#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCB1	5243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	87196165	87196165	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr7:87196165T>A	ENST00000265724.3	-	7	883	c.466A>T	c.(466-468)Atg>Ttg	p.M156L	ABCB1_ENST00000543898.1_Intron	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	156	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	TCCTGTCGCATTATAGCATGA	0.428																																					p.M156L		.											.	ABCB1	582	0			c.A466T						.						135.0	138.0	137.0					7																	87196165		2203	4300	6503	SO:0001583	missense	5243	exon7			GTCGCATTATAGC	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.466A>T	7.37:g.87196165T>A	ENSP00000265724:p.Met156Leu	147.0	0.0		133.0	23.0	NM_000927	A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	ENST00000265724.3	37	CCDS5608.1	.	.	.	.	.	.	.	.	.	.	T	6.733	0.504023	0.12822	.	.	ENSG00000085563	ENST00000265724	D	0.86769	-2.17	5.91	4.69	0.59074	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.259797	0.51477	D	0.000087	T	0.61375	0.2342	N	0.00605	-1.335	0.80722	D	1	B	0.10296	0.003	B	0.17433	0.018	T	0.64947	-0.6287	10	0.02654	T	1	-34.9453	12.3263	0.55013	0.0:0.0:0.322:0.678	.	156	P08183	MDR1_HUMAN	L	156	ENSP00000265724:M156L	ENSP00000265724:M156L	M	-	1	0	ABCB1	87034101	0.987000	0.35691	0.919000	0.36401	0.941000	0.58515	1.562000	0.36353	2.269000	0.75478	0.533000	0.62120	ATG	.		0.428	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927	
ACP1	52	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	277013	277013	+	Silent	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr2:277013C>T	ENST00000272065.5	+	5	420	c.327C>T	c.(325-327)acC>acT	p.T109T	ACP1_ENST00000272067.6_Silent_p.T109T|ACP1_ENST00000484464.1_3'UTR	NM_004300.3	NP_004291.1	P24666	PPAC_HUMAN	acid phosphatase 1, soluble	109						cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|extracellular vesicular exosome (GO:0070062)	acid phosphatase activity (GO:0003993)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	12	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00175)|Lung NSC(108;0.216)|all_epithelial(98;0.236)		all cancers(51;0.000391)|Epithelial(75;0.00281)|OV - Ovarian serous cystadenocarcinoma(76;0.00542)|GBM - Glioblastoma multiforme(21;0.127)	Adenine(DB00173)	AAGTTAAAACCTGCAAAGCTA	0.313																																					p.T109T		.											.	ACP1	523	0			c.C327T						.						60.0	63.0	62.0					2																	277013		2201	4300	6501	SO:0001819	synonymous_variant	52	exon5			TAAAACCTGCAAA	M87546	CCDS1639.1, CCDS1640.1, CCDS46217.1	2p25	2011-06-09			ENSG00000143727	ENSG00000143727	3.1.3.2	"""Protein tyrosine phosphatases / Class II Cys-based PTPs"""	122	protein-coding gene	gene with protein product		171500					Standard	NM_001040649		Approved		uc002qwf.3	P24666	OTTHUMG00000086933	ENST00000272065.5:c.327C>T	2.37:g.277013C>T		277.0	0.0		241.0	39.0	NM_007099	A8K1L9|B5MCC7|P24667|Q16035|Q16036|Q16725|Q3KQX8|Q53RU0	Silent	SNP	ENST00000272065.5	37	CCDS1639.1																																																																																			.		0.313	ACP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195862.3		
ALG2	85365	ucsc.edu;bcgsc.ca	37	9	101981028	101981028	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr9:101981028T>C	ENST00000476832.1	-	2	500	c.439A>G	c.(439-441)Aga>Gga	p.R147G	ALG2_ENST00000319033.6_Missense_Mutation_p.R54G	NM_033087.3	NP_149078.1	O75340	PDCD6_HUMAN	ALG2, alpha-1,3/1,6-mannosyltransferase	0	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|prostate(2)	22		Acute lymphoblastic leukemia(62;0.0559)				AAAGAATCTCTCTTGGTGAGA	0.483																																					p.R147G		.											.	ALG2	92	0			c.A439G						.						78.0	80.0	79.0					9																	101981028		2203	4300	6503	SO:0001583	missense	85365	exon2			AATCTCTCTTGGT	AK027417	CCDS6739.1	9q31.1	2013-02-22	2013-02-22		ENSG00000119523	ENSG00000119523	2.4.1.132, 2.4.1.257	"""Glycosyltransferase group 1 domain containing"""	23159	protein-coding gene	gene with protein product		607905	"""asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)"""			12684507	Standard	NR_024532		Approved	CDGIi, FLJ14511, hALPG2, NET38	uc004azf.3	Q9H553	OTTHUMG00000020355	ENST00000476832.1:c.439A>G	9.37:g.101981028T>C	ENSP00000417764:p.Arg147Gly	65.0	0.0		40.0	4.0	NM_033087	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	ENST00000476832.1	37	CCDS6739.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.963650	0.53507	.	.	ENSG00000119523	ENST00000476832;ENST00000319033	T;T	0.80653	-1.4;-1.4	5.46	4.28	0.50868	.	0.094012	0.64402	D	0.000001	D	0.88429	0.6434	M	0.83852	2.665	0.80722	D	1	D;B	0.62365	0.991;0.382	P;B	0.62740	0.906;0.383	D	0.88539	0.3108	10	0.56958	D	0.05	-19.5434	12.2906	0.54817	0.0:0.0:0.1419:0.8581	.	54;147	Q9H553-2;Q9H553	.;ALG2_HUMAN	G	147;54	ENSP00000417764:R147G;ENSP00000326609:R54G	ENSP00000432675:R54G	R	-	1	2	ALG2	101020849	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	2.432000	0.44784	0.859000	0.35456	0.528000	0.53228	AGA	.		0.483	ALG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215080.1	NM_033087	
ANO9	338440	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	418530	418530	+	Silent	SNP	C	C	T	rs369737399		TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr11:418530C>T	ENST00000332826.6	-	23	2274	c.2190G>A	c.(2188-2190)tcG>tcA	p.S730S	SIGIRR_ENST00000382520.2_5'Flank|SIGIRR_ENST00000332725.3_5'Flank|SIGIRR_ENST00000397632.3_5'Flank	NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	730					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						TGTTCTTCACCGACTGAGGGA	0.637																																					p.S730S		.											.	ANO9	227	0			c.G2190A						.	C		0,4406		0,0,2203	112.0	100.0	104.0		2190	-7.1	0.0	11		104	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ANO9	NM_001012302.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		730/783	418530	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	338440	exon23			CTTCACCGACTGA	U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.2190G>A	11.37:g.418530C>T		139.0	0.0		137.0	15.0	NM_001012302	B3KUC4|B4E134|Q8TEN4	Silent	SNP	ENST00000332826.6	37	CCDS31326.1																																																																																			.		0.637	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384116.1	NM_001012302	
ARHGEF18	23370	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	7505118	7505118	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr19:7505118T>A	ENST00000359920.6	+	1	545	c.292T>A	c.(292-294)Tcc>Acc	p.S98T	ARHGEF18_ENST00000319670.9_Intron|CTD-2207O23.3_ENST00000593531.1_Intron	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	98					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				GCTGCTGACCTCCAAGATCCT	0.637																																					p.S98T		.											.	ARHGEF18	228	0			c.T292A						.						27.0	33.0	31.0					19																	7505118		692	1591	2283	SO:0001583	missense	23370	exon1			CTGACCTCCAAGA	AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.292T>A	19.37:g.7505118T>A	ENSP00000352995:p.Ser98Thr	109.0	0.0		111.0	17.0	NM_001130955	A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	ENST00000359920.6	37	CCDS45946.1	.	.	.	.	.	.	.	.	.	.	T	15.32	2.799354	0.50208	.	.	ENSG00000104880	ENST00000359920	T	0.34275	1.37	5.43	4.41	0.53225	.	0.178690	0.27008	N	0.021398	T	0.22360	0.0539	N	0.17082	0.46	0.80722	D	1	B	0.13145	0.007	B	0.09377	0.004	T	0.03403	-1.1040	10	0.38643	T	0.18	-15.3691	10.0409	0.42158	0.1508:0.0:0.0:0.8492	.	98	Q6ZSZ5	ARHGI_HUMAN	T	98	ENSP00000352995:S98T	ENSP00000352995:S98T	S	+	1	0	ARHGEF18	7411118	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.697000	0.47060	0.877000	0.35895	0.459000	0.35465	TCC	.		0.637	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436340.1	NM_015318	
ATG14	22863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	14	55848812	55848812	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr14:55848812G>A	ENST00000247178.5	-	6	780	c.745C>T	c.(745-747)Cga>Tga	p.R249*		NM_014924.4	NP_055739.2	Q6ZNE5	BAKOR_HUMAN	autophagy related 14	249					autophagic vacuole assembly (GO:0000045)|endosome to lysosome transport (GO:0008333)|positive regulation of autophagy (GO:0010508)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|pre-autophagosomal structure membrane (GO:0034045)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(2)	13						CAGACCCATCGTCCTGAGAGG	0.537																																					p.R249X		.											.	ATG14	90	0			c.C745T						.						189.0	158.0	169.0					14																	55848812		2203	4300	6503	SO:0001587	stop_gained	22863	exon6			CCCATCGTCCTGA	AB020638	CCDS32087.1	14q22.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000126775	ENSG00000126775			19962	protein-coding gene	gene with protein product	"""Barkor"", ""beclin 1-associated autophagy-related key regulator"""	613515	"""KIAA0831"", ""ATG14 autophagy related 14 homolog (S. cerevisiae)"""	KIAA0831		18843052	Standard	NM_014924		Approved	ATG14L	uc001xbx.2	Q6ZNE5	OTTHUMG00000172129	ENST00000247178.5:c.745C>T	14.37:g.55848812G>A	ENSP00000247178:p.Arg249*	429.0	0.0		397.0	83.0	NM_014924	A6NJE4|A8K9U5|B7ZWP5|O94920|Q32MK7|Q32MK8	Nonsense_Mutation	SNP	ENST00000247178.5	37	CCDS32087.1	.	.	.	.	.	.	.	.	.	.	g	21.6	4.173478	0.78452	.	.	ENSG00000126775	ENST00000247178	.	.	.	5.87	-2.25	0.06888	.	0.054032	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.4068	12.222	0.54439	0.0779:0.0:0.4422:0.4799	.	.	.	.	X	249	.	ENSP00000247178:R249X	R	-	1	2	ATG14	54918565	0.981000	0.34729	0.231000	0.23993	0.631000	0.37964	1.067000	0.30616	-0.286000	0.09076	-0.142000	0.14014	CGA	.		0.537	ATG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416992.1	NM_014924	
AXIN2	8313	hgsc.bcm.edu;bcgsc.ca	37	17	63545764	63545765	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr17:63545764_63545765delCT	ENST00000375702.5	-	2	937_938	c.829_830delAG	c.(829-831)agcfs	p.S277fs	CTD-2535L24.2_ENST00000577662.1_3'UTR|AXIN2_ENST00000307078.5_Frame_Shift_Del_p.S277fs			Q9Y2T1	AXIN2_HUMAN	axin 2	277					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						AACAGGATCGCTCCTCTTGAAG	0.51									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																												p.277_277del		.											.	AXIN2	658	0			c.829_830del						.																																			SO:0001589	frameshift_variant	8313	exon3	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	GGATCGCTCCTCT	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.829_830delAG	17.37:g.63545764_63545765delCT	ENSP00000364854:p.Ser277fs	127.0	0.0		95.0	14.0	NM_004655	Q3MJ88|Q9H3M6|Q9UH84	Frame_Shift_Del	DEL	ENST00000375702.5	37																																																																																				.		0.510	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000445901.1	NM_004655	
BNC1	646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	83926506	83926506	+	Silent	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr15:83926506A>G	ENST00000345382.2	-	5	2758	c.2673T>C	c.(2671-2673)gaT>gaC	p.D891D	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Silent_p.D884D	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	891					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						CACAGTTCCCATCACTGTCCT	0.557																																					p.D891D		.											.	BNC1	93	0			c.T2673C						.						186.0	147.0	160.0					15																	83926506		2203	4300	6503	SO:0001819	synonymous_variant	646	exon5			GTTCCCATCACTG	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.2673T>C	15.37:g.83926506A>G		84.0	0.0		90.0	23.0	NM_001717	Q15840	Silent	SNP	ENST00000345382.2	37	CCDS10324.1																																																																																			.		0.557	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717	
BTBD18	643376	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	57512606	57512606	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr11:57512606G>T	ENST00000436147.3	-	2	1326	c.1139C>A	c.(1138-1140)aCt>aAt	p.T380N	BTBD18_ENST00000422652.1_Missense_Mutation_p.T380N|RP11-691N7.6_ENST00000531074.1_Intron|TMX2-CTNND1_ENST00000528395.1_Intron			B2RXH4	BTBDI_HUMAN	BTB (POZ) domain containing 18	380										endometrium(3)|kidney(1)	4						GCTATCTTGAGTGTTTTTGAG	0.498																																					p.T380N		.											.	.	.	0			c.C1139A						.						35.0	34.0	34.0					11																	57512606		692	1591	2283	SO:0001583	missense	643376	exon3			TCTTGAGTGTTTT		CCDS44603.1	11q12.1	2013-01-08			ENSG00000233436	ENSG00000233436		"""BTB/POZ domain containing"""	37214	protein-coding gene	gene with protein product							Standard	NM_001145101		Approved		uc010rjy.2	B2RXH4	OTTHUMG00000167203	ENST00000436147.3:c.1139C>A	11.37:g.57512606G>T	ENSP00000397020:p.Thr380Asn	91.0	0.0		106.0	8.0	NM_001145101		Missense_Mutation	SNP	ENST00000436147.3	37	CCDS44603.1	.	.	.	.	.	.	.	.	.	.	G	5.683	0.310659	0.10733	.	.	ENSG00000233436	ENST00000422652;ENST00000436147	T;T	0.79352	-1.26;-1.26	5.1	5.1	0.69264	.	.	.	.	.	T	0.65322	0.2680	N	0.14661	0.345	0.09310	N	1	B	0.13594	0.008	B	0.12156	0.007	T	0.59172	-0.7504	9	0.72032	D	0.01	.	13.884	0.63698	0.0:0.0:1.0:0.0	.	380	B2RXH4	BTBDI_HUMAN	N	380	ENSP00000394472:T380N;ENSP00000397020:T380N	ENSP00000394472:T380N	T	-	2	0	BTBD18	57269182	0.002000	0.14202	0.027000	0.17364	0.137000	0.21094	1.151000	0.31651	2.659000	0.90383	0.561000	0.74099	ACT	.		0.498	BTBD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393718.2	NM_001145101	
CAP2	10486	broad.mit.edu;bcgsc.ca	37	6	17514111	17514111	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr6:17514111T>C	ENST00000229922.2	+	7	1094	c.562T>C	c.(562-564)Tat>Cat	p.Y188H	CAP2_ENST00000489374.1_Intron|CAP2_ENST00000465994.1_Intron|CAP2_ENST00000493172.1_Intron|CAP2_ENST00000378990.2_Missense_Mutation_p.Y162H	NM_006366.2	NP_006357.1	P40123	CAP2_HUMAN	CAP, adenylate cyclase-associated protein, 2 (yeast)	188					activation of adenylate cyclase activity (GO:0007190)|axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|establishment or maintenance of cell polarity (GO:0007163)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(4)|urinary_tract(1)	27	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			GGTGAAGTCATATTTGAACAT	0.418																																					p.Y188H		.											.	CAP2	91	0			c.T562C						.						115.0	97.0	103.0					6																	17514111		2203	4300	6503	SO:0001583	missense	10486	exon7			AAGTCATATTTGA	BC008481	CCDS4539.1	6p22.3	2008-02-05			ENSG00000112186	ENSG00000112186			20039	protein-coding gene	gene with protein product						7962207, 8761950	Standard	NM_006366		Approved		uc003ncb.3	P40123	OTTHUMG00000014311	ENST00000229922.2:c.562T>C	6.37:g.17514111T>C	ENSP00000229922:p.Tyr188His	163.0	1.0		153.0	10.0	NM_006366	B2R5Y3|B7Z1C4|B7Z214|Q6IAY2	Missense_Mutation	SNP	ENST00000229922.2	37	CCDS4539.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.364193	0.82353	.	.	ENSG00000112186	ENST00000229922;ENST00000378990	T;T	0.19532	2.14;2.14	6.08	6.08	0.98989	Adenylate cyclase-associated CAP, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.43188	0.1236	M	0.83012	2.62	0.80722	D	1	P;D	0.76494	0.933;0.999	P;D	0.73380	0.718;0.98	T	0.49293	-0.8955	10	0.87932	D	0	-16.1991	16.3044	0.82842	0.0:0.0:0.0:1.0	.	162;188	E9PDI2;P40123	.;CAP2_HUMAN	H	188;162	ENSP00000229922:Y188H;ENSP00000368275:Y162H	ENSP00000229922:Y188H	Y	+	1	0	CAP2	17622090	1.000000	0.71417	0.133000	0.22050	0.895000	0.52256	8.040000	0.89188	2.330000	0.79161	0.533000	0.62120	TAT	.		0.418	CAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039952.2		
CDR2L	30850	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	72998268	72998268	+	Missense_Mutation	SNP	C	C	T	rs529209429		TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr17:72998268C>T	ENST00000337231.5	+	4	863	c.451C>T	c.(451-453)Cgc>Tgc	p.R151C		NM_014603.2	NP_055418.2	Q86X02	CDR2L_HUMAN	cerebellar degeneration-related protein 2-like	151												all_lung(278;0.226)					GAAGCGGGAACGCAGGCGTAC	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		17825	0.0		0.001	False		,,,				2504	0.0				p.R151C		.											.	.	.	0			c.C451T						.						67.0	49.0	56.0					17																	72998268		2203	4299	6502	SO:0001583	missense	30850	exon4			CGGGAACGCAGGC		CCDS11710.2	17q25.1	2006-03-28			ENSG00000109089	ENSG00000109089			29999	protein-coding gene	gene with protein product	"""paraneoplastic antigen"""						Standard	NM_014603		Approved	HUMPPA	uc002jml.4	Q86X02	OTTHUMG00000150435	ENST00000337231.5:c.451C>T	17.37:g.72998268C>T	ENSP00000336587:p.Arg151Cys	39.0	0.0		80.0	18.0	NM_014603	B4DFA7|Q15175	Missense_Mutation	SNP	ENST00000337231.5	37	CCDS11710.2	.	.	.	.	.	.	.	.	.	.	C	23.7	4.448746	0.84101	.	.	ENSG00000109089	ENST00000337231	T	0.50813	0.73	5.22	4.2	0.49525	.	0.000000	0.85682	D	0.000000	T	0.67970	0.2950	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71938	-0.4441	10	0.72032	D	0.01	-24.4178	13.7862	0.63110	0.2953:0.7047:0.0:0.0	.	151	Q86X02	CDR2L_HUMAN	C	151	ENSP00000336587:R151C	ENSP00000336587:R151C	R	+	1	0	CDR2L	70509863	0.949000	0.32298	0.984000	0.44739	0.996000	0.88848	1.774000	0.38573	2.609000	0.88269	0.563000	0.77884	CGC	.		0.642	CDR2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318080.1	NM_014603	
CHRNB3	1142	ucsc.edu;bcgsc.ca	37	8	42587687	42587687	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr8:42587687A>G	ENST00000289957.2	+	5	1365	c.1237A>G	c.(1237-1239)Agc>Ggc	p.S413G		NM_000749.3	NP_000740.1	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta 3 (neuronal)	413					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|drug binding (GO:0008144)			endometrium(4)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)	ACATTTTATCAGCCAGGTGAG	0.348																																					p.S413G		.											.	CHRNB3	91	0			c.A1237G						.						25.0	28.0	27.0					8																	42587687		2202	4291	6493	SO:0001583	missense	1142	exon5			TTTATCAGCCAGG	U62438	CCDS6134.1	8p11.21	2012-02-11	2012-02-07		ENSG00000147432	ENSG00000147432		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 3 (neuronal)"""	118508	"""cholinergic receptor, nicotinic, beta polypeptide 3"""			1505988	Standard	NM_000749		Approved		uc003xpi.1	Q05901	OTTHUMG00000165262	ENST00000289957.2:c.1237A>G	8.37:g.42587687A>G	ENSP00000289957:p.Ser413Gly	82.0	0.0		59.0	5.0	NM_000749	Q15827	Missense_Mutation	SNP	ENST00000289957.2	37	CCDS6134.1	.	.	.	.	.	.	.	.	.	.	a	12.12	1.842448	0.32513	.	.	ENSG00000147432	ENST00000289957	D	0.85702	-2.02	5.85	3.37	0.38596	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.370221	0.35646	N	0.003074	T	0.78323	0.4265	L	0.31845	0.965	0.22226	N	0.999278	B	0.22080	0.064	B	0.27170	0.077	T	0.63857	-0.6542	10	0.32370	T	0.25	.	12.8217	0.57696	0.7425:0.2575:0.0:0.0	.	413	Q05901	ACHB3_HUMAN	G	413	ENSP00000289957:S413G	ENSP00000289957:S413G	S	+	1	0	CHRNB3	42706844	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	4.191000	0.58372	0.431000	0.26258	-0.320000	0.08662	AGC	.		0.348	CHRNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383055.1		
CLTCL1	8218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	19223332	19223332	+	Missense_Mutation	SNP	C	C	G	rs191439705	byFrequency	TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr22:19223332C>G	ENST00000263200.10	-	6	928	c.856G>C	c.(856-858)Gac>Cac	p.D286H	CLTCL1_ENST00000427926.1_Missense_Mutation_p.D286H|CLTCL1_ENST00000353891.5_Missense_Mutation_p.D286H	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	286	Globular terminal domain.|WD40-like repeat 6.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					GACTCTAGGTCGTACAGATGA	0.418			T	?	ALCL								C|||	3	0.000599042	0.0	0.0043	5008	,	,		22655	0.0		0.0	False		,,,				2504	0.0				p.D286H		.		Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	.	CLTCL1	230	0			c.G856C						.						143.0	141.0	142.0					22																	19223332		2047	4209	6256	SO:0001583	missense	8218	exon6			CTAGGTCGTACAG		CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.856G>C	22.37:g.19223332C>G	ENSP00000445677:p.Asp286His	164.0	0.0		131.0	32.0	NM_001835	B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	3	0.0013736263736263737	0	0.0	3	0.008287292817679558	0	0.0	0	0.0	C	16.39	3.109631	0.56398	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.28069	1.63;1.63;1.63	3.74	3.74	0.42951	Clathrin, heavy chain, propeller, N-terminal (1);Clathrin, heavy chain, linker/propeller domain (1);	0.000000	0.85682	D	0.000000	T	0.58524	0.2128	H	0.94808	3.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.76984	-0.2756	10	0.87932	D	0	-20.4174	15.7151	0.77661	0.0:1.0:0.0:0.0	.	286;286	P53675-2;P53675	.;CLH2_HUMAN	H	286	ENSP00000439662:D286H;ENSP00000445677:D286H;ENSP00000441158:D286H	ENSP00000445677:D286H	D	-	1	0	CLTCL1	17603332	1.000000	0.71417	0.991000	0.47740	0.273000	0.26683	6.901000	0.75693	1.909000	0.55274	0.591000	0.81541	GAC	C|0.999;G|0.001		0.418	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098	
CNTD1	124817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40961398	40961398	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr17:40961398C>A	ENST00000588408.1	+	7	1114	c.838C>A	c.(838-840)Cag>Aag	p.Q280K	CNTD1_ENST00000588527.1_Missense_Mutation_p.Q197K|CNTD1_ENST00000315066.5_3'UTR	NM_173478.2	NP_775749.2	Q8N815	CNTD1_HUMAN	cyclin N-terminal domain containing 1	280										central_nervous_system(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		GGGGCATTTGCAGAGCATCAC	0.438																																					p.Q280K		.											.	CNTD1	90	0			c.C838A						.						135.0	128.0	130.0					17																	40961398		2203	4300	6503	SO:0001583	missense	124817	exon7			CATTTGCAGAGCA	AK097456	CCDS11440.1	17q21.31	2014-07-03	2006-03-31	2006-03-31	ENSG00000176563	ENSG00000176563			26847	protein-coding gene	gene with protein product			"""cyclin N-terminal domain containing"""	CNTD		24891606	Standard	NM_173478		Approved	FLJ40137	uc002ibm.4	Q8N815		ENST00000588408.1:c.838C>A	17.37:g.40961398C>A	ENSP00000465204:p.Gln280Lys	207.0	0.0		220.0	42.0	NM_173478	Q658Q6|Q8NEP1	Missense_Mutation	SNP	ENST00000588408.1	37	CCDS11440.1	.	.	.	.	.	.	.	.	.	.	C	5.742	0.321308	0.10845	.	.	ENSG00000176563	ENST00000315066	.	.	.	6.03	6.03	0.97812	.	0.192857	0.56097	D	0.000034	T	0.37679	0.1012	L	0.36672	1.1	0.32552	N	0.532304	B	0.23937	0.094	B	0.19666	0.026	T	0.35525	-0.9785	9	0.02654	T	1	-7.9759	12.2136	0.54394	0.132:0.7405:0.1275:0.0	.	280	Q8N815	CNTD1_HUMAN	K	280	.	ENSP00000316647:Q280K	Q	+	1	0	CNTD1	38214924	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	2.324000	0.43831	2.868000	0.98415	0.555000	0.69702	CAG	.		0.438	CNTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452398.1	NM_173478	
COBLL1	22837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	165551580	165551580	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr2:165551580T>A	ENST00000392717.2	-	13	2554	c.2550A>T	c.(2548-2550)aaA>aaT	p.K850N	COBLL1_ENST00000375458.2_Missense_Mutation_p.K774N|COBLL1_ENST00000409184.3_Missense_Mutation_p.K812N|COBLL1_ENST00000194871.6_Missense_Mutation_p.K879N|COBLL1_ENST00000342193.4_Missense_Mutation_p.K812N			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	850						extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						TGGCAGTTTCTTTCACATTCT	0.423																																					p.K812N		.											.	COBLL1	93	0			c.A2436T						.						147.0	145.0	146.0					2																	165551580		2203	4300	6503	SO:0001583	missense	22837	exon12			AGTTTCTTTCACA	AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.2550A>T	2.37:g.165551580T>A	ENSP00000376478:p.Lys850Asn	396.0	0.0		325.0	60.0	NM_014900	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	ENST00000392717.2	37		.	.	.	.	.	.	.	.	.	.	T	16.71	3.199731	0.58126	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	6.04	1.36	0.22044	.	0.144833	0.48767	D	0.000166	T	0.48804	0.1520	L	0.46157	1.445	0.32112	N	0.589155	P;P;D	0.58268	0.893;0.948;0.982	P;P;P	0.58331	0.567;0.649;0.837	T	0.53620	-0.8413	9	0.32370	T	0.25	-10.6926	6.1571	0.20344	0.1249:0.1933:0.0:0.6817	.	850;879;812	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	N	774;812;812;850;879	.	ENSP00000194871:K879N	K	-	3	2	COBLL1	165259826	0.158000	0.22850	0.990000	0.47175	0.986000	0.74619	-0.280000	0.08468	0.140000	0.18849	0.460000	0.39030	AAA	.		0.423	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014900	
