#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCC8	6833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	17418492	17418492	+	Missense_Mutation	SNP	C	C	A	rs138642224	byFrequency	TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr11:17418492C>A	ENST00000389817.3	-	33	4158	c.4090G>T	c.(4090-4092)Gtc>Ttc	p.V1364F	ABCC8_ENST00000302539.4_Missense_Mutation_p.V1365F			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1364	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	AGGGCATTGACGTGCTTCAGC	0.612																																					p.V1364F		.											.	ABCC8	91	0			c.G4090T						.						121.0	93.0	102.0					11																	17418492		2200	4293	6493	SO:0001583	missense	6833	exon33			CATTGACGTGCTT	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.4090G>T	11.37:g.17418492C>A	ENSP00000374467:p.Val1364Phe	135.0	0.0		195.0	78.0	NM_000352	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	CCDS31437.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.32|18.32	3.597040|3.597040	0.66332|0.66332	.|.	.|.	ENSG00000006071|ENSG00000006071	ENST00000528374|ENST00000389817;ENST00000302539	.|D;D	.|0.95171	.|-3.63;-3.63	4.83|4.83	4.83|4.83	0.62350|0.62350	.|ABC transporter-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.95667|0.95667	0.8591|0.8591	L|L	0.43646|0.43646	1.37|1.37	0.80722|0.80722	D|D	1|1	.|D	.|0.61080	.|0.989	.|D	.|0.64144	.|0.922	D|D	0.96374|0.96374	0.9276|0.9276	5|10	.|0.87932	.|D	.|0	.|.	18.2867|18.2867	0.90117|0.90117	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1364	.|Q09428	.|ABCC8_HUMAN	L|F	191|1364;1365	.|ENSP00000374467:V1364F;ENSP00000303960:V1365F	.|ENSP00000303960:V1365F	R|V	-|-	2|1	0|0	ABCC8|ABCC8	17375068|17375068	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.022000|0.022000	0.10575|0.10575	4.794000|4.794000	0.62482|0.62482	2.386000|2.386000	0.81285|0.81285	0.555000|0.555000	0.69702|0.69702	CGT|GTC	C|0.999;T|0.001		0.612	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352	
ADAMTS15	170689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	130343256	130343256	+	Missense_Mutation	SNP	T	T	G			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr11:130343256T>G	ENST00000299164.2	+	8	2393	c.2393T>G	c.(2392-2394)tTc>tGc	p.F798C		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	798	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		CGCTACTCCTTCTATCTGCCC	0.652																																					p.F798C		.											.	ADAMTS15	291	0			c.T2393G						.						95.0	110.0	105.0					11																	130343256		2201	4296	6497	SO:0001583	missense	170689	exon8			ACTCCTTCTATCT	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.2393T>G	11.37:g.130343256T>G	ENSP00000299164:p.Phe798Cys	122.0	0.0		150.0	74.0	NM_139055	Q32MI6	Missense_Mutation	SNP	ENST00000299164.2	37	CCDS8488.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.057315	0.76074	.	.	ENSG00000166106	ENST00000299164	T	0.61510	0.1	5.91	5.91	0.95273	ADAM-TS Spacer 1 (1);	.	.	.	.	T	0.80628	0.4659	M	0.90309	3.105	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	D	0.84819	0.0795	9	0.87932	D	0	.	16.3436	0.83110	0.0:0.0:0.0:1.0	.	798	Q8TE58	ATS15_HUMAN	C	798	ENSP00000299164:F798C	ENSP00000299164:F798C	F	+	2	0	ADAMTS15	129848466	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.816000	0.55658	2.269000	0.75478	0.533000	0.62120	TTC	.		0.652	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	NM_139055	
ADAMTS1	9510	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	28211905	28211905	+	Splice_Site	SNP	C	C	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr21:28211905C>A	ENST00000284984.3	-	7	2483		c.e7+1			NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1						heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		AAACGAACTACCTTGGGCTGC	0.418																																					.		.											.	ADAMTS1	272	0			c.2028+1G>T						.						124.0	121.0	122.0					21																	28211905		2203	4300	6503	SO:0001630	splice_region_variant	9510	exon8			GAACTACCTTGGG	AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.2028+1G>T	21.37:g.28211905C>A		27.0	0.0		27.0	12.0	NM_006988	D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Splice_Site	SNP	ENST00000284984.3	37	CCDS33524.1	.	.	.	.	.	.	.	.	.	.	C	19.47	3.833592	0.71258	.	.	ENSG00000154734	ENST00000284984	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6142	0.95626	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADAMTS1	27133776	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	7.320000	0.79064	2.941000	0.99782	0.655000	0.94253	.	.		0.418	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2		Intron
ADPRM	56985	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	10614393	10614393	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr17:10614393delT	ENST00000379774.4	+	4	1052	c.961delT	c.(961-963)ttgfs	p.L321fs	ADPRM_ENST00000609540.1_3'UTR	NM_020233.4	NP_064618.3	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent	321							ADP-ribose diphosphatase activity (GO:0047631)|CDP-glycerol diphosphatase activity (GO:0047734)|metal ion binding (GO:0046872)										CAAAATGATGTTGAAAGGGAG	0.383																																					p.L321X		.											.	.	.	0			c.961delT						.						99.0	99.0	99.0					17																	10614393		2203	4300	6503	SO:0001589	frameshift_variant	56985	exon4			ATGATGTTGAAAG	BC070155	CCDS11159.2	17p13.1	2012-07-20	2012-07-20	2012-07-20	ENSG00000170222	ENSG00000170222	3.6.1.13, 3.6.1.16, 3.6.1.53		30925	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 48"""	C17orf48		18352857	Standard	XM_005256738		Approved	MDS006	uc002gmt.3	Q3LIE5	OTTHUMG00000130366	ENST00000379774.4:c.961delT	17.37:g.10614393delT	ENSP00000369099:p.Leu321fs	68.0	0.0		64.0	39.0	NM_020233	A8K9B4|D3DTS4|Q9BVD4|Q9NRU8	Nonsense_Mutation	DEL	ENST00000379774.4	37	CCDS11159.2																																																																																			.		0.383	ADPRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252732.2	NM_020233	
AFF2	2334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	148037577	148037577	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chrX:148037577A>G	ENST00000370460.2	+	11	2481	c.2002A>G	c.(2002-2004)Aga>Gga	p.R668G	AFF2_ENST00000370457.5_Missense_Mutation_p.R635G|AFF2_ENST00000342251.3_Missense_Mutation_p.R635G|AFF2_ENST00000286437.5_Missense_Mutation_p.R309G	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	668					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TGACCCACCAAGAGGCCGCAA	0.512																																					p.R668G		.											.	AFF2	135	0			c.A2002G						.						83.0	88.0	87.0					X																	148037577		2203	4300	6503	SO:0001583	missense	2334	exon11			CCACCAAGAGGCC	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2002A>G	X.37:g.148037577A>G	ENSP00000359489:p.Arg668Gly	30.0	0.0		50.0	42.0	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	A	18.56	3.650378	0.67472	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	5.67	4.49	0.54785	.	0.113755	0.64402	D	0.000010	T	0.56337	0.1978	N	0.24115	0.695	0.33313	D	0.566365	D;P;P;P;P;P	0.53312	0.959;0.902;0.902;0.902;0.902;0.92	P;P;P;P;P;P	0.50860	0.652;0.52;0.52;0.52;0.52;0.652	T	0.67051	-0.5768	10	0.49607	T	0.09	.	11.8392	0.52344	0.8517:0.1483:0.0:0.0	.	309;633;635;629;658;668	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	G	668;635;635;309	ENSP00000359489:R668G;ENSP00000359486:R635G;ENSP00000345459:R635G;ENSP00000286437:R309G	ENSP00000286437:R309G	R	+	1	2	AFF2	147845277	1.000000	0.71417	0.936000	0.37596	0.955000	0.61496	4.237000	0.58681	0.753000	0.32945	0.486000	0.48141	AGA	.		0.512	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
APBB1	322	broad.mit.edu;ucsc.edu;mdanderson.org	37	11	6422250	6422250	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr11:6422250G>C	ENST00000609360.1	-	12	1740	c.1641C>G	c.(1639-1641)taC>taG	p.Y547*	APBB1_ENST00000609331.1_Nonsense_Mutation_p.Y312*|APBB1_ENST00000299402.6_Nonsense_Mutation_p.Y545*|APBB1_ENST00000530885.1_Nonsense_Mutation_p.Y325*|APBB1_ENST00000608645.1_Nonsense_Mutation_p.Y288*|APBB1_ENST00000608394.1_Nonsense_Mutation_p.Y288*|APBB1_ENST00000311051.3_Nonsense_Mutation_p.Y545*|APBB1_ENST00000608655.1_Nonsense_Mutation_p.Y327*|APBB1_ENST00000608704.1_Nonsense_Mutation_p.Y288*|APBB1_ENST00000529519.1_Nonsense_Mutation_p.Y72*|APBB1_ENST00000389906.2_Nonsense_Mutation_p.Y547*	NM_001164.3	NP_001155.1	O00213	APBB1_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)	547	PID 2. {ECO:0000255|PROSITE- ProRule:PRU00148}.				apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|histone H4 acetylation (GO:0043967)|negative regulation of cell growth (GO:0030308)|negative regulation of thymidylate synthase biosynthetic process (GO:0050760)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|proline-rich region binding (GO:0070064)|transcription factor binding (GO:0008134)			breast(4)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	24		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		CATTCCCCAGGTAATAGACTT	0.493																																					p.Y547X	GBM(147;1810 2556 5672 39622)	.											.	APBB1	136	0			c.C1641G						.						270.0	274.0	272.0					11																	6422250		2201	4296	6497	SO:0001587	stop_gained	322	exon11			CCCCAGGTAATAG	L77864	CCDS31410.1, CCDS58114.1, CCDS66015.1, CCDS66016.1, CCDS66017.1, CCDS66018.1	11p15	2008-02-01				ENSG00000166313			581	protein-coding gene	gene with protein product		602709		RIR		8955346, 8894693	Standard	NM_001164		Approved	Fe65	uc001mcy.1	O00213		ENST00000609360.1:c.1641C>G	11.37:g.6422250G>C	ENSP00000477213:p.Tyr547*	118.0	1.0		197.0	75.0	NM_001164	A1E379|A6NH82|A6NL69|B7Z1J5|B7Z1J6|B7Z2Y0|D3DQT2|Q7Z324|Q96A93|V9GYK0|V9GYT4	Nonsense_Mutation	SNP	ENST00000609360.1	37		.	.	.	.	.	.	.	.	.	.	G	25.8	4.674637	0.88445	.	.	ENSG00000166313	ENST00000299402;ENST00000311051;ENST00000389906;ENST00000539758;ENST00000536523;ENST00000544288;ENST00000530885	.	.	.	4.88	3.97	0.46021	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.3543	7.2271	0.26022	0.1948:0.0:0.8052:0.0	.	.	.	.	X	545;545;547;396;288;312;325	.	ENSP00000299402:Y545X	Y	-	3	2	APBB1	6378826	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.546000	0.45778	1.282000	0.44496	0.650000	0.86243	TAC	.		0.493	APBB1-023	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471831.1	NM_001164	
AGBL2	79841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	47712149	47712149	+	Silent	SNP	C	C	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr11:47712149C>T	ENST00000525123.1	-	10	1395	c.1110G>A	c.(1108-1110)ggG>ggA	p.G370G	AGBL2_ENST00000298861.4_Silent_p.G370G|AGBL2_ENST00000529712.1_5'UTR|AGBL2_ENST00000528244.1_Silent_p.G332G|AGBL2_ENST00000357610.3_Silent_p.G370G	NM_024783.3	NP_079059.2	Q5U5Z8	CBPC2_HUMAN	ATP/GTP binding protein-like 2	370						cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)	34						AGGGCTGCTGCCCATCATCCG	0.463																																					p.G370G		.											.	AGBL2	92	0			c.G1110A						.						178.0	152.0	161.0					11																	47712149		2201	4298	6499	SO:0001819	synonymous_variant	79841	exon10			CTGCTGCCCATCA		CCDS7944.1	11p11.2	2014-06-23			ENSG00000165923	ENSG00000165923			26296	protein-coding gene	gene with protein product	"""cytoplasmic carboxypeptidase 2"""					12738998, 21303978	Standard	NM_024783		Approved	FLJ23598, CCP2	uc001ngg.3	Q5U5Z8	OTTHUMG00000165368	ENST00000525123.1:c.1110G>A	11.37:g.47712149C>T		157.0	0.0		216.0	97.0	NM_024783	A8MPX2|Q53FV5|Q8IV57|Q9H5C0	Silent	SNP	ENST00000525123.1	37	CCDS7944.1																																																																																			.		0.463	AGBL2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383726.2	NM_024783	
ATF7IP	55729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	14650961	14650961	+	Missense_Mutation	SNP	G	G	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr12:14650961G>T	ENST00000540793.1	+	14	3922	c.3767G>T	c.(3766-3768)tGt>tTt	p.C1256F	ATF7IP_ENST00000536444.1_Missense_Mutation_p.C1255F|ATF7IP_ENST00000544627.1_Missense_Mutation_p.C1264F|ATF7IP_ENST00000261168.4_Missense_Mutation_p.C1256F			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	1256	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Interaction with MBD1.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						GGGCCTTTCTGTGATCCTCAG	0.423																																					p.C1256F		.											.	ATF7IP	252	0			c.G3767T						.						169.0	173.0	171.0					12																	14650961		2203	4300	6503	SO:0001583	missense	55729	exon15			CTTTCTGTGATCC	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.3767G>T	12.37:g.14650961G>T	ENSP00000444589:p.Cys1256Phe	85.0	0.0		56.0	38.0	NM_018179	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	ENST00000540793.1	37	CCDS8663.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444804	0.83993	.	.	ENSG00000171681	ENST00000261168;ENST00000536444;ENST00000544627;ENST00000540793	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	6.17	6.17	0.99709	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.53286	0.1787	L	0.48642	1.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.47302	-0.9128	10	0.87932	D	0	-12.7129	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1255;1256	G3V1U0;Q6VMQ6	.;MCAF1_HUMAN	F	1256;1255;1264;1256	ENSP00000261168:C1256F;ENSP00000445955:C1255F;ENSP00000440440:C1264F;ENSP00000444589:C1256F	ENSP00000261168:C1256F	C	+	2	0	ATF7IP	14542228	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.863000	0.99569	2.941000	0.99782	0.655000	0.94253	TGT	.		0.423	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179	
BCAN	63827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156618360	156618360	+	Splice_Site	SNP	G	G	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr1:156618360G>C	ENST00000329117.5	+	6	1106	c.770G>C	c.(769-771)gGa>gCa	p.G257A	BCAN_ENST00000361588.5_Splice_Site_p.G257A|RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	257	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ctccacCCAGGAGAACTGTTC	0.597																																					p.G257A		.											.	BCAN	516	0			c.G770C						.						64.0	66.0	65.0					1																	156618360		2203	4300	6503	SO:0001630	splice_region_variant	63827	exon6			ACCCAGGAGAACT	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.770-1G>C	1.37:g.156618360G>C		75.0	0.0		85.0	32.0	NM_198427	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	ENST00000329117.5	37	CCDS1149.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.527213	0.44969	.	.	ENSG00000132692	ENST00000255029;ENST00000329117;ENST00000424639;ENST00000361588	T;T;T	0.10099	2.91;2.91;2.91	4.65	4.65	0.58169	C-type lectin fold (1);Link (3);	0.000000	0.64402	D	0.000018	T	0.36690	0.0976	M	0.93150	3.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.52290	-0.8595	9	.	.	.	.	16.2642	0.82565	0.0:0.0:1.0:0.0	.	257;257	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	A	198;257;155;257	ENSP00000331210:G257A;ENSP00000401709:G155A;ENSP00000354925:G257A	.	G	+	2	0	BCAN	154884984	1.000000	0.71417	1.000000	0.80357	0.025000	0.11179	9.648000	0.98483	2.415000	0.81967	0.555000	0.69702	GGA	.		0.597	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948	Missense_Mutation
LMNTD2	256329	hgsc.bcm.edu;broad.mit.edu	37	11	556881	556881	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr11:556881delG	ENST00000329451.3	-	8	992	c.930delC	c.(928-930)tccfs	p.S310fs	RP11-496I9.1_ENST00000527113.1_RNA|RP11-496I9.1_ENST00000527620.1_RNA	NM_173573.2	NP_775844.2	Q8IXW0	LMTD2_HUMAN		310										NS(1)|breast(1)|central_nervous_system(1)|lung(4)|pancreas(1)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCGCTTGCTCGGAGGAAGCGC	0.701																																					p.S310fs		.											.	C11orf35	69	0			c.930delC						.						12.0	15.0	14.0					11																	556881		2181	4288	6469	SO:0001589	frameshift_variant	256329	exon8			TTGCTCGGAGGAA																												ENST00000329451.3:c.930delC	11.37:g.556881delG	ENSP00000331167:p.Ser310fs	25.0	0.0		38.0	13.0	NM_173573		Frame_Shift_Del	DEL	ENST00000329451.3	37	CCDS7701.1																																																																																			.		0.701	C11orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254973.2		
NUTM1	256646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	34640560	34640560	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr15:34640560C>T	ENST00000333756.4	+	2	562	c.407C>T	c.(406-408)gCa>gTa	p.A136V	NUTM1_ENST00000438749.3_Missense_Mutation_p.A154V|NUTM1_ENST00000537011.1_Missense_Mutation_p.A164V	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	136	Pro-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)											TTTGTGACAGCATCTAATGTG	0.562																																					p.A136V		.											.	C15orf55	206	0			c.C407T						.						67.0	58.0	61.0					15																	34640560		2201	4298	6499	SO:0001583	missense	256646	exon2			TGACAGCATCTAA	AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.407C>T	15.37:g.34640560C>T	ENSP00000329448:p.Ala136Val	117.0	0.0		112.0	39.0	NM_175741	B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	ENST00000333756.4	37	CCDS32190.1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.341155	0.41498	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000354999;ENST00000333756	T;T;T	0.28895	1.59;1.59;1.59	5.69	4.78	0.61160	Nuclear Testis  protein, N-terminal (1);	0.456783	0.20699	N	0.087312	T	0.49081	0.1536	M	0.80183	2.485	0.09310	N	1	D;D;P	0.63046	0.992;0.99;0.751	P;P;B	0.55545	0.778;0.67;0.357	T	0.49254	-0.8959	10	0.87932	D	0	.	10.4922	0.44756	0.0:0.9111:0.0:0.0889	.	154;164;136	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	V	164;154;136;136	ENSP00000444896:A164V;ENSP00000407031:A154V;ENSP00000329448:A136V	ENSP00000329448:A136V	A	+	2	0	C15orf55	32427852	0.010000	0.17322	0.003000	0.11579	0.090000	0.18270	2.098000	0.41757	1.414000	0.47017	0.655000	0.94253	GCA	.		0.562	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418026.1	NM_175741	
