009.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307968	0.81247	.	.	ENSG00000104611	ENST00000265807;ENST00000518040;ENST00000519207	T;T;T	0.66995	-0.24;-0.24;-0.24	5.89	5.02	0.67125	SH2 motif (4);	0.066655	0.64402	N	0.000007	D	0.86531	0.5955	H	0.94771	3.58	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90322	0.4345	10	0.72032	D	0.01	.	15.2528	0.73561	0.0:0.0:0.8585:0.1415	.	362;407	B4DDR1;Q9H788	.;SH24A_HUMAN	C	407;362;407	ENSP00000265807:G407C;ENSP00000429482:G362C;ENSP00000428684:G407C	ENSP00000265807:G407C	G	+	1	0	SH2D4A	19295279	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	8.241000	0.89816	1.486000	0.48398	-0.190000	0.12839	GGC	.		0.498	SH2D4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214094.1	NM_022071	
SH3BP2	6452	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	2814128	2814128	+	5'UTR	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr4:2814128G>A	ENST00000435136.2	+	0	98				SH3BP2_ENST00000442312.2_Missense_Mutation_p.A2T|SH3BP2_ENST00000452765.2_Intron|SH3BP2_ENST00000389838.2_Intron			P78314	3BP2_HUMAN	SH3-domain binding protein 2						positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)		SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	20				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		GAGCCGCATGGCCTCCCTGGG	0.697									Cherubism																												p.A2T		.											.	SH3BP2	514	0			c.G4A						.						8.0	15.0	13.0					4																	2814128		687	1572	2259	SO:0001623	5_prime_UTR_variant	6452	exon1	Familial Cancer Database	Familial Benign Giant-cell Tumor of the Jaw, Familial Multilocular Cystic Disease	CGCATGGCCTCCC	BC022996	CCDS33944.1, CCDS54715.1, CCDS54716.1	4p16.3	2013-02-14				ENSG00000087266		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	10825	protein-coding gene	gene with protein product		602104	"""Cherubism"""			9299232, 11381256	Standard	NM_003023		Approved	RES4-23, CRBM	uc003gfj.4	P78314		ENST00000435136.2:c.-81G>A	4.37:g.2814128G>A		212.0	1.0		214.0	92.0	NM_001145855	A6NNC2|B2R5R6|B4DT04|D3DVR0|D6R919|O00500|O15373|P78315	Missense_Mutation	SNP	ENST00000435136.2	37	CCDS33944.1	.	.	.	.	.	.	.	.	.	.	G	13.07	2.126344	0.37533	.	.	ENSG00000087266	ENST00000442312	T	0.79749	-1.3	3.47	3.47	0.39725	.	.	.	.	.	T	0.77538	0.4145	N	0.08118	0	0.80722	D	1	D	0.63880	0.993	D	0.72338	0.977	T	0.80301	-0.1440	9	0.87932	D	0	.	10.8192	0.46595	0.0:0.0:1.0:0.0	.	2	B4DT04	.	T	2	ENSP00000388152:A2T	ENSP00000388152:A2T	A	+	1	0	SH3BP2	2783926	1.000000	0.71417	0.805000	0.32314	0.149000	0.21700	3.047000	0.49854	2.255000	0.74692	0.485000	0.47835	GCC	.		0.697	SH3BP2-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000362401.1	NM_003023	
SIGLEC8	27181	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	51961640	51961640	+	Start_Codon_SNP	SNP	A	A	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:51961640A>T	ENST00000321424.3	-	1	68	c.2T>A	c.(1-3)aTg>aAg	p.M1K	SIGLEC8_ENST00000597352.1_5'Flank|SIGLEC8_ENST00000430817.1_Start_Codon_SNP_p.M1K|SIGLEC8_ENST00000340550.5_Start_Codon_SNP_p.M1K	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	1					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		cagcagcagcaTGTCTGGGTT	0.592																																					p.M1K		.											.	SIGLEC8	94	0			c.T2A						.						32.0	36.0	34.0					19																	51961640		2199	4296	6495	SO:0001582	initiator_codon_variant	27181	exon1			AGCAGCATGTCTG	AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.2T>A	19.37:g.51961640A>T	ENSP00000321077:p.Met1Lys	102.0	0.0		124.0	55.0	NM_014442	Q7Z728	Missense_Mutation	SNP	ENST00000321424.3	37	CCDS33086.1	.	.	.	.	.	.	.	.	.	.	.	8.083	0.772879	0.16051	.	.	ENSG00000105366	ENST00000430817;ENST00000321424;ENST00000340550	T;T;T	0.62941	1.34;-0.01;1.11	2.08	2.08	0.27032	.	.	.	.	.	T	0.57417	0.2052	.	.	.	0.09310	N	0.999996	D;D;D	0.62365	0.985;0.991;0.985	B;P;B	0.47102	0.336;0.537;0.336	T	0.50964	-0.8765	8	0.87932	D	0	.	6.1739	0.20433	1.0:0.0:0.0:0.0	.	1;1;1	C9JT30;Q9NYZ4-2;Q9NYZ4	.;.;SIGL8_HUMAN	K	1	ENSP00000389142:M1K;ENSP00000321077:M1K;ENSP00000339448:M1K	ENSP00000321077:M1K	M	-	2	0	SIGLEC8	56653452	0.015000	0.18098	0.016000	0.15963	0.361000	0.29550	0.224000	0.17738	1.183000	0.42943	0.416000	0.27883	ATG	.		0.592	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442	Missense_Mutation
SLC16A9	220963	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	10	61413875	61413875	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr10:61413875G>T	ENST00000395348.3	-	5	1545	c.909C>A	c.(907-909)aaC>aaA	p.N303K	SLC16A9_ENST00000395347.1_Missense_Mutation_p.N303K	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	303					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						AAAATACTTTGTTTTTAAAAA	0.373																																					p.N303K		.											.	SLC16A9	93	0			c.C909A						.						66.0	67.0	67.0					10																	61413875		2203	4300	6503	SO:0001583	missense	220963	exon5			TACTTTGTTTTTA	AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.909C>A	10.37:g.61413875G>T	ENSP00000378757:p.Asn303Lys	268.0	0.0		191.0	84.0	NM_194298	Q6ZMI2|Q9UFH8	Missense_Mutation	SNP	ENST00000395348.3	37	CCDS7256.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337746	0.60963	.	.	ENSG00000165449	ENST00000395348;ENST00000395347	D;D	0.82344	-1.6;-1.6	4.92	3.79	0.43588	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.089669	0.85682	D	0.000000	D	0.88687	0.6504	M	0.69823	2.125	0.50632	D	0.999886	D	0.64830	0.994	D	0.63793	0.918	D	0.89026	0.3438	10	0.49607	T	0.09	.	14.0905	0.64987	0.0872:0.0:0.9128:0.0	.	303	Q7RTY1	MOT9_HUMAN	K	303	ENSP00000378757:N303K;ENSP00000378756:N303K	ENSP00000378756:N303K	N	-	3	2	SLC16A9	61083881	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.900000	0.56295	2.261000	0.74972	0.591000	0.81541	AAC	.		0.373	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048174.2	NM_194298	
SLC4A1	6521	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	42335438	42335438	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr17:42335438C>A	ENST00000262418.6	-	11	1353	c.1198G>T	c.(1198-1200)Gca>Tca	p.A400S	SLC4A1_ENST00000471005.1_5'Flank|AC003043.1_ENST00000597382.1_Intron	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	400			Missing (in EL4; increased rigidity of the erythrocyte membrane leading to increased resistance to shear stress and increased resistance to P.falciparum). {ECO:0000269|PubMed:1538405, ECO:0000269|PubMed:1722314}.		anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		GGGCTGAATGCATCTGTGATG	0.612																																					p.A400S		.											.	SLC4A1	92	0			c.G1198T						.						85.0	84.0	85.0					17																	42335438		2203	4300	6503	SO:0001583	missense	6521	exon11			TGAATGCATCTGT		CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.1198G>T	17.37:g.42335438C>A	ENSP00000262418:p.Ala400Ser	112.0	1.0		158.0	53.0	NM_000342	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Missense_Mutation	SNP	ENST00000262418.6	37	CCDS11481.1	.	.	.	.	.	.	.	.	.	.	c	33	5.229228	0.95173	.	.	ENSG00000004939	ENST00000262418	D	0.83163	-1.69	4.82	4.82	0.62117	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91556	0.7333	M	0.83774	2.66	0.80722	D	1	D;P	0.89917	1.0;0.926	D;P	0.87578	0.998;0.842	D	0.92801	0.6256	10	0.87932	D	0	.	16.8247	0.85927	0.0:1.0:0.0:0.0	.	400;400	E2RVJ0;P02730	.;B3AT_HUMAN	S	400	ENSP00000262418:A400S	ENSP00000262418:A400S	A	-	1	0	SLC4A1	39690964	1.000000	0.71417	0.761000	0.31378	0.946000	0.59487	7.616000	0.83018	2.490000	0.84030	0.561000	0.74099	GCA	.		0.612	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1	NM_000342	
SLC6A2	6530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	55736246	55736246	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr16:55736246G>T	ENST00000379906.2	+	14	2097	c.1842G>T	c.(1840-1842)tgG>tgT	p.W614C	SLC6A2_ENST00000567238.1_Missense_Mutation_p.W509C|SLC6A2_ENST00000566163.1_Missense_Mutation_p.W569C|SLC6A2_ENST00000561820.1_Intron|SLC6A2_ENST00000414754.3_Missense_Mutation_p.W558C|SLC6A2_ENST00000568943.1_Missense_Mutation_p.W614C|SLC6A2_ENST00000219833.8_Intron	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	614					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)			breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	TGCAACACTGGCTGGCCATCT	0.607											OREG0023807	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.W614C		.											.	SLC6A2	526	0			c.G1842T						.						86.0	77.0	80.0					16																	55736246		2198	4300	6498	SO:0001583	missense	6530	exon15			ACACTGGCTGGCC		CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.1842G>T	16.37:g.55736246G>T	ENSP00000369237:p.Trp614Cys	298.0	1.0	1010	150.0	141.0	NM_001172501	B2R707|B4DX48|Q96KH8	Missense_Mutation	SNP	ENST00000379906.2	37	CCDS10754.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.676340	0.47886	.	.	ENSG00000103546	ENST00000414754;ENST00000537705;ENST00000379906	T	0.74737	-0.87	5.38	5.38	0.77491	.	.	.	.	.	T	0.77811	0.4186	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	1.0;0.991;0.967	D;P;P	0.74023	0.982;0.855;0.779	T	0.80446	-0.1379	9	0.87932	D	0	.	14.9917	0.71393	0.0:0.0:1.0:0.0	.	328;509;614	F5H0T4;B4DX48;P23975	.;.;SC6A2_HUMAN	C	614;328;614	ENSP00000369237:W614C	ENSP00000369237:W614C	W	+	3	0	SLC6A2	54293747	1.000000	0.71417	1.000000	0.80357	0.286000	0.27126	6.299000	0.72770	2.677000	0.91161	0.563000	0.77884	TGG	.		0.607	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2		
SLCO6A1	133482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	101816070	101816070	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr5:101816070C>G	ENST00000506729.1	-	2	598	c.427G>C	c.(427-429)Gag>Cag	p.E143Q	SLCO6A1_ENST00000379807.3_Missense_Mutation_p.E143Q|SLCO6A1_ENST00000514551.1_5'UTR|SLCO6A1_ENST00000379810.1_Missense_Mutation_p.E143Q|SLCO6A1_ENST00000389019.3_Missense_Mutation_p.E143Q|SLCO6A1_ENST00000513675.1_Missense_Mutation_p.E143Q			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		GCCAACTTCTCAATGGTTTTC	0.348																																					p.E143Q		.											.	SLCO6A1	96	0			c.G427C						.						115.0	116.0	116.0					5																	101816070		2203	4300	6503	SO:0001583	missense	133482	exon2			ACTTCTCAATGGT	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.427G>C	5.37:g.101816070C>G	ENSP00000421339:p.Glu143Gln	486.0	0.0		368.0	169.0	NM_173488	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	37	CCDS34206.1	.	.	.	.	.	.	.	.	.	.	C	11.47	1.648681	0.29336	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019;ENST00000513675;ENST00000379810	T;T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34;-1.34	4.56	-1.87	0.07737	Major facilitator superfamily domain, general substrate transporter (1);	1.362850	0.04600	N	0.398418	T	0.79257	0.4415	L	0.39566	1.225	0.09310	N	1	P;B;P	0.45569	0.859;0.011;0.861	P;B;P	0.60682	0.759;0.018;0.878	T	0.64635	-0.6361	10	0.16420	T	0.52	.	0.8792	0.01230	0.153:0.2692:0.2995:0.2782	.	143;143;143	Q86UG4-2;C9J020;Q86UG4	.;.;SO6A1_HUMAN	Q	143	ENSP00000421339:E143Q;ENSP00000369135:E143Q;ENSP00000373671:E143Q;ENSP00000421990:E143Q;ENSP00000369138:E143Q	ENSP00000369135:E143Q	E	-	1	0	SLCO6A1	101843969	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.482000	0.06544	-0.257000	0.09459	-1.045000	0.02358	GAG	.		0.348	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
