#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACADM	34	hgsc.bcm.edu;bcgsc.ca	37	1	76216192	76216192	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:76216192T>C	ENST00000370841.4	+	10	1343	c.906T>C	c.(904-906)taT>taC	p.Y302Y	ACADM_ENST00000370834.5_Silent_p.Y335Y|ACADM_ENST00000543667.1_Silent_p.Y113Y|ACADM_ENST00000541113.1_Silent_p.Y266Y|ACADM_ENST00000481374.1_3'UTR|ACADM_ENST00000420607.2_Silent_p.Y306Y	NM_000016.4|NM_001127328.1	NP_000007.1|NP_001120800.1	P11310	ACADM_HUMAN	acyl-CoA dehydrogenase, C-4 to C-12 straight chain	302					cardiac muscle cell differentiation (GO:0055007)|carnitine biosynthetic process (GO:0045329)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|glycogen biosynthetic process (GO:0005978)|liver development (GO:0001889)|medium-chain fatty acid catabolic process (GO:0051793)|medium-chain fatty acid metabolic process (GO:0051791)|oxidation-reduction process (GO:0055114)|post-embryonic development (GO:0009791)|regulation of gluconeogenesis (GO:0006111)|response to cold (GO:0009409)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|identical protein binding (GO:0042802)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)			breast(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	18					Flavin adenine dinucleotide(DB03147)	CTACCAAGTATGCCCTGGAAA	0.333																																					p.Y306Y		.											.	ACADM	155	0			c.T918C						.						66.0	73.0	71.0					1																	76216192		2203	4300	6503	SO:0001819	synonymous_variant	34	exon10			CAAGTATGCCCTG	M16827	CCDS668.1, CCDS44165.1, CCDS65562.1, CCDS72807.1	1p31	2014-09-17	2010-04-30		ENSG00000117054	ENSG00000117054	1.3.99.3		89	protein-coding gene	gene with protein product		607008	"""acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain"""			3035565	Standard	NM_000016		Approved	MCAD, MCADH, ACAD1	uc009wbp.3	P11310	OTTHUMG00000009784	ENST00000370841.4:c.906T>C	1.37:g.76216192T>C		75.0	0.0		86.0	4.0	NM_001127328	Q5T4U4|Q9NYF1	Silent	SNP	ENST00000370841.4	37	CCDS668.1																																																																																			.		0.333	ACADM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026967.1		
AKAP4	8852	hgsc.bcm.edu;bcgsc.ca	37	X	49958534	49958534	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:49958534T>C	ENST00000376056.2	-	5	953	c.803A>G	c.(802-804)gAa>gGa	p.E268G	AKAP4_ENST00000376064.3_Missense_Mutation_p.E268G|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Intron|AKAP4_ENST00000358526.2_Missense_Mutation_p.E277G					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					TTCCACAGCTTCATAGGCCAT	0.488																																					p.E277G		.											.	AKAP4	540	0			c.A830G						.						78.0	70.0	73.0					X																	49958534		2203	4300	6503	SO:0001583	missense	8852	exon5			ACAGCTTCATAGG	AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.803A>G	X.37:g.49958534T>C	ENSP00000365224:p.Glu268Gly	46.0	0.0		65.0	4.0	NM_003886		Missense_Mutation	SNP	ENST00000376056.2	37	CCDS14330.1	.	.	.	.	.	.	.	.	.	.	T	3.704	-0.060975	0.07317	.	.	ENSG00000147081	ENST00000376056;ENST00000358526;ENST00000376064	T;T;T	0.14391	2.51;2.51;2.51	4.9	3.68	0.42216	A-kinase anchor 110kDa, C-terminal (1);	0.137867	0.32120	N	0.006554	T	0.11707	0.0285	L	0.55990	1.75	0.21064	N	0.999794	B	0.31413	0.322	B	0.26202	0.067	T	0.22312	-1.0220	9	.	.	.	-10.1688	6.8947	0.24249	0.2086:0.0:0.0:0.7914	.	277	Q5JQC9	AKAP4_HUMAN	G	268;277;268	ENSP00000365224:E268G;ENSP00000351327:E277G;ENSP00000365232:E268G	.	E	-	2	0	AKAP4	49845274	0.861000	0.29849	0.091000	0.20842	0.078000	0.17371	2.080000	0.41586	0.496000	0.27904	0.242000	0.17961	GAA	.		0.488	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886	
AKAP8	10270	hgsc.bcm.edu;bcgsc.ca	37	19	15484733	15484733	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:15484733A>G	ENST00000269701.2	-	4	295	c.235T>C	c.(235-237)Tct>Cct	p.S79P		NM_005858.3	NP_005849.1	O43823	AKAP8_HUMAN	A kinase (PRKA) anchor protein 8	79					mitotic chromosome condensation (GO:0007076)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	condensed chromosome (GO:0000793)|female pronucleus (GO:0001939)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)	26						GGGCCGTAAGAGGCCATGTGC	0.647																																					p.S79P	GBM(190;1671 2163 3274 27186 30476)	.											.	AKAP8	290	0			c.T235C						.						46.0	45.0	46.0					19																	15484733		2203	4300	6503	SO:0001583	missense	10270	exon4			CGTAAGAGGCCAT	Y11997	CCDS12329.1	19p13.12	2012-05-16			ENSG00000105127	ENSG00000105127		"""A-kinase anchor proteins"""	378	protein-coding gene	gene with protein product	"""A-kinase anchor protein, 95kDa"""	604692				9473338	Standard	NM_005858		Approved	AKAP95, DKFZp586B1222	uc002nav.3	O43823		ENST00000269701.2:c.235T>C	19.37:g.15484733A>G	ENSP00000269701:p.Ser79Pro	104.0	0.0		97.0	5.0	NM_005858		Missense_Mutation	SNP	ENST00000269701.2	37	CCDS12329.1	.	.	.	.	.	.	.	.	.	.	A	12.18	1.860126	0.32884	.	.	ENSG00000105127	ENST00000269701	T	0.51071	0.72	5.07	1.29	0.21616	.	0.255751	0.28371	N	0.015591	T	0.47021	0.1423	L	0.56769	1.78	0.20703	N	0.999866	D	0.60575	0.988	P	0.53313	0.723	T	0.30387	-0.9980	10	0.35671	T	0.21	-20.7731	4.1839	0.10388	0.4484:0.0:0.0968:0.4548	.	79	O43823	AKAP8_HUMAN	P	79	ENSP00000269701:S79P	ENSP00000269701:S79P	S	-	1	0	AKAP8	15345733	0.938000	0.31826	0.169000	0.22859	0.045000	0.14185	1.071000	0.30666	0.340000	0.23745	-1.182000	0.01712	TCT	.		0.647	AKAP8-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461293.3	NM_005858	
ANKRD11	29123	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	89341222	89341227	+	Splice_Site	DEL	CTGGCT	CTGGCT	-			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	CTGGCT	CTGGCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:89341222_89341227delCTGGCT	ENST00000301030.4	-	11	8168_8173	c.7708_7713delAGCCAG	c.(7708-7713)agccagdel	p.SQ2570del	ANKRD11_ENST00000378330.2_Splice_Site_p.SQ2570del	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2570					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CGGGCCCTACCTGGCTCTCCAGGGGC	0.641																																					p.2570_2571del		.											.	ANKRD11	139	0			c.7708_7713del						.																																			SO:0001630	splice_region_variant	29123	exon11			CCCTACCTGGCTC	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.7713+1AGCCAG>-	16.37:g.89341222_89341227delCTGGCT		90.0	0.0		70.0	18.0	NM_001256183	Q6NTG1|Q6QMF8	In_Frame_Del	DEL	ENST00000301030.4	37	CCDS32513.1																																																																																			.		0.641	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	In_Frame_Del
ANO4	121601	hgsc.bcm.edu;bcgsc.ca	37	12	101333217	101333217	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:101333217A>G	ENST00000392977.3	+	4	495	c.285A>G	c.(283-285)gaA>gaG	p.E95E	ANO4_ENST00000538618.1_Silent_p.E261E|ANO4_ENST00000299222.9_5'UTR|ANO4_ENST00000392979.3_Silent_p.E60E			Q32M45	ANO4_HUMAN	anoctamin 4	95					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						GCAGATTGGAAGCCGGGGGAG	0.428										HNSCC(74;0.22)																											p.E60E		.											.	ANO4	96	0			c.A180G						.						91.0	93.0	92.0					12																	101333217		2203	4300	6503	SO:0001819	synonymous_variant	121601	exon3			ATTGGAAGCCGGG	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.285A>G	12.37:g.101333217A>G		110.0	0.0		63.0	4.0	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Silent	SNP	ENST00000392977.3	37																																																																																				.		0.428	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
AP2A2	161	ucsc.edu;bcgsc.ca	37	11	993286	993286	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:993286T>C	ENST00000448903.2	+	12	1596	c.1455T>C	c.(1453-1455)gcT>gcC	p.A485A	AP2A2_ENST00000534328.1_Intron|AP2A2_ENST00000332231.5_Silent_p.A486A	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	485					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		CTTCGCAGGCTCTTCAGGCTC	0.627																																					p.A486A		.											.	AP2A2	90	0			c.T1458C						.						31.0	37.0	35.0					11																	993286		1989	4156	6145	SO:0001819	synonymous_variant	161	exon12			GCAGGCTCTTCAG	AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.1455T>C	11.37:g.993286T>C		57.0	0.0		30.0	4.0	NM_001242837	O75403|Q53ET1|Q96SI8	Silent	SNP	ENST00000448903.2	37	CCDS44512.1																																																																																			.		0.627	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385431.2	NM_012305	
ARFIP2	23647	hgsc.bcm.edu;bcgsc.ca	37	11	6501574	6501574	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:6501574A>G	ENST00000254584.2	-	2	161	c.78T>C	c.(76-78)ccT>ccC	p.P26P	ARFIP2_ENST00000445086.2_Intron|TIMM10B_ENST00000254616.6_5'Flank|TIMM10B_ENST00000472836.1_5'Flank|ARFIP2_ENST00000525235.1_Silent_p.P26P|ARFIP2_ENST00000423813.2_Intron|ARFIP2_ENST00000396777.3_Silent_p.P26P|TIMM10B_ENST00000530751.1_5'Flank	NM_012402.3	NP_036534.1	P53365	ARFP2_HUMAN	ADP-ribosylation factor interacting protein 2	26					actin cytoskeleton organization (GO:0030036)|cellular component movement (GO:0006928)|lamellipodium assembly (GO:0030032)|ruffle organization (GO:0031529)|small GTPase mediated signal transduction (GO:0007264)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|Rac GTPase binding (GO:0048365)			endometrium(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(2)	15		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;3.41e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CATCATCTTCAGGAAGCTGCC	0.483																																					p.P26P	Melanoma(119;796 1674 9049 20480 24794)	.											.	ARFIP2	90	0			c.T78C						.						69.0	59.0	62.0					11																	6501574		2201	4296	6497	SO:0001819	synonymous_variant	23647	exon2			ATCTTCAGGAAGC	BC000392	CCDS7765.1, CCDS55739.1, CCDS55740.1, CCDS73250.1	11p15	2008-08-01	2008-08-01		ENSG00000132254	ENSG00000132254			17160	protein-coding gene	gene with protein product	"""arfaptin 2"""	601638				8670882, 9038142	Standard	NM_012402		Approved	POR1	uc010ran.2	P53365	OTTHUMG00000133406	ENST00000254584.2:c.78T>C	11.37:g.6501574A>G		132.0	0.0		70.0	4.0	NM_012402	B4DX86|B4E306|D3DQT5	Silent	SNP	ENST00000254584.2	37	CCDS7765.1																																																																																			.		0.483	ARFIP2-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387044.1	NM_012402	
ARHGAP17	55114	hgsc.bcm.edu;bcgsc.ca	37	16	24958829	24958829	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:24958829A>G	ENST00000289968.6	-	14	1284	c.1215T>C	c.(1213-1215)ccT>ccC	p.P405P	ARHGAP17_ENST00000441763.2_3'UTR|ARHGAP17_ENST00000303665.5_Silent_p.P405P	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	405	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		ATAACAAGTTAGGGCCTAACA	0.413																																					p.P405P		.											.	ARHGAP17	227	0			c.T1215C						.						120.0	104.0	110.0					16																	24958829		2197	4300	6497	SO:0001819	synonymous_variant	55114	exon14			CAAGTTAGGGCCT	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.1215T>C	16.37:g.24958829A>G		64.0	0.0		68.0	4.0	NM_001006634	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Silent	SNP	ENST00000289968.6	37	CCDS32409.1																																																																																			.		0.413	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436548.3	NM_018054	
ARHGAP36	158763	hgsc.bcm.edu;bcgsc.ca	37	X	130220617	130220617	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:130220617T>C	ENST00000276211.5	+	11	1809	c.1464T>C	c.(1462-1464)gcT>gcC	p.A488A	ARHGAP36_ENST00000370922.1_Silent_p.A476A|ARHGAP36_ENST00000370921.1_Silent_p.A352A	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	488					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						CTGTCCTTGCTCAAAGCAAGC	0.532																																					p.A488A		.											.	ARHGAP36	133	0			c.T1464C						.						84.0	75.0	78.0					X																	130220617		2203	4300	6503	SO:0001819	synonymous_variant	158763	exon11			CCTTGCTCAAAGC		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.1464T>C	X.37:g.130220617T>C		61.0	0.0		78.0	4.0	NM_144967	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Silent	SNP	ENST00000276211.5	37	CCDS14628.1																																																																																			.		0.532	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	
ARID2	196528	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	46246364	46246376	+	Frame_Shift_Del	DEL	TCCCGACTCAGGA	TCCCGACTCAGGA	-			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	TCCCGACTCAGGA	TCCCGACTCAGGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:46246364_46246376delTCCCGACTCAGGA	ENST00000334344.6	+	15	4630_4642	c.4458_4470delTCCCGACTCAGGA	c.(4456-4470)gttcccgactcaggafs	p.VPDSG1486fs	ARID2_ENST00000457135.1_Frame_Shift_Del_p.VPDSG94fs|ARID2_ENST00000444670.1_Frame_Shift_Del_p.VPDSG1096fs|ARID2_ENST00000422737.1_Frame_Shift_Del_p.VPDSG1337fs|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1486					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TCATAGCAGTTCCCGACTCAGGATCAAAAGTAT	0.451			"""N, S, F"""		hepatocellular carcinoma																																p.1486_1490del		.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	100	0			c.4458_4470del						.																																			SO:0001589	frameshift_variant	196528	exon15			AGCAGTTCCCGAC		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4458_4470delTCCCGACTCAGGA	12.37:g.46246364_46246376delTCCCGACTCAGGA	ENSP00000335044:p.Val1486fs	210.0	0.0		81.0	23.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Frame_Shift_Del	DEL	ENST00000334344.6	37	CCDS31783.1																																																																																			.		0.451	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
ASB13	79754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	5691033	5691033	+	Silent	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:5691033G>A	ENST00000357700.6	-	4	443	c.417C>T	c.(415-417)gtC>gtT	p.V139V	ASB13_ENST00000479033.1_5'UTR	NM_024701.3	NP_078977.2	Q8WXK3	ASB13_HUMAN	ankyrin repeat and SOCS box containing 13	139					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					NS(1)|endometrium(3)|lung(3)|ovary(1)	8				GBM - Glioblastoma multiforme(2;9.59e-09)		GATTGGCCCCGACGTCAATAA	0.527																																					p.V139V		.											.	ASB13	227	0			c.C417T						.						120.0	108.0	112.0					10																	5691033		2203	4300	6503	SO:0001819	synonymous_variant	79754	exon4			GGCCCCGACGTCA	AK091935	CCDS7070.1	10p15.1	2013-01-10	2011-01-25		ENSG00000196372	ENSG00000196372		"""Ankyrin repeat domain containing"""	19765	protein-coding gene	gene with protein product		615055	"""ankyrin repeat and SOCS box-containing 13"""			12076535	Standard	NM_024701		Approved	FLJ13134, MGC19879	uc001iig.2	Q8WXK3	OTTHUMG00000017603	ENST00000357700.6:c.417C>T	10.37:g.5691033G>A		98.0	0.0		105.0	61.0	NM_024701	A8K7Q6|D3DRR2|Q96EP7|Q9H8Z1	Silent	SNP	ENST00000357700.6	37	CCDS7070.1																																																																																			.		0.527	ASB13-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046564.1		
ATAD1	84896	hgsc.bcm.edu;bcgsc.ca	37	10	89544340	89544340	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:89544340A>G	ENST00000308448.7	-	5	848	c.470T>C	c.(469-471)cTt>cCt	p.L157P	ATAD1_ENST00000400215.3_Missense_Mutation_p.L99P|ATAD1_ENST00000541004.1_Missense_Mutation_p.L157P|ATAD1_ENST00000495903.1_5'UTR|ATAD1_ENST00000328142.3_Missense_Mutation_p.L157P	NM_032810.2	NP_116199.2	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	157					ATP catabolic process (GO:0006200)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|positive regulation of receptor internalization (GO:0002092)	cell junction (GO:0030054)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			kidney(1)|large_intestine(4)|lung(4)|ovary(1)	10		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		CGAAGGCTGAAGGTTAATAAA	0.463																																					p.L157P		.											.	ATAD1	578	0			c.T470C						.						142.0	130.0	134.0					10																	89544340		2203	4300	6503	SO:0001583	missense	84896	exon5			GGCTGAAGGTTAA	AL834370	CCDS7386.1	10q23.31	2010-04-21		2007-02-08	ENSG00000138138	ENSG00000138138		"""ATPases / AAA-type"""	25903	protein-coding gene	gene with protein product		614452				12477932	Standard	NM_032810		Approved	FLJ14600	uc001kez.1	Q8NBU5	OTTHUMG00000018685	ENST00000308448.7:c.470T>C	10.37:g.89544340A>G	ENSP00000339017:p.Leu157Pro	108.0	0.0		89.0	5.0	NM_032810	D3DR26|Q6DKG1|Q6P4B9|Q8N3G1|Q8WYR9|Q969Y3	Missense_Mutation	SNP	ENST00000308448.7	37	CCDS7386.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.695430	0.88830	.	.	ENSG00000138138	ENST00000308448;ENST00000328142;ENST00000400215;ENST00000541004	D;D;D;D	0.94232	-3.38;-3.38;-3.38;-3.38	5.35	5.35	0.76521	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97195	0.9083	M	0.89968	3.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97875	1.0288	9	.	.	.	-20.4442	15.6409	0.77001	1.0:0.0:0.0:0.0	.	99;157	B4E2J1;Q8NBU5	.;ATAD1_HUMAN	P	157;157;99;157	ENSP00000339017:L157P;ENSP00000339016:L157P;ENSP00000412968:L99P;ENSP00000445500:L157P	.	L	-	2	0	ATAD1	89534320	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	2.151000	0.67156	0.460000	0.39030	CTT	.		0.463	ATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049235.1	NM_032810	
ATP13A4	84239	ucsc.edu;bcgsc.ca	37	3	193151700	193151700	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:193151700T>C	ENST00000342695.4	-	25	3098	c.2776A>G	c.(2776-2778)Aac>Gac	p.N926D	ATP13A4_ENST00000392443.3_Missense_Mutation_p.N907D	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	926						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		GAAAGGCTGTTTGTCTCCTGA	0.343																																					p.N926D		.											.	ATP13A4	92	0			c.A2776G						.						97.0	106.0	103.0					3																	193151700		2203	4300	6503	SO:0001583	missense	84239	exon25			GGCTGTTTGTCTC	AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.2776A>G	3.37:g.193151700T>C	ENSP00000339182:p.Asn926Asp	30.0	0.0		28.0	4.0	NM_032279	B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Missense_Mutation	SNP	ENST00000342695.4	37	CCDS3304.2	.	.	.	.	.	.	.	.	.	.	T	16.96	3.265733	0.59540	.	.	ENSG00000127249	ENST00000392443;ENST00000342695	D;D	0.88586	-2.4;-2.4	5.46	5.46	0.80206	.	0.167110	0.42172	D	0.000744	D	0.85186	0.5639	L	0.40543	1.245	0.80722	D	1	B	0.19200	0.034	B	0.19946	0.027	T	0.82263	-0.0544	10	0.62326	D	0.03	-27.1562	14.3674	0.66815	0.0:0.0:0.0:1.0	.	926	Q4VNC1	AT134_HUMAN	D	907;926	ENSP00000376238:N907D;ENSP00000339182:N926D	ENSP00000339182:N926D	N	-	1	0	ATP13A4	194634394	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.119000	0.57891	2.064000	0.61679	0.533000	0.62120	AAC	.		0.343	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4	NM_032279	
BAHCC1	57597	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	79414423	79414423	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:79414423T>A	ENST00000307745.7	+	15	3525	c.3525T>A	c.(3523-3525)caT>caA	p.H1175Q																								GCCAGGCTCATTCTACTCAGG	0.687																																					.		.											.	BAHCC1	23	0			.						.						6.0	8.0	8.0					17																	79414423		1850	4026	5876	SO:0001583	missense	57597	.			GGCTCATTCTACT																												ENST00000307745.7:c.3525T>A	17.37:g.79414423T>A	ENSP00000303486:p.His1175Gln	95.0	0.0		50.0	13.0	.		Missense_Mutation	SNP	ENST00000307745.7	37		.	.	.	.	.	.	.	.	.	.	T	12.10	1.837990	0.32513	.	.	ENSG00000171282	ENST00000307745	T	0.25749	1.78	4.34	4.34	0.51931	.	1.071350	0.07377	N	0.886821	T	0.16041	0.0386	N	0.14661	0.345	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.17048	-1.0382	10	0.23891	T	0.37	.	8.2725	0.31853	0.1772:0.0:0.0:0.8228	.	1175;1175	Q9P281;F8WBW8	BAHC1_HUMAN;.	Q	1175	ENSP00000303486:H1175Q	ENSP00000303486:H1175Q	H	+	3	2	AC110285.1	77029018	0.000000	0.05858	0.883000	0.34634	0.918000	0.54935	0.020000	0.13466	1.804000	0.52760	0.533000	0.62120	CAT	.		0.687	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
BBS9	27241	hgsc.bcm.edu;bcgsc.ca	37	7	33217138	33217138	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:33217138T>C	ENST00000242067.6	+	5	898	c.377T>C	c.(376-378)aTg>aCg	p.M126T	BBS9_ENST00000354265.4_Missense_Mutation_p.M126T|BBS9_ENST00000396127.2_Missense_Mutation_p.M126T|RNA5SP229_ENST00000410809.1_RNA|BBS9_ENST00000355070.2_Missense_Mutation_p.M126T|BBS9_ENST00000350941.3_Missense_Mutation_p.M126T|BBS9_ENST00000425508.2_Missense_Mutation_p.M81T	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	126					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			ATGAAATTGATGTATGAACAT	0.328									Bardet-Biedl syndrome																												p.M126T		.											.	BBS9	230	0			c.T377C						.						170.0	160.0	163.0					7																	33217138		2203	4300	6503	SO:0001583	missense	27241	exon5	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AATTGATGTATGA		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.377T>C	7.37:g.33217138T>C	ENSP00000242067:p.Met126Thr	64.0	0.0		70.0	4.0	NM_014451	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	ENST00000242067.6	37	CCDS43566.1	.	.	.	.	.	.	.	.	.	.	T	16.05	3.011872	0.54468	.	.	ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132;ENST00000396125;ENST00000425508;ENST00000442858;ENST00000537775	D;D;D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57;-1.57;-1.57	5.61	5.61	0.85477	.	0.088451	0.85682	D	0.000000	T	0.81574	0.4851	L	0.43152	1.355	0.51482	D	0.999929	P;P;B;P;B	0.38370	0.628;0.591;0.057;0.591;0.127	B;B;B;B;B	0.42827	0.236;0.399;0.085;0.399;0.147	T	0.81690	-0.0818	10	0.45353	T	0.12	-21.6	16.1045	0.81212	0.0:0.0:0.0:1.0	.	126;126;126;126;126	B3KQ86;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4	.;.;.;.;PTHB1_HUMAN	T	126;126;126;126;126;126;126;81;4;4	ENSP00000242067:M126T;ENSP00000313122:M126T;ENSP00000379433:M126T;ENSP00000347182:M126T;ENSP00000346214:M126T;ENSP00000405151:M81T;ENSP00000388646:M4T	ENSP00000242067:M126T	M	+	2	0	BBS9	33183663	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.434000	0.80377	2.267000	0.75376	0.533000	0.62120	ATG	.		0.328	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329064.1		
BCL2	596	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	60795978	60795978	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr18:60795978T>C	ENST00000398117.1	-	2	2061	c.600A>G	c.(598-600)gaA>gaG	p.E200E	BCL2_ENST00000333681.4_Silent_p.E200E|BCL2_ENST00000590515.1_5'UTR	NM_000633.2	NP_000624.2	P10415	BCL2_HUMAN	B-cell CLL/lymphoma 2	200					actin filament organization (GO:0007015)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|axonogenesis (GO:0007409)|B cell homeostasis (GO:0001782)|B cell lineage commitment (GO:0002326)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|behavioral fear response (GO:0001662)|branching involved in ureteric bud morphogenesis (GO:0001658)|CD8-positive, alpha-beta T cell lineage commitment (GO:0043375)|cell aging (GO:0007569)|cell growth (GO:0016049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to organic substance (GO:0071310)|cochlear nucleus development (GO:0021747)|defense response to virus (GO:0051607)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|ear development (GO:0043583)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|female pregnancy (GO:0007565)|focal adhesion assembly (GO:0048041)|gland morphogenesis (GO:0022612)|glomerulus development (GO:0032835)|hair follicle morphogenesis (GO:0031069)|homeostasis of number of cells within a tissue (GO:0048873)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|melanin metabolic process (GO:0006582)|melanocyte differentiation (GO:0030318)|mesenchymal cell development (GO:0014031)|metanephros development (GO:0001656)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of autophagy (GO:0010507)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cellular pH reduction (GO:0032848)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of retinal cell programmed cell death (GO:0046671)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|oocyte development (GO:0048599)|organ growth (GO:0035265)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pigment granule organization (GO:0048753)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell growth (GO:0030307)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron maturation (GO:0014042)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smooth muscle cell migration (GO:0014911)|post-embryonic development (GO:0009791)|protein dephosphorylation (GO:0006470)|protein polyubiquitination (GO:0000209)|reactive oxygen species metabolic process (GO:0072593)|regulation of calcium ion transport (GO:0051924)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glycoprotein biosynthetic process (GO:0010559)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of nitrogen utilization (GO:0006808)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|regulation of protein stability (GO:0031647)|regulation of transmembrane transporter activity (GO:0022898)|regulation of viral genome replication (GO:0045069)|release of cytochrome c from mitochondria (GO:0001836)|renal system process (GO:0003014)|response to acid chemical (GO:0001101)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to iron ion (GO:0010039)|response to ischemia (GO:0002931)|response to nicotine (GO:0035094)|response to radiation (GO:0009314)|response to toxic substance (GO:0009636)|response to UV-B (GO:0010224)|single organismal cell-cell adhesion (GO:0016337)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|pore complex (GO:0046930)	BH3 domain binding (GO:0051434)|channel activity (GO:0015267)|channel inhibitor activity (GO:0016248)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(106)|kidney(1)|large_intestine(1)|lung(3)	113		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Ibuprofen(DB01050)|Paclitaxel(DB01229)|Rasagiline(DB01367)	GGCCGTACAGTTCCACAAAGG	0.542			T	IGH@	"""NHL, CLL"""																																p.E200E		.		Dom	yes		18	18q21.3	596	B-cell CLL/lymphoma 2		L	.	BCL2	1271	0			c.A600G						.						39.0	35.0	36.0					18																	60795978		2203	4300	6503	SO:0001819	synonymous_variant	596	exon3			GTACAGTTCCACA	M14745	CCDS11981.1, CCDS45882.1	18q21.3	2014-03-07			ENSG00000171791	ENSG00000171791		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	990	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 50"""	151430					Standard	XM_006722523		Approved	Bcl-2, PPP1R50	uc002lit.1	P10415	OTTHUMG00000132791	ENST00000398117.1:c.600A>G	18.37:g.60795978T>C		132.0	0.0		119.0	42.0	NM_000633	C9JHD5|P10416|Q13842|Q16197	Silent	SNP	ENST00000398117.1	37	CCDS11981.1																																																																																			.		0.542	BCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256199.1	NM_000633, NM_000657	
BRSK1	84446	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55816894	55816894	+	Silent	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:55816894C>T	ENST00000309383.1	+	16	2107	c.1830C>T	c.(1828-1830)ctC>ctT	p.L610L	BRSK1_ENST00000590333.1_Silent_p.L626L|BRSK1_ENST00000326848.7_Silent_p.L305L|BRSK1_ENST00000588584.1_3'UTR	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	610					axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		AAATATTCCTCGTGCTAAAGG	0.562																																					p.L610L		.											.	BRSK1	759	0			c.C1830T						.						184.0	187.0	186.0					19																	55816894		2203	4300	6503	SO:0001819	synonymous_variant	84446	exon16			ATTCCTCGTGCTA	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.1830C>T	19.37:g.55816894C>T		182.0	1.0		185.0	59.0	NM_032430	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Silent	SNP	ENST00000309383.1	37	CCDS12921.1																																																																																			.		0.562	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430	
NUTM1	256646	hgsc.bcm.edu;bcgsc.ca	37	15	34646648	34646648	+	Splice_Site	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:34646648G>A	ENST00000333756.4	+	5	1148	c.993G>A	c.(991-993)gtG>gtA	p.V331V	NUTM1_ENST00000537011.1_Splice_Site_p.V359V|NUTM1_ENST00000438749.3_Splice_Site_p.V349V	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	331						cytoplasm (GO:0005737)|nucleus (GO:0005634)											TTCCCTTAGTGTACATTCCGA	0.552																																					p.V331V		.											.	C15orf55	206	0			c.G993A						.						78.0	81.0	80.0					15																	34646648		2201	4298	6499	SO:0001630	splice_region_variant	256646	exon5			CTTAGTGTACATT	AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.992-1G>A	15.37:g.34646648G>A		160.0	0.0		68.0	4.0	NM_175741	B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Silent	SNP	ENST00000333756.4	37	CCDS32190.1																																																																																			.		0.552	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418026.1	NM_175741	Silent
C1QTNF8	390664	hgsc.bcm.edu;bcgsc.ca	37	16	1143730	1143730	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:1143730T>C	ENST00000328449.5	-	4	803	c.530A>G	c.(529-531)gAg>gGg	p.E177G		NM_207419.3	NP_997302.2	P60827	C1QT8_HUMAN	C1q and tumor necrosis factor related protein 8	177	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				lung(2)|prostate(1)|skin(1)	4		Hepatocellular(780;0.00369)				CAGGTAGGTCTCCTTGTAGTT	0.672																																					p.E177G		.											.	C1QTNF8	91	0			c.A530G						.						52.0	55.0	54.0					16																	1143730		2198	4293	6491	SO:0001583	missense	390664	exon4			TAGGTCTCCTTGT	AY358832	CCDS32358.1	16p13.3	2014-08-12			ENSG00000184471	ENSG00000184471			31374	protein-coding gene	gene with protein product		614147				12975309	Standard	NM_207419		Approved	UNQ5829, CTRP8	uc010uuw.1	P60827	OTTHUMG00000167756	ENST00000328449.5:c.530A>G	16.37:g.1143730T>C	ENSP00000330426:p.Glu177Gly	66.0	0.0		70.0	4.0	NM_207419	B7U178	Missense_Mutation	SNP	ENST00000328449.5	37	CCDS32358.1	.	.	.	.	.	.	.	.	.	.	T	13.67	2.307720	0.40795	.	.	ENSG00000184471	ENST00000328449	T	0.75704	-0.96	3.43	2.33	0.28932	Tumour necrosis factor-like (2);Complement C1q protein (2);	0.000000	0.53938	D	0.000055	D	0.83069	0.5174	M	0.87381	2.88	0.39218	D	0.963453	D	0.89917	1.0	D	0.73380	0.98	T	0.79560	-0.1753	10	0.40728	T	0.16	.	3.5733	0.07925	0.1943:0.1084:0.0:0.6973	.	177	P60827	C1QT8_HUMAN	G	177	ENSP00000330426:E177G	ENSP00000330426:E177G	E	-	2	0	C1QTNF8	1083731	1.000000	0.71417	0.939000	0.37840	0.055000	0.15305	4.027000	0.57239	0.423000	0.26033	0.528000	0.53228	GAG	.		0.672	C1QTNF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396120.1	XM_372606	