CFAP61	26074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	20177325	20177325	+	Missense_Mutation	SNP	C	C	T	rs142308308		TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr20:20177325C>T	ENST00000245957.5	+	16	1778	c.1702C>T	c.(1702-1704)Cgg>Tgg	p.R568W	C20orf26_ENST00000377309.2_5'UTR|C20orf26_ENST00000389656.3_5'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		568										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		CCCCATTTTCCGGCACTACAC	0.468																																					p.R568W		.											.	C20orf26	94	0			c.C1702T						.	C	TRP/ARG	0,4406		0,0,2203	146.0	128.0	134.0		1702	4.8	1.0	20	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	no	missense	C20orf26	NM_015585.3	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	568/1238	20177325	1,13005	2203	4300	6503	SO:0001583	missense	26074	exon16			ATTTTCCGGCACT																												ENST00000245957.5:c.1702C>T	20.37:g.20177325C>T	ENSP00000245957:p.Arg568Trp	108.0	0.0		200.0	113.0	NM_015585	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	37	CCDS33447.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.297695	0.81025	0.0	1.16E-4	ENSG00000089101	ENST00000343997;ENST00000339482;ENST00000389655;ENST00000245957	T	0.58210	0.35	5.83	4.83	0.62350	.	0.239742	0.36854	N	0.002374	T	0.60090	0.2242	L	0.42245	1.32	0.80722	D	1	D;D	0.76494	0.999;0.998	P;P	0.59221	0.854;0.731	T	0.62101	-0.6925	10	0.72032	D	0.01	.	13.5742	0.61864	0.2721:0.7279:0.0:0.0	.	548;568	F8W6K4;Q8NHU2	.;CT026_HUMAN	W	508;136;548;568	ENSP00000245957:R568W	ENSP00000245957:R568W	R	+	1	2	C20orf26	20125325	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.387000	0.44389	2.741000	0.93983	0.655000	0.94253	CGG	C|1.000;T|0.000		0.468	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3		
C21orf59	56683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	33976524	33976524	+	Missense_Mutation	SNP	C	C	A	rs367724246		TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr21:33976524C>A	ENST00000290155.3	-	4	1067	c.445G>T	c.(445-447)Gcg>Tcg	p.A149S	C21orf59_ENST00000540881.1_Missense_Mutation_p.A93S|AP000275.65_ENST00000553001.1_Missense_Mutation_p.A149S|C21orf59_ENST00000382549.4_Missense_Mutation_p.A149S	NM_021254.2	NP_067077.1	P57076	CU059_HUMAN	chromosome 21 open reading frame 59	149						cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|prostate(1)|skin(1)	5						ATCATCACCGCGCCTCGAAGC	0.493																																					p.A149S		.											.	C21orf59	90	0			c.G445T						.						129.0	108.0	115.0					21																	33976524		2203	4300	6503	SO:0001583	missense	56683	exon4			TCACCGCGCCTCG	AF282851	CCDS13617.1	21q22.11	2014-02-03	2003-07-22		ENSG00000159079	ENSG00000159079			1301	protein-coding gene	gene with protein product		615494	"""chromosome 21 open reading frame 48"""	C21orf48		24094744	Standard	NM_021254		Approved	FLJ20467, FBB18, CILD26	uc002yqc.3	P57076	OTTHUMG00000179510	ENST00000290155.3:c.445G>T	21.37:g.33976524C>A	ENSP00000290155:p.Ala149Ser	108.0	0.0		172.0	78.0	NM_021254	Q53FH0	Missense_Mutation	SNP	ENST00000290155.3	37	CCDS13617.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.881309	0.91740	.	.	ENSG00000159079	ENST00000553001;ENST00000440966;ENST00000382549;ENST00000290155;ENST00000543202;ENST00000540881;ENST00000458138	.	.	.	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.83358	0.5237	M	0.84326	2.69	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.977;0.992;1.0;0.999;1.0;1.0	D;D;P;P;D;P;D;D	0.91635	0.999;0.998;0.788;0.831;0.997;0.874;0.998;0.999	D	0.85121	0.0969	9	0.54805	T	0.06	-16.3074	18.2748	0.90078	0.0:1.0:0.0:0.0	.	93;149;149;149;149;30;149;149	F5GXV2;Q53FH0;C9J818;P57076;D3DSE6;Q8N9H5;Q96NJ2;F8VZ95	.;.;.;CU059_HUMAN;.;.;.;.	S	149;149;149;149;149;93;132	.	ENSP00000290155:A149S	A	-	1	0	C21orf59	32898395	1.000000	0.71417	0.243000	0.24186	0.699000	0.40488	7.647000	0.83462	2.539000	0.85634	0.563000	0.77884	GCG	.		0.493	C21orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139431.1	NM_021254	
C9orf85	138241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	74586499	74586499	+	Silent	SNP	C	C	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr9:74586499C>T	ENST00000377031.3	+	3	478	c.288C>T	c.(286-288)tgC>tgT	p.C96C	C9orf85_ENST00000334731.2_Silent_p.C96C|C9orf85_ENST00000486911.2_Intron			Q96MD7	CI085_HUMAN	chromosome 9 open reading frame 85	96										kidney(2)|large_intestine(1)|lung(4)	7						TTGAAGTTTGCGCAAAATGTG	0.308																																					p.C96C		.											.	C9orf85	90	0			c.C288T						.						148.0	135.0	139.0					9																	74586499		2203	4300	6503	SO:0001819	synonymous_variant	138241	exon3			AGTTTGCGCAAAA	BC010179	CCDS6639.1	9q21.2	2012-03-16			ENSG00000155621	ENSG00000155621			28784	protein-coding gene	gene with protein product						12477932	Standard	NM_182505		Approved	MGC61599	uc004ain.3	Q96MD7	OTTHUMG00000020002	ENST00000377031.3:c.288C>T	9.37:g.74586499C>T		48.0	0.0		65.0	33.0	NM_182505	Q5W0N1|Q5W0N3|Q6PJW9|Q86U95	Silent	SNP	ENST00000377031.3	37																																																																																				.		0.308	C9orf85-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052628.2	NM_182505	
CACNA1C	775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	2558277	2558277	+	Missense_Mutation	SNP	G	G	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr12:2558277G>T	ENST00000347598.4	+	4	613	c.613G>T	c.(613-615)Gtg>Ttg	p.V205L	CACNA1C_ENST00000327702.7_Missense_Mutation_p.V205L|CACNA1C_ENST00000399634.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000399629.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000399597.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000399591.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000406454.3_Missense_Mutation_p.V205L|CACNA1C_ENST00000480911.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000399621.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000344100.3_Missense_Mutation_p.V205L|CACNA1C_ENST00000399606.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000399617.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000399601.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000399655.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000399637.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000399641.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000399603.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000399644.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000399595.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000399649.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000335762.5_Missense_Mutation_p.V205L|CACNA1C_ENST00000399638.1_Missense_Mutation_p.V205L|CACNA1C_ENST00000402845.3_Missense_Mutation_p.V205L	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	205					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AATTGTGGTTGTGGGGTAAGT	0.468																																					p.V205L		.											.	CACNA1C	34	0			c.G613T						.						65.0	67.0	67.0					12																	2558277		1852	4059	5911	SO:0001583	missense	775	exon4			GTGGTTGTGGGGT	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.613G>T	12.37:g.2558277G>T	ENSP00000266376:p.Val205Leu	118.0	0.0		97.0	60.0	NM_001129831	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.064643	0.76187	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97279	-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32	4.71	4.71	0.59529	Ion transport (1);	0.206543	0.41500	N	0.000878	D	0.97111	0.9056	L	0.35593	1.075	0.58432	D	0.999999	D;D;B;D;D;D;D;B;D;D;D;B;B;D;B;D;D;D;D;D	0.76494	0.968;0.996;0.002;0.985;0.999;0.959;0.998;0.019;0.97;0.999;0.99;0.066;0.112;0.998;0.05;0.99;0.998;0.998;0.959;0.959	D;D;B;D;D;D;D;B;P;D;D;B;B;D;B;D;D;D;D;D	0.80764	0.963;0.987;0.026;0.976;0.994;0.949;0.994;0.061;0.721;0.994;0.98;0.053;0.199;0.994;0.075;0.98;0.994;0.994;0.949;0.949	D	0.96683	0.9505	10	0.34782	T	0.22	.	17.9253	0.88982	0.0:0.0:1.0:0.0	.	205;205;205;205;205;205;205;205;205;205;205;205;205;205;205;205;205;205;205;205	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-11;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	L	205;205;205;205;205;205;205;205;205;205;205;205;205;205;205;205;205;205;205;205;205;205;205;46	ENSP00000336982:V205L;ENSP00000382563:V205L;ENSP00000437936:V205L;ENSP00000382552:V205L;ENSP00000382547:V205L;ENSP00000382506:V205L;ENSP00000382530:V205L;ENSP00000382546:V205L;ENSP00000382500:V205L;ENSP00000382549:V205L;ENSP00000266376:V205L;ENSP00000382515:V205L;ENSP00000382510:V205L;ENSP00000341092:V205L;ENSP00000382537:V205L;ENSP00000329877:V205L;ENSP00000382557:V205L;ENSP00000385724:V205L;ENSP00000382512:V205L;ENSP00000382542:V205L;ENSP00000382526:V205L;ENSP00000385896:V205L;ENSP00000382504:V205L	ENSP00000323129:V46L	V	+	1	0	CACNA1C	2428538	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	7.589000	0.82641	2.470000	0.83445	0.638000	0.83543	GTG	.		0.468	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
CD244	51744	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160801203	160801203	+	Missense_Mutation	SNP	T	T	G	rs146201991		TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr1:160801203T>G	ENST00000368033.3	-	9	1129	c.1047A>C	c.(1045-1047)caA>caC	p.Q349H	CD244_ENST00000368034.4_Missense_Mutation_p.Q344H|CD244_ENST00000481677.1_5'Flank|CD244_ENST00000322302.7_Missense_Mutation_p.Q252H			Q9BZW8	CD244_HUMAN	CD244 molecule, natural killer cell receptor 2B4	349					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	18	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			GGGCTTTAGGTTGACTCTTTC	0.458																																					p.Q349H		.											.	CD244	91	0			c.A1047C						.						124.0	121.0	122.0					1																	160801203		2203	4300	6503	SO:0001583	missense	51744	exon9			TTTAGGTTGACTC	AF105261	CCDS1210.1, CCDS53398.1, CCDS53399.1	1q23.1	2013-01-11	2006-03-29		ENSG00000122223	ENSG00000122223		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18171	protein-coding gene	gene with protein product		605554	"""natural killer cell receptor 2B4"", ""CD244 natural killer cell receptor 2B4"""			3772297, 10458320	Standard	NM_016382		Approved	2B4, NAIL, NKR2B4, Nmrk, SLAMF4	uc009wtq.3	Q9BZW8	OTTHUMG00000028606	ENST00000368033.3:c.1047A>C	1.37:g.160801203T>G	ENSP00000357012:p.Gln349His	74.0	0.0		115.0	17.0	NM_001166663	Q5VYI2|Q5VYI6|Q5VYI7|Q96T47|Q9NQD2|Q9NQD3|Q9Y288	Missense_Mutation	SNP	ENST00000368033.3	37	CCDS53399.1	.	.	.	.	.	.	.	.	.	.	t	11.37	1.619532	0.28801	.	.	ENSG00000122223	ENST00000368034;ENST00000368033;ENST00000322302	T;T;T	0.31247	3.52;2.93;1.5	3.83	-7.67	0.01272	.	3.115750	0.00960	N	0.003086	T	0.06050	0.0157	N	0.24115	0.695	0.09310	N	1	B;B;D	0.54601	0.248;0.0;0.967	B;B;P	0.46049	0.097;0.0;0.502	T	0.40365	-0.9567	10	0.25106	T	0.35	-19.522	2.4305	0.04470	0.2163:0.4013:0.2192:0.1632	.	252;349;344	Q9BZW8-4;Q9BZW8;Q9BZW8-2	.;CD244_HUMAN;.	H	344;349;252	ENSP00000357013:Q344H;ENSP00000357012:Q349H;ENSP00000313619:Q252H	ENSP00000313619:Q252H	Q	-	3	2	CD244	159067827	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.105000	0.01339	-2.682000	0.00408	-1.224000	0.01588	CAA	T|1.000;C|0.000		0.458	CD244-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071469.1	NM_016382	
CDKN1A	1026	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	36652024	36652024	+	Missense_Mutation	SNP	G	G	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr6:36652024G>T	ENST00000405375.1	+	2	381	c.146G>T	c.(145-147)tGg>tTg	p.W49L	CDKN1A_ENST00000244741.5_Missense_Mutation_p.W49L|CDKN1A_ENST00000373711.2_Missense_Mutation_p.W49L|CDKN1A_ENST00000478800.1_3'UTR|CDKN1A_ENST00000448526.2_Missense_Mutation_p.W83L	NM_001220778.1	NP_001207707.1	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	49					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to ionizing radiation (GO:0071479)|cellular senescence (GO:0090398)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of gene expression (GO:0010629)|negative regulation of phosphorylation (GO:0042326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of DNA biosynthetic process (GO:2000278)|regulation of protein import into nucleus, translocation (GO:0033158)|response to arsenic-containing substance (GO:0046685)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to organonitrogen compound (GO:0010243)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|stress-induced premature senescence (GO:0090400)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA-p21 complex (GO:0070557)	cyclin-dependent protein kinase activating kinase activity (GO:0019912)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)	p.W49*(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|urinary_tract(5)	15						CGTGAGCGATGGAACTTCGAC	0.667																																					p.W49L		.											.	CDKN1A	872	1	Substitution - Nonsense(1)	urinary_tract(1)	c.G146T						.						57.0	51.0	53.0					6																	36652024		2203	4300	6503	SO:0001583	missense	1026	exon2			AGCGATGGAACTT	U03106	CCDS4824.1	6p21.1	2009-01-21			ENSG00000124762	ENSG00000124762			1784	protein-coding gene	gene with protein product		116899		CDKN1			Standard	NM_000389		Approved	P21, CIP1, WAF1, SDI1, CAP20, p21CIP1, p21Cip1/Waf1	uc021yzb.1	P38936	OTTHUMG00000014603	ENST00000405375.1:c.146G>T	6.37:g.36652024G>T	ENSP00000384849:p.Trp49Leu	32.0	0.0		78.0	44.0	NM_001220778	Q14010|Q6FI05|Q9BUT4	Missense_Mutation	SNP	ENST00000405375.1	37	CCDS4824.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.733646	0.89482	.	.	ENSG00000124762	ENST00000448526;ENST00000244741;ENST00000405375;ENST00000373711	D;D;D;D	0.90504	-2.68;-2.68;-2.68;-2.68	5.06	5.06	0.68205	.	0.000000	0.49916	D	0.000129	D	0.95484	0.8533	M	0.90252	3.1	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.986;0.993	D	0.95850	0.8874	10	0.87932	D	0	-33.4034	13.8081	0.63246	0.0:0.0:1.0:0.0	.	83;49;49	B4DQP9;P38936;Q96LE1	.;CDN1A_HUMAN;.	L	83;49;49;49	ENSP00000409259:W83L;ENSP00000244741:W49L;ENSP00000384849:W49L;ENSP00000362815:W49L	ENSP00000244741:W49L	W	+	2	0	CDKN1A	36760002	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.535000	0.73838	2.642000	0.89623	0.561000	0.74099	TGG	.		0.667	CDKN1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040354.1	NM_078467	
CISD3	284106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	36889706	36889706	+	Nonstop_Mutation	SNP	T	T	G			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr17:36889706T>G	ENST00000439660.2	+	4	506	c.382T>G	c.(382-384)Tga>Gga	p.*128G	CISD3_ENST00000578573.1_3'UTR|RNA5SP440_ENST00000363245.1_RNA	NM_001136498.1	NP_001129970.1	P0C7P0	CISD3_HUMAN	CDGSH iron sulfur domain 3	0						mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)			endometrium(2)	2						CTCCCCACTCTGAGGGGGCTG	0.642																																					p.X128G		.											.	.	.	0			c.T382G						.						12.0	15.0	14.0					17																	36889706		692	1591	2283	SO:0001578	stop_lost	284106	exon4			CCACTCTGAGGGG	AK097047	CCDS45662.1	17q12	2007-08-10				ENSG00000277972		"""CDGSH iron sulfur domain containing"""	27578	protein-coding gene	gene with protein product	"""mitoNEET related 2"""	611933				17376863, 17584744	Standard	NM_001136498		Approved	Miner2	uc010wds.1	P0C7P0		ENST00000439660.2:c.382T>G	17.37:g.36889706T>G	ENSP00000391402:p.*128Glyext*29	35.0	0.0		53.0	29.0	NM_001136498		Missense_Mutation	SNP	ENST00000439660.2	37	CCDS45662.1	.	.	.	.	.	.	.	.	.	.	T	14.79	2.641881	0.47153	.	.	ENSG00000230055	ENST00000439660	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8256	0.52265	0.0:0.0:0.0:1.0	.	.	.	.	G	128	.	.	X	+	1	0	CISD3	34143232	0.992000	0.36948	0.789000	0.31954	0.698000	0.40448	1.634000	0.37123	2.044000	0.60594	0.374000	0.22700	TGA	.		0.642	CISD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441921.1		
CLYBL	171425	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	100515304	100515304	+	Missense_Mutation	SNP	A	A	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr13:100515304A>C	ENST00000376360.1	+	4	525	c.498A>C	c.(496-498)ttA>ttC	p.L166F	CLYBL_ENST00000376354.1_Intron|CLYBL_ENST00000339105.4_Missense_Mutation_p.L166F|CLYBL_ENST00000376355.3_Intron|CLYBL_ENST00000444838.2_Intron			Q8N0X4	CLYBL_HUMAN	citrate lyase beta like	166						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|metal ion binding (GO:0046872)			NS(1)|kidney(6)|large_intestine(6)|lung(10)|skin(2)	25	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CAATGAATTTAATCCCTTTTG	0.333																																					p.L166F		.											.	CLYBL	90	0			c.A498C						.						88.0	88.0	88.0					13																	100515304		2203	4300	6503	SO:0001583	missense	171425	exon4			GAATTTAATCCCT	AF428253	CCDS32002.1	13q32.3	2011-04-08			ENSG00000125246	ENSG00000125246			18355	protein-coding gene	gene with protein product		609686					Standard	XM_005254030		Approved	CLB	uc001vok.3	Q8N0X4	OTTHUMG00000017278	ENST00000376360.1:c.498A>C	13.37:g.100515304A>C	ENSP00000365538:p.Leu166Phe	38.0	0.0		65.0	20.0	NM_206808	Q5W0F7|Q8TDH8	Missense_Mutation	SNP	ENST00000376360.1	37	CCDS32002.1	.	.	.	.	.	.	.	.	.	.	A	18.65	3.668739	0.67814	.	.	ENSG00000125246	ENST00000376360;ENST00000339105;ENST00000416504	T;T;T	0.38887	1.11;1.11;1.11	5.42	5.42	0.78866	Aldehyde-lyase domain (1);Pyruvate/Phosphoenolpyruvate kinase (2);	0.066402	0.64402	D	0.000007	T	0.48021	0.1477	M	0.69248	2.105	0.80722	D	1	P	0.49961	0.93	P	0.51866	0.682	T	0.52586	-0.8556	10	0.51188	T	0.08	0.3097	5.3713	0.16140	0.7214:0.0:0.0822:0.1964	.	166	Q8N0X4	CLYBL_HUMAN	F	166;166;83	ENSP00000365538:L166F;ENSP00000342991:L166F;ENSP00000403408:L83F	ENSP00000342991:L166F	L	+	3	2	CLYBL	99313305	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.934000	0.40163	2.180000	0.69256	0.460000	0.39030	TTA	.		0.333	CLYBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045611.1		