SMTN	6525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	31487025	31487025	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr22:31487025C>G	ENST00000347557.2	+	10	1234	c.1016C>G	c.(1015-1017)tCt>tGt	p.S339C	SMTN_ENST00000404574.1_5'Flank|SMTN_ENST00000358743.1_Missense_Mutation_p.S339C|SMTN_ENST00000333137.7_Missense_Mutation_p.S339C	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	339					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						AAGTTCACATCTGATTCTCCT	0.632																																					p.S395C		.											.	SMTN	154	0			c.C1184G						.						119.0	112.0	115.0					22																	31487025		2203	4300	6503	SO:0001583	missense	6525	exon9			TCACATCTGATTC	AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.1016C>G	22.37:g.31487025C>G	ENSP00000328635:p.Ser339Cys	247.0	0.0		261.0	109.0	NM_001207018	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Missense_Mutation	SNP	ENST00000347557.2	37	CCDS13886.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.983413	0.35036	.	.	ENSG00000183963	ENST00000358743;ENST00000347557;ENST00000333137;ENST00000329852;ENST00000404496	T;T;T	0.71341	-0.13;-0.56;-0.56	5.22	3.12	0.35913	.	0.000000	0.33496	N	0.004859	T	0.78585	0.4306	L	0.54323	1.7	0.49389	D	0.999786	D;D;D;D;D;D	0.89917	0.999;1.0;0.999;1.0;0.999;1.0	D;D;D;D;D;D	0.79784	0.993;0.985;0.993;0.96;0.993;0.98	T	0.78460	-0.2195	10	0.72032	D	0.01	-4.3699	10.7585	0.46251	0.0:0.8412:0.0:0.1588	.	395;393;331;339;339;339	E7ETT8;B4E229;B5MC56;E7EWD0;P53814;P53814-5	.;.;.;.;SMTN_HUMAN;.	C	339;339;339;339;331	ENSP00000351593:S339C;ENSP00000328635:S339C;ENSP00000329532:S339C	ENSP00000329393:S339C	S	+	2	0	SMTN	29817025	0.623000	0.27094	0.016000	0.15963	0.152000	0.21847	1.474000	0.35398	0.710000	0.31997	-0.339000	0.08088	TCT	.		0.632	SMTN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321766.1	NM_134270	
SP110	3431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	231079722	231079722	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:231079722G>C	ENST00000358662.4	-	3	337	c.259C>G	c.(259-261)Caa>Gaa	p.Q87E	SP110_ENST00000392048.3_Missense_Mutation_p.Q87E|SP110_ENST00000258382.5_Missense_Mutation_p.Q87E|SP110_ENST00000540870.1_Missense_Mutation_p.Q93E|SP110_ENST00000258381.6_Missense_Mutation_p.Q87E|SP110_ENST00000338556.3_5'UTR|SP110_ENST00000486146.2_5'Flank	NM_004509.3	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein	87	HSR. {ECO:0000255|PROSITE- ProRule:PRU00747}.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(4)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		AGGTTAATTTGACTGAACAAT	0.408																																					p.Q93E		.											.	SP110	155	0			c.C277G						.						100.0	99.0	99.0					2																	231079722		2203	4300	6503	SO:0001583	missense	3431	exon4			TAATTTGACTGAA	L22343	CCDS2474.1, CCDS2475.1, CCDS2476.1, CCDS54435.1	2q37.1	2014-09-17	2001-12-19	2001-12-20	ENSG00000135899	ENSG00000135899			5401	protein-coding gene	gene with protein product		604457	"""interferon-induced protein 41, 30kD"""	IFI41, IFI75		7693701, 10388521	Standard	NM_080424		Approved		uc002vqg.3	Q9HB58	OTTHUMG00000133204	ENST00000358662.4:c.259C>G	2.37:g.231079722G>C	ENSP00000351488:p.Gln87Glu	233.0	0.0		232.0	102.0	NM_001185015	B4DVI4|F5H1M1|Q14976|Q14977|Q53TG2|Q8WUZ6|Q9HCT8	Missense_Mutation	SNP	ENST00000358662.4	37	CCDS2474.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.758235	0.00657	.	.	ENSG00000135899	ENST00000258381;ENST00000358662;ENST00000392048;ENST00000258382;ENST00000540870;ENST00000409815;ENST00000455674;ENST00000416610	D;D;D;D;D;D;D;D	0.93712	-3.27;-3.27;-3.27;-3.27;-3.27;-3.27;-3.27;-3.27	4.2	2.31	0.28768	Sp100 (2);	1.304430	0.05488	N	0.556123	D	0.84257	0.5432	N	0.04880	-0.145	0.40754	D	0.982946	B;B;B;B	0.30563	0.009;0.009;0.285;0.004	B;B;B;B	0.31495	0.005;0.005;0.131;0.016	T	0.72127	-0.4384	10	0.19590	T	0.45	.	6.8514	0.24016	0.0:0.1867:0.6028:0.2104	.	87;93;87;87	G5E9C0;F5H1M1;Q9HB58;Q9HB58-6	.;.;SP110_HUMAN;.	E	87;87;87;87;93;87;41;87	ENSP00000258381:Q87E;ENSP00000351488:Q87E;ENSP00000375902:Q87E;ENSP00000258382:Q87E;ENSP00000439558:Q93E;ENSP00000387172:Q87E;ENSP00000393992:Q41E;ENSP00000399978:Q87E	ENSP00000258381:Q87E	Q	-	1	0	SP110	230787966	0.797000	0.28877	0.502000	0.27614	0.263000	0.26337	0.900000	0.28431	0.650000	0.30769	-0.165000	0.13383	CAA	.		0.408	SP110-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000332414.1	NM_080424	
SPATA13	221178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	24797411	24797411	+	Intron	SNP	A	A	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr13:24797411A>T	ENST00000382095.4	+	2	185				SPATA13_ENST00000424834.2_Missense_Mutation_p.K115M|RP11-307N16.6_ENST00000382141.4_Missense_Mutation_p.K115M|SPATA13_ENST00000382108.3_Missense_Mutation_p.K115M	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13						cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		GGATCCTTTAAGAAACTGAAG	0.577																																					p.K115M		.											.	SPATA13	229	0			c.A344T						.						29.0	33.0	32.0					13																	24797411		692	1591	2283	SO:0001627	intron_variant	221178	exon2			CCTTTAAGAAACT	AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.-222-26204A>T	13.37:g.24797411A>T		45.0	0.0		58.0	27.0	NM_001166271	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	ENST00000382095.4	37	CCDS9305.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.86|18.86	3.713979|3.713979	0.68730|0.68730	.|.	.|.	ENSG00000182957|ENSG00000182957	ENST00000382108|ENST00000424834	D|.	0.86097|.	-2.07|.	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	0.000000|.	0.39544|.	U|.	0.001339|.	T|.	0.62134|.	0.2403|.	L|L	0.47190|0.47190	1.495|1.495	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.59799|.	-0.7386|.	8|.	0.87932|.	D|.	0|.	.|.	14.6861|14.6861	0.69049|0.69049	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	M|Y	115|152	ENSP00000371542:K115M|.	ENSP00000371542:K115M|.	K|X	+|+	2|3	0|2	SPATA13|SPATA13	23695411|23695411	1.000000|1.000000	0.71417|0.71417	0.069000|0.069000	0.20011|0.20011	0.637000|0.637000	0.38172|0.38172	7.857000|7.857000	0.86963|0.86963	2.136000|2.136000	0.66102|0.66102	0.392000|0.392000	0.25879|0.25879	AAG|TAA	.		0.577	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044180.2	NM_153023	
SPATA5L1	79029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	45713263	45713263	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr15:45713263A>G	ENST00000305560.6	+	8	2216	c.2117A>G	c.(2116-2118)gAa>gGa	p.E706G	SPATA5L1_ENST00000533841.1_3'UTR	NM_024063.2	NP_076968.2	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1	706						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		GCTCTGCAAGAAAATGGACTA	0.373																																					p.E706G		.											.	SPATA5L1	94	0			c.A2117G						.						59.0	60.0	59.0					15																	45713263		2198	4298	6496	SO:0001583	missense	79029	exon8			TGCAAGAAAATGG	AK023232	CCDS10123.1	15q15.1	2010-04-21			ENSG00000171763	ENSG00000171763		"""ATPases / AAA-type"""	28762	protein-coding gene	gene with protein product						12477932	Standard	NM_024063		Approved	MGC5347, FLJ12286	uc001zve.3	Q9BVQ7	OTTHUMG00000131425	ENST00000305560.6:c.2117A>G	15.37:g.45713263A>G	ENSP00000305494:p.Glu706Gly	99.0	0.0		84.0	41.0	NM_024063	C9JHR5|Q9H8W7|Q9HA41	Missense_Mutation	SNP	ENST00000305560.6	37	CCDS10123.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.0|25.0	4.589728|4.589728	0.86851|0.86851	.|.	.|.	ENSG00000171763|ENSG00000171763	ENST00000305560|ENST00000531624	D|.	0.95482|.	-3.72|.	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	0.056632|.	0.64402|.	D|.	0.000001|.	T|T	0.60805|0.60805	0.2297|0.2297	L|L	0.43757|0.43757	1.38|1.38	0.80722|0.80722	D|D	1|1	P|.	0.36282|.	0.546|.	B|.	0.37387|.	0.248|.	T|T	0.57963|0.57963	-0.7720|-0.7720	10|5	0.87932|.	D|.	0|.	-28.6605|-28.6605	14.603|14.603	0.68456|0.68456	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	706|.	Q9BVQ7|.	SPA5L_HUMAN|.	G|E	706|211	ENSP00000305494:E706G|.	ENSP00000305494:E706G|.	E|K	+|+	2|1	0|0	SPATA5L1|SPATA5L1	43500555|43500555	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.849000|0.849000	0.48306|0.48306	7.021000|7.021000	0.76425|0.76425	2.127000|2.127000	0.65507|0.65507	0.459000|0.459000	0.35465|0.35465	GAA|AAA	.		0.373	SPATA5L1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254218.1	NM_024063	
SPINK5	11005	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	147503432	147503432	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr5:147503432delG	ENST00000256084.7	+	27	2617	c.2575delG	c.(2575-2577)ggafs	p.G859fs	SPINK5_ENST00000359874.3_Frame_Shift_Del_p.G859fs|SPINK5_ENST00000398454.1_Frame_Shift_Del_p.G859fs	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	859	Kazal-like 13. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGAGAAATGGAAAGCTTAT	0.398																																					p.G859fs		.											.	SPINK5	138	0			c.2575delG						.						109.0	107.0	108.0					5																	147503432		1895	4126	6021	SO:0001589	frameshift_variant	11005	exon27			AGAAATGGAAAGC	AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.2575delG	5.37:g.147503432delG	ENSP00000256084:p.Gly859fs	189.0	0.0		170.0	93.0	NM_001127699	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Frame_Shift_Del	DEL	ENST00000256084.7	37	CCDS43382.1																																																																																			.		0.398	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000259215.2	NM_001127698	
SPIRE1	56907	hgsc.bcm.edu;broad.mit.edu	37	18	12453128	12453128	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr18:12453128delA	ENST00000409402.4	-	14	2053	c.1786delT	c.(1786-1788)tgtfs	p.C597fs	SPIRE1_ENST00000464481.1_5'UTR|SPIRE1_ENST00000383356.2_Frame_Shift_Del_p.C424fs|SPIRE1_ENST00000453447.2_Frame_Shift_Del_p.C463fs|SPIRE1_ENST00000309836.5_Frame_Shift_Del_p.C386fs|SPIRE1_ENST00000410092.3_Frame_Shift_Del_p.C583fs	NM_001128626.1	NP_001122098.1			spire-type actin nucleation factor 1											breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)	28						GTTCGGCAACAAAAGCAGAGC	0.313																																					p.C596fs		.											.	SPIRE1	90	0			c.1786delT						.						51.0	54.0	53.0					18																	12453128		2202	4300	6502	SO:0001589	frameshift_variant	56907	exon14			GGCAACAAAAGCA	AL833817	CCDS32790.2, CCDS45829.1, CCDS45830.1	18p11.21	2013-08-27	2013-08-27		ENSG00000134278	ENSG00000134278			30622	protein-coding gene	gene with protein product		609216	"""spire homolog 1 (Drosophila)"", ""spire family actin nucleation factor 1"""			10574461, 11747823	Standard	NM_001128626		Approved	spir-1, KIAA1135	uc002kre.3	Q08AE8	OTTHUMG00000153940	ENST00000409402.4:c.1786delT	18.37:g.12453128delA	ENSP00000387266:p.Cys597fs	283.0	0.0		232.0	22.0	NM_001128626		Frame_Shift_Del	DEL	ENST00000409402.4	37	CCDS45829.1																																																																																			.		0.313	SPIRE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333109.2	XM_290818	