KNOP1	400506	hgsc.bcm.edu;bcgsc.ca	37	16	19725915	19725915	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:19725915A>G	ENST00000219837.7	-	2	521	c.443T>C	c.(442-444)cTc>cCc	p.L148P	IQCK_ENST00000320394.6_5'Flank|AC002550.5_ENST00000565916.1_RNA|KNOP1_ENST00000568230.1_5'Flank	NM_001012991.2	NP_001013009.2	Q1ED39	KNOP1_HUMAN	lysine-rich nucleolar protein 1	148	Lys-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										GTGTTTTTTGAGCTTCTTGCC	0.547																																					p.L148P		.											.	C16orf88	68	0			c.T443C						.						48.0	53.0	52.0					16																	19725915		2167	4287	6454	SO:0001583	missense	400506	exon2			TTTTTGAGCTTCT	BC047010	CCDS42127.1	16p12.3	2013-03-12	2013-03-12	2013-03-12	ENSG00000103550	ENSG00000103550			34404	protein-coding gene	gene with protein product	"""family with sequence similarity 191, member A"", ""testis-specific gene 118"""		"""chromosome 16 open reading frame 88"""	C16orf88			Standard	NM_001012991		Approved	101F10.1, FAM191A, TSG118	uc002dgq.3	Q1ED39		ENST00000219837.7:c.443T>C	16.37:g.19725915A>G	ENSP00000219837:p.Leu148Pro	95.0	0.0		68.0	4.0	NM_001012991	O43328|Q5FWF3	Missense_Mutation	SNP	ENST00000219837.7	37	CCDS42127.1	.	.	.	.	.	.	.	.	.	.	A	11.14	1.549815	0.27652	.	.	ENSG00000103550	ENST00000219837	T	0.23950	1.88	4.61	-2.03	0.07365	.	6.817630	0.00397	N	0.000046	T	0.12902	0.0313	N	0.11560	0.145	0.58432	D	0.999999	B	0.11235	0.004	B	0.13407	0.009	T	0.28744	-1.0034	9	.	.	.	-0.066	4.6376	0.12531	0.3509:0.0:0.4689:0.1801	.	148	Q1ED39	CP088_HUMAN	P	148	ENSP00000219837:L148P	.	L	-	2	0	C16orf88	19633416	0.984000	0.35163	0.985000	0.45067	0.901000	0.52897	0.261000	0.18442	-0.158000	0.11040	0.459000	0.35465	CTC	.		0.547	KNOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435993.2	NM_001012991	
CAPN10	11132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	241534647	241534647	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:241534647G>T	ENST00000391984.2	+	7	1400	c.1204G>T	c.(1204-1206)Gac>Tac	p.D402Y	CAPN10_ENST00000391982.2_Missense_Mutation_p.D402Y|CAPN10_ENST00000352879.4_Intron|CAPN10_ENST00000270364.7_Intron|CAPN10_ENST00000354082.4_Missense_Mutation_p.D402Y|CAPN10_ENST00000404753.3_Missense_Mutation_p.D402Y	NM_023083.3	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10	402	Domain III 1.				actin cytoskeleton reorganization (GO:0031532)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to insulin stimulus (GO:0032869)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin secretion (GO:0032024)|positive regulation of intracellular transport (GO:0032388)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteolysis (GO:0006508)|type B pancreatic cell apoptotic process (GO:0097050)	cell (GO:0005623)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cytoskeletal protein binding (GO:0008092)|SNARE binding (GO:0000149)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|urinary_tract(1)	27		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		ACTGGTGGGTGACAGTCATAC	0.657																																					p.D402Y		.											.	CAPN10	656	0			c.G1204T						.						40.0	44.0	42.0					2																	241534647		2203	4299	6502	SO:0001583	missense	11132	exon7			GTGGGTGACAGTC	AF089088	CCDS33420.1, CCDS42838.1	2q37.3	2008-05-22			ENSG00000142330	ENSG00000142330			1477	protein-coding gene	gene with protein product		605286				11017071, 11018080	Standard	NM_023083		Approved		uc002vzk.2	Q9HC96	OTTHUMG00000133358	ENST00000391984.2:c.1204G>T	2.37:g.241534647G>T	ENSP00000375844:p.Asp402Tyr	222.0	0.0		293.0	72.0	NM_023085	A8MVS7|Q4ZFV1|Q8NCD4|Q96IG4|Q96JI2|Q9HC89|Q9HC90|Q9HC91|Q9HC92|Q9HC93|Q9HC94|Q9HC95	Missense_Mutation	SNP	ENST00000391984.2	37	CCDS42838.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.480577	0.44044	.	.	ENSG00000142330	ENST00000391984;ENST00000391982;ENST00000404753;ENST00000354082	T;D;T;D	0.88431	1.02;-2.38;1.02;-1.9	4.38	-1.87	0.07737	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.770342	0.11744	N	0.533774	D	0.86560	0.5962	L	0.54323	1.7	0.09310	N	1	P;B;P;B	0.50272	0.889;0.307;0.933;0.307	B;B;P;B	0.49421	0.434;0.232;0.61;0.232	T	0.77915	-0.2409	10	0.87932	D	0	.	5.5588	0.17131	0.4988:0.147:0.3542:0.0	.	402;402;402;402	B7Z6G3;B7WPF5;Q9HC96-3;Q9HC96	.;.;.;CAN10_HUMAN	Y	402	ENSP00000375844:D402Y;ENSP00000375842:D402Y;ENSP00000384422:D402Y;ENSP00000270362:D402Y	ENSP00000270362:D402Y	D	+	1	0	CAPN10	241183320	0.005000	0.15991	0.000000	0.03702	0.010000	0.07245	1.184000	0.32053	-0.289000	0.09038	0.655000	0.94253	GAC	.		0.657	CAPN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257191.3	NM_023083	
CARD10	29775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	37902375	37902375	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr22:37902375C>A	ENST00000403299.1	-	8	1423	c.1207G>T	c.(1207-1209)Gac>Tac	p.D403Y	CARD10_ENST00000494166.1_5'Flank|CARD10_ENST00000406271.3_Missense_Mutation_p.D117Y|CARD10_ENST00000251973.5_Missense_Mutation_p.D403Y			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	403					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					TGGATCCGGTCACGGCTCTGG	0.622																																					p.D403Y		.											.	CARD10	662	0			c.G1207T						.						54.0	50.0	52.0					22																	37902375		2203	4300	6503	SO:0001583	missense	29775	exon7			TCCGGTCACGGCT	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.1207G>T	22.37:g.37902375C>A	ENSP00000384570:p.Asp403Tyr	207.0	0.0		230.0	68.0	NM_014550	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Missense_Mutation	SNP	ENST00000403299.1	37	CCDS13948.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095456	0.76870	.	.	ENSG00000100065	ENST00000403299;ENST00000406271;ENST00000251973;ENST00000437756	T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.16	5.31	4.29	0.51040	.	0.169713	0.50627	D	0.000119	D	0.86514	0.5951	M	0.73962	2.25	0.44092	D	0.996855	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.87541	0.2459	10	0.87932	D	0	-35.6918	12.0009	0.53230	0.0:0.9202:0.0:0.0798	.	403;117	Q9BWT7;Q8NC81	CAR10_HUMAN;.	Y	403;117;403;44	ENSP00000384570:D403Y;ENSP00000385799:D117Y;ENSP00000251973:D403Y;ENSP00000416239:D44Y	ENSP00000251973:D403Y	D	-	1	0	CARD10	36232321	0.999000	0.42202	0.862000	0.33874	0.993000	0.82548	4.295000	0.59049	1.235000	0.43724	0.561000	0.74099	GAC	.		0.622	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318997.1	NM_014550	
CCDC136	64753	hgsc.bcm.edu;bcgsc.ca	37	7	128452197	128452197	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:128452197A>G	ENST00000297788.4	+	13	2739	c.2372A>G	c.(2371-2373)gAc>gGc	p.D791G	CCDC136_ENST00000487361.1_Intron|CCDC136_ENST00000378685.4_Intron|CCDC136_ENST00000464832.1_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	791	Ser-rich.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						AAGAGCTATGACAGCAGCACC	0.488																																					p.D791G		.											.	CCDC136	24	0			c.A2372G						.						85.0	86.0	85.0					7																	128452197		2124	4238	6362	SO:0001583	missense	64753	exon13			GCTATGACAGCAG		CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.2372A>G	7.37:g.128452197A>G	ENSP00000297788:p.Asp791Gly	110.0	0.0		103.0	5.0	NM_022742	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Missense_Mutation	SNP	ENST00000297788.4	37	CCDS47704.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.27|15.27	2.785155|2.785155	0.49997|0.49997	.|.	.|.	ENSG00000128596|ENSG00000128596	ENST00000297788;ENST00000397697;ENST00000320524;ENST00000464672|ENST00000494552	T;T|.	0.50548|.	0.74;0.74|.	5.77|5.77	-2.62|-2.62	0.06152|0.06152	.|.	0.899797|.	0.09590|.	N|.	0.781606|.	T|T	0.37128|0.37128	0.0992|0.0992	M|M	0.63843|0.63843	1.955|1.955	0.09310|0.09310	N|N	1|1	B;B;B|.	0.06786|.	0.001;0.001;0.001|.	B;B;B|.	0.09377|.	0.004;0.004;0.001|.	T|T	0.40136|0.40136	-0.9579|-0.9579	10|5	0.46703|.	T|.	0.11|.	-0.7923|-0.7923	1.6647|1.6647	0.02799|0.02799	0.4178:0.139:0.309:0.1342|0.4178:0.139:0.309:0.1342	.|.	791;791;791|.	Q96JN2-4;Q96JN2-2;Q96JN2|.	.;.;CC136_HUMAN|.	G|A	791;791;791;382|668	ENSP00000297788:D791G;ENSP00000417991:D382G|.	ENSP00000297788:D791G|.	D|T	+|+	2|1	0|0	CCDC136|CCDC136	128239433|128239433	0.000000|0.000000	0.05858|0.05858	0.066000|0.066000	0.19879|0.19879	0.666000|0.666000	0.39218|0.39218	-0.072000|-0.072000	0.11486|0.11486	-0.347000|-0.347000	0.08299|0.08299	-0.250000|-0.250000	0.11733|0.11733	GAC|ACA	.		0.488	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742	
CCDC30	728621	hgsc.bcm.edu;bcgsc.ca	37	1	43076653	43076653	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:43076653T>C	ENST00000340612.4	+	9	1388	c.1388T>C	c.(1387-1389)gTc>gCc	p.V463A	CCDC30_ENST00000342022.4_Missense_Mutation_p.V463A|CCDC30_ENST00000428554.2_Missense_Mutation_p.V463A|CCDC30_ENST00000507855.1_Missense_Mutation_p.V252A|CCDC30_ENST00000390640.4_Missense_Mutation_p.V252A			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	463						extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						TTTCAGCATGTCAAAAGCAAC	0.348																																					p.V463A		.											.	CCDC30	90	0			c.T1388C						.						92.0	88.0	89.0					1																	43076653		2203	4300	6503	SO:0001583	missense	728621	exon10			AGCATGTCAAAAG	AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000340612.4:c.1388T>C	1.37:g.43076653T>C	ENSP00000340378:p.Val463Ala	82.0	0.0		65.0	4.0	NM_001080850	Q14F06|Q5VVM5	Missense_Mutation	SNP	ENST00000340612.4	37	CCDS30690.1	.	.	.	.	.	.	.	.	.	.	T	11.46	1.646364	0.29246	.	.	ENSG00000186409	ENST00000428554;ENST00000507855;ENST00000340612;ENST00000342022;ENST00000390640	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	5.68	5.68	0.88126	.	0.833727	0.10772	N	0.635922	T	0.33962	0.0881	L	0.40543	1.245	0.19775	N	0.999952	B;P	0.42871	0.341;0.792	B;B	0.37601	0.116;0.254	T	0.11567	-1.0582	10	0.18710	T	0.47	.	12.3251	0.55007	0.0:0.0:0.0:1.0	.	463;252	Q5VVM6;Q5VVM6-2	CCD30_HUMAN;.	A	463;252;463;463;252	ENSP00000397035:V463A;ENSP00000426711:V252A;ENSP00000340378:V463A;ENSP00000339280:V463A;ENSP00000375051:V252A	ENSP00000340378:V463A	V	+	2	0	CCDC30	42849240	0.636000	0.27207	0.784000	0.31847	0.131000	0.20780	0.634000	0.24614	2.156000	0.67533	0.460000	0.39030	GTC	.		0.348	CCDC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019524.3	NM_025030	
CCDC62	84660	hgsc.bcm.edu;bcgsc.ca	37	12	123285708	123285708	+	Missense_Mutation	SNP	C	C	T	rs373036488		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:123285708C>T	ENST00000253079.6	+	9	1359	c.1015C>T	c.(1015-1017)Cca>Tca	p.P339S	CCDC62_ENST00000392440.2_Missense_Mutation_p.P100S|CCDC62_ENST00000537566.1_Missense_Mutation_p.P100S|CCDC62_ENST00000392441.4_Missense_Mutation_p.P339S	NM_201435.4	NP_958843.2	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62	339					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		AAATAACCACCCAAAAGTCGA	0.358																																					p.P339S		.											.	CCDC62	157	0			c.C1015T						.						64.0	67.0	66.0					12																	123285708		2203	4300	6503	SO:0001583	missense	84660	exon9			AACCACCCAAAAG		CCDS9238.1	12q24.31	2009-08-18			ENSG00000130783	ENSG00000130783			30723	protein-coding gene	gene with protein product	"""cancer/testis antigen 109"""	613481				18563714, 19126643	Standard	NM_201435		Approved	TSP-NY, FLJ40344, CT109, ERAP75	uc001udc.3	Q6P9F0	OTTHUMG00000168764	ENST00000253079.6:c.1015C>T	12.37:g.123285708C>T	ENSP00000253079:p.Pro339Ser	124.0	0.0		81.0	4.0	NM_201435	A8K8V1|B3KUP3|Q6ZVF2|Q86VJ0|Q9BYZ5	Missense_Mutation	SNP	ENST00000253079.6	37	CCDS9238.1	.	.	.	.	.	.	.	.	.	.	C	6.804	0.517475	0.13005	.	.	ENSG00000130783	ENST00000253079;ENST00000392441;ENST00000537566;ENST00000392440	T;T;T;T	0.47177	1.47;1.47;0.85;0.85	5.41	0.358	0.16084	.	0.628588	0.14138	N	0.338882	T	0.29817	0.0745	L	0.29908	0.895	0.09310	N	1	B;B;B	0.20671	0.047;0.018;0.009	B;B;B	0.18561	0.019;0.022;0.007	T	0.22626	-1.0211	10	0.16896	T	0.51	0.043	7.9296	0.29895	0.0:0.5458:0.0:0.4542	.	339;100;339	Q6P9F0-2;Q6P9F0-3;Q6P9F0	.;.;CCD62_HUMAN	S	339;339;100;100	ENSP00000253079:P339S;ENSP00000376236:P339S;ENSP00000445045:P100S;ENSP00000376235:P100S	ENSP00000253079:P339S	P	+	1	0	CCDC62	121851661	0.138000	0.22547	0.043000	0.18650	0.432000	0.31715	0.298000	0.19120	-0.210000	0.10140	-0.150000	0.13652	CCA	.		0.358	CCDC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400930.1	NM_032573	
CCNJ	54619	hgsc.bcm.edu;bcgsc.ca	37	10	97816897	97816897	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:97816897T>C	ENST00000265992.5	+	5	967	c.600T>C	c.(598-600)gcT>gcC	p.A200A	ENTPD1-AS1_ENST00000452728.1_RNA|ENTPD1-AS1_ENST00000458228.1_RNA|ENTPD1-AS1_ENST00000454638.1_RNA|CCNJ_ENST00000534974.1_Silent_p.A200A|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1-AS1_ENST00000427846.1_RNA|ENTPD1-AS1_ENST00000451364.1_RNA|CCNJ_ENST00000403870.3_Silent_p.A199A|CCNJ_ENST00000465148.2_Silent_p.A211A	NM_001134375.1|NM_001134376.1|NM_019084.4	NP_001127847.1|NP_001127848.1|NP_061957.2	Q5T5M9	CCNJ_HUMAN	cyclin J	200						nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	11				Epithelial(162;6.1e-08)|all cancers(201;2.32e-06)		CATGTGTGGCTTCTTCGAGGA	0.423																																					p.A211A		.											.	CCNJ	91	0			c.T633C						.						245.0	213.0	224.0					10																	97816897		2203	4300	6503	SO:0001819	synonymous_variant	54619	exon5			TGTGGCTTCTTCG	AK001757	CCDS7445.1, CCDS44462.1, CCDS44463.1	10q23.33	2008-05-14			ENSG00000107443	ENSG00000107443			23434	protein-coding gene	gene with protein product						12477932	Standard	NM_019084		Approved	FLJ10895, bA690P14.1	uc010qoq.2	Q5T5M9	OTTHUMG00000018823	ENST00000265992.5:c.600T>C	10.37:g.97816897T>C		293.0	0.0		133.0	6.0	NM_001134375	B7Z4E7|Q86XL1|Q9NV69	Silent	SNP	ENST00000265992.5	37	CCDS7445.1																																																																																			.		0.423	CCNJ-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090166.3	NM_019084	
CDH16	1014	hgsc.bcm.edu;bcgsc.ca	37	16	66946026	66946026	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:66946026T>C	ENST00000299752.4	-	13	1759	c.1566A>G	c.(1564-1566)gcA>gcG	p.A522A	CDH16_ENST00000394055.3_Silent_p.A522A|CDH16_ENST00000565796.1_Silent_p.A522A|CDH16_ENST00000568632.1_Silent_p.A425A|CDH16_ENST00000570262.1_Silent_p.A442A	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	522	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		GACTTGGAGCTGCCTCATAAC	0.642																																					p.A522A		.											.	CDH16	93	0			c.A1566G						.						42.0	41.0	42.0					16																	66946026		2200	4300	6500	SO:0001819	synonymous_variant	1014	exon13			TGGAGCTGCCTCA	AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.1566A>G	16.37:g.66946026T>C		96.0	0.0		75.0	4.0	NM_004062	B4DPA8|H3BPD3|Q6UW93	Silent	SNP	ENST00000299752.4	37	CCDS10823.1																																																																																			.		0.642	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268839.2	NM_004062	
CDH6	1004	hgsc.bcm.edu;bcgsc.ca	37	5	31305284	31305284	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:31305284T>C	ENST00000265071.2	+	7	1268	c.1003T>C	c.(1003-1005)Ttg>Ctg	p.L335L	CDH6_ENST00000514738.1_Silent_p.L280L	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	335	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CCTCAAGCTCTTGGACTTTGA	0.428																																					p.L335L		.											.	CDH6	159	0			c.T1003C						.						71.0	73.0	72.0					5																	31305284		2203	4300	6503	SO:0001819	synonymous_variant	1004	exon7			AAGCTCTTGGACT	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.1003T>C	5.37:g.31305284T>C		61.0	0.0		54.0	5.0	NM_004932	A8K5H5|Q9BWS0	Silent	SNP	ENST00000265071.2	37	CCDS3894.1																																																																																			.		0.428	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932	
CENPT	80152	hgsc.bcm.edu;bcgsc.ca	37	16	67864301	67864301	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:67864301T>C	ENST00000562787.1	-	11	1402	c.854A>G	c.(853-855)cAg>cGg	p.Q285R	CENPT_ENST00000440851.2_Missense_Mutation_p.Q285R|CENPT_ENST00000562947.1_5'UTR|CENPT_ENST00000564817.1_Missense_Mutation_p.Q285R|CENPT_ENST00000219172.3_Missense_Mutation_p.Q285R	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T	285	Flexible stalk domain. {ECO:0000250}.				chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		ACTATTCTTCTGCAGCCCAGG	0.587																																					p.Q285R		.											.	CENPT	90	0			c.A854G						.						66.0	73.0	71.0					16																	67864301		2130	4257	6387	SO:0001583	missense	80152	exon11			TTCTTCTGCAGCC	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3		ENST00000562787.1:c.854A>G	16.37:g.67864301T>C	ENSP00000457810:p.Gln285Arg	119.0	0.0		94.0	6.0	NM_025082	Q96I29|Q96IC6|Q96NK9|Q9H901	Missense_Mutation	SNP	ENST00000562787.1	37	CCDS42182.1	.	.	.	.	.	.	.	.	.	.	T	15.43	2.832296	0.50845	.	.	ENSG00000102901	ENST00000440851;ENST00000219172	T;T	0.50548	0.74;0.74	4.98	2.74	0.32292	.	0.572147	0.16294	N	0.220785	T	0.44350	0.1289	M	0.74881	2.28	0.09310	N	0.999999	B;B	0.11235	0.004;0.004	B;B	0.11329	0.006;0.006	T	0.37572	-0.9700	10	0.34782	T	0.22	-5.75	6.7835	0.23659	0.0:0.1917:0.0:0.8083	.	285;285	Q96BT3;B3KPB2	CENPT_HUMAN;.	R	285	ENSP00000400140:Q285R;ENSP00000219172:Q285R	ENSP00000219172:Q285R	Q	-	2	0	CENPT	66421802	0.832000	0.29368	0.021000	0.16686	0.009000	0.06853	1.969000	0.40510	0.456000	0.26937	-0.376000	0.06991	CAG	.		0.587	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1	NM_025082	
CIT	11113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	120241020	120241020	+	Missense_Mutation	SNP	C	C	G	rs145965687	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:120241020C>G	ENST00000261833.7	-	10	1337	c.1285G>C	c.(1285-1287)Ggt>Cgt	p.G429R	CIT_ENST00000392521.2_Missense_Mutation_p.G429R	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	429	AGC-kinase C-terminal.				cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TCAGATCTACCAAGAATCCCC	0.532																																					p.G429R		.											.	CIT	399	0			c.G1285C						.						82.0	84.0	83.0					12																	120241020		2203	4300	6503	SO:0001583	missense	11113	exon10			ATCTACCAAGAAT	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.1285G>C	12.37:g.120241020C>G	ENSP00000261833:p.Gly429Arg	112.0	0.0		77.0	53.0	NM_001206999	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	37	CCDS9192.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.41|14.41	2.527671|2.527671	0.44969|0.44969	.|.	.|.	ENSG00000122966|ENSG00000122966	ENST00000392521;ENST00000261833|ENST00000392520	T;T|T	0.64438|0.13307	-0.1;-0.09|2.6	5.43|5.43	5.43|5.43	0.79202|0.79202	AGC-kinase, C-terminal (1);|.	0.340590|.	0.27861|.	N|.	0.017557|.	T|T	0.09642|0.09642	0.0237|0.0237	N|N	0.08118|0.08118	0|0	0.34036|0.34036	D|D	0.654392|0.654392	B;B|.	0.22683|.	0.008;0.073|.	B;B|.	0.23716|.	0.003;0.048|.	T|T	0.26052|0.26052	-1.0114|-1.0114	10|7	0.28530|0.37606	T|T	0.3|0.19	.|.	10.2233|10.2233	0.43209|0.43209	0.0:0.9107:0.0:0.0893|0.0:0.9107:0.0:0.0893	.|.	429;429|.	Q2M5E1;O14578|.	.;CTRO_HUMAN|.	R|F	429|56	ENSP00000376306:G429R;ENSP00000261833:G429R|ENSP00000376305:L56F	ENSP00000261833:G429R|ENSP00000376305:L56F	G|L	-|-	1|3	0|2	CIT|CIT	118725403|118725403	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.429000|2.429000	0.44758|0.44758	2.546000|2.546000	0.85860|0.85860	0.655000|0.655000	0.94253|0.94253	GGT|TTG	C|0.999;T|0.000		0.532	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
CNTN3	5067	hgsc.bcm.edu;bcgsc.ca	37	3	74418520	74418520	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:74418520T>C	ENST00000263665.6	-	7	793	c.766A>G	c.(766-768)Ata>Gta	p.I256V		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	256	Ig-like C2-type 3.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		ATCTGAGGTATGGGACTAAGA	0.383																																					p.I256V		.											.	CNTN3	137	0			c.A766G						.						43.0	43.0	43.0					3																	74418520		2203	4298	6501	SO:0001583	missense	5067	exon7			GAGGTATGGGACT	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.766A>G	3.37:g.74418520T>C	ENSP00000263665:p.Ile256Val	184.0	0.0		81.0	4.0	NM_020872	B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	T	0.670	-0.802436	0.02841	.	.	ENSG00000113805	ENST00000263665	T	0.65916	-0.18	5.2	-1.46	0.08800	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.272223	0.35708	N	0.003023	T	0.25975	0.0633	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30357	-0.9981	10	0.02654	T	1	.	6.2168	0.20659	0.0:0.5523:0.1122:0.3355	.	256	Q9P232	CNTN3_HUMAN	V	256	ENSP00000263665:I256V	ENSP00000263665:I256V	I	-	1	0	CNTN3	74501210	0.867000	0.29959	0.051000	0.19133	0.992000	0.81027	1.719000	0.38011	-0.721000	0.04929	0.482000	0.46254	ATA	.		0.383	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872	
COL4A4	1286	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	227922184	227922184	+	Missense_Mutation	SNP	G	G	A	rs199562472		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:227922184G>A	ENST00000396625.3	-	29	2723	c.2516C>T	c.(2515-2517)cCg>cTg	p.P839L	COL4A4_ENST00000329662.7_Missense_Mutation_p.P839L	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	839	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		AGGGAGTCCCGGTTGCCCTGG	0.537																																					p.P839L		.											.	COL4A4	142	0			c.C2516T						.						33.0	35.0	34.0					2																	227922184		1877	4113	5990	SO:0001583	missense	1286	exon29			AGTCCCGGTTGCC		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.2516C>T	2.37:g.227922184G>A	ENSP00000379866:p.Pro839Leu	61.0	1.0		75.0	23.0	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	37	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	G	1.757	-0.487704	0.04352	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.94046	-3.34;-3.34	5.82	5.82	0.92795	.	.	.	.	.	D	0.93145	0.7817	M	0.84082	2.675	0.20403	N	0.999905	P	0.52577	0.954	B	0.40659	0.336	D	0.88791	0.3278	9	0.33940	T	0.23	.	14.633	0.68671	0.0:0.1453:0.8547:0.0	.	839	P53420	CO4A4_HUMAN	L	839	ENSP00000379866:P839L;ENSP00000328553:P839L	ENSP00000328553:P839L	P	-	2	0	COL4A4	227630428	1.000000	0.71417	0.070000	0.20053	0.382000	0.30200	4.122000	0.57910	2.760000	0.94817	0.655000	0.94253	CCG	G|0.999;A|0.001		0.537	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
CORIN	10699	hgsc.bcm.edu;bcgsc.ca	37	4	47685795	47685795	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:47685795C>T	ENST00000273857.4	-	7	973	c.974G>A	c.(973-975)tGt>tAt	p.C325Y	CORIN_ENST00000508498.1_Missense_Mutation_p.C186Y|CORIN_ENST00000502252.1_Missense_Mutation_p.C258Y|CORIN_ENST00000504584.1_Missense_Mutation_p.C325Y|CORIN_ENST00000505909.1_Missense_Mutation_p.C325Y	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	325	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						ATATCCATCACACACAAGGCT	0.398																																					p.C325Y		.											.	CORIN	91	0			c.G974A						.						131.0	123.0	126.0					4																	47685795		2203	4300	6503	SO:0001583	missense	10699	exon7			CCATCACACACAA	AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.974G>A	4.37:g.47685795C>T	ENSP00000273857:p.Cys325Tyr	60.0	0.0		67.0	4.0	NM_006587	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	ENST00000273857.4	37	CCDS3477.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.759066	0.89843	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909;ENST00000504584	D;D;D;D;D	0.99755	-6.64;-6.64;-6.64;-6.64;-6.64	5.83	5.83	0.93111	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99900	0.9952	H	0.98738	4.315	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;1.0;1.0;1.0	D	0.96361	0.9266	10	0.87932	D	0	.	20.1133	0.97917	0.0:1.0:0.0:0.0	.	325;325;258;186;325	B7Z4R1;B4E2W9;B4E1Y7;B4DZA3;Q9Y5Q5	.;.;.;.;CORIN_HUMAN	Y	325;186;258;325;325	ENSP00000273857:C325Y;ENSP00000425597:C186Y;ENSP00000424212:C258Y;ENSP00000425401:C325Y;ENSP00000423216:C325Y	ENSP00000273857:C325Y	C	-	2	0	CORIN	47380552	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	7.163000	0.77524	2.762000	0.94881	0.591000	0.81541	TGT	.		0.398	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2		
DAO	1610	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	109288138	109288138	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:109288138A>G	ENST00000228476.3	+	7	811	c.607A>G	c.(607-609)Atg>Gtg	p.M203V	DAO_ENST00000551281.1_Missense_Mutation_p.M137V	NM_001917.4	NP_001908.3	P14920	OXDA_HUMAN	D-amino-acid oxidase	203					cellular nitrogen compound metabolic process (GO:0034641)|D-alanine catabolic process (GO:0055130)|D-serine catabolic process (GO:0036088)|D-serine metabolic process (GO:0070178)|dopamine biosynthetic process (GO:0042416)|glyoxylate metabolic process (GO:0046487)|leucine metabolic process (GO:0006551)|proline catabolic process (GO:0006562)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-amino-acid oxidase activity (GO:0003884)|FAD binding (GO:0071949)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|skin(1)	26					Flavin adenine dinucleotide(DB03147)	GGGGCAGATCATGAAGGTGAG	0.532																																					p.M203V		.											.	DAO	92	0			c.A607G						.						48.0	39.0	42.0					12																	109288138		2203	4300	6503	SO:0001583	missense	1610	exon7			CAGATCATGAAGG	D11370	CCDS9122.1	12q24.11	2013-09-20			ENSG00000110887	ENSG00000110887	1.4.3.3		2671	protein-coding gene	gene with protein product		124050				1356107, 8182053	Standard	NM_001917		Approved	DAMOX	uc001tnr.4	P14920	OTTHUMG00000169360	ENST00000228476.3:c.607A>G	12.37:g.109288138A>G	ENSP00000228476:p.Met203Val	83.0	0.0		44.0	4.0	NM_001917	B2R7I5|Q16758|Q8N6R2	Missense_Mutation	SNP	ENST00000228476.3	37	CCDS9122.1	.	.	.	.	.	.	.	.	.	.	A	12.85	2.062280	0.36373	.	.	ENSG00000110887	ENST00000551281;ENST00000228476;ENST00000547768	T;T;T	0.79454	-1.27;-1.27;-1.27	5.51	4.3	0.51218	FAD dependent oxidoreductase (1);	0.088548	0.85682	D	0.000000	T	0.44623	0.1302	N	0.01015	-1.05	0.23435	N	0.997689	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.26155	-1.0111	10	0.02654	T	1	-18.9327	12.0939	0.53744	0.7717:0.2283:0.0:0.0	.	203;186	P14920;Q7Z312	OXDA_HUMAN;.	V	137;203;80	ENSP00000446853:M137V;ENSP00000228476:M203V;ENSP00000449967:M80V	ENSP00000228476:M203V	M	+	1	0	DAO	107812267	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.955000	0.49121	2.108000	0.64289	0.409000	0.27619	ATG	.		0.532	DAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403682.1		
DCBLD1	285761	hgsc.bcm.edu;bcgsc.ca	37	6	117861869	117861869	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:117861869A>G	ENST00000338728.5	+	10	1260	c.1140A>G	c.(1138-1140)caA>caG	p.Q380Q	GOPC_ENST00000467125.1_Intron|DCBLD1_ENST00000296955.8_Silent_p.Q380Q|DCBLD1_ENST00000368503.4_Intron|DCBLD1_ENST00000534777.1_3'UTR			Q8N8Z6	DCBD1_HUMAN	discoidin, CUB and LCCL domain containing 1	380	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)		ACCCAGTGCAAAACAATTTCA	0.448																																					p.Q380Q		.											.	DCBLD1	91	0			c.A1140G						.						133.0	133.0	133.0					6																	117861869		2203	4300	6503	SO:0001819	synonymous_variant	285761	exon10			AGTGCAAAACAAT	AK055462	CCDS34522.1	6q22.31	2003-06-20			ENSG00000164465	ENSG00000164465			21479	protein-coding gene	gene with protein product							Standard	NM_173674		Approved	MGC46341, dJ94G16.1	uc003pxs.3	Q8N8Z6	OTTHUMG00000015455	ENST00000338728.5:c.1140A>G	6.37:g.117861869A>G		131.0	0.0		95.0	4.0	NM_173674	Q5H992|Q8IYK5|Q8N7L9|Q96NH2	Silent	SNP	ENST00000338728.5	37																																																																																				.		0.448	DCBLD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000041979.2	NM_173674	
DGKI	9162	hgsc.bcm.edu;bcgsc.ca	37	7	137374712	137374712	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:137374712A>G	ENST00000288490.5	-	2	438	c.438T>C	c.(436-438)gcT>gcC	p.A146A	DGKI_ENST00000424189.2_Silent_p.A146A|DGKI_ENST00000453654.2_Intron|DGKI_ENST00000446122.1_Silent_p.A146A	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	146					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						GATGTGCAGGAGCCAGATGCT	0.483																																					p.A146A		.											.	DGKI	228	0			c.T438C						.						72.0	71.0	71.0					7																	137374712		2203	4300	6503	SO:0001819	synonymous_variant	9162	exon2			TGCAGGAGCCAGA	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.438T>C	7.37:g.137374712A>G		75.0	0.0		87.0	5.0	NM_004717	A4D1Q9|Q9NZ49	Silent	SNP	ENST00000288490.5	37	CCDS5845.1																																																																																			.		0.483	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
DLST	1743	hgsc.bcm.edu;bcgsc.ca	37	14	75365074	75365074	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:75365074A>G	ENST00000334220.4	+	11	834	c.773A>G	c.(772-774)aAc>aGc	p.N258S	DLST_ENST00000555190.1_3'UTR|DLST_ENST00000334212.6_Missense_Mutation_p.N172S	NM_001933.4	NP_001924.2	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)	258					cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|generation of precursor metabolites and energy (GO:0006091)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|oxoglutarate dehydrogenase complex (GO:0045252)	dihydrolipoyllysine-residue succinyltransferase activity (GO:0004149)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00698)		TTTCACAGTAACATCCAGGAG	0.423																																					p.N258S		.											.	DLST	227	0			c.A773G						.						93.0	90.0	91.0					14																	75365074		2203	4300	6503	SO:0001583	missense	1743	exon11			ACAGTAACATCCA		CCDS9833.1	14q23.1	2008-08-11			ENSG00000119689	ENSG00000119689	2.3.1.61		2911	protein-coding gene	gene with protein product		126063		DLTS		8009371	Standard	NM_001933		Approved		uc001xqv.2	P36957		ENST00000334220.4:c.773A>G	14.37:g.75365074A>G	ENSP00000335304:p.Asn258Ser	140.0	0.0		92.0	4.0	NM_001933	B7Z5W8|E7ESY5|Q7LDY7|Q9BQ32	Missense_Mutation	SNP	ENST00000334220.4	37	CCDS9833.1	.	.	.	.	.	.	.	.	.	.	A	12.13	1.845180	0.32606	.	.	ENSG00000119689	ENST00000334220;ENST00000334212;ENST00000554806	T;T;T	0.42131	0.98;0.98;0.98	5.84	5.84	0.93424	2-oxoacid dehydrogenase acyltransferase, catalytic domain (1);Chloramphenicol acetyltransferase-like domain (1);	0.037870	0.85682	D	0.000000	T	0.39279	0.1072	L	0.43554	1.36	0.80722	D	1	B;B;B;B;B	0.28470	0.067;0.213;0.213;0.137;0.135	B;B;B;B;B	0.34346	0.065;0.18;0.18;0.115;0.089	T	0.17319	-1.0373	10	0.14656	T	0.56	-18.3689	16.21	0.82150	1.0:0.0:0.0:0.0	.	172;258;258;170;174	B7Z5W8;Q6IBS5;P36957;Q86TQ8;Q86TW7	.;.;ODO2_HUMAN;.;.	S	258;172;241	ENSP00000335304:N258S;ENSP00000335465:N172S;ENSP00000451957:N241S	ENSP00000238671:N241S	N	+	2	0	DLST	74434827	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	8.938000	0.92943	2.236000	0.73375	0.528000	0.53228	AAC	.		0.423	DLST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413637.1		