COG2	22796	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	230819335	230819335	+	Silent	SNP	G	G	C			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr1:230819335G>C	ENST00000366669.4	+	11	1297	c.1182G>C	c.(1180-1182)gcG>gcC	p.A394A	COG2_ENST00000535166.1_Silent_p.A278A|COG2_ENST00000546013.1_Silent_p.A83A|COG2_ENST00000534989.1_Silent_p.A335A|COG2_ENST00000366668.3_Silent_p.A394A	NM_001145036.1|NM_007357.2	NP_001138508.1|NP_031383.1	Q14746	COG2_HUMAN	component of oligomeric golgi complex 2	394					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|Golgi transport complex (GO:0017119)	protein transporter activity (GO:0008565)			NS(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|urinary_tract(3)	27	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				GAGAAATAGCGGGATCCTTAG	0.388																																					p.A394A		.											.	COG2	90	0			c.G1182C						.						146.0	143.0	144.0					1																	230819335		2203	4300	6503	SO:0001819	synonymous_variant	22796	exon11			AATAGCGGGATCC	Z34975	CCDS1584.1, CCDS44329.1	1q42.2	2008-02-05	2002-05-28	2002-05-31	ENSG00000135775	ENSG00000135775		"""Components of oligomeric golgi complex"""	6546	protein-coding gene	gene with protein product		606974	"""low density lipoprotein receptor defect C complementing"""	LDLC		7962052	Standard	NM_007357		Approved		uc001htw.3	Q14746	OTTHUMG00000037753	ENST00000366669.4:c.1182G>C	1.37:g.230819335G>C		160.0	0.0		155.0	12.0	NM_007357	Q86U99	Silent	SNP	ENST00000366669.4	37	CCDS1584.1																																																																																			.		0.388	COG2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092087.1	NM_007357	
COL21A1	81578	broad.mit.edu;bcgsc.ca	37	6	56035645	56035645	+	Silent	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr6:56035645A>G	ENST00000244728.5	-	5	1225	c.828T>C	c.(826-828)ggT>ggC	p.G276G	COL21A1_ENST00000370819.1_Silent_p.G276G|COL21A1_ENST00000535941.1_Silent_p.G276G	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	276	Laminin G-like.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			ATGGAGGAAGACCTTCTGGGA	0.353																																					p.G276G		.											.	COL21A1	24	0			c.T828C						.						74.0	64.0	67.0					6																	56035645		1821	4077	5898	SO:0001819	synonymous_variant	81578	exon5			AGGAAGACCTTCT	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.828T>C	6.37:g.56035645A>G		117.0	0.0		87.0	5.0	NM_030820	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Silent	SNP	ENST00000244728.5	37	CCDS55025.1																																																																																			.		0.353	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2		
CP	1356	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	148923993	148923993	+	Missense_Mutation	SNP	T	T	C	rs201036476		TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr3:148923993T>C	ENST00000264613.6	-	6	1432	c.1170A>G	c.(1168-1170)atA>atG	p.I390M		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	390	F5/8 type A 2.|Plastocyanin-like 3.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	TGAAGATGTCTATACCAGAGG	0.393																																					p.I390M		.											.	CP	515	0			c.A1170G						.						124.0	124.0	124.0					3																	148923993		2203	4300	6503	SO:0001583	missense	1356	exon6			GATGTCTATACCA	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.1170A>G	3.37:g.148923993T>C	ENSP00000264613:p.Ile390Met	267.0	0.0		253.0	62.0	NM_000096	Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	ENST00000264613.6	37	CCDS3141.1	.	.	.	.	.	.	.	.	.	.	T	2.831	-0.242725	0.05906	.	.	ENSG00000047457	ENST00000264613;ENST00000494544	D;D	0.98947	-5.26;-5.26	5.08	1.05	0.20165	Cupredoxin (2);	0.594800	0.17372	N	0.176645	D	0.94265	0.8158	L	0.31294	0.92	0.09310	N	0.999997	B;B;B;B	0.32245	0.2;0.2;0.2;0.361	B;B;B;B	0.28232	0.059;0.059;0.059;0.087	D	0.89158	0.3528	10	0.33940	T	0.23	-8.5659	2.7669	0.05322	0.1192:0.1462:0.1234:0.6113	.	390;390;390;390	A5PL27;A8K5A4;P00450;Q1L857	.;.;CERU_HUMAN;.	M	390;173	ENSP00000264613:I390M;ENSP00000420545:I173M	ENSP00000264613:I390M	I	-	3	3	CP	150406683	0.067000	0.21026	0.012000	0.15200	0.145000	0.21501	0.290000	0.18975	0.077000	0.16863	-0.316000	0.08728	ATA	T|0.999;C|0.001		0.393	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096	
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	3081364	3081364	+	Silent	SNP	G	G	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr8:3081364G>T	ENST00000520002.1	-	29	4929	c.4374C>A	c.(4372-4374)ggC>ggA	p.G1458G	CSMD1_ENST00000542608.1_Silent_p.G1457G|CSMD1_ENST00000539096.1_Silent_p.G1457G|CSMD1_ENST00000602557.1_Silent_p.G1458G|CSMD1_ENST00000602723.1_Silent_p.G1458G|CSMD1_ENST00000537824.1_Silent_p.G1457G|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000400186.3_Silent_p.G1458G			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1458	CUB 9. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CACCTGCTGGGCCCGTCAGAT	0.507																																					p.G1457G		.											.	CSMD1	86	0			c.C4371A						.						56.0	61.0	59.0					8																	3081364		1901	4123	6024	SO:0001819	synonymous_variant	64478	exon28			TGCTGGGCCCGTC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4374C>A	8.37:g.3081364G>T		188.0	0.0		169.0	18.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	G	10.22	1.288916	0.23478	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.08	-0.301	0.12800	.	.	.	.	.	T	0.44307	0.1287	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24297	-1.0164	4	.	.	.	.	4.2458	0.10670	0.1348:0.2292:0.5181:0.1179	.	.	.	.	T	938	.	.	P	-	1	0	CSMD1	3068771	1.000000	0.71417	0.821000	0.32701	0.974000	0.67602	1.471000	0.35365	-0.041000	0.13558	0.650000	0.86243	CCC	.		0.507	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CSNK1E	1454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	38696748	38696748	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr22:38696748G>C	ENST00000396832.1	-	5	806	c.546C>G	c.(544-546)atC>atG	p.I182M	CSNK1E_ENST00000359867.3_Missense_Mutation_p.I182M|CSNK1E_ENST00000405675.3_Missense_Mutation_p.I182M|CSNK1E_ENST00000413574.2_Missense_Mutation_p.I182M|CSNK1E_ENST00000498529.1_5'Flank|CSNK1E_ENST00000403904.1_Missense_Mutation_p.I182M|CSNK1E_ENST00000400206.2_Missense_Mutation_p.I182M	NM_152221.2	NP_689407.1	P49674	KC1E_HUMAN	casein kinase 1, epsilon	182	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					GGTGCGTGTTGATGGAAGCGT	0.662																																					p.I182M	Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)	.											.	CSNK1E	1193	0			c.C546G						.						88.0	78.0	81.0					22																	38696748		2203	4300	6503	SO:0001583	missense	1454	exon5			CGTGTTGATGGAA		CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000396832.1:c.546C>G	22.37:g.38696748G>C	ENSP00000380044:p.Ile182Met	353.0	0.0		289.0	77.0	NM_001894		Missense_Mutation	SNP	ENST00000396832.1	37	CCDS13970.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.364562|5.364562	0.95877|0.95877	.|.	.|.	ENSG00000213923|ENSG00000213923	ENST00000359867;ENST00000396832;ENST00000402865;ENST00000400206;ENST00000403904;ENST00000413574;ENST00000405675;ENST00000430335|ENST00000451964	T;T;T;T;T;T;T|.	0.65178|.	-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14|.	4.92|4.92	3.91|3.91	0.45181|0.45181	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.095385|.	0.64402|.	D|.	0.000001|.	T|.	0.74268|.	0.3694|.	M|M	0.88310|0.88310	2.945|2.945	0.80722|0.80722	D|D	1|1	D;P;D|.	0.63880|.	0.992;0.873;0.993|.	D;D;D|.	0.77557|.	0.984;0.966;0.99|.	T|.	0.75758|.	-0.3205|.	10|.	0.45353|.	T|.	0.12|.	.|.	5.7528|5.7528	0.18156|0.18156	0.1617:0.0:0.6809:0.1574|0.1617:0.0:0.6809:0.1574	.|.	182;182;182|.	B0QY35;B0QY34;P49674|.	.;.;KC1E_HUMAN|.	M|X	182|120	ENSP00000352929:I182M;ENSP00000380044:I182M;ENSP00000383067:I182M;ENSP00000384074:I182M;ENSP00000407235:I182M;ENSP00000384426:I182M;ENSP00000412335:I182M|.	ENSP00000352929:I182M|.	I|S	-|-	3|2	3|0	CSNK1E|CSNK1E	37026694|37026694	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.933000|0.933000	0.57130|0.57130	2.454000|2.454000	0.44979|0.44979	1.449000|1.449000	0.47699|0.47699	0.561000|0.561000	0.74099|0.74099	ATC|TCA	.		0.662	CSNK1E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321462.1	NM_001894	
CYP11B2	1585	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	143993483	143993483	+	Silent	SNP	T	T	C			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr8:143993483T>C	ENST00000323110.2	-	9	1427	c.1425A>G	c.(1423-1425)acA>acG	p.T475T		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	475					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	CTTGAGTTAGTGTCTCCACCA	0.542									Familial Hyperaldosteronism type I																												p.T475T		.											.	CYP11B2	90	0			c.A1425G						.						183.0	150.0	161.0					8																	143993483		2203	4300	6503	SO:0001819	synonymous_variant	1585	exon9	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	AGTTAGTGTCTCC	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1425A>G	8.37:g.143993483T>C		215.0	1.0		262.0	95.0	NM_000498	B0ZBE4|Q16726	Silent	SNP	ENST00000323110.2	37	CCDS6393.1																																																																																			.		0.542	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1		
DACH1	1602	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	72204825	72204825	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr13:72204825G>T	ENST00000359684.2	-	3	994	c.995C>A	c.(994-996)gCt>gAt	p.A332D	DACH1_ENST00000313174.7_Missense_Mutation_p.A332D|DACH1_ENST00000305425.4_Missense_Mutation_p.A332D|DACH1_ENST00000354591.4_Intron			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	332	Interaction with SIX6 and HDAC3. {ECO:0000250}.|Poly-Ala.				cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		agcagcagcagctgctgcagc	0.373																																					p.A332D		.											.	DACH1	135	0			c.C995A						.						99.0	89.0	92.0					13																	72204825		1802	4069	5871	SO:0001583	missense	1602	exon3			GCAGCAGCTGCTG	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.995C>A	13.37:g.72204825G>T	ENSP00000352712:p.Ala332Asp	100.0	0.0		118.0	39.0	NM_080759	D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	ENST00000359684.2	37		.	.	.	.	.	.	.	.	.	.	G	32	5.168386	0.94768	.	.	ENSG00000165659	ENST00000305425;ENST00000313174;ENST00000359684;ENST00000377826	T;T;T	0.36520	1.25;1.35;1.29	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.57489	0.2057	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.53802	-0.8387	10	0.72032	D	0.01	-10.5268	20.4702	0.99162	0.0:0.0:1.0:0.0	.	330;330	Q9UI36-3;Q9UI36-2	.;.	D	332	ENSP00000304994:A332D;ENSP00000318506:A332D;ENSP00000352712:A332D	ENSP00000304994:A332D	A	-	2	0	DACH1	71102826	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.357000	0.97099	2.937000	0.99478	0.650000	0.86243	GCT	.		0.373	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	NM_004392	
DCHS2	54798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	155226013	155226013	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr4:155226013C>A	ENST00000357232.4	-	17	4047	c.4048G>T	c.(4048-4050)Gga>Tga	p.G1350*		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1350	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GAAGGGAATCCCCCATCTCGT	0.418																																					p.G1350X		.											.	DCHS2	94	0			c.G4048T						.						57.0	54.0	55.0					4																	155226013		2203	4300	6503	SO:0001587	stop_gained	54798	exon17			GGAATCCCCCATC	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.4048G>T	4.37:g.155226013C>A	ENSP00000349768:p.Gly1350*	409.0	0.0		314.0	47.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Nonsense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	43	9.986833	0.99312	.	.	ENSG00000197410	ENST00000357232	.	.	.	5.88	5.88	0.94601	.	0.084158	0.49305	D	0.000146	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.2441	0.98394	0.0:1.0:0.0:0.0	.	.	.	.	X	1350	.	ENSP00000349768:G1350X	G	-	1	0	DCHS2	155445463	0.996000	0.38824	0.375000	0.26029	0.049000	0.14656	3.986000	0.56937	2.774000	0.95407	0.655000	0.94253	GGA	.		0.418	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
DDX31	64794	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	135537950	135537950	+	Missense_Mutation	SNP	C	C	T	rs367667543		TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr9:135537950C>T	ENST00000372159.3	-	2	674	c.523G>A	c.(523-525)Gca>Aca	p.A175T	DDX31_ENST00000372153.1_Missense_Mutation_p.A175T|DDX31_ENST00000480876.1_5'UTR|DDX31_ENST00000310532.2_Missense_Mutation_p.A175T|DDX31_ENST00000544003.1_Missense_Mutation_p.A79T|DDX31_ENST00000438527.3_Missense_Mutation_p.A46T	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	175						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		ATTTTTTGTGCGTTCCCCTTA	0.428																																					p.A175T		.											.	DDX31	226	0			c.G523A						.	C	THR/ALA,THR/ALA	0,4406		0,0,2203	174.0	171.0	172.0		523,523	-7.7	0.0	9		172	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	DDX31	NM_138620.1,NM_022779.7	58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	175/586,175/852	135537950	1,13005	2203	4300	6503	SO:0001583	missense	64794	exon2			TTTGTGCGTTCCC	AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.523G>A	9.37:g.135537950C>T	ENSP00000361232:p.Ala175Thr	319.0	0.0		271.0	22.0	NM_022779	Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Missense_Mutation	SNP	ENST00000372159.3	37	CCDS6951.1	.	.	.	.	.	.	.	.	.	.	c	3.149	-0.174630	0.06421	0.0	1.16E-4	ENSG00000125485	ENST00000372159;ENST00000372155;ENST00000372153;ENST00000438527;ENST00000310532;ENST00000544003	T;T;T;T;T	0.47869	4.37;3.92;4.34;3.5;0.83	5.6	-7.73	0.01245	.	1.174590	0.05861	N	0.622977	T	0.15998	0.0385	N	0.08118	0	0.09310	N	1	B;B;B	0.23891	0.093;0.003;0.002	B;B;B	0.14578	0.011;0.003;0.0	T	0.18871	-1.0323	10	0.09843	T	0.71	0.329	0.3822	0.00396	0.2246:0.2316:0.2547:0.2891	.	175;175;175	Q9H8H2-2;Q9H8H2-3;Q9H8H2	.;.;DDX31_HUMAN	T	175;175;175;46;175;79	ENSP00000361232:A175T;ENSP00000361226:A175T;ENSP00000387730:A46T;ENSP00000310539:A175T;ENSP00000442425:A79T	ENSP00000310539:A175T	A	-	1	0	DDX31	134527771	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.965000	0.03829	-0.997000	0.03450	-0.285000	0.09966	GCA	.		0.428	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054794.1	NM_138620	
DENND5B	160518	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	31605091	31605092	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr12:31605091_31605092insT	ENST00000389082.5	-	5	1675_1676	c.1411_1412insA	c.(1411-1413)atgfs	p.M471fs	DENND5B_ENST00000354285.4_Frame_Shift_Ins_p.M493fs|snoU13_ENST00000458765.1_RNA|DENND5B_ENST00000306833.6_Frame_Shift_Ins_p.M506fs|DENND5B_ENST00000536562.1_Frame_Shift_Ins_p.M506fs	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	471					positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						AGAGAGGTCCATTTTTTCCACA	0.47																																					p.M471fs		.											.	DENND5B	24	0			c.1412_1413insA						.																																			SO:0001589	frameshift_variant	160518	exon5			AGGTCCATTTTTT	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.1412dupA	12.37:g.31605097_31605097dupT	ENSP00000373734:p.Met471fs	227.0	0.0		269.0	42.0	NM_144973	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Frame_Shift_Ins	INS	ENST00000389082.5	37	CCDS44857.1																																																																																			.		0.470	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	38781906	38781906	+	Splice_Site	SNP	G	G	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr6:38781906G>T	ENST00000359357.3	+	23	2936		c.e23+1		DNAH8_ENST00000449981.2_Splice_Site|DNAH8_ENST00000441566.1_Splice_Site			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TCCTAATGTGGTAAGTATTAT	0.323																																					.		.											.	DNAH8	615	0			c.3333+1G>T						.						93.0	103.0	100.0					6																	38781906		2203	4299	6502	SO:0001630	splice_region_variant	1769	exon25			AATGTGGTAAGTA	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.2682+1G>T	6.37:g.38781906G>T		147.0	0.0		146.0	21.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Splice_Site	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	G	21.0	4.079767	0.76528	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.803	0.85618	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAH8	38889884	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.832000	0.69337	2.503000	0.84419	0.655000	0.94253	.	.		0.323	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	Intron
DNAI1	27019	broad.mit.edu;bcgsc.ca	37	9	34506717	34506717	+	Missense_Mutation	SNP	G	G	A	rs565923150		TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr9:34506717G>A	ENST00000242317.4	+	13	1327	c.1156G>A	c.(1156-1158)Gtc>Atc	p.V386I		NM_001281428.1|NM_012144.2	NP_001268357.1|NP_036276.1	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	386					cell projection organization (GO:0030030)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	motor activity (GO:0003774)			autonomic_ganglia(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|prostate(1)|skin(2)|urinary_tract(1)	34	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		CAACAGCGGCGTCATGTGTCT	0.572									Kartagener syndrome				G|||	1	0.000199681	0.0	0.0014	5008	,	,		20477	0.0		0.0	False		,,,				2504	0.0				p.V386I		.											.	DNAI1	90	0			c.G1156A						.						94.0	81.0	86.0					9																	34506717		2203	4300	6503	SO:0001583	missense	27019	exon13	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AGCGGCGTCATGT	AF091619	CCDS6557.1, CCDS75829.1	9p13.3	2013-02-19	2006-09-04		ENSG00000122735	ENSG00000122735		"""Axonemal dyneins"", ""WD repeat domain containing"""	2954	protein-coding gene	gene with protein product		604366	"""dynein, axonemal, intermediate polypeptide 1"""			10577904, 21953912	Standard	NM_012144		Approved	DIC1, PCD, CILD1	uc003zum.3	Q9UI46	OTTHUMG00000019825	ENST00000242317.4:c.1156G>A	9.37:g.34506717G>A	ENSP00000242317:p.Val386Ile	160.0	1.0		188.0	8.0	NM_012144	B7Z7U1|Q5T8G7|Q8NHQ7|Q9UEZ8	Missense_Mutation	SNP	ENST00000242317.4	37	CCDS6557.1	.	.	.	.	.	.	.	.	.	.	G	8.846	0.943490	0.18281	.	.	ENSG00000122735	ENST00000242317	T	0.71817	-0.6	5.3	4.16	0.48862	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.185901	0.46758	N	0.000268	T	0.60483	0.2272	L	0.45470	1.425	0.80722	D	1	B	0.10296	0.003	B	0.14578	0.011	T	0.53634	-0.8411	10	0.33141	T	0.24	.	8.2068	0.31461	0.8368:0.0:0.1632:0.0	.	386	Q9UI46	DNAI1_HUMAN	I	386	ENSP00000242317:V386I	ENSP00000242317:V386I	V	+	1	0	DNAI1	34496717	0.998000	0.40836	1.000000	0.80357	0.274000	0.26718	1.726000	0.38085	0.843000	0.35070	-0.414000	0.06135	GTC	.		0.572	DNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052192.1		
DOCK2	1794	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	169483728	169483728	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr5:169483728C>T	ENST00000256935.8	+	43	4416	c.4336C>T	c.(4336-4338)Cgg>Tgg	p.R1446W	DOCK2_ENST00000520908.1_Missense_Mutation_p.R938W|DOCK2_ENST00000540750.1_Missense_Mutation_p.R507W|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1446	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCACTACTCCCGGCCCGTGCG	0.572																																					p.R1446W		.											DOCK2,NS,carcinoma,-1	DOCK2	97	0			c.C4336T						.						104.0	89.0	94.0					5																	169483728		2203	4300	6503	SO:0001583	missense	1794	exon43			TACTCCCGGCCCG	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4336C>T	5.37:g.169483728C>T	ENSP00000256935:p.Arg1446Trp	175.0	1.0		215.0	16.0	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.117974	0.77323	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.19250	2.16;2.16;2.16	5.27	3.22	0.36961	.	0.070853	0.64402	D	0.000015	T	0.25606	0.0623	M	0.85373	2.75	0.48395	D	0.999643	P;P	0.40534	0.72;0.59	B;B	0.31946	0.138;0.055	T	0.30387	-0.9980	10	0.87932	D	0	.	11.618	0.51099	0.6362:0.3638:0.0:0.0	.	938;1446	E7ERW7;Q92608	.;DOCK2_HUMAN	W	1446;938;507	ENSP00000256935:R1446W;ENSP00000429283:R938W;ENSP00000438827:R507W	ENSP00000256935:R1446W	R	+	1	2	DOCK2	169416306	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.457000	0.35212	1.146000	0.42352	0.650000	0.86243	CGG	.		0.572	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
DPP6	1804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	154263941	154263941	+	Silent	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr7:154263941C>T	ENST00000377770.3	+	5	708	c.567C>T	c.(565-567)gcC>gcT	p.A189A	DPP6_ENST00000332007.3_Silent_p.A127A|DPP6_ENST00000404039.1_Silent_p.A125A|DPP6_ENST00000427557.1_Silent_p.A127A|DPP6_ENST00000406326.1_Silent_p.A189A|DPP6_ENST00000496611.1_3'UTR			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	189					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CATTAAGAGCCATCAGATATG	0.308																																					p.A189A	NSCLC(125;1384 1783 2490 7422 34254)	.											.	DPP6	652	0			c.C567T						.						67.0	68.0	68.0					7																	154263941		1794	4055	5849	SO:0001819	synonymous_variant	1804	exon5			AAGAGCCATCAGA	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.567C>T	7.37:g.154263941C>T		185.0	0.0		127.0	15.0	NM_130797		Silent	SNP	ENST00000377770.3	37																																																																																				.		0.308	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
EIF4G1	1981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	184045645	184045645	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr3:184045645G>A	ENST00000346169.2	+	26	4079	c.3808G>A	c.(3808-3810)Gcc>Acc	p.A1270T	EIF4G1_ENST00000435046.2_Missense_Mutation_p.A1074T|EIF4G1_ENST00000350481.5_Missense_Mutation_p.A1106T|EIF4G1_ENST00000342981.4_Missense_Mutation_p.A1271T|EIF4G1_ENST00000411531.1_Missense_Mutation_p.A1231T|EIF4G1_ENST00000414031.1_Missense_Mutation_p.A1230T|EIF4G1_ENST00000427845.1_Missense_Mutation_p.A1184T|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000441154.1_Missense_Mutation_p.A1107T|EIF4G1_ENST00000352767.3_Missense_Mutation_p.A1277T|EIF4G1_ENST00000319274.6_Missense_Mutation_p.A1270T|EIF4G1_ENST00000382330.3_Missense_Mutation_p.A1277T|SNORD66_ENST00000390856.1_RNA|EIF4G1_ENST00000424196.1_Missense_Mutation_p.A1277T|EIF4G1_ENST00000392537.2_Missense_Mutation_p.A1183T|EIF4G1_ENST00000434061.2_Missense_Mutation_p.A1075T	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	1270	MI. {ECO:0000255|PROSITE- ProRule:PRU00698}.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCAGGAGCTGGCCTCACCCTC	0.617																																					p.A1277T		.											.	EIF4G1	344	0			c.G3829A						.						88.0	74.0	79.0					3																	184045645		2203	4300	6503	SO:0001583	missense	1981	exon27			GAGCTGGCCTCAC	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.3808G>A	3.37:g.184045645G>A	ENSP00000316879:p.Ala1270Thr	106.0	0.0		109.0	33.0	NM_001194946	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	ENST00000346169.2	37	CCDS3259.1	.	.	.	.	.	.	.	.	.	.	G	19.92	3.916641	0.73098	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000382330;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000441154;ENST00000434061;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55	6.17	4.37	0.52481	Initiation factor eIF-4 gamma, MA3 (3);Armadillo-type fold (1);	0.221143	0.47852	D	0.000219	T	0.24392	0.0591	L	0.40543	1.245	0.30116	N	0.806153	P;P;P	0.40931	0.733;0.733;0.733	B;B;B	0.43052	0.406;0.406;0.406	T	0.09357	-1.0678	10	0.16420	T	0.52	-5.3456	6.6418	0.22913	0.1259:0.0:0.6099:0.2642	.	1277;1271;1270	E9PFM1;D3DNT2;Q04637	.;.;IF4G1_HUMAN	T	1270;1230;1183;1277;1106;1277;1184;1271;1270;1277;1231;1107;1075;1074	ENSP00000316879:A1270T;ENSP00000391935:A1230T;ENSP00000376320:A1183T;ENSP00000371767:A1277T;ENSP00000317600:A1106T;ENSP00000338020:A1277T;ENSP00000407682:A1184T;ENSP00000343450:A1271T;ENSP00000323737:A1270T;ENSP00000416255:A1277T;ENSP00000395974:A1231T;ENSP00000399858:A1107T;ENSP00000411826:A1075T;ENSP00000404754:A1074T	ENSP00000323737:A1270T	A	+	1	0	EIF4G1	185528339	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	3.505000	0.53356	0.923000	0.37045	-0.169000	0.13324	GCC	.		0.617	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917	
