#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCC12	94160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	48119516	48119516	+	Silent	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:48119516G>T	ENST00000311303.3	-	27	4161	c.3816C>A	c.(3814-3816)ctC>ctA	p.L1272L	ABCC12_ENST00000448542.1_3'UTR|ABCC12_ENST00000532355.1_5'UTR|ABCC12_ENST00000416054.1_3'UTR	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	1272	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				TTGAATTACGGAGAAGAGCTC	0.453																																					p.L1272L		.											.	ABCC12	93	0			c.C3816A						.						151.0	148.0	149.0					16																	48119516		2201	4300	6501	SO:0001819	synonymous_variant	94160	exon27			ATTACGGAGAAGA	AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.3816C>A	16.37:g.48119516G>T		191.0	0.0		144.0	43.0	NM_033226	Q49AL2|Q8TAF0|Q8TEY2	Silent	SNP	ENST00000311303.3	37	CCDS10730.1																																																																																			.		0.453	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226	
ACOXL	55289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	111556210	111556210	+	Silent	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:111556210T>C	ENST00000389811.4	+	6	593	c.369T>C	c.(367-369)tgT>tgC	p.C123C	ACOXL_ENST00000340561.4_Silent_p.C123C|ACOXL_ENST00000439055.1_Silent_p.C123C			Q9NUZ1	ACOXL_HUMAN	acyl-CoA oxidase-like	123					fatty acid beta-oxidation (GO:0006635)	peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)			kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(1)	21						ACACGCCGTGTGAAAATGCGG	0.438																																					p.C123C		.											.	ACOXL	90	0			c.T369C						.						130.0	123.0	125.0					2																	111556210		1926	4137	6063	SO:0001819	synonymous_variant	55289	exon6			GCCGTGTGAAAAT		CCDS46389.1	2q13	2010-06-30	2010-04-30		ENSG00000153093	ENSG00000153093			25621	protein-coding gene	gene with protein product			"""acyl-Coenzyme A oxidase-like"""				Standard	NM_001142807		Approved	FLJ11042	uc010yxk.1	Q9NUZ1	OTTHUMG00000131257	ENST00000389811.4:c.369T>C	2.37:g.111556210T>C		75.0	0.0		48.0	17.0	NM_001142807	A2RRB7|B7WPB3|B7WPP7|E9PB20|Q53R27|Q53R31|Q53SC6|Q8TCE7	Silent	SNP	ENST00000389811.4	37																																																																																				.		0.438	ACOXL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000254024.2	NM_018308	
ACVR2A	92	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	148684674	148684674	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:148684674T>C	ENST00000241416.7	+	11	2009	c.1373T>C	c.(1372-1374)aTt>aCt	p.I458T	ACVR2A_ENST00000535787.1_Missense_Mutation_p.I350T|ACVR2A_ENST00000495775.1_3'UTR|ACVR2A_ENST00000404590.1_Missense_Mutation_p.I458T	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	458	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.I458T(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		TGTGAAACCATTGAAGAATGT	0.378																																					p.I458T		.											ACVR2A,NS,carcinoma,0	ACVR2A	831	1	Substitution - Missense(1)	breast(1)	c.T1373C						.						106.0	101.0	103.0					2																	148684674		2203	4299	6502	SO:0001583	missense	92	exon11			AAACCATTGAAGA		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1373T>C	2.37:g.148684674T>C	ENSP00000241416:p.Ile458Thr	121.0	1.0		73.0	18.0	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Missense_Mutation	SNP	ENST00000241416.7	37	CCDS33301.1	.	.	.	.	.	.	.	.	.	.	T	18.74	3.688428	0.68271	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	T;T;T	0.71341	-0.56;-0.56;-0.56	6.06	6.06	0.98353	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80706	0.4674	M	0.76727	2.345	0.80722	D	1	P	0.41345	0.746	P	0.51550	0.673	T	0.82466	-0.0443	10	0.87932	D	0	.	16.6245	0.84952	0.0:0.0:0.0:1.0	.	458	P27037	AVR2A_HUMAN	T	458;350;458	ENSP00000241416:I458T;ENSP00000439988:I350T;ENSP00000384338:I458T	ENSP00000241416:I458T	I	+	2	0	ACVR2A	148401144	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	8.040000	0.89188	2.323000	0.78572	0.528000	0.53228	ATT	.		0.378	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
ADAMTS18	170692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	77355100	77355100	+	Splice_Site	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:77355100C>T	ENST00000282849.5	-	15	2582		c.e15-1			NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18						eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ATCCCACTAGCTGTGACAAAA	0.378																																					.		.											.	ADAMTS18	1036	0			c.2164-1G>A						.						73.0	73.0	73.0					16																	77355100		2198	4300	6498	SO:0001630	splice_region_variant	170692	exon16			CACTAGCTGTGAC	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2164-1G>A	16.37:g.77355100C>T		102.0	0.0		111.0	34.0	NM_199355	Q6P4R5|Q6ZWJ9	Splice_Site	SNP	ENST00000282849.5	37	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.019772	0.54576	.	.	ENSG00000140873	ENST00000282849	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8324	0.92145	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADAMTS18	75912601	1.000000	0.71417	1.000000	0.80357	0.529000	0.34654	7.409000	0.80053	2.696000	0.92011	0.655000	0.94253	.	.		0.378	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		Intron