DMBX1	127343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	46976674	46976674	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:46976674A>G	ENST00000360032.3	+	3	415	c.401A>G	c.(400-402)cAg>cGg	p.Q134R	DMBX1_ENST00000371956.4_Missense_Mutation_p.Q139R	NM_172225.1	NP_757379.1			diencephalon/mesencephalon homeobox 1											endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)					GAACAGCTCCAGAAGCAGAAG	0.647																																					p.Q139R		.											.	DMBX1	227	0			c.A416G						.						41.0	49.0	47.0					1																	46976674		2203	4300	6503	SO:0001583	missense	127343	exon3			AGCTCCAGAAGCA	AB037699	CCDS536.1	1p34.1	2011-06-20	2004-03-29	2004-03-30	ENSG00000197587	ENSG00000197587		"""Homeoboxes / PRD class"""	19026	protein-coding gene	gene with protein product		607410	"""orthodenticle homolog 3 (Drosophila)"""	OTX3			Standard	NM_147192		Approved	PAXB	uc001cpx.3	Q8NFW5	OTTHUMG00000007982	ENST00000360032.3:c.401A>G	1.37:g.46976674A>G	ENSP00000353132:p.Gln134Arg	124.0	0.0		117.0	43.0	NM_147192		Missense_Mutation	SNP	ENST00000360032.3	37	CCDS536.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.279998	0.80692	.	.	ENSG00000197587	ENST00000371956;ENST00000360032	D;D	0.93906	-3.21;-3.31	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.94551	0.8245	L	0.55990	1.75	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.79784	0.985;0.993	D	0.92307	0.5854	10	0.09590	T	0.72	.	13.9043	0.63823	1.0:0.0:0.0:0.0	.	139;134	Q8NFW5;Q8NFW5-2	DMBX1_HUMAN;.	R	139;134	ENSP00000361024:Q139R;ENSP00000353132:Q134R	ENSP00000353132:Q134R	Q	+	2	0	DMBX1	46749261	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.333000	0.96459	1.894000	0.54839	0.482000	0.46254	CAG	.		0.647	DMBX1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021895.1		
DMXL2	23312	hgsc.bcm.edu;bcgsc.ca	37	15	51748508	51748508	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:51748508T>C	ENST00000251076.5	-	37	8617	c.8330A>G	c.(8329-8331)tAc>tGc	p.Y2777C	RP11-707P17.1_ENST00000561007.1_RNA|RP11-707P17.2_ENST00000559977.1_RNA|RP11-707P17.2_ENST00000560727.1_RNA|DMXL2_ENST00000543779.2_Missense_Mutation_p.Y2778C|DMXL2_ENST00000449909.3_Missense_Mutation_p.Y2141C|RP11-707P17.2_ENST00000559173.1_RNA	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2777						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		ATACTTACAGTATTGATGGAC	0.274																																					p.Y2778C		.											.	DMXL2	99	0			c.A8333G						.						66.0	72.0	70.0					15																	51748508		2196	4292	6488	SO:0001583	missense	23312	exon37			TTACAGTATTGAT	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.8330A>G	15.37:g.51748508T>C	ENSP00000251076:p.Tyr2777Cys	197.0	0.0		99.0	4.0	NM_001174116	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	T	19.83	3.900687	0.72754	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909;ENST00000436119	T;T;T	0.01446	4.88;4.88;4.88	5.26	4.14	0.48551	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.09024	0.0223	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.974	D;D;D;P	0.91635	0.999;0.993;0.997;0.727	T	0.00664	-1.1620	10	0.87932	D	0	.	11.0239	0.47734	0.0:0.0727:0.0:0.9273	.	2778;2141;2777;2778	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	C	2777;2778;2141;343	ENSP00000251076:Y2777C;ENSP00000441858:Y2778C;ENSP00000400855:Y2141C	ENSP00000251076:Y2777C	Y	-	2	0	DMXL2	49535800	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	7.501000	0.81600	1.012000	0.39366	0.533000	0.62120	TAC	.		0.274	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
DNAH7	56171	hgsc.bcm.edu;bcgsc.ca	37	2	196750895	196750895	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:196750895T>C	ENST00000312428.6	-	34	5608	c.5508A>G	c.(5506-5508)agA>agG	p.R1836R		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1836					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CTCGATCATTTCTCTCCTTTA	0.398																																					p.R1836R		.											.	DNAH7	102	0			c.A5508G						.						154.0	154.0	154.0					2																	196750895		1878	4111	5989	SO:0001819	synonymous_variant	56171	exon34			ATCATTTCTCTCC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.5508A>G	2.37:g.196750895T>C		58.0	0.0		100.0	4.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	CCDS42794.1																																																																																			.		0.398	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
DSP	1832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	7580098	7580098	+	Silent	SNP	C	C	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:7580098C>G	ENST00000379802.3	+	23	4016	c.3675C>G	c.(3673-3675)tcC>tcG	p.S1225S	DSP_ENST00000418664.2_Intron	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1225	Central fibrous rod domain.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AGGAGATATCCATGCAAAAAG	0.368																																					p.S1225S		.											.	DSP	518	0			c.C3675G						.						75.0	72.0	73.0					6																	7580098		2203	4300	6503	SO:0001819	synonymous_variant	1832	exon23			GATATCCATGCAA	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.3675C>G	6.37:g.7580098C>G		116.0	0.0		91.0	39.0	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	37	CCDS4501.1																																																																																			.		0.368	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
DYNC2H1	79659	hgsc.bcm.edu;bcgsc.ca	37	11	103018563	103018563	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:103018563T>C	ENST00000375735.2	+	19	2909	c.2765T>C	c.(2764-2766)cTc>cCc	p.L922P	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.L922P	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	922	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		ATTGATGATCTCATCCAGAAG	0.303																																					p.L922P		.											.	DYNC2H1	68	0			c.T2765C						.						120.0	116.0	117.0					11																	103018563		1839	4078	5917	SO:0001583	missense	79659	exon19			ATGATCTCATCCA	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.2765T>C	11.37:g.103018563T>C	ENSP00000364887:p.Leu922Pro	41.0	0.0		64.0	4.0	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	T	17.45	3.393574	0.62066	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.28895	1.59;1.59	5.49	5.49	0.81192	.	0.385199	0.20577	U	0.089603	T	0.48295	0.1492	M	0.71581	2.175	0.80722	D	1	P;P	0.39576	0.679;0.619	P;P	0.51355	0.466;0.667	T	0.32929	-0.9888	10	0.29301	T	0.29	.	15.8882	0.79269	0.0:0.0:0.0:1.0	.	922;922	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	P	922	ENSP00000364887:L922P;ENSP00000381167:L922P	ENSP00000364887:L922P	L	+	2	0	DYNC2H1	102523773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.619000	0.83057	2.220000	0.72140	0.528000	0.53228	CTC	.		0.303	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
EFEMP1	2202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	56145028	56145028	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:56145028C>T	ENST00000394555.2	-	4	724	c.289G>A	c.(289-291)Gca>Aca	p.A97T	EFEMP1_ENST00000424836.2_Missense_Mutation_p.A39T|EFEMP1_ENST00000394554.1_Missense_Mutation_p.A97T|EFEMP1_ENST00000355426.3_Missense_Mutation_p.A97T	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	97					epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)			NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CCGGTGGTTGCCCCTGAGGTT	0.557																																					p.A97T	GBM(92;934 1319 7714 28760 40110)	.											.	EFEMP1	520	0			c.G289A						.						97.0	97.0	97.0					2																	56145028		2203	4300	6503	SO:0001583	missense	2202	exon4			TGGTTGCCCCTGA	U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.289G>A	2.37:g.56145028C>T	ENSP00000378058:p.Ala97Thr	217.0	0.0		199.0	78.0	NM_001039349	A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	ENST00000394555.2	37	CCDS1857.1	.	.	.	.	.	.	.	.	.	.	C	11.97	1.797549	0.31777	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000424836;ENST00000355426;ENST00000438672;ENST00000439193;ENST00000440439	D;D;T;D;T;T;T	0.83591	-1.74;-1.74;-1.28;-1.74;-1.23;-1.25;-1.12	5.34	-0.879	0.10613	.	0.646499	0.13744	N	0.365742	T	0.64450	0.2599	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.53816	-0.8385	10	0.48119	T	0.1	.	9.9113	0.41408	0.0:0.5395:0.0:0.4605	.	39;97	B4DW75;Q12805	.;FBLN3_HUMAN	T	97;97;39;97;97;97;97	ENSP00000378058:A97T;ENSP00000378057:A97T;ENSP00000399145:A39T;ENSP00000347596:A97T;ENSP00000392055:A97T;ENSP00000408195:A97T;ENSP00000398345:A97T	ENSP00000347596:A97T	A	-	1	0	EFEMP1	55998532	0.000000	0.05858	0.002000	0.10522	0.802000	0.45316	-0.396000	0.07278	-0.104000	0.12154	0.650000	0.86243	GCA	.		0.557	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251491.2		
EIF5	1983	hgsc.bcm.edu;bcgsc.ca	37	14	103803078	103803078	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:103803078T>C	ENST00000216554.3	+	5	895	c.219T>C	c.(217-219)cgT>cgC	p.R73R	SNORA28_ENST00000606769.1_RNA|EIF5_ENST00000558506.1_Silent_p.R73R|EIF5_ENST00000560200.1_3'UTR|EIF5_ENST00000392715.2_Silent_p.R73R	NM_001969.4	NP_001960.2	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5	73					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(3)|kidney(2)|large_intestine(3)|lung(5)|pancreas(2)|skin(2)|upper_aerodigestive_tract(1)	18		Melanoma(154;0.155)	Epithelial(46;0.182)			AGAATGACCGTTACATTGTCA	0.388																																					p.R73R		.											.	EIF5	155	0			c.T219C						.						132.0	121.0	125.0					14																	103803078		2203	4300	6503	SO:0001819	synonymous_variant	1983	exon5			TGACCGTTACATT	U49436	CCDS9980.1	14q32.32	2006-05-11				ENSG00000100664			3299	protein-coding gene	gene with protein product		601710				8663286	Standard	NM_001969		Approved		uc001ymq.4	P55010		ENST00000216554.3:c.219T>C	14.37:g.103803078T>C		97.0	0.0		80.0	4.0	NM_001969	Q53XB3|Q9H5N2|Q9UG48	Silent	SNP	ENST00000216554.3	37	CCDS9980.1																																																																																			.		0.388	EIF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415329.2	NM_001969	
EYS	346007	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	6	64498005	64498005	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:64498005A>G	ENST00000370621.3	-	39	8242	c.7716T>C	c.(7714-7716)ggT>ggC	p.G2572G	EYS_ENST00000503581.1_Silent_p.G2572G|EYS_ENST00000486069.1_5'UTR|EYS_ENST00000370616.2_Silent_p.G2572G			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	2572	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TACCTTGAAAACCATTTTTAA	0.333																																					p.G2572G		.											.	EYS	660	0			c.T7716C						.						124.0	102.0	109.0					6																	64498005		692	1591	2283	SO:0001819	synonymous_variant	346007	exon39			TTGAAAACCATTT		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.7716T>C	6.37:g.64498005A>G		58.0	0.0		56.0	5.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	A	8.281	0.815531	0.16607	.	.	ENSG00000188107	ENST00000398580	.	.	.	4.1	-0.136	0.13473	.	.	.	.	.	T	0.34019	0.0883	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22277	-1.0221	4	.	.	.	.	4.9725	0.14123	0.2999:0.3246:0.3755:0.0	.	.	.	.	A	344	.	.	V	-	2	0	EYS	64555964	0.970000	0.33590	0.995000	0.50966	0.998000	0.95712	0.006000	0.13152	-0.216000	0.10048	0.533000	0.62120	GTT	.		0.333	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
F10	2159	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	113803258	113803258	+	Silent	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr13:113803258C>T	ENST00000375559.3	+	8	932	c.894C>T	c.(892-894)ggC>ggT	p.G298G	F10_ENST00000375551.3_Missense_Mutation_p.A295V|F10_ENST00000409306.1_Missense_Mutation_p.A297V	NM_000504.3	NP_000495.1	P00742	FA10_HUMAN	coagulation factor X	298	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(4)|lung(10)|pancreas(1)|stomach(1)	18	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Antihemophilic Factor(DB00025)|Apixaban(DB06605)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Menadione(DB00170)|Rivaroxaban(DB06228)	AGGAGGAGGGCGGTGAGGCGG	0.607																																					p.G298G		.											.	F10	227	0			c.C894T						.						161.0	136.0	144.0					13																	113803258		2203	4300	6503	SO:0001819	synonymous_variant	2159	exon8			GGAGGGCGGTGAG		CCDS9530.1	13q34	2012-10-02			ENSG00000126218	ENSG00000126218	3.4.21.6		3528	protein-coding gene	gene with protein product		613872					Standard	XM_005268298		Approved		uc001vsx.3	P00742	OTTHUMG00000017374	ENST00000375559.3:c.894C>T	13.37:g.113803258C>T		361.0	0.0		420.0	26.0	NM_000504	Q14340	Silent	SNP	ENST00000375559.3	37	CCDS9530.1	.	.	.	.	.	.	.	.	.	.	C	0.094	-1.162845	0.01673	.	.	ENSG00000126218	ENST00000409306;ENST00000375551	D;D	0.95656	-3.71;-3.77	4.99	-0.441	0.12257	.	.	.	.	.	D	0.90710	0.7085	.	.	.	0.09310	N	1	P;P	0.44006	0.824;0.824	B;B	0.41135	0.24;0.348	T	0.82995	-0.0180	8	0.38643	T	0.18	.	5.7129	0.17945	0.2181:0.3549:0.359:0.0681	.	297;295	B7ZBK1;Q5JVE8	.;.	V	297;295	ENSP00000387092:A297V;ENSP00000364701:A295V	ENSP00000364701:A295V	A	+	2	0	F10	112851259	0.244000	0.23889	0.153000	0.22517	0.139000	0.21198	0.516000	0.22817	0.101000	0.17610	0.313000	0.20887	GCG	.		0.607	F10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045841.3		
FAM120C	54954	hgsc.bcm.edu;bcgsc.ca	37	X	54162988	54162988	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:54162988T>C	ENST00000375180.2	-	5	1250	c.1194A>G	c.(1192-1194)aaA>aaG	p.K398K	FAM120C_ENST00000328235.4_Silent_p.K398K	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	398							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						ACTCAACTGCTTTCTTGAATC	0.408																																					p.K398K		.											.	FAM120C	131	0			c.A1194G						.						306.0	255.0	272.0					X																	54162988		2203	4300	6503	SO:0001819	synonymous_variant	54954	exon5			AACTGCTTTCTTG	AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.1194A>G	X.37:g.54162988T>C		76.0	0.0		75.0	4.0	NM_017848	B2RMT7	Silent	SNP	ENST00000375180.2	37	CCDS14356.1																																																																																			.		0.408	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056795.2	NM_017848	
FAM208A	23272	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	56667646	56667646	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:56667646A>G	ENST00000493960.2	-	18	3183	c.3173T>C	c.(3172-3174)aTg>aCg	p.M1058T	FAM208A_ENST00000355628.5_Missense_Mutation_p.M997T|FAM208A_ENST00000431842.2_Missense_Mutation_p.M621T	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1058							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						AAGCCGTTTCATCTTCTCTTG	0.343																																					p.M1058T		.											.	.	.	0			c.T3173C						.						110.0	119.0	116.0					3																	56667646		2203	4300	6503	SO:0001583	missense	23272	exon18			CGTTTCATCTTCT	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.3173T>C	3.37:g.56667646A>G	ENSP00000417509:p.Met1058Thr	38.0	0.0		26.0	4.0	NM_001112736	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	ENST00000493960.2	37	CCDS46853.1	.	.	.	.	.	.	.	.	.	.	A	12.34	1.909510	0.33721	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.12774	2.65;2.89;2.9	5.76	5.76	0.90799	.	0.391146	0.30401	N	0.009705	T	0.15003	0.0362	L	0.59436	1.845	0.33387	D	0.575673	B;B;B;B	0.32467	0.332;0.372;0.218;0.224	B;B;B;B	0.31869	0.137;0.098;0.104;0.101	T	0.16364	-1.0405	10	0.32370	T	0.25	-2.4445	10.6901	0.45867	0.9288:0.0:0.0712:0.0	.	1058;997;621;1058	Q9UK61-3;Q9UK61-4;Q9UK61-2;Q9UK61	.;.;.;F208A_HUMAN	T	621;1058;997	ENSP00000399410:M621T;ENSP00000417509:M1058T;ENSP00000347845:M997T	ENSP00000347845:M997T	M	-	2	0	C3orf63	56642686	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.725000	0.61979	2.323000	0.78572	0.528000	0.53228	ATG	.		0.343	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
FAM3B	54097	hgsc.bcm.edu;bcgsc.ca	37	21	42720630	42720630	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr21:42720630T>C	ENST00000357985.2	+	7	743	c.597T>C	c.(595-597)ccT>ccC	p.P199P	FAM3B_ENST00000398647.3_Silent_p.P151P|FAM3B_ENST00000479810.2_3'UTR|FAM3B_ENST00000398652.3_Silent_p.P238P|FAM3B_ENST00000398646.3_Silent_p.P222P	NM_058186.3	NP_478066.3	P58499	FAM3B_HUMAN	family with sequence similarity 3, member B	199					apoptotic process (GO:0006915)|insulin secretion (GO:0030073)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			central_nervous_system(2)|endometrium(1)|lung(2)	5		Prostate(19;1.57e-07)|all_epithelial(19;0.0404)				TGGAACTCCCTTCCGAAATTC	0.423																																					p.P199P		.											.	FAM3B	90	0			c.T597C						.						81.0	77.0	79.0					21																	42720630		2203	4300	6503	SO:0001819	synonymous_variant	54097	exon7			ACTCCCTTCCGAA	AF494379	CCDS13671.1, CCDS42930.1	21q22.3	2014-08-14	2002-05-23	2002-06-20	ENSG00000183844	ENSG00000183844			1253	protein-coding gene	gene with protein product	"""pancreatic-derived factor"""	608617	"""chromosome 21 open reading frame 11"""	C21orf11			Standard	NM_058186		Approved	D21M16SJHU19e, PRED44, 2-21, ORF9, C21orf76, PANDER	uc002yzb.1	P58499	OTTHUMG00000086752	ENST00000357985.2:c.597T>C	21.37:g.42720630T>C		150.0	0.0		96.0	4.0	NM_058186		Silent	SNP	ENST00000357985.2	37	CCDS13671.1																																																																																			.		0.423	FAM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195142.1	NM_058186	
FAM83C	128876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	33874568	33874568	+	Missense_Mutation	SNP	G	G	A	rs138265873		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr20:33874568G>A	ENST00000374408.3	-	4	2110	c.2014C>T	c.(2014-2016)Cgg>Tgg	p.R672W	EIF6_ENST00000374443.3_5'Flank|EIF6_ENST00000462894.1_5'Flank|EIF6_ENST00000374450.3_5'Flank|EIF6_ENST00000374436.3_5'Flank|FAM83C-AS1_ENST00000429167.1_RNA	NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	672										central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			AGGGTTAGCCGTTTCTCATCC	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		18590	0.0		0.0	False		,,,				2504	0.001				p.R672W		.											.	FAM83C	92	0			c.C2014T						.	G	TRP/ARG	0,4406		0,0,2203	62.0	55.0	57.0		2014	3.0	1.0	20	dbSNP_134	57	1,8599	1.2+/-3.3	0,1,4299	yes	missense	FAM83C	NM_178468.4	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	672/748	33874568	1,13005	2203	4300	6503	SO:0001583	missense	128876	exon4			TTAGCCGTTTCTC	AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.2014C>T	20.37:g.33874568G>A	ENSP00000363529:p.Arg672Trp	222.0	0.0		206.0	62.0	NM_178468	Q14D67|Q5JWN6|Q8N276	Missense_Mutation	SNP	ENST00000374408.3	37	CCDS13251.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.364574	0.24684	0.0	1.16E-4	ENSG00000125998	ENST00000374408	T	0.11063	2.81	4.93	2.96	0.34315	.	0.000000	0.38959	N	0.001510	T	0.09598	0.0236	L	0.59436	1.845	0.37487	D	0.916223	B	0.33549	0.417	B	0.23716	0.048	T	0.12426	-1.0548	10	0.87932	D	0	-15.5217	6.3401	0.21319	0.0881:0.0:0.5665:0.3454	.	672	Q9BQN1	FA83C_HUMAN	W	672	ENSP00000363529:R672W	ENSP00000363529:R672W	R	-	1	2	FAM83C	33337982	0.991000	0.36638	0.992000	0.48379	0.434000	0.31775	0.580000	0.23803	0.605000	0.29947	0.462000	0.41574	CGG	G|1.000;A|0.000		0.627	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078854.3		
FANK1	92565	hgsc.bcm.edu;bcgsc.ca	37	10	127697829	127697829	+	Silent	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:127697829C>T	ENST00000368693.1	+	10	1070	c.966C>T	c.(964-966)gaC>gaT	p.D322D	FANK1_ENST00000368695.1_Silent_p.D316D|FANK1_ENST00000477963.1_3'UTR			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	322						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				GAGTTTTTGACAGACAGGTTG	0.413																																					p.D322D		.											.	FANK1	91	0			c.C966T						.						164.0	172.0	169.0					10																	127697829		2203	4300	6503	SO:0001819	synonymous_variant	92565	exon10			TTTTGACAGACAG	BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.966C>T	10.37:g.127697829C>T		106.0	0.0		58.0	5.0	NM_145235	Q6UXY9|Q6X7T6	Silent	SNP	ENST00000368693.1	37	CCDS31309.1																																																																																			.		0.413	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235	
FARP1	10160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	99038053	99038053	+	Silent	SNP	A	A	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr13:99038053A>T	ENST00000319562.6	+	8	1009	c.744A>T	c.(742-744)ggA>ggT	p.G248G	FARP1_ENST00000595437.1_Silent_p.G248G|FARP1_ENST00000376586.2_Silent_p.G248G	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	248	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			CCAACACGGGAATTCTAGTGT	0.537																																					p.G248G		.											.	FARP1	290	0			c.A744T						.						99.0	85.0	90.0					13																	99038053		2203	4300	6503	SO:0001819	synonymous_variant	10160	exon8			CACGGGAATTCTA	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.744A>T	13.37:g.99038053A>T		25.0	0.0		39.0	20.0	NM_005766	Q5JVI9|Q6IQ29	Silent	SNP	ENST00000319562.6	37	CCDS9487.1																																																																																			.		0.537	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
FBXL5	26234	hgsc.bcm.edu;bcgsc.ca	37	4	15629615	15629615	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:15629615T>C	ENST00000341285.3	-	7	1058	c.934A>G	c.(934-936)Atg>Gtg	p.M312V	FBXL5_ENST00000382358.4_Missense_Mutation_p.M186V|FBXL5_ENST00000412094.2_Missense_Mutation_p.M295V	NM_001193534.1|NM_001193535.1|NM_012161.3	NP_001180463.1|NP_001180464.1|NP_036293.1	Q9UKA1	FBXL5_HUMAN	F-box and leucine-rich repeat protein 5	312					iron ion homeostasis (GO:0055072)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	iron ion binding (GO:0005506)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13						CGTTTTTCCATTTGTGCAATG	0.353																																					p.M312V		.											.	FBXL5	226	0			c.A934G						.						133.0	120.0	124.0					4																	15629615		2202	4300	6502	SO:0001583	missense	26234	exon7			TTTCCATTTGTGC	AF174591	CCDS3415.1, CCDS54745.1	4p15.33	2011-06-09			ENSG00000118564	ENSG00000118564		"""F-boxes / Leucine-rich repeats"""	13602	protein-coding gene	gene with protein product		605655				10531035	Standard	NM_012161		Approved	FBL4, FBL5, FLR1	uc003goc.2	Q9UKA1	OTTHUMG00000097097	ENST00000341285.3:c.934A>G	4.37:g.15629615T>C	ENSP00000344866:p.Met312Val	86.0	0.0		82.0	4.0	NM_012161	A8MSK4|B4DIB5|Q4W5A8|Q8NHP3|Q9NXN2|Q9P0I0|Q9P0X5|Q9UJT7|Q9UKC8	Missense_Mutation	SNP	ENST00000341285.3	37	CCDS3415.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.92|12.92	2.082100|2.082100	0.36758|0.36758	.|.	.|.	ENSG00000118564|ENSG00000118564	ENST00000341285;ENST00000412094;ENST00000382358|ENST00000513163	T;T;T|.	0.28069|.	1.63;1.63;1.63|.	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	0.130156|.	0.64402|.	D|.	0.000005|.	T|T	0.36690|0.36690	0.0976|0.0976	N|N	0.22421|0.22421	0.69|0.69	0.29150|0.29150	N|N	0.87841|0.87841	B;B|.	0.22480|.	0.07;0.042|.	B;B|.	0.21151|.	0.033;0.015|.	T|T	0.29882|0.29882	-0.9997|-0.9997	10|5	0.20046|.	T|.	0.44|.	-9.9694|-9.9694	14.4046|14.4046	0.67073|0.67073	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	295;312|.	Q9UKA1-2;Q9UKA1|.	.;FBXL5_HUMAN|.	V|S	312;295;186|232	ENSP00000344866:M312V;ENSP00000408679:M295V;ENSP00000371795:M186V|.	ENSP00000344866:M312V|.	M|N	-|-	1|2	0|0	FBXL5|FBXL5	15238713|15238713	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.992000|0.992000	0.81027|0.81027	3.413000|3.413000	0.52686|0.52686	2.138000|2.138000	0.66242|0.66242	0.377000|0.377000	0.23210|0.23210	ATG|AAT	.		0.353	FBXL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214235.2		
FRYL	285527	hgsc.bcm.edu;bcgsc.ca	37	4	48545872	48545872	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:48545872A>G	ENST00000503238.1	-	41	5543	c.5544T>C	c.(5542-5544)gtT>gtC	p.V1848V	FRYL_ENST00000358350.4_Silent_p.V1848V|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Silent_p.V1848V|FRYL_ENST00000507873.2_5'UTR			O94915	FRYL_HUMAN	FRY-like	1848					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						GTCTGGAGAGAACATCAGAAA	0.443																																					p.V1848V		.											.	FRYL	69	0			c.T5544C						.						90.0	88.0	89.0					4																	48545872		1866	4109	5975	SO:0001819	synonymous_variant	285527	exon44			GGAGAGAACATCA	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.5544T>C	4.37:g.48545872A>G		68.0	0.0		90.0	4.0	NM_015030	O95640|Q8WTZ5|Q9NT40	Silent	SNP	ENST00000503238.1	37	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	A	8.997	0.979145	0.18812	.	.	ENSG00000075539	ENST00000514617	.	.	.	5.46	-1.56	0.08532	.	.	.	.	.	T	0.49847	0.1581	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41016	-0.9532	4	.	.	.	.	5.3753	0.16162	0.5375:0.2533:0.2092:0.0	.	.	.	.	P	718	.	.	S	-	1	0	FRYL	48240629	1.000000	0.71417	0.997000	0.53966	0.778000	0.44026	0.968000	0.29357	-0.088000	0.12506	0.533000	0.62120	TCT	.		0.443	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
FIP1L1	81608	hgsc.bcm.edu;bcgsc.ca	37	4	54265931	54265931	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:54265931A>G	ENST00000337488.6	+	10	934	c.740A>G	c.(739-741)gAa>gGa	p.E247G	FIP1L1_ENST00000306932.6_Missense_Mutation_p.E209G|FIP1L1_ENST00000507166.1_Missense_Mutation_p.E247G|FIP1L1_ENST00000507922.1_Missense_Mutation_p.E232G|FIP1L1_ENST00000358575.5_Missense_Mutation_p.E232G	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	247	Necessary for stimulating PAPOLA activity.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TCAGAGAAAGAAACTGCCCTT	0.373			T	PDGFRA	idiopathic hypereosinophilic syndrome																																p.E247G		.		Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	.	FIP1L1	1083	0			c.A740G						.						169.0	163.0	165.0					4																	54265931		2203	4300	6503	SO:0001583	missense	81608	exon10			AGAAAGAAACTGC	AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.740A>G	4.37:g.54265931A>G	ENSP00000336752:p.Glu247Gly	109.0	0.0		87.0	5.0	NM_030917	B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Missense_Mutation	SNP	ENST00000337488.6	37	CCDS3491.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.539816	0.85917	.	.	ENSG00000145216	ENST00000337488;ENST00000358575;ENST00000507922;ENST00000306932;ENST00000507166	T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72	5.38	5.38	0.77491	.	0.068969	0.64402	D	0.000013	T	0.58595	0.2133	L	0.43152	1.355	0.58432	D	0.99999	D;D;D;D;D;D	0.69078	0.994;0.997;0.99;0.969;0.983;0.983	P;D;P;P;P;P	0.64687	0.854;0.928;0.718;0.723;0.791;0.858	T	0.54938	-0.8218	10	0.32370	T	0.25	-13.739	15.6962	0.77502	1.0:0.0:0.0:0.0	.	232;51;232;209;247;232	G3XAD6;B4DTW7;B4DIR3;Q6UN15-3;Q6UN15;Q6UN15-4	.;.;.;.;FIP1_HUMAN;.	G	247;232;232;209;247	ENSP00000336752:E247G;ENSP00000351383:E232G;ENSP00000425456:E232G;ENSP00000302993:E209G;ENSP00000423325:E247G	ENSP00000302993:E209G	E	+	2	0	FIP1L1	53960688	1.000000	0.71417	0.992000	0.48379	0.963000	0.63663	5.426000	0.66476	2.168000	0.68352	0.533000	0.62120	GAA	.		0.373	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250602.1	NM_030917	
FYCO1	79443	hgsc.bcm.edu;bcgsc.ca	37	3	46021198	46021198	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:46021198T>C	ENST00000296137.2	-	4	492	c.287A>G	c.(286-288)gAg>gGg	p.E96G	FYCO1_ENST00000535325.1_Splice_Site_p.E96G	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	96	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		TCAGCTTACCTCTGAGATAGA	0.498																																					p.E96G		.											.	FYCO1	91	0			c.A287G						.						192.0	164.0	174.0					3																	46021198		2203	4300	6503	SO:0001630	splice_region_variant	79443	exon4			CTTACCTCTGAGA	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.288+1A>G	3.37:g.46021198T>C		210.0	0.0		125.0	5.0	NM_024513	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	37	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	T	18.28	3.590006	0.66105	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.12255	2.7;2.7	5.36	5.36	0.76844	RUN (2);	0.000000	0.85682	D	0.000000	T	0.32734	0.0839	L	0.53249	1.67	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.83275	0.981;0.996	T	0.02797	-1.1109	10	0.72032	D	0.01	-31.7368	13.9155	0.63895	0.0:0.0:0.0:1.0	.	96;96	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	G	96	ENSP00000296137:E96G;ENSP00000441178:E96G	ENSP00000296137:E96G	E	-	2	0	FYCO1	45996202	1.000000	0.71417	0.994000	0.49952	0.197000	0.23852	7.699000	0.84547	2.033000	0.60031	0.397000	0.26171	GAG	.		0.498	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	Missense_Mutation
GBP5	115362	hgsc.bcm.edu;bcgsc.ca	37	1	89728392	89728392	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:89728392A>G	ENST00000370459.3	-	9	1566	c.1439T>C	c.(1438-1440)cTc>cCc	p.L480P	GBP5_ENST00000471171.1_5'Flank|GBP5_ENST00000343435.5_Missense_Mutation_p.L480P|RP4-620F22.2_ENST00000437128.1_RNA			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	480						cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		CGTCTCTGTGAGAGCCTGGTC	0.383																																					p.L480P		.											.	GBP5	91	0			c.T1439C						.						80.0	81.0	81.0					1																	89728392		2203	4300	6503	SO:0001583	missense	115362	exon10			TCTGTGAGAGCCT	AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.1439T>C	1.37:g.89728392A>G	ENSP00000359488:p.Leu480Pro	102.0	0.0		75.0	4.0	NM_052942	B2RCE1|Q86TM5	Missense_Mutation	SNP	ENST00000370459.3	37	CCDS722.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.372748	0.82573	.	.	ENSG00000154451	ENST00000343435;ENST00000370459;ENST00000443807	T;T;T	0.72725	-0.68;-0.68;-0.68	4.86	4.86	0.63082	Guanylate-binding protein, C-terminal (3);	0.000000	0.64402	D	0.000001	D	0.84070	0.5391	M	0.90922	3.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87593	0.2492	10	0.87932	D	0	-17.0177	12.8668	0.57944	1.0:0.0:0.0:0.0	.	480	Q96PP8	GBP5_HUMAN	P	480	ENSP00000340396:L480P;ENSP00000359488:L480P;ENSP00000403010:L480P	ENSP00000340396:L480P	L	-	2	0	GBP5	89500980	1.000000	0.71417	0.997000	0.53966	0.295000	0.27426	4.243000	0.58721	2.198000	0.70561	0.524000	0.50904	CTC	.		0.383	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027700.1	NM_052942	