CR1	1378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207739189	207739189	+	Silent	SNP	A	A	G			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr1:207739189A>G	ENST00000367049.4	+	24	3873	c.3873A>G	c.(3871-3873)caA>caG	p.Q1291Q	RP11-78B10.2_ENST00000597497.1_RNA|CR1_ENST00000367051.1_Silent_p.Q841Q|CR1_ENST00000367052.1_Intron|CR1_ENST00000367053.1_Silent_p.Q841Q|CR1_ENST00000400960.2_Silent_p.Q841Q	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	841	Sushi 20. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TTAGATTTCAATTAAAAGGCA	0.413																																					p.Q1291Q		.											.	CR1	93	0			c.A3873G						.						255.0	225.0	234.0					1																	207739189		1821	4092	5913	SO:0001819	synonymous_variant	1378	exon24			ATTTCAATTAAAA	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.3873A>G	1.37:g.207739189A>G		379.0	0.0		525.0	218.0	NM_000651	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Silent	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	a	9.830	1.188053	0.21954	.	.	ENSG00000203710	ENST00000529814	.	.	.	2.72	-5.44	0.02624	.	.	.	.	.	T	0.16811	0.0404	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.22730	-1.0208	4	.	.	.	.	1.3663	0.02202	0.2803:0.1695:0.3832:0.167	.	.	.	.	S	367	.	.	N	+	2	0	CR1	205805812	0.000000	0.05858	0.000000	0.03702	0.807000	0.45602	-1.367000	0.02583	-1.411000	0.02032	0.254000	0.18369	AAT	.		0.413	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	113668402	113668402	+	Silent	SNP	A	A	G			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr8:113668402A>G	ENST00000297405.5	-	18	3229	c.2985T>C	c.(2983-2985)ggT>ggC	p.G995G	CSMD3_ENST00000343508.3_Silent_p.G955G|CSMD3_ENST00000455883.2_Silent_p.G891G|CSMD3_ENST00000352409.3_Silent_p.G995G	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	995	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GAATCTTGAAACCATTATTGG	0.308										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.G995G		.											.	CSMD3	1132	0			c.T2985C						.						58.0	65.0	62.0					8																	113668402		2203	4300	6503	SO:0001819	synonymous_variant	114788	exon18			CTTGAAACCATTA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2985T>C	8.37:g.113668402A>G		72.0	0.0		115.0	37.0	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1																																																																																			.		0.308	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CSNK2A1	1457	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	489179	489184	+	In_Frame_Del	DEL	GGCACG	GGCACG	-	rs138114936	byFrequency	TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	GGCACG	GGCACG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr20:489179_489184delGGCACG	ENST00000217244.3	-	3	387_392	c.12_17delCGTGCC	c.(10-18)cccgtgcca>cca	p.4_6PVP>P	CSNK2A1_ENST00000400227.3_In_Frame_Del_p.4_6PVP>P|CSNK2A1_ENST00000349736.5_In_Frame_Del_p.4_6PVP>P|CSNK2A1_ENST00000400217.2_Intron	NM_177559.2	NP_808227.1	P68400	CSK21_HUMAN	casein kinase 2, alpha 1 polypeptide	4					axon guidance (GO:0007411)|chaperone-mediated protein folding (GO:0061077)|mitotic cell cycle (GO:0000278)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	ATP binding (GO:0005524)|Hsp90 protein binding (GO:0051879)|protein N-terminus binding (GO:0047485)|protein phosphatase regulator activity (GO:0019888)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)			GGCCCTGCTTGGCACGGGTCCCGACA	0.495																																					p.4_6del		.											.	CSNK2A1	791	0			c.12_17del						.																																			SO:0001651	inframe_deletion	1457	exon2			CTGCTTGGCACGG	M55265	CCDS13003.1, CCDS13004.1	20p13	2013-01-17			ENSG00000101266	ENSG00000101266			2457	protein-coding gene	gene with protein product		115440				2174700, 1766873	Standard	NM_177559		Approved		uc002wdx.1	P68400	OTTHUMG00000031636	ENST00000217244.3:c.12_17delCGTGCC	20.37:g.489179_489184delGGCACG	ENSP00000217244:p.Pro4_Val5del	143.0	0.0		204.0	37.0	NM_001895	B4DYS6|D3DVV8|P19138|P20426|Q14013|Q5U065	In_Frame_Del	DEL	ENST00000217244.3	37	CCDS13003.1																																																																																			.		0.495	CSNK2A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077466.1	NM_001895	
CYSLTR2	57105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	49281716	49281716	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr13:49281716A>G	ENST00000282018.3	+	1	766	c.763A>G	c.(763-765)Atc>Gtc	p.I255V		NM_020377.2	NP_065110.1	Q9NS75	CLTR2_HUMAN	cysteinyl leukotriene receptor 2	255					immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell death (GO:0010942)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteinyl leukotriene receptor activity (GO:0001631)|leukotriene receptor activity (GO:0004974)			endometrium(2)|large_intestine(4)|lung(12)|skin(2)	20		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)		GBM - Glioblastoma multiforme(99;1.19e-09)	Nedocromil(DB00716)	CACCTTGATCATCTTCTTCTT	0.488																																					p.I255V		.											.	CYSLTR2	278	0			c.A763G						.						140.0	125.0	130.0					13																	49281716		2203	4300	6503	SO:0001583	missense	57105	exon1			TTGATCATCTTCT	AB038269	CCDS9412.1	13q14.2	2012-08-10			ENSG00000152207	ENSG00000152207		"""GPCR / Class A : Leukotriene receptors"""	18274	protein-coding gene	gene with protein product		605666				10913337, 1085123	Standard	NM_020377		Approved	CysLT(2), CYSLT2R	uc001vck.2	Q9NS75	OTTHUMG00000016906	ENST00000282018.3:c.763A>G	13.37:g.49281716A>G	ENSP00000282018:p.Ile255Val	25.0	0.0		49.0	15.0	NM_020377	Q9HCQ2	Missense_Mutation	SNP	ENST00000282018.3	37	CCDS9412.1	.	.	.	.	.	.	.	.	.	.	A	11.41	1.631129	0.28978	.	.	ENSG00000152207	ENST00000282018	T	0.67698	-0.28	5.65	0.362	0.16113	GPCR, rhodopsin-like superfamily (1);	0.423702	0.21166	N	0.079066	T	0.41259	0.1151	L	0.28556	0.865	0.23862	N	0.996637	B	0.25850	0.136	B	0.23852	0.049	T	0.28522	-1.0041	10	0.02654	T	1	.	4.4136	0.11445	0.3053:0.4989:0.0814:0.1145	.	255	Q9NS75	CLTR2_HUMAN	V	255	ENSP00000282018:I255V	ENSP00000282018:I255V	I	+	1	0	CYSLTR2	48179717	0.682000	0.27624	1.000000	0.80357	0.887000	0.51463	0.838000	0.27572	0.384000	0.24942	0.533000	0.62120	ATC	.		0.488	CYSLTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044894.1		
DCTN4	51164	ucsc.edu;bcgsc.ca	37	5	150111050	150111050	+	Splice_Site	SNP	T	T	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr5:150111050T>C	ENST00000447998.2	-	6	654	c.539A>G	c.(538-540)gAc>gGc	p.D180G	DCTN4_ENST00000446090.2_Splice_Site_p.D187G|DCTN4_ENST00000424236.1_Splice_Site_p.D123G|DCTN4_ENST00000521093.1_5'Flank	NM_016221.3	NP_057305.1	Q9UJW0	DCTN4_HUMAN	dynactin 4 (p62)	180					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	10		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACCATATTTGTCCTAAACAAA	0.418																																					p.D187G		.											.	DCTN4	90	0			c.A560G						.						53.0	51.0	51.0					5																	150111050		2203	4300	6503	SO:0001630	splice_region_variant	51164	exon7			TATTTGTCCTAAA	AF195120	CCDS4310.1, CCDS47310.1, CCDS47311.1	5q31-q32	2008-05-23			ENSG00000132912	ENSG00000132912			15518	protein-coding gene	gene with protein product		614758				10843801, 16554302	Standard	NM_016221		Approved		uc010jhi.3	Q9UJW0	OTTHUMG00000130079	ENST00000447998.2:c.538-1A>G	5.37:g.150111050T>C		26.0	0.0		29.0	4.0	NM_001135643	B3KWW0|D3DQH0|E5RGT5|Q8TAN8	Missense_Mutation	SNP	ENST00000447998.2	37	CCDS4310.1	.	.	.	.	.	.	.	.	.	.	T	18.90	3.721151	0.68959	.	.	ENSG00000132912	ENST00000447998;ENST00000424236;ENST00000446090;ENST00000521728;ENST00000518015	T;T;T;T;T	0.24908	1.83;1.83;2.06;1.83;1.83	5.88	5.88	0.94601	.	0.049868	0.85682	D	0.000000	T	0.32675	0.0837	L	0.54323	1.7	0.80722	D	1	B;B	0.26708	0.135;0.157	B;B	0.36608	0.082;0.229	T	0.05937	-1.0855	10	0.30854	T	0.27	-14.9982	16.2792	0.82664	0.0:0.0:0.0:1.0	.	187;180	Q9UJW0-3;Q9UJW0	.;DCTN4_HUMAN	G	180;123;187;37;123	ENSP00000416968:D180G;ENSP00000411251:D123G;ENSP00000414906:D187G;ENSP00000428987:D37G;ENSP00000430993:D123G	ENSP00000411251:D123G	D	-	2	0	DCTN4	150091243	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.576000	0.67437	2.243000	0.73865	0.533000	0.62120	GAC	.		0.418	DCTN4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252372.1		Missense_Mutation
DNAJB4	11080	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	78479088	78479088	+	Missense_Mutation	SNP	G	G	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr1:78479088G>A	ENST00000370763.5	+	2	822	c.565G>A	c.(565-567)Gat>Aat	p.D189N	GIPC2_ENST00000476882.1_Intron|DNAJB4_ENST00000487931.1_3'UTR	NM_007034.3	NP_008965.2	Q9UDY4	DNJB4_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 4	189					protein folding (GO:0006457)|response to heat (GO:0009408)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|unfolded protein binding (GO:0051082)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						GCTAAACGCTGATGGAAGGAG	0.373																																					p.D189N		.											.	DNAJB4	226	0			c.G565A						.						89.0	95.0	93.0					1																	78479088		2203	4300	6503	SO:0001583	missense	11080	exon2			AACGCTGATGGAA	U40992	CCDS684.1	1p31.1	2011-09-02			ENSG00000162616	ENSG00000162616		"""Heat shock proteins / DNAJ (HSP40)"""	14886	protein-coding gene	gene with protein product		611327				9546042, 11147971	Standard	NM_007034		Approved	HLJ1	uc001dij.3	Q9UDY4	OTTHUMG00000040905	ENST00000370763.5:c.565G>A	1.37:g.78479088G>A	ENSP00000359799:p.Asp189Asn	59.0	0.0		108.0	46.0	NM_007034	B2R824|Q13431	Missense_Mutation	SNP	ENST00000370763.5	37	CCDS684.1	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829812	0.71258	.	.	ENSG00000162616	ENST00000370763	D	0.83673	-1.75	5.33	5.33	0.75918	HSP40/DnaJ peptide-binding (1);	0.000000	0.85682	D	0.000000	T	0.69314	0.3097	L	0.35341	1.055	0.80722	D	1	B	0.29378	0.243	B	0.29785	0.107	T	0.68716	-0.5335	10	0.35671	T	0.21	.	19.088	0.93213	0.0:0.0:1.0:0.0	.	189	Q9UDY4	DNJB4_HUMAN	N	189	ENSP00000359799:D189N	ENSP00000359799:D189N	D	+	1	0	DNAJB4	78251676	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	9.864000	0.99589	2.476000	0.83614	0.650000	0.86243	GAT	.		0.373	DNAJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098248.3		
DUOX1	53905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	45440496	45440496	+	Missense_Mutation	SNP	G	G	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr15:45440496G>C	ENST00000321429.4	+	22	3076	c.2669G>C	c.(2668-2670)tGc>tCc	p.C890S	DUOX1_ENST00000389037.3_Missense_Mutation_p.C890S|DUOX1_ENST00000561166.1_Missense_Mutation_p.C536S	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	890					cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		TCCAACAACTGCCTGTCCAAG	0.577																																					p.C890S		.											.	DUOX1	142	0			c.G2669C						.						96.0	82.0	87.0					15																	45440496		2198	4298	6496	SO:0001583	missense	53905	exon22			ACAACTGCCTGTC	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.2669G>C	15.37:g.45440496G>C	ENSP00000317997:p.Cys890Ser	126.0	0.0		147.0	68.0	NM_017434	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	ENST00000321429.4	37	CCDS32221.1	.	.	.	.	.	.	.	.	.	.	G	6.243	0.413011	0.11812	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	T;T	0.61742	0.08;0.08	5.04	5.04	0.67666	EF-hand-like domain (1);	0.203512	0.52532	D	0.000066	T	0.49201	0.1543	L	0.41573	1.285	0.43787	D	0.996327	P;B	0.40794	0.729;0.038	B;B	0.43251	0.413;0.013	T	0.44375	-0.9332	10	0.02654	T	1	-35.5421	16.2575	0.82525	0.0:0.0:1.0:0.0	.	23;890	Q9NT13;Q9NRD9	.;DUOX1_HUMAN	S	890	ENSP00000317997:C890S;ENSP00000373689:C890S	ENSP00000317997:C890S	C	+	2	0	DUOX1	43227788	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.890000	0.63178	2.780000	0.95670	0.655000	0.94253	TGC	.		0.577	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
ENG	2022	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	130587248	130587248	+	Silent	SNP	A	A	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr9:130587248A>T	ENST00000373203.4	-	7	1222	c.822T>A	c.(820-822)acT>acA	p.T274T	ENG_ENST00000344849.3_Silent_p.T274T|RP11-228B15.4_ENST00000439298.1_RNA|ENG_ENST00000480266.1_5'UTR	NM_000118.2|NM_001114753.1|NM_001278138.1	NP_000109.1|NP_001108225.1|NP_001265067.1	P17813	EGLN_HUMAN	endoglin	274	Required for interaction with EGL.				artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in endocardial cushion formation (GO:0003273)|cell motility (GO:0048870)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|chronological cell aging (GO:0001300)|detection of hypoxia (GO:0070483)|extracellular matrix constituent secretion (GO:0070278)|extracellular matrix disassembly (GO:0022617)|heart looping (GO:0001947)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|patterning of blood vessels (GO:0001569)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of gene expression (GO:0010628)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of phosphorylation (GO:0042325)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to corticosteroid (GO:0031960)|response to hypoxia (GO:0001666)|response to statin (GO:0036273)|response to transforming growth factor beta (GO:0071559)|smooth muscle tissue development (GO:0048745)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	activin binding (GO:0048185)|galactose binding (GO:0005534)|glycosaminoglycan binding (GO:0005539)|protein homodimerization activity (GO:0042803)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane signaling receptor activity (GO:0004888)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	17						AGTATTCTCCAGTGGTCTAAT	0.577									Juvenile Polyposis;Hereditary Hemorrhagic Telangiectasia																												p.T274T		.											.	ENG	90	0			c.T822A						.						69.0	76.0	74.0					9																	130587248		2203	4300	6503	SO:0001819	synonymous_variant	2022	exon7	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HHT, Rendu-Osler-Weber disease, incl.: Pulmonary arteriovenous malformations, hypertrophic osteoarthropathy and juvenile polyposis,	TTCTCCAGTGGTC	AF035753	CCDS6880.1, CCDS48029.1, CCDS75906.1	9q34.11	2014-09-17	2008-09-04		ENSG00000106991	ENSG00000106991		"""CD molecules"""	3349	protein-coding gene	gene with protein product		131195	"""Osler-Rendu-Weber syndrome 1"""	ORW1, ORW		8404038, 10548503	Standard	NM_001278138		Approved	END, HHT1, CD105	uc031tfe.1	P17813	OTTHUMG00000020723	ENST00000373203.4:c.822T>A	9.37:g.130587248A>T		34.0	0.0		40.0	17.0	NM_001114753	Q14248|Q14926|Q5T9C0	Silent	SNP	ENST00000373203.4	37	CCDS48029.1																																																																																			.		0.577	ENG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054313.1		
FAIM2	23017	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	50291319	50291319	+	Silent	SNP	C	C	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr12:50291319C>T	ENST00000320634.3	-	4	457	c.363G>A	c.(361-363)gtG>gtA	p.V121V	FAIM2_ENST00000550890.1_Silent_p.V75V	NM_012306.3	NP_036438.2	Q9BWQ8	LFG2_HUMAN	Fas apoptotic inhibitory molecule 2	121					apoptotic process (GO:0006915)|cerebellar granular layer development (GO:0021681)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum development (GO:0021549)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of neuron apoptotic process (GO:0043523)|response to ischemia (GO:0002931)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|postsynaptic membrane (GO:0045211)				endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|skin(2)	14						TAAAGAGAGCCACGACAGCCA	0.597																																					p.V121V		.											.	FAIM2	230	0			c.G363A						.						67.0	63.0	65.0					12																	50291319		2203	4300	6503	SO:0001819	synonymous_variant	23017	exon4			GAGAGCCACGACA	AB023167	CCDS8791.1	12q13	2010-03-18				ENSG00000135472			17067	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 2"""	604306				10231032, 10535980	Standard	NM_012306		Approved	KIAA0950, LFG, NMP35, LIFEGUARD, TMBIM2, LFG2	uc001rvj.2	Q9BWQ8	OTTHUMG00000169808	ENST00000320634.3:c.363G>A	12.37:g.50291319C>T		136.0	0.0		178.0	69.0	NM_012306	A8K1W6|B3KR08|Q9UJY9|Q9Y2F7	Silent	SNP	ENST00000320634.3	37	CCDS8791.1																																																																																			.		0.597	FAIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405984.1	NM_012306	
FAM83H	286077	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	144808725	144808725	+	Missense_Mutation	SNP	A	A	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr8:144808725A>C	ENST00000388913.3	-	5	3031	c.2906T>G	c.(2905-2907)cTt>cGt	p.L969R		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	969					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CAGCTGCCTAAGACGCAAGGA	0.701																																					p.L969R		.											.	FAM83H	92	0			c.T2906G						.						13.0	15.0	14.0					8																	144808725		1856	4019	5875	SO:0001583	missense	286077	exon5			TGCCTAAGACGCA	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.2906T>G	8.37:g.144808725A>C	ENSP00000373565:p.Leu969Arg	34.0	0.0		59.0	24.0	NM_198488	A0JLS2|Q8N4W0	Missense_Mutation	SNP	ENST00000388913.3	37	CCDS6410.2	.	.	.	.	.	.	.	.	.	.	a	16.36	3.101373	0.56183	.	.	ENSG00000180921	ENST00000388913	T	0.37411	1.2	4.87	4.87	0.63330	.	3.735730	0.01511	U	0.017920	T	0.55305	0.1912	L	0.34521	1.04	0.35170	D	0.771512	D	0.89917	1.0	D	0.76575	0.988	T	0.25779	-1.0122	10	0.44086	T	0.13	.	13.7052	0.62633	1.0:0.0:0.0:0.0	.	969	Q6ZRV2	FA83H_HUMAN	R	969	ENSP00000373565:L969R	ENSP00000373565:L969R	L	-	2	0	FAM83H	144880713	1.000000	0.71417	0.923000	0.36655	0.450000	0.32258	5.107000	0.64603	1.844000	0.53588	0.450000	0.29827	CTT	.		0.701	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
FRA10AC1	118924	broad.mit.edu;ucsc.edu;mdanderson.org	37	10	95441348	95441348	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr10:95441348C>A	ENST00000359204.4	-	11	873	c.676G>T	c.(676-678)Gaa>Taa	p.E226*	FRA10AC1_ENST00000536233.1_Nonsense_Mutation_p.E226*|FRA10AC1_ENST00000394100.2_Nonsense_Mutation_p.E226*|FRA10AC1_ENST00000371430.2_Nonsense_Mutation_p.E226*	NM_145246.4	NP_660289.2	Q70Z53	F10C1_HUMAN	fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1	226	Lys-rich.					nucleus (GO:0005634)				NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(1)	14						GACTTGATTTCTTTTCTCCTT	0.284																																					p.E226X		.											.	FRA10AC1	90	0			c.G676T						.						68.0	60.0	63.0					10																	95441348		2201	4297	6498	SO:0001587	stop_gained	118924	exon11			TGATTTCTTTTCT	AK090955	CCDS7430.1	10q23.33	2014-01-28	2010-05-25	2010-05-25	ENSG00000148690	ENSG00000148690			1162	protein-coding gene	gene with protein product		608866	"""chromosome 10 open reading frame 4"""	C10orf4		15203205	Standard	NM_145246		Approved		uc001kiz.2	Q70Z53	OTTHUMG00000018776	ENST00000359204.4:c.676G>T	10.37:g.95441348C>A	ENSP00000360488:p.Glu226*	35.0	0.0		37.0	6.0	NM_145246	C9JCR4|C9JCR5|C9JMY4|Q70Z49|Q70Z50|Q70Z51|Q70Z52|Q8N293|Q8WVH5|Q96JQ8	Nonsense_Mutation	SNP	ENST00000359204.4	37	CCDS7430.1	.	.	.	.	.	.	.	.	.	.	C	37	6.248933	0.97412	.	.	ENSG00000148690	ENST00000359204;ENST00000536233;ENST00000371426;ENST00000371430;ENST00000394100	.	.	.	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-22.5236	15.7456	0.77939	0.0:1.0:0.0:0.0	.	.	.	.	X	226	.	ENSP00000360488:E226X	E	-	1	0	FRA10AC1	95431338	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.014000	0.57145	2.572000	0.86782	0.655000	0.94253	GAA	.		0.284	FRA10AC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049439.1	NM_145246	