ADAMTS18	170692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	77401346	77401346	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:77401346C>T	ENST00000282849.5	-	4	1188	c.770G>A	c.(769-771)cGc>cAc	p.R257H	ADAMTS18_ENST00000567121.1_5'Flank	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	257					eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ACATTTCTTGCGTCGTCCACA	0.443																																					p.R257H		.											.	ADAMTS18	1036	0			c.G770A						.						77.0	76.0	76.0					16																	77401346		2198	4300	6498	SO:0001583	missense	170692	exon4			TTCTTGCGTCGTC	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.770G>A	16.37:g.77401346C>T	ENSP00000282849:p.Arg257His	91.0	0.0		76.0	32.0	NM_199355	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	32	5.175432	0.94807	.	.	ENSG00000140873	ENST00000282849;ENST00000449265	T;T	0.61392	0.11;2.09	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.76608	0.4011	M	0.78049	2.395	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	T	0.78242	-0.2280	10	0.52906	T	0.07	.	17.4456	0.87577	0.0:1.0:0.0:0.0	.	257	Q8TE60	ATS18_HUMAN	H	257	ENSP00000282849:R257H;ENSP00000392540:R257H	ENSP00000282849:R257H	R	-	2	0	ADAMTS18	75958847	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.447000	0.66606	2.603000	0.88011	0.555000	0.69702	CGC	.		0.443	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
ADD2	119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	70933425	70933425	+	Missense_Mutation	SNP	G	G	T	rs373392326		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:70933425G>T	ENST00000264436.4	-	3	560	c.116C>A	c.(115-117)gCg>gAg	p.A39E	ADD2_ENST00000413157.2_Missense_Mutation_p.A39E|ADD2_ENST00000407644.2_Missense_Mutation_p.A39E|ADD2_ENST00000355733.3_Missense_Mutation_p.A39E|ADD2_ENST00000473232.1_5'Flank|ADD2_ENST00000430656.1_Missense_Mutation_p.A55E	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	39					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						CCGCAGGTCCGCCGCCCGGTT	0.687																																					p.A55E		.											.	ADD2	93	0			c.C164A						.						51.0	52.0	52.0					2																	70933425		2203	4300	6503	SO:0001583	missense	119	exon2			AGGTCCGCCGCCC	X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.116C>A	2.37:g.70933425G>T	ENSP00000264436:p.Ala39Glu	104.0	0.0		74.0	31.0	NM_001185055	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	ENST00000264436.4	37	CCDS1906.1	.	.	.	.	.	.	.	.	.	.	G	13.07	2.126225	0.37533	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000456320;ENST00000355733;ENST00000522886;ENST00000264439;ENST00000356565;ENST00000517596;ENST00000413157;ENST00000430656;ENST00000415348;ENST00000425976	T;T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53	4.89	4.89	0.63831	.	0.148379	0.44902	D	0.000412	T	0.46639	0.1403	M	0.66297	2.02	0.29846	N	0.828861	P;P;D;P;P;P	0.63046	0.645;0.631;0.992;0.505;0.623;0.904	B;B;P;B;B;B	0.54026	0.177;0.387;0.74;0.177;0.247;0.411	T	0.50841	-0.8780	10	0.87932	D	0	-14.2279	15.9349	0.79694	0.0:0.0:1.0:0.0	.	55;39;39;39;39;39	B4DM17;P35612-4;E9PAN1;Q05DK5;P35612;P35612-3	.;.;.;.;ADDB_HUMAN;.	E	39;39;39;39;39;39;39;39;39;55;39;39	ENSP00000264436:A39E;ENSP00000384677:A39E;ENSP00000347972:A39E;ENSP00000430243:A39E;ENSP00000388072:A39E;ENSP00000398112:A55E;ENSP00000412357:A39E;ENSP00000412681:A39E	ENSP00000264436:A39E	A	-	2	0	ADD2	70786933	0.998000	0.40836	0.018000	0.16275	0.076000	0.17211	5.317000	0.65822	2.690000	0.91761	0.591000	0.81541	GCG	.		0.687	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617	
ADPRHL1	113622	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	114107605	114107632	+	Frame_Shift_Del	DEL	GCGAGAGTACGAGGTGGTCCAGGCCCCC	GCGAGAGTACGAGGTGGTCCAGGCCCCC	-	rs34085933|rs546248843|rs35745409|rs141431509|rs148683938|rs558010517	byFrequency	TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	GCGAGAGTACGAGGTGGTCCAGGCCCCC	GCGAGAGTACGAGGTGGTCCAGGCCCCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr13:114107605_114107632delGCGAGAGTACGAGGTGGTCCAGGCCCCC	ENST00000375418.3	-	1	207_234	c.121_148delGGGGGCCTGGACCACCTCGTACTCTCGC	c.(121-150)gggggcctggaccacctcgtactctcgccafs	p.GGLDHLVLSP41fs		NM_138430.3	NP_612439.2	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1	41					protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)	p.L46L(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	11	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)			CATTCTCCTGGCGAGAGTACGAGGTGGTCCAGGCCCCCGGAACGTTGC	0.623																																					p.41_50del		.											.	ADPRHL1	90	1	Substitution - coding silent(1)	lung(1)	c.121_148del						.																																			SO:0001589	frameshift_variant	113622	exon1			CTCCTGGCGAGAG	AJ313429	CCDS9535.1, CCDS9536.1	13q34	2003-06-19			ENSG00000153531	ENSG00000153531			21303	protein-coding gene	gene with protein product		610620				12070318	Standard	NM_138430		Approved	ARH2	uc001vtq.1	Q8NDY3	OTTHUMG00000017386	ENST00000375418.3:c.121_148delGGGGGCCTGGACCACCTCGTACTCTCGC	13.37:g.114107605_114107632delGCGAGAGTACGAGGTGGTCCAGGCCCCC	ENSP00000364567:p.Gly41fs	107.0	0.0		96.0	9.0	NM_138430	Q5JUG2|Q96GD1	Frame_Shift_Del	DEL	ENST00000375418.3	37	CCDS9535.1																																																																																			.		0.623	ADPRHL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045915.2	NM_138430	