GHDC	84514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40343211	40343211	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:40343211G>C	ENST00000301671.8	-	5	1348	c.907C>G	c.(907-909)Cta>Gta	p.L303V	GHDC_ENST00000414034.3_Missense_Mutation_p.L303V|GHDC_ENST00000436923.2_Missense_Mutation_p.L303V|GHDC_ENST00000593209.1_Missense_Mutation_p.L303V|GHDC_ENST00000587427.1_Missense_Mutation_p.L303V|GHDC_ENST00000428494.2_Missense_Mutation_p.L264V|GHDC_ENST00000590520.1_5'Flank			Q8N2G8	GHDC_HUMAN	GH3 domain containing	303						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		TCTGGCTGTAGGTTTAGGCCC	0.627																																					p.L303V		.											.	GHDC	90	0			c.C907G						.						33.0	38.0	36.0					17																	40343211		2203	4300	6503	SO:0001583	missense	84514	exon6			GCTGTAGGTTTAG	AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.907C>G	17.37:g.40343211G>C	ENSP00000301671:p.Leu303Val	71.0	0.0		72.0	34.0	NM_001142623	B4DQS4|E9PDB5|Q9BXM6	Missense_Mutation	SNP	ENST00000301671.8	37	CCDS11422.1	.	.	.	.	.	.	.	.	.	.	G	10.96	1.500047	0.26861	.	.	ENSG00000167925	ENST00000393854;ENST00000428494;ENST00000414034;ENST00000301671;ENST00000436923	.	.	.	4.03	2.04	0.26737	.	0.000000	0.64402	D	0.000017	T	0.66167	0.2762	M	0.69185	2.1	0.38752	D	0.954132	D;P;D	0.76494	0.994;0.754;0.999	D;P;D	0.87578	0.94;0.65;0.998	T	0.63328	-0.6662	9	0.30078	T	0.28	-8.7373	4.661	0.12643	0.1912:0.0:0.6372:0.1716	.	264;303;303	E9PDB5;Q8N2G8-2;Q8N2G8	.;.;GHDC_HUMAN	V	247;264;303;303;303	.	ENSP00000301671:L303V	L	-	1	2	GHDC	37596737	1.000000	0.71417	0.979000	0.43373	0.257000	0.26127	1.724000	0.38064	0.383000	0.24910	-0.219000	0.12488	CTA	.		0.627	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449794.1	NM_032484	
GPAM	57678	hgsc.bcm.edu;bcgsc.ca	37	10	113940243	113940243	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:113940243A>G	ENST00000348367.4	-	4	410	c.213T>C	c.(211-213)acT>acC	p.T71T	GPAM_ENST00000480130.1_5'Flank|GPAM_ENST00000423155.1_Silent_p.T71T|GPAM_ENST00000369425.1_Silent_p.T71T			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	71					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		AGCTCTGGGGAGTGCAGGAGT	0.398																																					p.T71T	Ovarian(161;1017 2606 18293 52943)	.											.	GPAM	92	0			c.T213C						.						115.0	95.0	102.0					10																	113940243		2203	4300	6503	SO:0001819	synonymous_variant	57678	exon4			CTGGGGAGTGCAG	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.213T>C	10.37:g.113940243A>G		92.0	0.0		47.0	4.0	NM_020918	Q5VW51|Q86TA3	Silent	SNP	ENST00000348367.4	37	CCDS7570.1																																																																																			.		0.398	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
GPRASP1	9737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	101909698	101909698	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:101909698G>T	ENST00000361600.5	+	5	1658	c.857G>T	c.(856-858)aGg>aTg	p.R286M	GPRASP1_ENST00000415986.1_Missense_Mutation_p.R286M|GPRASP1_ENST00000444152.1_Missense_Mutation_p.R286M|RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000537097.1_Missense_Mutation_p.R286M	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	286					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TCCAGGTTTAGGTCTAAGAAA	0.488																																					p.R286M		.											.	GPRASP1	131	0			c.G857T						.						111.0	110.0	111.0					X																	101909698		2203	4300	6503	SO:0001583	missense	9737	exon3			GGTTTAGGTCTAA	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.857G>T	X.37:g.101909698G>T	ENSP00000355146:p.Arg286Met	76.0	0.0		80.0	66.0	NM_001099411	O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	37	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	G	9.348	1.064649	0.20067	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	1.95	-0.111	0.13576	.	.	.	.	.	T	0.28532	0.0706	L	0.59436	1.845	0.09310	N	1	P	0.49090	0.919	P	0.49561	0.615	T	0.13575	-1.0504	9	0.48119	T	0.1	-2.244	4.3479	0.11141	0.166:0.2325:0.6015:0.0	.	286	Q5JY77	GASP1_HUMAN	M	286	ENSP00000393691:R286M;ENSP00000409420:R286M;ENSP00000355146:R286M;ENSP00000445683:R286M	ENSP00000355146:R286M	R	+	2	0	GPRASP1	101796354	0.104000	0.21937	0.002000	0.10522	0.241000	0.25554	1.971000	0.40530	-0.116000	0.11893	0.279000	0.19357	AGG	.		0.488	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
GPRASP1	9737	hgsc.bcm.edu;bcgsc.ca	37	X	101912553	101912553	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:101912553T>C	ENST00000361600.5	+	5	4513	c.3712T>C	c.(3712-3714)Tgt>Cgt	p.C1238R	GPRASP1_ENST00000415986.1_Missense_Mutation_p.C1238R|GPRASP1_ENST00000444152.1_Missense_Mutation_p.C1238R|RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000537097.1_Missense_Mutation_p.C1238R	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	1238	OPRD1-binding.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GACATACATATGTAAAGTGTG	0.408																																					p.C1238R		.											.	GPRASP1	131	0			c.T3712C						.						93.0	85.0	88.0					X																	101912553		2203	4300	6503	SO:0001583	missense	9737	exon3			TACATATGTAAAG	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.3712T>C	X.37:g.101912553T>C	ENSP00000355146:p.Cys1238Arg	57.0	0.0		76.0	4.0	NM_001099411	O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	37	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	T	8.852	0.944939	0.18356	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	2.58	2.58	0.30949	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.45657	0.1353	M	0.63428	1.95	0.42123	D	0.991436	D	0.89917	1.0	D	0.91635	0.999	T	0.35649	-0.9780	9	0.40728	T	0.16	-4.7672	6.2679	0.20939	0.0:0.0:0.0:1.0	.	1238	Q5JY77	GASP1_HUMAN	R	1238	ENSP00000393691:C1238R;ENSP00000409420:C1238R;ENSP00000355146:C1238R;ENSP00000445683:C1238R	ENSP00000355146:C1238R	C	+	1	0	GPRASP1	101799209	0.988000	0.35896	0.823000	0.32752	0.747000	0.42532	2.952000	0.49097	1.274000	0.44362	0.376000	0.23039	TGT	.		0.408	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
GSTCD	79807	hgsc.bcm.edu;bcgsc.ca	37	4	106650634	106650634	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:106650634T>C	ENST00000515279.1	+	5	1438	c.1218T>C	c.(1216-1218)ccT>ccC	p.P406P	GSTCD_ENST00000360505.5_Silent_p.P406P|GSTCD_ENST00000515255.1_3'UTR|GSTCD_ENST00000394728.3_Silent_p.P406P|GSTCD_ENST00000507281.1_Silent_p.P319P|GSTCD_ENST00000394730.3_Silent_p.P319P			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	406						extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		ATGTTCTCCCTGCAGCAGTCA	0.383																																					p.P406P		.											.	GSTCD	92	0			c.T1218C						.						103.0	103.0	103.0					4																	106650634		2203	4300	6503	SO:0001819	synonymous_variant	79807	exon5			TCTCCCTGCAGCA	BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.1218T>C	4.37:g.106650634T>C		96.0	0.0		95.0	4.0	NM_001031720	A8K8J0|A8MVD3|H9KV97|Q9H8S3	Silent	SNP	ENST00000515279.1	37	CCDS43257.1																																																																																			.		0.383	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363981.1	NM_024751	
HACE1	57531	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	105244550	105244550	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:105244550C>T	ENST00000262903.4	-	9	1072	c.796G>A	c.(796-798)Gaa>Aaa	p.E266K	HACE1_ENST00000369125.2_Missense_Mutation_p.E266K	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	266					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		CGGAGGTCTTCATTCTGTGTC	0.338																																					p.E266K		.											.	HACE1	663	0			c.G796A						.						81.0	81.0	81.0					6																	105244550		2203	4298	6501	SO:0001583	missense	57531	exon9			GGTCTTCATTCTG	BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.796G>A	6.37:g.105244550C>T	ENSP00000262903:p.Glu266Lys	114.0	0.0		44.0	23.0	NM_020771	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	ENST00000262903.4	37	CCDS5050.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811993	0.90707	.	.	ENSG00000085382	ENST00000262903;ENST00000369125	T;T	0.36520	1.25;1.29	5.6	5.6	0.85130	.	0.093200	0.64402	D	0.000001	T	0.13415	0.0325	N	0.19112	0.55	0.58432	D	0.999999	P;P	0.34522	0.455;0.455	B;B	0.27076	0.076;0.076	T	0.05099	-1.0906	10	0.22109	T	0.4	.	19.6045	0.95575	0.0:1.0:0.0:0.0	.	266;266	E9PGP0;Q8IYU2	.;HACE1_HUMAN	K	266	ENSP00000262903:E266K;ENSP00000358121:E266K	ENSP00000262903:E266K	E	-	1	0	HACE1	105351243	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.400000	0.66320	2.623000	0.88846	0.585000	0.79938	GAA	.		0.338	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	XM_045095	
HDDC2	51020	hgsc.bcm.edu;bcgsc.ca	37	6	125619942	125619942	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:125619942A>G	ENST00000398153.2	-	3	269	c.227T>C	c.(226-228)gTt>gCt	p.V76A	HDDC2_ENST00000608284.1_Missense_Mutation_p.V76A|HDDC2_ENST00000608295.1_Missense_Mutation_p.V76A|HDDC2_ENST00000368377.4_Intron	NM_016063.2	NP_057147.2	Q7Z4H3	HDDC2_HUMAN	HD domain containing 2	76	HD.					extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(4)	6			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0186)		CATATCATGAACCAGGGCTAG	0.403																																					p.V76A		.											.	HDDC2	90	0			c.T227C						.						174.0	151.0	158.0					6																	125619942		1918	4165	6083	SO:0001583	missense	51020	exon3			TCATGAACCAGGG	AF151888	CCDS43503.1	6q13-q24.3	2008-02-05	2005-08-22	2005-08-22	ENSG00000111906	ENSG00000111906			21078	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 74"""	C6orf74		10810093	Standard	NM_016063		Approved	CGI-130, dJ167O5.2	uc003qaa.1	Q7Z4H3	OTTHUMG00000015506	ENST00000398153.2:c.227T>C	6.37:g.125619942A>G	ENSP00000381220:p.Val76Ala	131.0	0.0		89.0	4.0	NM_016063	Q5TDQ4|Q6NZ49|Q9BTT2|Q9BV31|Q9Y3D1	Missense_Mutation	SNP	ENST00000398153.2	37	CCDS43503.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.922341	0.92319	.	.	ENSG00000111906	ENST00000398153	T	0.48836	0.8	5.53	5.53	0.82687	Metal-dependent phosphohydrolase, HD domain (1);Metal-dependent phosphohydrolase, HD subdomain (1);HD domain (1);	0.000000	0.64402	U	0.000001	T	0.67988	0.2952	M	0.92268	3.29	0.80722	D	1	D	0.59767	0.986	P	0.61328	0.887	T	0.77616	-0.2521	10	0.87932	D	0	.	14.9197	0.70829	1.0:0.0:0.0:0.0	.	76	Q7Z4H3	HDDC2_HUMAN	A	76	ENSP00000381220:V76A	ENSP00000381220:V76A	V	-	2	0	HDDC2	125661641	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.852000	0.92215	2.229000	0.72834	0.533000	0.62120	GTT	.		0.403	HDDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472493.1	NM_016063	
HERC2	8924	ucsc.edu;bcgsc.ca	37	15	28427625	28427625	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:28427625T>C	ENST00000261609.7	-	57	8967	c.8859A>G	c.(8857-8859)tcA>tcG	p.S2953S		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TCGTAGCTGCTGATTCCAGCC	0.463																																					p.S2953S		.											.	HERC2	234	0			c.A8859G						.						68.0	69.0	69.0					15																	28427625		2203	4300	6503	SO:0001819	synonymous_variant	8924	exon57			AGCTGCTGATTCC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.8859A>G	15.37:g.28427625T>C		64.0	0.0		44.0	4.0	NM_004667		Silent	SNP	ENST00000261609.7	37	CCDS10021.1																																																																																			.		0.463	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
HSPA13	6782	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	15746539	15746539	+	Missense_Mutation	SNP	T	T	C	rs200321727		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr21:15746539T>C	ENST00000285667.3	-	5	882	c.815A>G	c.(814-816)tAt>tGt	p.Y272C	HSPA13_ENST00000544452.1_Missense_Mutation_p.Y64C	NM_006948.4	NP_008879.3	P48723	HSP13_HUMAN	heat shock protein 70kDa family, member 13	272						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						ATATGTTTGATAGATCTGTTT	0.358													T|||	1	0.000199681	0.0	0.0	5008	,	,		19122	0.0		0.001	False		,,,				2504	0.0				p.Y272C		.											.	HSPA13	226	0			c.A815G						.						76.0	76.0	76.0					21																	15746539		2203	4300	6503	SO:0001583	missense	6782	exon5			GTTTGATAGATCT		CCDS13567.1	21q11.1	2011-09-02	2008-06-17	2008-06-17	ENSG00000155304	ENSG00000155304		"""Heat shock proteins / HSP70"""	11375	protein-coding gene	gene with protein product		601100	"""stress 70 protein chaperone, microsome-associated, 60kD"", ""stress 70 protein chaperone, microsome-associated, 60kDa"""	STCH		8825657	Standard	NM_006948		Approved		uc002yjt.3	P48723	OTTHUMG00000074261	ENST00000285667.3:c.815A>G	21.37:g.15746539T>C	ENSP00000285667:p.Tyr272Cys	38.0	0.0		37.0	11.0	NM_006948	B2R616|Q8NE40	Missense_Mutation	SNP	ENST00000285667.3	37	CCDS13567.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	T	13.75	2.330648	0.41297	.	.	ENSG00000155304	ENST00000285667;ENST00000544452	T;T	0.00976	5.48;5.48	5.66	4.49	0.54785	.	0.401998	0.30830	N	0.008783	T	0.01523	0.0049	L	0.35854	1.095	0.36026	D	0.839053	P	0.45126	0.851	P	0.47626	0.552	T	0.63950	-0.6521	10	0.72032	D	0.01	-8.3585	8.9108	0.35552	0.0:0.0671:0.1274:0.8055	.	272	P48723	HSP13_HUMAN	C	272;64	ENSP00000285667:Y272C;ENSP00000441986:Y64C	ENSP00000285667:Y272C	Y	-	2	0	HSPA13	14668410	0.988000	0.35896	0.999000	0.59377	0.231000	0.25187	1.502000	0.35704	1.049000	0.40321	0.477000	0.44152	TAT	T|0.999;C|0.000		0.358	HSPA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157815.1		
IDE	3416	hgsc.bcm.edu;bcgsc.ca	37	10	94274762	94274762	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:94274762T>C	ENST00000265986.6	-	5	755	c.699A>G	c.(697-699)gaA>gaG	p.E233E		NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	233					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	CATCAATGCCTTCTTGGTTTG	0.363																																					p.E233E		.											.	IDE	92	0			c.A699G						.						183.0	190.0	188.0					10																	94274762		2203	4300	6503	SO:0001819	synonymous_variant	3416	exon5			AATGCCTTCTTGG	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.699A>G	10.37:g.94274762T>C		108.0	0.0		64.0	4.0	NM_004969	B2R721|B7ZAU2|D3DR35|Q5T5N2	Silent	SNP	ENST00000265986.6	37	CCDS7421.1																																																																																			.		0.363	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
IGSF21	84966	hgsc.bcm.edu;bcgsc.ca	37	1	18691796	18691796	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:18691796A>G	ENST00000251296.1	+	6	1003	c.620A>G	c.(619-621)cAg>cGg	p.Q207R		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	207						extracellular region (GO:0005576)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		GGCCCCCTACAGGACAGCAGG	0.602																																					p.Q207R		.											.	IGSF21	156	0			c.A620G						.						48.0	54.0	52.0					1																	18691796		2203	4300	6503	SO:0001583	missense	84966	exon6			CCCTACAGGACAG	AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.620A>G	1.37:g.18691796A>G	ENSP00000251296:p.Gln207Arg	135.0	0.0		68.0	4.0	NM_032880	Q8NBR8	Missense_Mutation	SNP	ENST00000251296.1	37	CCDS184.1	.	.	.	.	.	.	.	.	.	.	A	5.218	0.225751	0.09916	.	.	ENSG00000117154	ENST00000251296	T	0.29917	1.55	4.63	2.19	0.27852	.	0.374960	0.29609	N	0.011676	T	0.14485	0.0350	N	0.19112	0.55	0.28472	N	0.915381	B	0.02656	0.0	B	0.04013	0.001	T	0.25467	-1.0131	10	0.13108	T	0.6	-10.6533	4.7798	0.13197	0.7072:0.1906:0.1022:0.0	.	207	Q96ID5	IGS21_HUMAN	R	207	ENSP00000251296:Q207R	ENSP00000251296:Q207R	Q	+	2	0	IGSF21	18564383	0.968000	0.33430	0.979000	0.43373	0.780000	0.44128	1.073000	0.30691	0.216000	0.20781	0.379000	0.24179	CAG	.		0.602	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006924.1	NM_032880	
IL1RAPL2	26280	hgsc.bcm.edu;bcgsc.ca	37	X	104478544	104478544	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:104478544T>C	ENST00000372582.1	+	4	1155	c.399T>C	c.(397-399)gtT>gtC	p.V133V	IL1RAPL2_ENST00000344799.4_Silent_p.V133V	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	133					central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CCTTGACTGTTGCAGAGAATG	0.398																																					p.V133V		.											.	IL1RAPL2	194	0			c.T399C						.						134.0	127.0	129.0					X																	104478544		2203	4299	6502	SO:0001819	synonymous_variant	26280	exon4			GACTGTTGCAGAG	AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.399T>C	X.37:g.104478544T>C		64.0	0.0		66.0	4.0	NM_017416	Q2M3U3|Q9NZN0	Silent	SNP	ENST00000372582.1	37	CCDS14517.1																																																																																			.		0.398	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
IQCH	64799	hgsc.bcm.edu;bcgsc.ca	37	15	67553702	67553702	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:67553702A>G	ENST00000335894.4	+	2	210	c.144A>G	c.(142-144)acA>acG	p.T48T	IQCH_ENST00000546225.1_5'UTR|IQCH_ENST00000358767.3_5'UTR|IQCH_ENST00000512104.1_Silent_p.T48T	NM_001031715.2	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H	48										NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(2)|pancreas(2)|skin(5)|upper_aerodigestive_tract(1)	33				Colorectal(3;0.0856)		GTCTTGAAACAGCAATCAAAA	0.368																																					p.T48T		.											.	IQCH	94	0			c.A144G						.						96.0	109.0	105.0					15																	67553702		2201	4298	6499	SO:0001819	synonymous_variant	64799	exon2			TGAAACAGCAATC	AY014282	CCDS10223.1, CCDS32273.1, CCDS10223.2, CCDS61680.1, CCDS61681.1	15q23	2005-10-24			ENSG00000103599	ENSG00000103599			25721	protein-coding gene	gene with protein product		612523				12477932	Standard	NM_022784		Approved	FLJ12476	uc002aqo.2	Q86VS3	OTTHUMG00000133231	ENST00000335894.4:c.144A>G	15.37:g.67553702A>G		81.0	0.0		57.0	4.0	NM_022784	A8K8W3|C9JPR6|D6RJ88|Q4G0S6|Q8NEH9|Q9BWX2|Q9H9Y1|Q9UF88	Silent	SNP	ENST00000335894.4	37	CCDS32273.1																																																																																			.		0.368	IQCH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256969.1	NM_022784	
ITIH3	3699	broad.mit.edu;bcgsc.ca	37	3	52842646	52842646	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:52842646A>G	ENST00000449956.2	+	22	2628	c.2622A>G	c.(2620-2622)gaA>gaG	p.E874E	ITIH3_ENST00000416872.2_Silent_p.E682E	NM_002217.3	NP_002208.3	Q06033	ITIH3_HUMAN	inter-alpha-trypsin inhibitor heavy chain 3	874					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(6)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		ACAACGGAGAAGGGCTGATTG	0.522																																					p.E874E		.											.	ITIH3	93	0			c.A2622G						.						112.0	112.0	112.0					3																	52842646		2064	4198	6262	SO:0001819	synonymous_variant	3699	exon22			CGGAGAAGGGCTG		CCDS46845.1	3p21.1	2011-10-26	2011-10-26		ENSG00000162267	ENSG00000162267			6168	protein-coding gene	gene with protein product	"""pre-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha-trypsin inhibitor heavy chain H3"""	146650	"""inter-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha (globulin) inhibitor H3"""			2465147, 10100603	Standard	NM_002217		Approved	H3P	uc003dfv.2	Q06033	OTTHUMG00000158956	ENST00000449956.2:c.2622A>G	3.37:g.52842646A>G		202.0	1.0		142.0	6.0	NM_002217	Q3B7H5|Q53F06|Q6LAM2|Q99085	Silent	SNP	ENST00000449956.2	37	CCDS46845.1																																																																																			.		0.522	ITIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352668.2	NM_002217	
KAT6B	23522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	76790247	76790247	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:76790247A>G	ENST00000287239.4	+	18	6154	c.5665A>G	c.(5665-5667)Atg>Gtg	p.M1889V	KAT6B_ENST00000372711.1_Missense_Mutation_p.M1706V|KAT6B_ENST00000372725.1_Missense_Mutation_p.M1597V|KAT6B_ENST00000372724.1_Missense_Mutation_p.M1597V|KAT6B_ENST00000372714.1_Missense_Mutation_p.M1597V	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1889	Interaction with RUNX1 and RUNX2.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TCCTCCTCCAATGAATCTGCC	0.557																																					p.M1889V		.											.	.	.	0			c.A5665G						.						133.0	150.0	144.0					10																	76790247		2203	4300	6503	SO:0001583	missense	23522	exon18			CCTCCAATGAATC	AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.5665A>G	10.37:g.76790247A>G	ENSP00000287239:p.Met1889Val	106.0	0.0		216.0	73.0	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	ENST00000287239.4	37	CCDS7345.1	.	.	.	.	.	.	.	.	.	.	A	13.09	2.132500	0.37630	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	T;T;T;T;T	0.79749	-1.25;-1.25;-1.3;-1.25;-1.25	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000009	D	0.83769	0.5326	L	0.29908	0.895	0.42035	D	0.99104	P;P;D	0.53312	0.679;0.811;0.959	P;P;D	0.65443	0.65;0.879;0.935	D	0.86093	0.1551	10	0.72032	D	0.01	-10.0301	15.6712	0.77279	1.0:0.0:0.0:0.0	.	1706;1597;1889	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	V	1597;1597;1889;1597;1706	ENSP00000361810:M1597V;ENSP00000361809:M1597V;ENSP00000287239:M1889V;ENSP00000361799:M1597V;ENSP00000361796:M1706V	ENSP00000287239:M1889V	M	+	1	0	KAT6B	76460253	1.000000	0.71417	0.962000	0.40283	0.992000	0.81027	5.662000	0.68032	2.095000	0.63458	0.460000	0.39030	ATG	.		0.557	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
KIF16B	55614	hgsc.bcm.edu;bcgsc.ca	37	20	16360047	16360047	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr20:16360047T>C	ENST00000354981.2	-	19	2757	c.2600A>G	c.(2599-2601)gAa>gGa	p.E867G	KIF16B_ENST00000408042.1_Missense_Mutation_p.E867G|KIF16B_ENST00000355755.3_Missense_Mutation_p.E867G|KIF16B_ENST00000378003.2_Missense_Mutation_p.E93G	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	867	Glu-rich.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						TTTGTCATGTTCACATTTTAA	0.408																																					p.E867G		.											.	KIF16B	291	0			c.A2600G						.						150.0	148.0	149.0					20																	16360047		2203	4300	6503	SO:0001583	missense	55614	exon19			TCATGTTCACATT	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.2600A>G	20.37:g.16360047T>C	ENSP00000347076:p.Glu867Gly	74.0	0.0		82.0	4.0	NM_001199865	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	ENST00000354981.2	37	CCDS13122.1	.	.	.	.	.	.	.	.	.	.	T	3.052	-0.195247	0.06259	.	.	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000377997;ENST00000378003;ENST00000408042	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	5.6	-5.84	0.02318	.	1.633290	0.02854	N	0.129421	T	0.06371	0.0164	N	0.03608	-0.345	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.0	T	0.31724	-0.9933	10	0.21540	T	0.41	.	5.6248	0.17477	0.086:0.2973:0.4689:0.1478	.	867;867;867;867	Q96L93-4;Q96L93-2;Q96L93-6;Q96L93	.;.;.;KI16B_HUMAN	G	867;867;711;93;867	ENSP00000347076:E867G;ENSP00000347995:E867G;ENSP00000367242:E93G;ENSP00000384164:E867G	ENSP00000347076:E867G	E	-	2	0	KIF16B	16308047	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.022000	0.13511	-0.428000	0.07339	-0.263000	0.10527	GAA	.		0.408	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683	
KLF15	28999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	126071499	126071499	+	Silent	SNP	G	G	A	rs376071138	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:126071499G>A	ENST00000296233.3	-	2	497	c.267C>T	c.(265-267)ggC>ggT	p.G89G	KLF15_ENST00000509675.1_5'Flank	NM_014079.3	NP_054798.1	Q9UIH9	KLF15_HUMAN	Kruppel-like factor 15	89					cardiac muscle hypertrophy in response to stress (GO:0014898)|cellular response to peptide (GO:1901653)|glial cell differentiation (GO:0010001)|glomerular visceral epithelial cell differentiation (GO:0072112)|glucose transport (GO:0015758)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(7)|ovary(2)|skin(2)	12				GBM - Glioblastoma multiforme(114;0.147)		CGCTGCCCCCGCCACTGCCCA	0.672													G|||	3	0.000599042	0.0	0.0043	5008	,	,		16334	0.0		0.0	False		,,,				2504	0.0				p.G89G		.											.	KLF15	91	0			c.C267T						.	G		2,4374		0,2,2186	8.0	9.0	8.0		267	-6.8	0.0	3		8	2,8524		0,2,4261	no	coding-synonymous	KLF15	NM_014079.3		0,4,6447	AA,AG,GG		0.0235,0.0457,0.031		89/417	126071499	4,12898	2188	4263	6451	SO:0001819	synonymous_variant	28999	exon2			GCCCCCGCCACTG	AB029254	CCDS3036.1	3q21.3	2013-01-08			ENSG00000163884	ENSG00000163884		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	14536	protein-coding gene	gene with protein product	"""kidney-enriched Kruppel-like factor"""	606465				10982849	Standard	NM_014079		Approved	KKLF	uc011bkk.1	Q9UIH9	OTTHUMG00000162689	ENST00000296233.3:c.267C>T	3.37:g.126071499G>A		64.0	0.0		130.0	60.0	NM_014079		Silent	SNP	ENST00000296233.3	37	CCDS3036.1																																																																																			.		0.672	KLF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370096.1	NM_014079	
KLHL3	26249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	136963985	136963985	+	Splice_Site	SNP	C	C	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:136963985C>A	ENST00000309755.4	-	13	2035		c.e13+1		KLHL3_ENST00000506491.1_Splice_Site|KLHL3_ENST00000508657.1_Splice_Site|KLHL3_ENST00000541417.1_Splice_Site|KLHL3_ENST00000506873.1_Splice_Site	NM_017415.2	NP_059111.2	Q9UH77	KLHL3_HUMAN	kelch-like family member 3						distal tubule morphogenesis (GO:0072156)|ion homeostasis (GO:0050801)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|renal sodium ion absorption (GO:0070294)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|stomach(1)|upper_aerodigestive_tract(1)	21		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		GCAGTCATTACCTGCGTTGCG	0.532																																					.		.											.	KLHL3	90	0			c.1591+1G>T						.						208.0	180.0	190.0					5																	136963985		2203	4300	6503	SO:0001630	splice_region_variant	26249	exon14			TCATTACCTGCGT	AB032955	CCDS4192.1, CCDS58969.1, CCDS58970.1	5q31	2013-01-30	2013-01-30		ENSG00000146021	ENSG00000146021		"""Kelch-like"", ""BTB/POZ domain containing"""	6354	protein-coding gene	gene with protein product		605775	"""kelch (Drosophila)-like 3"", ""kelch-like 3 (Drosophila)"""			10843806	Standard	NM_017415		Approved	KIAA1129	uc010jek.3	Q9UH77	OTTHUMG00000129155	ENST00000309755.4:c.1591+1G>T	5.37:g.136963985C>A		99.0	0.0		93.0	42.0	NM_017415	B2RBK7|Q9UH75|Q9UH76|Q9ULU0|Q9Y6V6	Splice_Site	SNP	ENST00000309755.4	37	CCDS4192.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995012	0.74703	.	.	ENSG00000146021	ENST00000506491;ENST00000508657;ENST00000309755	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6787	0.95950	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KLHL3	136991884	1.000000	0.71417	1.000000	0.80357	0.706000	0.40770	7.651000	0.83577	2.884000	0.98904	0.655000	0.94253	.	.		0.532	KLHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251220.2		Intron
LPHN3	23284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	62936570	62936570	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:62936570G>A	ENST00000514591.1	+	25	4683	c.4354G>A	c.(4354-4356)Ggg>Agg	p.G1452R	LPHN3_ENST00000508946.1_Missense_Mutation_p.G1495R|LPHN3_ENST00000514157.1_3'UTR|LPHN3_ENST00000545650.1_Missense_Mutation_p.G1452R|LPHN3_ENST00000506720.1_Missense_Mutation_p.G1563R|LPHN3_ENST00000507164.1_3'UTR|LPHN3_ENST00000506700.1_3'UTR|LPHN3_ENST00000511324.1_3'UTR|LPHN3_ENST00000514996.1_Missense_Mutation_p.G1486R|LPHN3_ENST00000512091.2_3'UTR|LPHN3_ENST00000507625.1_Missense_Mutation_p.G1511R|LPHN3_ENST00000504896.1_3'UTR|LPHN3_ENST00000508693.1_3'UTR|RP11-84A1.3_ENST00000509461.1_RNA|LPHN3_ENST00000509896.1_3'UTR|RP11-84A1.3_ENST00000504135.1_RNA|RP11-84A1.3_ENST00000506704.1_RNA|LPHN3_ENST00000506746.1_Missense_Mutation_p.G1554R			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1430					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						AAACAAAGATGGGACCCCTCC	0.483																																					p.G1452R		.											.	LPHN3	508	0			c.G4354A						.						62.0	60.0	61.0					4																	62936570		692	1591	2283	SO:0001583	missense	23284	exon23			AAAGATGGGACCC	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.4354G>A	4.37:g.62936570G>A	ENSP00000422533:p.Gly1452Arg	90.0	0.0		83.0	32.0	NM_015236	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.69|19.69	3.874474|3.874474	0.72180|0.72180	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000514591;ENST00000545650;ENST00000295349;ENST00000507625;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996|ENST00000502815	T;T;T;T;T;T;T|.	0.71698|.	-0.57;-0.57;-0.59;-0.54;-0.55;-0.55;-0.54|.	5.5|5.5	5.5|5.5	0.81552|0.81552	GPCR, family 2, latrophilin, C-terminal (1);|.	0.112670|.	0.64402|.	D|.	0.000010|.	T|.	0.68540|.	0.3012|.	L|L	0.43923|0.43923	1.385|1.385	0.54753|0.54753	D|D	0.999981|0.999981	D;D|.	0.62365|.	0.966;0.991|.	P;D|.	0.64877|.	0.837;0.93|.	T|.	0.63730|.	-0.6571|.	10|.	0.87932|.	D|.	0|.	.|.	19.4053|19.4053	0.94646|0.94646	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1452;1430|.	E9PE04;Q9HAR2|.	.;LPHN3_HUMAN|.	R|X	1452;1452;1430;1511;1495;1563;1554;1486|900	ENSP00000422533:G1452R;ENSP00000439831:G1452R;ENSP00000421372:G1511R;ENSP00000421627:G1495R;ENSP00000420931:G1563R;ENSP00000425884:G1554R;ENSP00000424258:G1486R|.	ENSP00000295349:G1430R|.	G|W	+|+	1|2	0|0	LPHN3|LPHN3	62619165|62619165	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.990000|0.990000	0.78478|0.78478	9.416000|9.416000	0.97383|0.97383	2.607000|2.607000	0.88179|0.88179	0.591000|0.591000	0.81541|0.81541	GGG|TGG	.		0.483	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	141092035	141092035	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:141092035T>C	ENST00000389484.3	-	79	13181	c.12210A>G	c.(12208-12210)ttA>ttG	p.L4070L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4070					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGGGTCTCTGTAAGTTCTTTT	0.378										TSP Lung(27;0.18)																											p.L4070L	Colon(99;50 2074 2507 20106)	.											.	LRP1B	311	0			c.A12210G						.						164.0	152.0	156.0					2																	141092035		2203	4300	6503	SO:0001819	synonymous_variant	53353	exon79			TCTCTGTAAGTTC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12210A>G	2.37:g.141092035T>C		288.0	0.0		252.0	94.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	9.331	1.060628	0.19987	.	.	ENSG00000168702	ENST00000437977	.	.	.	6.08	-1.42	0.08913	.	.	.	.	.	T	0.51449	0.1675	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43458	-0.9390	4	.	.	.	.	6.9361	0.24466	0.0:0.3497:0.208:0.4423	.	.	.	.	C	302	.	.	Y	-	2	0	LRP1B	140808505	1.000000	0.71417	0.985000	0.45067	0.938000	0.57974	0.736000	0.26130	-0.136000	0.11475	0.482000	0.46254	TAC	.		0.378	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