G3BP2	9908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	76579227	76579227	+	Silent	SNP	A	A	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr4:76579227A>C	ENST00000359707.4	-	8	1550	c.765T>G	c.(763-765)ccT>ccG	p.P255P	G3BP2_ENST00000502654.1_5'Flank|G3BP2_ENST00000395719.3_Silent_p.P255P|G3BP2_ENST00000357854.3_Intron	NM_203505.2	NP_987101.1	Q9UN86	G3BP2_HUMAN	GTPase activating protein (SH3 domain) binding protein 2	255					cytoplasmic sequestering of NF-kappaB (GO:0007253)|mRNA transport (GO:0051028)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|receptor signaling complex scaffold activity (GO:0030159)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	27			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			TACCACTAGGAGGCAGGTTTT	0.448																																					p.P255P		.											.	G3BP2	153	0			c.T765G						.						86.0	84.0	85.0					4																	76579227		2203	4300	6503	SO:0001819	synonymous_variant	9908	exon8			ACTAGGAGGCAGG	AB014560	CCDS3571.1, CCDS3572.1	4q21.1	2013-02-12	2006-11-01		ENSG00000138757	ENSG00000138757		"""RNA binding motif (RRM) containing"""	30291	protein-coding gene	gene with protein product	"""Ras-GTPase activating protein SH3 domain-binding protein 2"""					9734811, 9575347	Standard	NM_203504		Approved	KIAA0660	uc003his.3	Q9UN86	OTTHUMG00000130097	ENST00000359707.4:c.765T>G	4.37:g.76579227A>C		57.0	0.0		43.0	29.0	NM_012297	A8K6X1|O60606|O75149|Q9UPA1	Silent	SNP	ENST00000359707.4	37	CCDS3571.1																																																																																			.		0.448	G3BP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252399.2	NM_012297	
GPI	2821	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	34887542	34887542	+	Silent	SNP	C	C	A	rs373085760		TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr19:34887542C>A	ENST00000356487.5	+	14	1490	c.1249C>A	c.(1249-1251)Cgg>Agg	p.R417R	GPI_ENST00000586425.1_Silent_p.R417R|GPI_ENST00000415930.3_Silent_p.R428R	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase	417					aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					GCACCCCATACGGAAGGGTCT	0.592																																					p.R428R		.											.	GPI	228	0			c.C1282A						.						53.0	47.0	49.0					19																	34887542		2203	4300	6503	SO:0001819	synonymous_variant	2821	exon14			CCCATACGGAAGG	M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744		ENST00000356487.5:c.1249C>A	19.37:g.34887542C>A		74.0	0.0		109.0	32.0	NM_001184722	B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Silent	SNP	ENST00000356487.5	37	CCDS12437.1																																																																																			.		0.592	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451693.3		
GPR142	350383	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	72363763	72363763	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr17:72363763C>T	ENST00000335666.4	+	1	167	c.119C>T	c.(118-120)tCc>tTc	p.S40F		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	40						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						TCAATGGTGTCCCATGCACAG	0.542																																					p.S40F		.											.	GPR142	93	0			c.C119T						.						118.0	96.0	103.0					17																	72363763		2203	4300	6503	SO:0001583	missense	350383	exon1			TGGTGTCCCATGC	AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.119C>T	17.37:g.72363763C>T	ENSP00000335158:p.Ser40Phe	90.0	0.0		108.0	34.0	NM_181790	A4CYJ8|Q86SL3	Missense_Mutation	SNP	ENST00000335666.4	37	CCDS11698.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.900822	0.52227	.	.	ENSG00000257008	ENST00000335666	T	0.71698	-0.59	2.09	2.09	0.27110	.	.	.	.	.	T	0.61664	0.2365	N	0.08118	0	0.35323	D	0.784908	D	0.59357	0.985	P	0.56278	0.795	T	0.71255	-0.4647	9	0.87932	D	0	.	9.8751	0.41197	0.0:1.0:0.0:0.0	.	40	Q7Z601	GP142_HUMAN	F	40	ENSP00000335158:S40F	ENSP00000335158:S40F	S	+	2	0	GPR142	69875358	0.998000	0.40836	0.029000	0.17559	0.010000	0.07245	3.861000	0.56002	1.174000	0.42811	0.650000	0.86243	TCC	.		0.542	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790	
GPR75	10936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	54081699	54081699	+	Silent	SNP	C	C	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr2:54081699C>T	ENST00000394705.2	-	2	465	c.195G>A	c.(193-195)ttG>ttA	p.L65L	ASB3_ENST00000406625.2_Intron|GPR75-ASB3_ENST00000352846.3_Intron|ASB3_ENST00000498475.2_Intron	NM_006794.3	NP_006785.1	O95800	GPR75_HUMAN	G protein-coupled receptor 75	65	Phe-rich.				chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of neuron death (GO:1901214)	integral component of plasma membrane (GO:0005887)	C-C chemokine receptor activity (GO:0016493)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CGAAGAAGGACAAGAAGACAA	0.478																																					p.L65L		.											.	GPR75	92	0			c.G195A						.						60.0	56.0	57.0					2																	54081699		2203	4300	6503	SO:0001819	synonymous_variant	10936	exon2			GAAGGACAAGAAG	AF101472	CCDS1849.1	2p16	2012-08-21			ENSG00000119737	ENSG00000119737		"""GPCR / Class A : Orphans"""	4526	protein-coding gene	gene with protein product		606704				10381362	Standard	NM_006794		Approved	WI-31133	uc002rxo.3	O95800	OTTHUMG00000129280	ENST00000394705.2:c.195G>A	2.37:g.54081699C>T		174.0	0.0		230.0	96.0	NM_006794	B2RC02|Q6NWR2	Silent	SNP	ENST00000394705.2	37	CCDS1849.1																																																																																			.		0.478	GPR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251403.2		
HIF3A	64344	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	46812017	46812017	+	Silent	SNP	G	G	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr19:46812017G>A	ENST00000377670.4	+	5	577	c.546G>A	c.(544-546)aaG>aaA	p.K182K	HIF3A_ENST00000600383.1_Silent_p.K113K|HIF3A_ENST00000300862.3_Silent_p.K180K|HIF3A_ENST00000244303.6_Silent_p.K113K|HIF3A_ENST00000525854.1_3'UTR|RNU6-924P_ENST00000362926.1_RNA|HIF3A_ENST00000420102.2_Silent_p.K131K|HIF3A_ENST00000339613.2_Silent_p.K126K|HIF3A_ENST00000472815.1_Silent_p.K113K	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	182					cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		TCAACCTCAAGGCGGCCACCT	0.677																																					p.K182K		.											.	HIF3A	228	0			c.G546A						.						15.0	13.0	14.0					19																	46812017		2198	4286	6484	SO:0001819	synonymous_variant	64344	exon5			CCTCAAGGCGGCC	AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.546G>A	19.37:g.46812017G>A		43.0	0.0		67.0	22.0	NM_152795	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Silent	SNP	ENST00000377670.4	37	CCDS12681.2	.	.	.	.	.	.	.	.	.	.	G	10.04	1.242571	0.22796	.	.	ENSG00000124440	ENST00000472815	.	.	.	4.8	-1.7	0.08159	.	.	.	.	.	T	0.55016	0.1894	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51671	-0.8676	4	.	.	.	.	9.5928	0.39557	0.4783:0.0:0.5217:0.0	.	.	.	.	S	155	.	.	G	+	1	0	HIF3A	51503857	1.000000	0.71417	0.977000	0.42913	0.939000	0.58152	0.884000	0.28214	-0.123000	0.11745	-0.254000	0.11334	GGC	.		0.677	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280556.3		
ING1	3621	hgsc.bcm.edu;bcgsc.ca	37	13	111371870	111371870	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr13:111371870A>G	ENST00000375774.3	+	2	1322	c.860A>G	c.(859-861)aAg>aGg	p.K287R	ING1_ENST00000375775.3_Missense_Mutation_p.K75R|ING1_ENST00000338450.7_Missense_Mutation_p.K100R|ING1_ENST00000333219.7_Missense_Mutation_p.K144R	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	287					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CAGGCTGACAAGCCCAACAGC	0.687																																					p.K287R		.											.	ING1	515	0			c.A860G						.						28.0	27.0	27.0					13																	111371870		2200	4293	6493	SO:0001583	missense	3621	exon2			CTGACAAGCCCAA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.860A>G	13.37:g.111371870A>G	ENSP00000364929:p.Lys287Arg	43.0	0.0		55.0	4.0	NM_005537	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Missense_Mutation	SNP	ENST00000375774.3	37	CCDS9517.1	.	.	.	.	.	.	.	.	.	.	A	13.80	2.346561	0.41599	.	.	ENSG00000153487	ENST00000338450;ENST00000333219;ENST00000375775;ENST00000375774	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.46	5.46	0.80206	.	0.101744	0.64402	D	0.000002	T	0.58864	0.2152	L	0.57536	1.79	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.99	D;D;D	0.77004	0.989;0.98;0.979	T	0.53989	-0.8360	10	0.20519	T	0.43	-49.3307	15.5207	0.75862	1.0:0.0:0.0:0.0	.	287;144;100	Q9UK53;Q5T9H0;Q9UK53-4	ING1_HUMAN;.;.	R	100;144;75;287	ENSP00000345202:K100R;ENSP00000328436:K144R;ENSP00000364930:K75R;ENSP00000364929:K287R	ENSP00000328436:K144R	K	+	2	0	ING1	110169871	1.000000	0.71417	0.986000	0.45419	0.067000	0.16453	6.467000	0.73547	2.071000	0.62044	0.402000	0.26972	AAG	.		0.687	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
CEMIP	57214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	81234212	81234212	+	Missense_Mutation	SNP	G	G	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr15:81234212G>T	ENST00000394685.3	+	26	3849	c.3430G>T	c.(3430-3432)Gct>Tct	p.A1144S	KIAA1199_ENST00000356249.5_Missense_Mutation_p.A1144S|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000220244.3_Missense_Mutation_p.A1144S			Q8WUJ3	CEMIP_HUMAN		1144					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						GAAGCTGAAAGCTCAGAACGA	0.493																																					p.A1144S		.											.	KIAA1199	93	0			c.G3430T						.						64.0	67.0	66.0					15																	81234212		2203	4300	6503	SO:0001583	missense	57214	exon25			CTGAAAGCTCAGA																												ENST00000394685.3:c.3430G>T	15.37:g.81234212G>T	ENSP00000378177:p.Ala1144Ser	54.0	0.0		78.0	30.0	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	ENST00000394685.3	37	CCDS10315.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.300051	0.81136	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249	T;T;T	0.50548	0.74;0.74;0.74	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.65312	0.2679	M	0.71036	2.16	0.39517	D	0.968442	D	0.67145	0.996	P	0.57620	0.824	T	0.65298	-0.6202	10	0.44086	T	0.13	-23.631	19.9504	0.97197	0.0:0.0:1.0:0.0	.	1144	Q8WUJ3	K1199_HUMAN	S	1144	ENSP00000220244:A1144S;ENSP00000378177:A1144S;ENSP00000348583:A1144S	ENSP00000220244:A1144S	A	+	1	0	KIAA1199	79021267	1.000000	0.71417	0.508000	0.27688	0.959000	0.62525	9.063000	0.93927	2.720000	0.93068	0.591000	0.81541	GCT	.		0.493	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
KIF13B	23303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	28971063	28971063	+	Missense_Mutation	SNP	G	G	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr8:28971063G>C	ENST00000524189.1	-	32	3885	c.3847C>G	c.(3847-3849)Cag>Gag	p.Q1283E	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1283					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		AGGAGACTCTGTGCAAAACCC	0.363																																					p.Q1283E		.											.	KIF13B	22	0			c.C3847G						.						41.0	37.0	38.0					8																	28971063		1812	4070	5882	SO:0001583	missense	23303	exon32			GACTCTGTGCAAA	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.3847C>G	8.37:g.28971063G>C	ENSP00000427900:p.Gln1283Glu	30.0	0.0		60.0	19.0	NM_015254	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	ENST00000524189.1	37	CCDS55217.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.772837	0.49680	.	.	ENSG00000197892	ENST00000524189	T	0.75367	-0.93	5.5	5.5	0.81552	.	0.058286	0.64402	D	0.000001	T	0.66036	0.2749	L	0.33245	0.995	0.80722	D	1	B	0.21309	0.054	B	0.17433	0.018	T	0.59289	-0.7482	10	0.17832	T	0.49	.	19.6014	0.95563	0.0:0.0:1.0:0.0	.	1283	F8VPJ2	.	E	1283	ENSP00000427900:Q1283E	ENSP00000427900:Q1283E	Q	-	1	0	KIF13B	29026982	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.298000	0.78815	2.854000	0.98071	0.655000	0.94253	CAG	.		0.363	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
KLHL32	114792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	97562045	97562045	+	Missense_Mutation	SNP	C	C	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr6:97562045C>A	ENST00000369261.4	+	7	1377	c.1014C>A	c.(1012-1014)caC>caA	p.H338Q	KLHL32_ENST00000536676.1_Missense_Mutation_p.H302Q|KLHL32_ENST00000544166.1_Intron|KLHL32_ENST00000539200.1_Missense_Mutation_p.H269Q	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	338										breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		GAAGGAGCCACCATTGTGTGG	0.562																																					p.H338Q		.											KLHL32,NS,carcinoma,+1	KLHL32	94	0			c.C1014A						.						93.0	89.0	90.0					6																	97562045		2203	4300	6503	SO:0001583	missense	114792	exon7			GAGCCACCATTGT	AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.1014C>A	6.37:g.97562045C>A	ENSP00000358265:p.His338Gln	43.0	0.0		81.0	25.0	NM_052904	B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	ENST00000369261.4	37	CCDS5038.1	.	.	.	.	.	.	.	.	.	.	C	11.76	1.735171	0.30774	.	.	ENSG00000186231	ENST00000369261;ENST00000536676;ENST00000539200	T;T;T	0.66815	-0.23;-0.23;-0.23	5.36	3.19	0.36642	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.49864	0.1582	L	0.31664	0.95	0.80722	D	1	D;D;P;D	0.89917	0.988;0.999;0.647;1.0	P;D;P;D	0.87578	0.875;0.996;0.621;0.998	T	0.55095	-0.8194	10	0.06757	T	0.87	.	8.1486	0.31126	0.0:0.7176:0.0:0.2824	.	269;302;338;338	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	Q	338;302;269	ENSP00000358265:H338Q;ENSP00000440382:H302Q;ENSP00000441527:H269Q	ENSP00000358265:H338Q	H	+	3	2	KLHL32	97668766	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	0.538000	0.23160	0.561000	0.29186	0.655000	0.94253	CAC	.		0.562	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041570.1	NM_052904	
KRTAP13-4	284827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	31802993	31802993	+	Missense_Mutation	SNP	C	C	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr21:31802993C>A	ENST00000334068.2	+	1	422	c.400C>A	c.(400-402)Cca>Aca	p.P134T		NM_181600.1	NP_853631.1	Q3LI77	KR134_HUMAN	keratin associated protein 13-4	134						intermediate filament (GO:0005882)				NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	15						ATTCTGCTACCCAAACTACTT	0.468																																					p.P134T	NSCLC(196;2401 3038 18004 35753)	.											.	KRTAP13-4	90	0			c.C400A						.						99.0	92.0	94.0					21																	31802993		2203	4300	6503	SO:0001583	missense	284827	exon1			TGCTACCCAAACT	AP001708	CCDS13592.1	21q22.1	2006-03-13			ENSG00000186971	ENSG00000186971		"""Keratin associated proteins"""	18926	protein-coding gene	gene with protein product						12359730	Standard	NM_181600		Approved	KAP13.4	uc011acw.2	Q3LI77	OTTHUMG00000057770	ENST00000334068.2:c.400C>A	21.37:g.31802993C>A	ENSP00000334834:p.Pro134Thr	127.0	0.0		193.0	92.0	NM_181600	A2RRL3	Missense_Mutation	SNP	ENST00000334068.2	37	CCDS13592.1	.	.	.	.	.	.	.	.	.	.	-	16.27	3.076530	0.55753	.	.	ENSG00000186971	ENST00000334068	T	0.10763	2.84	4.5	4.5	0.54988	.	0.148962	0.30695	N	0.009076	T	0.37237	0.0996	M	0.89095	3.005	0.09310	N	1	D	0.71674	0.998	D	0.69824	0.966	T	0.26677	-1.0096	10	0.87932	D	0	.	13.4325	0.61064	0.0:1.0:0.0:0.0	.	134	Q3LI77	KR134_HUMAN	T	134	ENSP00000334834:P134T	ENSP00000334834:P134T	P	+	1	0	KRTAP13-4	30724864	0.008000	0.16893	0.028000	0.17463	0.004000	0.04260	1.081000	0.30791	2.412000	0.81896	0.650000	0.86243	CCA	.		0.468	KRTAP13-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128222.1		
LAMA2	3908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	129571345	129571345	+	Missense_Mutation	SNP	T	T	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr6:129571345T>C	ENST00000421865.2	+	13	1920	c.1871T>C	c.(1870-1872)aTg>aCg	p.M624T		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	624	Laminin IV type A 1. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CTCCAGCTTATGATTATCTTA	0.413																																					p.M624T		.											.	LAMA2	162	0			c.T1871C						.						150.0	130.0	136.0					6																	129571345		2203	4300	6503	SO:0001583	missense	3908	exon13			AGCTTATGATTAT	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.1871T>C	6.37:g.129571345T>C	ENSP00000400365:p.Met624Thr	53.0	0.0		97.0	60.0	NM_000426	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	T	0.070	-1.204561	0.01568	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.35236	1.32	5.69	1.63	0.23807	Laminin B type IV (2);Laminin B, subgroup (1);	0.382752	0.29676	N	0.011482	T	0.05914	0.0154	N	0.17474	0.49	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.31194	-0.9952	10	0.30078	T	0.28	.	2.5455	0.04736	0.2488:0.0735:0.1283:0.5494	.	624;624	A6NF00;P24043	.;LAMA2_HUMAN	T	624	ENSP00000400365:M624T	ENSP00000346769:M624T	M	+	2	0	LAMA2	129613038	0.999000	0.42202	0.021000	0.16686	0.085000	0.17905	1.265000	0.33027	0.479000	0.27511	0.533000	0.62120	ATG	.		0.413	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
LRRC19	64922	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	9	26995539	26995539	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr9:26995539C>A	ENST00000380055.5	-	5	1203	c.1093G>T	c.(1093-1095)Gaa>Taa	p.E365*	IFT74_ENST00000443698.1_Intron|LRRC19_ENST00000482770.1_5'UTR|IFT74_ENST00000429045.2_Intron|IFT74_ENST00000433700.1_Intron|IFT74_ENST00000380062.5_Intron	NM_022901.2	NP_075052.1	Q9H756	LRC19_HUMAN	leucine rich repeat containing 19	365						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|lung(2)	6		all_neural(11;1.81e-09)		Lung(218;1.06e-05)|LUSC - Lung squamous cell carcinoma(38;0.0001)		TCACATAATTCATGGATATCT	0.279																																					p.E365X		.											.	LRRC19	514	0			c.G1093T						.						45.0	45.0	45.0					9																	26995539		2197	4293	6490	SO:0001587	stop_gained	64922	exon5			ATAATTCATGGAT	AK024955	CCDS6518.1	9p21.1	2008-02-05			ENSG00000184434	ENSG00000184434			23379	protein-coding gene	gene with protein product							Standard	NM_022901		Approved	FLJ21302	uc003zqh.3	Q9H756	OTTHUMG00000019710	ENST00000380055.5:c.1093G>T	9.37:g.26995539C>A	ENSP00000369395:p.Glu365*	56.0	0.0		92.0	39.0	NM_022901	A0AV00|B9EG91	Nonsense_Mutation	SNP	ENST00000380055.5	37	CCDS6518.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.052030	0.36181	.	.	ENSG00000184434	ENST00000380055	.	.	.	5.55	5.55	0.83447	.	0.137436	0.45606	D	0.000360	.	.	.	.	.	.	0.38383	D	0.945174	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-15.0338	13.7555	0.62935	0.0:0.9266:0.0:0.0734	.	.	.	.	X	365	.	ENSP00000369395:E365X	E	-	1	0	LRRC19	26985539	0.989000	0.36119	0.318000	0.25279	0.202000	0.24057	2.361000	0.44160	2.616000	0.88540	0.585000	0.79938	GAA	.		0.279	LRRC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051961.2	NM_022901	