ENPP6	133121	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	185038169	185038169	+	Missense_Mutation	SNP	C	C	T	rs139781867	byFrequency	TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr4:185038169C>T	ENST00000296741.2	-	5	836	c.695G>A	c.(694-696)cGc>cAc	p.R232H		NM_153343.3	NP_699174.1	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 6	232					choline metabolic process (GO:0019695)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glycerophosphocholine cholinephosphodiesterase activity (GO:0047390)|glycerophosphodiester phosphodiesterase activity (GO:0008889)|phosphoric diester hydrolase activity (GO:0008081)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	15		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		GACGTTCAGGCGGTCCTGCAG	0.493													C|||	2	0.000399361	0.0015	0.0	5008	,	,		20426	0.0		0.0	False		,,,				2504	0.0				p.R232H		.											.	ENPP6	90	0			c.G695A						.	C	HIS/ARG	4,4402	8.1+/-20.4	0,4,2199	78.0	69.0	72.0		695	0.0	0.1	4	dbSNP_134	72	0,8600		0,0,4300	yes	missense	ENPP6	NM_153343.3	29	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	benign	232/441	185038169	4,13002	2203	4300	6503	SO:0001583	missense	133121	exon5			TTCAGGCGGTCCT	AK057370	CCDS3834.1	4q35.1	2008-02-05			ENSG00000164303	ENSG00000164303			23409	protein-coding gene	gene with protein product							Standard	NM_153343		Approved	MGC33971	uc003iwc.3	Q6UWR7	OTTHUMG00000160617	ENST00000296741.2:c.695G>A	4.37:g.185038169C>T	ENSP00000296741:p.Arg232His	130.0	0.0		168.0	31.0	NM_153343	Q4W5Q1|Q96M57	Missense_Mutation	SNP	ENST00000296741.2	37	CCDS3834.1	.	.	.	.	.	.	.	.	.	.	C	7.046	0.563459	0.13498	9.08E-4	0.0	ENSG00000164303	ENST00000296741;ENST00000512353	T;T	0.74947	-0.89;-0.89	5.88	0.00445	0.14058	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.952406	0.08898	N	0.877718	T	0.53351	0.1791	N	0.16368	0.405	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39860	-0.9593	10	0.45353	T	0.12	-3.5889	2.8771	0.05635	0.1169:0.1325:0.1219:0.6287	.	232	Q6UWR7	ENPP6_HUMAN	H	232;144	ENSP00000296741:R232H;ENSP00000423497:R144H	ENSP00000296741:R232H	R	-	2	0	ENPP6	185275163	0.508000	0.26154	0.078000	0.20375	0.090000	0.18270	2.107000	0.41844	0.114000	0.18032	-0.290000	0.09829	CGC	C|0.999;T|0.001		0.493	ENPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361428.1	NM_153343	
EPC1	80314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	32582635	32582635	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr10:32582635T>C	ENST00000263062.8	-	3	613	c.344A>G	c.(343-345)tAt>tGt	p.Y115C	EPC1_ENST00000375110.2_Missense_Mutation_p.Y65C|EPC1_ENST00000319778.6_Missense_Mutation_p.Y115C	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	115					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				ATCCAAATCATAATCAGGCTG	0.378																																					p.Y115C		.											.	EPC1	93	0			c.A344G						.						55.0	50.0	52.0					10																	32582635		2203	4300	6503	SO:0001583	missense	80314	exon3			AAATCATAATCAG	AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.344A>G	10.37:g.32582635T>C	ENSP00000263062:p.Tyr115Cys	210.0	0.0		260.0	37.0	NM_001272004	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	ENST00000263062.8	37	CCDS7172.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.397618	0.83120	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	D;D;D	0.82255	-1.59;-1.59;-1.59	5.67	5.67	0.87782	Enhancer of polycomb-like, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92655	0.7666	M	0.89601	3.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.997;1.0;1.0	D	0.94069	0.7333	10	0.87932	D	0	-10.2067	15.9001	0.79365	0.0:0.0:0.0:1.0	.	115;65;115;115	B8XCX7;Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;.;EPC1_HUMAN	C	65;115;115	ENSP00000364251:Y65C;ENSP00000318559:Y115C;ENSP00000263062:Y115C	ENSP00000263062:Y115C	Y	-	2	0	EPC1	32622641	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.040000	0.89188	2.162000	0.67917	0.383000	0.25322	TAT	.		0.378	EPC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047484.1		
EPHA5	2044	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	66361224	66361224	+	Silent	SNP	G	G	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr4:66361224G>A	ENST00000273854.3	-	4	1548	c.948C>T	c.(946-948)atC>atT	p.I316I	EPHA5_ENST00000511294.1_Silent_p.I316I|EPHA5_ENST00000432638.2_Intron|EPHA5_ENST00000354839.4_Silent_p.I316I	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	316	Cys-rich.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						CGCAGCTCTGGATGTGAGGTG	0.448										TSP Lung(17;0.13)																											p.I316I		.											.	EPHA5	1430	0			c.C948T						.						130.0	131.0	131.0					4																	66361224		2203	4300	6503	SO:0001819	synonymous_variant	2044	exon4			GCTCTGGATGTGA	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.948C>T	4.37:g.66361224G>A		216.0	0.0		209.0	37.0	NM_004439	Q7Z3F2	Silent	SNP	ENST00000273854.3	37	CCDS3513.1																																																																																			.		0.448	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
EPHA7	2045	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	94124469	94124469	+	Silent	SNP	A	A	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr6:94124469A>T	ENST00000369303.4	-	2	298	c.114T>A	c.(112-114)tcT>tcA	p.S38S	EPHA7_ENST00000369297.1_Silent_p.S38S	NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	38	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		GTTGTGCTTTAGAATCCAGCA	0.323																																					p.S38S		.											.	EPHA7	1453	0			c.T114A						.						93.0	90.0	91.0					6																	94124469		2203	4298	6501	SO:0001819	synonymous_variant	2045	exon2			TGCTTTAGAATCC	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.114T>A	6.37:g.94124469A>T		97.0	0.0		71.0	10.0	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Silent	SNP	ENST00000369303.4	37	CCDS5031.1																																																																																			.		0.323	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
FAM111B	374393	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	58893210	58893210	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr11:58893210T>G	ENST00000343597.3	+	4	1831	c.1640T>G	c.(1639-1641)aTt>aGt	p.I547S	FAM111B_ENST00000411426.1_Missense_Mutation_p.I517S|FAM111B_ENST00000529618.1_Missense_Mutation_p.I517S	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	547							catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						GATTATGCCATTTTAAAACTA	0.378																																					p.I547S		.											.	FAM111B	92	0			c.T1640G						.						92.0	90.0	90.0					11																	58893210		2201	4295	6496	SO:0001583	missense	374393	exon4			ATGCCATTTTAAA	BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.1640T>G	11.37:g.58893210T>G	ENSP00000341565:p.Ile547Ser	90.0	0.0		69.0	14.0	NM_198947	B4E2G2|Q6P661	Missense_Mutation	SNP	ENST00000343597.3	37	CCDS7972.1	.	.	.	.	.	.	.	.	.	.	T	16.36	3.102341	0.56183	.	.	ENSG00000189057	ENST00000411426;ENST00000529618;ENST00000343597	D;D;D	0.90069	-2.61;-2.61;-2.61	4.63	4.63	0.57726	Peptidase cysteine/serine, trypsin-like (1);	0.233245	0.28940	N	0.013644	D	0.93207	0.7836	M	0.77313	2.365	0.27418	N	0.954369	D	0.63046	0.992	D	0.65987	0.94	D	0.87986	0.2746	10	0.87932	D	0	.	11.667	0.51379	0.0:0.0:0.0:1.0	.	547	Q6SJ93	F111B_HUMAN	S	517;517;547	ENSP00000393855:I517S;ENSP00000432875:I517S;ENSP00000341565:I547S	ENSP00000341565:I547S	I	+	2	0	FAM111B	58649786	0.281000	0.24258	0.851000	0.33527	0.453000	0.32348	5.032000	0.64140	1.958000	0.56883	0.533000	0.62120	ATT	.		0.378	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393974.1	NM_198947	
FAT3	120114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	92085831	92085831	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr11:92085831G>T	ENST00000298047.6	+	1	570	c.553G>T	c.(553-555)Gca>Tca	p.A185S	FAT3_ENST00000525166.1_Missense_Mutation_p.A35S|FAT3_ENST00000541502.1_Missense_Mutation_p.A185S|FAT3_ENST00000409404.2_Missense_Mutation_p.A185S			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	185	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A185T(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGCAACAGACGCAGATATTGG	0.428										TCGA Ovarian(4;0.039)																											p.A185S		.											.	FAT3	73	2	Substitution - Missense(2)	endometrium(2)	c.G553T						.						60.0	60.0	60.0					11																	92085831		1866	4110	5976	SO:0001583	missense	120114	exon1			ACAGACGCAGATA	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.553G>T	11.37:g.92085831G>T	ENSP00000298047:p.Ala185Ser	108.0	0.0		86.0	14.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	G	21.6	4.180161	0.78564	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.61859	0.07;0.07;0.07;0.07	5.26	5.26	0.73747	.	.	.	.	.	T	0.74696	0.3750	M	0.67397	2.05	0.54753	D	0.999981	D	0.89917	1.0	D	0.91635	0.999	T	0.73084	-0.4094	9	0.39692	T	0.17	.	18.2264	0.89918	0.0:0.0:1.0:0.0	.	185	Q8TDW7-3	.	S	185;185;185;35	ENSP00000298047:A185S;ENSP00000387040:A185S;ENSP00000443786:A185S;ENSP00000432586:A35S	ENSP00000298047:A185S	A	+	1	0	FAT3	91725479	1.000000	0.71417	0.998000	0.56505	0.797000	0.45037	9.787000	0.99055	2.607000	0.88179	0.655000	0.94253	GCA	.		0.428	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FGF11	2256	broad.mit.edu;mdanderson.org	37	17	7343007	7343007	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr17:7343007C>T	ENST00000293829.4	+	1	662	c.68C>T	c.(67-69)cCg>cTg	p.P23L	FGF11_ENST00000575082.1_5'Flank|RP11-104H15.7_ENST00000575310.1_RNA|FGF11_ENST00000575235.1_Intron|RP11-104H15.9_ENST00000570444.1_RNA|RP11-104H15.8_ENST00000576615.1_RNA|FGF11_ENST00000575398.1_5'Flank|FGF11_ENST00000572907.1_5'Flank|RP11-104H15.10_ENST00000575331.1_RNA	NM_004112.2	NP_004103.1	Q92914	FGF11_HUMAN	fibroblast growth factor 11	23					cell-cell signaling (GO:0007267)|nervous system development (GO:0007399)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	growth factor activity (GO:0008083)			central_nervous_system(1)|large_intestine(3)|ovary(1)|prostate(1)	6		Prostate(122;0.157)				GGCAGCCGGCCGGTGTCGGCG	0.726																																					p.P23L		.											.	FGF11	522	0			c.C68T						.						5.0	7.0	6.0					17																	7343007		2093	4079	6172	SO:0001583	missense	2256	exon1			GCCGGCCGGTGTC		CCDS11105.1	17p13.1	2008-07-18			ENSG00000161958	ENSG00000161958			3667	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 3"""	601514				8790420	Standard	NM_004112		Approved	FHF3, FLJ16061, MGC45269, MGC102953	uc002ggz.3	Q92914	OTTHUMG00000108136	ENST00000293829.4:c.68C>T	17.37:g.7343007C>T	ENSP00000293829:p.Pro23Leu	12.0	0.0		34.0	5.0	NM_004112	Q2YDX8	Missense_Mutation	SNP	ENST00000293829.4	37	CCDS11105.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.704061	0.48412	.	.	ENSG00000161958	ENST00000293829	T	0.74737	-0.87	5.01	5.01	0.66863	.	0.070971	0.64402	D	0.000018	T	0.66107	0.2756	L	0.53249	1.67	0.80722	D	1	P	0.34462	0.454	B	0.23716	0.048	T	0.66460	-0.5918	10	0.33940	T	0.23	.	13.8005	0.63196	0.0:1.0:0.0:0.0	.	23	Q92914	FGF11_HUMAN	L	23	ENSP00000293829:P23L	ENSP00000293829:P23L	P	+	2	0	FGF11	7283731	0.971000	0.33674	0.988000	0.46212	0.970000	0.65996	2.367000	0.44213	2.315000	0.78130	0.478000	0.44815	CCG	.		0.726	FGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226939.3	NM_004112	
FLRT3	23767	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	14307370	14307370	+	Silent	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr20:14307370C>T	ENST00000378053.3	-	2	1039	c.783G>A	c.(781-783)cgG>cgA	p.R261R	FLRT3_ENST00000462077.1_5'Flank|FLRT3_ENST00000341420.4_Silent_p.R261R|MACROD2_ENST00000217246.4_Intron|MACROD2_ENST00000310348.4_Intron	NM_013281.3	NP_037413.1	Q9NZU0	FLRT3_HUMAN	fibronectin leucine rich transmembrane protein 3	261					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Colorectal(1;0.0464)	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)		TTGGGGGCACCCGATTGATGT	0.448																																					p.R261R		.											.	FLRT3	91	0			c.G783A						.						47.0	48.0	48.0					20																	14307370		2203	4300	6503	SO:0001819	synonymous_variant	23767	exon2			GGGCACCCGATTG	AF169677	CCDS13121.1	20p11	2013-02-11			ENSG00000125848	ENSG00000125848		"""Fibronectin type III domain containing"""	3762	protein-coding gene	gene with protein product		604808				10644439	Standard	NM_198391		Approved		uc002wow.2	Q9NZU0	OTTHUMG00000031914	ENST00000378053.3:c.783G>A	20.37:g.14307370C>T		154.0	1.0		131.0	30.0	NM_013281	D3DW20|Q542Z9|Q96K39|Q96K42|Q96KB1|Q9P259	Silent	SNP	ENST00000378053.3	37	CCDS13121.1																																																																																			.		0.448	FLRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078075.1	NM_013281	
FLT1	2321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	28883065	28883065	+	Splice_Site	SNP	C	C	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr13:28883065C>G	ENST00000282397.4	-	28	3887		c.e28-1		FLT1_ENST00000543394.1_Splice_Site|FLT1_ENST00000540678.1_Splice_Site	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1						blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ATTTACGTATCTAATGAAGAA	0.403																																					.		.											.	FLT1	1406	0			c.3636-1G>C						.						79.0	67.0	71.0					13																	28883065		2203	4300	6503	SO:0001630	splice_region_variant	2321	exon29			ACGTATCTAATGA	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.3636-1G>C	13.37:g.28883065C>G		71.0	0.0		67.0	8.0	NM_002019	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Splice_Site	SNP	ENST00000282397.4	37	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703649	0.48412	.	.	ENSG00000102755	ENST00000282397;ENST00000543394;ENST00000540678	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8181	0.78621	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FLT1	27781065	1.000000	0.71417	0.996000	0.52242	0.583000	0.36354	4.400000	0.59709	2.551000	0.86045	0.561000	0.74099	.	.		0.403	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		Intron
FNBP4	23360	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	47744730	47744730	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr11:47744730G>T	ENST00000263773.5	-	15	2615	c.2603C>A	c.(2602-2604)gCa>gAa	p.A868E		NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	868						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						AATTGCAGGTGCTGCCGCTAG	0.522																																					p.A868E		.											.	FNBP4	91	0			c.C2603A						.						133.0	131.0	131.0					11																	47744730		2024	4176	6200	SO:0001583	missense	23360	exon15			GCAGGTGCTGCCG	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.2603C>A	11.37:g.47744730G>T	ENSP00000263773:p.Ala868Glu	238.0	1.0		237.0	35.0	NM_015308	Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	37	CCDS41644.1	.	.	.	.	.	.	.	.	.	.	G	16.01	3.000779	0.54254	.	.	ENSG00000109920	ENST00000263773	T	0.35236	1.32	5.11	5.11	0.69529	.	0.399011	0.26457	N	0.024271	T	0.30541	0.0768	L	0.48642	1.525	0.18873	N	0.999988	P	0.38922	0.651	B	0.27887	0.084	T	0.37430	-0.9706	10	0.62326	D	0.03	-8.1983	16.7197	0.85407	0.0:0.0:1.0:0.0	.	868	Q8N3X1	FNBP4_HUMAN	E	868	ENSP00000263773:A868E	ENSP00000263773:A868E	A	-	2	0	FNBP4	47701306	0.947000	0.32204	0.876000	0.34364	0.984000	0.73092	5.585000	0.67497	2.387000	0.81309	0.484000	0.47621	GCA	.		0.522	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
FNDC1	84624	broad.mit.edu;bcgsc.ca	37	6	159655417	159655417	+	Silent	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr6:159655417C>T	ENST00000297267.9	+	11	4073	c.3873C>T	c.(3871-3873)tcC>tcT	p.S1291S	FNDC1_ENST00000340366.6_Silent_p.S1228S	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1291					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GCCACTTCTCCACCACCCCGA	0.662																																					p.S1291S		.											.	FNDC1	138	0			c.C3873T						.						22.0	24.0	23.0					6																	159655417		2041	4131	6172	SO:0001819	synonymous_variant	84624	exon11			CTTCTCCACCACC	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.3873C>T	6.37:g.159655417C>T		180.0	0.0		246.0	11.0	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Silent	SNP	ENST00000297267.9	37	CCDS47512.1	.	.	.	.	.	.	.	.	.	.	C	1.900	-0.453431	0.04540	.	.	ENSG00000164694	ENST00000329629	.	.	.	5.56	1.1	0.20463	.	.	.	.	.	T	0.27594	0.0678	.	.	.	0.48762	D	0.999703	.	.	.	.	.	.	T	0.18967	-1.0320	4	.	.	.	-8.3501	2.567	0.04785	0.2382:0.4616:0.1638:0.1364	.	.	.	.	Y	1187	.	.	H	+	1	0	FNDC1	159575407	0.000000	0.05858	0.749000	0.31150	0.020000	0.10135	-0.014000	0.12656	0.695000	0.31675	0.650000	0.86243	CAC	.		0.662	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
FRAS1	80144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	79328918	79328918	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr4:79328918C>T	ENST00000325942.6	+	31	4671	c.4231C>T	c.(4231-4233)Cag>Tag	p.Q1411*	FRAS1_ENST00000264895.6_Nonsense_Mutation_p.Q1411*	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1411					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CACCTTCACCCAGCAGGACAT	0.582																																					p.Q1411X		.											.	FRAS1	68	0			c.C4231T						.						77.0	84.0	82.0					4																	79328918		2123	4238	6361	SO:0001587	stop_gained	80144	exon31			TTCACCCAGCAGG	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4231C>T	4.37:g.79328918C>T	ENSP00000326330:p.Gln1411*	162.0	0.0		207.0	27.0	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Nonsense_Mutation	SNP	ENST00000325942.6	37	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	C	47	13.622374	0.99753	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	18.7528	0.91821	0.0:1.0:0.0:0.0	.	.	.	.	X	1411	.	ENSP00000264895:Q1411X	Q	+	1	0	FRAS1	79547942	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.264000	0.78432	2.671000	0.90904	0.585000	0.79938	CAG	.		0.582	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
FRAS1	80144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	79455713	79455713	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr4:79455713C>T	ENST00000264895.6	+	71	11476	c.11036C>T	c.(11035-11037)cCc>cTc	p.P3679L		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3675					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CTAATGGATCCCAATACATCT	0.453																																					p.P3679L		.											.	FRAS1	68	0			c.C11036T						.						131.0	118.0	122.0					4																	79455713		1896	4124	6020	SO:0001583	missense	80144	exon71			TGGATCCCAATAC	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.11036C>T	4.37:g.79455713C>T	ENSP00000264895:p.Pro3679Leu	133.0	0.0		133.0	20.0	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	37	CCDS54771.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.401489	0.83120	.	.	ENSG00000138759	ENST00000264895	T	0.14516	2.5	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.39332	0.1074	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.28106	-1.0054	10	0.87932	D	0	.	18.4025	0.90522	0.0:1.0:0.0:0.0	.	3679	E9PHH6	.	L	3679	ENSP00000264895:P3679L	ENSP00000264895:P3679L	P	+	2	0	FRAS1	79674737	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	7.667000	0.83888	2.336000	0.79503	0.591000	0.81541	CCC	.		0.453	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
GABRQ	55879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	151821044	151821044	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chrX:151821044C>A	ENST00000370306.2	+	9	1219	c.1199C>A	c.(1198-1200)cCc>cAc	p.P400H		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	400					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGCTCTCTCCCCATCACCCCA	0.582																																					p.P400H		.											.	GABRQ	133	0			c.C1199A						.						74.0	68.0	70.0					X																	151821044		2203	4300	6503	SO:0001583	missense	55879	exon9			CTCTCCCCATCAC	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.1199C>A	X.37:g.151821044C>A	ENSP00000359329:p.Pro400His	159.0	0.0		169.0	66.0	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	37	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.279283	0.59758	.	.	ENSG00000147402	ENST00000370306	D	0.85629	-2.01	4.59	-0.767	0.11016	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.485053	0.15556	N	0.256196	T	0.74558	0.3732	L	0.46157	1.445	0.09310	N	1	B	0.12013	0.005	B	0.20767	0.031	T	0.62576	-0.6825	10	0.56958	D	0.05	.	0.591	0.00728	0.1747:0.3097:0.1684:0.3472	.	400	Q9UN88	GBRT_HUMAN	H	400	ENSP00000359329:P400H	ENSP00000359329:P400H	P	+	2	0	GABRQ	151571700	0.000000	0.05858	0.000000	0.03702	0.480000	0.33159	0.034000	0.13776	-0.294000	0.08973	0.600000	0.82982	CCC	.		0.582	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
GMCL1	64395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	70066643	70066643	+	Missense_Mutation	SNP	A	A	G	rs147534979	byFrequency	TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr2:70066643A>G	ENST00000282570.3	+	3	690	c.439A>G	c.(439-441)Att>Gtt	p.I147V	GMCL1_ENST00000468386.2_3'UTR	NM_178439.3	NP_848526.1	Q96IK5	GMCL1_HUMAN	germ cell-less, spermatogenesis associated 1	147	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)	nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)				endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	15						CAGCATGAATATTATTGAACT	0.323													A|||	3	0.000599042	0.0023	0.0	5008	,	,		18190	0.0		0.0	False		,,,				2504	0.0				p.I147V		.											.	GMCL1	93	0			c.A439G						.	A	VAL/ILE	8,4398	14.3+/-33.2	0,8,2195	74.0	79.0	77.0		439	3.7	1.0	2	dbSNP_134	77	0,8594		0,0,4297	yes	missense	GMCL1	NM_178439.3	29	0,8,6492	GG,GA,AA		0.0,0.1816,0.0615	benign	147/516	70066643	8,12992	2203	4297	6500	SO:0001583	missense	64395	exon3			ATGAATATTATTG	AK023119	CCDS1895.1	2p13.3	2013-01-09	2012-08-20		ENSG00000087338	ENSG00000087338		"""BTB/POZ domain containing"""	23843	protein-coding gene	gene with protein product	"""spermatogenesis associated 29"""		"""germ cell-less homolog 1 (Drosophila)"""				Standard	NM_178439		Approved	FLJ13057, BTBD13, GCL1, SPATA29	uc002sfu.3	Q96IK5	OTTHUMG00000129643	ENST00000282570.3:c.439A>G	2.37:g.70066643A>G	ENSP00000282570:p.Ile147Val	592.0	1.0		484.0	97.0	NM_178439	Q9H826|Q9H8V7|Q9H927	Missense_Mutation	SNP	ENST00000282570.3	37	CCDS1895.1	.	.	.	.	.	.	.	.	.	.	A	3.705	-0.060665	0.07317	0.001816	0.0	ENSG00000087338	ENST00000282570	T	0.69561	-0.41	4.86	3.71	0.42584	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.340884	0.30277	N	0.009994	T	0.36220	0.0959	N	0.04063	-0.285	0.27396	N	0.954981	B	0.02656	0.0	B	0.09377	0.004	T	0.19418	-1.0306	10	0.10636	T	0.68	-8.1505	6.1011	0.20047	0.8044:0.0:0.1956:0.0	.	147	Q96IK5	GMCL1_HUMAN	V	147	ENSP00000282570:I147V	ENSP00000282570:I147V	I	+	1	0	GMCL1	69920147	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.522000	0.45572	0.882000	0.36016	0.482000	0.46254	ATT	A|0.999;G|0.001		0.323	GMCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251841.2	NM_178439	
GOLGA3	2802	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	133358985	133358985	+	Missense_Mutation	SNP	A	A	C	rs79085716	byFrequency	TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr12:133358985A>C	ENST00000450791.2	-	16	3545	c.3362T>G	c.(3361-3363)cTt>cGt	p.L1121R	GOLGA3_ENST00000456883.2_Missense_Mutation_p.L1121R|GOLGA3_ENST00000204726.3_Missense_Mutation_p.L1121R			Q08378	GOGA3_HUMAN	golgin A3	1121					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GAGGCCCGTAAGCTTCCCTTT	0.493													A|||	3	0.000599042	0.0	0.0	5008	,	,		19017	0.003		0.0	False		,,,				2504	0.0				p.L1121R		.											.	GOLGA3	95	0			c.T3362G						.						216.0	201.0	206.0					12																	133358985		2203	4300	6503	SO:0001583	missense	2802	exon17			CCCGTAAGCTTCC	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.3362T>G	12.37:g.133358985A>C	ENSP00000410378:p.Leu1121Arg	393.0	1.0		394.0	65.0	NM_005895	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	37	CCDS9281.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	A	18.94	3.729384	0.69074	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883	T;T;T	0.47528	0.84;0.84;0.87	6.07	6.07	0.98685	.	0.055534	0.64402	D	0.000001	T	0.55000	0.1893	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.51052	-0.8754	10	0.23891	T	0.37	.	16.6288	0.85011	1.0:0.0:0.0:0.0	.	1121;1121	Q08378-2;Q08378	.;GOGA3_HUMAN	R	1121	ENSP00000204726:L1121R;ENSP00000410378:L1121R;ENSP00000409303:L1121R	ENSP00000204726:L1121R	L	-	2	0	GOLGA3	131869058	1.000000	0.71417	0.909000	0.35828	0.123000	0.20343	9.109000	0.94291	2.326000	0.78906	0.533000	0.62120	CTT	A|0.999;C|0.001		0.493	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895	