ST14	6768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	130058534	130058534	+	Silent	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr11:130058534C>T	ENST00000278742.5	+	3	769	c.351C>T	c.(349-351)gcC>gcT	p.A117A		NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)	117	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	TAAGCCTGGCCAGCAAGGTGA	0.572																																					p.A117A		.											.	ST14	94	0			c.C351T						.						99.0	89.0	92.0					11																	130058534		2201	4297	6498	SO:0001819	synonymous_variant	6768	exon3			CCTGGCCAGCAAG	AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.351C>T	11.37:g.130058534C>T		62.0	0.0		89.0	37.0	NM_021978	Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Silent	SNP	ENST00000278742.5	37	CCDS8487.1																																																																																			.		0.572	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386119.1		
STAC	6769	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	36526541	36526541	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr3:36526541A>T	ENST00000273183.3	+	4	862	c.562A>T	c.(562-564)Atg>Ttg	p.M188L	STAC_ENST00000457375.2_Intron|STAC_ENST00000476388.1_3'UTR	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	188					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						TAAAGAAGTTATGCCCATTGG	0.488																																					p.M188L		.											.	STAC	94	0			c.A562T						.						188.0	167.0	174.0					3																	36526541		2203	4300	6503	SO:0001583	missense	6769	exon4			GAAGTTATGCCCA	D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.562A>T	3.37:g.36526541A>T	ENSP00000273183:p.Met188Leu	352.0	2.0		310.0	134.0	NM_003149	B2R8S8	Missense_Mutation	SNP	ENST00000273183.3	37	CCDS2662.1	.	.	.	.	.	.	.	.	.	.	A	10.78	1.445444	0.25987	.	.	ENSG00000144681	ENST00000273183;ENST00000544687	T	0.74209	-0.82	5.57	4.35	0.52113	.	0.038347	0.85682	D	0.000000	T	0.75250	0.3824	L	0.43152	1.355	0.80722	D	1	D	0.53462	0.96	D	0.64321	0.924	T	0.70970	-0.4727	10	0.02654	T	1	.	12.4523	0.55684	0.8613:0.1387:0.0:0.0	.	188	Q99469	STAC_HUMAN	L	188;120	ENSP00000273183:M188L	ENSP00000273183:M188L	M	+	1	0	STAC	36501545	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.598000	0.67585	2.254000	0.74563	0.482000	0.46254	ATG	.		0.488	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253338.2	NM_003149	
STARD3	10948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	37814042	37814042	+	Silent	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr17:37814042C>T	ENST00000336308.5	+	4	530	c.312C>T	c.(310-312)ttC>ttT	p.F104F	STARD3_ENST00000578232.1_3'UTR|STARD3_ENST00000580611.1_Silent_p.F78F|STARD3_ENST00000544210.2_Silent_p.F104F|STARD3_ENST00000394250.4_Silent_p.F104F	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3	104	MENTAL. {ECO:0000255|PROSITE- ProRule:PRU00770}.				cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			TGGCCTTCTTCCGCTTCTCTG	0.657																																					p.F104F		.											.	STARD3	90	0			c.C312T						.						105.0	112.0	110.0					17																	37814042		2203	4300	6503	SO:0001819	synonymous_variant	10948	exon4			CTTCTTCCGCTTC		CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.312C>T	17.37:g.37814042C>T		284.0	0.0		427.0	254.0	NM_006804	A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	Silent	SNP	ENST00000336308.5	37	CCDS11341.1																																																																																			.		0.657	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256933.1		
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	152765606	152765606	+	Silent	SNP	A	A	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr6:152765606A>T	ENST00000367255.5	-	30	4378	c.3777T>A	c.(3775-3777)gcT>gcA	p.A1259A	SYNE1_ENST00000448038.1_Silent_p.A1266A|SYNE1_ENST00000367248.3_Silent_p.A1249A|SYNE1_ENST00000413186.2_Silent_p.A1259A|SYNE1_ENST00000367253.4_Silent_p.A1259A|SYNE1_ENST00000341594.5_Silent_p.A1325A|SYNE1_ENST00000265368.4_Silent_p.A1259A|SYNE1_ENST00000423061.1_Silent_p.A1266A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1259					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGATCTTCTCAGCTTGTTCCT	0.368										HNSCC(10;0.0054)																											p.A1266A		.											.	SYNE1	607	0			c.T3798A						.						126.0	124.0	124.0					6																	152765606		2203	4300	6503	SO:0001819	synonymous_variant	23345	exon30			CTTCTCAGCTTGT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3777T>A	6.37:g.152765606A>T		310.0	0.0		253.0	120.0	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																			.		0.368	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	152765624	152765624	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr6:152765624T>G	ENST00000367255.5	-	30	4360	c.3759A>C	c.(3757-3759)aaA>aaC	p.K1253N	SYNE1_ENST00000448038.1_Missense_Mutation_p.K1260N|SYNE1_ENST00000367248.3_Missense_Mutation_p.K1243N|SYNE1_ENST00000413186.2_Missense_Mutation_p.K1253N|SYNE1_ENST00000367253.4_Missense_Mutation_p.K1253N|SYNE1_ENST00000341594.5_Missense_Mutation_p.K1319N|SYNE1_ENST00000265368.4_Missense_Mutation_p.K1253N|SYNE1_ENST00000423061.1_Missense_Mutation_p.K1260N	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1253					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTGGACTTCTTTAGAGCCAG	0.368										HNSCC(10;0.0054)																											p.K1260N		.											.	SYNE1	607	0			c.A3780C						.						107.0	106.0	106.0					6																	152765624		2203	4300	6503	SO:0001583	missense	23345	exon30			GACTTCTTTAGAG	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3759A>C	6.37:g.152765624T>G	ENSP00000356224:p.Lys1253Asn	329.0	0.0		255.0	115.0	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	19.07	3.756884	0.69648	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186	T;T;T;T;T;D;D;D	0.89050	0.48;0.48;0.39;0.48;0.54;-2.35;-2.46;-2.46	5.96	-0.955	0.10356	.	0.371038	0.25663	N	0.029121	T	0.80644	0.4662	L	0.55481	1.735	0.80722	D	1	B;P;P;P;P;P	0.52463	0.418;0.756;0.817;0.953;0.756;0.842	B;B;P;P;B;P	0.49226	0.074;0.398;0.474;0.597;0.398;0.603	T	0.77115	-0.2707	10	0.20519	T	0.43	.	11.813	0.52194	0.0:0.4208:0.0:0.5791	.	1236;1253;1243;1253;1253;1260	B3W695;Q8NF91;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.	N	1253;1260;1253;1260;1319;1253;1243;1253	ENSP00000356224:K1253N;ENSP00000396024:K1260N;ENSP00000265368:K1253N;ENSP00000390975:K1260N;ENSP00000341887:K1319N;ENSP00000356222:K1253N;ENSP00000356217:K1243N;ENSP00000414510:K1253N	ENSP00000265368:K1253N	K	-	3	2	SYNE1	152807317	0.996000	0.38824	0.960000	0.40013	0.991000	0.79684	0.283000	0.18846	-0.377000	0.07930	0.533000	0.62120	AAA	.		0.368	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNRG	11276	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	35880688	35880688	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr17:35880688C>G	ENST00000339208.6	-	20	3870	c.3730G>C	c.(3730-3732)Gag>Cag	p.E1244Q	SYNRG_ENST00000394378.2_Missense_Mutation_p.E1189Q|SYNRG_ENST00000591288.1_Missense_Mutation_p.E1038Q|SYNRG_ENST00000345615.4_Missense_Mutation_p.E1166Q|SYNRG_ENST00000585472.1_Missense_Mutation_p.E1165Q|SYNRG_ENST00000502449.2_Missense_Mutation_p.E1121Q|SYNRG_ENST00000346661.4_Missense_Mutation_p.E1244Q	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	1244					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						CAGGCAAGCTCCTGAGCATTT	0.512																																					p.E1244Q		.											.	SYNRG	92	0			c.G3730C						.						80.0	81.0	80.0					17																	35880688		2203	4300	6503	SO:0001583	missense	11276	exon20			CAAGCTCCTGAGC	AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.3730G>C	17.37:g.35880688C>G	ENSP00000343610:p.Glu1244Gln	158.0	0.0		208.0	71.0	NM_007247	A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Missense_Mutation	SNP	ENST00000339208.6	37	CCDS11321.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.915251	0.92178	.	.	ENSG00000006114	ENST00000346661;ENST00000339208;ENST00000345615;ENST00000502449;ENST00000394378	T;T	0.48836	1.4;0.8	5.56	5.56	0.83823	.	0.109912	0.64402	D	0.000010	T	0.65460	0.2693	M	0.61703	1.905	0.58432	D	0.999999	P;D;D;B;D;D	0.63880	0.742;0.993;0.993;0.309;0.986;0.986	B;D;D;B;P;P	0.63703	0.363;0.917;0.917;0.149;0.87;0.87	T	0.60821	-0.7187	10	0.33940	T	0.23	-14.4844	19.5168	0.95168	0.0:1.0:0.0:0.0	.	1038;1166;1189;1166;1244;1244	B7ZKZ2;Q9UMZ2-3;A8MWU4;Q9UMZ2-4;Q9UMZ2-5;Q9UMZ2	.;.;.;.;.;SYNRG_HUMAN	Q	1244;1038;1244;1166;1189	ENSP00000005279:E1244Q;ENSP00000377903:E1189Q	ENSP00000343610:E1038Q	E	-	1	0	SYNRG	32954801	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	4.894000	0.63206	2.621000	0.88768	0.591000	0.81541	GAG	.		0.512	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256811.2	NM_007247	
TEX19	400629	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	80320463	80320463	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr17:80320463C>G	ENST00000333437.4	+	2	747	c.437C>G	c.(436-438)cCc>cGc	p.P146R		NM_207459.3	NP_997342.1	Q8NA77	TEX19_HUMAN	testis expressed 19	146					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	6						CAGGGTCTTCCCTGGAGATTT	0.602																																					p.P146R		.											.	TEX19	90	0			c.C437G						.						52.0	52.0	52.0					17																	80320463		2203	4297	6500	SO:0001583	missense	400629	exon2			GTCTTCCCTGGAG	BC016939	CCDS11809.1	17q25.3	2009-04-14			ENSG00000182459	ENSG00000182459			33802	protein-coding gene	gene with protein product		615647					Standard	NM_207459		Approved	FLJ35767	uc002keq.3	Q8NA77	OTTHUMG00000132857	ENST00000333437.4:c.437C>G	17.37:g.80320463C>G	ENSP00000331500:p.Pro146Arg	160.0	0.0		215.0	68.0	NM_207459		Missense_Mutation	SNP	ENST00000333437.4	37	CCDS11809.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.012124	0.35511	.	.	ENSG00000182459	ENST00000333437	.	.	.	3.55	3.55	0.40652	.	.	.	.	.	T	0.63861	0.2547	L	0.34521	1.04	0.38363	D	0.944661	D	0.89917	1.0	D	0.91635	0.999	T	0.68648	-0.5353	8	0.87932	D	0	-18.5464	10.8916	0.46998	0.0:1.0:0.0:0.0	.	146	Q8NA77	TEX19_HUMAN	R	146	.	ENSP00000331500:P146R	P	+	2	0	TEX19	77913752	0.963000	0.33076	0.992000	0.48379	0.044000	0.14063	1.568000	0.36418	2.265000	0.75225	0.563000	0.77884	CCC	.		0.602	TEX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256331.1	NM_207459	
THADA	63892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	43813540	43813540	+	Splice_Site	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:43813540C>A	ENST00000405006.4	-	7	884	c.533G>T	c.(532-534)aGa>aTa	p.R178I	THADA_ENST00000415080.2_5'UTR|THADA_ENST00000405975.2_Splice_Site_p.R178I|THADA_ENST00000404790.1_Splice_Site_p.R178I|THADA_ENST00000403856.1_Splice_Site_p.R178I|THADA_ENST00000402360.2_Splice_Site_p.R178I	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	178										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TAGCACTTGCCTATTTTCTTC	0.313																																					p.R178I		.											.	THADA	228	0			c.G533T						.						63.0	56.0	58.0					2																	43813540		1811	4072	5883	SO:0001630	splice_region_variant	63892	exon7			ACTTGCCTATTTT	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.533+1G>T	2.37:g.43813540C>A		513.0	1.0		475.0	258.0	NM_001083953	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	ENST00000405006.4	37	CCDS46268.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.477815	0.63849	.	.	ENSG00000115970	ENST00000405975;ENST00000356975;ENST00000405006;ENST00000402360;ENST00000404790;ENST00000403856	T;T;T;T;T	0.34859	2.79;2.79;1.38;1.37;1.34	5.35	5.35	0.76521	.	0.061993	0.64402	D	0.000009	T	0.55033	0.1895	L	0.56769	1.78	0.80722	D	1	D;P;P;D	0.76494	0.978;0.956;0.939;0.999	P;P;P;D	0.66196	0.731;0.742;0.745;0.942	T	0.51284	-0.8725	9	.	.	.	.	16.8609	0.86018	0.0:1.0:0.0:0.0	.	178;178;178;178	B5MC89;Q8IY32;Q6YHU6-5;Q6YHU6	.;.;.;THADA_HUMAN	I	178	ENSP00000386088:R178I;ENSP00000385995:R178I;ENSP00000385441:R178I;ENSP00000384266:R178I;ENSP00000385469:R178I	.	R	-	2	0	THADA	43667044	1.000000	0.71417	1.000000	0.80357	0.317000	0.28152	4.341000	0.59335	2.493000	0.84123	0.655000	0.94253	AGA	.		0.313	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065	Missense_Mutation