AGBL1	123624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	87097615	87097615	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:87097615G>A	ENST00000441037.2	+	20	2798	c.2703G>A	c.(2701-2703)aaG>aaA	p.K901K	AGBL1_ENST00000389298.3_Silent_p.K632K|AGBL1_ENST00000421325.2_Silent_p.K901K	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	901					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						TCCTTGATAAGCTAGCACCAG	0.463																																					p.K901K		.											.	.	.	0			c.G2703A						.						31.0	31.0	31.0					15																	87097615		1870	4103	5973	SO:0001819	synonymous_variant	123624	exon20			TGATAAGCTAGCA	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2703G>A	15.37:g.87097615G>A		72.0	0.0		61.0	23.0	NM_152336	A1A4X5|A6NJH6|C9JHL5	Silent	SNP	ENST00000441037.2	37	CCDS58398.1																																																																																			.		0.463	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336	
AHNAK2	113146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105413999	105413999	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr14:105413999C>A	ENST00000333244.5	-	7	7908	c.7789G>T	c.(7789-7791)Ggc>Tgc	p.G2597C	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2597						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCCTTGGGGCCTTTCAGGTCC	0.617																																					p.G2597C		.											.	AHNAK2	47	0			c.G7789T						.						123.0	135.0	131.0					14																	105413999		1861	4092	5953	SO:0001583	missense	113146	exon7			TGGGGCCTTTCAG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7789G>T	14.37:g.105413999C>A	ENSP00000353114:p.Gly2597Cys	198.0	0.0		183.0	76.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	11.90	1.777164	0.31411	.	.	ENSG00000185567	ENST00000333244	T	0.03468	3.92	3.56	3.56	0.40772	.	.	.	.	.	T	0.19248	0.0462	M	0.88775	2.98	0.09310	N	1	D	0.63046	0.992	P	0.60473	0.875	T	0.04103	-1.0977	9	0.54805	T	0.06	.	14.1715	0.65512	0.0:1.0:0.0:0.0	.	2597	Q8IVF2	AHNK2_HUMAN	C	2597	ENSP00000353114:G2597C	ENSP00000353114:G2597C	G	-	1	0	AHNAK2	104485044	0.000000	0.05858	0.059000	0.19551	0.263000	0.26337	0.184000	0.16939	1.543000	0.49345	0.485000	0.47835	GGC	.		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AKR1B15	441282	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	134262493	134262493	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:134262493C>A	ENST00000457545.2	+	11	1207	c.947C>A	c.(946-948)aCc>aAc	p.T316N	AKR1B15_ENST00000423958.1_Missense_Mutation_p.T288N	NM_001080538.2	NP_001074007.2	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	316							oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|urinary_tract(1)	18						GAGATGGCAACCATACTCAGC	0.428																																					p.T316N		.											.	AKR1B15	23	0			c.C947A						.						69.0	67.0	68.0					7																	134262493		2203	4300	6503	SO:0001583	missense	441282	exon11			TGGCAACCATACT		CCDS47715.1, CCDS47715.2	7q33	2009-09-09			ENSG00000227471	ENSG00000227471		"""Aldo-keto reductases"""	37281	protein-coding gene	gene with protein product							Standard	NM_001080538		Approved		uc011kpr.2	C9JRZ8	OTTHUMG00000155376	ENST00000457545.2:c.947C>A	7.37:g.134262493C>A	ENSP00000389289:p.Thr316Asn	117.0	1.0		127.0	74.0	NM_001080538	C9J3V2	Missense_Mutation	SNP	ENST00000457545.2	37	CCDS47715.2	.	.	.	.	.	.	.	.	.	.	C	2.121	-0.401317	0.04865	.	.	ENSG00000227471	ENST00000457545;ENST00000423958	T;T	0.24908	1.83;1.83	3.8	2.87	0.33458	NADP-dependent oxidoreductase domain (3);	.	.	.	.	T	0.32615	0.0835	L	0.45228	1.405	0.09310	N	1	B;P	0.47484	0.08;0.896	B;P	0.52710	0.044;0.707	T	0.08046	-1.0741	9	0.48119	T	0.1	.	10.3599	0.43987	0.1986:0.8014:0.0:0.0	.	288;316	C9JRZ8-2;C9JRZ8	.;AK1BF_HUMAN	N	316;288	ENSP00000389289:T316N;ENSP00000397009:T288N	ENSP00000397009:T288N	T	+	2	0	AKR1B15	133913033	0.000000	0.05858	0.001000	0.08648	0.029000	0.11900	0.286000	0.18902	0.659000	0.30945	0.405000	0.27470	ACC	.		0.428	AKR1B15-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339726.2		