GRIA4	2893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	105842667	105842667	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr11:105842667A>C	ENST00000530497.1	+	14	2321	c.2321A>C	c.(2320-2322)aAa>aCa	p.K774T	GRIA4_ENST00000282499.5_Missense_Mutation_p.K774T|GRIA4_ENST00000533094.1_Intron|GRIA4_ENST00000525187.1_Intron|GRIA4_ENST00000393127.2_Intron|RNU6-277P_ENST00000516272.1_RNA			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	774					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		GCCGTTTTGAAACTCAGTGAG	0.383																																					p.K774T		.											.	GRIA4	230	0			c.A2321C						.						91.0	89.0	90.0					11																	105842667		2201	4299	6500	SO:0001583	missense	2893	exon15			TTTTGAAACTCAG	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.2321A>C	11.37:g.105842667A>C	ENSP00000435775:p.Lys774Thr	164.0	1.0		201.0	40.0	NM_000829	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.3|20.3	3.963841|3.963841	0.74131|0.74131	.|.	.|.	ENSG00000152578|ENSG00000152578	ENST00000539249|ENST00000282499;ENST00000530497	.|T;T	.|0.40225	.|1.04;1.04	5.55|5.55	5.55|5.55	0.83447|0.83447	.|Ionotropic glutamate receptor (2);	.|0.000000	.|0.64402	.|D	.|0.000002	T|T	0.43144|0.43144	0.1234|0.1234	L|L	0.37850|0.37850	1.14|1.14	0.80722|0.80722	D|D	1|1	.|P	.|0.46395	.|0.877	.|P	.|0.46885	.|0.53	T|T	0.43228|0.43228	-0.9404|-0.9404	6|10	0.16896|0.87932	T|D	0.51|0	.|.	15.7049|15.7049	0.77569|0.77569	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|774	.|P48058	.|GRIA4_HUMAN	D|T	117|774	.|ENSP00000282499:K774T;ENSP00000435775:K774T	ENSP00000440835:E117D|ENSP00000282499:K774T	E|K	+|+	3|2	2|0	GRIA4|GRIA4	105347877|105347877	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.307000|9.307000	0.96226|0.96226	2.117000|2.117000	0.64856|0.64856	0.533000|0.533000	0.62120|0.62120	GAA|AAA	.		0.383	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	185970862	185970862	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr1:185970862T>A	ENST00000271588.4	+	28	4566	c.4337T>A	c.(4336-4338)aTt>aAt	p.I1446N	HMCN1_ENST00000367492.2_Missense_Mutation_p.I1446N	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1446	Ig-like C2-type 11.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TACTTTAACATTGATGTGCTA	0.353																																					p.I1446N		.											.	HMCN1	113	0			c.T4337A						.						49.0	52.0	51.0					1																	185970862		2203	4298	6501	SO:0001583	missense	83872	exon28			TTAACATTGATGT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.4337T>A	1.37:g.185970862T>A	ENSP00000271588:p.Ile1446Asn	234.0	0.0		189.0	46.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.429619	0.83776	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.78816	-1.21;-1.21	5.82	5.82	0.92795	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.370573	0.29868	N	0.010988	D	0.86752	0.6008	M	0.77486	2.375	0.23487	N	0.997577	D	0.60160	0.987	P	0.60173	0.87	T	0.81756	-0.0787	10	0.87932	D	0	.	16.1839	0.81934	0.0:0.0:0.0:1.0	.	1446	Q96RW7	HMCN1_HUMAN	N	1446	ENSP00000271588:I1446N;ENSP00000356462:I1446N	ENSP00000271588:I1446N	I	+	2	0	HMCN1	184237485	0.972000	0.33761	0.708000	0.30435	0.982000	0.71751	7.344000	0.79328	2.222000	0.72286	0.533000	0.62120	ATT	.		0.353	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HYDIN	54768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	70884548	70884548	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr16:70884548C>T	ENST00000393567.2	-	74	12604	c.12454G>A	c.(12454-12456)Gat>Aat	p.D4152N	RNU6ATAC25P_ENST00000408798.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4152					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				AAGAAAATATCAATTGGGAAC	0.398																																					p.D4152N		.											.	HYDIN	92	0			c.G12454A						.						53.0	47.0	49.0					16																	70884548		1846	4095	5941	SO:0001583	missense	54768	exon74			AAATATCAATTGG	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.12454G>A	16.37:g.70884548C>T	ENSP00000377197:p.Asp4152Asn	162.0	0.0		134.0	20.0	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.997662	0.54147	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00882	5.58	5.56	4.6	0.57074	.	0.982987	0.08228	U	0.978048	T	0.01835	0.0058	L	0.56769	1.78	0.80722	D	1	P	0.42337	0.776	P	0.48598	0.583	T	0.60352	-0.7280	10	0.12430	T	0.62	.	4.0023	0.09585	0.2125:0.6206:0.0:0.1669	.	4151	F8WD23	.	N	4152;4151	ENSP00000377197:D4152N	ENSP00000313052:D4151N	D	-	1	0	HYDIN	69442049	0.988000	0.35896	1.000000	0.80357	0.936000	0.57629	1.568000	0.36418	2.615000	0.88500	0.511000	0.50034	GAT	.		0.398	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
IKBIP	121457	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	99019886	99019886	+	Intron	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr12:99019886A>G	ENST00000342502.2	-	2	709				IKBIP_ENST00000420861.1_Intron|IKBIP_ENST00000393042.3_Intron|IKBIP_ENST00000299157.4_Missense_Mutation_p.M319T	NM_201612.2	NP_963906.1	Q70UQ0	IKIP_HUMAN	IKBKB interacting protein						response to X-ray (GO:0010165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(2)	6						CTGCATCTCCATTATTTCAGA	0.318																																					p.M319T		.											.	IKBIP	226	0			c.T956C						.						80.0	77.0	78.0					12																	99019886		2202	4299	6501	SO:0001627	intron_variant	121457	exon3			ATCTCCATTATTT	AJ539425	CCDS9067.1, CCDS9068.1, CCDS41822.1	12q23.1	2010-02-17			ENSG00000166130	ENSG00000166130			26430	protein-coding gene	gene with protein product	"""I kappa B kinase interacting protein"""	609861				15389287	Standard	NM_153687		Approved	FLJ31051, IKIP	uc001tfx.4	Q70UQ0	OTTHUMG00000170213	ENST00000342502.2:c.297+8187T>C	12.37:g.99019886A>G		571.0	1.0		421.0	70.0	NM_153687	Q6ZWH4|Q70UP9|Q86V91|Q96ND2	Missense_Mutation	SNP	ENST00000342502.2	37	CCDS9067.1	.	.	.	.	.	.	.	.	.	.	A	9.902	1.207131	0.22205	.	.	ENSG00000166130	ENST00000299157	T	0.44083	0.93	5.86	5.86	0.93980	.	0.451330	0.29376	N	0.012334	T	0.24470	0.0593	.	.	.	0.80722	D	1	B	0.21225	0.053	B	0.15484	0.013	T	0.11421	-1.0588	9	0.09338	T	0.73	-6.9164	11.3137	0.49379	0.9295:0.0:0.0705:0.0	.	319	Q70UQ0-4	.	T	319	ENSP00000299157:M319T	ENSP00000299157:M319T	M	-	2	0	IKBIP	97544017	1.000000	0.71417	0.995000	0.50966	0.985000	0.73830	6.107000	0.71517	2.237000	0.73441	0.533000	0.62120	ATG	.		0.318	IKBIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000408003.2	NM_153687	
IL9R	3581	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	155239667	155239667	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chrX:155239667C>A	ENST00000244174.5	+	9	1338	c.1159C>A	c.(1159-1161)Ctg>Atg	p.L387M	IL9R_ENST00000424344.3_Missense_Mutation_p.L366M|IL9R_ENST00000540897.1_3'UTR|IL9R_ENST00000369423.2_3'UTR	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	387					cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)			NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CCCGGGGAACCTGAGCTCAGA	0.647																																					p.L387M		.											.	IL9R	40	0			c.C1159A						.						18.0	33.0	28.0					X																	155239667		2128	4267	6395	SO:0001583	missense	3581	exon9			GGGAACCTGAGCT	M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.1159C>A	X.37:g.155239667C>A	ENSP00000244174:p.Leu387Met	247.0	0.0		330.0	38.0	NM_002186	B9ZVT0|Q14634|Q8WWU1|Q96TF0	Missense_Mutation	SNP	ENST00000244174.5	37	CCDS14771.4	.	.	.	.	.	.	.	.	.	.	c	6.810	0.518491	0.13005	.	.	ENSG00000124334	ENST00000244174;ENST00000424344	T;T	0.10860	2.83;2.83	0.971	0.0097	0.14080	.	2.975570	0.01806	U	0.033170	T	0.17365	0.0417	.	.	.	0.09310	N	1	D	0.60160	0.987	P	0.55391	0.775	T	0.09292	-1.0681	9	0.38643	T	0.18	.	3.0994	0.06320	0.0:0.6516:0.0:0.3484	.	387	Q01113	IL9R_HUMAN	M	387;366	ENSP00000244174:L387M;ENSP00000388918:L366M	ENSP00000244174:L387M	L	+	1	2	IL9R	154892861	0.000000	0.05858	0.003000	0.11579	0.052000	0.14988	-0.626000	0.05527	-0.069000	0.12931	0.287000	0.19450	CTG	.		0.647	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058981.1	NM_002186	
INTS1	26173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	1517435	1517435	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr7:1517435C>T	ENST00000404767.3	-	34	4853	c.4768G>A	c.(4768-4770)Gag>Aag	p.E1590K	INTS1_ENST00000389470.4_Missense_Mutation_p.E1789K	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	1590					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		GGCTCCTCCTCCTGCAGCAGC	0.687																																					p.E1590K		.											.	.	.	0			c.G4768A						.						26.0	33.0	30.0					7																	1517435		2068	4183	6251	SO:0001583	missense	26173	exon34			CCTCCTCCTGCAG	AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.4768G>A	7.37:g.1517435C>T	ENSP00000385722:p.Glu1590Lys	93.0	0.0		165.0	21.0	NM_001080453	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	ENST00000404767.3	37	CCDS47526.1	.	.	.	.	.	.	.	.	.	.	C	11.63	1.697416	0.30142	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.52295	0.75;0.67	4.46	3.01	0.34805	.	0.197549	0.52532	D	0.000077	T	0.34164	0.0888	L	0.32530	0.975	0.37088	D	0.899313	B	0.09022	0.002	B	0.08055	0.003	T	0.18178	-1.0345	10	0.36615	T	0.2	.	9.7376	0.40397	0.0:0.8534:0.0:0.1466	.	1590	Q8N201	INT1_HUMAN	K	1590;1789	ENSP00000385722:E1590K;ENSP00000374121:E1789K	ENSP00000374121:E1789K	E	-	1	0	INTS1	1483961	1.000000	0.71417	0.943000	0.38184	0.923000	0.55619	5.424000	0.66464	0.441000	0.26529	0.561000	0.74099	GAG	.		0.687	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323683.1		
ITGB8	3696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	20445703	20445703	+	Silent	SNP	T	T	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr7:20445703T>A	ENST00000222573.4	+	12	2616	c.1932T>A	c.(1930-1932)ctT>ctA	p.L644L	ITGB8_ENST00000537992.1_Silent_p.L509L	NM_002214.2	NP_002205.1	P26012	ITB8_HUMAN	integrin, beta 8	644					cartilage development (GO:0051216)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|ganglioside metabolic process (GO:0001573)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of gene expression (GO:0010629)|placenta blood vessel development (GO:0060674)|positive regulation of gene expression (GO:0010628)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	extracellular matrix protein binding (GO:1990430)|receptor activity (GO:0004872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(4)|stomach(2)|urinary_tract(1)	37						TGCAATGCCTTCACCCTCACA	0.383																																					p.L644L		.											.	ITGB8	227	0			c.T1932A						.						133.0	118.0	123.0					7																	20445703		2203	4300	6503	SO:0001819	synonymous_variant	3696	exon12			ATGCCTTCACCCT		CCDS5370.1	7p15.3	2010-03-23			ENSG00000105855	ENSG00000105855		"""Integrins"""	6163	protein-coding gene	gene with protein product		604160					Standard	XM_005249751		Approved		uc003suu.3	P26012	OTTHUMG00000023594	ENST00000222573.4:c.1932T>A	7.37:g.20445703T>A		145.0	0.0		141.0	25.0	NM_002214	A4D133|B4DHD4	Silent	SNP	ENST00000222573.4	37	CCDS5370.1																																																																																			.		0.383	ITGB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059915.3	NM_002214	
ITSN1	6453	broad.mit.edu;bcgsc.ca	37	21	35208755	35208755	+	Silent	SNP	G	G	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr21:35208755G>A	ENST00000381318.3	+	29	3768	c.3480G>A	c.(3478-3480)gtG>gtA	p.V1160V	ITSN1_ENST00000381285.4_Silent_p.V1160V|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000437442.2_Silent_p.V1155V|ITSN1_ENST00000399355.2_Silent_p.V1089V|ITSN1_ENST00000399326.3_3'UTR|ITSN1_ENST00000381291.4_Silent_p.V1160V|ITSN1_ENST00000399352.1_Silent_p.V1155V|ITSN1_ENST00000399353.1_Silent_p.V1118V|ITSN1_ENST00000399349.1_Silent_p.V1084V|ITSN1_ENST00000399367.3_Silent_p.V1155V|ITSN1_ENST00000379960.5_3'UTR	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	1160	SH3 5. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						TGTGCCAGGTGATTGGGATGT	0.582																																					p.V1160V		.											.	ITSN1	94	0			c.G3480A						.						54.0	46.0	49.0					21																	35208755		2203	4300	6503	SO:0001819	synonymous_variant	6453	exon29			CCAGGTGATTGGG	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.3480G>A	21.37:g.35208755G>A		79.0	0.0		51.0	4.0	NM_001001132	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Silent	SNP	ENST00000381318.3	37	CCDS33545.1																																																																																			.		0.582	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	
KCND2	3751	broad.mit.edu;bcgsc.ca	37	7	120382615	120382615	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr7:120382615A>G	ENST00000331113.4	+	4	2391	c.1426A>G	c.(1426-1428)Acc>Gcc	p.T476A		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	476	Mediates dendritic targeting. {ECO:0000250}.				action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CAGCTTTGAAACCCAGCACCA	0.453																																					p.T476A		.											KCND2,brain,glioma,-2	KCND2	517	0			c.A1426G						.						137.0	132.0	134.0					7																	120382615		2203	4300	6503	SO:0001583	missense	3751	exon4			TTTGAAACCCAGC	AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.1426A>G	7.37:g.120382615A>G	ENSP00000333496:p.Thr476Ala	186.0	0.0		200.0	10.0	NM_012281	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	ENST00000331113.4	37	CCDS5776.1	.	.	.	.	.	.	.	.	.	.	A	18.12	3.554171	0.65425	.	.	ENSG00000184408	ENST00000331113	D	0.82344	-1.6	5.4	5.4	0.78164	Potassium channel, voltage dependent, Kv4, C-terminal (1);	0.138109	0.46758	D	0.000275	T	0.76190	0.3953	L	0.36672	1.1	0.40237	D	0.977919	B	0.10296	0.003	B	0.14023	0.01	T	0.71126	-0.4683	9	.	.	.	.	15.7345	0.77831	1.0:0.0:0.0:0.0	.	476	Q9NZV8	KCND2_HUMAN	A	476	ENSP00000333496:T476A	.	T	+	1	0	KCND2	120169851	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.655000	0.61476	2.170000	0.68504	0.455000	0.32223	ACC	.		0.453	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281	
KLHL22	84861	broad.mit.edu;bcgsc.ca	37	22	20843480	20843480	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr22:20843480A>G	ENST00000328879.4	-	2	175	c.19T>C	c.(19-21)Ttc>Ctc	p.F7L	KLHL22_ENST00000470335.1_5'UTR|KLHL22_ENST00000440659.2_5'UTR	NM_032775.3	NP_116164.2	Q53GT1	KLH22_HUMAN	kelch-like family member 22	7					cell division (GO:0051301)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein monoubiquitination (GO:0006513)	centrosome (GO:0005813)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|polar microtubule (GO:0005827)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	20	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			AGCTGGGTGAACTCCTGCTCC	0.607																																					p.F7L		.											.	KLHL22	278	0			c.T19C						.						124.0	99.0	107.0					22																	20843480		2203	4300	6503	SO:0001583	missense	84861	exon2			GGGTGAACTCCTG		CCDS13780.1	22q11.21	2013-01-30	2013-01-30		ENSG00000099910	ENSG00000099910		"""Kelch-like"", ""BTB/POZ domain containing"""	25888	protein-coding gene	gene with protein product			"""kelch-like 22 (Drosophila)"""			12477932	Standard	NM_032775		Approved	FLJ14360, KELCHL	uc002zsl.2	Q53GT1	OTTHUMG00000150778	ENST00000328879.4:c.19T>C	22.37:g.20843480A>G	ENSP00000331682:p.Phe7Leu	163.0	0.0		158.0	8.0	NM_032775	A8K3Q4|A8MTV3|B7Z2G1|D3DX30|Q96B68|Q96KC6	Missense_Mutation	SNP	ENST00000328879.4	37	CCDS13780.1	.	.	.	.	.	.	.	.	.	.	a	10.26	1.300009	0.23650	.	.	ENSG00000099910	ENST00000328879;ENST00000444967;ENST00000458248;ENST00000443285;ENST00000431430;ENST00000423364	T;T;T;T;D	0.83837	-0.71;-0.5;-0.34;-0.34;-1.77	4.88	3.77	0.43336	.	0.551776	0.18426	N	0.141582	T	0.57213	0.2038	N	0.08118	0	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.52946	-0.8507	10	0.06494	T	0.89	.	2.144	0.03782	0.5903:0.0:0.1589:0.2508	.	7	Q53GT1	KLH22_HUMAN	L	7;39;7;41;7;39	ENSP00000331682:F7L;ENSP00000403999:F39L;ENSP00000398616:F7L;ENSP00000397882:F41L;ENSP00000409092:F7L	ENSP00000331682:F7L	F	-	1	0	KLHL22	19173480	0.981000	0.34729	1.000000	0.80357	0.976000	0.68499	2.562000	0.45914	1.828000	0.53243	0.449000	0.29647	TTC	.		0.607	KLHL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320045.2	NM_032775	
KRT14	3861	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	39742690	39742690	+	Missense_Mutation	SNP	C	C	T	rs61027685		TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr17:39742690C>T	ENST00000167586.6	-	1	483	c.397G>A	c.(397-399)Gtg>Atg	p.V133M		NM_000526.4	NP_000517	P02533	K1C14_HUMAN	keratin 14	133	Coil 1A.|Rod.		V -> A (in dbSNP:rs642601).|V -> L (in WC-EBS and K-EBS; dbSNP:rs61027685). {ECO:0000269|PubMed:14987259, ECO:0000269|PubMed:16786515}.		aging (GO:0007568)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|hair cycle (GO:0042633)|hemidesmosome assembly (GO:0031581)|intermediate filament bundle assembly (GO:0045110)|response to ionizing radiation (GO:0010212)|response to zinc ion (GO:0010043)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	keratin filament binding (GO:1990254)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(3)|lung(7)|ovary(1)|prostate(5)|skin(1)|stomach(1)	25		Breast(137;0.000307)				AGAGCACGCACCTTGTCCAGG	0.582																																					p.V133M		.											.	KRT14	91	0			c.G397A	GRCh37	CM044653|CM055346|CM070974	KRT14	M	rs61027685	.						136.0	142.0	140.0					17																	39742690		2203	4296	6499	SO:0001583	missense	3861	exon1			CACGCACCTTGTC	BC002690	CCDS11400.1	17q21.2	2013-06-20	2008-09-19		ENSG00000186847	ENSG00000186847		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6416	protein-coding gene	gene with protein product	"""epidermolysis bullosa simplex, Dowling-Meara, Koebner"""	148066	"""keratin 14 (epidermolysis bullosa simplex, Dowling-Meara, Koebner)"""	EBS3, EBS4		1717157, 16831889	Standard	NM_000526		Approved		uc002hxf.2	P02533	OTTHUMG00000133426	ENST00000167586.6:c.397G>A	17.37:g.39742690C>T	ENSP00000167586:p.Val133Met	200.0	0.0		225.0	48.0	NM_000526	Q14715|Q53XY3|Q9BUE3|Q9UBN2|Q9UBN3|Q9UCY4	Missense_Mutation	SNP	ENST00000167586.6	37	CCDS11400.1	.	.	.	.	.	.	.	.	.	.	C	32	5.121927	0.94429	.	.	ENSG00000186847	ENST00000167586	D	0.95885	-3.84	4.98	4.98	0.66077	Filament (1);	0.000000	0.47455	D	0.000240	D	0.98598	0.9531	H	0.97659	4.05	0.80722	D	1	D	0.61080	0.989	D	0.67382	0.951	D	0.99601	1.0978	10	0.66056	D	0.02	.	18.6154	0.91300	0.0:1.0:0.0:0.0	.	133	P02533	K1C14_HUMAN	M	133	ENSP00000167586:V133M	ENSP00000167586:V133M	V	-	1	0	KRT14	36996216	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.757000	0.85209	2.472000	0.83506	0.448000	0.29417	GTG	.		0.582	KRT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257289.1	NM_000526	
LIPJ	142910	ucsc.edu;bcgsc.ca	37	10	90351178	90351178	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr10:90351178A>G	ENST00000371939.3	+	4	367	c.53A>G	c.(52-54)gAt>gGt	p.D18G		NM_001010939.2	NP_001010939.2	Q5W064	LIPJ_HUMAN	lipase, family member J	18					lipid catabolic process (GO:0016042)		hydrolase activity, acting on ester bonds (GO:0016788)			large_intestine(4)|lung(4)|ovary(1)	9		all_cancers(4;2.79e-10)|Prostate(4;1.68e-15)|all_epithelial(4;1.43e-09)|Colorectal(252;0.0381)|Breast(4;0.141)|Melanoma(5;0.2)|all_hematologic(4;0.222)		Colorectal(12;1.02e-05)|COAD - Colon adenocarcinoma(12;1.54e-05)		GAAGAATATGATATTGTAACC	0.313																																					p.D18G		.											.	LIPJ	91	0			c.A53G						.						74.0	77.0	76.0					10																	90351178		2203	4299	6502	SO:0001583	missense	142910	exon4			AATATGATATTGT	BC031219	CCDS31240.1	10q23.31	2008-02-04	2008-02-04	2007-02-27	ENSG00000204022	ENSG00000204022			21773	protein-coding gene	gene with protein product		613921	"""lipase-like, ab-hydrolase domain containing 1"", ""lipase, family member J"""	LIPL1			Standard	NM_001010939		Approved	bA425M17.2	uc001kff.3	Q5W064	OTTHUMG00000018691	ENST00000371939.3:c.53A>G	10.37:g.90351178A>G	ENSP00000361007:p.Asp18Gly	101.0	0.0		41.0	4.0	NM_001010939	A8MT98|Q0P671	Missense_Mutation	SNP	ENST00000371939.3	37	CCDS31240.1	.	.	.	.	.	.	.	.	.	.	A	17.90	3.502025	0.64298	.	.	ENSG00000204022	ENST00000371939	T	0.71461	-0.57	4.47	4.47	0.54385	Partial AB-hydrolase lipase domain (1);	0.844176	0.10080	N	0.718564	D	0.83594	0.5288	M	0.90977	3.165	0.30375	N	0.782484	P	0.47034	0.889	P	0.52554	0.702	T	0.79883	-0.1615	10	0.41790	T	0.15	-28.5314	13.1317	0.59387	1.0:0.0:0.0:0.0	.	18	Q5W064	LIPJ_HUMAN	G	18	ENSP00000361007:D18G	ENSP00000361007:D18G	D	+	2	0	LIPJ	90341158	1.000000	0.71417	0.142000	0.22268	0.758000	0.43043	7.598000	0.82745	1.986000	0.57962	0.477000	0.44152	GAT	.		0.313	LIPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049248.2	XM_084377	
LLGL2	3993	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	73569581	73569581	+	Silent	SNP	C	C	G	rs144386071	byFrequency	TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr17:73569581C>G	ENST00000392550.3	+	21	2862	c.2745C>G	c.(2743-2745)ccC>ccG	p.P915P	LLGL2_ENST00000577200.1_Silent_p.P915P|LLGL2_ENST00000167462.5_Silent_p.P915P	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	915					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			TGATCTCACCCTCGGAGTTTG	0.637																																					p.P915P		.											.	LLGL2	251	0			c.C2745G						.						90.0	93.0	92.0					17																	73569581		2203	4299	6502	SO:0001819	synonymous_variant	3993	exon21			CTCACCCTCGGAG	X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.2745C>G	17.37:g.73569581C>G		224.0	0.0		254.0	40.0	NM_004524	Q14521|Q9BR62	Silent	SNP	ENST00000392550.3	37	CCDS32733.1																																																																																			C|0.997;T|0.003		0.637	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447633.1	NM_004524	
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	141812802	141812802	+	Missense_Mutation	SNP	G	G	A	rs545142973		TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr2:141812802G>A	ENST00000389484.3	-	10	2406	c.1435C>T	c.(1435-1437)Cca>Tca	p.P479S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	479	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATTCCATATGGATCGACTTCA	0.433										TSP Lung(27;0.18)																											p.P479S	Colon(99;50 2074 2507 20106)	.											.	LRP1B	311	0			c.C1435T						.						100.0	89.0	93.0					2																	141812802		2203	4300	6503	SO:0001583	missense	53353	exon10			CATATGGATCGAC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1435C>T	2.37:g.141812802G>A	ENSP00000374135:p.Pro479Ser	167.0	0.0		167.0	22.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.118079	0.37339	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.89681	-2.55	5.45	4.56	0.56223	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);Epidermal growth factor-like (1);	0.370906	0.25349	U	0.031320	T	0.78253	0.4254	N	0.12746	0.255	0.25272	N	0.989504	B	0.06786	0.001	B	0.04013	0.001	T	0.56195	-0.8019	10	0.09084	T	0.74	.	15.8587	0.79005	0.0:0.1406:0.8594:0.0	.	479	Q9NZR2	LRP1B_HUMAN	S	479;417	ENSP00000374135:P479S	ENSP00000374135:P479S	P	-	1	0	LRP1B	141529272	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.527000	0.45615	1.268000	0.44264	0.557000	0.71058	CCA	.		0.433	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