TIAL1	7073	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	121337034	121337034	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr10:121337034delT	ENST00000436547.2	-	9	710	c.666delA	c.(664-666)agafs	p.R222fs	TIAL1_ENST00000369092.4_Frame_Shift_Del_p.R99fs|TIAL1_ENST00000463089.2_5'Flank|TIAL1_ENST00000369093.2_Frame_Shift_Del_p.R239fs	NM_003252.3	NP_003243.1	Q01085	TIAR_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein-like 1	222	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|defense response (GO:0006952)|germ cell development (GO:0007281)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell division (GO:0017145)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	13		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)		AGAATGTCTGTCTCATAAGCT	0.328																																					p.R239fs		.											.	TIAL1	91	0			c.717delA						.						85.0	84.0	84.0					10																	121337034		2202	4300	6502	SO:0001589	frameshift_variant	7073	exon9			TGTCTGTCTCATA	AL833106	CCDS7613.1, CCDS31295.1	10q	2013-02-12	2001-11-28		ENSG00000151923	ENSG00000151923		"""RNA binding motif (RRM) containing"""	11804	protein-coding gene	gene with protein product		603413	"""TIA1 cytotoxic granule-associated RNA-binding protein-like 1"""			1326761	Standard	XM_005270108		Approved	TIAR	uc001lej.1	Q01085	OTTHUMG00000019156	ENST00000436547.2:c.666delA	10.37:g.121337034delT	ENSP00000394902:p.Arg222fs	155.0	0.0		153.0	65.0	NM_001033925	A8K3T0|A8K4L9	Frame_Shift_Del	DEL	ENST00000436547.2	37	CCDS7613.1																																																																																			.		0.328	TIAL1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050672.2	NM_022333, NM_003252	
TLE6	79816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	2989558	2989558	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:2989558G>A	ENST00000246112.4	+	13	1220	c.1019G>A	c.(1018-1020)tGc>tAc	p.C340Y	TLE6_ENST00000478073.2_3'UTR|TLE6_ENST00000452088.1_Missense_Mutation_p.C217Y	NM_001143986.1	NP_001137458.1	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6	340					regulation of transcription, DNA-templated (GO:0006355)	cell cortex (GO:0005938)|nucleus (GO:0005634)|protein complex (GO:0043234)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCGCACCTGCCTGCTGTCC	0.657																																					p.C340Y		.											.	TLE6	91	0			c.G1019A						.						23.0	25.0	24.0					19																	2989558		2202	4296	6498	SO:0001583	missense	79816	exon13			GCACCTGCCTGCT	AK024071	CCDS12100.1, CCDS45910.1	19p13.3	2014-03-07	2014-03-07		ENSG00000104953	ENSG00000104953		"""WD repeat domain containing"""	30788	protein-coding gene	gene with protein product		612399	"""transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)"""			11486032	Standard	NM_024760		Approved	FLJ14009, GRG6	uc002lwt.2	Q9H808	OTTHUMG00000156793	ENST00000246112.4:c.1019G>A	19.37:g.2989558G>A	ENSP00000246112:p.Cys340Tyr	67.0	0.0		49.0	15.0	NM_001143986	J3KMZ1	Missense_Mutation	SNP	ENST00000246112.4	37	CCDS45910.1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.522465	0.44866	.	.	ENSG00000104953	ENST00000447920;ENST00000246112;ENST00000452088;ENST00000441927	T;T	0.11385	2.78;2.78	3.15	3.15	0.36227	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.31009	0.0783	M	0.82716	2.605	0.58432	D	0.999998	D;D;D;D	0.71674	0.998;0.995;0.993;0.993	D;D;D;D	0.66847	0.947;0.914;0.911;0.911	T	0.08554	-1.0716	9	0.87932	D	0	.	10.0139	0.42003	0.0:0.0:1.0:0.0	.	340;198;217;217	C9JGZ7;Q9Y6S1;Q9H808;Q6PJM9	.;.;TLE6_HUMAN;.	Y	340;340;217;217	ENSP00000246112:C340Y;ENSP00000406893:C217Y	ENSP00000246112:C340Y	C	+	2	0	TLE6	2940558	1.000000	0.71417	1.000000	0.80357	0.180000	0.23129	7.561000	0.82288	2.083000	0.62718	0.505000	0.49811	TGC	.		0.657	TLE6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345996.3	NM_024760	
TIMM44	10469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	7996055	7996055	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:7996055G>C	ENST00000270538.3	-	10	1274	c.1006C>G	c.(1006-1008)Ctt>Gtt	p.L336V	TIMM44_ENST00000598968.1_5'UTR	NM_006351.3	NP_006342.2	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44 homolog (yeast)	336					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			NS(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	17						AGAATGTCAAGCTCTCCAGAA	0.433																																					p.L336V		.											.	TIMM44	91	0			c.C1006G						.						110.0	106.0	108.0					19																	7996055		2203	4300	6503	SO:0001583	missense	10469	exon10			TGTCAAGCTCTCC	AF026030	CCDS12192.1	19p13.3-p13.2	2008-07-04				ENSG00000104980			17316	protein-coding gene	gene with protein product		605058				10848612, 10339406	Standard	NM_006351		Approved	TIM44	uc002miz.3	O43615		ENST00000270538.3:c.1006C>G	19.37:g.7996055G>C	ENSP00000270538:p.Leu336Val	370.0	1.0		271.0	89.0	NM_006351	A8K0R9|D6W664|Q8N193	Missense_Mutation	SNP	ENST00000270538.3	37	CCDS12192.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.992637	0.74703	.	.	ENSG00000104980	ENST00000270538	T	0.78364	-1.17	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.78541	0.4299	L	0.39397	1.21	0.80722	D	1	P	0.48230	0.907	P	0.55871	0.786	T	0.73940	-0.3824	10	0.16896	T	0.51	-10.2862	14.7762	0.69734	0.0:0.0:1.0:0.0	.	336	O43615	TIM44_HUMAN	V	336	ENSP00000270538:L336V	ENSP00000270538:L336V	L	-	1	0	TIMM44	7902055	1.000000	0.71417	0.989000	0.46669	0.990000	0.78478	5.978000	0.70501	2.084000	0.62774	0.556000	0.70494	CTT	.		0.433	TIMM44-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461596.3		
TLN1	7094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	35697837	35697837	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr9:35697837C>T	ENST00000314888.9	-	57	7930	c.7577G>A	c.(7576-7578)cGg>cAg	p.R2526Q	TLN1_ENST00000540444.1_Missense_Mutation_p.R2414Q	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2526	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTGCTGCTGCCGGATCTGGGC	0.542											OREG0019174	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R2526Q		.											.	TLN1	609	0			c.G7577A						.						95.0	90.0	92.0					9																	35697837		2203	4300	6503	SO:0001583	missense	7094	exon57			TGCTGCCGGATCT	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.7577G>A	9.37:g.35697837C>T	ENSP00000316029:p.Arg2526Gln	426.0	0.0	857	550.0	187.0	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	C	32	5.140189	0.94560	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.68331	-0.32;-0.32	5.09	5.09	0.68999	I/LWEQ (4);	0.065800	0.64402	D	0.000007	D	0.86867	0.6036	M	0.93720	3.45	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90160	0.4227	10	0.87932	D	0	-11.3857	18.6738	0.91521	0.0:1.0:0.0:0.0	.	2526	Q9Y490	TLN1_HUMAN	Q	2526;2414	ENSP00000316029:R2526Q;ENSP00000442981:R2414Q	ENSP00000316029:R2526Q	R	-	2	0	TLN1	35687837	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.587000	0.82613	2.633000	0.89246	0.563000	0.77884	CGG	.		0.542	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
TMEM132E	124842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	32959819	32959819	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr17:32959819C>T	ENST00000321639.5	+	7	1637	c.1309C>T	c.(1309-1311)Ccc>Tcc	p.P437S		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	437						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		CCTCAATGCTCCCCTGGAAAT	0.577																																					p.P437S		.											.	TMEM132E	68	0			c.C1309T						.						202.0	173.0	183.0					17																	32959819		2203	4300	6503	SO:0001583	missense	124842	exon7			AATGCTCCCCTGG	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.1309C>T	17.37:g.32959819C>T	ENSP00000316532:p.Pro437Ser	190.0	0.0		262.0	74.0	NM_207313	Q8WUF4|Q8WVA5	Missense_Mutation	SNP	ENST00000321639.5	37	CCDS11283.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962487	0.74016	.	.	ENSG00000181291	ENST00000321639	T	0.19105	2.17	4.61	4.61	0.57282	.	0.108387	0.64402	D	0.000005	T	0.22513	0.0543	L	0.39245	1.2	0.80722	D	1	P	0.46142	0.873	P	0.47299	0.543	T	0.01879	-1.1255	10	0.08599	T	0.76	-27.8359	16.6219	0.84932	0.0:1.0:0.0:0.0	.	437	Q6IEE7	T132E_HUMAN	S	437	ENSP00000316532:P437S	ENSP00000316532:P437S	P	+	1	0	TMEM132E	29983932	0.985000	0.35326	0.997000	0.53966	0.959000	0.62525	3.235000	0.51328	2.388000	0.81334	0.551000	0.68910	CCC	.		0.577	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	NM_207313	
TMEM244	253582	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	130166922	130166922	+	Missense_Mutation	SNP	C	C	T	rs143949103		TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr6:130166922C>T	ENST00000368143.1	-	2	191	c.109G>A	c.(109-111)Gtg>Atg	p.V37M	TMEM244_ENST00000438392.1_Missense_Mutation_p.V37M	NM_001010876.1	NP_001010876.1	Q5VVB8	TM244_HUMAN	transmembrane protein 244	37						integral component of membrane (GO:0016021)		p.V37M(1)									TCAAACATCACGCAGCCCATG	0.358													C|||	1	0.000199681	0.0	0.0	5008	,	,		18431	0.001		0.0	False		,,,				2504	0.0				p.V37M		.											C6orf191,colon,carcinoma,0	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G109A						.	C	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	111.0	103.0	106.0		109	-2.4	0.0	6	dbSNP_134	106	0,8600		0,0,4300	yes	missense	C6orf191	NM_001010876.1	21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	37/129	130166922	1,13005	2203	4300	6503	SO:0001583	missense	253582	exon2			ACATCACGCAGCC		CCDS34536.1	6q22.33	2012-02-21	2012-02-21	2012-02-21	ENSG00000203756	ENSG00000203756			21571	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 191"""	C6orf191			Standard	NM_001010876		Approved	bA174C7.4	uc003qbs.3	Q5VVB8	OTTHUMG00000015553	ENST00000368143.1:c.109G>A	6.37:g.130166922C>T	ENSP00000357125:p.Val37Met	263.0	0.0		263.0	136.0	NM_001010876		Missense_Mutation	SNP	ENST00000368143.1	37	CCDS34536.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	3.211	-0.161646	0.06502	2.27E-4	0.0	ENSG00000203756	ENST00000368143;ENST00000438392	T;T	0.38401	1.14;1.14	4.41	-2.44	0.06502	.	0.691250	0.12851	N	0.433943	T	0.03434	0.0099	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41592	-0.9500	10	0.30854	T	0.27	-33.3459	5.9151	0.19050	0.0:0.2501:0.3143:0.4356	.	37	Q5VVB8	CF191_HUMAN	M	37	ENSP00000357125:V37M;ENSP00000403755:V37M	ENSP00000357125:V37M	V	-	1	0	C6orf191	130208615	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.521000	0.06245	-0.489000	0.06716	-2.688000	0.00140	GTG	C|1.000;T|0.000		0.358	TMEM244-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042194.1	NM_001010876	