ALG1	56052	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	5121883	5121883	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:5121883G>A	ENST00000262374.5	+	1	64	c.33G>A	c.(31-33)ctG>ctA	p.L11L	ALG1_ENST00000544428.1_5'Flank|ALG1_ENST00000588623.1_Intron	NM_019109.4	NP_061982.3	Q9BT22	ALG1_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase	11					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipopolysaccharide biosynthetic process (GO:0009103)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitobiosyldiphosphodolichol beta-mannosyltransferase activity (GO:0004578)|mannosyltransferase activity (GO:0000030)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(90;0.0164)				TGCTGGCGCTGTGTctgctgc	0.721																																					p.L11L		.											.	ALG1	92	0			c.G33A						.						11.0	12.0	11.0					16																	5121883		2174	4256	6430	SO:0001819	synonymous_variant	56052	exon1			GGCGCTGTGTCTG	AB019038	CCDS10528.1	16p13.3	2013-02-22	2013-02-22		ENSG00000033011	ENSG00000033011	2.4.1.142	"""Glycosyltransferase group 1 domain containing"""	18294	protein-coding gene	gene with protein product		605907	"""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase)"", ""asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)"""			10704531	Standard	NM_019109		Approved	HMT-1, HMAT1	uc002cym.3	Q9BT22	OTTHUMG00000129529	ENST00000262374.5:c.33G>A	16.37:g.5121883G>A		29.0	0.0		18.0	14.0	NM_019109	B4DP08|Q6UVZ9|Q8N5Y4|Q9P2Y2	Silent	SNP	ENST00000262374.5	37	CCDS10528.1																																																																																			.		0.721	ALG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251716.2	NM_019109	
AMPH	273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	38457451	38457451	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:38457451C>A	ENST00000356264.2	-	17	1587	c.1372G>T	c.(1372-1374)Gct>Tct	p.A458S	AMPH_ENST00000428293.2_Intron|AMPH_ENST00000325590.5_Intron|AMPH_ENST00000471913.1_Intron	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	458					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						GGCTCCTCAGCCCGAGTGTCC	0.597																																					p.A458S		.											.	AMPH	95	0			c.G1372T						.						115.0	92.0	100.0					7																	38457451		2203	4300	6503	SO:0001583	missense	273	exon17			CCTCAGCCCGAGT		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1372G>T	7.37:g.38457451C>A	ENSP00000348602:p.Ala458Ser	74.0	0.0		67.0	19.0	NM_001635	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	37	CCDS5456.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.424877	0.43020	.	.	ENSG00000078053	ENST00000356264	T	0.59083	0.29	4.75	2.87	0.33458	.	.	.	.	.	T	0.25457	0.0619	N	0.08118	0	0.80722	D	1	B	0.32245	0.361	B	0.24155	0.051	T	0.10359	-1.0633	9	0.07030	T	0.85	9.8062	5.0881	0.14693	0.0:0.4882:0.2886:0.2231	.	458	P49418	AMPH_HUMAN	S	458	ENSP00000348602:A458S	ENSP00000348602:A458S	A	-	1	0	AMPH	38423976	0.164000	0.22935	0.920000	0.36463	0.973000	0.67179	0.102000	0.15272	0.990000	0.38787	0.609000	0.83330	GCT	.		0.597	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	
ANKDD1A	348094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	65208032	65208032	+	Missense_Mutation	SNP	G	G	A	rs553148491		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:65208032G>A	ENST00000380230.3	+	2	100	c.71G>A	c.(70-72)cGc>cAc	p.R24H	ANKDD1A_ENST00000357698.3_Missense_Mutation_p.R24H|ANKDD1A_ENST00000491145.1_3'UTR|ANKDD1A_ENST00000319580.8_Intron|AC069368.3_ENST00000437723.1_Intron|ANKDD1A_ENST00000496660.1_Intron|ANKDD1A_ENST00000395720.1_Missense_Mutation_p.R24H	NM_182703.3	NP_874362.3	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A	24					signal transduction (GO:0007165)					NS(1)|endometrium(1)|large_intestine(10)|liver(2)|lung(4)|ovary(1)|prostate(2)	21						GAGGCCGCCCGCCAGAACAAT	0.597													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18846	0.0		0.0	False		,,,				2504	0.0				p.R24H		.											.	ANKDD1A	69	0			c.G71A						.						34.0	38.0	37.0					15																	65208032		1925	4132	6057	SO:0001583	missense	348094	exon2			CCGCCCGCCAGAA		CCDS10197.2	15q22.31	2013-01-10	2006-02-16		ENSG00000166839	ENSG00000166839		"""Ankyrin repeat domain containing"""	28002	protein-coding gene	gene with protein product						12477932	Standard	NM_182703		Approved	FLJ25870	uc002aoa.3	Q495B1	OTTHUMG00000133051	ENST00000380230.3:c.71G>A	15.37:g.65208032G>A	ENSP00000369579:p.Arg24His	57.0	0.0		43.0	13.0	NM_182703	Q495B2|Q495B3|Q8N7A0|Q8NBS5	Missense_Mutation	SNP	ENST00000380230.3	37	CCDS10197.2	.	.	.	.	.	.	.	.	.	.	G	15.22	2.769437	0.49680	.	.	ENSG00000166839	ENST00000380230;ENST00000357698;ENST00000395720	T;T;T	0.66460	-0.21;-0.21;-0.21	3.94	2.06	0.26882	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.66147	0.2760	L	0.37697	1.125	0.09310	N	0.999997	D;D	0.76494	0.999;0.999	D;D	0.66847	0.947;0.911	T	0.53858	-0.8379	9	0.14656	T	0.56	-9.5593	6.0201	0.19625	0.238:0.0:0.762:0.0	.	24;24	Q495B1;Q495B1-1	AKD1A_HUMAN;.	H	24	ENSP00000369579:R24H;ENSP00000350329:R24H;ENSP00000379070:R24H	ENSP00000350329:R24H	R	+	2	0	ANKDD1A	62995085	0.098000	0.21812	0.018000	0.16275	0.787000	0.44495	1.223000	0.32527	0.363000	0.24346	0.484000	0.47621	CGC	.		0.597	ANKDD1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256705.2	NM_182703	
ANKFN1	162282	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	54559743	54559743	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr17:54559743G>A	ENST00000318698.2	+	17	2162	c.2127G>A	c.(2125-2127)caG>caA	p.Q709Q	ANKFN1_ENST00000566473.2_Silent_p.Q709Q	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	709										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						TCTACACACAGGAGGTGTTGG	0.517																																					p.Q709Q		.											.	ANKFN1	136	0			c.G2127A						.						165.0	152.0	157.0					17																	54559743		2203	4300	6503	SO:0001819	synonymous_variant	162282	exon17			CACACAGGAGGTG	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.2127G>A	17.37:g.54559743G>A		195.0	2.0		133.0	47.0	NM_153228		Silent	SNP	ENST00000318698.2	37	CCDS32686.1																																																																																			.		0.517	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228	