LRRN2	10446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	204588961	204588961	+	Missense_Mutation	SNP	C	C	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr1:204588961C>A	ENST00000367175.1	-	1	2372	c.160G>T	c.(160-162)Gac>Tac	p.D54Y	LRRN2_ENST00000367176.3_Missense_Mutation_p.D54Y|LRRN2_ENST00000367177.3_Missense_Mutation_p.D54Y|LRRN2_ENST00000496057.1_5'Flank			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	54	LRRNT.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			TCATTGCAGTCCACAGTGGTA	0.652																																					p.D54Y		.											.	LRRN2	514	0			c.G160T						.						50.0	47.0	48.0					1																	204588961		2203	4300	6503	SO:0001583	missense	10446	exon3			TGCAGTCCACAGT	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.160G>T	1.37:g.204588961C>A	ENSP00000356143:p.Asp54Tyr	80.0	0.0		83.0	36.0	NM_006338	B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	ENST00000367175.1	37	CCDS1448.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.989520	0.74589	.	.	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.25414	1.8;1.8;1.8	5.53	5.53	0.82687	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.45126	D	0.000381	T	0.56426	0.1984	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60757	-0.7200	10	0.87932	D	0	.	19.1097	0.93312	0.0:1.0:0.0:0.0	.	54	O75325	LRRN2_HUMAN	Y	54	ENSP00000356144:D54Y;ENSP00000356145:D54Y;ENSP00000356143:D54Y	ENSP00000356143:D54Y	D	-	1	0	LRRN2	202855584	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.816000	0.86201	2.597000	0.87782	0.650000	0.86243	GAC	.		0.652	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089894.1	NM_006338	
MAD2L1	4085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	120982128	120982128	+	Missense_Mutation	SNP	G	G	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr4:120982128G>T	ENST00000296509.6	-	4	685	c.346C>A	c.(346-348)Ccc>Acc	p.P116T		NM_002358.3	NP_002349.1	Q13257	MD2L1_HUMAN	MAD2 mitotic arrest deficient-like 1 (yeast)	116	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(2)|kidney(2)|large_intestine(2)|lung(3)	9						TTTTCTCTGGGTGCACTGTCA	0.353																																					p.P116T		.											.	MAD2L1	227	0			c.C346A						.						50.0	50.0	50.0					4																	120982128		2203	4298	6501	SO:0001583	missense	4085	exon4			CTCTGGGTGCACT	U65410	CCDS3715.1	4q27	2013-01-17	2001-11-28		ENSG00000164109	ENSG00000164109			6763	protein-coding gene	gene with protein product		601467	"""MAD2 (mitotic arrest deficient, yeast, homolog)-like 1"""			8824189, 9345911	Standard	NM_002358		Approved	MAD2, HSMAD2	uc003idl.2	Q13257	OTTHUMG00000132967	ENST00000296509.6:c.346C>A	4.37:g.120982128G>T	ENSP00000296509:p.Pro116Thr	113.0	0.0		156.0	62.0	NM_002358	Q53F56|Q548X9|Q6IRW7|Q8IZX3	Missense_Mutation	SNP	ENST00000296509.6	37	CCDS3715.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.470958	0.43942	.	.	ENSG00000164109	ENST00000296509	.	.	.	5.16	4.31	0.51392	DNA-binding HORMA (4);	0.173317	0.52532	D	0.000073	T	0.45994	0.1370	L	0.38953	1.18	0.53688	D	0.99997	B	0.32939	0.391	B	0.33295	0.161	T	0.31280	-0.9949	9	0.13108	T	0.6	-3.5224	14.5615	0.68140	0.0:0.2774:0.7226:0.0	.	116	Q13257	MD2L1_HUMAN	T	116	.	ENSP00000296509:P116T	P	-	1	0	MAD2L1	121201576	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.892000	0.63193	1.283000	0.44513	0.561000	0.74099	CCC	.		0.353	MAD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256525.2		
MAST1	22983	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12978549	12978549	+	Missense_Mutation	SNP	G	G	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr19:12978549G>C	ENST00000251472.4	+	20	2363	c.2324G>C	c.(2323-2325)cGa>cCa	p.R775P		NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						TGCAGCAAGCGATTCTCCGCG	0.682																																					p.R775P		.											.	MAST1	523	0			c.G2324C						.						7.0	7.0	7.0					19																	12978549		2139	4185	6324	SO:0001583	missense	22983	exon20			GCAAGCGATTCTC	AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.2324G>C	19.37:g.12978549G>C	ENSP00000251472:p.Arg775Pro	41.0	0.0		55.0	13.0	NM_014975		Missense_Mutation	SNP	ENST00000251472.4	37	CCDS32921.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.423921	0.83667	.	.	ENSG00000105613	ENST00000251472	T	0.68765	-0.35	4.44	4.44	0.53790	.	0.071807	0.56097	D	0.000031	T	0.74627	0.3741	L	0.46819	1.47	0.58432	D	0.999997	D	0.67145	0.996	D	0.64144	0.922	T	0.77536	-0.2551	10	0.66056	D	0.02	-22.8863	15.0031	0.71489	0.0:0.0:1.0:0.0	.	775	Q9Y2H9	MAST1_HUMAN	P	775	ENSP00000251472:R775P	ENSP00000251472:R775P	R	+	2	0	MAST1	12839549	1.000000	0.71417	0.996000	0.52242	0.519000	0.34347	6.595000	0.74109	2.229000	0.72834	0.543000	0.68304	CGA	.		0.682	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451733.2	NM_014975	
MEX3C	51320	hgsc.bcm.edu;mdanderson.org	37	18	48723394	48723394	+	Intron	SNP	C	C	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr18:48723394C>A	ENST00000591040.1	-	2	43				MEX3C_ENST00000592416.1_5'Flank			Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		cctccggggccccgggccggc	0.786																																					p.G99G		.											.	MEX3C	659	0			c.G297T						.						9.0	9.0	9.0					18																	48723394		1281	2866	4147	SO:0001627	intron_variant	51320	exon1			CGGGGCCCCGGGC	BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693	ENST00000591040.1:c.757-19448G>T	18.37:g.48723394C>A		12.0	0.0		14.0	7.0	NM_016626	A1L022|Q9NZE3	Silent	SNP	ENST00000591040.1	37																																																																																				.		0.786	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	protein_coding	OTTHUMT00000449559.1	NM_016626	
MON1B	22879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	77228317	77228317	+	Silent	SNP	G	G	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr16:77228317G>T	ENST00000248248.3	+	4	911	c.561G>T	c.(559-561)cgG>cgT	p.R187R	MON1B_ENST00000545553.1_Silent_p.R41R|MON1B_ENST00000439557.2_Silent_p.R78R|MON1B_ENST00000320859.6_Intron	NM_014940.2	NP_055755.1	Q7L1V2	MON1B_HUMAN	MON1 secretory trafficking family member B	187										breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	17						CCCAGCTGCGGGGGGAGCTGC	0.602																																					p.R187R		.											.	MON1B	90	0			c.G561T						.						95.0	93.0	93.0					16																	77228317		2198	4300	6498	SO:0001819	synonymous_variant	22879	exon4			GCTGCGGGGGGAG	BC024277	CCDS10925.1, CCDS67082.1, CCDS67083.1	16q23.1	2013-08-21	2013-08-21		ENSG00000103111	ENSG00000103111			25020	protein-coding gene	gene with protein product		608954	"""MON1 homolog B (yeast)"""			10048485	Standard	NM_014940		Approved	SAND2, HSRG1, KIAA0872	uc002fez.3	Q7L1V2	OTTHUMG00000137618	ENST00000248248.3:c.561G>T	16.37:g.77228317G>T		46.0	0.0		90.0	37.0	NM_014940	B4DDZ0|O94949	Silent	SNP	ENST00000248248.3	37	CCDS10925.1																																																																																			.		0.602	MON1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269036.2	NM_014940	
MUSK	4593	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	113550088	113550088	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr9:113550088delT	ENST00000374448.4	+	14	2031	c.1897delT	c.(1897-1899)tttfs	p.F633fs	MUSK_ENST00000416899.2_Frame_Shift_Del_p.F625fs|MUSK_ENST00000374438.1_Frame_Shift_Del_p.F149fs|MUSK_ENST00000189978.5_Frame_Shift_Del_p.F633fs	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	633	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						CATGGCAGAATTTGACAACCC	0.428																																					p.F633fs		.											.	MUSK	1379	0			c.1897delT						.						48.0	46.0	46.0					9																	113550088		1877	4105	5982	SO:0001589	frameshift_variant	4593	exon13			GCAGAATTTGACA	AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.1897delT	9.37:g.113550088delT	ENSP00000363571:p.Phe633fs	91.0	0.0		124.0	52.0	NM_005592	Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Frame_Shift_Del	DEL	ENST00000374448.4	37	CCDS48005.1																																																																																			.		0.428	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
NCKAP1	10787	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	183847561	183847561	+	Missense_Mutation	SNP	T	T	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr2:183847561T>C	ENST00000361354.4	-	12	1568	c.1196A>G	c.(1195-1197)gAc>gGc	p.D399G	NCKAP1_ENST00000360982.2_Missense_Mutation_p.D405G	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	399					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			ATCTATAAAGTCGTCTGCACT	0.343																																					p.D405G		.											.	NCKAP1	92	0			c.A1214G						.						39.0	38.0	38.0					2																	183847561		2202	4300	6502	SO:0001583	missense	10787	exon13			ATAAAGTCGTCTG	AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.1196A>G	2.37:g.183847561T>C	ENSP00000355348:p.Asp399Gly	109.0	0.0		208.0	93.0	NM_205842	O60329|Q53QN5|Q53S94|Q53Y35	Missense_Mutation	SNP	ENST00000361354.4	37	CCDS2287.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.647551	0.87958	.	.	ENSG00000061676	ENST00000361354;ENST00000360982	T;T	0.44482	0.92;0.92	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.65729	0.2719	M	0.84683	2.71	0.80722	D	1	D;D	0.63880	0.993;0.991	P;P	0.61275	0.886;0.818	T	0.72666	-0.4224	10	0.72032	D	0.01	-11.9836	15.2429	0.73485	0.0:0.0:0.0:1.0	.	399;405	Q9Y2A7;Q9Y2A7-2	NCKP1_HUMAN;.	G	399;405	ENSP00000355348:D399G;ENSP00000354251:D405G	ENSP00000354251:D405G	D	-	2	0	NCKAP1	183555806	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.019000	0.88732	2.011000	0.59026	0.533000	0.62120	GAC	.		0.343	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255867.2	NM_205842	
NCKAP5L	57701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	50190101	50190101	+	Missense_Mutation	SNP	C	C	G			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr12:50190101C>G	ENST00000335999.6	-	8	1743	c.1542G>C	c.(1540-1542)gaG>gaC	p.E514D		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	510	Pro-rich.									central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18						CTTGCGCCCCCTCTGGGGACA	0.672																																					p.E514D		.											.	NCKAP5L	68	0			c.G1542C						.						13.0	15.0	14.0					12																	50190101		2078	4193	6271	SO:0001583	missense	57701	exon8			CGCCCCCTCTGGG	AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566			29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602			Standard	NM_001037806		Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.1542G>C	12.37:g.50190101C>G	ENSP00000337998:p.Glu514Asp	85.0	0.0		126.0	52.0	NM_001037806	Q2TB26|Q71RH1|Q8N4W1|Q96HX2	Missense_Mutation	SNP	ENST00000335999.6	37	CCDS41781.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.590|3.590	-0.083794|-0.083794	0.07141|0.07141	.|.	.|.	ENSG00000167566|ENSG00000167566	ENST00000335999;ENST00000354423|ENST00000433948	T|.	0.47869|.	0.83|.	4.73|4.73	0.729|0.729	0.18266|0.18266	.|.	0.298342|.	0.24321|.	N|.	0.039550|.	T|T	0.22975|0.22975	0.0555|0.0555	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	0.999999|0.999999	B;B|.	0.06786|.	0.001;0.001|.	B;B|.	0.06405|.	0.002;0.001|.	T|T	0.27640|0.27640	-1.0068|-1.0068	10|5	0.13470|.	T|.	0.59|.	-15.7334|-15.7334	8.1321|8.1321	0.31033|0.31033	0.0:0.3345:0.5062:0.1593|0.0:0.3345:0.5062:0.1593	.|.	510;510|.	E2QRB5;Q9HCH0-2|.	.;.|.	D|R	514;510|229	ENSP00000337998:E514D|.	ENSP00000337998:E514D|.	E|G	-|-	3|1	2|0	NCKAP5L|NCKAP5L	48476368|48476368	0.993000|0.993000	0.37304|0.37304	0.725000|0.725000	0.30721|0.30721	0.680000|0.680000	0.39746|0.39746	-0.022000|-0.022000	0.12480|0.12480	-0.058000|-0.058000	0.13177|0.13177	0.561000|0.561000	0.74099|0.74099	GAG|GGG	.		0.672	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346884.2	XM_035497	
NCOR2	9612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	124915190	124915190	+	Missense_Mutation	SNP	C	C	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr12:124915190C>A	ENST00000405201.1	-	9	1026	c.1026G>T	c.(1024-1026)aaG>aaT	p.K342N	NCOR2_ENST00000404621.1_Missense_Mutation_p.K342N|NCOR2_ENST00000429285.2_Missense_Mutation_p.K342N|NCOR2_ENST00000356219.3_Missense_Mutation_p.K342N|NCOR2_ENST00000397355.1_Missense_Mutation_p.K342N|NCOR2_ENST00000404121.2_5'UTR			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	342					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GCTCGCGCTGCTTGCGGATCT	0.662																																					p.K342N		.											.	NCOR2	229	0			c.G1026T						.						76.0	83.0	81.0					12																	124915190		2054	4198	6252	SO:0001583	missense	9612	exon11			GCGCTGCTTGCGG	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1026G>T	12.37:g.124915190C>A	ENSP00000384018:p.Lys342Asn	63.0	0.0		85.0	43.0	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	ENST00000405201.1	37	CCDS41858.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.75|11.75	1.730714|1.730714	0.30684|0.30684	.|.	.|.	ENSG00000196498|ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000429285;ENST00000458234;ENST00000420698;ENST00000448008|ENST00000542927	T;T;T;T;T;T;T;T|.	0.49432|.	0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78|.	3.75|3.75	3.75|3.75	0.43078|0.43078	.|.	0.203636|.	0.40908|.	N|.	0.001000|.	T|T	0.70868|0.70868	0.3273|0.3273	M|M	0.73598|0.73598	2.24|2.24	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.998;0.998;0.999|.	D;D;D|.	0.83275|.	0.991;0.991;0.996|.	T|T	0.71497|0.71497	-0.4575|-0.4575	10|5	0.87932|.	D|.	0|.	-39.1233|-39.1233	10.8781|10.8781	0.46923|0.46923	0.0:0.9068:0.0:0.0932|0.0:0.9068:0.0:0.0932	.|.	342;342;342|.	C9J0Q5;C9J239;C9JFD3|.	.;.;.|.	N|I	342;342;342;342;342;342;342;342;244|265	ENSP00000384018:K342N;ENSP00000384202:K342N;ENSP00000348551:K342N;ENSP00000380513:K342N;ENSP00000400281:K342N;ENSP00000402808:K342N;ENSP00000405367:K342N;ENSP00000403034:K244N|.	ENSP00000348551:K342N|.	K|S	-|-	3|2	2|0	NCOR2|NCOR2	123481143|123481143	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.935000|0.935000	0.57460|0.57460	1.168000|1.168000	0.31859|0.31859	2.104000|2.104000	0.64026|0.64026	0.462000|0.462000	0.41574|0.41574	AAG|AGC	.		0.662	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
NOS2	4843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	26110007	26110007	+	Missense_Mutation	SNP	G	G	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr17:26110007G>A	ENST00000313735.6	-	6	826	c.593C>T	c.(592-594)cCa>cTa	p.P198L		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	198					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	AATGCAGCGTGGGGCATTGCG	0.577																																					p.P198L		.											.	NOS2	156	0			c.C593T						.						204.0	147.0	166.0					17																	26110007		2203	4300	6503	SO:0001583	missense	4843	exon6			CAGCGTGGGGCAT	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.593C>T	17.37:g.26110007G>A	ENSP00000327251:p.Pro198Leu	233.0	0.0		318.0	116.0	NM_000625	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	37	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307413	0.81247	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.24908	1.83	5.62	5.62	0.85841	Nitric oxide synthase, oxygenase domain (3);	0.000000	0.85682	D	0.000000	T	0.61135	0.2323	M	0.90814	3.15	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.97110	0.933;1.0	T	0.68830	-0.5305	10	0.87932	D	0	.	18.6591	0.91465	0.0:0.0:1.0:0.0	.	198;198	F8WEM3;P35228	.;NOS2_HUMAN	L	198	ENSP00000327251:P198L	ENSP00000305638:P198L	P	-	2	0	NOS2	23134134	1.000000	0.71417	0.998000	0.56505	0.373000	0.29922	9.781000	0.99029	2.664000	0.90586	0.603000	0.83216	CCA	.		0.577	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625	
NPEPPS	9520	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	45608887	45608887	+	Missense_Mutation	SNP	T	T	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr17:45608887T>A	ENST00000322157.4	+	1	458	c.221T>A	c.(220-222)tTc>tAc	p.F74Y	NPEPPS_ENST00000525037.1_Intron|NPEPPS_ENST00000544660.1_Missense_Mutation_p.F30Y|NPEPPS_ENST00000530173.1_Missense_Mutation_p.F70Y	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	74					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						TTGCTGGACTTCACCTTCGAG	0.706																																					p.F74Y		.											.	NPEPPS	90	0			c.T221A						.						11.0	12.0	12.0					17																	45608887		1852	4077	5929	SO:0001583	missense	9520	exon1			TGGACTTCACCTT	Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.221T>A	17.37:g.45608887T>A	ENSP00000320324:p.Phe74Tyr	188.0	0.0		242.0	71.0	NM_006310	B7Z463|Q6P145|Q9NP16|Q9UEM2	Missense_Mutation	SNP	ENST00000322157.4	37	CCDS45721.1	.	.	.	.	.	.	.	.	.	.	T	13.63	2.294738	0.40594	.	.	ENSG00000141279	ENST00000525007;ENST00000530173;ENST00000322157;ENST00000539572;ENST00000544660	T;T;T;T	0.04317	4.22;4.22;4.22;3.65	2.69	2.69	0.31865	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	U	0.000000	T	0.12646	0.0307	M	0.64567	1.98	0.58432	D	0.999997	B;B;P	0.49253	0.176;0.062;0.921	B;B;P	0.61658	0.202;0.089;0.892	T	0.14309	-1.0477	10	0.20046	T	0.44	.	9.7133	0.40258	0.0:0.0:0.0:1.0	.	74;70;74	A6NEC2;E9PLK3;P55786	PSAL_HUMAN;.;PSA_HUMAN	Y	61;70;74;61;30	ENSP00000437019:F61Y;ENSP00000433287:F70Y;ENSP00000320324:F74Y;ENSP00000442461:F30Y	ENSP00000320324:F74Y	F	+	2	0	NPEPPS	42963886	1.000000	0.71417	1.000000	0.80357	0.414000	0.31173	5.950000	0.70265	1.092000	0.41356	0.392000	0.25879	TTC	.		0.706	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384269.1	NM_006310	