TMEM8B	51754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	35841793	35841793	+	Splice_Site	SNP	T	T	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr9:35841793T>A	ENST00000377991.4	+	6	968		c.e6+2		TMEM8B_ENST00000377988.2_Splice_Site|TMEM8B_ENST00000473947.1_Intron|TMEM8B_ENST00000377996.1_Splice_Site|TMEM8B_ENST00000439587.2_Splice_Site	NM_001042589.2	NP_001036054.1	A6NDV4	TMM8B_HUMAN	transmembrane protein 8B						cell-matrix adhesion (GO:0007160)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle (GO:0007346)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|large_intestine(2)|lung(1)|ovary(1)	7						GGTTGCAAGGTCAGAACCCCT	0.597																																					.		.											.	TMEM8B	91	0			.						.																																			SO:0001630	splice_region_variant	51754	.			GCAAGGTCAGAAC	BC043384	CCDS6595.1, CCDS43800.1	9p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000137103	ENSG00000137103			21427	protein-coding gene	gene with protein product	"""nasopharyngeal carcinoma expressed 6"""		"""chromosome 9 open reading frame 127"""	C9orf127		12918109, 8619474	Standard	NM_016446		Approved	NAG-5, NGX6	uc003zym.4	A6NDV4	OTTHUMG00000019885	ENST00000377991.4:c.-48+2T>A	9.37:g.35841793T>A		203.0	0.0		210.0	85.0	.	B3KQF3|O75539|Q49AB1|Q4KMX5|Q5TCW5|Q9HBY2|Q9P0U7	Splice_Site	SNP	ENST00000377991.4	37	CCDS43800.1																																																																																			.		0.597	TMEM8B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052388.2	NM_016446	Intron
TMPRSS12	283471	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	51237659	51237659	+	Silent	SNP	A	A	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:51237659A>G	ENST00000398458.3	+	2	254	c.222A>G	c.(220-222)caA>caG	p.Q74Q	RN7SL519P_ENST00000497925.2_RNA|TMPRSS12_ENST00000551456.1_Silent_p.Q74Q	NM_182559.2	NP_872365	Q86WS5	TMPSC_HUMAN	transmembrane (C-terminal) protease, serine 12	74						integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	18						ATGTGTTGCAAGGGTCTCGGA	0.443																																					p.Q74Q		.											.	.	.	0			c.A222G						.						44.0	43.0	44.0					12																	51237659		1956	4134	6090	SO:0001819	synonymous_variant	283471	exon2			GTTGCAAGGGTCT	BC048112	CCDS44881.1	12q13.12	2014-08-12	2010-04-21		ENSG00000186452	ENSG00000186452		"""Serine peptidases / Transmembrane"""	28779	protein-coding gene	gene with protein product			"""transmembrane protease, serine 12"""				Standard	NM_182559		Approved	MGC57341, CT151	uc001rwx.4	Q86WS5	OTTHUMG00000169483	ENST00000398458.3:c.222A>G	12.37:g.51237659A>G		153.0	0.0		132.0	63.0	NM_182559	B9ZVX2	Silent	SNP	ENST00000398458.3	37	CCDS44881.1																																																																																			.		0.443	TMPRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404289.1	NM_182559	
TRIM3	10612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6477958	6477958	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr11:6477958C>A	ENST00000525074.1	-	6	1392	c.998G>T	c.(997-999)cGc>cTc	p.R333L	TRIM3_ENST00000345851.3_Missense_Mutation_p.R333L|TRIM3_ENST00000537602.1_Missense_Mutation_p.R255L|TRIM3_ENST00000529058.1_5'UTR|TRIM3_ENST00000536344.1_Missense_Mutation_p.R214L|TRIM3_ENST00000359518.3_Missense_Mutation_p.R333L	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	333					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TAGCGCCTGGCGCAGGCCCTC	0.662																																					p.R333L	Melanoma(6;5 510 1540 25169 29084)	.											.	TRIM3	714	0			c.G998T						.						39.0	41.0	40.0					11																	6477958		2188	4282	6470	SO:0001583	missense	10612	exon6			GCCTGGCGCAGGC	AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.998G>T	11.37:g.6477958C>A	ENSP00000433102:p.Arg333Leu	56.0	0.0		76.0	29.0	NM_001248006	B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Missense_Mutation	SNP	ENST00000525074.1	37	CCDS7764.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070042	0.76301	.	.	ENSG00000110171	ENST00000530899;ENST00000525074;ENST00000545029;ENST00000345851;ENST00000336043;ENST00000537602;ENST00000359518;ENST00000536344	D;D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91;-1.91	5.27	3.35	0.38373	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.160727	0.56097	D	0.000031	D	0.87474	0.6186	M	0.62154	1.92	0.49213	D	0.999761	P;P;P	0.51147	0.485;0.942;0.677	B;P;P	0.55545	0.299;0.778;0.624	D	0.85024	0.0913	10	0.40728	T	0.16	-19.0968	10.9691	0.47428	0.1466:0.7124:0.141:0.0	.	214;214;333	F5H2Q8;D3DQT4;O75382	.;.;TRIM3_HUMAN	L	333;333;333;333;322;255;333;214	ENSP00000433102:R333L;ENSP00000340797:R333L;ENSP00000441091:R255L;ENSP00000352508:R333L;ENSP00000445460:R214L	ENSP00000337094:R322L	R	-	2	0	TRIM3	6434534	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.682000	0.61671	0.572000	0.29383	0.563000	0.77884	CGC	.		0.662	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384224.2	NM_006458	
TTC39A	22996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	51761791	51761791	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr1:51761791C>A	ENST00000447632.2	-	13	1261	c.1213G>T	c.(1213-1215)Gac>Tac	p.D405Y	TTC39A_ENST00000530004.1_Missense_Mutation_p.D13Y|TTC39A_ENST00000413473.2_Missense_Mutation_p.D373Y|TTC39A_ENST00000262675.7_Missense_Mutation_p.D342Y|TTC39A_ENST00000534098.1_Intron|TTC39A_ENST00000371747.3_Missense_Mutation_p.D404Y|TTC39A_ENST00000371750.5_Missense_Mutation_p.D370Y|TTC39A_ENST00000451380.1_Missense_Mutation_p.D369Y			Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A	405								p.0?(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(2)|prostate(2)|skin(3)|urinary_tract(1)	17						GGCTTGTGGTCCTCCTTCCCA	0.592																																					p.D373Y		.											.	TTC39A	23	2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)	c.G1117T						.						50.0	58.0	56.0					1																	51761791		2042	4180	6222	SO:0001583	missense	22996	exon13			TGTGGTCCTCCTT	AB007921	CCDS44143.1, CCDS44144.1, CCDS72789.1, CCDS72790.1	1p32.3	2013-01-11	2008-06-23	2008-06-23	ENSG00000085831	ENSG00000085831		"""Tetratricopeptide (TTC) repeat domain containing"""	18657	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 34"""	C1orf34		9455484, 9461476	Standard	XM_005270643		Approved	KIAA0452, DEME-6	uc010onf.2	Q5SRH9	OTTHUMG00000008193	ENST00000447632.2:c.1213G>T	1.37:g.51761791C>A	ENSP00000393952:p.Asp405Tyr	41.0	0.0		60.0	19.0	NM_001144832	B7Z782|E7EQY9|G3XAF8|O43417|O75040|Q5SRH5|Q5SRH6|Q5SRH7|Q5SRH8|Q5SRI0|Q5SRI1|Q5SRI2|Q5T7S1|Q6PIU8|Q9BT24	Missense_Mutation	SNP	ENST00000447632.2	37		.	.	.	.	.	.	.	.	.	.	C	23.1	4.373576	0.82573	.	.	ENSG00000085831	ENST00000530004;ENST00000447632;ENST00000413473;ENST00000262675;ENST00000451380;ENST00000371750;ENST00000525906;ENST00000371747	T;T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83	5.09	5.09	0.68999	.	0.182539	0.56097	D	0.000021	T	0.67401	0.2889	M	0.64404	1.975	0.53688	D	0.999977	B;P;D;D;B;D	0.89917	0.211;0.828;1.0;1.0;0.251;0.995	B;P;D;D;B;D	0.76071	0.246;0.579;0.987;0.987;0.361;0.947	T	0.70085	-0.4969	10	0.62326	D	0.03	-22.6578	18.4872	0.90834	0.0:1.0:0.0:0.0	.	373;369;342;369;405;370	Q5SRH9-4;E7EQY9;D3DQ30;B7Z782;Q5SRH9;G3XAF8	.;.;.;.;TT39A_HUMAN;.	Y	13;405;373;342;369;370;13;404	ENSP00000431228:D13Y;ENSP00000393952:D405Y;ENSP00000406144:D373Y;ENSP00000262675:D342Y;ENSP00000397207:D369Y;ENSP00000360815:D370Y;ENSP00000436659:D13Y;ENSP00000360812:D404Y	ENSP00000262675:D342Y	D	-	1	0	TTC39A	51534379	1.000000	0.71417	1.000000	0.80357	0.693000	0.40251	7.393000	0.79851	2.344000	0.79699	0.563000	0.77884	GAC	.		0.592	TTC39A-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000022434.2		
CFAP46	54777	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	134660574	134660574	+	Silent	SNP	T	T	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr10:134660574T>A	ENST00000368586.5	-	43	6229	c.6129A>T	c.(6127-6129)tcA>tcT	p.S2043S	TTC40_ENST00000263170.5_Silent_p.S204S	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GCAGCACCTCTGACGCCTGAG	0.672																																					p.S2043S		.											.	.	.	0			c.A6129T						.						37.0	39.0	38.0					10																	134660574		2202	4299	6501	SO:0001819	synonymous_variant	54777	exon43			CACCTCTGACGCC																												ENST00000368586.5:c.6129A>T	10.37:g.134660574T>A		41.0	0.0		31.0	11.0	NM_001200049		Silent	SNP	ENST00000368586.5	37	CCDS58101.1																																																																																			.		0.672	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179463285	179463285	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:179463285A>T	ENST00000591111.1	-	242	52360	c.52136T>A	c.(52135-52137)gTa>gAa	p.V17379E	TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V10147E|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V19020E|TTN_ENST00000342992.6_Missense_Mutation_p.V16452E|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V10080E|TTN_ENST00000460472.2_Missense_Mutation_p.V9955E|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17379	Fibronectin type-III 26. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTATCCAGTTACTTTGGATCC	0.413																																					p.V19020E		.											.	TTN	636	0			c.T57059A						.						93.0	88.0	89.0					2																	179463285		1837	4090	5927	SO:0001583	missense	7273	exon292			CCAGTTACTTTGG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.52136T>A	2.37:g.179463285A>T	ENSP00000465570:p.Val17379Glu	408.0	0.0		380.0	156.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	15.07	2.724730	0.48833	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	5.91	5.91	0.95273	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77505	0.4140	M	0.90705	3.14	0.35177	D	0.772089	P;P;P;P	0.39311	0.667;0.667;0.667;0.667	P;P;P;P	0.51945	0.529;0.529;0.685;0.685	D	0.86183	0.1607	9	0.87932	D	0	.	16.3364	0.83064	1.0:0.0:0.0:0.0	.	9955;10080;10147;17379	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	16452;9955;10147;10080;9953	ENSP00000343764:V16452E;ENSP00000434586:V9955E;ENSP00000340554:V10147E;ENSP00000352154:V10080E	ENSP00000340554:V10147E	V	-	2	0	TTN	179171530	1.000000	0.71417	0.996000	0.52242	0.999000	0.98932	9.326000	0.96389	2.252000	0.74401	0.528000	0.53228	GTA	.		0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179470150	179470150	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr2:179470150C>T	ENST00000591111.1	-	229	49173	c.48949G>A	c.(48949-48951)Gat>Aat	p.D16317N	TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D9085N|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D17958N|TTN_ENST00000342992.6_Missense_Mutation_p.D15390N|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D9018N|TTN_ENST00000460472.2_Missense_Mutation_p.D8893N|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16317	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTCATCATCTTGTATGACT	0.333																																					p.D17958N		.											