ANAPC15	25906	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	71819858	71819858	+	IGR	SNP	C	C	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:71819858C>A	ENST00000227618.4	-	0	886				ANAPC15_ENST00000502597.2_Intron|LRTOMT_ENST00000435085.1_Missense_Mutation_p.Q255K|ANAPC15_ENST00000543050.1_Intron|LRTOMT_ENST00000307198.7_Missense_Mutation_p.Q255K|LRTOMT_ENST00000419228.1_Missense_Mutation_p.Q215K|ANAPC15_ENST00000543015.1_5'Flank	NM_001278487.1|NM_001278491.1|NM_014042.2	NP_001265416.1|NP_001265420.1|NP_054761.1	P60006	APC15_HUMAN	anaphase promoting complex subunit 15						mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)	anaphase-promoting complex (GO:0005680)|intracellular (GO:0005622)											CCGCTTCTTGCAGTATGCTAA	0.622																																					p.Q255K		.											.	LRTOMT	68	0			c.C763A						.						75.0	67.0	69.0					11																	71819858		692	1591	2283	SO:0001628	intergenic_variant	220074	exon7			TTCTTGCAGTATG	AL080071	CCDS8210.1, CCDS60880.1	11q13.4	2012-10-17	2012-05-31	2012-05-31	ENSG00000110200	ENSG00000110200		"""Anaphase promoting complex subunits"""	24531	protein-coding gene	gene with protein product		614717	"""chromosome 11 open reading frame 51"""	C11orf51		21926987	Standard	NM_014042		Approved	HSPC020, DKFZP564M082, APC15	uc001orw.3	P60006	OTTHUMG00000167865		11.37:g.71819858C>A		108.0	0.0		125.0	45.0	NM_001145308	G3V1Q3|Q9CXK2|Q9Y269	Missense_Mutation	SNP	ENST00000227618.4	37	CCDS8210.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.704317	0.48412	.	.	ENSG00000184154	ENST00000419228;ENST00000435085;ENST00000307198	T;T;T	0.70282	-0.47;-0.47;-0.47	5.53	4.6	0.57074	.	.	.	.	.	T	0.51500	0.1678	N	0.12182	0.205	0.80722	D	1	P;P	0.39022	0.454;0.655	B;B	0.38264	0.266;0.269	T	0.51601	-0.8685	9	0.08599	T	0.76	-10.8557	15.9651	0.79966	0.0:0.8648:0.1352:0.0	.	255;215	Q8WZ04;Q8WZ04-2	TOMT_HUMAN;.	K	215;255;255	ENSP00000392233:Q215K;ENSP00000409789:Q255K;ENSP00000305742:Q255K	ENSP00000305742:Q215K	Q	+	1	0	LRTOMT	71497506	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	4.200000	0.58433	1.513000	0.48852	0.651000	0.88453	CAG	.		0.622	ANAPC15-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396695.1	NM_014042	
MAGEB10	139422	hgsc.bcm.edu;bcgsc.ca	37	X	27839847	27839847	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:27839847A>G	ENST00000356790.2	+	3	669	c.424A>G	c.(424-426)Acc>Gcc	p.T142A		NM_182506.3	NP_872312.2	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	142	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	26						GAGAAATGTAACCCAAATGTC	0.438																																					p.T142A		.											.	MAGEB10	130	0			c.A424G						.						63.0	60.0	61.0					X																	27839847		2202	4300	6502	SO:0001583	missense	139422	exon3			AATGTAACCCAAA		CCDS35221.1	Xp21.3	2008-02-05			ENSG00000177689	ENSG00000177689			25377	protein-coding gene	gene with protein product		300761				11454705	Standard	NM_182506		Approved	FLJ32965	uc004dbw.3	Q96LZ2	OTTHUMG00000046084	ENST00000356790.2:c.424A>G	X.37:g.27839847A>G	ENSP00000368304:p.Thr142Ala	113.0	0.0		84.0	4.0	NM_182506	Q494Y6|Q494Y7|Q9BZ78	Missense_Mutation	SNP	ENST00000356790.2	37	CCDS35221.1	.	.	.	.	.	.	.	.	.	.	A	0.033	-1.324496	0.01309	.	.	ENSG00000177689	ENST00000356790	T	0.04551	3.6	2.62	0.0418	0.14214	.	0.757856	0.11792	U	0.529088	T	0.03739	0.0106	L	0.43923	1.385	0.09310	N	1	B	0.30973	0.302	B	0.33568	0.166	T	0.44128	-0.9348	10	0.08599	T	0.76	.	2.5435	0.04731	0.5407:0.2854:0.1739:0.0	.	142	Q96LZ2	MAGBA_HUMAN	A	142	ENSP00000368304:T142A	ENSP00000368304:T142A	T	+	1	0	MAGEB10	27749768	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.270000	0.08584	-0.080000	0.12685	0.345000	0.21793	ACC	.		0.438	MAGEB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106216.1	NM_182506	
MATN2	4147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	98943556	98943556	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr8:98943556C>G	ENST00000520016.1	+	2	642	c.518C>G	c.(517-519)cCt>cGt	p.P173R	MATN2_ENST00000521689.1_Missense_Mutation_p.P173R|MATN2_ENST00000254898.5_Missense_Mutation_p.P173R|MATN2_ENST00000524308.1_Missense_Mutation_p.P173R|MATN2_ENST00000522025.2_Intron			O00339	MATN2_HUMAN	matrilin 2	173	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			GATGGGAGACCTCAGGACTCC	0.577																																					p.P173R		.											.	MATN2	24	0			c.C518G						.						38.0	44.0	42.0					8																	98943556		2125	4241	6366	SO:0001583	missense	4147	exon3			GGAGACCTCAGGA	U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.518C>G	8.37:g.98943556C>G	ENSP00000430487:p.Pro173Arg	73.0	0.0		95.0	18.0	NM_002380	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Missense_Mutation	SNP	ENST00000520016.1	37	CCDS55264.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128974	0.77549	.	.	ENSG00000132561	ENST00000521689;ENST00000254898;ENST00000378716;ENST00000524308;ENST00000520016	D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8	5.82	5.82	0.92795	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000008	D	0.92747	0.7694	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.92955	0.6384	10	0.66056	D	0.02	-16.2546	20.1001	0.97870	0.0:1.0:0.0:0.0	.	173;173;173;173	E9PF03;O00339-2;O00339;Q8N2G3	.;.;MATN2_HUMAN;.	R	173	ENSP00000429977:P173R;ENSP00000254898:P173R;ENSP00000430221:P173R;ENSP00000430487:P173R	ENSP00000254898:P173R	P	+	2	0	MATN2	99012732	1.000000	0.71417	0.966000	0.40874	0.501000	0.33797	7.770000	0.85390	2.760000	0.94817	0.655000	0.94253	CCT	.		0.577	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1		
MTHFD2L	441024	hgsc.bcm.edu;bcgsc.ca	37	4	75023925	75023925	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:75023925A>G	ENST00000395759.2	+	1	97	c.70A>G	c.(70-72)Agc>Ggc	p.S24G	MTHFD2L_ENST00000433372.1_Intron|AC093677.1_ENST00000600169.1_Missense_Mutation_p.L54P|MTHFD2L_ENST00000331145.6_5'UTR|MTHFD2L_ENST00000325278.6_5'UTR|MTHFD2L_ENST00000461101.1_3'UTR	NM_001144978.1	NP_001138450.1	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like	24					folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|tetrahydrofolate interconversion (GO:0035999)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)			central_nervous_system(1)|endometrium(1)|lung(4)|ovary(2)	8			all cancers(17;0.0101)|Lung(101;0.196)			GTTGGGCAGAAGCACAGCACC	0.746																																					p.S24G		.											.	MTHFD2L	91	0			c.A70G						.						7.0	12.0	11.0					4																	75023925		673	1565	2238	SO:0001583	missense	441024	exon1			GGCAGAAGCACAG	BC065771	CCDS47075.1	4q13.3	2011-08-03			ENSG00000163738	ENSG00000163738			31865	protein-coding gene	gene with protein product		614047				21163947	Standard	NM_001144978		Approved	MGC72244	uc011cbk.2	Q9H903	OTTHUMG00000157135	ENST00000395759.2:c.70A>G	4.37:g.75023925A>G	ENSP00000379108:p.Ser24Gly	36.0	0.0		101.0	5.0	NM_001144978	Q6P079|Q8N560	Missense_Mutation	SNP	ENST00000395759.2	37	CCDS47075.1	.	.	.	.	.	.	.	.	.	.	A	9.307	1.054588	0.19907	.	.	ENSG00000163738	ENST00000395759	T	0.22945	1.93	2.18	-3.69	0.04450	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain (1);	.	.	.	.	T	0.12050	0.0293	N	0.22421	0.69	0.09310	N	0.999992	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.36890	-0.9729	9	0.13853	T	0.58	.	5.2508	0.15521	0.2217:0.2008:0.5775:0.0	.	24;24	Q9H903;Q9H903-5	MTD2L_HUMAN;.	G	24	ENSP00000379108:S24G	ENSP00000379108:S24G	S	+	1	0	MTHFD2L	75242789	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.155000	0.03163	-0.982000	0.03515	-0.334000	0.08254	AGC	.		0.746	MTHFD2L-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004346	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9020072	9020072	+	Missense_Mutation	SNP	G	G	A	rs566860711		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:9020072G>A	ENST00000397910.4	-	21	37626	c.37423C>T	c.(37423-37425)Cgg>Tgg	p.R12475W		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12477	SEA 3. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGTACAGCCGCTCTCTGTTG	0.557																																					p.R12475W		.											.	MUC16	566	0			c.C37423T						.						179.0	157.0	164.0					19																	9020072		1949	4155	6104	SO:0001583	missense	94025	exon21			ACAGCCGCTCTCT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37423C>T	19.37:g.9020072G>A	ENSP00000381008:p.Arg12475Trp	220.0	0.0		247.0	90.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	11.31	1.602258	0.28534	.	.	ENSG00000181143	ENST00000397910	T	0.38240	1.15	3.32	-3.03	0.05429	.	.	.	.	.	T	0.33673	0.0871	L	0.43923	1.385	.	.	.	D	0.64830	0.994	P	0.51016	0.656	T	0.45600	-0.9250	8	0.87932	D	0	.	5.9414	0.19196	0.0:0.1762:0.2883:0.5355	.	12475	B5ME49	.	W	12475	ENSP00000381008:R12475W	ENSP00000381008:R12475W	R	-	1	2	MUC16	8881072	0.000000	0.05858	0.049000	0.19019	0.498000	0.33706	-1.965000	0.01511	-0.169000	0.10834	0.555000	0.69702	CGG	.		0.557	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
NAF1	92345	hgsc.bcm.edu;bcgsc.ca	37	4	164058390	164058390	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:164058390T>C	ENST00000274054.2	-	6	1084	c.891A>G	c.(889-891)tcA>tcG	p.S297S	NAF1_ENST00000422287.2_Silent_p.S297S|NAF1_ENST00000509434.1_Silent_p.S25S	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	297					pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				ATGATGCATCTGATCCCTTAT	0.353																																					p.S297S		.											.	NAF1	70	0			c.A891G						.						103.0	96.0	99.0					4																	164058390		2203	4300	6503	SO:0001819	synonymous_variant	92345	exon6			TGCATCTGATCCC		CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.891A>G	4.37:g.164058390T>C		144.0	0.0		69.0	4.0	NM_138386	D3DP28|E9PAZ2	Silent	SNP	ENST00000274054.2	37	CCDS3803.1																																																																																			.		0.353	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2	NM_138386	
NCOR2	9612	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	124824953	124824953	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:124824953G>A	ENST00000405201.1	-	36	5375	c.5375C>T	c.(5374-5376)tCc>tTc	p.S1792F	NCOR2_ENST00000404621.1_Missense_Mutation_p.S1782F|NCOR2_ENST00000429285.2_Missense_Mutation_p.S1782F|NCOR2_ENST00000397355.1_Missense_Mutation_p.S1783F|NCOR2_ENST00000356219.3_Missense_Mutation_p.S1799F|NCOR2_ENST00000404121.2_Missense_Mutation_p.S1353F			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1800					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CTCGGACGAGGACGTGGTGGT	0.622																																					p.S1792F		.											.	NCOR2	229	0			c.C5375T						.						71.0	81.0	77.0					12																	124824953		2080	4215	6295	SO:0001583	missense	9612	exon38			GACGAGGACGTGG	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5375C>T	12.37:g.124824953G>A	ENSP00000384018:p.Ser1792Phe	90.0	0.0		51.0	4.0	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	ENST00000405201.1	37	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	G	11.24	1.580150	0.28180	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285	T;T;T;T;T;T	0.20881	2.05;2.3;2.04;2.3;2.04;2.3	3.89	3.89	0.44902	.	0.424514	0.24029	N	0.042206	T	0.38532	0.1044	L	0.43152	1.355	0.44432	D	0.997353	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.78314	0.915;0.991;0.961	T	0.30794	-0.9966	10	0.72032	D	0.01	-11.8694	15.4561	0.75314	0.0:0.0:1.0:0.0	.	1782;1783;1792	C9J0Q5;C9J239;C9JFD3	.;.;.	F	1792;1782;1799;1783;1791;1353;1782	ENSP00000384018:S1792F;ENSP00000384202:S1782F;ENSP00000348551:S1799F;ENSP00000380513:S1783F;ENSP00000385618:S1353F;ENSP00000400281:S1782F	ENSP00000348551:S1799F	S	-	2	0	NCOR2	123390906	0.963000	0.33076	0.356000	0.25785	0.152000	0.21847	6.150000	0.71801	1.701000	0.51217	0.491000	0.48974	TCC	.		0.622	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
NEDD4	4734	hgsc.bcm.edu;bcgsc.ca	37	15	56207944	56207944	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:56207944T>C	ENST00000508342.1	-	1	1385	c.1086A>G	c.(1084-1086)agA>agG	p.R362R	NEDD4_ENST00000338963.2_Silent_p.R362R|NEDD4_ENST00000506154.1_Silent_p.R362R|NEDD4_ENST00000435532.3_Intron	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	362					adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		AGACAGTCTGTCTGGGAGTAT	0.418																																					p.R362R		.											.	NEDD4	723	0			c.A1086G						.						49.0	49.0	49.0					15																	56207944		2191	4290	6481	SO:0001819	synonymous_variant	4734	exon1			AGTCTGTCTGGGA	D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.1086A>G	15.37:g.56207944T>C		67.0	0.0		59.0	4.0	NM_198400	A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Silent	SNP	ENST00000508342.1	37																																																																																				.		0.418	NEDD4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000359817.1	NM_198400	
NHSL1	57224	hgsc.bcm.edu;bcgsc.ca	37	6	138753581	138753581	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:138753581T>C	ENST00000427025.2	-	5	2541	c.1913A>G	c.(1912-1914)cAc>cGc	p.H638R	NHSL1_ENST00000343505.5_Missense_Mutation_p.H634R|MIR3145_ENST00000580727.1_RNA	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	638										breast(2)|endometrium(4)|kidney(1)	7						GATCACGCTGTGCCTGGGGTT	0.473																																					p.H638R		.											.	NHSL1	68	0			c.A1913G						.						144.0	122.0	129.0					6																	138753581		692	1591	2283	SO:0001583	missense	57224	exon5			ACGCTGTGCCTGG	AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.1913A>G	6.37:g.138753581T>C	ENSP00000394546:p.His638Arg	128.0	0.0		75.0	4.0	NM_020464	Q3ZCS5|Q5SYE8|Q9P2J0	Missense_Mutation	SNP	ENST00000427025.2	37	CCDS55063.1	.	.	.	.	.	.	.	.	.	.	T	13.63	2.293176	0.40594	.	.	ENSG00000135540	ENST00000427025;ENST00000343505	T;T	0.36340	1.26;1.74	5.14	3.89	0.44902	.	0.261346	0.36409	N	0.002616	T	0.20007	0.0481	L	0.55834	1.745	0.47547	D	0.99945	P;P	0.42456	0.78;0.78	B;B	0.36959	0.237;0.237	T	0.09015	-1.0694	10	0.56958	D	0.05	-14.7625	11.9114	0.52741	0.0:0.0:0.1453:0.8547	.	634;638	E2QRJ1;Q5SYE7	.;NHSL1_HUMAN	R	638;634	ENSP00000394546:H638R;ENSP00000344672:H634R	ENSP00000344672:H634R	H	-	2	0	NHSL1	138795274	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.961000	0.56759	2.066000	0.61787	0.533000	0.62120	CAC	.		0.473	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043700.2	XM_050421	
NOTCH2	4853	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	120458918	120458919	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:120458918_120458919insAA	ENST00000256646.2	-	34	6645_6646	c.6426_6427insTT	c.(6424-6429)tctgagfs	p.E2143fs		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	2143					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACTGAACTCTCAGACAGTTGGA	0.485			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.E2143fs		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2	1441	0			c.6427_6428insTT						.																																			SO:0001589	frameshift_variant	4853	exon34	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AACTCTCAGACAG	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.6426_6427insTT	1.37:g.120458918_120458919insAA	ENSP00000256646:p.Glu2143fs	217.0	0.0		216.0	49.0	NM_024408	Q5T3X7|Q99734|Q9H240	Frame_Shift_Ins	INS	ENST00000256646.2	37	CCDS908.1																																																																																			.		0.485	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
NUP85	79902	hgsc.bcm.edu;bcgsc.ca	37	17	73214301	73214301	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:73214301T>C	ENST00000245544.4	+	7	568	c.497T>C	c.(496-498)cTc>cCc	p.L166P	NUP85_ENST00000447371.2_Intron|NUP85_ENST00000449421.2_3'UTR|NUP85_ENST00000579324.1_Missense_Mutation_p.L54P|NUP85_ENST00000579298.1_Missense_Mutation_p.L166P|NUP85_ENST00000541827.1_Missense_Mutation_p.L120P	NM_024844.3	NP_079120.1	Q9BW27	NUP85_HUMAN	nucleoporin 85kDa	166					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|lamellipodium assembly (GO:0030032)|macrophage chemotaxis (GO:0048246)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	16	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			CTCCTCCATCTCCTTGACTGG	0.527																																					p.L166P		.											.	NUP85	205	0			c.T497C						.						138.0	117.0	124.0					17																	73214301		2203	4300	6503	SO:0001583	missense	79902	exon7			TCCATCTCCTTGA	AF514995	CCDS32730.1	17q25	2006-11-29	2005-11-03	2005-11-03		ENSG00000125450			8734	protein-coding gene	gene with protein product		170285				8124707	Standard	XM_005257690		Approved	NUP75, FLJ12549	uc002jng.1	Q9BW27		ENST00000245544.4:c.497T>C	17.37:g.73214301T>C	ENSP00000245544:p.Leu166Pro	115.0	0.0		110.0	6.0	NM_024844	B4DMQ3|B4DPW1|Q8NDI4|Q9H9U1	Missense_Mutation	SNP	ENST00000245544.4	37	CCDS32730.1	.	.	.	.	.	.	.	.	.	.	T	14.88	2.668512	0.47677	.	.	ENSG00000125450	ENST00000245544;ENST00000541827;ENST00000449421	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.84297	0.5441	M	0.86420	2.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.87120	0.2190	9	0.87932	D	0	-20.273	16.2343	0.82363	0.0:0.0:0.0:1.0	.	120;166	B4DMQ3;Q9BW27	.;NUP85_HUMAN	P	166;120;120	.	ENSP00000245544:L166P	L	+	2	0	NUP85	70725896	1.000000	0.71417	0.992000	0.48379	0.983000	0.72400	7.588000	0.82629	2.234000	0.73211	0.533000	0.62120	CTC	.		0.527	NUP85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446619.1	NM_024844	
NYNRIN	57523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24884365	24884365	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:24884365C>T	ENST00000382554.3	+	9	3728	c.3410C>T	c.(3409-3411)gCc>gTc	p.A1137V		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1137					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						CATGAGGAGGCCTTCCTGGCC	0.657																																					p.A1137V		.											.	NYNRIN	3	0			c.C3410T						.						37.0	43.0	41.0					14																	24884365		2089	4196	6285	SO:0001583	missense	57523	exon9			AGGAGGCCTTCCT	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.3410C>T	14.37:g.24884365C>T	ENSP00000371994:p.Ala1137Val	36.0	0.0		15.0	12.0	NM_025081	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	37	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	C	18.92	3.725702	0.69074	.	.	ENSG00000205978	ENST00000382554	T	0.54279	0.58	4.61	4.61	0.57282	.	.	.	.	.	T	0.60945	0.2308	M	0.72353	2.195	0.26064	N	0.981317	D	0.54047	0.964	P	0.49561	0.615	T	0.58702	-0.7590	9	0.87932	D	0	.	12.8162	0.57667	0.0:1.0:0.0:0.0	.	1137	Q9P2P1	NYNRI_HUMAN	V	1137	ENSP00000371994:A1137V	ENSP00000371994:A1137V	A	+	2	0	NYNRIN	23954205	0.997000	0.39634	1.000000	0.80357	0.987000	0.75469	3.304000	0.51866	2.379000	0.81126	0.561000	0.74099	GCC	.		0.657	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
NYNRIN	57523	hgsc.bcm.edu;bcgsc.ca	37	14	24885708	24885708	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:24885708A>G	ENST00000382554.3	+	9	5071	c.4753A>G	c.(4753-4755)Agc>Ggc	p.S1585G		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1585					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						TTACTGCAGGAGCTGCTTGTT	0.587																																					p.S1585G		.											.	NYNRIN	3	0			c.A4753G						.						49.0	52.0	51.0					14																	24885708		2015	4170	6185	SO:0001583	missense	57523	exon9			TGCAGGAGCTGCT	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.4753A>G	14.37:g.24885708A>G	ENSP00000371994:p.Ser1585Gly	83.0	0.0		55.0	4.0	NM_025081	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	37	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	A	11.00	1.511102	0.27036	.	.	ENSG00000205978	ENST00000382554;ENST00000206466	T	0.10573	2.86	5.25	4.05	0.47172	.	0.195318	0.31660	N	0.007269	T	0.05090	0.0136	N	0.12887	0.27	0.24807	N	0.992663	P	0.42409	0.779	B	0.37989	0.262	T	0.26643	-1.0097	10	0.48119	T	0.1	.	4.6423	0.12555	0.743:0.0:0.0889:0.1681	.	1585	Q9P2P1	NYNRI_HUMAN	G	1585;114	ENSP00000371994:S1585G	ENSP00000206466:S114G	S	+	1	0	NYNRIN	23955548	1.000000	0.71417	1.000000	0.80357	0.195000	0.23768	2.786000	0.47790	2.194000	0.70268	0.533000	0.62120	AGC	.		0.587	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
OCRL	4952	hgsc.bcm.edu;bcgsc.ca	37	X	128695175	128695175	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:128695175A>G	ENST00000371113.4	+	10	1009	c.844A>G	c.(844-846)Agc>Ggc	p.S282G	OCRL_ENST00000357121.5_Missense_Mutation_p.S282G	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	282	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						ACTGGACTTGAGCACAGAAGC	0.398																																					p.S282G		.											.	OCRL	206	0			c.A844G						.						161.0	155.0	157.0					X																	128695175		2203	4300	6503	SO:0001583	missense	4952	exon10			GACTTGAGCACAG	U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.844A>G	X.37:g.128695175A>G	ENSP00000360154:p.Ser282Gly	111.0	0.0		112.0	5.0	NM_000276	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000371113.4	37	CCDS35393.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.358713	0.82243	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	T;T	0.79940	-1.32;-1.32	5.44	5.44	0.79542	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.89128	0.6627	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.976;0.994	D	0.90467	0.4450	10	0.87932	D	0	.	13.7631	0.62979	1.0:0.0:0.0:0.0	.	282;282	Q01968-2;Q01968	.;OCRL_HUMAN	G	282	ENSP00000360154:S282G;ENSP00000349635:S282G	ENSP00000349635:S282G	S	+	1	0	OCRL	128522856	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	8.962000	0.93254	1.915000	0.55452	0.486000	0.48141	AGC	.		0.398	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058917.1	NM_000276	
OLFML2B	25903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	161989875	161989875	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:161989875C>A	ENST00000294794.3	-	2	695	c.272G>T	c.(271-273)aGg>aTg	p.R91M	OLFML2B_ENST00000367940.2_Missense_Mutation_p.R91M	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	91					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			CGCATTGATCCTCTGGCAGGC	0.592																																					p.R91M		.											.	OLFML2B	69	0			c.G272T						.						80.0	81.0	80.0					1																	161989875		2203	4300	6503	SO:0001583	missense	25903	exon2			TTGATCCTCTGGC	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.272G>T	1.37:g.161989875C>A	ENSP00000294794:p.Arg91Met	127.0	0.0		223.0	49.0	NM_015441	B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	ENST00000294794.3	37	CCDS1236.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.391902	0.83011	.	.	ENSG00000162745	ENST00000294794;ENST00000367940	T;T	0.49720	0.77;0.77	4.5	4.5	0.54988	.	.	.	.	.	T	0.52613	0.1745	L	0.55213	1.73	0.38414	D	0.945999	D;D	0.76494	0.997;0.999	P;P	0.61201	0.781;0.885	T	0.58662	-0.7597	8	0.87932	D	0	.	15.0948	0.72226	0.0:1.0:0.0:0.0	.	91;91	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	M	91	ENSP00000294794:R91M;ENSP00000356917:R91M	ENSP00000294794:R91M	R	-	2	0	OLFML2B	160256499	1.000000	0.71417	0.942000	0.38095	0.789000	0.44602	6.931000	0.75863	2.487000	0.83934	0.561000	0.74099	AGG	.		0.592	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441	
OVOL2	58495	hgsc.bcm.edu;bcgsc.ca	37	20	18022238	18022238	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr20:18022238A>G	ENST00000278780.6	-	3	693	c.451T>C	c.(451-453)Ttc>Ctc	p.F151L	OVOL2_ENST00000483661.1_5'UTR	NM_021220.2	NP_067043.2	Q9BRP0	OVOL2_HUMAN	ovo-like zinc finger 2	151					angiogenesis (GO:0001525)|dorsal/ventral pattern formation (GO:0009953)|embryonic digestive tract morphogenesis (GO:0048557)|endocardium formation (GO:0060214)|heart looping (GO:0001947)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neural fold formation (GO:0001842)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of keratinocyte proliferation (GO:0010837)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)	6						TTGCCGCAGAAGGTGCACAGG	0.562																																					p.F151L		.											.	OVOL2	68	0			c.T451C						.						155.0	97.0	117.0					20																	18022238		2203	4300	6503	SO:0001583	missense	58495	exon3			CGCAGAAGGTGCA	AK022284	CCDS13132.1	20p11.23	2013-10-17	2013-10-17	2005-05-31	ENSG00000125850	ENSG00000125850		"""Zinc fingers, C2H2-type"""	15804	protein-coding gene	gene with protein product			"""zinc finger protein 339"", ""ovo-like 2 (Drosophila)"""	ZNF339			Standard	NM_021220		Approved	bA504H3.3, HOVO2	uc002wqi.1	Q9BRP0	OTTHUMG00000031960	ENST00000278780.6:c.451T>C	20.37:g.18022238A>G	ENSP00000278780:p.Phe151Leu	114.0	0.0		123.0	5.0	NM_021220	Q5T8B4|Q9BX22|Q9HA54|Q9Y4M0	Missense_Mutation	SNP	ENST00000278780.6	37	CCDS13132.1	.	.	.	.	.	.	.	.	.	.	A	36	5.679291	0.96774	.	.	ENSG00000125850	ENST00000278780	T	0.05996	3.36	5.73	5.73	0.89815	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.10637	0.0260	N	0.04805	-0.155	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.52609	-0.8553	10	0.33141	T	0.24	-33.5679	16.0048	0.80354	1.0:0.0:0.0:0.0	.	151	Q9BRP0	OVOL2_HUMAN	L	151	ENSP00000278780:F151L	ENSP00000278780:F151L	F	-	1	0	OVOL2	17970238	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.418000	0.80167	2.180000	0.69256	0.533000	0.62120	TTC	.		0.562	OVOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078148.5	NM_021220	
PCLO	27445	hgsc.bcm.edu;bcgsc.ca	37	7	82580361	82580361	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:82580361A>G	ENST00000333891.9	-	6	9880	c.9543T>C	c.(9541-9543)gtT>gtC	p.V3181V	PCLO_ENST00000423517.2_Silent_p.V3181V|PCLO_ENST00000437081.1_5'Flank	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTAAAGTGGGAACAGAGTCTA	0.433																																					p.V3181V		.											.	PCLO	29	0			c.T9543C						.						52.0	49.0	50.0					7																	82580361		1922	4153	6075	SO:0001819	synonymous_variant	27445	exon6			AGTGGGAACAGAG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.9543T>C	7.37:g.82580361A>G		90.0	0.0		100.0	4.0	NM_014510		Silent	SNP	ENST00000333891.9	37	CCDS47630.1																																																																																			.		0.433	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PHLPP2	23035	hgsc.bcm.edu;bcgsc.ca	37	16	71683278	71683278	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:71683278T>C	ENST00000568954.1	-	19	3865	c.3487A>G	c.(3487-3489)Agc>Ggc	p.S1163G	PHLPP2_ENST00000393524.2_Missense_Mutation_p.S1096G|PHLPP2_ENST00000540628.1_Intron|PHLPP2_ENST00000567016.1_Missense_Mutation_p.S1198G|PHLPP2_ENST00000356272.3_Missense_Mutation_p.S1163G|PHLPP2_ENST00000360429.3_Intron			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	1163					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						TCTACCTTGCTGCCATTGGTT	0.552																																					p.S1163G		.											.	PHLPP2	91	0			c.A3487G						.						69.0	69.0	69.0					16																	71683278		2198	4300	6498	SO:0001583	missense	23035	exon18			CCTTGCTGCCATT	BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.3487A>G	16.37:g.71683278T>C	ENSP00000457991:p.Ser1163Gly	72.0	0.0		69.0	4.0	NM_015020	A1L374|Q9NV17|Q9Y2E3	Missense_Mutation	SNP	ENST00000568954.1	37	CCDS32479.1	.	.	.	.	.	.	.	.	.	.	T	18.48	3.632192	0.67015	.	.	ENSG00000040199	ENST00000356272;ENST00000393524	T;T	0.62639	0.67;0.01	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.79137	0.4395	M	0.75264	2.295	0.54753	D	0.99998	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.98	T	0.81446	-0.0929	10	0.87932	D	0	-21.3651	15.7393	0.77876	0.0:0.0:0.0:1.0	.	1096;1163	Q6ZVD8-3;Q6ZVD8	.;PHLP2_HUMAN	G	1163;1096	ENSP00000348611:S1163G;ENSP00000377159:S1096G	ENSP00000348611:S1163G	S	-	1	0	PHLPP2	70240779	1.000000	0.71417	1.000000	0.80357	0.532000	0.34746	6.103000	0.71492	2.308000	0.77769	0.533000	0.62120	AGC	.		0.552	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434139.1	NM_015020	
PIK3C2B	5287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	204401382	204401382	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:204401382G>C	ENST00000367187.3	-	28	4657	c.4101C>G	c.(4099-4101)atC>atG	p.I1367M	RP11-739N20.2_ENST00000443515.1_RNA|PIK3C2B_ENST00000424712.2_Missense_Mutation_p.I1339M	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1367	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			AAACATCACTGATTCGGCCAG	0.517																																					p.I1367M		.											.	PIK3C2B	1310	0			c.C4101G						.						131.0	130.0	130.0					1																	204401382		2203	4300	6503	SO:0001583	missense	5287	exon28			ATCACTGATTCGG	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.4101C>G	1.37:g.204401382G>C	ENSP00000356155:p.Ile1367Met	184.0	0.0		360.0	81.0	NM_002646	O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	37	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686187	0.47991	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.45276	0.9;0.9	6.08	4.18	0.49190	Phox homologous domain (5);	0.104907	0.64402	D	0.000005	T	0.64182	0.2575	M	0.82823	2.61	0.40977	D	0.984742	P;B	0.52463	0.953;0.331	P;P	0.59357	0.856;0.448	T	0.71823	-0.4476	10	0.87932	D	0	.	15.3304	0.74203	0.0:0.0:0.744:0.256	.	1339;1367	F5GWN5;O00750	.;P3C2B_HUMAN	M	1367;1339	ENSP00000356155:I1367M;ENSP00000400561:I1339M	ENSP00000356155:I1367M	I	-	3	3	PIK3C2B	202668005	1.000000	0.71417	0.727000	0.30756	0.312000	0.27988	4.878000	0.63093	0.880000	0.35969	-0.181000	0.13052	ATC	.		0.517	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646	
PIK3R4	30849	hgsc.bcm.edu;bcgsc.ca	37	3	130449233	130449233	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:130449233A>G	ENST00000356763.3	-	5	2061	c.1504T>C	c.(1504-1506)Tta>Cta	p.L502L		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	502					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						AGATTTTTTAACTGTACTAAT	0.303																																					p.L502L		.											.	PIK3R4	1471	0			c.T1504C						.						73.0	77.0	75.0					3																	130449233		2203	4296	6499	SO:0001819	synonymous_variant	30849	exon5			TTTTTAACTGTAC	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.1504T>C	3.37:g.130449233A>G		85.0	0.0		86.0	4.0	NM_014602	Q2TBF4	Silent	SNP	ENST00000356763.3	37	CCDS3067.1																																																																																			.		0.303	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602	