MAP3K15	389840	ucsc.edu;bcgsc.ca	37	X	19418728	19418728	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chrX:19418728T>C	ENST00000338883.4	-	14	1897	c.1898A>G	c.(1897-1899)gAg>gGg	p.E633G	MAP3K15_ENST00000359173.3_Missense_Mutation_p.E68G|MAP3K15_ENST00000469203.2_Missense_Mutation_p.E465G|MAP3K15_ENST00000518578.1_5'UTR	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	633							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					TCCCTCCAGCTCCACCGTACT	0.443																																					p.E633G		.											.	MAP3K15	335	0			c.A1898G						.						373.0	317.0	336.0					X																	19418728		2203	4300	6503	SO:0001583	missense	389840	exon14			TCCAGCTCCACCG	AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.1898A>G	X.37:g.19418728T>C	ENSP00000345629:p.Glu633Gly	61.0	0.0		51.0	5.0	NM_001001671	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Missense_Mutation	SNP	ENST00000338883.4	37		.	.	.	.	.	.	.	.	.	.	T	15.88	2.965009	0.53507	.	.	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	T;T;T	0.74106	-0.79;-0.81;-0.78	5.28	4.11	0.48088	.	0.101239	0.64402	D	0.000003	D	0.82568	0.5065	M	0.76574	2.34	0.41420	D	0.987793	D;D	0.65815	0.991;0.995	D;P	0.64410	0.925;0.848	T	0.80708	-0.1262	10	0.38643	T	0.18	.	10.319	0.43753	0.0:0.0784:0.0:0.9216	.	108;633	Q6ZN16-3;Q6ZN16	.;M3K15_HUMAN	G	633;68;465	ENSP00000345629:E633G;ENSP00000352093:E68G;ENSP00000428356:E465G	ENSP00000345629:E633G	E	-	2	0	MAP3K15	19328649	1.000000	0.71417	0.909000	0.35828	0.300000	0.27592	4.470000	0.60175	0.672000	0.31204	0.483000	0.47432	GAG	.		0.443	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671	
MAGEC3	139081	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	140985121	140985121	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chrX:140985121A>G	ENST00000298296.1	+	7	1577	c.1577A>G	c.(1576-1578)gAa>gGa	p.E526G	MAGEC3_ENST00000544766.1_Missense_Mutation_p.E228G|MAGEC3_ENST00000409007.1_Missense_Mutation_p.E228G|MAGEC3_ENST00000443323.2_Missense_Mutation_p.E148G|MAGEC3_ENST00000536088.1_Missense_Mutation_p.E228G	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	526	MAGE 2. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					TATTTCTTTGAAGACACATTA	0.438																																					p.E526G		.											.	MAGEC3	555	0			c.A1577G						.						152.0	144.0	147.0					X																	140985121		2203	4300	6503	SO:0001583	missense	139081	exon7			TCTTTGAAGACAC	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1577A>G	X.37:g.140985121A>G	ENSP00000298296:p.Glu526Gly	75.0	0.0		44.0	22.0	NM_138702	Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	ENST00000298296.1	37	CCDS14676.1	.	.	.	.	.	.	.	.	.	.	a	5.460	0.269946	0.10349	.	.	ENSG00000165509	ENST00000298296;ENST00000536088;ENST00000443323;ENST00000544766;ENST00000409007	T;T;T;T;T	0.04603	3.59;3.59;3.59;3.59;3.59	1.25	-2.5	0.06384	.	.	.	.	.	T	0.02418	0.0074	N	0.08118	0	0.09310	N	1	P;P	0.49253	0.921;0.49	B;B	0.42188	0.218;0.379	T	0.37865	-0.9687	9	0.59425	D	0.04	.	4.071	0.09882	0.5973:0.0:0.0:0.4027	.	526;228	Q8TD91;Q3SYA7	MAGC3_HUMAN;.	G	526;228;148;228;228	ENSP00000298296:E526G;ENSP00000441107:E228G;ENSP00000438254:E148G;ENSP00000440444:E228G;ENSP00000386566:E228G	ENSP00000298296:E526G	E	+	2	0	MAGEC3	140812787	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.807000	0.04520	-1.029000	0.03317	-1.111000	0.02071	GAA	.		0.438	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702	
MME	4311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	154890002	154890002	+	Splice_Site	SNP	G	G	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr3:154890002G>T	ENST00000460393.1	+	21	2196		c.e21+1		MME_ENST00000493237.1_Splice_Site|MME-AS1_ENST00000484721.1_RNA|MME_ENST00000360490.2_Splice_Site|MME_ENST00000462745.1_Splice_Site|MME_ENST00000492661.1_Splice_Site	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase						angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	CTTTGCACAGGTATTGTGTCT	0.328																																					.		.											.	MME	516	0			c.2076+1G>T						.						89.0	96.0	94.0					3																	154890002		2203	4298	6501	SO:0001630	splice_region_variant	4311	exon21			GCACAGGTATTGT		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.2076+1G>T	3.37:g.154890002G>T		1098.0	0.0		827.0	132.0	NM_000902	A8K6U6|D3DNJ9|Q3MIX4	Splice_Site	SNP	ENST00000460393.1	37	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.110435	0.77210	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2626	0.93974	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MME	156372696	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.666000	0.98612	2.544000	0.85801	0.585000	0.79938	.	.		0.328	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	Intron
MPP1	4354	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	154013425	154013425	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chrX:154013425C>T	ENST00000369534.3	-	7	832	c.685G>A	c.(685-687)Gca>Aca	p.A229T	MPP1_ENST00000413259.3_Missense_Mutation_p.A199T|MPP1_ENST00000393531.1_Missense_Mutation_p.A209T|MPP1_ENST00000462825.1_5'UTR	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	229					nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GCCATACTTGCCACTCGCCTG	0.557																																					p.A229T		.											.	MPP1	132	0			c.G685A						.						71.0	60.0	64.0					X																	154013425		2203	4300	6503	SO:0001583	missense	4354	exon7			TACTTGCCACTCG		CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.685G>A	X.37:g.154013425C>T	ENSP00000358547:p.Ala229Thr	65.0	0.0		70.0	30.0	NM_002436	B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Missense_Mutation	SNP	ENST00000369534.3	37	CCDS14762.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372189	0.61624	.	.	ENSG00000130830	ENST00000369534;ENST00000413259;ENST00000393531;ENST00000453245;ENST00000393529;ENST00000428488	D;D;D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66;-1.66;-1.66	5.56	5.56	0.83823	Src homology-3 domain (1);	0.000000	0.85682	D	0.000000	D	0.91754	0.7392	M	0.83312	2.635	0.54753	D	0.999988	D;P;D;P;P	0.89917	1.0;0.784;1.0;0.863;0.784	D;P;D;P;P	0.85130	0.996;0.465;0.997;0.666;0.465	D	0.92891	0.6331	10	0.87932	D	0	.	16.9479	0.86235	0.0:1.0:0.0:0.0	.	212;199;103;209;229	B4E325;B4DZV5;C9J9J4;G3XAI1;Q00013	.;.;.;.;EM55_HUMAN	T	229;199;209;103;183;126	ENSP00000358547:A229T;ENSP00000400155:A199T;ENSP00000377165:A209T;ENSP00000410888:A103T;ENSP00000377163:A183T;ENSP00000391701:A126T	ENSP00000358547:A229T	A	-	1	0	MPP1	153666619	1.000000	0.71417	0.805000	0.32314	0.040000	0.13550	7.146000	0.77373	2.313000	0.78055	0.600000	0.82982	GCA	.		0.557	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061191.3	NM_002436	
MSH4	4438	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	76365354	76365354	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr1:76365354C>T	ENST00000263187.3	+	19	2686	c.2582C>T	c.(2581-2583)gCc>gTc	p.A861V		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	861					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						GTCTTGGATGCCAAGGAAATC	0.303								Mismatch excision repair (MMR)																													p.A861V		.											.	MSH4	660	0			c.C2582T						.						88.0	90.0	89.0					1																	76365354		2203	4300	6503	SO:0001583	missense	4438	exon19			TGGATGCCAAGGA	U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.2582C>T	1.37:g.76365354C>T	ENSP00000263187:p.Ala861Val	940.0	1.0		733.0	42.0	NM_002440	Q5T4U6|Q8NEB3|Q9UNP8	Missense_Mutation	SNP	ENST00000263187.3	37	CCDS670.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.846237	0.91277	.	.	ENSG00000057468	ENST00000263187	D	0.91068	-2.78	5.61	5.61	0.85477	DNA mismatch repair protein MutS, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.97414	0.9154	H	0.98525	4.255	0.53688	D	0.999977	D	0.89917	1.0	D	0.97110	1.0	D	0.98735	1.0714	10	0.87932	D	0	4.3097	17.8182	0.88642	0.0:1.0:0.0:0.0	.	861	O15457	MSH4_HUMAN	V	861	ENSP00000263187:A861V	ENSP00000263187:A861V	A	+	2	0	MSH4	76137942	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.158000	0.71851	2.643000	0.89663	0.467000	0.42956	GCC	.		0.303	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026983.1	NM_002440	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	9024161	9024161	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr19:9024161T>A	ENST00000397910.4	-	18	37314	c.37111A>T	c.(37111-37113)Act>Tct	p.T12371S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12373					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGGATGGAGTCCCTGAGGTT	0.468																																					p.T12371S		.											.	MUC16	566	0			c.A37111T						.						78.0	75.0	76.0					19																	9024161		1910	4124	6034	SO:0001583	missense	94025	exon18			ATGGAGTCCCTGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37111A>T	19.37:g.9024161T>A	ENSP00000381008:p.Thr12371Ser	254.0	0.0		241.0	21.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	8.766	0.924672	0.18056	.	.	ENSG00000181143	ENST00000397910	T	0.01998	4.51	1.58	-1.68	0.08212	.	.	.	.	.	T	0.01905	0.0060	L	0.45137	1.4	.	.	.	P	0.35481	0.504	B	0.26614	0.071	T	0.37572	-0.9700	8	0.87932	D	0	.	4.7752	0.13175	0.0:0.4639:0.0:0.5361	.	12371	B5ME49	.	S	12371	ENSP00000381008:T12371S	ENSP00000381008:T12371S	T	-	1	0	MUC16	8885161	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-4.046000	0.00306	-0.479000	0.06813	0.172000	0.16884	ACT	.		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	broad.mit.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9048323	9048324	+	Missense_Mutation	DNP	GT	GT	TG			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G|T	G|T	.	.	.	.	.|Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr19:9048323_9048324GT>TG	ENST00000397910.4	-	5	33510_33511	c.33307_33308AC>CA	c.(33307-33309)ACt>CAt	p.T11103H		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11105	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCTGGAACTAGTGACCAGAGGG	0.52																																					p.T11103N|p.T11103P		.											.	MUC16	566	0			c.C33308A|c.A33307C						.																																			SO:0001583	missense	94025	exon5			GAACTAGTGACCA|AACTAGTGACCAG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.33307_33308delinsTG	19.37:g.9048323_9048324delinsTG	ENSP00000381008:p.Thr11103His	158.0	1.0|0.0		133.0|136.0	22.0|21.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			.		0.520	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC7	4589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	71346814	71346814	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr4:71346814C>T	ENST00000304887.5	+	3	543	c.353C>T	c.(352-354)tCa>tTa	p.S118L	MUC7_ENST00000514512.1_3'UTR|MUC7_ENST00000413702.1_Missense_Mutation_p.S118L|MUC7_ENST00000456088.1_Missense_Mutation_p.S118L	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	118	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			ACTTTCCCATCAGCTTCCACC	0.428																																					p.S118L		.											.	MUC7	93	0			c.C353T						.						122.0	115.0	118.0					4																	71346814		2203	4300	6503	SO:0001583	missense	4589	exon4			TCCCATCAGCTTC	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.353C>T	4.37:g.71346814C>T	ENSP00000302021:p.Ser118Leu	171.0	0.0		160.0	31.0	NM_001145007	Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	C	11.66	1.704882	0.30232	.	.	ENSG00000171195	ENST00000413702;ENST00000505411;ENST00000456088;ENST00000304887	T;T;T;T	0.54479	0.58;0.57;0.58;0.58	3.44	2.57	0.30868	.	.	.	.	.	T	0.52256	0.1723	N	0.24115	0.695	0.09310	N	1	D	0.65815	0.995	P	0.61003	0.882	T	0.39035	-0.9633	9	0.37606	T	0.19	-2.6315	10.1996	0.43075	0.2007:0.7993:0.0:0.0	.	118	Q8TAX7	MUC7_HUMAN	L	118	ENSP00000407422:S118L;ENSP00000427594:S118L;ENSP00000400585:S118L;ENSP00000302021:S118L	ENSP00000302021:S118L	S	+	2	0	MUC7	71381403	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	1.245000	0.32790	0.991000	0.38814	-0.181000	0.13052	TCA	.		0.428	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291	
MYBL1	4603	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	67492397	67492397	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr8:67492397A>G	ENST00000522677.3	-	9	1482	c.1072T>C	c.(1072-1074)Ttt>Ctt	p.F358L	MYBL1_ENST00000517885.1_Intron|MYBL1_ENST00000524176.2_Missense_Mutation_p.F358L	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	358	Negative regulatory domain. {ECO:0000250}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			GTCTCTGCAAATTCTGGGATG	0.388																																					p.F358L		.											.	MYBL1	395	0			c.T1072C						.						59.0	56.0	57.0					8																	67492397		1857	4100	5957	SO:0001583	missense	4603	exon9			CTGCAAATTCTGG	X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.1072T>C	8.37:g.67492397A>G	ENSP00000429633:p.Phe358Leu	111.0	0.0		206.0	20.0	NM_001080416	E7EW29|Q495F9	Missense_Mutation	SNP	ENST00000522677.3	37	CCDS47867.1	.	.	.	.	.	.	.	.	.	.	A	19.21	3.784089	0.70222	.	.	ENSG00000185697	ENST00000522677;ENST00000524176	T;T	0.22134	2.42;1.97	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.39145	0.1067	L	0.48986	1.54	0.80722	D	1	D;D;P	0.76494	0.999;0.969;0.714	D;D;B	0.68765	0.96;0.914;0.288	T	0.06285	-1.0835	10	0.34782	T	0.22	-15.6715	15.3103	0.74026	1.0:0.0:0.0:0.0	.	358;357;358	Q495F9;Q495G0;P10243	.;.;MYBA_HUMAN	L	358	ENSP00000429633:F358L;ENSP00000428011:F358L	ENSP00000429633:F358L	F	-	1	0	MYBL1	67654951	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	8.546000	0.90661	2.007000	0.58848	0.533000	0.62120	TTT	.		0.388	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379221.3	XM_034274	
MYRF	745	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	61537931	61537931	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr11:61537931C>T	ENST00000278836.5	+	5	770	c.674C>T	c.(673-675)cCc>cTc	p.P225L	MYRF_ENST00000265460.5_Missense_Mutation_p.P216L|TMEM258_ENST00000535042.1_Intron	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	225	Pro-rich.				central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GGGCTGGTGCCCACTGATCTT	0.652																																					p.P225L		.											.	.	.	0			c.C674T						.						13.0	12.0	12.0					11																	61537931		2180	4256	6436	SO:0001583	missense	745	exon5			TGGTGCCCACTGA		CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.674C>T	11.37:g.61537931C>T	ENSP00000278836:p.Pro225Leu	278.0	0.0		363.0	37.0	NM_001127392	O43582|Q9P1Q6	Missense_Mutation	SNP	ENST00000278836.5	37	CCDS44622.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.156698	0.78114	.	.	ENSG00000124920	ENST00000278836;ENST00000265460	T;T	0.36520	1.25;1.28	4.35	4.35	0.52113	.	0.247105	0.41294	D	0.000915	T	0.44095	0.1277	N	0.24115	0.695	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.62184	0.899;0.895	T	0.45160	-0.9280	10	0.51188	T	0.08	-29.57	17.4499	0.87589	0.0:1.0:0.0:0.0	.	216;225	Q9Y2G1-2;Q9Y2G1	.;MRF_HUMAN	L	225;216	ENSP00000278836:P225L;ENSP00000265460:P216L	ENSP00000265460:P216L	P	+	2	0	C11orf9	61294507	0.979000	0.34478	0.977000	0.42913	0.972000	0.66771	5.193000	0.65120	2.430000	0.82344	0.491000	0.48974	CCC	.		0.652	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398519.2	NM_013279	
MYT1L	23040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	1812887	1812887	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr2:1812887C>T	ENST00000399161.2	-	22	3880	c.3133G>A	c.(3133-3135)Gga>Aga	p.G1045R	MYT1L_ENST00000407844.1_Missense_Mutation_p.G41R|MYT1L_ENST00000428368.2_Missense_Mutation_p.G1043R	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1045					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		ATCTGCTCTCCAGAAAGCTTT	0.592																																					p.G1043R		.											.	MYT1L	95	0			c.G3127A						.						116.0	123.0	121.0					2																	1812887		2147	4245	6392	SO:0001583	missense	23040	exon22			GCTCTCCAGAAAG	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3133G>A	2.37:g.1812887C>T	ENSP00000382114:p.Gly1045Arg	197.0	0.0		170.0	26.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37		.	.	.	.	.	.	.	.	.	.	C	29.7	5.029396	0.93518	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000407844;ENST00000399157;ENST00000428368	T;T;T	0.48201	0.82;1.62;0.82	5.24	5.24	0.73138	.	0.108901	0.64402	D	0.000007	T	0.63189	0.2490	M	0.62723	1.935	0.80722	D	1	P;D;D	0.63880	0.587;0.988;0.993	B;P;P	0.57776	0.221;0.676;0.827	T	0.64202	-0.6463	10	0.49607	T	0.09	-16.9142	18.8228	0.92105	0.0:1.0:0.0:0.0	.	41;1045;1043	Q9UL68-3;Q9UL68;Q9UL68-4	.;MYT1L_HUMAN;.	R	1045;991;41;99;1043	ENSP00000382114:G1045R;ENSP00000382111:G99R;ENSP00000396103:G1043R	ENSP00000295067:G991R	G	-	1	0	MYT1L	1791894	1.000000	0.71417	0.837000	0.33122	0.967000	0.64934	4.754000	0.62191	2.439000	0.82584	0.655000	0.94253	GGA	.		0.592	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
NDST3	9348	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	119154261	119154261	+	Silent	SNP	T	T	C			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr4:119154261T>C	ENST00000296499.5	+	9	2317	c.1914T>C	c.(1912-1914)aaT>aaC	p.N638N	NDST3_ENST00000433996.2_Intron	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	638	Heparan sulfate N-sulfotransferase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						AGTTCTTTAATAGAAATAACT	0.368																																					p.N638N		.											.	NDST3	153	0			c.T1914C						.						100.0	100.0	100.0					4																	119154261		2203	4300	6503	SO:0001819	synonymous_variant	9348	exon9			CTTTAATAGAAAT	AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.1914T>C	4.37:g.119154261T>C		234.0	0.0		238.0	45.0	NM_004784	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Silent	SNP	ENST00000296499.5	37	CCDS3708.1																																																																																			.		0.368	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	NM_004784	
NELFB	25920	ucsc.edu;bcgsc.ca	37	9	140151427	140151427	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr9:140151427A>G	ENST00000343053.4	+	4	855	c.518A>G	c.(517-519)gAg>gGg	p.E173G		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	173					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CTGGAGAAGGAGAGCGCTCTC	0.612																																					p.E173G		.											.	.	.	0			c.A518G						.						96.0	86.0	90.0					9																	140151427		2203	4300	6503	SO:0001583	missense	25920	exon4			AGAAGGAGAGCGC	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.518A>G	9.37:g.140151427A>G	ENSP00000339495:p.Glu173Gly	38.0	0.0		58.0	6.0	NM_015456	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Missense_Mutation	SNP	ENST00000343053.4	37	CCDS7040.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.332926	0.81801	.	.	ENSG00000188986	ENST00000343053	.	.	.	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.78717	0.4327	M	0.78637	2.42	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.81881	-0.0729	9	0.87932	D	0	-49.9089	13.8763	0.63655	1.0:0.0:0.0:0.0	.	173	Q8WX92	NELFB_HUMAN	G	173	.	ENSP00000339495:E173G	E	+	2	0	COBRA1	139271248	1.000000	0.71417	0.988000	0.46212	0.596000	0.36781	8.949000	0.93012	1.954000	0.56735	0.459000	0.35465	GAG	.		0.612	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1	NM_015456	
NF2	4771	broad.mit.edu;ucsc.edu;mdanderson.org	37	22	30069414	30069414	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr22:30069414G>T	ENST00000338641.4	+	12	1720	c.1279G>T	c.(1279-1281)Gag>Tag	p.E427*	NF2_ENST00000347330.5_Intron|NF2_ENST00000397789.3_Nonsense_Mutation_p.E427*|NF2_ENST00000361452.4_Nonsense_Mutation_p.E386*|NF2_ENST00000361166.4_Nonsense_Mutation_p.E427*|NF2_ENST00000334961.7_Nonsense_Mutation_p.E344*|NF2_ENST00000413209.2_Intron|NF2_ENST00000353887.4_Nonsense_Mutation_p.E344*|NF2_ENST00000403435.1_Nonsense_Mutation_p.E398*|NF2_ENST00000403999.3_Nonsense_Mutation_p.E427*|NF2_ENST00000361676.4_Nonsense_Mutation_p.E385*	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	427	Glu-rich.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(3)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						GCGCCTGATGGAGCAGAAGGT	0.632			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.E427X		.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2	4696	3	Unknown(3)	large_intestine(1)|stomach(1)|central_nervous_system(1)	c.G1279T	GRCh37	CM002818	NF2	M		.						53.0	46.0	48.0					22																	30069414		2203	4300	6503	SO:0001587	stop_gained	4771	exon12	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	CTGATGGAGCAGA	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.1279G>T	22.37:g.30069414G>T	ENSP00000344666:p.Glu427*	96.0	1.0		106.0	25.0	NM_000268	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Nonsense_Mutation	SNP	ENST00000338641.4	37	CCDS13861.1	.	.	.	.	.	.	.	.	.	.	G	42	9.416160	0.99164	.	.	ENSG00000186575	ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2159	0.98296	0.0:0.0:1.0:0.0	.	.	.	.	X	427;398;386;402;427;344;344;427;385;427	.	.	E	+	1	0	NF2	28399414	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.848000	0.99507	2.882000	0.98803	0.655000	0.94253	GAG	.		0.632	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
NR2F2	7026	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	96875607	96875608	+	Frame_Shift_Del	DEL	CG	CG	-			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr15:96875607_96875608delCG	ENST00000394166.3	+	1	1662_1663	c.273_274delCG	c.(271-276)tacggcfs	p.YG91fs	NR2F2_ENST00000453270.2_5'Flank|NR2F2_ENST00000421109.2_Intron|MIR1469_ENST00000410719.1_RNA|NR2F2_ENST00000394171.2_5'Flank	NM_021005.3	NP_066285.1	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	91					anterior/posterior pattern specification (GO:0009952)|blood vessel morphogenesis (GO:0048514)|fertilization (GO:0009566)|forebrain development (GO:0030900)|intracellular receptor signaling pathway (GO:0030522)|limb development (GO:0060173)|lipid metabolic process (GO:0006629)|maternal placenta development (GO:0001893)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|radial pattern formation (GO:0009956)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(2)|lung(3)|ovary(2)|urinary_tract(1)	17	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			GCAAGCACTACGGCCAGTTCAC	0.653																																					p.91_92del		.											.	NR2F2	228	0			c.273_274del						.																																			SO:0001589	frameshift_variant	7026	exon1			GCACTACGGCCAG	M64497	CCDS10375.1, CCDS45358.1, CCDS45359.1	15q26	2013-01-16			ENSG00000185551	ENSG00000185551		"""Nuclear hormone receptors"""	7976	protein-coding gene	gene with protein product		107773		ARP1, TFCOUP2		8530078, 11544252	Standard	NM_021005		Approved	COUP-TFII, COUPTFB, SVP40, NF-E3	uc010uri.2	P24468	OTTHUMG00000149848	ENST00000394166.3:c.273_274delCG	15.37:g.96875607_96875608delCG	ENSP00000377721:p.Tyr91fs	100.0	0.0		100.0	15.0	NM_021005	B4DQJ2|B6ZGU1|Q03754|Q3KQR7	Frame_Shift_Del	DEL	ENST00000394166.3	37	CCDS10375.1																																																																																			.		0.653	NR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313534.1		
NTF3	4908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	5603521	5603521	+	Silent	SNP	G	G	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr12:5603521G>A	ENST00000331010.6	+	1	224	c.141G>A	c.(139-141)aaG>aaA	p.K47K	NTF3_ENST00000535299.1_Intron|NTF3_ENST00000423158.3_Silent_p.K60K	NM_002527.4	NP_002518.1	P20783	NTF3_HUMAN	neurotrophin 3	47					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell-cell signaling (GO:0007267)|enteric nervous system development (GO:0048484)|epidermis development (GO:0008544)|glial cell fate determination (GO:0007403)|induction of positive chemotaxis (GO:0050930)|mechanoreceptor differentiation (GO:0042490)|myelination (GO:0042552)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive chemotaxis (GO:0050918)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of synaptic transmission (GO:0050804)|signal transduction (GO:0007165)|smooth muscle cell differentiation (GO:0051145)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular region (GO:0005576)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(3)|upper_aerodigestive_tract(1)	22						TGAAAAACAAGCTCTCCAAGC	0.517																																					p.K60K	GBM(194;1104 2182 8339 9578 18493)	.											.	NTF3	205	0			c.G180A						.						88.0	91.0	90.0					12																	5603521		2203	4300	6503	SO:0001819	synonymous_variant	4908	exon2			AAACAAGCTCTCC		CCDS8538.1, CCDS44806.1	12p13	2014-01-30			ENSG00000185652	ENSG00000185652		"""Endogenous ligands"""	8023	protein-coding gene	gene with protein product		162660				1889806	Standard	NM_002527		Approved	NGF2	uc001qnk.4	P20783	OTTHUMG00000168649	ENST00000331010.6:c.141G>A	12.37:g.5603521G>A		68.0	0.0		54.0	10.0	NM_001102654	B7Z1T5|Q6FH50	Silent	SNP	ENST00000331010.6	37	CCDS8538.1																																																																																			.		0.517	NTF3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400486.1		