ORM1	5004	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	117086007	117086007	+	Missense_Mutation	SNP	A	A	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr9:117086007A>T	ENST00000259396.8	+	2	257	c.179A>T	c.(178-180)cAg>cTg	p.Q60L	ORM1_ENST00000538816.1_3'UTR	NM_000607.2	NP_000598.2	P02763	A1AG1_HUMAN	orosomucoid 1	60					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|regulation of immune system process (GO:0002682)|transport (GO:0006810)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(2)|large_intestine(4)|lung(2)	8		Myeloproliferative disorder(63;0.163)			Abiraterone(DB05812)|Acenocoumarol(DB01418)|Ajmaline(DB01426)|Alfentanil(DB00802)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aprindine(DB01429)|Bupropion(DB01156)|Canagliflozin(DB08907)|Celecoxib(DB00482)|Chlorpromazine(DB00477)|Desipramine(DB01151)|Disopyramide(DB00280)|Doxazosin(DB00590)|Doxepin(DB01142)|Erlotinib(DB00530)|Fluoxetine(DB00472)|Gefitinib(DB00317)|Imatinib(DB00619)|Imipramine(DB00458)|Ivacaftor(DB08820)|Maprotiline(DB00934)|Mirabegron(DB08893)|Nateglinide(DB00731)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxycodone(DB00497)|Penbutolol(DB01359)|Pethidine(DB00454)|Phenprocoumon(DB00946)|Pitavastatin(DB08860)|Prazosin(DB00457)|Propranolol(DB00571)|Quinidine(DB00908)|Saquinavir(DB01232)|Tacrolimus(DB00864)|Tamsulosin(DB00706)|Telaprevir(DB05521)|Thalidomide(DB01041)|Trazodone(DB00656)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Vismodegib(DB08828)|Warfarin(DB00682)	AAGTCGGTTCAGGAGATCCAA	0.517																																					p.Q60L		.											.	ORM1	90	0			c.A179T						.						129.0	124.0	126.0					9																	117086007		2203	4300	6503	SO:0001583	missense	5004	exon2			CGGTTCAGGAGAT		CCDS6803.1	9q32	2013-09-19			ENSG00000229314	ENSG00000229314		"""Lipocalins"""	8498	protein-coding gene	gene with protein product		138600					Standard	NM_000607		Approved		uc004bik.4	P02763	OTTHUMG00000021012	ENST00000259396.8:c.179A>T	9.37:g.117086007A>T	ENSP00000259396:p.Gln60Leu	222.0	0.0		353.0	155.0	NM_000607	B7ZKQ5|Q5T539|Q5U067|Q8TC16	Missense_Mutation	SNP	ENST00000259396.8	37	CCDS6803.1	.	.	.	.	.	.	.	.	.	.	A	11.60	1.686756	0.29962	.	.	ENSG00000229314	ENST00000259396	T	0.08193	3.12	4.77	-2.6	0.06190	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.458180	0.03745	N	0.255645	T	0.11495	0.0280	L	0.58101	1.795	0.09310	N	1	B	0.16166	0.016	B	0.13407	0.009	T	0.46176	-0.9210	10	0.66056	D	0.02	-0.5495	10.5234	0.44934	0.7599:0.0:0.2401:0.0	.	60	P02763	A1AG1_HUMAN	L	60	ENSP00000259396:Q60L	ENSP00000259396:Q60L	Q	+	2	0	ORM1	116125828	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.143000	0.10296	-0.439000	0.07222	0.383000	0.25322	CAG	.		0.517	ORM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055426.1		
PCDHGA11	56105	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140803121	140803121	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr5:140803121A>G	ENST00000398587.2	+	1	2360	c.2327A>G	c.(2326-2328)tAt>tGt	p.Y776C	PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB8P_ENST00000502926.1_RNA|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA10_ENST00000398610.2_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	776					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCCCAACTATGGGGACACG	0.532																																					p.Y776C		.											.	.	.	0			c.A2327G						.						68.0	75.0	72.0					5																	140803121		2203	4300	6503	SO:0001583	missense	56105	exon1			CCAACTATGGGGA	AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.2327A>G	5.37:g.140803121A>G	ENSP00000381589:p.Tyr776Cys	129.0	1.0		153.0	54.0	NM_032091	B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	ENST00000398587.2	37	CCDS47294.1	.	.	.	.	.	.	.	.	.	.	a	13.09	2.133710	0.37630	.	.	ENSG00000253873	ENST00000398587	T	0.46819	0.86	5.2	5.2	0.72013	.	.	.	.	.	T	0.62732	0.2452	M	0.78223	2.4	0.80722	D	1	P;P	0.41420	0.516;0.749	B;P	0.56563	0.289;0.801	T	0.63116	-0.6709	9	0.39692	T	0.17	.	9.2448	0.37518	0.9155:0.0:0.0845:0.0	.	776;776	Q9Y5H2;Q9Y5H2-2	PCDGB_HUMAN;.	C	776	ENSP00000381589:Y776C	ENSP00000381589:Y776C	Y	+	2	0	PCDHGA11	140783305	0.781000	0.28676	0.989000	0.46669	0.906000	0.53458	1.332000	0.33805	2.096000	0.63516	0.533000	0.62120	TAT	.		0.532	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914	
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	82784756	82784756	+	Missense_Mutation	SNP	G	G	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr7:82784756G>T	ENST00000333891.9	-	2	1538	c.1201C>A	c.(1201-1203)Cca>Aca	p.P401T	PCLO_ENST00000423517.2_Missense_Mutation_p.P401T	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGTTGAGCTGGAGTCTTTCCA	0.587																																					p.P401T		.											.	PCLO	29	0			c.C1201A						.						89.0	91.0	90.0					7																	82784756		2004	4181	6185	SO:0001583	missense	27445	exon2			GAGCTGGAGTCTT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.1201C>A	7.37:g.82784756G>T	ENSP00000334319:p.Pro401Thr	145.0	0.0		209.0	73.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	2.847	-0.239193	0.05944	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.14766	2.5;2.48	4.47	2.65	0.31530	.	.	.	.	.	T	0.10465	0.0256	L	0.47016	1.485	0.09310	N	0.999991	B;B	0.32829	0.386;0.386	B;B	0.22601	0.04;0.04	T	0.27191	-1.0081	9	0.87932	D	0	.	4.7342	0.12979	0.2752:0.1608:0.564:0.0	.	401;401	Q9Y6V0-5;Q9Y6V0-6	.;.	T	401	ENSP00000334319:P401T;ENSP00000388393:P401T	ENSP00000334319:P401T	P	-	1	0	PCLO	82622692	0.000000	0.05858	0.004000	0.12327	0.312000	0.27988	0.260000	0.18424	0.604000	0.29930	0.655000	0.94253	CCA	.		0.587	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PLK1	5347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	23700573	23700573	+	Missense_Mutation	SNP	G	G	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr16:23700573G>C	ENST00000300093.4	+	8	1396	c.1285G>C	c.(1285-1287)Gat>Cat	p.D429H	CTD-2196E14.5_ENST00000566143.1_RNA	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1	429	POLO box 1. {ECO:0000255|PROSITE- ProRule:PRU00154}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		TCAGCTCTGTGATAACAGCGT	0.552																																					p.D429H	Colon(12;240 564 27038 33155)	.											.	PLK1	766	0			c.G1285C						.						102.0	93.0	96.0					16																	23700573		2197	4300	6497	SO:0001583	missense	5347	exon8			CTCTGTGATAACA		CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984	ENST00000300093.4:c.1285G>C	16.37:g.23700573G>C	ENSP00000300093:p.Asp429His	135.0	0.0		226.0	29.0	NM_005030	Q15153|Q99746	Missense_Mutation	SNP	ENST00000300093.4	37	CCDS10616.1	.	.	.	.	.	.	.	.	.	.	G	18.07	3.542350	0.65198	.	.	ENSG00000166851	ENST00000300093;ENST00000425844	T	0.15718	2.4	5.3	5.3	0.74995	POLO box duplicated domain (2);	0.000000	0.85682	D	0.000000	T	0.55689	0.1936	H	0.95402	3.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70051	-0.4978	10	0.87932	D	0	-32.0468	16.4424	0.83906	0.0:0.0:1.0:0.0	.	429	P53350	PLK1_HUMAN	H	429;332	ENSP00000300093:D429H	ENSP00000300093:D429H	D	+	1	0	PLK1	23608074	1.000000	0.71417	1.000000	0.80357	0.366000	0.29705	9.415000	0.97375	2.489000	0.83994	0.650000	0.86243	GAT	.		0.552	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214057.2	NM_005030	
PRKCH	5583	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	61909960	61909960	+	Missense_Mutation	SNP	C	C	G			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr14:61909960C>G	ENST00000332981.5	+	3	944	c.559C>G	c.(559-561)Cac>Gac	p.H187D	PRKCH_ENST00000555082.1_Missense_Mutation_p.H26D	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	187					blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		CTACTGCTCTCACTGCAGGGA	0.502																																					p.H187D	Melanoma(135;863 1779 8064 14443 26348)	.											.	PRKCH	1063	0			c.C559G						.						124.0	100.0	108.0					14																	61909960		2203	4300	6503	SO:0001583	missense	5583	exon3			TGCTCTCACTGCA	M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.559C>G	14.37:g.61909960C>G	ENSP00000329127:p.His187Asp	85.0	0.0		133.0	71.0	NM_006255	B4DJN5|Q16246|Q8NE03	Missense_Mutation	SNP	ENST00000332981.5	37	CCDS9752.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.705663	0.89018	.	.	ENSG00000027075	ENST00000556778;ENST00000555906;ENST00000332981;ENST00000555082;ENST00000553830;ENST00000553831;ENST00000553265;ENST00000556164;ENST00000557585;ENST00000557473	D;D;D;D;D;D;D;D;D;D	0.93488	-3.23;-3.23;-3.23;-3.23;-3.23;-3.23;-3.23;-3.23;-3.23;-3.23	5.66	5.66	0.87406	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);Diacylglycerol/phorbol-ester binding (1);	0.000000	0.64402	D	0.000002	D	0.98083	0.9368	H	0.97465	4.01	0.80722	D	1	D	0.54397	0.966	D	0.68943	0.961	D	0.98455	1.0593	10	0.54805	T	0.06	.	19.7525	0.96273	0.0:1.0:0.0:0.0	.	187	P24723	KPCL_HUMAN	D	26;26;187;26;129;26;26;26;26;26	ENSP00000452055:H26D;ENSP00000451205:H26D;ENSP00000329127:H187D;ENSP00000450981:H26D;ENSP00000452588:H129D;ENSP00000450959:H26D;ENSP00000451933:H26D;ENSP00000452330:H26D;ENSP00000451930:H26D;ENSP00000452528:H26D	ENSP00000329127:H187D	H	+	1	0	PRKCH	60979713	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.770000	0.85390	2.666000	0.90696	0.563000	0.77884	CAC	.		0.502	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276974.2	NM_006255	
PTEN	5728	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	89720811	89720812	+	Frame_Shift_Ins	INS	-	-	A	rs587783058|rs121913291		TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr10:89720811_89720812insA	ENST00000371953.3	+	8	2319_2320	c.962_963insA	c.(961-966)acaaaafs	p.TK321fs	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	321	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.T321fs*23(9)|p.T321fs*3(7)|p.R55fs*1(5)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.N323fs*2(2)|p.T319_K332del(1)|p.T321fs*22(1)|p.G165_*404del(1)|p.L316fs*1(1)|p.W274_F341del(1)|p.V317_K322del(1)|p.T321fs*6(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CTTACTTTAACAAAAAATGATC	0.327	N323fs*2(MFE319_ENDOMETRIUM)|N323fs*2(RL952_ENDOMETRIUM)|N323fs*2(SKUT1_SOFT_TISSUE)	31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.T321fs		.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	.	PTEN	17735	73	Whole gene deletion(37)|Deletion - Frameshift(20)|Insertion - Frameshift(10)|Deletion - In frame(4)|Unknown(2)	endometrium(18)|prostate(16)|central_nervous_system(12)|skin(7)|lung(4)|ovary(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|urinary_tract(2)|large_intestine(1)|stomach(1)|soft_tissue(1)|pancreas(1)	c.962_963insA						.																																			SO:0001589	frameshift_variant	5728	exon8	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	CTTTAACAAAAAA	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.968dupA	10.37:g.89720817_89720817dupA	ENSP00000361021:p.Thr321fs	171.0	0.0		170.0	110.0	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Ins	INS	ENST00000371953.3	37	CCDS31238.1																																																																																			.		0.327	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
PTK2	5747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	141684416	141684416	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr8:141684416C>T	ENST00000522684.1	-	29	2919	c.2690G>A	c.(2689-2691)aGc>aAc	p.S897N	PTK2_ENST00000430260.2_Missense_Mutation_p.S207N|PTK2_ENST00000517887.1_Missense_Mutation_p.S941N|PTK2_ENST00000395218.2_Missense_Mutation_p.S907N|PTK2_ENST00000519419.1_Missense_Mutation_p.S941N|PTK2_ENST00000519465.1_Missense_Mutation_p.S525N|PTK2_ENST00000535192.1_Missense_Mutation_p.S851N|PTK2_ENST00000538769.1_Missense_Mutation_p.S565N|PTK2_ENST00000521059.1_Missense_Mutation_p.S897N|PTK2_ENST00000340930.3_Missense_Mutation_p.S907N	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	897	Interaction with TGFB1I1.|Pro-rich.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			CTCGTTGTAGCTGTCAGCAGG	0.572																																					p.S919N		.											.	PTK2	1517	0			c.G2756A						.						48.0	40.0	43.0					8																	141684416		2203	4300	6503	SO:0001583	missense	5747	exon29			TTGTAGCTGTCAG	L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.2690G>A	8.37:g.141684416C>T	ENSP00000429911:p.Ser897Asn	75.0	0.0		76.0	29.0	NM_005607	B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	ENST00000522684.1	37	CCDS6381.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.199674	0.79015	.	.	ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000519465;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000354438;ENST00000395221;ENST00000523539;ENST00000340930;ENST00000538769;ENST00000519419;ENST00000430260;ENST00000521986	T;T;T;T;T;T;T;T;T;T;T;T	0.77877	-0.98;-1.0;-0.98;-0.99;-0.98;-1.13;-0.97;-1.06;-0.97;-0.99;1.42;-0.99	5.96	5.09	0.68999	.	0.075131	0.85682	D	0.000000	T	0.72882	0.3516	L	0.27053	0.805	0.47584	D	0.99946	B;P;B;B;B;B;P;P;B;P	0.38788	0.425;0.647;0.258;0.376;0.258;0.376;0.647;0.609;0.159;0.469	B;P;B;B;B;B;P;B;B;B	0.44623	0.233;0.455;0.138;0.177;0.103;0.104;0.455;0.258;0.103;0.149	T	0.73113	-0.4085	10	0.40728	T	0.16	.	15.465	0.75394	0.0:0.9336:0.0:0.0664	.	907;592;817;897;919;851;849;724;565;525	B4E2N6;B4DH13;Q59GN8;Q05397;Q658W2;Q8IYN9;Q59GM6;Q05397-2;Q8N9D7;E9PEI4	.;.;.;FAK1_HUMAN;.;.;.;.;.;.	N	897;851;525;941;897;849;907;818;592;569;907;565;941;207;595	ENSP00000429911:S897N;ENSP00000438009:S851N;ENSP00000429170:S525N;ENSP00000429082:S941N;ENSP00000429474:S897N;ENSP00000378644:S907N;ENSP00000428492:S569N;ENSP00000341189:S907N;ENSP00000445742:S565N;ENSP00000429129:S941N;ENSP00000403416:S207N;ENSP00000430603:S595N	ENSP00000341189:S907N	S	-	2	0	PTK2	141753598	1.000000	0.71417	0.988000	0.46212	0.986000	0.74619	5.852000	0.69488	1.536000	0.49237	0.650000	0.86243	AGC	.		0.572	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	
PTPN23	25930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47453376	47453376	+	Missense_Mutation	SNP	A	A	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr3:47453376A>T	ENST00000265562.4	+	21	4069	c.3992A>T	c.(3991-3993)gAg>gTg	p.E1331V	PTPN23_ENST00000431726.1_Missense_Mutation_p.E1205V	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	1331	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACCCATGTGGAGCGCGTGCTG	0.627																																					p.E1331V		.											.	PTPN23	227	0			c.A3992T						.						67.0	60.0	63.0					3																	47453376		2203	4300	6503	SO:0001583	missense	25930	exon21			ATGTGGAGCGCGT	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.3992A>T	3.37:g.47453376A>T	ENSP00000265562:p.Glu1331Val	169.0	0.0		226.0	93.0	NM_015466	A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	ENST00000265562.4	37	CCDS2754.1	.	.	.	.	.	.	.	.	.	.	A	17.18	3.323313	0.60634	.	.	ENSG00000076201	ENST00000265562	T	0.81163	-1.46	4.34	4.34	0.51931	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.064498	0.64402	D	0.000014	T	0.80665	0.4666	N	0.12920	0.275	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.83812	0.0242	10	0.87932	D	0	-23.649	12.6697	0.56860	1.0:0.0:0.0:0.0	.	1331	Q9H3S7	PTN23_HUMAN	V	1331	ENSP00000265562:E1331V	ENSP00000265562:E1331V	E	+	2	0	PTPN23	47428380	1.000000	0.71417	0.951000	0.38953	0.205000	0.24178	8.580000	0.90784	1.824000	0.53156	0.460000	0.39030	GAG	.		0.627	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257492.2	NM_015466	
RAC2	5880	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	37627330	37627330	+	Missense_Mutation	SNP	T	T	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr22:37627330T>C	ENST00000249071.6	-	5	510	c.389A>G	c.(388-390)aAg>aGg	p.K130R	RAC2_ENST00000405484.1_Missense_Mutation_p.K123R|RAC2_ENST00000406508.1_Missense_Mutation_p.K86R	NM_002872.3	NP_002863.1	P15153	RAC2_HUMAN	ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)	130					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|cell projection assembly (GO:0030031)|G-protein coupled receptor signaling pathway (GO:0007186)|lymphocyte aggregation (GO:0071593)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neutrophil chemotaxis (GO:0090023)|regulation of cell-substrate adhesion (GO:0010810)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of neutrophil migration (GO:1902622)|regulation of respiratory burst (GO:0060263)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)	12					Dextromethorphan(DB00514)	CTTCTTCTCCTTCAGTTTCTC	0.632																																					p.K130R		.											.	RAC2	723	0			c.A389G						.						128.0	112.0	117.0					22																	37627330		2203	4300	6503	SO:0001583	missense	5880	exon5			TTCTCCTTCAGTT	M64595	CCDS13945.1	22q13.1	2014-09-17			ENSG00000128340	ENSG00000128340		"""Endogenous ligands"""	9802	protein-coding gene	gene with protein product		602049				2674130	Standard	NM_002872		Approved	EN-7	uc003arc.3	P15153	OTTHUMG00000150540	ENST00000249071.6:c.389A>G	22.37:g.37627330T>C	ENSP00000249071:p.Lys130Arg	241.0	1.0		330.0	127.0	NM_002872	Q9UDJ4	Missense_Mutation	SNP	ENST00000249071.6	37	CCDS13945.1	.	.	.	.	.	.	.	.	.	.	T	6.673	0.492753	0.12702	.	.	ENSG00000128340	ENST00000249071;ENST00000406508;ENST00000405484;ENST00000441619	T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43	4.98	4.98	0.66077	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.46521	0.1397	N	0.11724	0.165	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.41215	-0.9521	10	0.10377	T	0.69	.	14.9666	0.71198	0.0:0.0:0.0:1.0	.	130	P15153	RAC2_HUMAN	R	130;86;123;130	ENSP00000249071:K130R;ENSP00000385270:K86R;ENSP00000385590:K123R;ENSP00000403778:K130R	ENSP00000249071:K130R	K	-	2	0	RAC2	35957276	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.388000	0.52509	2.003000	0.58678	0.459000	0.35465	AAG	.		0.632	RAC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318812.1		
RHBDF2	79651	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	74473344	74473344	+	Missense_Mutation	SNP	A	A	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr17:74473344A>T	ENST00000313080.4	-	8	1198	c.925T>A	c.(925-927)Tcc>Acc	p.S309T	RHBDF2_ENST00000591885.1_Missense_Mutation_p.S280T|RHBDF2_ENST00000389760.4_Missense_Mutation_p.S280T|RHBDF2_ENST00000592378.1_5'Flank	NM_024599.5	NP_078875.4	Q6PJF5	RHDF2_HUMAN	rhomboid 5 homolog 2 (Drosophila)	309					negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(4)|skin(1)	27						AGTGGGGGGGACTCAAAGACA	0.582																																					p.S309T		.											.	RHBDF2	90	0			c.T925A						.						31.0	37.0	35.0					17																	74473344		2202	4299	6501	SO:0001583	missense	79651	exon8			GGGGGGACTCAAA	BC016034	CCDS32743.1, CCDS32744.1	17q25.3	2014-09-17	2006-02-22	2006-02-22		ENSG00000129667			20788	protein-coding gene	gene with protein product		614404	"""rhomboid, veinlet-like 6 (Drosophila)"", ""tylosis with oesophageal cancer"""	RHBDL6, TOC		12838346, 22265016	Standard	NM_024599		Approved	FLJ22341, RHBDL5, TOCG	uc002jrq.2	Q6PJF5		ENST00000313080.4:c.925T>A	17.37:g.74473344A>T	ENSP00000322775:p.Ser309Thr	49.0	0.0		70.0	22.0	NM_024599	A6NEM3|A8K801|Q5U607|Q5YGQ8|Q9H6E9	Missense_Mutation	SNP	ENST00000313080.4	37	CCDS32743.1	.	.	.	.	.	.	.	.	.	.	A	18.16	3.561507	0.65538	.	.	ENSG00000129667	ENST00000313080;ENST00000389760;ENST00000389762	T;T	0.70045	-0.45;-0.45	5.54	5.54	0.83059	.	0.058379	0.64402	D	0.000001	T	0.74951	0.3784	L	0.41710	1.295	0.50313	D	0.999868	D;P;P;P	0.76494	0.999;0.938;0.84;0.675	D;P;P;B	0.85130	0.997;0.557;0.773;0.28	T	0.73142	-0.4076	10	0.33141	T	0.24	-20.856	15.678	0.77344	1.0:0.0:0.0:0.0	.	280;255;309;280	B7Z8H4;Q6ZWP8;Q6PJF5;Q6PJF5-2	.;.;RHDF2_HUMAN;.	T	309;280;255	ENSP00000322775:S309T;ENSP00000374410:S280T	ENSP00000322775:S309T	S	-	1	0	RHBDF2	71984939	1.000000	0.71417	0.997000	0.53966	0.746000	0.42486	8.701000	0.91331	2.098000	0.63641	0.533000	0.62120	TCC	.		0.582	RHBDF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450134.1	NM_024599	