PLEKHA4	57664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49357343	49357343	+	Splice_Site	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:49357343G>A	ENST00000263265.6	-	11	1652	c.1097C>T	c.(1096-1098)aCg>aTg	p.T366M	PLEKHA4_ENST00000355496.5_Splice_Site_p.T341M	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	366						cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		GGTCAGCAGCGTCTGGAGAAA	0.612																																					p.T366M		.											.	PLEKHA4	227	0			c.C1097T						.						43.0	43.0	43.0					19																	49357343		2203	4300	6503	SO:0001630	splice_region_variant	57664	exon11			AGCAGCGTCTGGA	AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.1096-1C>T	19.37:g.49357343G>A		106.0	0.0		121.0	59.0	NM_020904	Q8N4M8|Q8N658	Missense_Mutation	SNP	ENST00000263265.6	37	CCDS12737.1	.	.	.	.	.	.	.	.	.	.	G	16.25	3.070509	0.55539	.	.	ENSG00000105559	ENST00000263265;ENST00000355496	T;T	0.36340	1.26;1.26	4.91	3.85	0.44370	.	0.165964	0.39544	N	0.001332	T	0.41282	0.1152	L	0.40543	1.245	0.23862	N	0.996632	D;D	0.67145	0.995;0.996	P;P	0.54706	0.759;0.72	T	0.22836	-1.0205	10	0.72032	D	0.01	.	11.2063	0.48771	0.0:0.1854:0.8146:0.0	.	341;366	Q9H4M7-2;Q9H4M7	.;PKHA4_HUMAN	M	366;341	ENSP00000263265:T366M;ENSP00000347683:T341M	ENSP00000263265:T366M	T	-	2	0	PLEKHA4	54049155	0.977000	0.34250	0.783000	0.31826	0.631000	0.37964	2.023000	0.41040	1.393000	0.46605	0.563000	0.77884	ACG	.		0.612	PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466216.1		Missense_Mutation
PLXNC1	10154	hgsc.bcm.edu;bcgsc.ca	37	12	94631455	94631455	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:94631455T>C	ENST00000258526.4	+	10	2245	c.1996T>C	c.(1996-1998)Tcc>Ccc	p.S666P		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	666					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CTACATTAAGTCCATTGAGCC	0.408																																					p.S666P		.											.	PLXNC1	92	0			c.T1996C						.						77.0	69.0	71.0					12																	94631455		2203	4300	6503	SO:0001583	missense	10154	exon10			ATTAAGTCCATTG	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.1996T>C	12.37:g.94631455T>C	ENSP00000258526:p.Ser666Pro	71.0	0.0		55.0	4.0	NM_005761	Q59H25	Missense_Mutation	SNP	ENST00000258526.4	37	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	T	14.97	2.694898	0.48202	.	.	ENSG00000136040	ENST00000258526	T	0.80994	-1.44	5.75	2.08	0.27032	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.446825	0.25848	N	0.027909	T	0.73908	0.3647	L	0.29908	0.895	0.80722	D	1	P	0.42518	0.782	P	0.48598	0.583	T	0.70963	-0.4729	10	0.59425	D	0.04	.	7.2307	0.26040	0.1253:0.0:0.3471:0.5276	.	666	O60486	PLXC1_HUMAN	P	666	ENSP00000258526:S666P	ENSP00000258526:S666P	S	+	1	0	PLXNC1	93155586	0.999000	0.42202	0.999000	0.59377	0.991000	0.79684	2.268000	0.43338	0.509000	0.28195	0.533000	0.62120	TCC	.		0.408	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2		
POLE2	5427	hgsc.bcm.edu;bcgsc.ca	37	14	50118040	50118040	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:50118040T>C	ENST00000216367.5	-	16	1366	c.1267A>G	c.(1267-1269)Atg>Gtg	p.M423V	POLE2_ENST00000556584.1_5'UTR|POLE2_ENST00000539565.2_Missense_Mutation_p.M397V|POLE2_ENST00000554396.1_Missense_Mutation_p.M423V	NM_002692.3	NP_002683.2	P56282	DPOE2_HUMAN	polymerase (DNA directed), epsilon 2, accessory subunit	423					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	epsilon DNA polymerase complex (GO:0008622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	10	all_epithelial(31;0.0021)|Breast(41;0.0124)				Cladribine(DB00242)	TTTCTGCACATTTTATTTACT	0.338																																					p.M423V		.											.	POLE2	229	0			c.A1267G						.						74.0	75.0	75.0					14																	50118040		2203	4300	6503	SO:0001583	missense	5427	exon16			TGCACATTTTATT	AF025840	CCDS32073.1, CCDS55914.1, CCDS55915.1	14q21-q22	2012-05-18	2012-05-18		ENSG00000100479	ENSG00000100479		"""DNA polymerases"""	9178	protein-coding gene	gene with protein product	"""DNA polymerase epsilon subunit B"""	602670	"""polymerase (DNA directed), epsilon 2 (p59 subunit)"""			9405441, 9443964	Standard	NM_002692		Approved	DPE2	uc001wwu.3	P56282	OTTHUMG00000170813	ENST00000216367.5:c.1267A>G	14.37:g.50118040T>C	ENSP00000216367:p.Met423Val	159.0	0.0		83.0	4.0	NM_001197331	A0AV55|A4FU92|A4LBB7|A6NH58|B4DDE6|O43560	Missense_Mutation	SNP	ENST00000216367.5	37	CCDS32073.1	.	.	.	.	.	.	.	.	.	.	T	15.95	2.984872	0.53934	.	.	ENSG00000100479	ENST00000216367;ENST00000539565;ENST00000554396	T;T;T	0.27557	1.66;1.66;1.66	5.52	5.52	0.82312	DNA polymerase alpha/epsilon, subunit B (1);	0.000000	0.85682	D	0.000000	T	0.43831	0.1265	M	0.79614	2.46	0.58432	D	0.999999	B;B;B	0.18863	0.031;0.01;0.006	B;B;B	0.33846	0.171;0.06;0.032	T	0.41413	-0.9510	10	0.54805	T	0.06	-17.3453	15.938	0.79729	0.0:0.0:0.0:1.0	.	423;397;423	A4FU92;B4DDE6;P56282	.;.;DPOE2_HUMAN	V	423;397;423	ENSP00000216367:M423V;ENSP00000446313:M397V;ENSP00000451621:M423V	ENSP00000216367:M423V	M	-	1	0	POLE2	49187790	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.836000	0.86788	2.222000	0.72286	0.533000	0.62120	ATG	.		0.338	POLE2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410512.1	NM_002692	
PPP1R12A	4659	hgsc.bcm.edu;bcgsc.ca	37	12	80266678	80266678	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:80266678A>G	ENST00000450142.2	-	2	544	c.278T>C	c.(277-279)gTa>gCa	p.V93A	PPP1R12A_ENST00000261207.5_Missense_Mutation_p.V93A|PPP1R12A_ENST00000546369.1_Missense_Mutation_p.V6A|PPP1R12A_ENST00000437004.2_Missense_Mutation_p.V93A|PPP1R12A_ENST00000550107.1_Missense_Mutation_p.V93A	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	93					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						TCCATTTTCTACCAGAAACTT	0.358																																					p.V93A		.											.	PPP1R12A	273	0			c.T278C						.						102.0	95.0	97.0					12																	80266678		1883	4160	6043	SO:0001583	missense	4659	exon2			TTTTCTACCAGAA	D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.278T>C	12.37:g.80266678A>G	ENSP00000389168:p.Val93Ala	122.0	0.0		74.0	4.0	NM_002480	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	ENST00000450142.2	37	CCDS44947.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.632309	0.87660	.	.	ENSG00000058272	ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000312727;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000550107;ENST00000547330;ENST00000550510	T;T;T;D;T;T;T	0.83163	-0.24;-0.24;-0.24;-1.69;-0.24;-0.1;-0.17	5.02	5.02	0.67125	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.87398	0.6167	L	0.41573	1.285	0.80722	D	1	D;P;D;D	0.64830	0.993;0.878;0.982;0.994	D;D;D;D	0.83275	0.993;0.972;0.989;0.996	D	0.88754	0.3252	10	0.72032	D	0.01	.	15.0448	0.71819	1.0:0.0:0.0:0.0	.	93;93;93;93	F8W8Q6;O14974-2;O14974-3;O14974	.;.;.;MYPT1_HUMAN	A	93;93;93;93;93;93;93;6;93;93;21	ENSP00000261207:V93A;ENSP00000389168:V93A;ENSP00000416769:V93A;ENSP00000449514:V6A;ENSP00000446855:V93A;ENSP00000446816:V93A;ENSP00000447338:V21A	ENSP00000261207:V93A	V	-	2	0	PPP1R12A	78790809	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.087000	0.94110	2.006000	0.58801	0.477000	0.44152	GTA	.		0.358	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407254.2	NM_002480	
PPP1R13B	23368	hgsc.bcm.edu;bcgsc.ca	37	14	104206859	104206859	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:104206859A>G	ENST00000202556.9	-	12	2176	c.1894T>C	c.(1894-1896)Tcc>Ccc	p.S632P	PPP1R13B_ENST00000423488.2_Missense_Mutation_p.S51P|PPP1R13B_ENST00000555391.1_5'UTR	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	632	Pro-rich.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				GTGCCCGTGGACAGTGACCCG	0.587																																					p.S632P		.											.	PPP1R13B	227	0			c.T1894C						.						33.0	42.0	39.0					14																	104206859		2085	4208	6293	SO:0001583	missense	23368	exon12			CCGTGGACAGTGA	AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.1894T>C	14.37:g.104206859A>G	ENSP00000202556:p.Ser632Pro	114.0	0.0		75.0	5.0	NM_015316	B2RMX5|O94870	Missense_Mutation	SNP	ENST00000202556.9	37	CCDS41997.1	.	.	.	.	.	.	.	.	.	.	A	11.64	1.698031	0.30142	.	.	ENSG00000088808	ENST00000202556;ENST00000423488;ENST00000380023	T;T	0.55413	0.7;0.52	5.48	0.92	0.19397	.	0.471590	0.24876	N	0.034887	T	0.28366	0.0701	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13255	-1.0516	10	0.22109	T	0.4	.	6.5986	0.22687	0.3434:0.3871:0.2695:0.0	.	632	Q96KQ4	ASPP1_HUMAN	P	632;51;499	ENSP00000202556:S632P;ENSP00000395213:S51P	ENSP00000202556:S632P	S	-	1	0	PPP1R13B	103276612	0.988000	0.35896	0.005000	0.12908	0.046000	0.14306	1.435000	0.34969	0.125000	0.18397	0.533000	0.62120	TCC	.		0.587	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414591.1	NM_015316	
PROS1	5627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	93611837	93611837	+	Silent	SNP	A	A	G	rs199469491	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:93611837A>G	ENST00000394236.3	-	10	1411	c.1095T>C	c.(1093-1095)aaT>aaC	p.N365N	PROS1_ENST00000407433.1_Silent_p.N234N	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	365	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	ATGTATGTTCATTCTTAAGCT	0.398																																					p.N365N		.											.	PROS1	153	0			c.T1095C						.						130.0	120.0	124.0					3																	93611837		2203	4300	6503	SO:0001819	synonymous_variant	5627	exon10			ATGTTCATTCTTA		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.1095T>C	3.37:g.93611837A>G		371.0	0.0		421.0	172.0	NM_000313	A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Silent	SNP	ENST00000394236.3	37	CCDS2923.1																																																																																			A|0.999;C|0.001		0.398	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313	
PSMD13	5719	hgsc.bcm.edu;bcgsc.ca	37	11	248788	248788	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:248788A>G	ENST00000532097.1	+	8	1085	c.581A>G	c.(580-582)cAg>cGg	p.Q194R	PSMD13_ENST00000352303.5_Missense_Mutation_p.Q194R|PSMD13_ENST00000431206.2_Missense_Mutation_p.Q196R	NM_002817.3	NP_002808.3	Q9UNM6	PSD13_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 13	194					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|meiosis I (GO:0007127)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				NS(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	10		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)		TCTGAGCAGCAGGAGAGAGCC	0.443																																					p.Q196R		.											.	PSMD13	515	0			c.A587G						.						77.0	75.0	75.0					11																	248788		2203	4300	6503	SO:0001583	missense	5719	exon6			AGCAGCAGGAGAG	AB009398	CCDS7692.1, CCDS44504.1	11p15.5	2008-05-22			ENSG00000185627	ENSG00000185627		"""Proteasome (prosome, macropain) subunits"""	9558	protein-coding gene	gene with protein product		603481				9714768, 8811196	Standard	NM_002817		Approved	p40.5, Rpn9	uc001loo.2	Q9UNM6	OTTHUMG00000119072	ENST00000532097.1:c.581A>G	11.37:g.248788A>G	ENSP00000436186:p.Gln194Arg	119.0	0.0		72.0	4.0	NM_175932	B3KT15|O75831|Q53XU2|Q9UNV3	Missense_Mutation	SNP	ENST00000532097.1	37	CCDS7692.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.87|11.87	1.768985|1.768985	0.31320|0.31320	.|.	.|.	ENSG00000185627|ENSG00000185627	ENST00000532097;ENST00000538343;ENST00000431206;ENST00000528906;ENST00000352303|ENST00000526783	T;T;T;T|.	0.18502|.	2.22;2.22;2.24;2.21|.	5.45|5.45	3.14|3.14	0.36123|0.36123	.|.	0.222920|.	0.47455|.	D|.	0.000236|.	T|T	0.51244|0.51244	0.1663|0.1663	L|L	0.38175|0.38175	1.15|1.15	0.52501|0.52501	D|D	0.999957|0.999957	B;B;B;B|.	0.13594|.	0.008;0.002;0.001;0.001|.	B;B;B;B|.	0.09377|.	0.004;0.003;0.002;0.002|.	T|T	0.35201|0.35201	-0.9798|-0.9798	10|5	0.11182|.	T|.	0.66|.	.|.	9.0653|9.0653	0.36460|0.36460	0.8486:0.0:0.1514:0.0|0.8486:0.0:0.1514:0.0	.|.	196;129;194;194|.	Q9UNM6-2;B4DJ66;B2RBM7;Q9UNM6|.	.;.;.;PSD13_HUMAN|.	R|G	194;129;196;156;194|105	ENSP00000436186:Q194R;ENSP00000396937:Q196R;ENSP00000433364:Q156R;ENSP00000333811:Q194R|.	ENSP00000333811:Q194R|.	Q|R	+|+	2|1	0|2	PSMD13|PSMD13	238788|238788	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.408000|7.408000	0.80041|0.80041	0.471000|0.471000	0.27319|0.27319	0.529000|0.529000	0.55759|0.55759	CAG|AGG	.		0.443	PSMD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239286.2	NM_002817	
PTPRM	5797	hgsc.bcm.edu;bcgsc.ca	37	18	8376068	8376068	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr18:8376068A>G	ENST00000332175.8	+	23	4194	c.3157A>G	c.(3157-3159)Atc>Gtc	p.I1053V	PTPRM_ENST00000580170.1_Missense_Mutation_p.I1066V|PTPRM_ENST00000400060.4_Missense_Mutation_p.I1067V|PTPRM_ENST00000400053.4_Missense_Mutation_p.I991V|PTPRM_ENST00000444013.1_Missense_Mutation_p.I840V	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1053	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				AATCCGAGAGATCAGACAGTT	0.547																																					p.I1066V		.											.	PTPRM	228	0			c.A3196G						.						92.0	91.0	91.0					18																	8376068		2203	4300	6503	SO:0001583	missense	5797	exon25			CGAGAGATCAGAC	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3157A>G	18.37:g.8376068A>G	ENSP00000331418:p.Ile1053Val	68.0	0.0		67.0	4.0	NM_001105244	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	A	11.71	1.720594	0.30503	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	6.04	6.04	0.98038	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.096128	0.64402	D	0.000001	T	0.09113	0.0225	N	0.00894	-1.105	0.58432	D	0.999999	B;B;B	0.18166	0.026;0.004;0.004	B;B;B	0.20577	0.03;0.011;0.011	T	0.25012	-1.0144	10	0.02654	T	1	.	16.6349	0.85050	1.0:0.0:0.0:0.0	.	840;1066;1053	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	V	1053;1067;991;840	ENSP00000331418:I1053V;ENSP00000382933:I1067V;ENSP00000382927:I991V;ENSP00000387608:I840V	ENSP00000331418:I1053V	I	+	1	0	PTPRM	8366068	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.369000	0.73109	2.330000	0.79161	0.477000	0.44152	ATC	.		0.547	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
QSER1	79832	hgsc.bcm.edu;bcgsc.ca	37	11	32977609	32977609	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:32977609A>G	ENST00000399302.2	+	7	4641	c.4306A>G	c.(4306-4308)Aag>Gag	p.K1436E	QSER1_ENST00000527788.1_Missense_Mutation_p.K1197E	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1436										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					TGCAAACAAGAAGGAATATGT	0.308																																					p.K1436E		.											.	QSER1	95	0			c.A4306G						.						142.0	135.0	137.0					11																	32977609		1820	4069	5889	SO:0001583	missense	79832	exon7			AACAAGAAGGAAT	AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.4306A>G	11.37:g.32977609A>G	ENSP00000382241:p.Lys1436Glu	115.0	0.0		71.0	4.0	NM_001076786	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	ENST00000399302.2	37	CCDS41631.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.279215	0.80692	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	T;T	0.31769	1.81;1.48	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000006	T	0.50069	0.1594	M	0.66939	2.045	0.42105	D	0.991359	D;D;D	0.67145	0.99;0.982;0.996	P;P;P	0.58266	0.768;0.628;0.836	T	0.54556	-0.8276	10	0.72032	D	0.01	.	15.7316	0.77810	1.0:0.0:0.0:0.0	.	1197;1197;1436	C9JJ88;Q2KHR3-2;Q2KHR3	.;.;QSER1_HUMAN	E	1436;1197;1197	ENSP00000382241:K1436E;ENSP00000432766:K1197E	ENSP00000078652:K1197E	K	+	1	0	QSER1	32934185	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.629000	0.67798	2.109000	0.64355	0.482000	0.46254	AAG	.		0.308	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774	
RASA1	5921	broad.mit.edu;bcgsc.ca	37	5	86665656	86665668	+	Frame_Shift_Del	DEL	AGCACTTTAGTGA	AGCACTTTAGTGA	-	rs528357903	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	AGCACTTTAGTGA	AGCACTTTAGTGA	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:86665656_86665668delAGCACTTTAGTGA	ENST00000274376.6	+	12	2201_2213	c.1637_1649delAGCACTTTAGTGA	c.(1636-1650)cagcactttagtgaafs	p.QHFSE546fs	RASA1_ENST00000456692.2_Frame_Shift_Del_p.QHFSE369fs|RASA1_ENST00000512763.1_Frame_Shift_Del_p.QHFSE379fs|RASA1_ENST00000506290.1_Frame_Shift_Del_p.QHFSE380fs	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	546	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		ATAGTAGTTCAGCACTTTAGTGAAGAACATTAC	0.31																																					p.546_550del		.											.	RASA1	661	0			c.1637_1649del						.																																			SO:0001589	frameshift_variant	5921	exon12			TAGTTCAGCACTT		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1637_1649delAGCACTTTAGTGA	5.37:g.86665656_86665668delAGCACTTTAGTGA	ENSP00000274376:p.Gln546fs	188.0	0.0		143.0	12.0	NM_002890	B2R6W3|Q9UDI1	Frame_Shift_Del	DEL	ENST00000274376.6	37	CCDS34200.1																																																																																			.		0.310	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
RASEF	158158	hgsc.bcm.edu;bcgsc.ca	37	9	85627416	85627416	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:85627416T>C	ENST00000376447.3	-	5	1036	c.776A>G	c.(775-777)cAa>cGa	p.Q259R		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	259					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						GCGTTTTGATTGTTCTTCGAG	0.328																																					p.Q259R		.											.	RASEF	280	0			c.A776G						.						115.0	96.0	102.0					9																	85627416		2200	4298	6498	SO:0001583	missense	158158	exon5			TTTGATTGTTCTT	AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.776A>G	9.37:g.85627416T>C	ENSP00000365630:p.Gln259Arg	74.0	0.0		77.0	4.0	NM_152573	A6NC29|Q96N04	Missense_Mutation	SNP	ENST00000376447.3	37	CCDS6662.1	.	.	.	.	.	.	.	.	.	.	T	17.05	3.289356	0.59976	.	.	ENSG00000165105	ENST00000376447	T	0.61742	0.08	5.22	5.22	0.72569	.	0.122400	0.56097	D	0.000030	T	0.59238	0.2179	M	0.67953	2.075	0.80722	D	1	P	0.46142	0.873	B	0.42422	0.387	T	0.66763	-0.5841	10	0.87932	D	0	.	14.3933	0.66994	0.0:0.0:0.0:1.0	.	259	Q8IZ41	RASEF_HUMAN	R	259	ENSP00000365630:Q259R	ENSP00000365630:Q259R	Q	-	2	0	RASEF	84817236	1.000000	0.71417	0.974000	0.42286	0.874000	0.50279	5.042000	0.64202	2.093000	0.63338	0.528000	0.53228	CAA	.		0.328	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052825.1	NM_152573	
RELN	5649	hgsc.bcm.edu;bcgsc.ca	37	7	103162472	103162472	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:103162472A>G	ENST00000428762.1	-	48	7824	c.7665T>C	c.(7663-7665)agT>agC	p.S2555S	RELN_ENST00000424685.2_Silent_p.S2555S|RELN_ENST00000343529.5_Silent_p.S2555S	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2555					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CACTCACCCCACTGAAATGGA	0.478																																					p.S2555S	NSCLC(146;835 1944 15585 22231 52158)	.											.	RELN	574	0			c.T7665C						.						135.0	124.0	128.0					7																	103162472		2203	4300	6503	SO:0001819	synonymous_variant	5649	exon48			CACCCCACTGAAA		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.7665T>C	7.37:g.103162472A>G		57.0	0.0		75.0	4.0	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	CCDS47680.1																																																																																			.		0.478	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
RNF157	114804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	74169787	74169787	+	Missense_Mutation	SNP	C	C	T	rs144334591		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:74169787C>T	ENST00000269391.6	-	3	424	c.292G>A	c.(292-294)Gtc>Atc	p.V98I	RNF157_ENST00000319945.6_Missense_Mutation_p.V98I	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	98							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			ACTTACTTGACGAGCCTCAGT	0.567																																					p.V98I	GBM(186;507 2120 27388 27773 52994)	.											.	RNF157	228	0			c.G292A						.	C	ILE/VAL	2,4404	6.2+/-15.9	0,2,2201	46.0	40.0	42.0		292	5.3	0.9	17	dbSNP_134	42	0,8600		0,0,4300	no	missense	RNF157	NM_052916.2	29	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	98/680	74169787	2,13004	2203	4300	6503	SO:0001583	missense	114804	exon3			ACTTGACGAGCCT	AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.292G>A	17.37:g.74169787C>T	ENSP00000269391:p.Val98Ile	152.0	0.0		131.0	62.0	NM_052916	Q8NB72|Q96N56	Missense_Mutation	SNP	ENST00000269391.6	37	CCDS32740.1	.	.	.	.	.	.	.	.	.	.	C	32	5.129204	0.94473	4.54E-4	0.0	ENSG00000141576	ENST00000269391;ENST00000319945;ENST00000301610	T;T	0.33438	1.41;1.41	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.49915	0.1585	M	0.63169	1.94	0.80722	D	1	D;P	0.59767	0.986;0.873	P;P	0.58577	0.841;0.459	T	0.45702	-0.9243	10	0.45353	T	0.12	.	18.5089	0.90909	0.0:1.0:0.0:0.0	.	98;98	Q96PX1-2;Q96PX1	.;RN157_HUMAN	I	98;98;60	ENSP00000269391:V98I;ENSP00000321837:V98I	ENSP00000269391:V98I	V	-	1	0	RNF157	71681382	1.000000	0.71417	0.948000	0.38648	0.879000	0.50718	7.689000	0.84165	2.437000	0.82529	0.655000	0.94253	GTC	C|1.000;T|0.000		0.567	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255874.2	XM_290732	
SACS	26278	hgsc.bcm.edu;bcgsc.ca	37	13	23909856	23909856	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr13:23909856T>C	ENST00000382292.3	-	9	8432	c.8159A>G	c.(8158-8160)gAc>gGc	p.D2720G	SACS_ENST00000402364.1_Missense_Mutation_p.D1970G|SACS_ENST00000382298.3_Missense_Mutation_p.D2720G			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2720					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GACCATTCTGTCTGATGCTGG	0.373																																					p.D2720G		.											.	SACS	298	0			c.A8159G						.						69.0	70.0	70.0					13																	23909856		2203	4299	6502	SO:0001583	missense	26278	exon10			ATTCTGTCTGATG	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.8159A>G	13.37:g.23909856T>C	ENSP00000371729:p.Asp2720Gly	106.0	0.0		72.0	4.0	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	T	25.4	4.635701	0.87760	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.93811	-3.29;-3.29;-3.29	5.56	5.56	0.83823	ATPase-like, ATP-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.95089	0.8409	L	0.44542	1.39	0.53688	D	0.999978	D	0.89917	1.0	D	0.87578	0.998	D	0.95378	0.8470	10	0.56958	D	0.05	.	15.7067	0.77588	0.0:0.0:0.0:1.0	.	2720	Q9NZJ4	SACS_HUMAN	G	2720;1970;2720	ENSP00000371729:D2720G;ENSP00000385844:D1970G;ENSP00000371735:D2720G	ENSP00000371729:D2720G	D	-	2	0	SACS	22807856	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	7.698000	0.84413	2.116000	0.64780	0.379000	0.24179	GAC	.		0.373	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
SCAPER	49855	hgsc.bcm.edu;bcgsc.ca	37	15	77059425	77059425	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:77059425A>G	ENST00000563290.1	-	11	1348	c.1253T>C	c.(1252-1254)aTg>aCg	p.M418T	SCAPER_ENST00000538941.2_Missense_Mutation_p.M172T|SCAPER_ENST00000324767.7_Missense_Mutation_p.M418T			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	418	Glu-rich.					endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						GACTTCTGCCATGGACTATAA	0.338																																					p.M418T		.											.	SCAPER	137	0			c.T1253C						.						68.0	54.0	58.0					15																	77059425		1815	4062	5877	SO:0001583	missense	49855	exon10			TCTGCCATGGACT	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.1253T>C	15.37:g.77059425A>G	ENSP00000454973:p.Met418Thr	155.0	0.0		76.0	4.0	NM_020843	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	37	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	A	16.95	3.264612	0.59431	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.24151	1.9;1.87	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.32615	0.0835	N	0.14661	0.345	0.53005	D	0.999964	D;D;D	0.69078	0.994;0.997;0.997	D;D;D	0.76575	0.983;0.988;0.988	T	0.14755	-1.0461	10	0.19147	T	0.46	.	15.9905	0.80202	1.0:0.0:0.0:0.0	.	418;439;172	Q6NSF1;Q9BY12-2;F5H7X8	.;.;.	T	418;172;440	ENSP00000326924:M418T;ENSP00000442190:M172T	ENSP00000303560:M440T	M	-	2	0	SCAPER	74846480	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.759000	0.91667	2.183000	0.69458	0.397000	0.26171	ATG	.		0.338	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
SEPT4	5414	hgsc.bcm.edu;bcgsc.ca	37	17	56603141	56603141	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:56603141T>C	ENST00000317268.3	-	4	629	c.453A>G	c.(451-453)ggA>ggG	p.G151G	SEPT4_ENST00000426861.1_Splice_Site_p.G132G|RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000317256.6_Splice_Site_p.G132G|SEPT4_ENST00000580791.1_5'Flank|RP11-112H10.4_ENST00000578022.1_RNA|SEPT4_ENST00000393086.1_Splice_Site_p.G132G|SEPT4_ENST00000457347.2_Splice_Site_p.G166G|SEPT4_ENST00000580809.1_Splice_Site_p.G33G|SEPT4_ENST00000583114.1_Splice_Site_p.G4G|SEPT4_ENST00000579371.1_Splice_Site_p.G52G|SEPT4_ENST00000580844.1_Splice_Site_p.G52G|RP11-112H10.4_ENST00000580769.1_RNA|SEPT4_ENST00000412945.3_Splice_Site_p.G143G	NM_004574.3	NP_004565.1	O43236	SEPT4_HUMAN	septin 4	151	Septin-type G.				apoptotic process (GO:0006915)|brain development (GO:0007420)|cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein ubiquitination (GO:0031398)|regulation of apoptotic process (GO:0042981)|sperm capacitation (GO:0048240)|sperm mitochondrion organization (GO:0030382)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm annulus (GO:0097227)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	18	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GGCCAGACTCTCCTGAGAGGA	0.493																																					p.G166G		.											.	SEPT4	68	0			c.A498G						.						72.0	64.0	67.0					17																	56603141		2203	4300	6503	SO:0001630	splice_region_variant	5414	exon5			AGACTCTCCTGAG	AF073312	CCDS11609.1, CCDS11610.1, CCDS45743.1, CCDS56041.1, CCDS58581.1, CCDS58582.1	17q22	2013-01-21	2005-01-11	2005-01-12	ENSG00000108387	ENSG00000108387		"""Septins"""	9165	protein-coding gene	gene with protein product	"""bradeoin"", ""septin-M"""	603696	"""peanut-like 2 (Drosophila)"""	PNUTL2		9889007	Standard	NM_001198713		Approved	H5, CE5B3, hucep-7, ARTS, hCDCREL-2, MART	uc002iwm.2	O43236		ENST00000317268.3:c.452-1A>G	17.37:g.56603141T>C		80.0	0.0		58.0	4.0	NM_001256782	B2RD42|B3KSX9|B4DXC6|B4DXV5|Q6IAP3|Q9H315|Q9UM58	Silent	SNP	ENST00000317268.3	37	CCDS11610.1																																																																																			.		0.493	SEPT4-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445420.1	NM_080417	Silent
SGK3	23678	hgsc.bcm.edu;bcgsc.ca	37	8	67752280	67752280	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr8:67752280A>G	ENST00000396596.1	+	11	998	c.784A>G	c.(784-786)Aga>Gga	p.R262G	SGK3_ENST00000521435.1_3'UTR|SGK3_ENST00000520976.1_Missense_Mutation_p.R262G|SGK3_ENST00000522398.1_Missense_Mutation_p.R262G|SGK3_ENST00000345714.4_Missense_Mutation_p.R262G|SGK3_ENST00000521198.2_Missense_Mutation_p.R262G|C8orf44-SGK3_ENST00000519289.1_Missense_Mutation_p.R262G	NM_013257.4	NP_037389.4	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase family, member 3	262	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ion transmembrane transport (GO:0034220)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to stress (GO:0006950)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|phosphatidylinositol binding (GO:0035091)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	18	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TCCTGAGCACAGAGCTAGGTT	0.383																																					p.R262G		.											.	SGK3	1003	0			c.A784G						.						129.0	113.0	119.0					8																	67752280		2203	4300	6503	SO:0001583	missense	23678	exon11			GAGCACAGAGCTA		CCDS6195.1, CCDS6196.1	8q12	2008-07-28	2005-09-13	2005-09-13		ENSG00000104205			10812	protein-coding gene	gene with protein product		607591	"""serum/glucocorticoid regulated kinase-like"""	SGK2, SGKL		10585774, 10548550	Standard	NM_013257		Approved		uc003xwr.3	Q96BR1		ENST00000396596.1:c.784A>G	8.37:g.67752280A>G	ENSP00000379842:p.Arg262Gly	85.0	0.0		75.0	4.0	NM_001033578	A8K5W3|B3KQC2|Q9P1Q7|Q9UKG5	Missense_Mutation	SNP	ENST00000396596.1	37	CCDS6195.1	.	.	.	.	.	.	.	.	.	.	A	14.97	2.693556	0.48202	.	.	ENSG00000104205	ENST00000519289;ENST00000521198;ENST00000262211;ENST00000522398;ENST00000520976;ENST00000396596;ENST00000345714;ENST00000521152	T;T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	5.29	4.12	0.48240	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74435	0.3716	L	0.60455	1.87	0.49582	D	0.999809	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80768	-0.1235	9	0.87932	D	0	.	12.3914	0.55360	0.8591:0.1409:0.0:0.0	.	262;262	Q96BR1-2;Q96BR1	.;SGK3_HUMAN	G	262;262;262;262;262;262;262;159	ENSP00000429022:R262G;ENSP00000430463:R262G;ENSP00000430256:R262G;ENSP00000430691:R262G;ENSP00000379842:R262G;ENSP00000331816:R262G;ENSP00000429565:R159G	ENSP00000262211:R262G	R	+	1	2	SGK3	67914834	1.000000	0.71417	0.997000	0.53966	0.090000	0.18270	7.234000	0.78134	0.813000	0.34350	-0.321000	0.08615	AGA	.		0.383	SGK3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379232.3		
SGOL2	151246	hgsc.bcm.edu;bcgsc.ca	37	2	201437542	201437542	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:201437542A>G	ENST00000357799.4	+	7	2571	c.2473A>G	c.(2473-2475)Ata>Gta	p.I825V		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	825					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						AACCAACCAAATATATGAGAA	0.323																																					p.I825V		.											.	SGOL2	94	0			c.A2473G						.						90.0	87.0	88.0					2																	201437542		1830	4085	5915	SO:0001583	missense	151246	exon7			AACCAAATATATG	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.2473A>G	2.37:g.201437542A>G	ENSP00000350447:p.Ile825Val	116.0	0.0		119.0	5.0	NM_001160046	Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Missense_Mutation	SNP	ENST00000357799.4	37	CCDS42796.1	.	.	.	.	.	.	.	.	.	.	A	0.141	-1.101785	0.01828	.	.	ENSG00000163535	ENST00000357799	T	0.14766	2.48	5.0	1.3	0.21679	.	0.530450	0.18477	N	0.140028	T	0.13927	0.0337	M	0.69823	2.125	0.09310	N	1	B;B;B	0.20887	0.049;0.018;0.007	B;B;B	0.10450	0.005;0.005;0.003	T	0.21245	-1.0251	10	0.31617	T	0.26	-0.2792	6.9476	0.24528	0.7311:0.0:0.2689:0.0	.	825;825;825	B7Z7S9;Q562F6-2;Q562F6	.;.;SGOL2_HUMAN	V	825	ENSP00000350447:I825V	ENSP00000350447:I825V	I	+	1	0	SGOL2	201145787	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.168000	0.09925	0.136000	0.18733	-0.359000	0.07587	ATA	.		0.323	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335834.1	NM_152524	
SLC17A6	57084	hgsc.bcm.edu;bcgsc.ca	37	11	22381052	22381052	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:22381052A>G	ENST00000263160.3	+	4	989	c.552A>G	c.(550-552)agA>agG	p.R184R	CTD-2140G10.4_ENST00000534543.1_RNA	NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	184					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						TCTTTGTCAGAATACTGCAGG	0.408																																					p.R184R		.											.	SLC17A6	580	0			c.A552G						.						148.0	133.0	138.0					11																	22381052		2203	4300	6503	SO:0001819	synonymous_variant	57084	exon4			TGTCAGAATACTG	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.552A>G	11.37:g.22381052A>G		139.0	0.0		96.0	4.0	NM_020346	A6NKS2	Silent	SNP	ENST00000263160.3	37	CCDS7856.1																																																																																			.		0.408	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346	