NUP205	23165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	135269705	135269705	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr7:135269705C>T	ENST00000285968.6	+	8	1194	c.1168C>T	c.(1168-1170)Cgc>Tgc	p.R390C	NUP205_ENST00000440390.2_Missense_Mutation_p.R184C	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	390					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						ATTTTATATTCGCAGAGTCCA	0.348																																					p.R390C		.											.	NUP205	207	0			c.C1168T						.						56.0	55.0	55.0					7																	135269705		2203	4300	6503	SO:0001583	missense	23165	exon8			TATATTCGCAGAG	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.1168C>T	7.37:g.135269705C>T	ENSP00000285968:p.Arg390Cys	161.0	0.0		153.0	18.0	NM_015135	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.848444	0.91277	.	.	ENSG00000155561	ENST00000285968;ENST00000440390	T;T	0.35605	1.3;1.3	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.64204	0.2577	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.66901	-0.5806	10	0.66056	D	0.02	-27.8968	19.44	0.94815	0.0:1.0:0.0:0.0	.	390	Q92621	NU205_HUMAN	C	390;184	ENSP00000285968:R390C;ENSP00000401983:R184C	ENSP00000285968:R390C	R	+	1	0	NUP205	134920245	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	7.818000	0.86416	2.586000	0.87340	0.591000	0.81541	CGC	.		0.348	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
OR2B11	127623	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	247614391	247614391	+	Silent	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr1:247614391A>G	ENST00000318749.6	-	1	917	c.894T>C	c.(892-894)aaT>aaC	p.N298N		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	298						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TCATATCTTTATTTCTCAGGG	0.473																																					p.N298N		.											.	OR2B11	69	0			c.T894C						.						186.0	200.0	195.0					1																	247614391		2203	4300	6503	SO:0001819	synonymous_variant	127623	exon1			ATCTTTATTTCTC		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.894T>C	1.37:g.247614391A>G		202.0	0.0		186.0	28.0	NM_001004492	B2RP03	Silent	SNP	ENST00000318749.6	37	CCDS31090.1																																																																																			.		0.473	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492	
OR2W3	343171	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	248059698	248059698	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr1:248059698G>T	ENST00000360358.3	+	1	810	c.810G>T	c.(808-810)caG>caT	p.Q270H	OR2W3_ENST00000537741.1_Missense_Mutation_p.Q270H	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CCCAGGACCAGGGCATGTTCC	0.537																																					p.Q270H		.											.	OR2W3	115	0			c.G810T						.						113.0	104.0	107.0					1																	248059698		2203	4300	6503	SO:0001583	missense	343171	exon1			GGACCAGGGCATG	N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.810G>T	1.37:g.248059698G>T	ENSP00000353516:p.Gln270His	292.0	1.0		269.0	69.0	NM_001001957	Q6IF06|Q8NG86	Missense_Mutation	SNP	ENST00000360358.3	37	CCDS31099.1	.	.	.	.	.	.	.	.	.	.	G	13.07	2.126206	0.37533	.	.	ENSG00000238243	ENST00000537741;ENST00000360358	T;T	0.00169	8.63;8.63	5.29	0.952	0.19584	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000025	T	0.00328	0.0010	M	0.67569	2.06	0.09310	N	1	D	0.89917	1.0	D	0.79108	0.992	T	0.52313	-0.8592	10	0.62326	D	0.03	.	0.8499	0.01170	0.2541:0.1233:0.3832:0.2394	.	270	Q7Z3T1	OR2W3_HUMAN	H	270	ENSP00000445853:Q270H;ENSP00000353516:Q270H	ENSP00000353516:Q270H	Q	+	3	2	OR2W3	246126321	0.000000	0.05858	1.000000	0.80357	0.670000	0.39368	-0.971000	0.03806	0.326000	0.23384	-0.192000	0.12808	CAG	.		0.537	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096861.1	NM_001001957	
OR5D13	390142	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	55541610	55541610	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr11:55541610G>A	ENST00000361760.1	+	1	697	c.697G>A	c.(697-699)Gca>Aca	p.A233T		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				GATGCGATCTGCAAGTGGGCG	0.418																																					p.A233T		.											.	OR5D13	71	0			c.G697A						.						133.0	120.0	124.0					11																	55541610		2200	4296	6496	SO:0001583	missense	390142	exon1			CGATCTGCAAGTG	BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.697G>A	11.37:g.55541610G>A	ENSP00000354800:p.Ala233Thr	170.0	0.0		189.0	17.0	NM_001001967	Q6IF68|Q6IFC9	Missense_Mutation	SNP	ENST00000361760.1	37	CCDS31507.1	.	.	.	.	.	.	.	.	.	.	G	8.180	0.793602	0.16327	.	.	ENSG00000198877	ENST00000361760	T	0.00174	8.62	3.82	-0.775	0.10988	GPCR, rhodopsin-like superfamily (1);	0.514144	0.14326	N	0.326681	T	0.00109	0.0003	N	0.20357	0.565	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.12553	-1.0543	10	0.28530	T	0.3	-0.3088	3.2185	0.06707	0.471:0.0:0.2483:0.2807	.	233	Q8NGL4	OR5DD_HUMAN	T	233	ENSP00000354800:A233T	ENSP00000354800:A233T	A	+	1	0	OR5D13	55298186	0.000000	0.05858	0.004000	0.12327	0.015000	0.08874	-0.680000	0.05197	0.230000	0.21059	0.486000	0.48141	GCA	.		0.418	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391511.1	NM_001001967	
PCDHA6	56142	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140210049	140210049	+	Silent	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr5:140210049A>G	ENST00000529310.1	+	1	2487	c.2373A>G	c.(2371-2373)ttA>ttG	p.L791L	PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	791					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCAGGATTTAAATGAAGATC	0.368																																					p.L791L		.											.	PCDHA6	92	0			c.A2373G						.						60.0	64.0	63.0					5																	140210049		2203	4300	6503	SO:0001819	synonymous_variant	56142	exon1			GGATTTAAATGAA	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.2373A>G	5.37:g.140210049A>G		133.0	0.0		153.0	12.0	NM_018909	O75283|Q9NRT8	Silent	SNP	ENST00000529310.1	37	CCDS47281.1																																																																																			.		0.368	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
PCDHB1	29930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140432442	140432442	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr5:140432442G>A	ENST00000306549.3	+	1	1464	c.1387G>A	c.(1387-1389)Gaa>Aaa	p.E463K		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	463	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GACTGTTCGAGAAAACAACAG	0.413																																					p.E463K		.											.	PCDHB1	90	0			c.G1387A						.						76.0	75.0	75.0					5																	140432442		2203	4300	6503	SO:0001583	missense	29930	exon1			GTTCGAGAAAACA	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.1387G>A	5.37:g.140432442G>A	ENSP00000307234:p.Glu463Lys	146.0	0.0		147.0	23.0	NM_013340	Q2M257	Missense_Mutation	SNP	ENST00000306549.3	37	CCDS4243.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.631364	0.87660	.	.	ENSG00000171815	ENST00000306549	T	0.76316	-1.01	6.17	6.17	0.99709	Cadherin (4);Cadherin-like (1);	0.000000	0.45606	D	0.000356	D	0.94453	0.8215	H	0.99770	4.765	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.96165	0.9118	10	0.87932	D	0	.	20.4898	0.99202	0.0:0.0:1.0:0.0	.	463	Q9Y5F3	PCDB1_HUMAN	K	463	ENSP00000307234:E463K	ENSP00000307234:E463K	E	+	1	0	PCDHB1	140412626	1.000000	0.71417	0.998000	0.56505	0.878000	0.50629	6.688000	0.74557	2.941000	0.99782	0.655000	0.94253	GAA	.		0.413	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
PCDHGA6	56109	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140753695	140753695	+	Silent	SNP	G	G	T	rs376765941		TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr5:140753695G>T	ENST00000517434.1	+	1	45	c.45G>T	c.(43-45)ctG>ctT	p.L15L	PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	15					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCAGGTCCTGCTCCTCACGC	0.597																																					p.L15L		.											.	PCDHGA6	67	0			c.G45T						.	G	,,,,,,,,,	1,3989		0,1,1994	14.0	17.0	16.0		,,,,,45,,,,45	1.0	0.0	5		16	0,8370		0,0,4185	no	intron,intron,intron,intron,intron,coding-synonymous,intron,intron,intron,coding-synonymous	PCDHGB3,PCDHGB2,PCDHGB1,PCDHGA6,PCDHGA5,PCDHGA4,PCDHGA3,PCDHGA2,PCDHGA1	NM_018912.2,NM_018915.2,NM_018916.3,NM_018917.2,NM_018918.2,NM_018919.2,NM_018922.2,NM_018923.2,NM_018924.2,NM_032086.1	,,,,,,,,,	0,1,6179	TT,TG,GG		0.0,0.0251,0.0081	,,,,,,,,,	,,,,,15/933,,,,15/819	140753695	1,12359	1995	4185	6180	SO:0001819	synonymous_variant	56109	exon1			GGTCCTGCTCCTC	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.45G>T	5.37:g.140753695G>T		122.0	0.0		176.0	47.0	NM_018919	A6H8K7|B2RN55|Q9Y5D1	Silent	SNP	ENST00000517434.1	37	CCDS54926.1																																																																																			.		0.597	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919	
PDE1C	5137	broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	31877505	31877505	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr7:31877505G>A	ENST00000396191.1	-	10	1516	c.1061C>T	c.(1060-1062)aCt>aTt	p.T354I	PDE1C_ENST00000396193.1_Missense_Mutation_p.T414I|PDE1C_ENST00000396184.3_Missense_Mutation_p.T354I|PDE1C_ENST00000321453.7_Missense_Mutation_p.T354I|PDE1C_ENST00000396182.2_Missense_Mutation_p.T354I	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	354	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)	p.T354I(2)|p.T414I(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	CTGCAGAGCAGTCTTCATTGC	0.433																																					p.T414I		.											.	PDE1C	94	3	Substitution - Missense(3)	lung(3)	c.C1241T						.						191.0	184.0	187.0					7																	31877505		2203	4300	6503	SO:0001583	missense	5137	exon11			AGAGCAGTCTTCA	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1061C>T	7.37:g.31877505G>A	ENSP00000379494:p.Thr354Ile	109.0	0.0		117.0	11.0	NM_001191058	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	ENST00000396191.1	37	CCDS55099.1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.953691	0.53293	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05	5.53	4.59	0.56863	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.090141	0.64402	D	0.000001	T	0.73079	0.3541	M	0.66297	2.02	0.43021	D	0.994577	B;B;B	0.24920	0.016;0.017;0.114	B;B;B	0.21917	0.037;0.009;0.03	T	0.74087	-0.3778	10	0.87932	D	0	.	8.4074	0.32622	0.0:0.1284:0.5786:0.293	.	354;414;354	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	I	414;354;354;354;354	ENSP00000379496:T414I;ENSP00000379494:T354I;ENSP00000318105:T354I;ENSP00000379487:T354I;ENSP00000379485:T354I	ENSP00000318105:T354I	T	-	2	0	PDE1C	31844030	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	5.689000	0.68234	2.603000	0.88011	0.655000	0.94253	ACT	.		0.433	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1		
PIK3CB	5291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	138426053	138426053	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr3:138426053A>G	ENST00000477593.1	-	10	1551	c.1478T>C	c.(1477-1479)gTt>gCt	p.V493A	PIK3CB_ENST00000289153.2_Missense_Mutation_p.V493A|PIK3CB_ENST00000544716.1_Intron			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	493	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	TGGAAATTTAACATGCAAAGC	0.313																																					p.V493A		.											.	PIK3CB	1311	0			c.T1478C						.						107.0	106.0	106.0					3																	138426053		2203	4300	6503	SO:0001583	missense	5291	exon9			AATTTAACATGCA		CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.1478T>C	3.37:g.138426053A>G	ENSP00000418143:p.Val493Ala	257.0	0.0		265.0	34.0	NM_006219	D3DNF0|Q24JU2	Missense_Mutation	SNP	ENST00000477593.1	37	CCDS3104.1	.	.	.	.	.	.	.	.	.	.	A	12.41	1.930360	0.34096	.	.	ENSG00000051382	ENST00000477593;ENST00000289153	T;T	0.73789	-0.78;-0.78	5.84	4.67	0.58626	C2 calcium/lipid-binding domain, CaLB (1);	0.830341	0.11251	N	0.583632	T	0.73552	0.3601	L	0.52011	1.625	0.80722	D	1	B;B	0.29270	0.08;0.24	B;B	0.36092	0.142;0.217	T	0.68758	-0.5324	10	0.87932	D	0	-6.1165	11.9542	0.52973	0.932:0.0:0.068:0.0	.	493;97	P42338;B4DZI3	PK3CB_HUMAN;.	A	493	ENSP00000418143:V493A;ENSP00000289153:V493A	ENSP00000289153:V493A	V	-	2	0	PIK3CB	139908743	1.000000	0.71417	0.572000	0.28498	0.194000	0.23727	8.690000	0.91272	1.024000	0.39682	0.482000	0.46254	GTT	.		0.313	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358019.1		
GSAP	54103	ucsc.edu;bcgsc.ca	37	7	76982931	76982931	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr7:76982931A>G	ENST00000257626.7	-	17	1444	c.1366T>C	c.(1366-1368)Tct>Cct	p.S456P		NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	456					positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)										TGGCAGGCAGAGACATTCTCA	0.373																																					p.S456P		.											.	PION	514	0			c.T1366C						.						94.0	90.0	92.0					7																	76982931		2203	4300	6503	SO:0001583	missense	54103	exon17			AGGCAGAGACATT		CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.1366T>C	7.37:g.76982931A>G	ENSP00000257626:p.Ser456Pro	70.0	0.0		47.0	4.0	NM_017439	A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Missense_Mutation	SNP	ENST00000257626.7	37	CCDS34672.2	.	.	.	.	.	.	.	.	.	.	A	9.051	0.992034	0.18966	.	.	ENSG00000186088	ENST00000257626	T	0.19105	2.17	5.57	4.41	0.53225	.	0.760424	0.11816	N	0.526661	T	0.23572	0.0570	M	0.64997	1.995	0.22771	N	0.998759	B;B	0.20671	0.047;0.023	B;B	0.20955	0.032;0.016	T	0.19778	-1.0295	10	0.52906	T	0.07	.	8.1882	0.31352	0.9017:0.0:0.0983:0.0	.	456;456	A4D1B5-3;A4D1B5	.;GSAP_HUMAN	P	456	ENSP00000257626:S456P	ENSP00000257626:S456P	S	-	1	0	PION	76820867	0.829000	0.29322	0.728000	0.30774	0.590000	0.36582	2.308000	0.43690	0.941000	0.37499	0.528000	0.53228	TCT	.		0.373	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318672.2	NM_017439	
PLCL1	5334	broad.mit.edu;bcgsc.ca	37	2	198950191	198950191	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr2:198950191T>A	ENST00000428675.1	+	2	2348	c.1950T>A	c.(1948-1950)gaT>gaA	p.D650E	PLCL1_ENST00000437704.2_Missense_Mutation_p.D552E	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	650	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	TGAGGATCGATTCCAGTAACT	0.423																																					p.D650E		.											.	PLCL1	228	0			c.T1950A						.						41.0	43.0	43.0					2																	198950191		2202	4299	6501	SO:0001583	missense	5334	exon2			GATCGATTCCAGT	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.1950T>A	2.37:g.198950191T>A	ENSP00000402861:p.Asp650Glu	164.0	1.0		153.0	7.0	NM_006226	Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	ENST00000428675.1	37	CCDS2326.2	.	.	.	.	.	.	.	.	.	.	T	14.54	2.565551	0.45694	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.57436	0.4;0.4	5.36	0.398	0.16319	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.169626	0.41294	D	0.000909	T	0.72153	0.3425	M	0.88310	2.945	0.50467	D	0.999872	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.72394	-0.4307	9	.	.	.	.	10.2899	0.43590	0.0:0.4659:0.0:0.5341	.	650;576	Q15111;B4DYZ4	PLCL1_HUMAN;.	E	650;552	ENSP00000402861:D650E;ENSP00000414138:D552E	.	D	+	3	2	PLCL1	198658436	0.987000	0.35691	0.976000	0.42696	0.953000	0.61014	0.173000	0.16724	-0.063000	0.13065	0.459000	0.35465	GAT	.		0.423	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226	
PLEK2	26499	ucsc.edu;bcgsc.ca	37	14	67862126	67862126	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr14:67862126T>C	ENST00000216446.4	-	3	522	c.382A>G	c.(382-384)Agc>Ggc	p.S128G	PLEK2_ENST00000557388.1_5'Flank	NM_016445.1	NP_057529.1	Q9NYT0	PLEK2_HUMAN	pleckstrin 2	128					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	15				all cancers(60;0.000728)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.00953)		CACTGCAGGCTGATGTGCGGG	0.657																																					p.S128G		.											.	PLEK2	92	0			c.A382G						.						42.0	42.0	42.0					14																	67862126		2203	4300	6503	SO:0001583	missense	26499	exon3			GCAGGCTGATGTG	AF228603	CCDS9782.1	14q23.3	2014-08-12			ENSG00000100558	ENSG00000100558		"""Pleckstrin homology (PH) domain containing"""	19238	protein-coding gene	gene with protein product		608007				11911883, 17658464	Standard	NM_016445		Approved		uc001xjh.1	Q9NYT0	OTTHUMG00000171247	ENST00000216446.4:c.382A>G	14.37:g.67862126T>C	ENSP00000216446:p.Ser128Gly	47.0	1.0		47.0	5.0	NM_016445	Q96JT0	Missense_Mutation	SNP	ENST00000216446.4	37	CCDS9782.1	.	.	.	.	.	.	.	.	.	.	T	16.44	3.124873	0.56613	.	.	ENSG00000100558	ENST00000216446;ENST00000554395	D;T	0.94046	-3.34;2.4	5.48	5.48	0.80851	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.123875	0.85682	D	0.000000	D	0.87305	0.6144	L	0.29908	0.895	0.41847	D	0.990159	P	0.38767	0.646	B	0.34093	0.175	D	0.86160	0.1593	10	0.20519	T	0.43	-2.0559	14.1413	0.65322	0.0:0.0:0.0:1.0	.	128	Q9NYT0	PLEK2_HUMAN	G	128;62	ENSP00000216446:S128G;ENSP00000450892:S62G	ENSP00000216446:S128G	S	-	1	0	PLEK2	66931879	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	5.004000	0.63966	2.084000	0.62774	0.379000	0.24179	AGC	.		0.657	PLEK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412547.2		
PRRT3	285368	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	9991578	9991578	+	Silent	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr3:9991578A>G	ENST00000412055.1	-	2	351	c.222T>C	c.(220-222)gaT>gaC	p.D74D	PRRT3-AS1_ENST00000431558.1_RNA|PRRT3_ENST00000411976.2_Silent_p.D74D	NM_207351.3	NP_997234.3	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3	74						integral component of membrane (GO:0016021)				NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)|stomach(2)	13						CGTGGCGGACATCAGAGTTCC	0.627																																					p.D74D		.											.	PRRT3	90	0			c.T222C						.						53.0	60.0	57.0					3																	9991578		2009	4178	6187	SO:0001819	synonymous_variant	285368	exon2			GCGGACATCAGAG	AK090993	CCDS43049.1	3p25.3	2011-10-10			ENSG00000163704	ENSG00000163704		"""Proline-rich transmembrane proteins"""	26591	protein-coding gene	gene with protein product							Standard	NM_207351		Approved	FLJ33674	uc003bul.2	Q5FWE3	OTTHUMG00000155285	ENST00000412055.1:c.222T>C	3.37:g.9991578A>G		90.0	0.0		120.0	25.0	NM_207351	Q49AD0|Q6UXY6|Q8NBC9	Silent	SNP	ENST00000412055.1	37	CCDS43049.1																																																																																			.		0.627	PRRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339322.1	NM_207351	
RASSF4	83937	ucsc.edu;bcgsc.ca	37	10	45479554	45479554	+	Silent	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr10:45479554C>T	ENST00000340258.5	+	5	479	c.366C>T	c.(364-366)gaC>gaT	p.D122D	RASSF4_ENST00000472561.1_Intron|RASSF4_ENST00000334940.6_Silent_p.D131D|RASSF4_ENST00000374417.2_Intron	NM_032023.3	NP_114412.2	Q8WYP3	RIN2_HUMAN	Ras association (RalGDS/AF-6) domain family member 4	287	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						GTTCCACAGACAGCTCGGGTA	0.597																																					p.D122D		.											.	RASSF4	290	0			c.C366T						.						47.0	43.0	45.0					10																	45479554		2199	4297	6496	SO:0001819	synonymous_variant	83937	exon5			CACAGACAGCTCG	BC032593	CCDS7208.1	10q11.1	2008-02-22	2008-02-22		ENSG00000107551	ENSG00000107551			20793	protein-coding gene	gene with protein product		610559					Standard	NM_032023		Approved	AD037, MGC44914	uc001jbo.3	Q9H2L5	OTTHUMG00000018060	ENST00000340258.5:c.366C>T	10.37:g.45479554C>T		27.0	0.0		39.0	4.0	NM_032023	Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	ENST00000340258.5	37	CCDS7208.1																																																																																			.		0.597	RASSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047745.2	NM_032023	
SEMA6C	10500	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	151108527	151108527	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr1:151108527G>T	ENST00000341697.3	-	13	2910	c.1219C>A	c.(1219-1221)Cca>Aca	p.P407T				Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	407	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GTGACAGGTGGTACAGCGGGG	0.572																																					p.P407T		.											.	SEMA6C	92	0			c.C1219A						.						128.0	120.0	123.0					1																	151108527		2203	4300	6503	SO:0001583	missense	10500	exon13			CAGGTGGTACAGC	AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.1219C>A	1.37:g.151108527G>T	ENSP00000344148:p.Pro407Thr	284.0	0.0		452.0	170.0	NM_001178061	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Missense_Mutation	SNP	ENST00000341697.3	37	CCDS984.1	.	.	.	.	.	.	.	.	.	.	G	18.60	3.658586	0.67586	.	.	ENSG00000143434	ENST00000368914;ENST00000368912;ENST00000368913;ENST00000341697	T;T;T;T	0.10005	2.92;2.92;2.92;2.92	5.35	5.35	0.76521	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.056339	0.64402	D	0.000001	T	0.24160	0.0585	M	0.68593	2.085	0.47308	D	0.999387	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.996;0.998;0.999	T	0.00533	-1.1685	10	0.59425	D	0.04	.	16.5625	0.84570	0.0:0.0:1.0:0.0	.	407;367;407;407	B4DZD4;Q9H3T2-2;Q9H3T2-3;Q9H3T2	.;.;.;SEM6C_HUMAN	T	407;367;407;407	ENSP00000357910:P407T;ENSP00000357908:P367T;ENSP00000357909:P407T;ENSP00000344148:P407T	ENSP00000344148:P407T	P	-	1	0	SEMA6C	149375151	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	3.325000	0.52030	2.526000	0.85167	0.561000	0.74099	CCA	.		0.572	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034074.1	NM_030913	
SGK3	23678	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	67752248	67752248	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr8:67752248A>G	ENST00000396596.1	+	11	966	c.752A>G	c.(751-753)cAc>cGc	p.H251R	SGK3_ENST00000521198.2_Missense_Mutation_p.H251R|SGK3_ENST00000520976.1_Missense_Mutation_p.H251R|SGK3_ENST00000522398.1_Missense_Mutation_p.H251R|C8orf44-SGK3_ENST00000519289.1_Missense_Mutation_p.H251R|SGK3_ENST00000345714.4_Missense_Mutation_p.H251R|SGK3_ENST00000521435.1_3'UTR	NM_013257.4	NP_037389.4	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase family, member 3	251	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ion transmembrane transport (GO:0034220)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to stress (GO:0006950)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|phosphatidylinositol binding (GO:0035091)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	18	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CTTTTTTTCCACTTACAAAGA	0.398																																					p.H251R		.											.	SGK3	1003	0			c.A752G						.						113.0	96.0	102.0					8																	67752248		2203	4300	6503	SO:0001583	missense	23678	exon11			TTTTCCACTTACA		CCDS6195.1, CCDS6196.1	8q12	2008-07-28	2005-09-13	2005-09-13		ENSG00000104205			10812	protein-coding gene	gene with protein product		607591	"""serum/glucocorticoid regulated kinase-like"""	SGK2, SGKL		10585774, 10548550	Standard	NM_013257		Approved		uc003xwr.3	Q96BR1		ENST00000396596.1:c.752A>G	8.37:g.67752248A>G	ENSP00000379842:p.His251Arg	145.0	1.0		183.0	72.0	NM_001033578	A8K5W3|B3KQC2|Q9P1Q7|Q9UKG5	Missense_Mutation	SNP	ENST00000396596.1	37	CCDS6195.1	.	.	.	.	.	.	.	.	.	.	A	16.32	3.089251	0.55968	.	.	ENSG00000104205	ENST00000519289;ENST00000521198;ENST00000262211;ENST00000522398;ENST00000520976;ENST00000396596;ENST00000345714;ENST00000521152	T;T;T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14	5.29	5.29	0.74685	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.69124	0.3076	L	0.28344	0.845	0.48087	D	0.999580	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.76642	-0.2884	9	0.87932	D	0	.	15.2148	0.73258	1.0:0.0:0.0:0.0	.	251;251	Q96BR1-2;Q96BR1	.;SGK3_HUMAN	R	251;251;251;251;251;251;251;148	ENSP00000429022:H251R;ENSP00000430463:H251R;ENSP00000430256:H251R;ENSP00000430691:H251R;ENSP00000379842:H251R;ENSP00000331816:H251R;ENSP00000429565:H148R	ENSP00000262211:H251R	H	+	2	0	SGK3	67914802	1.000000	0.71417	1.000000	0.80357	0.006000	0.05464	9.264000	0.95635	1.978000	0.57642	0.528000	0.53228	CAC	.		0.398	SGK3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379232.3		