ROCK1	6093	hgsc.bcm.edu;broad.mit.edu	37	18	18629104	18629105	+	Frame_Shift_Ins	INS	-	-	A	rs35810558		TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr18:18629104_18629105insA	ENST00000399799.2	-	4	1302_1303	c.362_363insT	c.(361-363)ttcfs	p.F121fs		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	121	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					TTTCTTCCCAGAAAAAAGCAGA	0.361																																					p.F121fs		.											.	ROCK1	1026	0			c.363_364insT						.																																			SO:0001589	frameshift_variant	6093	exon4			TTCCCAGAAAAAA		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.363dupT	18.37:g.18629110_18629110dupA	ENSP00000382697:p.Phe121fs	83.0	0.0		127.0	13.0	NM_005406	B0YJ91|Q2KHM4|Q59GZ4	Frame_Shift_Ins	INS	ENST00000399799.2	37	CCDS11870.2																																																																																			.		0.361	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406	
RYR3	6263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	34109151	34109151	+	Missense_Mutation	SNP	G	G	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr15:34109151G>T	ENST00000389232.4	+	75	10661	c.10591G>T	c.(10591-10593)Gat>Tat	p.D3531Y	RYR3_ENST00000415757.3_Missense_Mutation_p.D3526Y	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3531					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ACTAGTACAGGATTTGGCTGT	0.423																																					p.D3531Y		.											.	RYR3	520	0			c.G10591T						.						57.0	54.0	55.0					15																	34109151		1865	4108	5973	SO:0001583	missense	6263	exon75			GTACAGGATTTGG		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.10591G>T	15.37:g.34109151G>T	ENSP00000373884:p.Asp3531Tyr	95.0	0.0		128.0	42.0	NM_001036	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874939	0.72180	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D	0.97089	-4.24	5.11	4.19	0.49359	.	0.057072	0.64402	D	0.000002	D	0.96734	0.8934	M	0.78049	2.395	0.80722	D	1	P;P	0.48503	0.911;0.74	P;P	0.45946	0.461;0.498	D	0.96602	0.9445	10	0.87932	D	0	.	13.5624	0.61797	0.0746:0.0:0.9254:0.0	.	3526;3531	Q15413-2;Q15413	.;RYR3_HUMAN	Y	3531;3530;3526	ENSP00000373884:D3531Y	ENSP00000354735:D3526Y	D	+	1	0	RYR3	31896443	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.657000	0.98554	1.368000	0.46115	0.655000	0.94253	GAT	.		0.423	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SCN4A	6329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	62020305	62020305	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr17:62020305A>G	ENST00000435607.1	-	23	4245	c.4169T>C	c.(4168-4170)aTg>aCg	p.M1390T	SCN4A_ENST00000578147.1_Missense_Mutation_p.M1390T	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1390					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GATGAAGATCATGTTGATGTT	0.507																																					p.M1390T		.											.	SCN4A	93	0			c.T4169C						.						239.0	223.0	228.0					17																	62020305		2203	4300	6503	SO:0001583	missense	6329	exon23			AAGATCATGTTGA	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.4169T>C	17.37:g.62020305A>G	ENSP00000396320:p.Met1390Thr	359.0	0.0		394.0	152.0	NM_000334	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	37	CCDS45761.1	.	.	.	.	.	.	.	.	.	.	A	14.79	2.639486	0.47153	.	.	ENSG00000007314	ENST00000435607	D	0.98400	-4.91	3.87	3.87	0.44632	Ion transport (1);	0.193855	0.47093	D	0.000247	D	0.95698	0.8601	L	0.37466	1.105	0.44006	D	0.996714	B	0.31893	0.345	B	0.32864	0.154	D	0.95435	0.8520	10	0.72032	D	0.01	.	12.3276	0.55020	1.0:0.0:0.0:0.0	.	1390	P35499	SCN4A_HUMAN	T	1390	ENSP00000396320:M1390T	ENSP00000396320:M1390T	M	-	2	0	SCN4A	59374037	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.087000	0.94110	1.760000	0.52011	0.379000	0.24179	ATG	.		0.507	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
SDR42E1	93517	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	82033315	82033315	+	Missense_Mutation	SNP	T	T	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr16:82033315T>C	ENST00000328945.5	-	3	710	c.583A>G	c.(583-585)Aga>Gga	p.R195G	SDR42E1_ENST00000534209.1_5'Flank	NM_145168.2	NP_660151.2	Q8WUS8	D42E1_HUMAN	short chain dehydrogenase/reductase family 42E, member 1	195					steroid biosynthetic process (GO:0006694)	integral component of membrane (GO:0016021)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)			NS(2)|endometrium(1)|lung(4)|skin(3)	10						GGAAGGTGTCTTTGTTCTCCA	0.552																																					p.R195G		.											.	SDR42E1	90	0			c.A583G						.						111.0	111.0	111.0					16																	82033315		1976	4164	6140	SO:0001583	missense	93517	exon3			GGTGTCTTTGTTC	AF161368	CCDS42205.1	16q23.3	2011-09-14				ENSG00000184860	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	29834	protein-coding gene	gene with protein product						19027726	Standard	NM_145168		Approved	HSPC105	uc002fgu.3	Q8WUS8		ENST00000328945.5:c.583A>G	16.37:g.82033315T>C	ENSP00000332407:p.Arg195Gly	105.0	0.0		128.0	6.0	NM_145168	B2RDS1|Q9P0D1	Missense_Mutation	SNP	ENST00000328945.5	37	CCDS42205.1	.	.	.	.	.	.	.	.	.	.	T	18.81	3.702878	0.68501	.	.	ENSG00000184860	ENST00000328945;ENST00000532128	D;D	0.87571	-2.27;-1.87	5.76	5.76	0.90799	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.88919	0.6568	M	0.64170	1.965	0.58432	D	0.999999	P	0.46859	0.885	P	0.51297	0.665	D	0.89438	0.3721	10	0.62326	D	0.03	-24.1762	11.2905	0.49247	0.0:0.0:0.1522:0.8478	.	195	Q8WUS8	D42E1_HUMAN	G	195;192	ENSP00000332407:R195G;ENSP00000434529:R192G	ENSP00000332407:R195G	R	-	1	2	SDR42E1	80590816	0.997000	0.39634	0.988000	0.46212	0.989000	0.77384	2.668000	0.46816	2.191000	0.70037	0.533000	0.62120	AGA	.		0.552	SDR42E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388081.2	NM_145168	
SLC1A3	6507	broad.mit.edu;bcgsc.ca	37	5	36680561	36680561	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr5:36680561A>G	ENST00000265113.4	+	8	1635	c.1159A>G	c.(1159-1161)Acc>Gcc	p.T387A	CTD-2353F22.1_ENST00000510740.1_RNA|SLC1A3_ENST00000381918.3_Missense_Mutation_p.T387A	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	387					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CAAGCGCGTCACCAGATTCGT	0.507																																					p.T387A		.											.	SLC1A3	90	0			c.A1159G						.						108.0	92.0	98.0					5																	36680561		2203	4300	6503	SO:0001583	missense	6507	exon8			CGCGTCACCAGAT		CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.1159A>G	5.37:g.36680561A>G	ENSP00000265113:p.Thr387Ala	52.0	0.0		86.0	5.0	NM_004172	B2R5T3|Q4JCQ8	Missense_Mutation	SNP	ENST00000265113.4	37	CCDS3919.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.965974	0.74131	.	.	ENSG00000079215	ENST00000265113;ENST00000427100;ENST00000381918	T;T	0.56275	0.47;0.47	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.55986	0.1955	N	0.17564	0.495	0.58432	D	0.999999	B;P	0.46327	0.228;0.876	B;P	0.62813	0.07;0.907	T	0.54357	-0.8306	10	0.27082	T	0.32	-31.7451	16.1502	0.81611	1.0:0.0:0.0:0.0	.	387;387	Q4JCQ8;P43003	.;EAA1_HUMAN	A	387;335;387	ENSP00000265113:T387A;ENSP00000371343:T387A	ENSP00000265113:T387A	T	+	1	0	SLC1A3	36716318	1.000000	0.71417	0.998000	0.56505	0.769000	0.43574	9.332000	0.96446	2.224000	0.72417	0.533000	0.62120	ACC	.		0.507	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207579.2	NM_004172	
SLC30A1	7779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	211749145	211749145	+	Missense_Mutation	SNP	T	T	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr1:211749145T>A	ENST00000367001.4	-	2	1238	c.1109A>T	c.(1108-1110)cAt>cTt	p.H370L		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	370					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		ATGTAATTCATGAACTTCCTC	0.358																																					p.H370L		.											.	SLC30A1	93	0			c.A1109T						.						81.0	79.0	80.0					1																	211749145		2203	4300	6503	SO:0001583	missense	7779	exon2			AATTCATGAACTT	AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.1109A>T	1.37:g.211749145T>A	ENSP00000355968:p.His370Leu	39.0	0.0		60.0	23.0	NM_021194	Q0VAK9|Q9BZF6	Missense_Mutation	SNP	ENST00000367001.4	37	CCDS1499.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.327221	0.81690	.	.	ENSG00000170385	ENST00000367001	T	0.61274	0.12	5.69	5.69	0.88448	.	0.090564	0.85682	D	0.000000	D	0.82939	0.5146	H	0.95328	3.655	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	D	0.88299	0.2948	10	0.87932	D	0	-9.5283	15.9538	0.79865	0.0:0.0:0.0:1.0	.	370	Q9Y6M5	ZNT1_HUMAN	L	370	ENSP00000355968:H370L	ENSP00000355968:H370L	H	-	2	0	SLC30A1	209815768	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.748000	0.85085	2.170000	0.68504	0.460000	0.39030	CAT	.		0.358	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104738.2		
SLC38A9	153129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	54952566	54952566	+	Missense_Mutation	SNP	A	A	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr5:54952566A>C	ENST00000396865.2	-	9	1325	c.734T>G	c.(733-735)cTg>cGg	p.L245R	SLC38A9_ENST00000318672.3_Missense_Mutation_p.L245R|SLC38A9_ENST00000515629.1_Missense_Mutation_p.L182R|SLC38A9_ENST00000539768.1_Missense_Mutation_p.L245R|SLC38A9_ENST00000512595.1_Missense_Mutation_p.L218R|SLC38A9_ENST00000416547.2_Missense_Mutation_p.L121R	NM_173514.3	NP_775785.2	Q8NBW4	S38A9_HUMAN	solute carrier family 38, member 9	245					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8		Lung NSC(810;0.00122)|Prostate(74;0.0376)|Breast(144;0.181)				ATTGGTACTCAGTATAGTGTC	0.323																																					p.L245R		.											.	SLC38A9	68	0			c.T734G						.						112.0	109.0	110.0					5																	54952566		2201	4299	6500	SO:0001583	missense	153129	exon9			GTACTCAGTATAG		CCDS3968.1, CCDS58947.1, CCDS58948.1, CCDS75243.1	5q11.2	2013-05-22			ENSG00000177058	ENSG00000177058		"""Solute carriers"""	26907	protein-coding gene	gene with protein product							Standard	NM_173514		Approved	FLJ90709	uc003jqf.3	Q8NBW4	OTTHUMG00000131189	ENST00000396865.2:c.734T>G	5.37:g.54952566A>C	ENSP00000380074:p.Leu245Arg	86.0	0.0		107.0	38.0	NM_173514	B3KXV1|B7Z7D0|Q0P5S0|Q6MZJ8	Missense_Mutation	SNP	ENST00000396865.2	37	CCDS3968.1	.	.	.	.	.	.	.	.	.	.	A	14.32	2.501485	0.44455	.	.	ENSG00000177058	ENST00000396865;ENST00000318672;ENST00000539768;ENST00000515629;ENST00000416547;ENST00000512595;ENST00000512208	T;T;T;T;T;T;T	0.50813	1.82;1.82;0.81;1.85;1.85;1.37;0.73	6.01	1.13	0.20643	.	0.368947	0.31648	N	0.007297	T	0.44953	0.1318	L	0.43152	1.355	0.39951	D	0.974538	P;P	0.43633	0.813;0.602	P;B	0.51055	0.657;0.354	T	0.26018	-1.0115	10	0.27082	T	0.32	-3.5205	7.9605	0.30068	0.5489:0.0:0.4511:0.0	.	218;245	B3KXV1;Q8NBW4	.;S38A9_HUMAN	R	245;245;245;182;121;218;182	ENSP00000380074:L245R;ENSP00000316596:L245R;ENSP00000437771:L245R;ENSP00000420934:L182R;ENSP00000397429:L121R;ENSP00000427335:L218R;ENSP00000426413:L182R	ENSP00000316596:L245R	L	-	2	0	SLC38A9	54988323	0.992000	0.36948	0.508000	0.27688	0.832000	0.47134	1.265000	0.33027	0.181000	0.19994	0.523000	0.50628	CTG	.		0.323	SLC38A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253912.2	NM_173514	
SLTM	79811	broad.mit.edu;bcgsc.ca	37	15	59179713	59179713	+	Missense_Mutation	SNP	T	T	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr15:59179713T>C	ENST00000380516.2	-	18	2489	c.2402A>G	c.(2401-2403)gAg>gGg	p.E801G	AC025918.2_ENST00000452467.1_RNA|SLTM_ENST00000536328.1_Missense_Mutation_p.E370G	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	801	Arg/Glu-rich.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TTTTTTCCCCTCACTTTGACC	0.423																																					p.E801G		.											.	SLTM	91	0			c.A2402G						.						112.0	101.0	105.0					15																	59179713		2192	4292	6484	SO:0001583	missense	79811	exon18			TTCCCCTCACTTT	BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.2402A>G	15.37:g.59179713T>C	ENSP00000369887:p.Glu801Gly	85.0	0.0		109.0	7.0	NM_024755	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000380516.2	37	CCDS10168.2	.	.	.	.	.	.	.	.	.	.	T	27.5	4.838965	0.91117	.	.	ENSG00000137776	ENST00000380516;ENST00000432750;ENST00000536328	T	0.13538	2.58	5.68	5.68	0.88126	.	0.000000	0.64402	D	0.000011	T	0.25195	0.0612	L	0.34521	1.04	0.58432	D	0.999999	D;D	0.69078	0.997;0.993	D;D	0.65684	0.937;0.91	T	0.01545	-1.1328	10	0.29301	T	0.29	.	15.9384	0.79734	0.0:0.0:0.0:1.0	.	801;370	Q9NWH9;A8K5V8	SLTM_HUMAN;.	G	801;367;370	ENSP00000369887:E801G	ENSP00000369887:E801G	E	-	2	0	SLTM	56967005	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.099000	0.76981	2.159000	0.67721	0.460000	0.39030	GAG	.		0.423	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157124.1	NM_024755	
SLCO3A1	28232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	92459662	92459662	+	Missense_Mutation	SNP	G	G	A	rs534712973		TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr15:92459662G>A	ENST00000318445.6	+	2	834	c.620G>A	c.(619-621)cGg>cAg	p.R207Q	SLCO3A1_ENST00000424469.2_Missense_Mutation_p.R207Q	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	207					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	GACCACGTGCGGAGGAAGGAC	0.582																																					p.R207Q		.											.	SLCO3A1	91	0			c.G620A						.						20.0	21.0	21.0					15																	92459662		2198	4298	6496	SO:0001583	missense	28232	exon2			ACGTGCGGAGGAA	AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.620G>A	15.37:g.92459662G>A	ENSP00000320634:p.Arg207Gln	109.0	0.0		122.0	50.0	NM_013272	A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	ENST00000318445.6	37	CCDS10371.1	.	.	.	.	.	.	.	.	.	.	G	19.43	3.825441	0.71143	.	.	ENSG00000176463	ENST00000318445;ENST00000424469	T;T	0.80909	-1.43;-1.43	5.44	4.53	0.55603	Major facilitator superfamily domain, general substrate transporter (1);	0.340480	0.27447	N	0.019329	T	0.74512	0.3726	L	0.56769	1.78	0.80722	D	1	P;P;P	0.51791	0.89;0.948;0.646	B;B;B	0.37601	0.131;0.254;0.227	T	0.75941	-0.3140	10	0.46703	T	0.11	.	13.0234	0.58802	0.0772:0.0:0.9228:0.0	.	149;207;207	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	Q	207	ENSP00000320634:R207Q;ENSP00000387846:R207Q	ENSP00000320634:R207Q	R	+	2	0	SLCO3A1	90260666	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	5.289000	0.65656	1.302000	0.44855	0.655000	0.94253	CGG	.		0.582	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313529.1	NM_013272	
SOS1	6654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	39213099	39213099	+	Missense_Mutation	SNP	G	G	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr2:39213099G>A	ENST00000426016.1	-	24	3954	c.3868C>T	c.(3868-3870)Ccg>Tcg	p.P1290S	SOS1_ENST00000395038.2_Missense_Mutation_p.P1275S|SOS1_ENST00000402219.2_Missense_Mutation_p.P1290S			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	1290					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				GGAACAGGCGGCCCAGCAATG	0.507									Noonan syndrome																												p.P1290S		.											.	SOS1	851	0			c.C3868T						.						266.0	239.0	248.0					2																	39213099		2203	4300	6503	SO:0001583	missense	6654	exon23	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CAGGCGGCCCAGC	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.3868C>T	2.37:g.39213099G>A	ENSP00000387784:p.Pro1290Ser	426.0	0.0		536.0	205.0	NM_005633	A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	37	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099887	0.56183	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038	D;D;D	0.84944	-1.92;-1.92;-1.81	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.82176	0.4980	L	0.55990	1.75	0.80722	D	1	P	0.39809	0.689	B	0.33254	0.16	D	0.84644	0.0697	10	0.62326	D	0.03	.	18.8284	0.92127	0.0:0.0:1.0:0.0	.	1290	Q07889	SOS1_HUMAN	S	1290;1290;1007;1275	ENSP00000387784:P1290S;ENSP00000384675:P1290S;ENSP00000378479:P1275S	ENSP00000378479:P1275S	P	-	1	0	SOS1	39066603	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	6.554000	0.73923	2.677000	0.91161	0.563000	0.77884	CCG	.		0.507	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633	
SPEF2	79925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	35793440	35793440	+	Missense_Mutation	SNP	G	G	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr5:35793440G>T	ENST00000356031.3	+	32	4888	c.4734G>T	c.(4732-4734)atG>atT	p.M1578I	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Missense_Mutation_p.M1573I|SPEF2_ENST00000303129.4_Missense_Mutation_p.M375I	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1578					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGCAGTATATGCAGGTTGTTA	0.478																																					p.M1578I		.											.	SPEF2	26	0			c.G4734T						.						86.0	89.0	88.0					5																	35793440		2050	4184	6234	SO:0001583	missense	79925	exon32			GTATATGCAGGTT	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.4734G>T	5.37:g.35793440G>T	ENSP00000348314:p.Met1578Ile	161.0	0.0		202.0	71.0	NM_024867	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.017307	0.35606	.	.	ENSG00000152582	ENST00000356031;ENST00000440995;ENST00000303129	T;T;T	0.62232	0.04;0.04;0.04	5.88	1.86	0.25419	.	0.918493	0.09581	N	0.782820	T	0.49779	0.1577	L	0.40543	1.245	0.24303	N	0.995118	B;B;B	0.32968	0.392;0.019;0.003	B;B;B	0.34093	0.175;0.004;0.002	T	0.40850	-0.9541	10	0.38643	T	0.18	.	5.5934	0.17313	0.2149:0.0:0.5432:0.2419	.	375;1573;1578	Q9C093-4;Q9C093-2;Q9C093	.;.;SPEF2_HUMAN	I	1578;1573;375	ENSP00000348314:M1578I;ENSP00000412125:M1573I;ENSP00000303843:M375I	ENSP00000303843:M375I	M	+	3	0	SPEF2	35829197	0.962000	0.33011	0.999000	0.59377	0.989000	0.77384	0.304000	0.19228	0.830000	0.34757	-0.150000	0.13652	ATG	.		0.478	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