SLC24A3	57419	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	19698204	19698204	+	Silent	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr20:19698204C>T	ENST00000328041.6	+	16	1949	c.1752C>T	c.(1750-1752)tcC>tcT	p.S584S		NM_020689.3	NP_065740.2	Q9HC58	NCKX3_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3	584					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TGATCTACTCCGTAGGCTTGC	0.507																																					p.S584S		.											.	SLC24A3	91	0			c.C1752T						.						293.0	289.0	290.0					20																	19698204		2203	4300	6503	SO:0001819	synonymous_variant	57419	exon16			CTACTCCGTAGGC	AF169257	CCDS13140.1	20p13	2013-05-22			ENSG00000185052	ENSG00000185052		"""Solute carriers"""	10977	protein-coding gene	gene with protein product		609839					Standard	NM_020689		Approved		uc002wrl.3	Q9HC58	OTTHUMG00000031993	ENST00000328041.6:c.1752C>T	20.37:g.19698204C>T		235.0	0.0		241.0	103.0	NM_020689	B1AKV7|Q9BQJ9|Q9BQL7|Q9BQY3|Q9H519	Silent	SNP	ENST00000328041.6	37	CCDS13140.1																																																																																			.		0.507	SLC24A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078207.4	NM_020689	
SLC7A13	157724	hgsc.bcm.edu;bcgsc.ca	37	8	87242258	87242258	+	Silent	SNP	A	A	G	rs141043236	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr8:87242258A>G	ENST00000297524.3	-	1	352	c.249T>C	c.(247-249)ttT>ttC	p.F83F	SLC7A13_ENST00000419776.2_Silent_p.F83F|SLC7A13_ENST00000520624.1_Intron	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	83						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						ATCTCTTGAGAAAATAGTATT	0.488													A|||	17	0.00339457	0.0129	0.0	5008	,	,		19105	0.0		0.0	False		,,,				2504	0.0				p.F83F		.											.	SLC7A13	90	0			c.T249C						.	A		59,4347	56.2+/-92.4	2,55,2146	61.0	59.0	59.0		249	0.2	0.0	8	dbSNP_134	59	0,8600		0,0,4300	no	coding-synonymous	SLC7A13	NM_138817.2		2,55,6446	GG,GA,AA		0.0,1.3391,0.4536		83/471	87242258	59,12947	2203	4300	6503	SO:0001819	synonymous_variant	157724	exon1			CTTGAGAAAATAG	AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.249T>C	8.37:g.87242258A>G		53.0	0.0		87.0	4.0	NM_138817	Q05C37|Q08AH9|Q96N84	Silent	SNP	ENST00000297524.3	37	CCDS34917.1																																																																																			A|0.996;G|0.004		0.488	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374704.1	NM_138817	
SLCO1B3	28234	hgsc.bcm.edu;bcgsc.ca	37	12	21068948	21068948	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:21068948T>C	ENST00000381545.3	+	16	2095	c.1876T>C	c.(1876-1878)Ttg>Ctg	p.L626L	SLCO1B7_ENST00000554957.1_Intron|LST3_ENST00000540229.1_Intron|SLCO1B3_ENST00000261196.2_Silent_p.L626L|LST3_ENST00000381541.3_Intron|SLCO1B3_ENST00000553473.1_Intron	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	626					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	AAGGGTCTACTTGGGCTTATC	0.299																																					p.L626L		.											.	SLCO1B3	155	0			c.T1876C						.						77.0	77.0	77.0					12																	21068948		2201	4299	6500	SO:0001819	synonymous_variant	28234	exon16			GTCTACTTGGGCT		CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.1876T>C	12.37:g.21068948T>C		59.0	0.0		58.0	5.0	NM_019844	E7EMT8|Q5JAR4	Silent	SNP	ENST00000381545.3	37	CCDS8684.1																																																																																			.		0.299	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401936.1	NM_019844	
SLITRK2	84631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	144905987	144905987	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:144905987G>A	ENST00000370490.1	+	1	6299	c.2044G>A	c.(2044-2046)Ggc>Agc	p.G682S	SLITRK2_ENST00000413937.2_Missense_Mutation_p.G682S|SLITRK2_ENST00000447897.2_Missense_Mutation_p.G682S|SLITRK2_ENST00000434188.2_Missense_Mutation_p.G682S|TMEM257_ENST00000408967.2_5'Flank|SLITRK2_ENST00000428560.2_Missense_Mutation_p.G682S			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	682					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TAAAACAGACGGCCATGTCTA	0.488																																					p.G682S		.											.	SLITRK2	136	0			c.G2044A						.						76.0	68.0	71.0					X																	144905987		2203	4300	6503	SO:0001583	missense	84631	exon5			ACAGACGGCCATG	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.2044G>A	X.37:g.144905987G>A	ENSP00000359521:p.Gly682Ser	57.0	0.0		51.0	43.0	NM_001144005	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.073220	0.36566	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.55413	0.62;0.52;0.52;0.52;0.52;0.52	5.67	5.67	0.87782	.	0.294597	0.36815	N	0.002391	T	0.45034	0.1322	L	0.55990	1.75	0.30799	N	0.74006	B	0.32396	0.369	B	0.26202	0.067	T	0.48340	-0.9044	10	0.10636	T	0.68	-9.5346	16.0092	0.80385	0.0:0.0:1.0:0.0	.	682	Q9H156	SLIK2_HUMAN	S	682	ENSP00000334374:G682S;ENSP00000411681:G682S;ENSP00000359521:G682S;ENSP00000397015:G682S;ENSP00000407347:G682S;ENSP00000412010:G682S	ENSP00000334374:G682S	G	+	1	0	SLITRK2	144713679	1.000000	0.71417	0.952000	0.39060	0.919000	0.55068	3.575000	0.53870	2.380000	0.81148	0.600000	0.82982	GGC	.		0.488	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
SNAP91	9892	hgsc.bcm.edu;bcgsc.ca	37	6	84371275	84371275	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:84371275T>C	ENST00000439399.2	-	5	714	c.398A>G	c.(397-399)gAa>gGa	p.E133G	SNAP91_ENST00000195649.6_Missense_Mutation_p.E133G|SNAP91_ENST00000521485.1_Missense_Mutation_p.E133G|SNAP91_ENST00000520213.1_Missense_Mutation_p.E133G|SNAP91_ENST00000428679.2_Missense_Mutation_p.E133G|SNAP91_ENST00000437520.1_Missense_Mutation_p.E133G|SNAP91_ENST00000369694.2_Missense_Mutation_p.E133G|SNAP91_ENST00000521743.1_Missense_Mutation_p.E133G|SNAP91_ENST00000520302.1_Missense_Mutation_p.E133G	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	133	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		AAAAGCCTTTTCATTCAAATA	0.328																																					p.E133G		.											.	SNAP91	23	0			c.A398G						.						57.0	56.0	56.0					6																	84371275		1808	4070	5878	SO:0001583	missense	9892	exon5			GCCTTTTCATTCA	AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.398A>G	6.37:g.84371275T>C	ENSP00000400459:p.Glu133Gly	134.0	0.0		72.0	4.0	NM_001242794	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	ENST00000439399.2	37	CCDS47455.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.679502	0.88542	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000521931;ENST00000519779;ENST00000518309;ENST00000369690	T;T;T;T;T;T;T;T;T;T;T;T;T	0.37235	1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21	5.13	5.13	0.70059	ENTH/VHS (2);ANTH (1);Epsin-like, N-terminal (2);	0.099801	0.64402	D	0.000002	T	0.65037	0.2653	H	0.94847	3.59	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.996;1.0	D;D;D;D	0.83275	0.996;0.995;0.921;0.995	T	0.77000	-0.2750	10	0.87932	D	0	-16.6735	15.2297	0.73378	0.0:0.0:0.0:1.0	.	133;133;133;133	O60641-3;E5RI02;O60641;E1P549	.;.;AP180_HUMAN;.	G	133	ENSP00000429776:E133G;ENSP00000358708:E133G;ENSP00000400459:E133G;ENSP00000195649:E133G;ENSP00000412492:E133G;ENSP00000413277:E133G;ENSP00000428511:E133G;ENSP00000428215:E133G;ENSP00000428026:E133G;ENSP00000430071:E133G;ENSP00000429429:E133G;ENSP00000430441:E133G;ENSP00000358704:E133G	ENSP00000195649:E133G	E	-	2	0	SNAP91	84427994	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.932000	0.87634	2.056000	0.61249	0.460000	0.39030	GAA	.		0.328	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375296.1		
SNX3	8724	hgsc.bcm.edu;bcgsc.ca	37	6	108544209	108544209	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:108544209C>T	ENST00000230085.8	-	2	541	c.203G>A	c.(202-204)aGa>aAa	p.R68K	SNX3_ENST00000349379.5_Missense_Mutation_p.R46K|SNX3_ENST00000368982.4_Missense_Mutation_p.R68K|SNX3_ENST00000426155.2_Intron	NM_003795.4	NP_003786.1	O60493	SNX3_HUMAN	sorting nexin 3	68	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				hemoglobin biosynthetic process (GO:0042541)|intracellular protein transport (GO:0006886)|intralumenal vesicle formation (GO:0070676)|membrane invagination (GO:0010324)|negative regulation of early endosome to late endosome transport (GO:2000642)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein transport (GO:0051224)|negative regulation of viral entry into host cell (GO:0046597)|regulation of cellular protein metabolic process (GO:0032268)|regulation of intracellular protein transport (GO:0033157)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein phosphatase binding (GO:0019903)			large_intestine(1)	1		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0136)|Epithelial(106;0.0564)|OV - Ovarian serous cystadenocarcinoma(136;0.0717)|all cancers(137;0.0743)		GTATCTTCTTCTAACAGTAGA	0.328																																					p.R68K		.											.	SNX3	226	0			c.G203A						.						85.0	78.0	80.0					6																	108544209		2203	4297	6500	SO:0001583	missense	8724	exon2			CTTCTTCTAACAG	AF034546	CCDS5064.1, CCDS5065.1, CCDS75501.1	6q21	2010-08-05			ENSG00000112335	ENSG00000112335		"""Sorting nexins"""	11174	protein-coding gene	gene with protein product		605930				9819414	Standard	XM_005267192		Approved	Grd19	uc003psh.3	O60493	OTTHUMG00000015323	ENST00000230085.8:c.203G>A	6.37:g.108544209C>T	ENSP00000230085:p.Arg68Lys	71.0	0.0		50.0	4.0	NM_003795	A8K0B1|E1P5E4|E1P5E5|O60718|Q4TT29|Q4TT31|Q5JXJ7|Q5JXJ8|Q96AP9|Q9C0J5|Q9NU45	Missense_Mutation	SNP	ENST00000230085.8	37	CCDS5064.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.044505	0.75732	.	.	ENSG00000112335	ENST00000230085;ENST00000349379;ENST00000368982	T;T;T	0.36699	1.24;1.24;1.24	6.08	6.08	0.98989	Phox homologous domain (5);	0.129957	0.64402	D	0.000004	T	0.31136	0.0787	M	0.64080	1.96	0.80722	D	1	B	0.09022	0.002	B	0.28991	0.097	T	0.06899	-1.0801	10	0.29301	T	0.29	-16.5963	20.6647	0.99678	0.0:1.0:0.0:0.0	.	68	O60493	SNX3_HUMAN	K	68;46;68	ENSP00000230085:R68K;ENSP00000296991:R46K;ENSP00000357978:R68K	ENSP00000230085:R68K	R	-	2	0	SNX3	108650902	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.800000	0.62524	2.890000	0.99128	0.655000	0.94253	AGA	.		0.328	SNX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041717.1		
SRRM1	10250	hgsc.bcm.edu;bcgsc.ca	37	1	24997900	24997900	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:24997900A>G	ENST00000323848.9	+	16	2739	c.2424A>G	c.(2422-2424)ggA>ggG	p.G808G	SRRM1_ENST00000447431.2_Silent_p.G820G|SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000374389.4_Silent_p.G817G	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	808					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		AAGGAGGTGGAaagaaaaaga	0.358																																					p.G808G	Ovarian(68;897 1494 3282 17478)	.											.	SRRM1	93	0			c.A2424G						.						40.0	42.0	41.0					1																	24997900		2203	4300	6503	SO:0001819	synonymous_variant	10250	exon16			AGGTGGAAAGAAA	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.2424A>G	1.37:g.24997900A>G		100.0	0.0		66.0	4.0	NM_005839	O60585|Q5VVN4	Silent	SNP	ENST00000323848.9	37	CCDS255.1																																																																																			.		0.358	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	
STARD8	9754	hgsc.bcm.edu;bcgsc.ca	37	X	67937131	67937131	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:67937131T>C	ENST00000252336.6	+	5	507	c.135T>C	c.(133-135)tcT>tcC	p.S45S	STARD8_ENST00000374599.3_Silent_p.S125S|STARD8_ENST00000374597.3_Silent_p.S45S	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	45					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						AGTGCTGGTCTCCTATGGGGT	0.577																																					p.S125S		.											.	STARD8	196	0			c.T375C						.						72.0	42.0	52.0					X																	67937131		2203	4300	6503	SO:0001819	synonymous_variant	9754	exon6			CTGGTCTCCTATG	D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.135T>C	X.37:g.67937131T>C		96.0	0.0		78.0	4.0	NM_001142503	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Silent	SNP	ENST00000252336.6	37	CCDS14390.1																																																																																			.		0.577	STARD8-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057026.2	NM_014725	
STK17B	9262	hgsc.bcm.edu;bcgsc.ca	37	2	197021354	197021354	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:197021354T>C	ENST00000263955.4	-	3	430	c.144A>G	c.(142-144)agA>agG	p.R48R	RP11-347P5.1_ENST00000606818.1_RNA|STK17B_ENST00000409228.1_Silent_p.R48R	NM_004226.3	NP_004217.1	O94768	ST17B_HUMAN	serine/threonine kinase 17b	48	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(10)	15			OV - Ovarian serous cystadenocarcinoma(117;0.141)			ATATACATTGTCTAACCACAG	0.348																																					p.R48R		.											.	STK17B	334	0			c.A144G						.						85.0	88.0	87.0					2																	197021354		2203	4300	6503	SO:0001819	synonymous_variant	9262	exon3			ACATTGTCTAACC	AB011421	CCDS2315.1	2q33.1	2008-02-05	2007-02-12		ENSG00000081320	ENSG00000081320			11396	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 2"""	604727	"""serine/threonine kinase 17b (apoptosis-inducing)"""			9786912	Standard	NM_004226		Approved	DRAK2	uc002utk.3	O94768	OTTHUMG00000132735	ENST00000263955.4:c.144A>G	2.37:g.197021354T>C		102.0	0.0		98.0	4.0	NM_004226		Silent	SNP	ENST00000263955.4	37	CCDS2315.1																																																																																			.		0.348	STK17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256092.2		
SYNE1	23345	hgsc.bcm.edu;bcgsc.ca	37	6	152763360	152763360	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:152763360T>C	ENST00000367255.5	-	31	4459	c.3858A>G	c.(3856-3858)tcA>tcG	p.S1286S	SYNE1_ENST00000423061.1_Silent_p.S1293S|SYNE1_ENST00000367253.4_Silent_p.S1286S|SYNE1_ENST00000413186.2_Silent_p.S1286S|SYNE1_ENST00000448038.1_Silent_p.S1293S|SYNE1_ENST00000341594.5_Silent_p.S1352S|SYNE1_ENST00000367248.3_Silent_p.S1276S|SYNE1_ENST00000265368.4_Silent_p.S1286S	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1286					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTTCTTTGCTGAGATCCGCT	0.522										HNSCC(10;0.0054)																											p.S1293S		.											.	SYNE1	607	0			c.A3879G						.						78.0	68.0	71.0					6																	152763360		2203	4300	6503	SO:0001819	synonymous_variant	23345	exon31			CTTTGCTGAGATC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3858A>G	6.37:g.152763360T>C		107.0	0.0		73.0	4.0	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																			.		0.522	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNE2	23224	hgsc.bcm.edu;bcgsc.ca	37	14	64641759	64641759	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:64641759A>G	ENST00000344113.4	+	95	17545	c.17333A>G	c.(17332-17334)gAg>gGg	p.E5778G	SYNE2_ENST00000358025.3_Missense_Mutation_p.E5778G|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000357395.3_Missense_Mutation_p.E2163G|SYNE2_ENST00000394768.2_Missense_Mutation_p.E2163G|SYNE2_ENST00000554584.1_Missense_Mutation_p.E5643G|SYNE2_ENST00000555002.1_Missense_Mutation_p.E2412G	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5778					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAAACTAAAGAGTCTGTGGGT	0.453																																					p.E5778G		.											.	SYNE2	164	0			c.A17333G						.						110.0	111.0	111.0					14																	64641759		2203	4300	6503	SO:0001583	missense	23224	exon95			CTAAAGAGTCTGT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.17333A>G	14.37:g.64641759A>G	ENSP00000341781:p.Glu5778Gly	96.0	0.0		59.0	4.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	A	11.81	1.749142	0.30955	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.58060	1.22;1.22;1.22;0.36;1.22;1.22	5.58	4.41	0.53225	.	0.407306	0.21011	N	0.081689	T	0.50086	0.1595	M	0.62723	1.935	0.24361	N	0.994872	B;B;B;B;B	0.31077	0.009;0.001;0.073;0.012;0.307	B;B;B;B;B	0.30572	0.025;0.003;0.037;0.018;0.117	T	0.45775	-0.9238	10	0.46703	T	0.11	.	12.3724	0.55261	0.6757:0.3243:0.0:0.0	.	2163;166;5643;5778;5778	Q8WXH0-7;Q7Z362;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;.;SYNE2_HUMAN;.	G	5778;2163;5778;5643;5649;2412;2163	ENSP00000350719:E5778G;ENSP00000349969:E2163G;ENSP00000341781:E5778G;ENSP00000452570:E5643G;ENSP00000450831:E2412G;ENSP00000378249:E2163G	ENSP00000261678:E5649G	E	+	2	0	SYNE2	63711512	0.925000	0.31364	0.494000	0.27515	0.024000	0.10985	2.650000	0.46665	1.011000	0.39340	0.482000	0.46254	GAG	.		0.453	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
TAS1R2	80834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	19186095	19186095	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:19186095C>G	ENST00000375371.3	-	1	81	c.60G>C	c.(58-60)gaG>gaC	p.E20D	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	20					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	TCTCAGCCGGCTCAGCCAGGA	0.577																																					p.E20D		.											.	TAS1R2	93	0			c.G60C						.						120.0	111.0	114.0					1																	19186095		2203	4300	6503	SO:0001583	missense	80834	exon1			AGCCGGCTCAGCC		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.60G>C	1.37:g.19186095C>G	ENSP00000364520:p.Glu20Asp	186.0	0.0		135.0	90.0	NM_152232	Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	CCDS187.1	.	.	.	.	.	.	.	.	.	.	C	12.20	1.866326	0.32977	.	.	ENSG00000179002	ENST00000375371	D	0.88896	-2.44	4.47	2.58	0.30949	.	.	.	.	.	T	0.79511	0.4458	L	0.40543	1.245	0.09310	N	1	P	0.38922	0.651	B	0.32677	0.15	T	0.64241	-0.6454	9	0.14656	T	0.56	.	7.1459	0.25583	0.0:0.7855:0.0:0.2145	.	20	Q8TE23	TS1R2_HUMAN	D	20	ENSP00000364520:E20D	ENSP00000364520:E20D	E	-	3	2	TAS1R2	19058682	0.000000	0.05858	0.001000	0.08648	0.082000	0.17680	0.321000	0.19558	0.446000	0.26666	0.313000	0.20887	GAG	.		0.577	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
TENM2	57451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	167689611	167689611	+	Silent	SNP	C	C	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:167689611C>G	ENST00000518659.1	+	29	8160	c.8121C>G	c.(8119-8121)gcC>gcG	p.A2707A	TENM2_ENST00000520394.1_Silent_p.A2468A|TENM2_ENST00000545108.1_Silent_p.A2706A|TENM2_ENST00000403607.2_Silent_p.A2531A|TENM2_ENST00000519204.1_Silent_p.A2586A	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2707					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										TGGGCACGGCCTGGGCCAAGG	0.687																																					p.A2698A		.											.	.	.	0			c.C8094G						.						11.0	12.0	12.0					5																	167689611		1984	4145	6129	SO:0001819	synonymous_variant	57451	exon29			CACGGCCTGGGCC	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.8121C>G	5.37:g.167689611C>G		60.0	0.0		63.0	26.0	NM_001122679	Q9ULU2	Silent	SNP	ENST00000518659.1	37																																																																																				.		0.687	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
TEP1	7011	hgsc.bcm.edu;bcgsc.ca	37	14	20859791	20859791	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:20859791T>C	ENST00000262715.5	-	13	2104	c.2064A>G	c.(2062-2064)gcA>gcG	p.A688A	TEP1_ENST00000556935.1_Silent_p.A580A	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	688					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		AGAGCCTGTCTGCATTAGCAT	0.542																																					p.A688A		.											.	TEP1	95	0			c.A2064G						.						150.0	131.0	137.0					14																	20859791		2203	4300	6503	SO:0001819	synonymous_variant	7011	exon13			CCTGTCTGCATTA		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.2064A>G	14.37:g.20859791T>C		149.0	0.0		72.0	4.0	NM_007110	A0AUV9	Silent	SNP	ENST00000262715.5	37	CCDS9548.1																																																																																			.		0.542	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
TEX14	56155	hgsc.bcm.edu;bcgsc.ca	37	17	56638968	56638968	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:56638968T>C	ENST00000240361.8	-	30	4293	c.4208A>G	c.(4207-4209)cAc>cGc	p.H1403R	TEX14_ENST00000584699.1_5'UTR|TEX14_ENST00000349033.5_Missense_Mutation_p.H1357R|TEX14_ENST00000389934.3_Missense_Mutation_p.H1397R			Q8IWB6	TEX14_HUMAN	testis expressed 14	1403					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CAGAGTAGAGTGAGCTCTGTT	0.483																																					p.H1403R		.											.	TEX14	810	0			c.A4208G						.						116.0	111.0	113.0					17																	56638968		2203	4300	6503	SO:0001583	missense	56155	exon30			GTAGAGTGAGCTC	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.4208A>G	17.37:g.56638968T>C	ENSP00000240361:p.His1403Arg	114.0	0.0		109.0	5.0	NM_001201457	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	37	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	T	18.39	3.612708	0.66672	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.25085	1.82;1.82;1.82	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000012	T	0.46405	0.1391	M	0.63843	1.955	0.34185	D	0.671351	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.998	T	0.61917	-0.6964	10	0.87932	D	0	-6.7257	11.1812	0.48629	0.0:0.0:0.0:1.0	.	1403;1357;1397	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	R	1403;1397;1357	ENSP00000240361:H1403R;ENSP00000374584:H1397R;ENSP00000268910:H1357R	ENSP00000240361:H1403R	H	-	2	0	TEX14	53993967	1.000000	0.71417	0.994000	0.49952	0.979000	0.70002	3.662000	0.54510	2.143000	0.66587	0.533000	0.62120	CAC	.		0.483	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1		
TMEFF2	23671	hgsc.bcm.edu;bcgsc.ca	37	2	193056689	193056689	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:193056689A>G	ENST00000272771.5	-	2	1383	c.199T>C	c.(199-201)Ttc>Ctc	p.F67L	TMEFF2_ENST00000392314.1_Missense_Mutation_p.F67L|TMEFF2_ENST00000409056.3_Missense_Mutation_p.F67L	NM_016192.2	NP_057276.2	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 2	67						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(12)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			TCACAGAGGAAGAGATCATTT	0.348																																					p.F67L	Pancreas(50;1277 1381 28487 47072)	.											.	TMEFF2	524	0			c.T199C						.						91.0	87.0	89.0					2																	193056689		2203	4300	6503	SO:0001583	missense	23671	exon2			AGAGGAAGAGATC	AB017269	CCDS2314.1	2q32.3	2010-05-04			ENSG00000144339	ENSG00000144339			11867	protein-coding gene	gene with protein product	"""transmembrane protein TENB2"", ""tomoregulin"", ""cancer/testis antigen family 120, member 2"""	605734				10903839	Standard	NM_016192		Approved	TENB2, HPP1, TR, TPEF, CT120.2	uc002utc.3	Q9UIK5	OTTHUMG00000132723	ENST00000272771.5:c.199T>C	2.37:g.193056689A>G	ENSP00000272771:p.Phe67Leu	86.0	0.0		91.0	4.0	NM_016192	Q2FA44|Q4ZFW4|Q53H90|Q53RE1|Q8N2R5|Q9NR15|Q9NSS5|Q9P2Y9|Q9UK65	Missense_Mutation	SNP	ENST00000272771.5	37	CCDS2314.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.137932	0.77775	.	.	ENSG00000144339	ENST00000392314;ENST00000272771;ENST00000409056	T;T;T	0.67865	0.34;0.33;-0.29	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.76198	0.3954	L	0.54323	1.7	0.58432	D	0.999999	D;P	0.71674	0.998;0.863	D;P	0.63283	0.913;0.53	T	0.72972	-0.4129	10	0.27785	T	0.31	-15.4577	16.5655	0.84588	1.0:0.0:0.0:0.0	.	67;67	Q9UIK5-3;Q9UIK5	.;TEFF2_HUMAN	L	67	ENSP00000376128:F67L;ENSP00000272771:F67L;ENSP00000386871:F67L	ENSP00000272771:F67L	F	-	1	0	TMEFF2	192764934	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.801000	0.75170	2.302000	0.77476	0.533000	0.62120	TTC	.		0.348	TMEFF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256065.2	NM_016192	
TMF1	7110	hgsc.bcm.edu;bcgsc.ca	37	3	69079080	69079080	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:69079080T>C	ENST00000398559.2	-	11	2696	c.2480A>G	c.(2479-2481)cAg>cGg	p.Q827R	CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000599467.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA|TMF1_ENST00000543976.1_Missense_Mutation_p.Q830R|CTD-2013N24.2_ENST00000597366.1_RNA|CTD-2013N24.2_ENST00000601511.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	827					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		GGAAGACATCTGAATTTTGTT	0.423																																					p.Q827R		.											.	TMF1	90	0			c.A2480G						.						156.0	154.0	155.0					3																	69079080		1890	4120	6010	SO:0001583	missense	7110	exon11			GACATCTGAATTT		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.2480A>G	3.37:g.69079080T>C	ENSP00000381567:p.Gln827Arg	132.0	0.0		77.0	4.0	NM_007114	B7ZLJ2|Q17R87|Q59GK0	Missense_Mutation	SNP	ENST00000398559.2	37	CCDS43105.1	.	.	.	.	.	.	.	.	.	.	T	13.86	2.362304	0.41902	.	.	ENSG00000144747	ENST00000398559;ENST00000543976;ENST00000356248	T;T	0.43294	0.95;0.95	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.35038	0.0918	L	0.34521	1.04	0.80722	D	1	P;P	0.42518	0.782;0.726	B;B	0.43413	0.419;0.259	T	0.08889	-1.0700	10	0.07644	T	0.81	-10.1573	15.8852	0.79241	0.0:0.0:0.0:1.0	.	830;827	P82094-2;P82094	.;TMF1_HUMAN	R	827;830;743	ENSP00000381567:Q827R;ENSP00000438706:Q830R	ENSP00000348582:Q743R	Q	-	2	0	TMF1	69161770	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	7.694000	0.84235	2.146000	0.66826	0.477000	0.44152	CAG	.		0.423	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7579349	7579349	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:7579349A>C	ENST00000269305.4	-	4	527	c.338T>G	c.(337-339)tTc>tGc	p.F113C	TP53_ENST00000420246.2_Missense_Mutation_p.F113C|TP53_ENST00000455263.2_Missense_Mutation_p.F113C|TP53_ENST00000445888.2_Missense_Mutation_p.F113C|TP53_ENST00000413465.2_Missense_Mutation_p.F113C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.F113C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	113	Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> G (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|F -> I (in a sporadic cancer; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F113C(11)|p.0?(8)|p.F113S(4)|p.G59fs*23(3)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.G112fs*9(1)|p.F113del(1)|p.Y107fs*44(1)|p.G112_S116delGFLHS(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGAATGCAAGAAGCCCAGACG	0.607		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.F113C	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,brain,glioma,-1	TP53	70225	35	Substitution - Missense(15)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(4)	upper_aerodigestive_tract(6)|lung(5)|large_intestine(4)|bone(4)|central_nervous_system(3)|ovary(3)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|breast(2)|stomach(1)|liver(1)|oesophagus(1)|autonomic_ganglia(1)	c.T338G						.						65.0	61.0	62.0					17																	7579349		2203	4300	6503	SO:0001583	missense	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TGCAAGAAGCCCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.338T>G	17.37:g.7579349A>C	ENSP00000269305:p.Phe113Cys	200.0	0.0		137.0	84.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	18.70	3.680367	0.68042	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99867	-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31	4.75	4.75	0.60458	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99854	0.9932	M	0.89414	3.03	0.52099	D	0.999945	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.995;1.0;1.0;1.0	D	0.96472	0.9349	10	0.87932	D	0	-31.6488	12.5363	0.56144	1.0:0.0:0.0:0.0	.	74;113;113;113;113;113;113	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	113	ENSP00000410739:F113C;ENSP00000352610:F113C;ENSP00000269305:F113C;ENSP00000398846:F113C;ENSP00000391127:F113C;ENSP00000391478:F113C;ENSP00000424104:F113C;ENSP00000426252:F113C	ENSP00000269305:F113C	F	-	2	0	TP53	7520074	1.000000	0.71417	0.986000	0.45419	0.960000	0.62799	5.450000	0.66626	2.125000	0.65367	0.533000	0.62120	TTC	.		0.607	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRIM16L	147166	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	18638692	18638692	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:18638692G>T	ENST00000449552.2	+	7	2450	c.966G>T	c.(964-966)aaG>aaT	p.K322N	TRIM16L_ENST00000414850.2_3'UTR|TRIM16L_ENST00000395672.2_Missense_Mutation_p.K322N|TRIM16L_ENST00000395902.3_Missense_Mutation_p.K376N|TRIM16L_ENST00000395671.4_Missense_Mutation_p.K322N|TRIM16L_ENST00000571708.1_Missense_Mutation_p.K322N|TRIM16L_ENST00000572555.1_Missense_Mutation_p.K322N			Q309B1	TR16L_HUMAN	tripartite motif containing 16-like	322	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)	9						GGCTTTCCAAGAAGGAAAACG	0.517																																					p.K322N		.											.	TRIM16L	90	0			c.G966T						.						50.0	50.0	50.0					17																	18638692		2203	4300	6503	SO:0001583	missense	147166	exon5			TTCCAAGAAGGAA	DQ232882	CCDS32588.1	17p11.2	2011-02-10	2011-01-25		ENSG00000108448	ENSG00000108448			32670	protein-coding gene	gene with protein product			"""tripartite motif-containing 16-like"""				Standard	XM_005256479		Approved	TRIM70	uc002gui.1	Q309B1	OTTHUMG00000059050	ENST00000449552.2:c.966G>T	17.37:g.18638692G>T	ENSP00000461386:p.Lys322Asn	161.0	0.0		182.0	74.0	NM_001037330	A0PK10|B2RUW6|B4DQK2|B4DWQ8	Missense_Mutation	SNP	ENST00000449552.2	37	CCDS32588.1	.	.	.	.	.	.	.	.	.	.	g	12.62	1.991570	0.35131	.	.	ENSG00000108448	ENST00000395902;ENST00000395672;ENST00000395671	T;T;T	0.69175	-0.38;-0.38;-0.38	3.35	2.37	0.29283	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.135643	0.49305	U	0.000141	T	0.70842	0.3270	L	0.43554	1.36	0.40720	D	0.982651	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.66945	-0.5795	10	0.34782	T	0.22	-22.435	8.3174	0.32108	0.1242:0.0:0.8758:0.0	.	376;538;322	B4DE22;B3KMJ2;Q309B1	.;.;TR16L_HUMAN	N	376;322;322	ENSP00000379239:K376N;ENSP00000379031:K322N;ENSP00000379030:K322N	ENSP00000379030:K322N	K	+	3	2	TRIM16L	18579417	1.000000	0.71417	1.000000	0.80357	0.435000	0.31806	5.627000	0.67784	0.607000	0.29982	0.194000	0.17425	AAG	.		0.517	TRIM16L-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130670.3	NM_001037330	