ANKRD27	84079	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	33096767	33096767	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:33096767G>A	ENST00000306065.4	-	24	2625	c.2467C>T	c.(2467-2469)Cac>Tac	p.H823Y	SNORA68_ENST00000364518.1_RNA	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	823					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					ACAAGCTCGTGATGGCCACCG	0.587																																					p.H823Y		.											.	ANKRD27	95	0			c.C2467T						.						123.0	109.0	114.0					19																	33096767		2203	4300	6503	SO:0001583	missense	84079	exon24			GCTCGTGATGGCC	AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.2467C>T	19.37:g.33096767G>A	ENSP00000304292:p.His823Tyr	166.0	0.0		454.0	292.0	NM_032139	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	ENST00000306065.4	37	CCDS32986.1	.	.	.	.	.	.	.	.	.	.	G	0.416	-0.910890	0.02434	.	.	ENSG00000105186	ENST00000306065	T	0.64438	-0.1	5.92	5.92	0.95590	Ankyrin repeat-containing domain (4);	0.095833	0.45606	D	0.000348	T	0.38348	0.1037	N	0.04132	-0.27	0.80722	D	1	B	0.13145	0.007	B	0.14578	0.011	T	0.34625	-0.9821	10	0.10902	T	0.67	-29.3388	14.4765	0.67548	0.072:0.0:0.928:0.0	.	823	Q96NW4	ANR27_HUMAN	Y	823	ENSP00000304292:H823Y	ENSP00000304292:H823Y	H	-	1	0	ANKRD27	37788607	1.000000	0.71417	0.784000	0.31847	0.024000	0.10985	6.296000	0.72751	2.809000	0.96659	0.650000	0.86243	CAC	.		0.587	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139	
AP5Z1	9907	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	4825905	4825905	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:4825905A>T	ENST00000348624.4	+	10	1251	c.1157A>T	c.(1156-1158)gAa>gTa	p.E386V	MIR4656_ENST00000579503.1_RNA|AP5Z1_ENST00000401897.1_Missense_Mutation_p.E386V	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	386					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											GTGGACTCGGAAGCCGTCTAC	0.627																																					p.E386V		.											.	.	.	0			c.A1157T						.						41.0	49.0	46.0					7																	4825905		1986	4145	6131	SO:0001583	missense	9907	exon10			ACTCGGAAGCCGT	AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.1157A>T	7.37:g.4825905A>T	ENSP00000297562:p.Glu386Val	64.0	0.0		73.0	30.0	NM_014855	Q8N3X2|Q96H80	Missense_Mutation	SNP	ENST00000348624.4	37	CCDS47528.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.044372	0.75732	.	.	ENSG00000242802	ENST00000348624;ENST00000401897	T;T	0.53206	0.65;0.63	5.29	2.89	0.33648	.	0.408719	0.26079	N	0.026467	T	0.58623	0.2135	M	0.78049	2.395	0.38295	D	0.94281	D	0.59357	0.985	P	0.55713	0.782	T	0.62110	-0.6923	10	0.72032	D	0.01	.	7.7425	0.28849	0.8331:0.0:0.1669:0.0	.	386	O43299	K0415_HUMAN	V	386	ENSP00000297562:E386V;ENSP00000384980:E386V	ENSP00000297562:E386V	E	+	2	0	KIAA0415	4792431	1.000000	0.71417	0.007000	0.13788	0.968000	0.65278	4.534000	0.60622	0.327000	0.23409	0.459000	0.35465	GAA	.		0.627	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323771.1		
ARHGAP17	55114	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	24955152	24955152	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:24955152C>T	ENST00000289968.6	-	15	1342	c.1273G>A	c.(1273-1275)Gtc>Atc	p.V425I	ARHGAP17_ENST00000441763.2_3'UTR|ARHGAP17_ENST00000303665.5_Missense_Mutation_p.V425I	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	425	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		ACCACATGGACGGATGTGGCT	0.443																																					p.V425I		.											.	ARHGAP17	227	0			c.G1273A						.						101.0	85.0	90.0					16																	24955152		2197	4300	6497	SO:0001583	missense	55114	exon15			CATGGACGGATGT	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.1273G>A	16.37:g.24955152C>T	ENSP00000289968:p.Val425Ile	73.0	1.0		121.0	31.0	NM_001006634	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	ENST00000289968.6	37	CCDS32409.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.232551	0.79688	.	.	ENSG00000140750	ENST00000289968;ENST00000303665;ENST00000455311	T;T	0.11495	2.77;2.77	5.91	5.91	0.95273	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.000000	0.37178	N	0.002214	T	0.21631	0.0521	N	0.25890	0.77	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.78314	0.991;0.987	T	0.01771	-1.1277	10	0.27082	T	0.32	.	17.7991	0.88581	0.0:1.0:0.0:0.0	.	425;425	Q68EM7-2;Q68EM7	.;RHG17_HUMAN	I	425	ENSP00000289968:V425I;ENSP00000303130:V425I	ENSP00000289968:V425I	V	-	1	0	ARHGAP17	24862653	1.000000	0.71417	0.933000	0.37362	0.965000	0.64279	7.374000	0.79633	2.808000	0.96608	0.655000	0.94253	GTC	.		0.443	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436548.3	NM_018054	