.	TTN	636	0			c.G53872A						.						72.0	67.0	68.0					2																	179470150		1847	4091	5938	SO:0001583	missense	7273	exon279			CATCATCTTGTAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.48949G>A	2.37:g.179470150C>T	ENSP00000465570:p.Asp16317Asn	245.0	0.0		181.0	88.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	16.55	3.154827	0.57259	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	5.74	5.74	0.90152	Fibronectin, type III (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.71600	0.3359	L	0.58354	1.805	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.72564	-0.4255	9	0.87932	D	0	.	19.9346	0.97133	0.0:1.0:0.0:0.0	.	8893;9018;9085;16317	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	15390;8893;9085;9018;8893	ENSP00000343764:D15390N;ENSP00000434586:D8893N;ENSP00000340554:D9085N;ENSP00000352154:D9018N	ENSP00000340554:D9085N	D	-	1	0	TTN	179178395	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.710000	0.84655	2.712000	0.92718	0.563000	0.77884	GAT	.		0.333	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TYR	7299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	88911272	88911272	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr11:88911272G>A	ENST00000263321.5	+	1	653	c.151G>A	c.(151-153)Ggc>Agc	p.G51S	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	51					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.G51S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	CCAGCTTTCAGGCAGAGGTTC	0.562																																					p.G51S		.											.	TYR	92	1	Substitution - Missense(1)	lung(1)	c.G151A	GRCh37	HM070075	TYR	M		.						61.0	52.0	55.0					11																	88911272		2201	4299	6500	SO:0001583	missense	7299	exon1			CTTTCAGGCAGAG	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.151G>A	11.37:g.88911272G>A	ENSP00000263321:p.Gly51Ser	112.0	0.0		98.0	32.0	NM_000372	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	37	CCDS8284.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.364750	0.61513	.	.	ENSG00000077498	ENST00000263321	D	0.99454	-5.92	6.07	6.07	0.98685	.	0.095612	0.64402	D	0.000001	D	0.98887	0.9623	M	0.90870	3.155	0.53688	D	0.99997	P	0.35307	0.494	B	0.27608	0.081	D	0.98012	1.0366	9	.	.	.	.	14.2203	0.65823	0.0761:0.0:0.9239:0.0	.	51	P14679	TYRO_HUMAN	S	51	ENSP00000263321:G51S	.	G	+	1	0	TYR	88550920	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	5.945000	0.70226	2.885000	0.99019	0.655000	0.94253	GGC	.		0.562	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372	
VWA8	23078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	42293771	42293771	+	Silent	SNP	C	C	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr13:42293771C>A	ENST00000379310.3	-	26	3140	c.3072G>T	c.(3070-3072)ggG>ggT	p.G1024G	VWA8_ENST00000281496.6_Silent_p.G1024G	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1024						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										CGATAGGTATCCCGTATTTGT	0.403																																					p.G1024G		.											.	.	.	0			c.G3072T						.						190.0	163.0	172.0					13																	42293771		2203	4300	6503	SO:0001819	synonymous_variant	23078	exon26			AGGTATCCCGTAT	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.3072G>T	13.37:g.42293771C>A		307.0	0.0		312.0	120.0	NM_015058	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Silent	SNP	ENST00000379310.3	37	CCDS41881.1																																																																																			.		0.403	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
WBSCR17	64409	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	71130478	71130478	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr7:71130478G>T	ENST00000333538.5	+	7	1797	c.1163G>T	c.(1162-1164)aGc>aTc	p.S388I	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	388					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CCATATAATAGCAACATTGGC	0.517																																					p.S388I		.											.	WBSCR17	96	0			c.G1163T						.						116.0	105.0	109.0					7																	71130478		2203	4300	6503	SO:0001583	missense	64409	exon7			ATAATAGCAACAT	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1163G>T	7.37:g.71130478G>T	ENSP00000329654:p.Ser388Ile	137.0	0.0		188.0	96.0	NM_022479	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.920181	0.33908	.	.	ENSG00000185274	ENST00000333538	T	0.57752	0.38	5.85	4.87	0.63330	.	0.088641	0.85682	D	0.000000	T	0.48132	0.1483	L	0.49455	1.56	0.44899	D	0.997917	P	0.35944	0.529	B	0.42771	0.397	T	0.33574	-0.9863	10	0.22706	T	0.39	.	7.9303	0.29899	0.1594:0.0:0.8406:0.0	.	388	Q6IS24	GLTL3_HUMAN	I	388	ENSP00000329654:S388I	ENSP00000329654:S388I	S	+	2	0	WBSCR17	70768414	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	2.966000	0.49208	2.770000	0.95276	0.563000	0.77884	AGC	.		0.517	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
WDR41	55255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	76785371	76785371	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr5:76785371T>A	ENST00000296679.4	-	2	453	c.78A>T	c.(76-78)gaA>gaT	p.E26D	WDR41_ENST00000414719.2_De_novo_Start_OutOfFrame|WDR41_ENST00000507029.1_Intron	NM_018268.2	NP_060738.2	Q9HAD4	WDR41_HUMAN	WD repeat domain 41	26						lysosomal membrane (GO:0005765)				NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)	14		all_lung(232;0.000961)|Lung NSC(167;0.0011)|Ovarian(174;0.0105)|Prostate(461;0.059)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-50)|Epithelial(54;2.04e-44)|all cancers(79;6.84e-40)		GGGTTTGTTCTTCACCTATTG	0.323																																					p.E26D		.											.	WDR41	90	0			c.A78T						.						209.0	199.0	202.0					5																	76785371		2203	4300	6503	SO:0001583	missense	55255	exon2			TTGTTCTTCACCT	AF115511	CCDS4038.1	5q14	2013-01-09			ENSG00000164253	ENSG00000164253		"""WD repeat domain containing"""	25601	protein-coding gene	gene with protein product						12477932	Standard	NM_018268		Approved	FLJ10904	uc003kff.1	Q9HAD4	OTTHUMG00000102169	ENST00000296679.4:c.78A>T	5.37:g.76785371T>A	ENSP00000296679:p.Glu26Asp	378.0	0.0		350.0	164.0	NM_018268	B4DT55|Q7Z792|Q8IWG3|Q8IXA9|Q8NDA7|Q9NV62	Missense_Mutation	SNP	ENST00000296679.4	37	CCDS4038.1	.	.	.	.	.	.	.	.	.	.	T	18.49	3.636011	0.67130	.	.	ENSG00000164253	ENST00000296679;ENST00000515253;ENST00000514559;ENST00000511036;ENST00000504895;ENST00000509971	T;T;T;T;T;T	0.64085	0.63;0.66;0.4;0.4;-0.08;0.13	5.97	2.88	0.33553	.	0.044935	0.85682	D	0.000000	T	0.62853	0.2462	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.56092	-0.8036	10	0.13108	T	0.6	-27.1156	9.9787	0.41800	0.0:0.1955:0.0:0.8045	.	26	Q9HAD4	WDR41_HUMAN	D	26;19;26;21;18;23	ENSP00000296679:E26D;ENSP00000426499:E19D;ENSP00000426937:E26D;ENSP00000422510:E21D;ENSP00000426141:E18D;ENSP00000422922:E23D	ENSP00000296679:E26D	E	-	3	2	WDR41	76821127	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.825000	0.27393	0.878000	0.35920	0.523000	0.50628	GAA	.		0.323	WDR41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220014.2	NM_018268	
XPO5	57510	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43517661	43517661	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr6:43517661G>A	ENST00000265351.7	-	16	1949	c.1739C>T	c.(1738-1740)tCt>tTt	p.S580F	XPO5_ENST00000424378.2_5'Flank	NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	580	Necessary for interaction with ILF3.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			AAAAGTGACAGATGAAAATAG	0.348																																					p.S580F		.											.	XPO5	271	0			c.C1739T						.						126.0	119.0	121.0					6																	43517661		1854	4090	5944	SO:0001583	missense	57510	exon16			GTGACAGATGAAA	AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.1739C>T	6.37:g.43517661G>A	ENSP00000265351:p.Ser580Phe	181.0	0.0		264.0	160.0	NM_020750	Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Missense_Mutation	SNP	ENST00000265351.7	37	CCDS47430.1	.	.	.	.	.	.	.	.	.	.	G	16.07	3.019143	0.54576	.	.	ENSG00000124571	ENST00000265351;ENST00000436943;ENST00000372252;ENST00000372258;ENST00000439465	T	0.66815	-0.23	5.82	4.94	0.65067	Armadillo-like helical (1);Armadillo-type fold (1);	0.324438	0.33980	N	0.004372	T	0.34978	0.0916	L	0.39397	1.21	0.42107	D	0.991368	B	0.06786	0.001	B	0.04013	0.001	T	0.27606	-1.0069	10	0.09084	T	0.74	-6.9371	12.0098	0.53280	0.0818:0.0:0.9182:0.0	.	580	Q9HAV4	XPO5_HUMAN	F	580;285;120;120;208	ENSP00000265351:S580F	ENSP00000265351:S580F	S	-	2	0	XPO5	43625639	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.063000	0.71162	1.443000	0.47586	0.655000	0.94253	TCT	.		0.348	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040657.2	NM_020750	
ZNF106	64397	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42734378	42734378	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr15:42734378G>A	ENST00000263805.4	-	7	3913	c.3587C>T	c.(3586-3588)tCa>tTa	p.S1196L	ZNF106_ENST00000565611.1_Missense_Mutation_p.S381L|ZNF106_ENST00000565380.1_Missense_Mutation_p.S424L	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	1196					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										AATCTGAACTGATGAGTCTGG	0.493																																					p.S1196L		.											.	ZFP106	515	0			c.C3587T						.						153.0	141.0	145.0					15																	42734378		2203	4299	6502	SO:0001583	missense	64397	exon7			TGAACTGATGAGT	AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.3587C>T	15.37:g.42734378G>A	ENSP00000263805:p.Ser1196Leu	262.0	0.0		241.0	116.0	NM_022473	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	ENST00000263805.4	37	CCDS32208.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.701669	0.88924	.	.	ENSG00000103994	ENST00000263805;ENST00000434903	T	0.67698	-0.28	5.44	5.44	0.79542	.	0.162012	0.43260	D	0.000589	T	0.80396	0.4615	L	0.56769	1.78	0.53005	D	0.999967	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.986;0.994;0.986	T	0.81097	-0.1087	10	0.87932	D	0	-11.187	19.441	0.94821	0.0:0.0:1.0:0.0	.	424;1196;424	E9PE29;Q9H2Y7;B4DZ40	.;ZF106_HUMAN;.	L	1196;424	ENSP00000263805:S1196L	ENSP00000263805:S1196L	S	-	2	0	ZFP106	40521670	1.000000	0.71417	0.960000	0.40013	0.933000	0.57130	6.516000	0.73755	2.831000	0.97527	0.655000	0.94253	TCA	.		0.493	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1	NM_022473	
ZFP42	132625	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	188924570	188924570	+	Silent	SNP	T	T	A			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr4:188924570T>A	ENST00000326866.4	+	4	1017	c.609T>A	c.(607-609)gcT>gcA	p.A203A	ZFP42_ENST00000509524.1_Silent_p.A203A	NM_174900.3	NP_777560.2	Q96MM3	ZFP42_HUMAN	ZFP42 zinc finger protein	203					female gonad development (GO:0008585)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|meiotic nuclear division (GO:0007126)|regulation of genetic imprinting (GO:2000653)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		GGAATAGAGCTGCCCTGAGAA	0.473																																					p.A203A		.											.	ZFP42	228	0			c.T609A						.						122.0	126.0	124.0					4																	188924570		2203	4300	6503	SO:0001819	synonymous_variant	132625	exon4			TAGAGCTGCCCTG	AK056719	CCDS3849.1	4q35.2	2014-09-04	2012-11-27		ENSG00000179059	ENSG00000179059		"""Zinc fingers, C2H2-type"""	30949	protein-coding gene	gene with protein product		614572	"""zinc finger protein 42 homolog (mouse)"", ""zinc finger protein 42"""			12110702	Standard	NM_174900		Approved	REX1, ZNF754	uc003izh.1	Q96MM3	OTTHUMG00000160235	ENST00000326866.4:c.609T>A	4.37:g.188924570T>A		112.0	1.0		102.0	43.0	NM_174900	D3DP65|Q8WXE2	Silent	SNP	ENST00000326866.4	37	CCDS3849.1																																																																																			.		0.473	ZFP42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359794.1	NM_174900	