TRNT1	51095	hgsc.bcm.edu;bcgsc.ca	37	3	3189269	3189269	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:3189269T>C	ENST00000251607.6	+	7	1040	c.938T>C	c.(937-939)tTg>tCg	p.L313S	TRNT1_ENST00000280591.6_Missense_Mutation_p.L293S	NM_182916.2	NP_886552	Q96Q11	TRNT1_HUMAN	tRNA nucleotidyl transferase, CCA-adding, 1	313					protein targeting to mitochondrion (GO:0006626)|tRNA 3'-end processing (GO:0042780)|tRNA 3'-terminal CCA addition (GO:0001680)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP:3'-cytidine-cytidine-tRNA adenylyltransferase activity (GO:0052929)|CTP:3'-cytidine-tRNA cytidylyltransferase activity (GO:0052928)|CTP:tRNA cytidylyltransferase activity (GO:0052927)|tRNA adenylyltransferase activity (GO:0004810)|tRNA binding (GO:0000049)			breast(2)|endometrium(3)|large_intestine(4)|lung(2)|urinary_tract(1)	12				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)		GATTTGAGGTTGAAGATCGCA	0.333																																					p.L313S		.											.	TRNT1	90	0			c.T938C						.						87.0	93.0	91.0					3																	3189269		2203	4300	6503	SO:0001583	missense	51095	exon7			TGAGGTTGAAGAT	AF151805	CCDS2561.2	3p25.1	2002-05-30			ENSG00000072756	ENSG00000072756	2.7.7.25		17341	protein-coding gene	gene with protein product		612907				10810093, 11504732	Standard	NM_182916		Approved	MtCCA, CGI-47, CCA1	uc003bpp.4	Q96Q11	OTTHUMG00000090259	ENST00000251607.6:c.938T>C	3.37:g.3189269T>C	ENSP00000251607:p.Leu313Ser	148.0	0.0		102.0	5.0	NM_182916	A8K2Z6|B7WP13|C9JKA2|Q8ND57|Q9BS97|Q9Y362	Missense_Mutation	SNP	ENST00000251607.6	37	CCDS2561.2	.	.	.	.	.	.	.	.	.	.	T	23.7	4.445521	0.84101	.	.	ENSG00000072756	ENST00000251607;ENST00000280591	T;T	0.54866	0.55;0.59	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000001	T	0.73297	0.3569	M	0.80183	2.485	0.80722	D	1	P;D	0.76494	0.86;0.999	P;D	0.69654	0.661;0.965	T	0.77760	-0.2467	10	0.87932	D	0	-2.0847	15.5464	0.76104	0.0:0.0:0.0:1.0	.	293;313	Q96Q11-2;Q96Q11	.;TRNT1_HUMAN	S	313;293	ENSP00000251607:L313S;ENSP00000280591:L293S	ENSP00000251607:L313S	L	+	2	0	TRNT1	3164269	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.424000	0.80242	2.155000	0.67459	0.533000	0.62120	TTG	.		0.333	TRNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337616.1		
TSHZ2	128553	hgsc.bcm.edu;bcgsc.ca	37	20	51872639	51872639	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr20:51872639A>G	ENST00000371497.5	+	2	3529	c.2642A>G	c.(2641-2643)gAg>gGg	p.E881G	TSHZ2_ENST00000329613.6_Missense_Mutation_p.E878G|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000603338.2_Missense_Mutation_p.E878G	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	881					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			GGCCCACAAGAGCGTATGCAA	0.502																																					p.E881G		.											.	TSHZ2	232	0			c.A2642G						.						86.0	83.0	84.0					20																	51872639		2203	4300	6503	SO:0001583	missense	128553	exon2			CACAAGAGCGTAT	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2642A>G	20.37:g.51872639A>G	ENSP00000360552:p.Glu881Gly	104.0	0.0		86.0	4.0	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.218555	0.79464	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.27890	1.64;1.64	5.8	5.8	0.92144	Homeobox (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.50069	0.1594	L	0.47190	1.495	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.50541	-0.8816	10	0.87932	D	0	-1.386	16.1354	0.81481	1.0:0.0:0.0:0.0	.	881	Q9NRE2	TSH2_HUMAN	G	881;878;407	ENSP00000360552:E881G;ENSP00000333114:E878G	ENSP00000333114:E878G	E	+	2	0	TSHZ2	51306046	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.956000	0.93066	2.206000	0.71126	0.523000	0.50628	GAG	.		0.502	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
USP15	9958	hgsc.bcm.edu;bcgsc.ca	37	12	62790141	62790141	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:62790141T>C	ENST00000280377.5	+	20	2695	c.2637T>C	c.(2635-2637)gcT>gcC	p.A879A	USP15_ENST00000353364.3_Silent_p.A850A|USP15_ENST00000393654.3_Silent_p.A854A	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	879	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		ATCTGATTGCTGTTTCCAACC	0.378																																					p.A879A	Melanoma(181;615 2041 39364 49691 50001)	.											.	USP15	1084	0			c.T2637C						.						127.0	117.0	120.0					12																	62790141		2203	4300	6503	SO:0001819	synonymous_variant	9958	exon20			GATTGCTGTTTCC	AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.2637T>C	12.37:g.62790141T>C		124.0	0.0		75.0	6.0	NM_001252078	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Silent	SNP	ENST00000280377.5	37	CCDS58251.1																																																																																			.		0.378	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407831.2	NM_006313	
USP47	55031	hgsc.bcm.edu;bcgsc.ca	37	11	11941963	11941963	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:11941963G>A	ENST00000399455.2	+	11	1320	c.1200G>A	c.(1198-1200)atG>atA	p.M400I	USP47_ENST00000539466.1_5'UTR|USP47_ENST00000527733.1_Missense_Mutation_p.M380I|USP47_ENST00000339865.5_Missense_Mutation_p.M312I	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	400	USP.				base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		ATACAACCATGCATAGGATTA	0.338																																					p.M312I		.											.	USP47	660	0			c.G936A						.						109.0	103.0	105.0					11																	11941963		1823	4075	5898	SO:0001583	missense	55031	exon9			AACCATGCATAGG	AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.1200G>A	11.37:g.11941963G>A	ENSP00000382382:p.Met400Ile	102.0	0.0		58.0	4.0	NM_017944	B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Missense_Mutation	SNP	ENST00000399455.2	37		.	.	.	.	.	.	.	.	.	.	G	25.9	4.687971	0.88639	.	.	ENSG00000170242	ENST00000339865;ENST00000527733;ENST00000399455;ENST00000535588	T;T;T	0.29917	1.55;1.55;1.55	5.5	5.5	0.81552	.	0.105200	0.85682	D	0.000000	T	0.47284	0.1437	L	0.55990	1.75	0.80722	D	1	P;P	0.47677	0.899;0.745	P;P	0.56865	0.808;0.6	T	0.11941	-1.0567	10	0.26408	T	0.33	.	18.9869	0.92775	0.0:0.0:1.0:0.0	.	380;312	E9PM46;Q96K76-2	.;.	I	312;380;400;400	ENSP00000339957:M312I;ENSP00000433146:M380I;ENSP00000382382:M400I	ENSP00000339957:M312I	M	+	3	0	USP47	11898539	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.062000	0.89475	2.591000	0.87537	0.563000	0.77884	ATG	.		0.338	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000385853.2	NM_017944	
USP9X	8239	hgsc.bcm.edu;bcgsc.ca	37	X	41088999	41088999	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:41088999A>G	ENST00000324545.8	+	43	8031	c.7398A>G	c.(7396-7398)acA>acG	p.T2466T	USP9X_ENST00000378308.2_Silent_p.T2466T	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	2466					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						CTAGGATGACACTTGCAAAAG	0.413																																					p.T2466T	Ovarian(172;1807 2695 35459 49286)	.											.	USP9X	563	0			c.A7398G						.						89.0	86.0	87.0					X																	41088999		2203	4300	6503	SO:0001819	synonymous_variant	8239	exon43			GATGACACTTGCA	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.7398A>G	X.37:g.41088999A>G		79.0	0.0		108.0	5.0	NM_001039591	O75550|Q8WWT3|Q8WX12	Silent	SNP	ENST00000324545.8	37	CCDS43930.1																																																																																			.		0.413	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
VWA2	340706	hgsc.bcm.edu;bcgsc.ca	37	10	116045937	116045937	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:116045937A>G	ENST00000392982.3	+	11	1487	c.1237A>G	c.(1237-1239)Att>Gtt	p.I413V	VWA2_ENST00000603594.1_Missense_Mutation_p.I413V			Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	413	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium-independent cell-matrix adhesion (GO:0007161)|protein homooligomerization (GO:0051260)|regulation of insulin receptor signaling pathway (GO:0046626)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Epithelial(162;0.036)|all cancers(201;0.0793)		CCTCGATGGCATTCCCTTCCG	0.697																																					p.I413V		.											.	VWA2	156	0			c.A1237G						.						76.0	69.0	72.0					10																	116045937		2203	4300	6503	SO:0001583	missense	340706	exon11			GATGGCATTCCCT	AK127756	CCDS7589.1, CCDS7589.2	10q25.3	2009-11-06			ENSG00000165816	ENSG00000165816			24709	protein-coding gene	gene with protein product						15580307, 14506275	Standard	NM_001272046		Approved	FLJ45857, FLJ16213, CCSP-2, AMACO, NET42	uc001lbl.2	Q5GFL6	OTTHUMG00000019082	ENST00000392982.3:c.1237A>G	10.37:g.116045937A>G	ENSP00000376708:p.Ile413Val	115.0	0.0		72.0	4.0	NM_001272046	A1A5D4|B5MDJ8|Q6ZS39|Q6ZWJ7|Q708C5|Q70UZ8	Missense_Mutation	SNP	ENST00000392982.3	37		.	.	.	.	.	.	.	.	.	.	A	0.011	-1.730903	0.00687	.	.	ENSG00000165816	ENST00000392982;ENST00000298715	T	0.80123	-1.34	5.6	-5.49	0.02584	von Willebrand factor, type A (3);	0.762112	0.12551	N	0.459047	T	0.57902	0.2085	N	0.25060	0.705	0.09310	N	0.999999	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.08055	0.003;0.003;0.002	T	0.40232	-0.9574	10	0.29301	T	0.29	.	2.9749	0.05934	0.3066:0.3463:0.2545:0.0926	.	109;413;413	Q5GFL6-3;Q5GFL6;Q5GFL6-2	.;VWA2_HUMAN;.	V	413	ENSP00000376708:I413V	ENSP00000298715:I413V	I	+	1	0	VWA2	116035927	0.010000	0.17322	0.000000	0.03702	0.153000	0.21895	0.219000	0.17641	-0.875000	0.04022	-0.376000	0.06991	ATT	.		0.697	VWA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050456.3	NM_198496	
WDHD1	11169	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	55408242	55408242	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:55408242T>C	ENST00000360586.3	-	26	3421	c.3356A>G	c.(3355-3357)cAg>cGg	p.Q1119R	WDHD1_ENST00000421192.1_Missense_Mutation_p.Q996R|WDHD1_ENST00000420358.2_Missense_Mutation_p.Q996R|WDHD1_ENST00000359167.4_Missense_Mutation_p.Q637R	NM_007086.3	NP_009017.1	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	1119					heterochromatin maintenance (GO:0070829)|regulation of chromosome organization (GO:0033044)|RNA processing (GO:0006396)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(2)	42						TGATAGTTTCTGATTTGTAGA	0.338																																					p.Q1119R		.											.	WDHD1	91	0			c.A3356G						.						106.0	109.0	108.0					14																	55408242		2202	4297	6499	SO:0001583	missense	11169	exon26			AGTTTCTGATTTG	AJ006266	CCDS9721.1, CCDS41955.1	14q22.2	2013-01-09			ENSG00000198554	ENSG00000198554		"""WD repeat domain containing"""	23170	protein-coding gene	gene with protein product	"""CTF4, chromosome transmission fidelity factor 4 homolog (S. cerevisiae)"""	608126				9175701, 20028748	Standard	NM_007086		Approved	AND-1, CTF4, CHTF4	uc001xbm.2	O75717	OTTHUMG00000140304	ENST00000360586.3:c.3356A>G	14.37:g.55408242T>C	ENSP00000353793:p.Gln1119Arg	117.0	1.0		82.0	51.0	NM_007086	C9JW18|F6W0U7	Missense_Mutation	SNP	ENST00000360586.3	37	CCDS9721.1	.	.	.	.	.	.	.	.	.	.	T	12.96	2.093303	0.36952	.	.	ENSG00000198554	ENST00000360586;ENST00000359167;ENST00000421192	T;T;T	0.62105	0.42;0.91;0.05	5.78	5.78	0.91487	.	0.723150	0.13452	N	0.386801	T	0.49490	0.1560	L	0.54323	1.7	0.22835	N	0.998672	P;P	0.44627	0.839;0.698	B;B	0.32211	0.142;0.093	T	0.52328	-0.8590	10	0.37606	T	0.19	.	7.0222	0.24920	0.1453:0.0:0.1516:0.7031	.	637;1119	F8W7P7;O75717	.;WDHD1_HUMAN	R	1119;637;996	ENSP00000353793:Q1119R;ENSP00000352085:Q637R;ENSP00000391049:Q996R	ENSP00000352085:Q637R	Q	-	2	0	WDHD1	54477992	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	1.004000	0.29822	2.210000	0.71456	0.533000	0.62120	CAG	.		0.338	WDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276897.2	NM_007086	
WSB1	26118	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	25630657	25630657	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:25630657T>A	ENST00000262394.2	+	3	790	c.474T>A	c.(472-474)taT>taA	p.Y158*	WSB1_ENST00000579733.1_Intron|WSB1_ENST00000427287.2_Nonsense_Mutation_p.Y127*|WSB1_ENST00000583193.1_Intron|WSB1_ENST00000348811.2_Intron|WSB1_ENST00000581185.1_Nonsense_Mutation_p.Y158*	NM_015626.8	NP_056441.6	Q9Y6I7	WSB1_HUMAN	WD repeat and SOCS box containing 1	158					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)				lung(3)	3	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		GGGATGTATATACAGGTATGG	0.378																																					p.Y158X		.											.	WSB1	226	0			c.T474A						.						126.0	133.0	130.0					17																	25630657		2203	4300	6503	SO:0001587	stop_gained	26118	exon3			TGTATATACAGGT	AF069313	CCDS11220.1, CCDS11221.1	17q11.2	2013-01-09	2011-01-25		ENSG00000109046	ENSG00000109046		"""WD repeat domain containing"""	19221	protein-coding gene	gene with protein product		610091	"""WD repeat and SOCS box-containing 1"""			10354473, 12076535	Standard	XR_243778		Approved	DKFZp564A122, DKFZp564B0482, SWIP1	uc002gzd.1	Q9Y6I7	OTTHUMG00000132293	ENST00000262394.2:c.474T>A	17.37:g.25630657T>A	ENSP00000262394:p.Tyr158*	115.0	0.0		90.0	34.0	NM_015626	Q9NRB1|Q9UBH9|Q9UG25|Q9UNN6|Q9Y656	Nonsense_Mutation	SNP	ENST00000262394.2	37	CCDS11220.1	.	.	.	.	.	.	.	.	.	.	T	38	6.910434	0.97928	.	.	ENSG00000109046	ENST00000262394;ENST00000427287	.	.	.	6.04	1.53	0.23141	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-6.4536	9.3047	0.37867	0.0:0.4004:0.0:0.5996	.	.	.	.	X	158;127	.	ENSP00000262394:Y158X	Y	+	3	2	WSB1	22654784	0.999000	0.42202	1.000000	0.80357	0.968000	0.65278	0.611000	0.24268	0.547000	0.28938	-0.376000	0.06991	TAT	.		0.378	WSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255391.4	NM_015626	
YIPF6	286451	hgsc.bcm.edu;bcgsc.ca	37	X	67731743	67731743	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:67731743A>G	ENST00000462683.1	+	2	854	c.110A>G	c.(109-111)gAa>gGa	p.E37G	YIPF6_ENST00000374622.2_Intron|YIPF6_ENST00000470730.1_3'UTR	NM_173834.3	NP_776195.2	Q96EC8	YIPF6_HUMAN	Yip1 domain family, member 6	37					intestinal epithelial cell development (GO:0060576)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(1)	7						GTAGAAGGAGAAATCACCATT	0.423																																					p.E37G		.											.	YIPF6	130	0			c.A110G						.						170.0	149.0	156.0					X																	67731743		2203	4300	6503	SO:0001583	missense	286451	exon2			AAGGAGAAATCAC	BC012469	CCDS14389.1, CCDS56604.1	Xq13.1	2008-02-05			ENSG00000181704	ENSG00000181704		"""Yip1 domain family"""	28304	protein-coding gene	gene with protein product						12477932	Standard	NM_173834		Approved	MGC21416, FinGER6	uc004dwz.3	Q96EC8	OTTHUMG00000021745	ENST00000462683.1:c.110A>G	X.37:g.67731743A>G	ENSP00000417573:p.Glu37Gly	47.0	0.0		50.0	4.0	NM_173834	B4E1U7|G5E997|Q5JP08	Missense_Mutation	SNP	ENST00000462683.1	37	CCDS14389.1	.	.	.	.	.	.	.	.	.	.	A	17.64	3.440731	0.63067	.	.	ENSG00000181704	ENST00000462683	T	0.47528	0.84	5.66	5.66	0.87406	.	0.048265	0.85682	D	0.000000	T	0.41166	0.1147	L	0.54323	1.7	0.80722	D	1	P	0.36683	0.565	B	0.32980	0.156	T	0.27773	-1.0064	10	0.23891	T	0.37	-18.4373	12.7643	0.57383	1.0:0.0:0.0:0.0	.	37	Q96EC8	YIPF6_HUMAN	G	37	ENSP00000417573:E37G	ENSP00000417573:E37G	E	+	2	0	YIPF6	67648468	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	7.102000	0.77005	1.921000	0.55644	0.427000	0.28365	GAA	.		0.423	YIPF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057016.1	NM_173834	
ZAN	7455	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100334504	100334504	+	RNA	SNP	T	T	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:100334504T>A	ENST00000348028.3	+	0	491				ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000443370.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AGCCCCGACCTATGGGAGCAA	0.642																																					.		.											.	ZAN	142	0			.						.						8.0	11.0	10.0					7																	100334504		1884	3847	5731			7455	.			CCGACCTATGGGA	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100334504T>A		86.0	0.0		101.0	45.0	.	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	RNA	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	T	12.71	2.018797	0.35606	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.02763	4.17;4.17;4.17	4.27	4.27	0.50696	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	1.084040	0.07442	N	0.897428	T	0.15825	0.0381	M	0.80616	2.505	0.42711	D	0.993646	D;D	0.65815	0.994;0.995	D;D	0.67900	0.924;0.954	T	0.00153	-1.1982	10	0.87932	D	0	.	10.3757	0.44081	0.0:0.0:0.0:1.0	.	109;109	F5H0T8;Q9Y493	.;ZAN_HUMAN	Q	109	ENSP00000445943:L109Q;ENSP00000445091:L109Q;ENSP00000444427:L109Q	ENSP00000423579:L109Q	L	+	2	0	ZAN	100172440	0.006000	0.16342	0.005000	0.12908	0.035000	0.12851	1.883000	0.39658	1.891000	0.54761	0.459000	0.35465	CTA	.		0.642	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
ZBTB41	360023	hgsc.bcm.edu;bcgsc.ca	37	1	197169179	197169179	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:197169179A>G	ENST00000367405.4	-	1	493	c.425T>C	c.(424-426)tTt>tCt	p.F142S	CRB1_ENST00000535699.1_5'Flank|ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	142	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						TGTGTAAAGAAATTCAAGCAA	0.343																																					p.F142S		.											.	ZBTB41	92	0			c.T425C						.						48.0	47.0	47.0					1																	197169179		2203	4300	6503	SO:0001583	missense	360023	exon1			TAAAGAAATTCAA		CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.425T>C	1.37:g.197169179A>G	ENSP00000356375:p.Phe142Ser	42.0	0.0		83.0	4.0	NM_194314	A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Missense_Mutation	SNP	ENST00000367405.4	37	CCDS30960.1	.	.	.	.	.	.	.	.	.	.	A	19.48	3.835592	0.71373	.	.	ENSG00000177888	ENST00000367405	T	0.72394	-0.65	4.77	4.77	0.60923	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.44902	D	0.000411	D	0.82412	0.5031	M	0.75777	2.31	0.53688	D	0.99997	D	0.76494	0.999	D	0.67231	0.95	D	0.85099	0.0956	10	0.87932	D	0	.	14.2994	0.66336	1.0:0.0:0.0:0.0	.	142	Q5SVQ8	ZBT41_HUMAN	S	142	ENSP00000356375:F142S	ENSP00000356375:F142S	F	-	2	0	ZBTB41	195435802	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.957000	0.93082	1.755000	0.51935	0.254000	0.18369	TTT	.		0.343	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088249.2	NM_194314	
ZC3H12D	340152	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	149783104	149783104	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:149783104T>C	ENST00000409806.3	-	3	626	c.308A>G	c.(307-309)cAt>cGt	p.H103R	ZC3H12D_ENST00000409948.1_Missense_Mutation_p.H103R|ZC3H12D_ENST00000389942.5_Missense_Mutation_p.H103R|ZC3H12D_ENST00000416573.2_Missense_Mutation_p.H103R|ZC3H12D_ENST00000542614.1_Missense_Mutation_p.H103R			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D	103					negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		TTTATTTCCATGGCTACAATG	0.443																																					p.H103R		.											.	.	.	0			c.A308G						.						46.0	46.0	46.0					6																	149783104		1914	4129	6043	SO:0001583	missense	340152	exon3			TTTCCATGGCTAC			6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.308A>G	6.37:g.149783104T>C	ENSP00000386616:p.His103Arg	94.0	0.0		41.0	4.0	NM_207360	A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	Missense_Mutation	SNP	ENST00000409806.3	37		.	.	.	.	.	.	.	.	.	.	T	24.0	4.478196	0.84747	.	.	ENSG00000178199	ENST00000389942;ENST00000416573;ENST00000409806;ENST00000542614;ENST00000409948	T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67	5.19	5.19	0.71726	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.67439	0.2893	M	0.86420	2.815	0.53005	D	0.999969	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.74951	-0.3489	10	0.87932	D	0	-15.4523	15.2075	0.73190	0.0:0.0:0.0:1.0	.	103;103	A2A288;B7WNU7	ZC12D_HUMAN;.	R	103	ENSP00000374592:H103R;ENSP00000408686:H103R;ENSP00000386616:H103R;ENSP00000440813:H103R;ENSP00000387062:H103R	ENSP00000374592:H103R	H	-	2	0	ZC3H12D	149824797	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.388000	0.79795	2.187000	0.69744	0.460000	0.39030	CAT	.		0.443	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000286400.2	NM_207360	
ZFYVE26	23503	hgsc.bcm.edu;bcgsc.ca	37	14	68215323	68215323	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:68215323A>G	ENST00000347230.4	-	42	7588	c.7450T>C	c.(7450-7452)Tct>Cct	p.S2484P	RN7SL213P_ENST00000463482.2_RNA	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2484					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		AAGTAGGCAGAACGCAGTTTG	0.542																																					p.S2484P		.											.	ZFYVE26	162	0			c.T7450C						.						69.0	57.0	61.0					14																	68215323		2203	4300	6503	SO:0001583	missense	23503	exon42			AGGCAGAACGCAG	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.7450T>C	14.37:g.68215323A>G	ENSP00000251119:p.Ser2484Pro	117.0	0.0		68.0	4.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	A	15.96	2.988091	0.53934	.	.	ENSG00000072121	ENST00000347230;ENST00000411699	T	0.30182	1.54	5.54	5.54	0.83059	.	0.126103	0.53938	D	0.000043	T	0.32526	0.0832	L	0.49126	1.545	0.80722	D	1	B	0.22276	0.067	B	0.22152	0.038	T	0.09530	-1.0670	10	0.72032	D	0.01	-15.0401	15.9657	0.79968	1.0:0.0:0.0:0.0	.	2484	Q68DK2	ZFY26_HUMAN	P	2484;2463	ENSP00000251119:S2484P	ENSP00000251119:S2484P	S	-	1	0	ZFYVE26	67285076	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.538000	0.67193	2.236000	0.73375	0.533000	0.62120	TCT	.		0.542	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
ZNF567	163081	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	37211090	37211090	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:37211090G>T	ENST00000536254.2	+	6	1686	c.1464G>T	c.(1462-1464)atG>atT	p.M488I	ZNF850_ENST00000589390.1_Intron|ZNF567_ENST00000588311.1_Missense_Mutation_p.M457I|ZNF567_ENST00000585696.1_Missense_Mutation_p.M457I|ZNF567_ENST00000360729.4_Missense_Mutation_p.M457I|ZNF567_ENST00000392163.2_Missense_Mutation_p.M457I			Q8N184	ZN567_HUMAN	zinc finger protein 567	488					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CCTTTAGAATGAAGTCATACC	0.413																																					p.M457I		.											.	ZNF567	90	0			c.G1371T						.						85.0	83.0	83.0					19																	37211090		2203	4300	6503	SO:0001583	missense	163081	exon4			TAGAATGAAGTCA	AK093034	CCDS12495.1, CCDS74349.1	19q13.12	2013-10-08				ENSG00000189042		"""Zinc fingers, C2H2-type"", ""-"""	28696	protein-coding gene	gene with protein product						12477932	Standard	XM_006723064		Approved	MGC45586	uc002oep.4	Q8N184		ENST00000536254.2:c.1464G>T	19.37:g.37211090G>T	ENSP00000441838:p.Met488Ile	92.0	0.0		108.0	32.0	NM_152603	B3KX49|Q6N044	Missense_Mutation	SNP	ENST00000536254.2	37		.	.	.	.	.	.	.	.	.	.	G	12.68	2.011518	0.35511	.	.	ENSG00000189042	ENST00000536254;ENST00000378686;ENST00000360729;ENST00000423498;ENST00000392163	T;T;T	0.35236	1.32;1.32;1.32	4.88	1.58	0.23477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.128065	0.36101	N	0.002795	T	0.26376	0.0644	N	0.04746	-0.17	0.09310	N	0.999998	B;P	0.44281	0.003;0.831	B;P	0.54664	0.002;0.758	T	0.05241	-1.0897	10	0.42905	T	0.14	.	6.7195	0.23323	0.1726:0.1509:0.6765:0.0	.	488;457	Q8N184;F8WEL6	ZN567_HUMAN;.	I	488;432;457;487;457	ENSP00000441838:M488I;ENSP00000353957:M457I;ENSP00000376003:M457I	ENSP00000353957:M457I	M	+	3	0	ZNF567	41902930	0.000000	0.05858	0.984000	0.44739	0.997000	0.91878	-0.239000	0.08965	0.754000	0.32968	0.561000	0.74099	ATG	.		0.413	ZNF567-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000453549.1	NM_152603	
ZNF576	79177	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44103100	44103100	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:44103100G>A	ENST00000336564.4	+	3	357	c.203G>A	c.(202-204)gGg>gAg	p.G68E	ZNF576_ENST00000391965.2_Missense_Mutation_p.G68E|SRRM5_ENST00000607544.1_Intron|IRGQ_ENST00000422989.1_5'Flank|ZNF576_ENST00000533118.1_Missense_Mutation_p.G68E|ZNF576_ENST00000529930.1_Missense_Mutation_p.G68E|ZNF576_ENST00000528387.1_Missense_Mutation_p.G68E|ZNF576_ENST00000525771.1_Missense_Mutation_p.G68E|SRRM5_ENST00000526798.1_Intron	NM_001145347.1	NP_001138819.1	Q9H609	ZN576_HUMAN	zinc finger protein 576	68					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(1)|prostate(1)	2		Prostate(69;0.0199)				AAGCTGCAGGGGGTCCTCTTC	0.637																																					p.G68E		.											.	ZNF576	90	0			c.G203A						.						91.0	106.0	101.0					19																	44103100		2203	4300	6503	SO:0001583	missense	79177	exon3			TGCAGGGGGTCCT	AK026353	CCDS12625.1	19q13.31	2013-09-20			ENSG00000124444	ENSG00000124444		"""Zinc fingers, C2H2-type"""	28357	protein-coding gene	gene with protein product						12477932	Standard	NM_024327		Approved	MGC2508	uc002owz.2	Q9H609	OTTHUMG00000165479	ENST00000336564.4:c.203G>A	19.37:g.44103100G>A	ENSP00000337852:p.Gly68Glu	133.0	0.0		173.0	80.0	NM_001145347	Q9BU03	Missense_Mutation	SNP	ENST00000336564.4	37	CCDS12625.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.766090	0.69878	.	.	ENSG00000124444	ENST00000391965;ENST00000525771;ENST00000533118;ENST00000528387;ENST00000529930;ENST00000336564	T;T;T;T;T;T	0.01252	5.1;5.1;5.1;5.1;5.1;5.1	3.93	3.93	0.45458	.	0.164033	0.36972	N	0.002318	T	0.02119	0.0066	N	0.11064	0.09	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	T	0.70103	-0.4964	10	0.08381	T	0.77	-15.9544	11.7501	0.51843	0.0:0.0:1.0:0.0	.	68	Q9H609	ZN576_HUMAN	E	68	ENSP00000375827:G68E;ENSP00000436182:G68E;ENSP00000435899:G68E;ENSP00000435934:G68E;ENSP00000435463:G68E;ENSP00000337852:G68E	ENSP00000337852:G68E	G	+	2	0	ZNF576	48794940	0.995000	0.38212	0.999000	0.59377	0.922000	0.55478	1.051000	0.30417	2.500000	0.84329	0.591000	0.81541	GGG	.		0.637	ZNF576-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384397.1	NM_024327	
ZNF347	84671	hgsc.bcm.edu;bcgsc.ca	37	19	53643997	53643997	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:53643997T>C	ENST00000334197.7	-	5	2152	c.2084A>G	c.(2083-2085)aAg>aGg	p.K695R	ZNF347_ENST00000452676.2_Missense_Mutation_p.K696R|ZNF347_ENST00000601469.2_Missense_Mutation_p.K696R|ZNF347_ENST00000601804.1_Intron	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	695					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		CCTTGCAAGCTTTGATGTTTG	0.433																																					p.K696R	Melanoma(64;205 1597 17324 45721)	.											.	ZNF347	90	0			c.A2087G						.						141.0	134.0	136.0					19																	53643997		2203	4300	6503	SO:0001583	missense	84671	exon5			GCAAGCTTTGATG	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.2084A>G	19.37:g.53643997T>C	ENSP00000334146:p.Lys695Arg	88.0	0.0		122.0	6.0	NM_001172675	B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	37	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	T	1.642	-0.516307	0.04200	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.07688	3.17;3.17	2.87	-0.786	0.10946	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03564	0.0102	N	0.12887	0.27	0.09310	N	1	B;B	0.28055	0.199;0.029	B;B	0.30572	0.117;0.051	T	0.45498	-0.9257	9	0.15499	T	0.54	.	1.6483	0.02766	0.1603:0.1023:0.3294:0.4081	.	696;695	G5E9N4;Q96SE7	.;ZN347_HUMAN	R	695;696	ENSP00000334146:K695R;ENSP00000405218:K696R	ENSP00000334146:K695R	K	-	2	0	ZNF347	58335809	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.448000	0.02394	-0.409000	0.07553	-1.281000	0.01382	AAG	.		0.433	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584	
ZNF630	57232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	47919903	47919903	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:47919903T>C	ENST00000409324.3	-	4	390	c.164A>G	c.(163-165)gAt>gGt	p.D55G	ZNF630-AS1_ENST00000436124.1_RNA|ZNF630_ENST00000276054.4_5'UTR|ZNF630_ENST00000442455.3_Missense_Mutation_p.D41G	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	55	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						AAAGATTACATCTGGTTTTAT	0.448																																					p.D55G		.											.	ZNF630	131	0			c.A164G						.						176.0	134.0	147.0					X																	47919903		1559	3573	5132	SO:0001583	missense	57232	exon4			ATTACATCTGGTT	AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.164A>G	X.37:g.47919903T>C	ENSP00000386393:p.Asp55Gly	22.0	0.0		27.0	21.0	NM_001037735	F8WAG4|Q5H8Z5	Missense_Mutation	SNP	ENST00000409324.3	37	CCDS35237.2	.	.	.	.	.	.	.	.	.	.	.	9.927	1.213667	0.22289	.	.	ENSG00000221994	ENST00000442455;ENST00000409324;ENST00000428686	T;T;T	0.00892	5.57;5.57;5.57	2.13	-4.27	0.03744	Krueppel-associated box (3);	.	.	.	.	T	0.01029	0.0034	L	0.54323	1.7	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41448	-0.9508	9	0.45353	T	0.12	.	3.7256	0.08473	0.1795:0.3978:0.0:0.4227	.	55	Q2M218	ZN630_HUMAN	G	41;55;55	ENSP00000393163:D41G;ENSP00000386393:D55G;ENSP00000407278:D55G	ENSP00000386393:D55G	D	-	2	0	ZNF630	47804847	0.000000	0.05858	0.006000	0.13384	0.514000	0.34195	-0.324000	0.07986	-1.222000	0.02587	-0.451000	0.05528	GAT	.		0.448	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327254.1	NM_001037735	
ZNF662	389114	hgsc.bcm.edu;bcgsc.ca	37	3	42954744	42954744	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:42954744A>G	ENST00000541208.1	+	4	572	c.203A>G	c.(202-204)gAg>gGg	p.E68G	KRBOX1_ENST00000426937.1_Intron|ZNF662_ENST00000422021.1_Intron|ZNF662_ENST00000440367.2_Missense_Mutation_p.E68G|ZNF662_ENST00000430067.2_3'UTR|ZNF662_ENST00000328199.6_Intron			Q6ZS27	ZN662_HUMAN	zinc finger protein 662	68					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|large_intestine(6)|lung(5)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.217)		CAGGTGGAAGAGCCATTAAAC	0.473																																					p.E68G		.											.	ZNF662	90	0			c.A203G						.						95.0	97.0	96.0					3																	42954744		2203	4300	6503	SO:0001583	missense	389114	exon4			TGGAAGAGCCATT	AK127779	CCDS2708.1, CCDS46807.1	3p22.1	2013-01-08			ENSG00000182983	ENSG00000182983		"""Zinc fingers, C2H2-type"", ""-"""	31930	protein-coding gene	gene with protein product							Standard	NM_207404		Approved	FLJ45880	uc003cmk.2	Q6ZS27	OTTHUMG00000133041	ENST00000541208.1:c.203A>G	3.37:g.42954744A>G	ENSP00000446208:p.Glu68Gly	127.0	0.0		62.0	4.0	NM_207404	A1A4T9|F8W7S8|Q6ZNF8|Q6ZQW8	Missense_Mutation	SNP	ENST00000541208.1	37	CCDS2708.1	.	.	.	.	.	.	.	.	.	.	A	7.478	0.648042	0.14516	.	.	ENSG00000182983	ENST00000440367;ENST00000541208	T;T	0.49720	0.77;0.77	3.46	3.46	0.39613	.	.	.	.	.	T	0.48822	0.1521	L	0.34521	1.04	0.21527	N	0.999654	D	0.69078	0.997	P	0.60682	0.878	T	0.25813	-1.0121	9	0.22706	T	0.39	.	8.4924	0.33108	1.0:0.0:0.0:0.0	.	68	Q6ZS27	ZN662_HUMAN	G	68	ENSP00000405047:E68G;ENSP00000446208:E68G	ENSP00000405047:E68G	E	+	2	0	ZNF662	42929748	0.992000	0.36948	0.447000	0.26932	0.016000	0.09150	2.013000	0.40942	1.575000	0.49775	0.460000	0.39030	GAG	.		0.473	ZNF662-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256646.4	NM_207404	
ZNF777	27153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	149129992	149129992	+	Silent	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:149129992G>A	ENST00000247930.4	-	6	1694	c.1371C>T	c.(1369-1371)gaC>gaT	p.D457D		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	457	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			cttcctcctcGTCTTGTTCCT	0.582																																					p.D457D		.											.	ZNF777	136	0			c.C1371T						.						11.0	12.0	12.0					7																	149129992		2132	4244	6376	SO:0001819	synonymous_variant	27153	exon6			CTCCTCGTCTTGT	AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.1371C>T	7.37:g.149129992G>A		141.0	0.0		143.0	63.0	NM_015694	Q8N2R2|Q8N659	Silent	SNP	ENST00000247930.4	37	CCDS43675.1																																																																																			.		0.582	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352708.1	NM_015694	