ARHGAP35	2909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	47424838	47424838	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:47424838A>T	ENST00000404338.3	+	1	2906	c.2906A>T	c.(2905-2907)aAc>aTc	p.N969I		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	969					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										GAGGTGTTTAACTCCCCCCGG	0.473																																					p.N969I		.											.	.	.	0			c.A2906T						.						55.0	55.0	55.0					19																	47424838		1926	4130	6056	SO:0001583	missense	2909	exon1			TGTTTAACTCCCC	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.2906A>T	19.37:g.47424838A>T	ENSP00000385720:p.Asn969Ile	111.0	0.0		130.0	68.0	NM_004491	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	37	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	A	10.99	1.506344	0.26949	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	T	0.07216	3.21	5.86	3.79	0.43588	.	0.300009	0.33272	N	0.005086	T	0.03959	0.0111	N	0.08118	0	0.32820	D	0.50265	P	0.36465	0.554	B	0.31869	0.137	T	0.19745	-1.0296	10	0.72032	D	0.01	-39.5541	7.3702	0.26798	0.7635:0.0:0.2365:0.0	.	969	Q9NRY4-2	.	I	969	ENSP00000385720:N969I	ENSP00000324820:N969I	N	+	2	0	ARHGAP35	52116678	0.621000	0.27077	0.992000	0.48379	0.975000	0.68041	1.285000	0.33261	1.058000	0.40530	0.533000	0.62120	AAC	.		0.473	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491	
ARID3B	10620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	74836781	74836781	+	Silent	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:74836781C>T	ENST00000346246.5	+	2	735	c.504C>T	c.(502-504)gtC>gtT	p.V168V		NM_006465.2	NP_006456.1	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)	168						nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						CACCTTCTGTCTCCACAGCAG	0.517																																					p.V168V		.											.	ARID3B	90	0			c.C504T						.						70.0	56.0	61.0					15																	74836781		2197	4296	6493	SO:0001819	synonymous_variant	10620	exon2			TTCTGTCTCCACA		CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000346246.5:c.504C>T	15.37:g.74836781C>T		104.0	0.0		77.0	27.0	NM_006465	O95443|Q59HC9|Q6P9C9	Silent	SNP	ENST00000346246.5	37	CCDS10264.1																																																																																			.		0.517	ARID3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280688.2	NM_006465	
ATP1A3	478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42492257	42492257	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:42492257G>T	ENST00000302102.5	-	4	338	c.188C>A	c.(187-189)gCc>gAc	p.A63D	ATP1A3_ENST00000545399.1_Missense_Mutation_p.A76D|ATP1A3_ENST00000468774.2_5'UTR|ATP1A3_ENST00000602133.1_Missense_Mutation_p.A33D|ATP1A3_ENST00000543770.1_Missense_Mutation_p.A74D	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	63					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						CCCATCCCGGGCCAGGATCTC	0.632																																					p.A76D		.											.	ATP1A3	92	0			c.C227A						.						92.0	96.0	95.0					19																	42492257		2203	4300	6503	SO:0001583	missense	478	exon4			TCCCGGGCCAGGA		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.188C>A	19.37:g.42492257G>T	ENSP00000302397:p.Ala63Asp	96.0	0.0		63.0	49.0	NM_001256214	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	ENST00000302102.5	37	CCDS12594.1	.	.	.	.	.	.	.	.	.	.	G	8.773	0.926333	0.18056	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000543770;ENST00000448429	T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32	4.09	3.02	0.34903	ATPase, P-type cation-transporter, N-terminal (2);	0.057698	0.64402	D	0.000002	T	0.74711	0.3752	L	0.56396	1.775	0.47547	D	0.999451	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.13407	0.003;0.001;0.009;0.002	T	0.67530	-0.5647	10	0.24483	T	0.36	.	11.67	0.51395	0.0:0.1816:0.8184:0.0	.	76;74;63;63	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	D	63;63;76;33;74;76	ENSP00000302397:A63D;ENSP00000411503:A63D;ENSP00000444688:A76D;ENSP00000437577:A74D	ENSP00000302397:A63D	A	-	2	0	ATP1A3	47184097	1.000000	0.71417	1.000000	0.80357	0.302000	0.27658	3.247000	0.51422	0.822000	0.34565	-0.479000	0.04858	GCC	.		0.632	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296	
BSN	8927	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49701930	49701930	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr3:49701930G>A	ENST00000296452.4	+	9	11797	c.11683G>A	c.(11683-11685)Gtg>Atg	p.V3895M		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3895					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TGGGGAGAGCGTGTTCTCCAA	0.627																																					p.V3895M		.											.	BSN	97	0			c.G11683A						.						53.0	62.0	59.0					3																	49701930		2203	4300	6503	SO:0001583	missense	8927	exon9			GAGAGCGTGTTCT	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.11683G>A	3.37:g.49701930G>A	ENSP00000296452:p.Val3895Met	55.0	0.0		30.0	8.0	NM_003458	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	G	9.813	1.183641	0.21870	.	.	ENSG00000164061	ENST00000296452	T	0.21734	1.99	5.04	4.17	0.49024	.	0.250174	0.31507	N	0.007528	T	0.11836	0.0288	L	0.34521	1.04	0.49299	D	0.999776	P	0.45176	0.852	B	0.24541	0.054	T	0.09037	-1.0693	10	0.30854	T	0.27	-7.0904	13.1455	0.59459	0.0785:0.0:0.9215:0.0	.	3895	Q9UPA5	BSN_HUMAN	M	3895	ENSP00000296452:V3895M	ENSP00000296452:V3895M	V	+	1	0	BSN	49676934	0.993000	0.37304	0.590000	0.28732	0.401000	0.30781	2.202000	0.42743	1.123000	0.41961	-0.258000	0.10820	GTG	.		0.627	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