SPEG	10290	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	220354314	220354314	+	Silent	SNP	G	G	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr2:220354314G>A	ENST00000312358.7	+	36	8706	c.8574G>A	c.(8572-8574)gcG>gcA	p.A2858A	AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2858	Pro-rich.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CCCGGCCAGCGGAGCCCACCC	0.652																																					p.A2858A		.											.	SPEG	383	0			c.G8574A						.						81.0	90.0	87.0					2																	220354314		1991	4134	6125	SO:0001819	synonymous_variant	10290	exon36			GCCAGCGGAGCCC	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.8574G>A	2.37:g.220354314G>A		88.0	0.0		109.0	34.0	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	ENST00000312358.7	37	CCDS42824.1																																																																																			.		0.652	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
TAF1	6872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	70604840	70604840	+	Missense_Mutation	SNP	A	A	G			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chrX:70604840A>G	ENST00000373790.4	+	14	2215	c.2164A>G	c.(2164-2166)Act>Gct	p.T722A	TAF1_ENST00000423759.1_Missense_Mutation_p.T743A|TAF1_ENST00000276072.3_Missense_Mutation_p.T743A|TAF1_ENST00000449580.1_Missense_Mutation_p.T722A	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	722	Histone acetyltransferase (HAT).				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				ATATGGGGAAACTGTTTACTG	0.388																																					p.T743A		.											.	TAF1	900	0			c.A2227G						.						142.0	122.0	129.0					X																	70604840		2203	4300	6503	SO:0001583	missense	6872	exon14			GGGGAAACTGTTT		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.2164A>G	X.37:g.70604840A>G	ENSP00000362895:p.Thr722Ala	74.0	0.0		104.0	82.0	NM_004606	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	.	20.4	3.990674	0.74589	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.16457	2.34;2.34;2.34;2.34	5.32	4.11	0.48088	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.000000	0.85682	D	0.000000	T	0.38321	0.1036	M	0.81112	2.525	0.49798	D	0.999828	P;P	0.51057	0.891;0.941	P;P	0.60012	0.867;0.79	T	0.26018	-1.0115	10	0.52906	T	0.07	.	11.5744	0.50854	0.8533:0.1467:0.0:0.0	.	722;743	P21675;P21675-2	TAF1_HUMAN;.	A	722;722;743;743	ENSP00000362895:T722A;ENSP00000389000:T722A;ENSP00000406549:T743A;ENSP00000276072:T743A	ENSP00000276072:T743A	T	+	1	0	TAF1	70521565	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.910000	0.92685	1.773000	0.52216	0.481000	0.45027	ACT	.		0.388	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
TAS2R41	259287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	143175217	143175217	+	Silent	SNP	C	C	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr7:143175217C>T	ENST00000408916.1	+	1	252	c.252C>T	c.(250-252)ttC>ttT	p.F84F	EPHA1-AS1_ENST00000429289.1_RNA	NM_176883.2	NP_795364.2	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	84					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(2)|skin(1)	18	Melanoma(164;0.15)					GCCGACAGTTCTTCCATCTAC	0.547																																					p.F84F		.											.	TAS2R41	92	0			c.C252T						.						108.0	108.0	108.0					7																	143175217		2004	4175	6179	SO:0001819	synonymous_variant	259287	exon1			ACAGTTCTTCCAT	AF494232	CCDS43663.1	7q34	2012-08-22			ENSG00000221855	ENSG00000221855		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18883	protein-coding gene	gene with protein product		613965				12379855	Standard	NM_176883		Approved	T2R59	uc003wdc.1	P59536	OTTHUMG00000155892	ENST00000408916.1:c.252C>T	7.37:g.143175217C>T		81.0	0.0		91.0	11.0	NM_176883	P59550|Q495I2|Q50KJ5|Q50KJ6|Q50KJ7|Q645W7	Silent	SNP	ENST00000408916.1	37	CCDS43663.1																																																																																			.		0.547	TAS2R41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342149.1		
TF	7018	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	133476711	133476712	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr3:133476711_133476712insG	ENST00000402696.3	+	8	1454_1455	c.969_970insG	c.(970-972)gtcfs	p.V324fs	TF_ENST00000264998.3_Frame_Shift_Ins_p.V197fs	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	324	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)			NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	GGTTTTTAAAAGTCCCCCCCAG	0.485																																					p.K323fs		.											.	TF	92	0			c.969_970insG						.																																			SO:0001589	frameshift_variant	7018	exon8			TTTAAAAGTCCCC		CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.970dupG	3.37:g.133476712_133476712dupG	ENSP00000385834:p.Val324fs	99.0	0.0		153.0	54.0	NM_001063	O43890|Q1HBA5|Q9NQB8|Q9UHV0	Frame_Shift_Ins	INS	ENST00000402696.3	37	CCDS3080.1																																																																																			.		0.485	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317775.1	NM_001063	
TF	7018	hgsc.bcm.edu;bcgsc.ca	37	3	133476713	133476713	+	Missense_Mutation	SNP	T	T	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr3:133476713T>C	ENST00000402696.3	+	8	1456	c.971T>C	c.(970-972)gTc>gCc	p.V324A	TF_ENST00000264998.3_Missense_Mutation_p.V197A	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	324	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)			NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	TTTTTAAAAGTCCCCCCCAGG	0.488																																					p.V324A		.											.	TF	92	0			c.T971C						.						85.0	84.0	85.0					3																	133476713		2203	4300	6503	SO:0001583	missense	7018	exon8			TAAAAGTCCCCCC		CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.971T>C	3.37:g.133476713T>C	ENSP00000385834:p.Val324Ala	100.0	0.0		151.0	52.0	NM_001063	O43890|Q1HBA5|Q9NQB8|Q9UHV0	Missense_Mutation	SNP	ENST00000402696.3	37	CCDS3080.1	.	.	.	.	.	.	.	.	.	.	T	18.48	3.632164	0.67015	.	.	ENSG00000091513	ENST00000402696;ENST00000264998	T;T	0.39229	1.09;1.09	4.91	4.91	0.64330	.	0.315004	0.34178	N	0.004193	T	0.66127	0.2758	M	0.83384	2.64	0.09310	N	1	D	0.63880	0.993	D	0.74348	0.983	T	0.62086	-0.6928	10	0.72032	D	0.01	-22.6412	13.9505	0.64113	0.0:0.0:0.0:1.0	.	324	P02787	TRFE_HUMAN	A	324;197	ENSP00000385834:V324A;ENSP00000264998:V197A	ENSP00000264998:V197A	V	+	2	0	TF	134959403	0.118000	0.22208	0.008000	0.14137	0.008000	0.06430	3.423000	0.52756	2.190000	0.69967	0.459000	0.35465	GTC	.		0.488	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317775.1	NM_001063	
TRIML1	339976	broad.mit.edu;ucsc.edu;mdanderson.org	37	4	189065204	189065204	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr4:189065204T>A	ENST00000332517.3	+	5	913	c.773T>A	c.(772-774)tTg>tAg	p.L258*	TRIML1_ENST00000507581.1_3'UTR|RP11-366H4.3_ENST00000501322.2_RNA	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	258					multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		GAGCCACTCTTGCTTCAGTGT	0.557																																					p.L258X	Melanoma(31;213 1036 16579 23968 32372)	.											.	TRIML1	156	0			c.T773A						.						58.0	60.0	59.0					4																	189065204		2203	4300	6503	SO:0001587	stop_gained	339976	exon5			CACTCTTGCTTCA	AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.773T>A	4.37:g.189065204T>A	ENSP00000327738:p.Leu258*	85.0	0.0		79.0	31.0	NM_178556	Q96BE5	Nonsense_Mutation	SNP	ENST00000332517.3	37	CCDS3851.1	.	.	.	.	.	.	.	.	.	.	t	29.3	4.996173	0.93167	.	.	ENSG00000184108	ENST00000332517	.	.	.	5.29	5.29	0.74685	.	0.208396	0.24056	N	0.041950	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	-17.0882	11.8273	0.52275	0.0:0.0:0.0:1.0	.	.	.	.	X	258	.	ENSP00000327738:L258X	L	+	2	0	TRIML1	189302198	0.976000	0.34144	0.958000	0.39756	0.045000	0.14185	2.074000	0.41529	2.361000	0.80049	0.520000	0.50463	TTG	.		0.557	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359813.1	NM_178556	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	216420124	216420124	+	Missense_Mutation	SNP	T	T	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr1:216420124T>A	ENST00000307340.3	-	13	2998	c.2612A>T	c.(2611-2613)aAa>aTa	p.K871I	USH2A_ENST00000366943.2_Missense_Mutation_p.K871I|USH2A_ENST00000366942.3_Missense_Mutation_p.K871I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	871	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TACCCCTAATTTGCAAGGACA	0.423										HNSCC(13;0.011)																											p.K871I		.											.	USH2A	115	0			c.A2612T						.						235.0	212.0	220.0					1																	216420124		2203	4300	6503	SO:0001583	missense	7399	exon13			CCTAATTTGCAAG	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.2612A>T	1.37:g.216420124T>A	ENSP00000305941:p.Lys871Ile	157.0	0.0		236.0	86.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.983905	0.74474	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.64618	-0.11;-0.11;-0.11	6.03	4.91	0.64330	EGF-like, laminin (4);	0.000000	0.45867	D	0.000332	D	0.85075	0.5614	H	0.97390	3.995	0.44890	D	0.9979	D;D	0.69078	0.975;0.997	P;D	0.71870	0.805;0.975	D	0.88746	0.3247	10	0.87932	D	0	.	11.9264	0.52823	0.0:0.0673:0.0:0.9327	.	871;871	O75445-2;O75445	.;USH2A_HUMAN	I	871	ENSP00000305941:K871I;ENSP00000355910:K871I;ENSP00000355909:K871I	ENSP00000305941:K871I	K	-	2	0	USH2A	214486747	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	4.270000	0.58896	1.112000	0.41740	0.533000	0.62120	AAA	.		0.423	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
USP19	10869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49153563	49153563	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr3:49153563C>T	ENST00000398888.2	-	9	1403	c.1085G>A	c.(1084-1086)tGt>tAt	p.C362Y	USP19_ENST00000398896.1_Missense_Mutation_p.C168Y|USP19_ENST00000417901.1_Missense_Mutation_p.C463Y|USP19_ENST00000434032.2_Missense_Mutation_p.C463Y|USP19_ENST00000398892.3_Missense_Mutation_p.C400Y|USP19_ENST00000398898.2_Missense_Mutation_p.C400Y|USP19_ENST00000453664.1_Missense_Mutation_p.C453Y|USP19_ENST00000488993.1_5'Flank	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	362	CS 2. {ECO:0000255|PROSITE- ProRule:PRU00547}.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AGCCGTGAAACAGAAGGTGCA	0.582																																					p.C463Y		.											.	USP19	663	0			c.G1388A						.						38.0	40.0	39.0					3																	49153563		2052	4201	6253	SO:0001583	missense	10869	exon10			GTGAAACAGAAGG	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.1085G>A	3.37:g.49153563C>T	ENSP00000381863:p.Cys362Tyr	100.0	0.0		177.0	80.0	NM_001199160	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Missense_Mutation	SNP	ENST00000398888.2	37	CCDS43090.1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.791609	0.50102	.	.	ENSG00000172046	ENST00000398896;ENST00000398898;ENST00000417901;ENST00000453664;ENST00000398892;ENST00000398888;ENST00000434032;ENST00000306026;ENST00000425298	T;T;T;T;T;T;T;T	0.13901	2.55;2.55;2.55;2.55;2.55;2.55;2.55;2.55	5.92	4.95	0.65309	Domain of unknown function DUF1872 (1);CS-like domain (1);HSP20-like chaperone (1);	0.274056	0.47852	D	0.000211	T	0.10766	0.0263	L	0.29908	0.895	0.34642	D	0.720707	P;P;P;P;P;P;P	0.44241	0.615;0.829;0.615;0.565;0.635;0.785;0.565	B;B;B;B;B;B;B	0.41917	0.37;0.296;0.296;0.229;0.323;0.254;0.213	T	0.05500	-1.0881	10	0.59425	D	0.04	-15.4006	7.5374	0.27719	0.0:0.8206:0.0:0.1794	.	526;463;453;362;400;448;168	A5PKX8;E9PEG8;E7EN22;O94966;B5MEG5;O94966-2;E7ESU0	.;.;.;UBP19_HUMAN;.;.;.	Y	168;400;463;453;400;362;463;448;448	ENSP00000381870:C168Y;ENSP00000381872:C400Y;ENSP00000395260:C463Y;ENSP00000400090:C453Y;ENSP00000381867:C400Y;ENSP00000381863:C362Y;ENSP00000401197:C463Y;ENSP00000303503:C448Y	ENSP00000303503:C448Y	C	-	2	0	USP19	49128567	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.453000	0.52978	2.818000	0.97014	0.655000	0.94253	TGT	.		0.582	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677	
VWA3A	146177	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	22120822	22120822	+	Missense_Mutation	SNP	G	G	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr16:22120822G>A	ENST00000389398.5	+	7	599	c.503G>A	c.(502-504)gGg>gAg	p.G168E	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	168						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		CTCATCAAAGGGGCCAGAGTC	0.517																																					p.G168E		.											.	VWA3A	1	0			c.G503A						.						102.0	87.0	91.0					16																	22120822		692	1591	2283	SO:0001583	missense	146177	exon7			TCAAAGGGGCCAG	AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.503G>A	16.37:g.22120822G>A	ENSP00000374049:p.Gly168Glu	33.0	0.0		55.0	18.0	NM_173615	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	ENST00000389398.5	37	CCDS45441.1	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430752	0.62844	.	.	ENSG00000175267	ENST00000310694;ENST00000389398	T	0.14022	2.54	5.29	5.29	0.74685	.	0.000000	0.64402	D	0.000020	T	0.35595	0.0937	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.01528	-1.1332	10	0.36615	T	0.2	.	17.5529	0.87881	0.0:0.0:1.0:0.0	.	168	A6NCI4	VWA3A_HUMAN	E	68;168	ENSP00000374049:G168E	ENSP00000308827:G68E	G	+	2	0	VWA3A	22028323	1.000000	0.71417	0.995000	0.50966	0.828000	0.46876	5.398000	0.66308	2.481000	0.83766	0.650000	0.86243	GGG	.		0.517	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430052.1		
WAPAL	23063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	88259978	88259978	+	Missense_Mutation	SNP	C	C	T			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr10:88259978C>T	ENST00000298767.5	-	3	1494	c.1022G>A	c.(1021-1023)gGt>gAt	p.G341D		NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	341	Mediates interaction with the cohesin complex.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						ACAACTTACACCCCCTTTCTT	0.443																																					p.G341D		.											.	WAPAL	91	0			c.G1022A						.						191.0	161.0	171.0					10																	88259978		2203	4300	6503	SO:0001583	missense	23063	exon3			CTTACACCCCCTT	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.1022G>A	10.37:g.88259978C>T	ENSP00000298767:p.Gly341Asp	67.0	0.0		69.0	46.0	NM_015045	A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	37	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	C	8.496	0.863198	0.17250	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076	T	0.29655	1.56	5.77	3.92	0.45320	.	0.476548	0.21051	N	0.080998	T	0.19366	0.0465	N	0.22421	0.69	0.80722	D	1	B;B;B	0.17038	0.012;0.012;0.02	B;B;B	0.21360	0.018;0.008;0.034	T	0.05146	-1.0903	10	0.20519	T	0.43	.	9.3555	0.38164	0.0:0.577:0.3452:0.0778	.	341;341;384	B2RTX8;Q7Z5K2;Q7Z5K2-2	.;WAPL_HUMAN;.	D	426;341;426	ENSP00000298767:G341D	ENSP00000298767:G341D	G	-	2	0	WAPAL	88249958	0.918000	0.31147	0.930000	0.37139	0.911000	0.54048	1.399000	0.34566	0.782000	0.33613	0.650000	0.86243	GGT	.		0.443	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045	
WDFY3	23001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	85711036	85711036	+	Missense_Mutation	SNP	G	G	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr4:85711036G>A	ENST00000295888.4	-	22	3919	c.3512C>T	c.(3511-3513)tCa>tTa	p.S1171L	WDFY3_ENST00000322366.6_Missense_Mutation_p.S1171L	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1171					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TTCATAAAATGAGGACTCTTC	0.398																																					p.S1171L		.											.	WDFY3	93	0			c.C3512T						.						84.0	83.0	84.0					4																	85711036		2203	4300	6503	SO:0001583	missense	23001	exon22			TAAAATGAGGACT	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.3512C>T	4.37:g.85711036G>A	ENSP00000295888:p.Ser1171Leu	139.0	1.0		113.0	82.0	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365241	0.61513	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.67345	-0.26;-0.26	4.85	4.85	0.62838	Concanavalin A-like lectin/glucanase (1);	0.056192	0.64402	D	0.000001	T	0.60431	0.2268	L	0.41824	1.3	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	T	0.56667	-0.7941	10	0.40728	T	0.16	.	18.3293	0.90263	0.0:0.0:1.0:0.0	.	1171	Q8IZQ1	WDFY3_HUMAN	L	1171	ENSP00000318466:S1171L;ENSP00000295888:S1171L	ENSP00000295888:S1171L	S	-	2	0	WDFY3	85930060	1.000000	0.71417	0.981000	0.43875	0.978000	0.69477	7.580000	0.82523	2.365000	0.80145	0.561000	0.74099	TCA	.		0.398	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
WDR59	79726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	74943789	74943789	+	Silent	SNP	T	T	C			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr16:74943789T>C	ENST00000262144.6	-	15	1546	c.1416A>G	c.(1414-1416)aaA>aaG	p.K472K		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	472	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.									breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						CACGCTTCACTTTCTGCAGGG	0.483																																					p.K472K		.											.	WDR59	92	0			c.A1416G						.						37.0	37.0	37.0					16																	74943789		2198	4300	6498	SO:0001819	synonymous_variant	79726	exon15			CTTCACTTTCTGC	AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.1416A>G	16.37:g.74943789T>C		123.0	0.0		203.0	95.0	NM_030581	B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Silent	SNP	ENST00000262144.6	37	CCDS32488.1																																																																																			.		0.483	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410601.3	NM_030581	
ZNF638	27332	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	71592562	71592563	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BD-A2L6-01A-11D-A20W-10	TCGA-BD-A2L6-11A-21D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	45885dc7-e1ae-4db7-a384-59865f009277	c37989ed-705e-458e-a38d-819266a434f5	g.chr2:71592562_71592563insA	ENST00000409544.1	+	6	2351_2352	c.1721_1722insA	c.(1720-1725)agaaaafs	p.RK574fs	ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000264447.4_Frame_Shift_Ins_p.RK574fs|ZNF638_ENST00000377802.2_Frame_Shift_Ins_p.RK574fs|ZNF638_ENST00000355812.3_Frame_Shift_Ins_p.RK574fs	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	574	Arg-rich.				regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						TTACTAGATAGAAAAAAAGCAT	0.342																																					p.R574fs		.											.	ZNF638	94	0			c.1721_1722insA						.																																			SO:0001589	frameshift_variant	27332	exon6			TAGATAGAAAAAA	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.1728dupA	2.37:g.71592569_71592569dupA	ENSP00000386433:p.Arg574fs	31.0	0.0		65.0	23.0	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Frame_Shift_Ins	INS	ENST00000409544.1	37	CCDS1917.1																																																																																			.		0.342	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