SH3D21	79729	broad.mit.edu;bcgsc.ca	37	1	36774016	36774016	+	Silent	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr1:36774016A>G	ENST00000426732.2	+	8	603	c.318A>G	c.(316-318)gaA>gaG	p.E106E	SH3D21_ENST00000453908.2_Silent_p.E222E|SH3D21_ENST00000505871.1_Silent_p.E111E|SH3D21_ENST00000312808.4_5'UTR			A4FU49	SH321_HUMAN	SH3 domain containing 21	106	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.					extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(6)|lung(4)|pancreas(1)	12						GCTGGTGGGAAGGAGAGTGTC	0.572																																					p.E222E		.											.	SH3D21	91	0			c.A666G						.						52.0	47.0	48.0					1																	36774016		692	1591	2283	SO:0001819	synonymous_variant	79729	exon9			GTGGGAAGGAGAG	AK056459	CCDS30674.1, CCDS30674.2	1p34.3	2011-02-21	2011-02-21	2011-02-21	ENSG00000214193	ENSG00000214193			26236	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 113"""	C1orf113		12477932	Standard	NM_024676		Approved	FLJ22938	uc010oia.1	A4FU49	OTTHUMG00000007868	ENST00000426732.2:c.318A>G	1.37:g.36774016A>G		51.0	0.0		90.0	7.0	NM_001162530	B4DLI6|D3DPS6|J3KQM5|Q5VTK7|Q86XZ6|Q8N445|Q96DN4|Q9H5W5	Silent	SNP	ENST00000426732.2	37																																																																																				.		0.572	SH3D21-202	KNOWN	basic	protein_coding	protein_coding		NM_024676	
SLC13A1	6561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	122787291	122787291	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr7:122787291G>C	ENST00000194130.2	-	7	773	c.734C>G	c.(733-735)gCc>gGc	p.A245G	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	245					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	AGAAGAGTAGGCAATGCACAA	0.413																																					p.A245G		.											.	SLC13A1	92	0			c.C734G						.						242.0	184.0	204.0					7																	122787291		2203	4300	6503	SO:0001583	missense	6561	exon7			GAGTAGGCAATGC		CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.734C>G	7.37:g.122787291G>C	ENSP00000194130:p.Ala245Gly	163.0	0.0		168.0	29.0	NM_022444	Q9H5Z0	Missense_Mutation	SNP	ENST00000194130.2	37	CCDS5786.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.720452	0.89205	.	.	ENSG00000081800	ENST00000194130	T	0.03094	4.05	5.0	5.0	0.66597	.	0.107097	0.64402	D	0.000006	T	0.18841	0.0452	M	0.85777	2.775	0.80722	D	1	D;D	0.55800	0.973;0.973	P;P	0.62382	0.901;0.901	T	0.00512	-1.1696	10	0.51188	T	0.08	.	15.81	0.78552	0.0:0.0:1.0:0.0	.	245;245	A4D0X1;Q9BZW2	.;S13A1_HUMAN	G	245	ENSP00000194130:A245G	ENSP00000194130:A245G	A	-	2	0	SLC13A1	122574527	1.000000	0.71417	0.995000	0.50966	0.968000	0.65278	8.354000	0.90080	2.337000	0.79520	0.563000	0.77884	GCC	.		0.413	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347404.1	NM_022444	
SLC2A14	144195	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	7967043	7967043	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr12:7967043G>A	ENST00000543909.1	-	16	2191	c.1432C>T	c.(1432-1434)Cgt>Tgt	p.R478C	SLC2A14_ENST00000340749.5_Missense_Mutation_p.R455C|SLC2A14_ENST00000535295.1_Missense_Mutation_p.R369C|SLC2A14_ENST00000542505.1_Missense_Mutation_p.R119C|SLC2A14_ENST00000539924.1_Missense_Mutation_p.R493C|SLC2A14_ENST00000542546.1_Missense_Mutation_p.R369C|SLC2A14_ENST00000431042.2_Missense_Mutation_p.R455C|SLC2A14_ENST00000396589.2_Missense_Mutation_p.R478C			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	478					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		GTCCTGCCACGGGTCTCAGGG	0.498													G|||	1	0.000199681	0.0008	0.0	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.0				p.R478C		.											.	SLC2A14	91	0			c.C1432T						.						79.0	71.0	74.0					12																	7967043		2203	4300	6503	SO:0001583	missense	144195	exon12			TGCCACGGGTCTC	AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.1432C>T	12.37:g.7967043G>A	ENSP00000440480:p.Arg478Cys	202.0	0.0		195.0	15.0	NM_153449	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	ENST00000543909.1	37	CCDS8585.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.567354	0.45694	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000542505;ENST00000396589;ENST00000535295;ENST00000542546;ENST00000539924	T;T;T;T;T;T;T;T	0.74209	-0.82;-0.82;-0.82;-0.82;-0.82;-0.82;-0.82;-0.82	3.81	1.64	0.23874	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.264168	0.34484	N	0.003935	T	0.74794	0.3763	M	0.88906	2.99	0.43191	D	0.995025	P;B;B;B	0.37276	0.589;0.435;0.381;0.108	B;B;B;B	0.36244	0.168;0.12;0.073;0.22	T	0.76141	-0.3068	10	0.87932	D	0	.	8.9369	0.35706	0.0:0.0:0.4245:0.5754	.	493;369;455;478	B7ZAC3;B7Z844;Q8TDB8-2;Q8TDB8	.;.;.;GTR14_HUMAN	C	455;478;455;119;478;369;369;493	ENSP00000340450:R455C;ENSP00000440480:R478C;ENSP00000407287:R455C;ENSP00000438484:R119C;ENSP00000379834:R478C;ENSP00000440492:R369C;ENSP00000443903:R369C;ENSP00000445929:R493C	ENSP00000340450:R455C	R	-	1	0	SLC2A14	7858310	0.997000	0.39634	0.999000	0.59377	0.989000	0.77384	3.098000	0.50259	0.643000	0.30638	0.460000	0.39030	CGT	.		0.498	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399836.2	NM_153449	
SLCO1A2	6579	broad.mit.edu;bcgsc.ca	37	12	21445184	21445184	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr12:21445184C>A	ENST00000307378.6	-	13	2244	c.1524G>T	c.(1522-1524)ttG>ttT	p.L508F	SLCO1A2_ENST00000390670.3_Missense_Mutation_p.L506F|SLCO1A2_ENST00000458504.1_Missense_Mutation_p.L376F|SLCO1A2_ENST00000537524.1_Missense_Mutation_p.L376F|SLCO1A2_ENST00000452078.1_Missense_Mutation_p.L508F	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	508					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	ACTGGAGCATCAAGGAACAGT	0.403																																					p.L508F		.											.	SLCO1A2	157	0			c.G1524T						.						76.0	73.0	74.0					12																	21445184		2203	4300	6503	SO:0001583	missense	6579	exon13			GAGCATCAAGGAA		CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.1524G>T	12.37:g.21445184C>A	ENSP00000305974:p.Leu508Phe	89.0	0.0		85.0	7.0	NM_134431	Q9UGP7|Q9UL38	Missense_Mutation	SNP	ENST00000307378.6	37	CCDS8686.1	.	.	.	.	.	.	.	.	.	.	C	10.59	1.392865	0.25118	.	.	ENSG00000084453	ENST00000307378;ENST00000452078;ENST00000458504;ENST00000537524;ENST00000390670	T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09	5.09	3.23	0.37069	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.193210	0.05292	N	0.521319	T	0.29061	0.0722	N	0.16903	0.455	0.19575	N	0.999961	B;B	0.28400	0.21;0.002	B;B	0.28916	0.096;0.009	T	0.29852	-0.9998	10	0.52906	T	0.07	.	4.9655	0.14089	0.154:0.6186:0.1484:0.079	.	506;508	P46721-2;P46721	.;SO1A2_HUMAN	F	508;508;376;376;506	ENSP00000305974:L508F;ENSP00000393973:L508F;ENSP00000394854:L376F;ENSP00000439401:L376F;ENSP00000375088:L506F	ENSP00000305974:L508F	L	-	3	2	SLCO1A2	21336451	0.834000	0.29399	0.895000	0.35142	0.582000	0.36321	0.573000	0.23699	0.706000	0.31912	0.563000	0.77884	TTG	.		0.403	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343648.3	NM_021094	
CAPN15	6650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	601376	601376	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr16:601376G>A	ENST00000219611.2	+	8	2504	c.2141G>A	c.(2140-2142)cGc>cAc	p.R714H	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	714	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CTGGGCCTGCGCCCCCGGCAT	0.682																																					p.R714H		.											.	SOLH	523	0			c.G2141A						.						52.0	61.0	58.0					16																	601376		2200	4297	6497	SO:0001583	missense	6650	exon8			GCCTGCGCCCCCG	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.2141G>A	16.37:g.601376G>A	ENSP00000219611:p.Arg714His	27.0	0.0		44.0	7.0	NM_005632	B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Missense_Mutation	SNP	ENST00000219611.2	37	CCDS10410.1	.	.	.	.	.	.	.	.	.	.	g	29.2	4.989237	0.93106	.	.	ENSG00000103326	ENST00000219611	D	0.87809	-2.3	5.36	5.36	0.76844	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	D	0.000000	D	0.91774	0.7398	L	0.49256	1.55	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92401	0.5929	10	0.72032	D	0.01	.	17.6567	0.88180	0.0:0.0:1.0:0.0	.	714	O75808	CAN15_HUMAN	H	714	ENSP00000219611:R714H	ENSP00000219611:R714H	R	+	2	0	SOLH	541377	1.000000	0.71417	0.995000	0.50966	0.793000	0.44817	9.745000	0.98856	2.509000	0.84616	0.556000	0.70494	CGC	.		0.682	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239271.1	NM_005632	
SPATA2	9825	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	48523374	48523374	+	Silent	SNP	C	C	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr20:48523374C>A	ENST00000422556.1	-	3	694	c.345G>T	c.(343-345)acG>acT	p.T115T	SPATA2_ENST00000543716.1_5'UTR|SPATA2_ENST00000289431.5_Silent_p.T115T	NM_001135773.1	NP_001129245.1	Q9UM82	SPAT2_HUMAN	spermatogenesis associated 2	115					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	20	Hepatocellular(150;0.133)		BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			CAAAAGGGCCCGTGTAGGTCT	0.488																																					p.T115T		.											.	SPATA2	91	0			c.G345T						.																																			SO:0001819	synonymous_variant	9825	exon3			AGGGCCCGTGTAG	AB018300	CCDS13422.1	20q13.13	2014-06-13			ENSG00000158480	ENSG00000158480			14681	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 145"""	607662					Standard	NM_001135773		Approved	KIAA0757, PD1, tamo, PPP1R145	uc002xuw.3	Q9UM82	OTTHUMG00000032704	ENST00000422556.1:c.345G>T	20.37:g.48523374C>A		186.0	0.0		242.0	22.0	NM_006038	E1P626|O94857	Silent	SNP	ENST00000422556.1	37	CCDS13422.1																																																																																			.		0.488	SPATA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079658.1	NM_006038	
SPTA1	6708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	158623173	158623173	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr1:158623173G>T	ENST00000368147.4	-	22	3259	c.3079C>A	c.(3079-3081)Cca>Aca	p.P1027T		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1027	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TAGACAGCTGGGACAATGCCC	0.552																																					p.P1027T		.											.	SPTA1	142	0			c.C3079A						.						90.0	93.0	92.0					1																	158623173		2048	4175	6223	SO:0001583	missense	6708	exon22			CAGCTGGGACAAT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3079C>A	1.37:g.158623173G>T	ENSP00000357129:p.Pro1027Thr	203.0	0.0		232.0	97.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	18.06	3.540463	0.65085	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	D;D	0.90504	-2.68;-2.68	5.15	5.15	0.70609	Src homology-3 domain (4);Spectrin alpha chain, SH3 domain (1);	0.000000	0.31976	N	0.006762	D	0.97043	0.9034	H	0.97758	4.07	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.97467	1.0038	10	0.54805	T	0.06	.	17.367	0.87367	0.0:0.0:1.0:0.0	.	1027	P02549	SPTA1_HUMAN	T	1027	ENSP00000357130:P1027T;ENSP00000357129:P1027T	ENSP00000357129:P1027T	P	-	1	0	SPTA1	156889797	1.000000	0.71417	1.000000	0.80357	0.188000	0.23474	8.882000	0.92420	2.692000	0.91855	0.655000	0.94253	CCA	.		0.552	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
SRPK2	6733	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	104787043	104787043	+	Silent	SNP	C	C	T	rs369405262		TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr7:104787043C>T	ENST00000393651.3	-	8	771	c.684G>A	c.(682-684)ccG>ccA	p.P228P	SRPK2_ENST00000489828.1_Silent_p.P217P|SRPK2_ENST00000357311.3_Silent_p.P217P	NM_182692.1	NP_872634.1			SRSF protein kinase 2											NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						AGATATTTTCCGGCTTTATGT	0.428																																					p.P228P		.											.	SRPK2	805	0			c.G684A						.	C	,	0,4406		0,0,2203	145.0	120.0	128.0		651,684	-10.9	0.5	7		128	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SRPK2	NM_182691.1,NM_182692.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	217/689,228/700	104787043	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6733	exon8			ATTTTCCGGCTTT	U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.684G>A	7.37:g.104787043C>T		312.0	2.0		277.0	27.0	NM_182692		Silent	SNP	ENST00000393651.3	37	CCDS34724.1																																																																																			.		0.428	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348723.1	NM_182691	
ST14	6768	ucsc.edu;bcgsc.ca;mdanderson.org	37	11	130067803	130067803	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr11:130067803G>T	ENST00000278742.5	+	12	1840	c.1422G>T	c.(1420-1422)tgG>tgT	p.W474C		NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)	474	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	GTGATGGCTGGGCCGACTGCA	0.701																																					p.W474C		.											.	ST14	94	0			c.G1422T						.						30.0	24.0	26.0					11																	130067803		2197	4295	6492	SO:0001583	missense	6768	exon12			TGGCTGGGCCGAC	AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.1422G>T	11.37:g.130067803G>T	ENSP00000278742:p.Trp474Cys	48.0	0.0		65.0	9.0	NM_021978	Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Missense_Mutation	SNP	ENST00000278742.5	37	CCDS8487.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.388987	0.61956	.	.	ENSG00000149418	ENST00000278742;ENST00000525779	T	0.41400	1.0	5.13	5.13	0.70059	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.35903	N	0.002903	T	0.67804	0.2932	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71457	-0.4587	10	0.54805	T	0.06	.	18.186	0.89793	0.0:0.0:1.0:0.0	.	474	Q9Y5Y6	ST14_HUMAN	C	474;376	ENSP00000278742:W474C	ENSP00000278742:W474C	W	+	3	0	ST14	129573013	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	6.735000	0.74806	2.366000	0.80165	0.561000	0.74099	TGG	.		0.701	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386119.1		
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	152674871	152674871	+	Missense_Mutation	SNP	G	G	T	rs201704617		TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr6:152674871G>T	ENST00000367255.5	-	68	11536	c.10935C>A	c.(10933-10935)caC>caA	p.H3645Q	SYNE1_ENST00000448038.1_Missense_Mutation_p.H3630Q|SYNE1_ENST00000341594.5_Missense_Mutation_p.H3616Q|SYNE1_ENST00000265368.4_Missense_Mutation_p.H3645Q|SYNE1_ENST00000423061.1_Missense_Mutation_p.H3630Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3645					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCACTTCTTCGTGCCACTTCT	0.438										HNSCC(10;0.0054)																											p.H3645Q		.											.	SYNE1	607	0			c.C10935A						.						131.0	117.0	122.0					6																	152674871		2203	4300	6503	SO:0001583	missense	23345	exon68			TTCTTCGTGCCAC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10935C>A	6.37:g.152674871G>T	ENSP00000356224:p.His3645Gln	122.0	0.0		132.0	21.0	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	11.54	1.670013	0.29693	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5	5.75	-11.5	0.00074	.	0.095986	0.45867	N	0.000325	T	0.06096	0.0158	L	0.43923	1.385	0.80722	D	1	B;B;B;B	0.16396	0.002;0.002;0.002;0.017	B;B;B;B	0.15052	0.008;0.008;0.008;0.012	T	0.28138	-1.0053	10	0.21014	T	0.42	.	8.2456	0.31686	0.4341:0.2698:0.2961:0.0	.	3645;3645;3645;3630	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	Q	3645;3630;3645;3630;3616	ENSP00000356224:H3645Q;ENSP00000396024:H3630Q;ENSP00000265368:H3645Q;ENSP00000390975:H3630Q;ENSP00000341887:H3616Q	ENSP00000265368:H3645Q	H	-	3	2	SYNE1	152716564	0.200000	0.23398	0.321000	0.25320	0.811000	0.45836	-0.313000	0.08103	-1.959000	0.01018	-0.290000	0.09829	CAC	G|0.999;A|0.001		0.438	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
TACR3	6870	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	104640417	104640417	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr4:104640417G>T	ENST00000304883.2	-	1	556	c.416C>A	c.(415-417)aCg>aAg	p.T139K		NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	139					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		ATTGACCAACGTGTTGAAGGC	0.537																																					p.T139K		.											.	TACR3	525	0			c.C416A						.						110.0	100.0	104.0					4																	104640417		2203	4300	6503	SO:0001583	missense	6870	exon1			ACCAACGTGTTGA	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.416C>A	4.37:g.104640417G>T	ENSP00000303325:p.Thr139Lys	128.0	0.0		128.0	17.0	NM_001059	Q0P510	Missense_Mutation	SNP	ENST00000304883.2	37	CCDS3664.1	.	.	.	.	.	.	.	.	.	.	G	31	5.082663	0.94050	.	.	ENSG00000169836	ENST00000304883	T	0.19806	2.12	5.26	5.26	0.73747	GPCR, rhodopsin-like superfamily (1);	0.120864	0.56097	D	0.000032	T	0.51924	0.1703	M	0.82716	2.605	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.58075	-0.7700	10	0.72032	D	0.01	.	17.8687	0.88804	0.0:0.0:1.0:0.0	.	139	P29371	NK3R_HUMAN	K	139	ENSP00000303325:T139K	ENSP00000303325:T139K	T	-	2	0	TACR3	104859866	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.398000	0.97281	2.446000	0.82766	0.591000	0.81541	ACG	.		0.537	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059	
TCAIM	285343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	44449032	44449032	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr3:44449032T>G	ENST00000342649.4	+	11	1776	c.1349T>G	c.(1348-1350)gTg>gGg	p.V450G	TCAIM_ENST00000417237.1_Missense_Mutation_p.V450G	NM_001282913.1|NM_173826.3	NP_001269842.1|NP_776187.2	Q8N3R3	TCAIM_HUMAN	T cell activation inhibitor, mitochondrial	450						mitochondrion (GO:0005739)											ATACAAATGGTGGATTGTTGT	0.358																																					p.V450G		.											.	.	.	0			c.T1349G						.						103.0	106.0	105.0					3																	44449032		2203	4300	6503	SO:0001583	missense	285343	exon11			AAATGGTGGATTG		CCDS2712.1, CCDS43076.1	3p21.33-p21.32	2012-08-22	2012-08-22	2012-08-22	ENSG00000179152	ENSG00000179152			25241	protein-coding gene	gene with protein product	"""tolerance associated gene-1"""		"""chromosome 3 open reading frame 23"""	C3orf23		12477932	Standard	NM_001029840		Approved	DKFZp313N0621, TOAG-1	uc003cnd.4	Q8N3R3	OTTHUMG00000133049	ENST00000342649.4:c.1349T>G	3.37:g.44449032T>G	ENSP00000341539:p.Val450Gly	376.0	0.0		362.0	56.0	NM_173826	A8K9P1|Q0P5T9|Q495R1|Q495R3|Q4G0M4|Q6GMU8	Missense_Mutation	SNP	ENST00000342649.4	37	CCDS2712.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.212411	0.79240	.	.	ENSG00000179152	ENST00000417237;ENST00000342649	T;T	0.54279	0.58;0.58	6.07	1.07	0.20283	.	0.227073	0.42420	D	0.000718	T	0.42017	0.1184	L	0.36672	1.1	0.58432	D	0.999992	P	0.38078	0.617	B	0.39738	0.308	T	0.29882	-0.9997	10	0.87932	D	0	.	9.7349	0.40382	0.0:0.255:0.0:0.745	.	450	Q8N3R3	CC023_HUMAN	G	450	ENSP00000402581:V450G;ENSP00000341539:V450G	ENSP00000341539:V450G	V	+	2	0	C3orf23	44424036	1.000000	0.71417	0.878000	0.34440	0.990000	0.78478	3.661000	0.54503	-0.035000	0.13691	0.533000	0.62120	GTG	.		0.358	TCAIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256655.2	NM_173826	
TEX10	54881	broad.mit.edu;bcgsc.ca	37	9	103090078	103090078	+	Missense_Mutation	SNP	G	G	C	rs546886577		TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr9:103090078G>C	ENST00000374902.4	-	8	1968	c.1792C>G	c.(1792-1794)Cga>Gga	p.R598G	TEX10_ENST00000535814.1_Missense_Mutation_p.R601G	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	598						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		CCATAAATTCGGAGGGCAGTA	0.388																																					p.R601G		.											.	TEX10	92	0			c.C1801G						.						93.0	92.0	92.0					9																	103090078		2203	4300	6503	SO:0001583	missense	54881	exon8			AAATTCGGAGGGC	AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.1792C>G	9.37:g.103090078G>C	ENSP00000364037:p.Arg598Gly	292.0	0.0		235.0	14.0	NM_001161584	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Missense_Mutation	SNP	ENST00000374902.4	37	CCDS6748.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.739317	0.49045	.	.	ENSG00000136891	ENST00000535814;ENST00000374902;ENST00000444730	.	.	.	5.61	5.61	0.85477	.	0.388124	0.26700	N	0.022954	T	0.47395	0.1443	N	0.19112	0.55	0.80722	D	1	P;D;P	0.53312	0.465;0.959;0.465	B;P;B	0.47044	0.066;0.535;0.088	T	0.40683	-0.9550	9	0.33940	T	0.23	-5.1577	19.6241	0.95671	0.0:0.0:1.0:0.0	.	601;466;598	B4DYV2;E7ERG2;Q9NXF1	.;.;TEX10_HUMAN	G	601;598;466	.	ENSP00000364037:R598G	R	-	1	2	TEX10	102129899	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.056000	0.64287	2.640000	0.89533	0.655000	0.94253	CGA	.		0.388	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053416.1	NM_017746	
TGM3	7053	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	2321189	2321189	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr20:2321189G>T	ENST00000381458.5	+	13	2107	c.2044G>T	c.(2044-2046)Gca>Tca	p.A682S		NM_003245.3	NP_003236.3	Q08188	TGM3_HUMAN	transglutaminase 3	682					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|hair follicle morphogenesis (GO:0031069)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	calcium ion binding (GO:0005509)|catalytic activity (GO:0003824)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|transferase activity, transferring acyl groups (GO:0016746)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(11)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	39					L-Glutamine(DB00130)	CAAGTTCCCTGCAATCAAGGC	0.592																																					p.A682S		.											.	TGM3	139	0			c.G2044T						.						137.0	100.0	113.0					20																	2321189		2203	4300	6503	SO:0001583	missense	7053	exon13			TTCCCTGCAATCA	L10386	CCDS33435.1	20q11.2	2013-05-02	2013-05-02		ENSG00000125780	ENSG00000125780	2.3.2.13	"""Transglutaminases"""	11779	protein-coding gene	gene with protein product	"""E polypeptide, protein-glutamine-gamma-glutamyltransferase"""	600238	"""transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7851911, 9452468	Standard	NM_003245		Approved	TGE	uc002wfx.4	Q08188	OTTHUMG00000031690	ENST00000381458.5:c.2044G>T	20.37:g.2321189G>T	ENSP00000370867:p.Ala682Ser	122.0	0.0		141.0	12.0	NM_003245	A8K5N6|B2RCR6|D3DVX1|O95933|Q32ML9|Q32MM0	Missense_Mutation	SNP	ENST00000381458.5	37	CCDS33435.1	.	.	.	.	.	.	.	.	.	.	G	19.94	3.920268	0.73098	.	.	ENSG00000125780	ENST00000381458	T	0.28666	1.6	4.68	4.68	0.58851	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.361836	0.28241	N	0.016067	T	0.47691	0.1459	L	0.57536	1.79	0.35900	D	0.830321	D	0.55800	0.973	D	0.66979	0.948	T	0.51818	-0.8657	10	0.29301	T	0.29	-5.3995	12.9733	0.58525	0.0:0.0:1.0:0.0	.	682	Q08188	TGM3_HUMAN	S	682	ENSP00000370867:A682S	ENSP00000370867:A682S	A	+	1	0	TGM3	2269189	0.522000	0.26266	0.819000	0.32651	0.871000	0.50021	3.691000	0.54720	2.427000	0.82271	0.655000	0.94253	GCA	.		0.592	TGM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077579.2	NM_003245	
TMBIM6	7009	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	50152248	50152248	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr12:50152248T>C	ENST00000267115.5	+	6	503	c.418T>C	c.(418-420)Tac>Cac	p.Y140H	TMBIM6_ENST00000552699.1_Missense_Mutation_p.Y198H|TMBIM6_ENST00000395006.4_Missense_Mutation_p.Y140H|TMBIM6_ENST00000423828.1_Missense_Mutation_p.Y198H|TMBIM6_ENST00000547798.1_Missense_Mutation_p.Y103H|TMBIM6_ENST00000549385.1_Missense_Mutation_p.Y140H	NM_003217.2	NP_003208.2	P55061	BI1_HUMAN	transmembrane BAX inhibitor motif containing 6	140					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)				lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	6						GCGCCGTAGCTACCTCTTTCT	0.498																																					p.Y198H		.											.	TMBIM6	90	0			c.T592C						.						110.0	95.0	100.0					12																	50152248		2203	4300	6503	SO:0001583	missense	7009	exon6			CGTAGCTACCTCT	X75861	CCDS31797.1, CCDS44875.1	12q13.12	2013-10-08	2008-09-17	2008-09-17	ENSG00000139644	ENSG00000139644			11723	protein-coding gene	gene with protein product	"""BAX inhibitor 1"""	600748	"""testis enhanced gene transcript"""	TEGT		8530040, 9660918	Standard	NM_001098576		Approved	BI-1, BAXI1	uc001ruy.2	P55061	OTTHUMG00000169652	ENST00000267115.5:c.418T>C	12.37:g.50152248T>C	ENSP00000267115:p.Tyr140His	205.0	1.0		206.0	26.0	NM_001098576	B2R5M4|F8W034|O14938|Q643A7|Q96J50	Missense_Mutation	SNP	ENST00000267115.5	37	CCDS31797.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.039202	0.75617	.	.	ENSG00000139644	ENST00000546796;ENST00000552699;ENST00000267115;ENST00000549385;ENST00000423828;ENST00000542631;ENST00000550445;ENST00000552370;ENST00000395006;ENST00000547798	T;T;T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94	5.61	5.61	0.85477	.	0.062991	0.64402	D	0.000003	T	0.50326	0.1609	M	0.83774	2.66	0.80722	D	1	P;B	0.34522	0.455;0.079	B;B	0.35278	0.199;0.114	T	0.58059	-0.7703	10	0.87932	D	0	.	14.977	0.71281	0.0:0.0:0.0:1.0	.	198;140	F8W034;P55061	.;BI1_HUMAN	H	140;198;140;140;198;140;140;140;140;103	ENSP00000450159:Y140H;ENSP00000446734:Y198H;ENSP00000267115:Y140H;ENSP00000448036:Y140H;ENSP00000389277:Y198H;ENSP00000449907:Y140H;ENSP00000450158:Y140H;ENSP00000378454:Y140H;ENSP00000447030:Y103H	ENSP00000267115:Y140H	Y	+	1	0	TMBIM6	48438515	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.094000	0.76944	2.367000	0.80283	0.529000	0.55759	TAC	.		0.498	TMBIM6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405289.1	NM_003217	