C10orf113	387638	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	21414907	21414907	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:21414907C>T	ENST00000534331.1	-	2	363	c.313G>A	c.(313-315)Gca>Aca	p.A105T	NEBL_ENST00000417816.2_Intron|C10orf113_ENST00000377118.4_Missense_Mutation_p.A95T|C10orf113_ENST00000529198.1_3'UTR	NM_001010896.2	NP_001010896.2	Q5VZT2	CJ113_HUMAN	chromosome 10 open reading frame 113	105										endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|pancreas(1)	7						TCAGGAGCTGCCTGGATGGGC	0.572																																					p.A105T		.											.	C10orf113	93	0			c.G313A						.						63.0	64.0	63.0					10																	21414907		2203	4300	6503	SO:0001583	missense	387638	exon2			GAGCTGCCTGGAT		CCDS31162.1, CCDS31162.2, CCDS53496.1	10p12.31	2012-06-12			ENSG00000204683	ENSG00000204683			31447	protein-coding gene	gene with protein product							Standard	NM_001010896		Approved	bA165O3.1	uc001iqm.3	Q5VZT2	OTTHUMG00000017786	ENST00000534331.1:c.313G>A	10.37:g.21414907C>T	ENSP00000433646:p.Ala105Thr	110.0	1.0		93.0	32.0	NM_001010896	B9EIM9|E9PRX7	Missense_Mutation	SNP	ENST00000534331.1	37	CCDS31162.2	.	.	.	.	.	.	.	.	.	.	C	13.74	2.327267	0.41197	.	.	ENSG00000204683	ENST00000534331;ENST00000377118	T;T	0.38401	1.14;1.14	4.51	3.52	0.40303	.	.	.	.	.	T	0.34135	0.0887	N	0.08118	0	0.09310	N	1	D	0.71674	0.998	P	0.62014	0.897	T	0.12268	-1.0554	9	0.87932	D	0	-7.0274	9.2299	0.37430	0.2158:0.7842:0.0:0.0	.	105	Q5VZT2	CJ113_HUMAN	T	105;95	ENSP00000433646:A105T;ENSP00000366322:A95T	ENSP00000366322:A95T	A	-	1	0	C10orf113	21454913	0.984000	0.35163	0.308000	0.25141	0.859000	0.49053	1.085000	0.30840	2.484000	0.83849	0.460000	0.39030	GCA	.		0.572	C10orf113-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047108.3	NM_001010896	
C2orf16	84226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27804122	27804122	+	Silent	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:27804122C>A	ENST00000408964.2	+	1	4734	c.4683C>A	c.(4681-4683)ccC>ccA	p.P1561P	RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000556601.1_5'Flank|ZNF512_ENST00000355467.4_5'Flank|ZNF512_ENST00000413371.2_5'Flank|AC074091.1_ENST00000408604.1_RNA|ZNF512_ENST00000416005.2_5'Flank|ZNF512_ENST00000379717.1_5'Flank	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1561	Arg-rich.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					GTCATAACCCCTCTTGGAGAA	0.527																																					p.P1561P		.											.	C2orf16	67	0			c.C4683A						.						117.0	118.0	118.0					2																	27804122		1891	4109	6000	SO:0001819	synonymous_variant	84226	exon1			TAACCCCTCTTGG	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.4683C>A	2.37:g.27804122C>A		79.0	0.0		100.0	21.0	NM_032266	B9EIQ4|Q53S01|Q8ND64|Q9H088	Silent	SNP	ENST00000408964.2	37	CCDS42666.1																																																																																			.		0.527	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	NM_032266	
CACNA1S	779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	201021743	201021743	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:201021743G>T	ENST00000362061.3	-	32	4121	c.3895C>A	c.(3895-3897)Caa>Aaa	p.Q1299K	CACNA1S_ENST00000367338.3_Missense_Mutation_p.Q1280K	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1299					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CGGTTTATTTGGGTCCCATCC	0.562																																					p.Q1299K		.											.	CACNA1S	94	0			c.C3895A						.						266.0	228.0	241.0					1																	201021743		2203	4300	6503	SO:0001583	missense	779	exon32			TTATTTGGGTCCC	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.3895C>A	1.37:g.201021743G>T	ENSP00000355192:p.Gln1299Lys	123.0	0.0		113.0	38.0	NM_000069	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	37	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	.	16.64	3.178620	0.57692	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.98419	-4.92;-4.92	4.68	4.68	0.58851	Ion transport (1);	0.116892	0.64402	D	0.000017	D	0.97476	0.9174	M	0.72894	2.215	0.39160	D	0.962395	P	0.38473	0.633	B	0.42959	0.403	D	0.98619	1.0666	10	0.49607	T	0.09	.	13.6846	0.62508	0.0:0.1548:0.8451:0.0	.	1299	Q13698	CAC1S_HUMAN	K	1299;1280	ENSP00000355192:Q1299K;ENSP00000356307:Q1280K	ENSP00000355192:Q1299K	Q	-	1	0	CACNA1S	199288366	1.000000	0.71417	0.579000	0.28588	0.957000	0.61999	4.616000	0.61197	2.299000	0.77371	0.551000	0.68910	CAA	.		0.562	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