ZFP64	55734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	50701265	50701265	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr20:50701265A>C	ENST00000361387.2	-	9	1829	c.1769T>G	c.(1768-1770)gTc>gGc	p.V590G	ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371523.4_Missense_Mutation_p.V371G	NM_199427.2	NP_955459.2	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	435					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						GTCATCCCTGACGAAGGAGGC	0.602																																					p.V590G		.											.	ZFP64	155	0			c.T1769G						.						56.0	49.0	51.0					20																	50701265		2203	4300	6503	SO:0001583	missense	55734	exon9			TCCCTGACGAAGG	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000361387.2:c.1769T>G	20.37:g.50701265A>C	ENSP00000355179:p.Val590Gly	75.0	0.0		93.0	52.0	NM_199427	Q9NTS7|Q9NVH4	Missense_Mutation	SNP	ENST00000361387.2	37	CCDS13439.1	.	.	.	.	.	.	.	.	.	.	A	14.24	2.476129	0.44044	.	.	ENSG00000020256	ENST00000371523;ENST00000361387	T;T	0.70516	-0.49;-0.49	4.4	3.26	0.37387	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57213	0.2038	L	0.28694	0.88	0.80722	D	1	B;B	0.25441	0.092;0.126	B;B	0.27715	0.036;0.082	T	0.50591	-0.8810	9	0.33940	T	0.23	.	10.3403	0.43873	0.9204:0.0:0.0796:0.0	.	590;371	Q9NTW7;Q9NTW7-2	ZF64B_HUMAN;.	G	371;590	ENSP00000360578:V371G;ENSP00000355179:V590G	ENSP00000355179:V590G	V	-	2	0	ZFP64	50134672	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.096000	0.76960	0.778000	0.33520	0.533000	0.62120	GTC	.		0.602	ZFP64-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079743.2	NM_018197	
ZFYVE26	23503	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	68274384	68274384	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr14:68274384C>T	ENST00000347230.4	-	5	755	c.617G>A	c.(616-618)gGc>gAc	p.G206D	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.G206D	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	206					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CGAATCAGGGCCCTGCAAAGC	0.602																																					p.G206D		.											.	ZFYVE26	162	0			c.G617A						.						72.0	72.0	72.0					14																	68274384		2203	4300	6503	SO:0001583	missense	23503	exon5			TCAGGGCCCTGCA	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.617G>A	14.37:g.68274384C>T	ENSP00000251119:p.Gly206Asp	40.0	0.0		19.0	13.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	C	1.532	-0.544116	0.04024	.	.	ENSG00000072121	ENST00000347230;ENST00000555452	T;T	0.26518	1.87;1.73	5.69	0.697	0.18081	.	0.542263	0.20668	N	0.087890	T	0.15003	0.0362	L	0.35723	1.085	0.09310	N	1	B;B;B	0.14438	0.01;0.002;0.0	B;B;B	0.13407	0.009;0.004;0.001	T	0.37197	-0.9716	10	0.05959	T	0.93	-2.7155	9.5295	0.39185	0.0:0.4255:0.0:0.5745	.	206;206;206	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	D	206	ENSP00000251119:G206D;ENSP00000450603:G206D	ENSP00000251119:G206D	G	-	2	0	ZFYVE26	67344137	0.066000	0.20996	0.233000	0.24025	0.272000	0.26649	0.584000	0.23864	0.052000	0.16007	0.491000	0.48974	GGC	.		0.602	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
ZKSCAN5	23660	broad.mit.edu;bcgsc.ca	37	7	99129075	99129075	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr7:99129075A>G	ENST00000394170.2	+	7	1974	c.1723A>G	c.(1723-1725)Aaa>Gaa	p.K575E	ZKSCAN5_ENST00000451158.1_Missense_Mutation_p.K575E|ZKSCAN5_ENST00000326775.5_Missense_Mutation_p.K575E	NM_014569.3	NP_055384.1	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	575					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	21	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					CACTGGGGAGAAACCATTCAG	0.483																																					p.K575E		.											.	ZKSCAN5	91	0			c.A1723G						.						84.0	82.0	82.0					7																	99129075		2203	4300	6503	SO:0001583	missense	23660	exon7			GGGGAGAAACCAT	AF170025	CCDS5667.1	7q22	2013-01-09	2007-02-20	2007-02-20	ENSG00000196652	ENSG00000196652		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12867	protein-coding gene	gene with protein product		611272	"""zinc finger protein homologous to Zfp95 in mouse"", ""zinc finger protein 95 homolog (mouse)"""	ZFP95		10585779	Standard	NM_014569		Approved	ZNF914, ZSCAN37	uc003uqv.3	Q9Y2L8	OTTHUMG00000156749	ENST00000394170.2:c.1723A>G	7.37:g.99129075A>G	ENSP00000377725:p.Lys575Glu	118.0	0.0		111.0	5.0	NM_145102	A4D280|D6W5S9	Missense_Mutation	SNP	ENST00000394170.2	37	CCDS5667.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.086775	0.76642	.	.	ENSG00000196652	ENST00000537357;ENST00000326775;ENST00000451158;ENST00000394170	T;T;T	0.27104	1.69;1.69;1.69	5.22	5.22	0.72569	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000014	T	0.49864	0.1582	M	0.77820	2.39	0.36307	D	0.85743	D;D	0.69078	0.997;0.997	D;D	0.66497	0.944;0.944	T	0.63193	-0.6692	10	0.87932	D	0	.	13.3881	0.60807	1.0:0.0:0.0:0.0	.	575;575	Q8N718;Q9Y2L8	.;ZKSC5_HUMAN	E	575	ENSP00000322872:K575E;ENSP00000392104:K575E;ENSP00000377725:K575E	ENSP00000322872:K575E	K	+	1	0	ZKSCAN5	98967011	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.930000	0.63462	2.330000	0.79161	0.477000	0.44152	AAA	.		0.483	ZKSCAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345597.1	NM_014569	
ZKSCAN1	7586	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	99621227	99621227	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr7:99621227A>T	ENST00000324306.6	+	2	332	c.98A>T	c.(97-99)gAg>gTg	p.E33V	ZKSCAN1_ENST00000426572.1_De_novo_Start_OutOfFrame|ZKSCAN1_ENST00000535170.1_Intron	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	33					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			GAGGAAGATGAGGAAGACCAC	0.547																																					p.E33V		.											.	ZKSCAN1	93	0			c.A98T						.						95.0	85.0	89.0					7																	99621227		2203	4300	6503	SO:0001583	missense	7586	exon2			AAGATGAGGAAGA	X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.98A>T	7.37:g.99621227A>T	ENSP00000323148:p.Glu33Val	117.0	0.0		96.0	36.0	NM_003439	A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Missense_Mutation	SNP	ENST00000324306.6	37	CCDS34698.1	.	.	.	.	.	.	.	.	.	.	A	19.79	3.893772	0.72639	.	.	ENSG00000106261	ENST00000324306;ENST00000432317	T;T	0.07114	3.22;3.85	4.63	4.63	0.57726	.	0.000000	0.51477	D	0.000087	T	0.20495	0.0493	L	0.50333	1.59	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	T	0.00792	-1.1564	10	0.34782	T	0.22	.	12.0381	0.53438	1.0:0.0:0.0:0.0	.	33	P17029	ZKSC1_HUMAN	V	33	ENSP00000323148:E33V;ENSP00000394445:E33V	ENSP00000323148:E33V	E	+	2	0	ZKSCAN1	99459163	0.900000	0.30661	0.999000	0.59377	0.843000	0.47879	1.287000	0.33284	1.942000	0.56320	0.397000	0.26171	GAG	.		0.547	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344550.2	NM_003439	
ZNF285	26974	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44890851	44890851	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:44890851T>G	ENST00000330997.4	-	4	1620	c.1556A>C	c.(1555-1557)aAa>aCa	p.K519T	ZNF285_ENST00000544719.2_Missense_Mutation_p.K519T|CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000591679.1_Missense_Mutation_p.K526T	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	519					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GCTGAAGCCTTTACCACACTC	0.413																																					p.K519T		.											.	ZNF285	94	0			c.A1556C						.						90.0	92.0	91.0					19																	44890851		2203	4300	6503	SO:0001583	missense	26974	exon4			AAGCCTTTACCAC	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1556A>C	19.37:g.44890851T>G	ENSP00000333595:p.Lys519Thr	501.0	0.0		422.0	204.0	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	T	16.54	3.152482	0.57259	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.07908	3.15	3.6	2.56	0.30785	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23249	0.0562	M	0.94101	3.495	0.23515	N	0.997514	D;D	0.56968	0.978;0.978	P;P	0.48488	0.579;0.579	T	0.17715	-1.0360	9	0.87932	D	0	.	8.1482	0.31124	0.0:0.103:0.0:0.897	.	543;519	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	T	542;519	ENSP00000333595:K519T	ENSP00000333595:K519T	K	-	2	0	ZNF285	49582691	0.999000	0.42202	0.972000	0.41901	0.983000	0.72400	5.705000	0.68355	0.389000	0.25086	0.373000	0.22412	AAA	.		0.413	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
ZNF326	284695	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	90486427	90486427	+	Silent	SNP	A	A	G			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr1:90486427A>G	ENST00000340281.4	+	10	1394	c.1251A>G	c.(1249-1251)ttA>ttG	p.L417L	ZNF326_ENST00000455342.2_Silent_p.L211L|ZNF326_ENST00000370447.3_Silent_p.L328L	NM_182976.2	NP_892021.1	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326	417					mRNA processing (GO:0006397)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, elongation (GO:0032784)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	DBIRD complex (GO:0044609)|nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(7)|ovary(1)	25		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		TCCCTGCTTTACATAGTTCAG	0.363																																					p.L417L		.											.	ZNF326	91	0			c.A1251G						.						132.0	129.0	130.0					1																	90486427		2203	4300	6503	SO:0001819	synonymous_variant	284695	exon10			TGCTTTACATAGT	BC013102	CCDS727.1, CCDS728.1	1p22	2012-04-19			ENSG00000162664	ENSG00000162664		"""Zinc fingers, C2H2-type"""	14104	protein-coding gene	gene with protein product	"""ZNF-protein interacting with nuclear mRNPs and DBC1"""	614601				22446626	Standard	NM_182976		Approved	Zfp326, ZAN75, FLJ20403, ZIRD	uc001dnq.2	Q5BKZ1	OTTHUMG00000010675	ENST00000340281.4:c.1251A>G	1.37:g.90486427A>G		601.0	0.0		501.0	221.0	NM_182976	A8MYX1|B4DLN0|B4E179|Q5VW93|Q5VW94|Q5VW96|Q5VW97|Q6NSA2|Q7Z638|Q7Z6C2	Silent	SNP	ENST00000340281.4	37	CCDS727.1																																																																																			.		0.363	ZNF326-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029428.2	NM_181781	