TMEM115	11070	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	50396005	50396005	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr3:50396005C>T	ENST00000266025.3	-	1	1036	c.490G>A	c.(490-492)Gtg>Atg	p.V164M	XXcos-LUCA11.5_ENST00000606589.1_Intron	NM_007024.4	NP_008955.1	Q12893	TM115_HUMAN	transmembrane protein 115	164					negative regulation of cell proliferation (GO:0008285)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(1)|lung(1)|prostate(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CTGACGCGCACCTGGGGCACT	0.662																																					p.V164M		.											.	TMEM115	278	0			c.G490A						.						29.0	27.0	28.0					3																	50396005		2197	4299	6496	SO:0001583	missense	11070	exon1			CGCGCACCTGGGG	BC011948	CCDS2828.1	3p21.31	2008-11-04			ENSG00000126062	ENSG00000126062			30055	protein-coding gene	gene with protein product	"""placental protein 6"""	607069				11085536	Standard	NM_007024		Approved	PL6	uc003dan.1	Q12893	OTTHUMG00000044212	ENST00000266025.3:c.490G>A	3.37:g.50396005C>T	ENSP00000266025:p.Val164Met	24.0	0.0		24.0	7.0	NM_007024	A2IDB7|O14568|Q6IAY4|Q9UIX3	Missense_Mutation	SNP	ENST00000266025.3	37	CCDS2828.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.242778	0.79912	.	.	ENSG00000126062	ENST00000266025	T	0.12672	2.66	5.49	5.49	0.81192	.	0.131649	0.51477	D	0.000092	T	0.10551	0.0258	N	0.04508	-0.205	0.53688	D	0.999977	D	0.54772	0.968	P	0.51582	0.674	T	0.27365	-1.0076	10	0.35671	T	0.21	-2.8696	11.6069	0.51037	0.0:0.9175:0.0:0.0825	.	164	Q12893	TM115_HUMAN	M	164	ENSP00000266025:V164M	ENSP00000266025:V164M	V	-	1	0	TMEM115	50371009	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.543000	0.60684	2.566000	0.86566	0.563000	0.77884	GTG	.		0.662	TMEM115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102784.3	NM_007024	
TMEM30A	55754	ucsc.edu;bcgsc.ca	37	6	75974945	75974945	+	Splice_Site	SNP	A	A	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr6:75974945A>T	ENST00000230461.6	-	3	783		c.e3+1		TMEM30A_ENST00000475111.2_Splice_Site|TMEM30A_ENST00000370050.5_Splice_Site	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A						drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CATTTTACTTACAAGCAAAGC	0.284																																					.		.											.	TMEM30A	90	0			c.453+2T>A						.						55.0	53.0	54.0					6																	75974945		2203	4300	6503	SO:0001630	splice_region_variant	55754	exon4			TTACTTACAAGCA	AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.453+1T>A	6.37:g.75974945A>T		54.0	0.0		45.0	4.0	NM_018247	A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Splice_Site	SNP	ENST00000230461.6	37	CCDS4983.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.852455	0.91355	.	.	ENSG00000112697	ENST00000230461;ENST00000545449;ENST00000370050;ENST00000475111;ENST00000518161	.	.	.	6.02	6.02	0.97574	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5494	0.84464	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM30A	76031665	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.387000	0.73191	2.299000	0.77371	0.528000	0.53228	.	.		0.284	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041248.2	NM_018247	Intron
TNP1	7141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	217724619	217724619	+	Splice_Site	SNP	C	C	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr2:217724619C>A	ENST00000236979.2	-	1	168	c.139G>T	c.(139-141)Gcc>Tcc	p.A47S	AC007563.5_ENST00000607591.1_RNA|AC007563.5_ENST00000447289.1_RNA	NM_003284.3	NP_003275.1	P09430	STP1_HUMAN	transition protein 1 (during histone to protamine replacement)	47					chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|fertilization, exchange of chromosomal proteins (GO:0035042)|multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|sexual reproduction (GO:0019953)|single strand break repair (GO:0000012)|sperm motility (GO:0030317)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|spermatid nucleus elongation (GO:0007290)	male germ cell nucleus (GO:0001673)|nucleosome (GO:0000786)	DNA binding (GO:0003677)			large_intestine(1)|lung(1)|stomach(1)	3		Renal(207;0.0822)		Epithelial(149;8.97e-07)|all cancers(144;2.46e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCTCACTCACCGTCATCGCCC	0.552																																					p.A47S		.											.	TNP1	90	0			c.G139T						.						218.0	196.0	203.0					2																	217724619		2203	4300	6503	SO:0001630	splice_region_variant	7141	exon1			ACTCACCGTCATC		CCDS2406.1	2q35-q36	2008-06-03			ENSG00000118245	ENSG00000118245			11951	protein-coding gene	gene with protein product		190231				2249851	Standard	NM_003284		Approved		uc002vgk.3	P09430	OTTHUMG00000133057	ENST00000236979.2:c.139+1G>T	2.37:g.217724619C>A		221.0	0.0		226.0	37.0	NM_003284		Missense_Mutation	SNP	ENST00000236979.2	37	CCDS2406.1	.	.	.	.	.	.	.	.	.	.	C	11.69	1.714696	0.30413	.	.	ENSG00000118245	ENST00000236979	.	.	.	5.55	4.67	0.58626	.	0.123073	0.37437	N	0.002085	T	0.34221	0.0890	.	.	.	0.29839	N	0.829379	B	0.21225	0.053	B	0.25405	0.06	T	0.24512	-1.0158	7	.	.	.	-7.7748	11.7343	0.51757	0.1755:0.8245:0.0:0.0	.	47	P09430	STP1_HUMAN	S	47	.	.	A	-	1	0	TNP1	217432864	0.980000	0.34600	0.998000	0.56505	0.660000	0.38997	1.224000	0.32539	1.569000	0.49696	0.655000	0.94253	GCC	.		0.552	TNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256673.1	NM_003284	Missense_Mutation
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7578555	7578555	+	Splice_Site	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr17:7578555C>T	ENST00000269305.4	-	5	565		c.e5-1		TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(39)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGGGGAGTACTGTAGGAAGA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											.	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,0	TP53	70225	51	Unknown(39)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	ovary(9)|pancreas(6)|bone(5)|upper_aerodigestive_tract(4)|liver(4)|lung(4)|breast(4)|large_intestine(3)|central_nervous_system(3)|oesophagus(3)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|endometrium(1)|urinary_tract(1)|autonomic_ganglia(1)	c.376-1G>A						.						42.0	42.0	42.0					17																	7578555		2203	4300	6503	SO:0001630	splice_region_variant	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GGAGTACTGTAGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.376-1G>A	17.37:g.7578555C>T		56.0	0.0		50.0	8.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	17.60	3.431133	0.62844	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	.	.	.	4.87	3.9	0.45041	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4246	0.50003	0.0:0.9094:0.0:0.0906	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519280	1.000000	0.71417	0.999000	0.59377	0.918000	0.54935	7.639000	0.83342	1.359000	0.45940	0.655000	0.94253	.	.		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron
TP53BP1	7158	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	43749109	43749109	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr15:43749109G>C	ENST00000263801.3	-	12	1934	c.1682C>G	c.(1681-1683)cCt>cGt	p.P561R	TP53BP1_ENST00000382044.4_Missense_Mutation_p.P566R|TP53BP1_ENST00000450115.2_Missense_Mutation_p.P566R|TP53BP1_ENST00000382039.3_Missense_Mutation_p.P566R|TP53BP1_ENST00000605155.1_5'Flank	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	561					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		ATTTTCAGCAGGAACAAATTT	0.413								Other conserved DNA damage response genes																													p.P566R		.											.	TP53BP1	294	0			c.C1697G						.						147.0	134.0	139.0					15																	43749109		2201	4298	6499	SO:0001583	missense	7158	exon12			TCAGCAGGAACAA	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.1682C>G	15.37:g.43749109G>C	ENSP00000263801:p.Pro561Arg	204.0	0.0		174.0	34.0	NM_001141980	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	ENST00000263801.3	37	CCDS10096.1	.	.	.	.	.	.	.	.	.	.	G	8.830	0.939737	0.18281	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115;ENST00000413546	T;T;T;T;T	0.16597	2.33;2.33;2.33;2.33;2.33	5.04	3.13	0.36017	.	0.321644	0.29995	N	0.010668	T	0.13200	0.0320	L	0.38838	1.175	0.31601	N	0.652675	B;B;B;B	0.09022	0.002;0.001;0.001;0.001	B;B;B;B	0.09377	0.004;0.001;0.003;0.003	T	0.05971	-1.0853	10	0.51188	T	0.08	-1.3124	8.7541	0.34635	0.0775:0.2843:0.6381:0.0	.	566;561;566;566	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	R	561;566;566;566;566	ENSP00000263801:P561R;ENSP00000371475:P566R;ENSP00000371470:P566R;ENSP00000393497:P566R;ENSP00000388028:P566R	ENSP00000263801:P561R	P	-	2	0	TP53BP1	41536401	0.048000	0.20356	1.000000	0.80357	0.663000	0.39108	1.628000	0.37060	0.609000	0.30018	0.563000	0.77884	CCT	.		0.413	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		
TRIM28	10155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	59059680	59059680	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr19:59059680G>A	ENST00000253024.5	+	8	1410	c.1121G>A	c.(1120-1122)cGg>cAg	p.R374Q	TRIM28_ENST00000341753.6_Missense_Mutation_p.R292Q	NM_005762.2	NP_005753.1	Q13263	TIF1B_HUMAN	tripartite motif containing 28	374	Interaction with MAGEC2.|Leucine zipper alpha helical coiled-coil region.|RBCC domain.				convergent extension involved in axis elongation (GO:0060028)|DNA repair (GO:0006281)|embryonic placenta morphogenesis (GO:0060669)|epithelial to mesenchymal transition (GO:0001837)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|Krueppel-associated box domain binding (GO:0035851)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		CAGCTGCACCGGGCCCTCAAG	0.542																																					p.R374Q		.											.	TRIM28	870	0			c.G1121A						.						74.0	74.0	74.0					19																	59059680		2203	4300	6503	SO:0001583	missense	10155	exon8			TGCACCGGGCCCT		CCDS12985.1	19q13.4	2014-06-13	2011-01-25			ENSG00000130726		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	16384	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 157"""	601742	"""tripartite motif-containing 28"""			11331580, 11226167	Standard	NM_005762		Approved	TIF1B, KAP1, TF1B, RNF96, PPP1R157	uc002qtg.1	Q13263		ENST00000253024.5:c.1121G>A	19.37:g.59059680G>A	ENSP00000253024:p.Arg374Gln	121.0	0.0		129.0	34.0	NM_005762	O00677|Q7Z632|Q93040|Q96IM1	Missense_Mutation	SNP	ENST00000253024.5	37	CCDS12985.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.931134	0.52866	.	.	ENSG00000130726	ENST00000253024;ENST00000341753	T;T	0.67698	-0.07;-0.28	5.64	4.61	0.57282	B-box, C-terminal (1);	0.235442	0.36303	N	0.002665	T	0.49218	0.1544	L	0.32530	0.975	0.36324	D	0.858459	P;P	0.42161	0.772;0.663	B;B	0.28385	0.089;0.041	T	0.62129	-0.6919	10	0.49607	T	0.09	-21.1432	12.4604	0.55729	0.0812:0.0:0.9188:0.0	.	292;374	Q13263-2;Q13263	.;TIF1B_HUMAN	Q	374;292	ENSP00000253024:R374Q;ENSP00000342232:R292Q	ENSP00000253024:R374Q	R	+	2	0	TRIM28	63751492	0.810000	0.29049	0.997000	0.53966	0.994000	0.84299	3.464000	0.53057	1.540000	0.49301	0.655000	0.94253	CGG	.		0.542	TRIM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467074.1	NM_005762	
TRIM42	287015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	140401304	140401304	+	Splice_Site	SNP	C	C	A			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr3:140401304C>A	ENST00000286349.3	+	2	533	c.342C>A	c.(340-342)tcC>tcA	p.S114S		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	114						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CTCCTTTCAGCTCCAAGACTG	0.537																																					p.S114S		.											.	TRIM42	227	0			c.C342A						.						62.0	64.0	63.0					3																	140401304		2203	4300	6503	SO:0001630	splice_region_variant	287015	exon2			TTTCAGCTCCAAG	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.342-1C>A	3.37:g.140401304C>A		111.0	0.0		119.0	15.0	NM_152616	A1L4B4|Q8N832|Q8NDL3	Silent	SNP	ENST00000286349.3	37	CCDS3113.1																																																																																			.		0.537	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616	Silent
TTC27	55622	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	32859027	32859027	+	Silent	SNP	C	C	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr2:32859027C>T	ENST00000317907.4	+	3	582	c.351C>T	c.(349-351)caC>caT	p.H117H	MIR4765_ENST00000585007.1_RNA	NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	117										breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						TTGACTTACACCCTCAGGACT	0.363																																					p.H117H		.											.	TTC27	90	0			c.C351T						.						130.0	128.0	128.0					2																	32859027		2203	4300	6503	SO:0001819	synonymous_variant	55622	exon3			CTTACACCCTCAG	BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.351C>T	2.37:g.32859027C>T		456.0	0.0		461.0	74.0	NM_017735	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Silent	SNP	ENST00000317907.4	37	CCDS33176.1																																																																																			.		0.363	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325395.1	NM_017735	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179395002	179395002	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr2:179395002G>C	ENST00000591111.1	-	308	101641	c.101417C>G	c.(101416-101418)cCc>cGc	p.P33806R	TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P32879R|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P26507R|TTN_ENST00000589042.1_Missense_Mutation_p.P35447R|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000587576.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592161.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P26382R|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P26574R			Q8WZ42	TITIN_HUMAN	titin	33806	Ig-like 149.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTTGGCCGGGGTTCTCCAGT	0.378																																					p.P35447R		.											.	TTN	636	0			c.C106340G						.						97.0	90.0	92.0					2																	179395002		1822	4080	5902	SO:0001583	missense	7273	exon358			GGCCGGGGTTCTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.101417C>G	2.37:g.179395002G>C	ENSP00000465570:p.Pro33806Arg	131.0	0.0		134.0	21.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	8.740	0.918832	0.17982	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83	5.14	5.14	0.70334	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.89111	0.6622	H	0.96269	3.795	0.39327	D	0.965345	D;D;D;D	0.59767	0.986;0.986;0.986;0.986	P;P;P;P	0.61800	0.859;0.859;0.859;0.894	D	0.92802	0.6257	9	0.87932	D	0	.	14.1191	0.65175	0.0:0.0:1.0:0.0	.	26382;26507;26574;33806	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	32879;26382;26574;26507;26379	ENSP00000343764:P32879R;ENSP00000434586:P26382R;ENSP00000340554:P26574R;ENSP00000352154:P26507R	ENSP00000340554:P26574R	P	-	2	0	TTN	179103248	1.000000	0.71417	0.993000	0.49108	0.157000	0.22087	5.191000	0.65110	2.406000	0.81754	0.491000	0.48974	CCC	.		0.378	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
VGLL4	9686	hgsc.bcm.edu;broad.mit.edu	37	3	11606425	11606426	+	Frame_Shift_Del	DEL	GC	GC	-	rs145391722		TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr3:11606425_11606426delGC	ENST00000413604.1	-	3	515_516	c.145_146delGC	c.(145-147)gctfs	p.A49fs	VGLL4_ENST00000451674.2_Frame_Shift_Del_p.A28fs|VGLL4_ENST00000424529.2_Frame_Shift_Del_p.A24fs|VGLL4_ENST00000404339.1_Frame_Shift_Del_p.A113fs|VGLL4_ENST00000273038.3_Frame_Shift_Del_p.A108fs|VGLL4_ENST00000430365.2_Frame_Shift_Del_p.A114fs			Q14135	VGLL4_HUMAN	vestigial-like family member 4	108					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|endometrium(1)|large_intestine(1)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		GGGGGCCACAGCGCGCTCGATG	0.653																																					p.114_114del		.											.	VGLL4	91	0			c.340_341del						.																																			SO:0001589	frameshift_variant	9686	exon3			GCCACAGCGCGCT	D50911	CCDS2606.1, CCDS46754.1, CCDS46755.1, CCDS46756.1, CCDS68342.1, CCDS68343.1	3p25.2	2014-03-03	2014-03-03		ENSG00000144560	ENSG00000144560			28966	protein-coding gene	gene with protein product			"""vestigial like 4 (Drosophila)"""			8590280, 15140898	Standard	NM_001284390		Approved	KIAA0121	uc010hdx.1	Q14135	OTTHUMG00000129739	ENST00000413604.1:c.145_146delGC	3.37:g.11606429_11606430delGC	ENSP00000404624:p.Ala49fs	80.0	0.0		105.0	11.0	NM_001128219	B4DTS7|J3KN68|Q7L5V0|Q9BQ78	Frame_Shift_Del	DEL	ENST00000413604.1	37																																																																																				.		0.653	VGLL4-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000339139.2	NM_014667	
VWA9	81556	broad.mit.edu;bcgsc.ca	37	15	65883977	65883977	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr15:65883977A>G	ENST00000395644.4	-	9	1414	c.1079T>C	c.(1078-1080)cTc>cCc	p.L360P	VWA9_ENST00000313182.2_Missense_Mutation_p.L360P|VWA9_ENST00000569491.1_Missense_Mutation_p.L310P|VWA9_ENST00000442903.3_Missense_Mutation_p.L324P|VWA9_ENST00000431261.2_Missense_Mutation_p.L281P|VWA9_ENST00000567744.1_Missense_Mutation_p.L396P|VWA9_ENST00000420799.2_Missense_Mutation_p.L303P			Q96SY0	VWA9_HUMAN	von Willebrand factor A domain containing 9	360																	TAGCCATGGGAGAGGTTCTGG	0.443																																					p.L342P		.											.	.	.	0			c.T1025C						.						132.0	113.0	119.0					15																	65883977		2201	4299	6500	SO:0001583	missense	81556	exon9			CATGGGAGAGGTT	AL136662	CCDS55969.1, CCDS45283.1	15q22.31	2012-09-27	2012-09-27	2012-09-27	ENSG00000138614	ENSG00000138614			25372	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 44"""	C15orf44		11230166	Standard	NM_001136043		Approved	DKFZP564O1664	uc010uja.2	Q96SY0	OTTHUMG00000133159	ENST00000395644.4:c.1079T>C	15.37:g.65883977A>G	ENSP00000379006:p.Leu360Pro	174.0	1.0		171.0	8.0	NM_001207058	B4DDI6|B4DVD5|Q49AH8|Q96HX5|Q9H0S5	Missense_Mutation	SNP	ENST00000395644.4	37		.	.	.	.	.	.	.	.	.	.	A	25.6	4.654334	0.88056	.	.	ENSG00000138614	ENST00000395644;ENST00000313182;ENST00000431261;ENST00000420799;ENST00000442903	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.76350	0.3975	L	0.59436	1.845	0.80722	D	1	D;D;D;D	0.71674	0.998;0.994;0.998;0.996	D;P;P;P	0.70935	0.971;0.878;0.896;0.823	T	0.78342	-0.2241	9	0.87932	D	0	-21.5879	16.5582	0.84512	1.0:0.0:0.0:0.0	.	310;324;396;360	B4DWZ3;B4DVT3;B4DJL6;Q96SY0	.;.;.;CO044_HUMAN	P	360;360;281;303;324	.	ENSP00000326379:L360P	L	-	2	0	C15orf44	63671030	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.253000	0.95501	2.308000	0.77769	0.533000	0.62120	CTC	.		0.443	VWA9-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420604.3	NM_030800	
WDR24	84219	ucsc.edu;bcgsc.ca	37	16	736891	736891	+	Silent	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr16:736891A>G	ENST00000248142.6	-	7	1574	c.1575T>C	c.(1573-1575)agT>agC	p.S525S	LA16c-313D11.12_ENST00000566927.1_RNA|JMJD8_ENST00000293882.4_5'Flank|JMJD8_ENST00000562824.1_5'Flank|JMJD8_ENST00000412368.2_5'Flank|JMJD8_ENST00000454700.1_5'Flank|WDR24_ENST00000293883.4_Silent_p.S395S|JMJD8_ENST00000562111.1_5'Flank|JMJD8_ENST00000609261.1_5'Flank			Q96S15	WDR24_HUMAN	WD repeat domain 24	525										breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				CACTGAGGGCACTGGAGGCGA	0.677																																					p.S395S		.											.	WDR24	91	0			c.T1185C						.						16.0	17.0	16.0					16																	736891		2191	4295	6486	SO:0001819	synonymous_variant	84219	exon3			GAGGGCACTGGAG	AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.1575T>C	16.37:g.736891A>G		32.0	0.0		29.0	4.0	NM_032259	A2IDB8|D3DU59|Q96GC7|Q9H0B7	Silent	SNP	ENST00000248142.6	37																																																																																				.		0.677	WDR24-201	KNOWN	basic	protein_coding	protein_coding		NM_032259	
ZNF253	56242	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	20002465	20002465	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr19:20002465A>T	ENST00000589717.1	+	4	501	c.409A>T	c.(409-411)Aca>Tca	p.T137S	CTC-559E9.8_ENST00000585571.1_RNA|AC011477.1_ENST00000578823.1_RNA|ZNF253_ENST00000355650.4_Missense_Mutation_p.T61S	NM_021047.2	NP_066385.2	O75346	ZN253_HUMAN	zinc finger protein 253	137					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CCAATGTTTGACAACTACCCA	0.323																																					p.T137S		.											.	ZNF253	90	0			c.A409T						.						56.0	58.0	57.0					19																	20002465		2139	4275	6414	SO:0001583	missense	56242	exon4			TGTTTGACAACTA	AF038951	CCDS42532.1	19p12	2014-02-12	2003-12-17		ENSG00000256771	ENSG00000256771		"""Zinc fingers, C2H2-type"", ""-"""	13497	protein-coding gene	gene with protein product		606954	"""zinc finger protein 411"""	ZNF411		10585455	Standard	NM_021047		Approved	BMZF-1, FLJ90391	uc002noj.3	O75346	OTTHUMG00000182369	ENST00000589717.1:c.409A>T	19.37:g.20002465A>T	ENSP00000468720:p.Thr137Ser	236.0	0.0		163.0	27.0	NM_021047	A4FVA7|Q0P6G3|Q6P0L2|Q8NCA3|Q8NCF9	Missense_Mutation	SNP	ENST00000589717.1	37	CCDS42532.1	.	.	.	.	.	.	.	.	.	.	a	0.054	-1.242289	0.01481	.	.	ENSG00000256771	ENST00000355650	.	.	.	1.4	-2.81	0.05805	.	.	.	.	.	T	0.14399	0.0348	L	0.31420	0.93	0.09310	N	1	P	0.40144	0.704	B	0.34093	0.175	T	0.10823	-1.0613	7	.	.	.	.	2.2207	0.03971	0.3458:0.2228:0.0:0.4315	.	137	O75346	ZN253_HUMAN	S	137	.	.	T	+	1	0	ZNF253	19863465	0.003000	0.15002	0.043000	0.18650	0.043000	0.13939	1.039000	0.30266	-0.987000	0.03494	-1.020000	0.02445	ACA	.		0.323	ZNF253-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460802.1	NM_021047	
ZNF229	7772	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44934680	44934680	+	Silent	SNP	A	A	G			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr19:44934680A>G	ENST00000588931.1	-	6	709	c.276T>C	c.(274-276)gaT>gaC	p.D92D	ZNF229_ENST00000591289.1_Intron|CTC-512J12.4_ENST00000588655.1_RNA|ZNF229_ENST00000291187.4_Silent_p.D86D	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	92	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				TTAATTCTTCATCTTGAATAT	0.418																																					p.D92D		.											.	ZNF229	94	0			c.T276C						.						48.0	46.0	46.0					19																	44934680		1839	4092	5931	SO:0001819	synonymous_variant	7772	exon6			TTCTTCATCTTGA	AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.276T>C	19.37:g.44934680A>G		161.0	0.0		121.0	11.0	NM_014518	B2RWN3|Q59FV2|Q86WL9	Silent	SNP	ENST00000588931.1	37	CCDS42574.1																																																																																			.		0.418	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460833.1	NM_014518	
AMER3	205147	broad.mit.edu;bcgsc.ca	37	2	131520956	131520957	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-CC-A1HT-01A-11D-A12Z-10	TCGA-CC-A1HT-10A-01D-A12Z-10	CC	CC	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b25a78f-20dc-4ccc-b4c0-f9885d16725d	0255f601-3be9-4059-9d36-7f666977eff0	g.chr2:131520956_131520957CC>AA	ENST00000423981.1	+	2	1421_1422	c.1311_1312CC>AA	c.(1309-1314)agCCca>agAAca	p.437_438SP>RT	AMER3_ENST00000321420.4_Missense_Mutation_p.437_438SP>RT	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	437					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										TTGGCCCCAGCCCAGATGATGA	0.663																																					p.SP437RT		.											.	.	.	0			.						.																																			SO:0001583	missense	205147	.			CCCCAGCCCAGAT	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	Exception_encountered	2.37:g.131520956_131520957delinsAA	ENSP00000392700:p.S437_P438delinsRT	41.0	0.0		56.0	7.0	.	B7ZLH6	Missense_Mutation	DNP	ENST00000423981.1	37	CCDS2164.1																																																																																			.		0.663	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698	