ZNF486	90649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	20308237	20308237	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:20308237T>C	ENST00000335117.8	+	4	775	c.718T>C	c.(718-720)Tgt>Cgt	p.C240R	CTC-260E6.6_ENST00000593655.1_RNA|CTC-260E6.6_ENST00000585498.1_RNA|CTC-260E6.6_ENST00000586657.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	240					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						ACCCTACAAATGTGAAGAATG	0.378																																					p.C240R		.											.	ZNF486	47	0			c.T718C						.						37.0	40.0	39.0					19																	20308237		2146	4271	6417	SO:0001583	missense	90649	exon4			TACAAATGTGAAG	BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.718T>C	19.37:g.20308237T>C	ENSP00000335042:p.Cys240Arg	94.0	0.0		93.0	52.0	NM_052852	Q0VG00	Missense_Mutation	SNP	ENST00000335117.8	37	CCDS46029.1	.	.	.	.	.	.	.	.	.	.	t	11.26	1.585708	0.28268	.	.	ENSG00000256229	ENST00000545779;ENST00000335117	D	0.85258	-1.96	0.85	0.85	0.18980	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.91147	0.7212	H	0.99026	4.405	0.43588	D	0.995934	P	0.36483	0.555	B	0.43754	0.43	D	0.88072	0.2801	9	0.72032	D	0.01	.	5.4501	0.16560	0.0:0.0:0.0:1.0	.	240	Q96H40	ZN486_HUMAN	R	279;240	ENSP00000335042:C240R	ENSP00000335042:C240R	C	+	1	0	ZNF486	20169237	1.000000	0.71417	0.029000	0.17559	0.029000	0.11900	5.474000	0.66781	0.166000	0.19597	0.164000	0.16699	TGT	.		0.378	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447843.2	NM_052852	
ZNF429	353088	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	21720692	21720692	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:21720692A>T	ENST00000358491.4	+	4	2045	c.1837A>T	c.(1837-1839)Aaa>Taa	p.K613*	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	613					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						TCAACATAAGAAAATTCATAC	0.363																																					p.K613X		.											.	ZNF429	516	0			c.A1837T						.						59.0	64.0	62.0					19																	21720692		2070	4242	6312	SO:0001587	stop_gained	353088	exon4			CATAAGAAAATTC	AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.1837A>T	19.37:g.21720692A>T	ENSP00000351280:p.Lys613*	90.0	0.0		102.0	45.0	NM_001001415	A6NLV7|Q9BZE6	Nonsense_Mutation	SNP	ENST00000358491.4	37	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	.	33	5.282575	0.95489	.	.	ENSG00000197013	ENST00000358491	.	.	.	1.09	1.09	0.20402	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	7.1337	0.25517	1.0:0.0:0.0:0.0	.	.	.	.	X	613	.	ENSP00000351280:K613X	K	+	1	0	ZNF429	21512532	0.000000	0.05858	0.006000	0.13384	0.356000	0.29392	-0.226000	0.09139	0.464000	0.27142	0.248000	0.18094	AAA	.		0.363	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463981.1	NM_001001415	
ZNF510	22869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	99522164	99522164	+	Silent	SNP	T	T	C			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr9:99522164T>C	ENST00000375231.1	-	6	1598	c.948A>G	c.(946-948)aaA>aaG	p.K316K	ZNF510_ENST00000223428.4_Silent_p.K316K			Q9Y2H8	ZN510_HUMAN	zinc finger protein 510	316					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	21		Acute lymphoblastic leukemia(62;0.0527)				TCTCAAAGGATTTCCCACATT	0.338																																					p.K316K		.											.	ZNF510	90	0			c.A948G						.						94.0	99.0	98.0					9																	99522164		2203	4300	6503	SO:0001819	synonymous_variant	22869	exon6			AAAGGATTTCCCA	AB023189	CCDS35074.1	9q22.33	2013-01-08			ENSG00000081386	ENSG00000081386		"""Zinc fingers, C2H2-type"", ""-"""	29161	protein-coding gene	gene with protein product						10231032	Standard	XM_005251807		Approved	KIAA0972	uc004awn.1	Q9Y2H8	OTTHUMG00000020303	ENST00000375231.1:c.948A>G	9.37:g.99522164T>C		297.0	0.0		215.0	110.0	NM_014930	Q5SZP5	Silent	SNP	ENST00000375231.1	37	CCDS35074.1																																																																																			.		0.338	ZNF510-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053287.1	NM_014930	
ZNF571	51276	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38056942	38056942	+	Missense_Mutation	SNP	G	G	A	rs115914028	byFrequency	TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:38056942G>A	ENST00000328550.2	-	4	487	c.388C>T	c.(388-390)Cgg>Tgg	p.R130W	ZNF571-AS1_ENST00000585578.1_RNA|ZNF571-AS1_ENST00000591430.1_RNA|ZNF540_ENST00000592533.1_Intron|ZNF571-AS1_ENST00000589802.1_RNA|ZNF571_ENST00000593133.1_Missense_Mutation_p.R130W|ZNF571-AS1_ENST00000590838.1_RNA|ZNF571-AS1_ENST00000587121.1_RNA|ZNF571_ENST00000451802.2_Missense_Mutation_p.R130W|ZNF571-AS1_ENST00000586013.1_RNA|ZNF571-AS1_ENST00000589750.1_RNA|ZNF571_ENST00000590751.1_Intron|ZNF571-AS1_ENST00000592392.1_RNA|ZNF571_ENST00000358744.3_Missense_Mutation_p.R130W|ZNF571-AS1_ENST00000586139.1_RNA			Q7Z3V5	ZN571_HUMAN	zinc finger protein 571	130					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	25			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGAATTATCCGATGAAAAGTA	0.383													G|||	2	0.000399361	0.0	0.0	5008	,	,		20497	0.002		0.0	False		,,,				2504	0.0				p.R130W		.											.	ZNF571	90	0			c.C388T						.						111.0	107.0	108.0					19																	38056942		2203	4300	6503	SO:0001583	missense	51276	exon4			TTATCCGATGAAA	AF161544	CCDS12505.1	19q13.12	2013-09-20			ENSG00000180479	ENSG00000180479		"""Zinc fingers, C2H2-type"", ""-"""	25000	protein-coding gene	gene with protein product						11042152	Standard	XM_005258977		Approved	HSPC059	uc002ogt.3	Q7Z3V5	OTTHUMG00000182016	ENST00000328550.2:c.388C>T	19.37:g.38056942G>A	ENSP00000333660:p.Arg130Trp	393.0	0.0		366.0	169.0	NM_016536	Q2HIY0|Q3ZCU3|Q9NZX7	Missense_Mutation	SNP	ENST00000328550.2	37	CCDS12505.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	12.52	1.962201	0.34659	.	.	ENSG00000180479	ENST00000328550;ENST00000451802;ENST00000358744	T;T;T	0.08193	3.12;3.12;3.12	3.23	-6.47	0.01902	.	.	.	.	.	T	0.04318	0.0119	N	0.14661	0.345	0.09310	N	1	P	0.49253	0.921	B	0.40741	0.339	T	0.37478	-0.9704	9	0.87932	D	0	.	8.4454	0.32838	0.0:0.5277:0.2056:0.2666	.	130	Q7Z3V5	ZN571_HUMAN	W	130	ENSP00000333660:R130W;ENSP00000392638:R130W;ENSP00000351594:R130W	ENSP00000333660:R130W	R	-	1	2	ZNF571	42748782	0.001000	0.12720	0.000000	0.03702	0.392000	0.30506	-0.234000	0.09028	-0.819000	0.04323	0.313000	0.20887	CGG	G|0.998;A|0.002		0.383	ZNF571-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458669.1	NM_016536	
ZNF835	90485	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	57176266	57176266	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr19:57176266delC	ENST00000537055.2	-	2	532	c.301delG	c.(301-303)gagfs	p.E101fs		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	101					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						CCACCTCTCTCCCGCTGGCGG	0.637																																					p.E101fs		.											.	ZNF835	72	0			c.301delG						.						46.0	55.0	52.0					19																	57176266		2139	4263	6402	SO:0001589	frameshift_variant	90485	exon2			CTCTCTCCCGCTG	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.301delG	19.37:g.57176266delC	ENSP00000444747:p.Glu101fs	82.0	0.0		82.0	38.0	NM_001005850	B7Z5Y0|G3V1S0	Frame_Shift_Del	DEL	ENST00000537055.2	37	CCDS56105.1																																																																																			.		0.637	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850	
ACACB	32	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	109637346	109637347	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr12:109637346_109637347GC>CT	ENST00000338432.7	+	18	2886_2887	c.2767_2768GC>CT	c.(2767-2769)GCt>CTt	p.A923L	ACACB_ENST00000377848.3_Missense_Mutation_p.A923L|ACACB_ENST00000377854.5_Missense_Mutation_p.A923L			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	923	Biotinyl-binding. {ECO:0000255|PROSITE- ProRule:PRU01066}.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	GAGCAGCTACGCTGAGATGGAG	0.584																																					p.A923L		.											.	.	.	0			.						.																																			SO:0001583	missense	32	.			AGCTACGCTGAGA	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	Exception_encountered	12.37:g.109637346_109637347delinsCT	ENSP00000341044:p.Ala923Leu	54.0	0.0		31.0	26.0	.	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	DNP	ENST00000338432.7	37	CCDS31898.1																																																																																			.		0.584	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
CLEC14A	161198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	38724364	38724365	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr14:38724364_38724365GG>AT	ENST00000342213.2	-	1	1209_1210	c.863_864CC>AT	c.(862-864)aCC>aAT	p.T288N		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	288						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		CTTCCCCACTGGTCACACAAGA	0.653																																					p.T288N		.											.	.	.	0			.						.																																			SO:0001583	missense	161198	.			CCCACTGGTCACA		CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.863_864delinsAT	14.37:g.38724364_38724365delinsAT	ENSP00000353013:p.Thr288Asn	35.0	0.0		35.0	9.0	.	Q695G9|Q6PWT6|Q8N5V5	Missense_Mutation	DNP	ENST00000342213.2	37	CCDS9667.1																																																																																			.		0.653	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060	
C4orf45	152940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	159894436	159894437	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr4:159894436_159894437GG>TT	ENST00000434826.2	-	2	175_176	c.91_92CC>AA	c.(91-93)CCc>AAc	p.P31N	C4orf45_ENST00000508011.1_5'UTR	NM_152543.2	NP_689756.2	Q96LM5	CD045_HUMAN	chromosome 4 open reading frame 45	31										large_intestine(2)|lung(3)	5						ATGAATTTTGGGTAAATAATCC	0.356																																					p.P31N		.											.	.	.	0			.						.																																			SO:0001583	missense	152940	.			ATTTTGGGTAAAT		CCDS47156.1	4q32.1	2012-03-02			ENSG00000164123	ENSG00000164123			26342	protein-coding gene	gene with protein product							Standard	NM_152543		Approved	FLJ25371	uc003iqf.1	Q96LM5	OTTHUMG00000161988	ENST00000434826.2:c.91_92delinsTT	4.37:g.159894436_159894437delinsTT	ENSP00000412215:p.Pro31Asn	270.0	0.0		223.0	100.0	.	A8MPU3|C9J0T8	Missense_Mutation	DNP	ENST00000434826.2	37	CCDS47156.1																																																																																			.		0.356	C4orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366636.1	NM_152543	
PRR16	51334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	120022379	120022380	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-BC-A10Z-01A-11D-A12Z-10	TCGA-BC-A10Z-11A-11D-A12Z-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6bbfd9b-d3b5-4611-9011-ec67b57f3577	40a34014-00b9-4b89-9e56-3e2e6bc78a52	g.chr5:120022379_120022380GG>TT	ENST00000407149.2	+	2	1099_1100	c.890_891GG>TT	c.(889-891)aGG>aTT	p.R297I	PRR16_ENST00000505123.1_Missense_Mutation_p.R227I|PRR16_ENST00000446965.1_Missense_Mutation_p.R227I|PRR16_ENST00000379551.2_Missense_Mutation_p.R274I			Q569H4	LARGN_HUMAN	proline rich 16	297					positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)					endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		ACGATCTTGAGGAAGTCAACCA	0.396																																					p.R297I		.											.	.	.	0			.						.																																			SO:0001583	missense	51334	.			TCTTGAGGAAGTC	AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	Exception_encountered	5.37:g.120022379_120022380delinsTT	ENSP00000385118:p.Arg297Ile	20.0	0.0		25.0	15.0	.	D3DSZ0|Q8IXY1|Q9NYI5	Missense_Mutation	DNP	ENST00000407149.2	37																																																																																				.		0.396	PRR16-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000371059.1	NM_016644	