CACNA2D1	781	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	81591312	81591312	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:81591312G>T	ENST00000356253.5	-	36	3155	c.2900C>A	c.(2899-2901)gCc>gAc	p.A967D	CACNA2D1_ENST00000356860.3_Missense_Mutation_p.A955D|CACNA2D1_ENST00000535308.1_Missense_Mutation_p.A167D			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	967					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GGACAGGGAGGCCGTGAAGTC	0.483																																					p.A955D		.											.	CACNA2D1	96	0			c.C2864A						.						129.0	120.0	123.0					7																	81591312		2203	4300	6503	SO:0001583	missense	781	exon36			AGGGAGGCCGTGA	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2900C>A	7.37:g.81591312G>T	ENSP00000348589:p.Ala967Asp	160.0	1.0		84.0	27.0	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37		.	.	.	.	.	.	.	.	.	.	G	11.10	1.539029	0.27475	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000535308	T;T;T	0.71817	-0.6;-0.6;-0.6	5.19	5.19	0.71726	.	0.222326	0.45867	D	0.000340	T	0.46983	0.1421	N	0.02213	-0.635	0.31936	N	0.611528	B;B	0.13145	0.007;0.001	B;B	0.11329	0.006;0.002	T	0.38243	-0.9670	10	0.12103	T	0.63	-4.3879	19.123	0.93371	0.0:0.0:1.0:0.0	.	167;955	B7Z658;P54289-2	.;.	D	955;974;967;167	ENSP00000349320:A955D;ENSP00000348589:A967D;ENSP00000443124:A167D	ENSP00000284088:A974D	A	-	2	0	CACNA2D1	81429248	1.000000	0.71417	0.804000	0.32291	0.652000	0.38707	4.923000	0.63412	2.591000	0.87537	0.650000	0.86243	GCC	.		0.483	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
CASP8AP2	9994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	90577673	90577673	+	RNA	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr6:90577673G>A	ENST00000551025.1	+	0	6101									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		ACCTCTTCTGGCCTTAAACAG	0.408																																					p.G1555D	Colon(187;1656 2025 17045 31481 39901)	.											.	CASP8AP2	24	0			c.G4664A						.						158.0	141.0	146.0					6																	90577673		1926	4129	6055			9994	exon8			CTTCTGGCCTTAA	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90577673G>A		84.0	0.0		68.0	21.0	NM_001137667		Missense_Mutation	SNP	ENST00000551025.1	37																																																																																				.		0.408	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667	
CCDC13	152206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	42750569	42750569	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr3:42750569C>A	ENST00000310232.6	-	16	2134	c.2051G>T	c.(2050-2052)gGa>gTa	p.G684V	HHATL-AS1_ENST00000600839.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	684										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						CTCCTCCTTTCCCCGCAGGGC	0.587																																					p.G684V		.											.	CCDC13	91	0			c.G2051T						.						93.0	81.0	85.0					3																	42750569		2203	4300	6503	SO:0001583	missense	152206	exon16			TCCTTTCCCCGCA	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.2051G>T	3.37:g.42750569C>A	ENSP00000309836:p.Gly684Val	82.0	0.0		60.0	19.0	NM_144719		Missense_Mutation	SNP	ENST00000310232.6	37	CCDS2705.1	.	.	.	.	.	.	.	.	.	.	C	9.128	1.010651	0.19277	.	.	ENSG00000244607	ENST00000310232	T	0.23754	1.89	4.58	3.63	0.41609	.	0.474521	0.20779	N	0.085822	T	0.14787	0.0357	L	0.36672	1.1	0.28566	N	0.910859	B	0.27882	0.192	B	0.24541	0.054	T	0.06534	-1.0821	10	0.31617	T	0.26	.	1.6896	0.02849	0.2154:0.4638:0.1796:0.1412	.	684	Q8IYE1	CCD13_HUMAN	V	684	ENSP00000309836:G684V	ENSP00000309836:G684V	G	-	2	0	CCDC13	42725573	0.003000	0.15002	0.967000	0.41034	0.991000	0.79684	0.212000	0.17497	2.374000	0.81015	0.563000	0.77884	GGA	.		0.587	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	
CCDC141	285025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179701999	179701999	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:179701999C>A	ENST00000420890.2	-	23	4064	c.3947G>T	c.(3946-3948)aGt>aTt	p.S1316I	CCDC141_ENST00000295723.5_Missense_Mutation_p.S741I|CCDC141_ENST00000480419.1_5'UTR	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1316										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			ATGTTCAGCACTGATTCTGTG	0.483																																					p.S1316I		.											.	CCDC141	78	0			c.G3947T						.						120.0	105.0	110.0					2																	179701999		2203	4300	6503	SO:0001583	missense	285025	exon23			TCAGCACTGATTC	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3947G>T	2.37:g.179701999C>A	ENSP00000395995:p.Ser1316Ile	117.0	0.0		81.0	28.0	NM_173648	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	37		.	.	.	.	.	.	.	.	.	.	C	11.13	1.546935	0.27652	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.49139	0.79;1.35;1.34	5.71	-0.467	0.12150	.	0.737124	0.13245	N	0.402553	T	0.48077	0.1480	L	0.50333	1.59	0.09310	N	1	D;D	0.59767	0.986;0.958	P;P	0.54312	0.66;0.748	T	0.38023	-0.9680	10	0.87932	D	0	-1.0937	5.3175	0.15864	0.0:0.3511:0.1499:0.499	.	741;741	Q6ZP82;Q6ZP82-2	CC141_HUMAN;.	I	1316;760;741	ENSP00000395995:S1316I;ENSP00000344627:S760I;ENSP00000295723:S741I	ENSP00000295723:S741I	S	-	2	0	CCDC141	179410244	0.897000	0.30589	0.021000	0.16686	0.476000	0.33039	0.025000	0.13577	0.052000	0.16007	0.655000	0.94253	AGT	.		0.483	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648	
LINC00283	100874057	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	13	103398453	103398453	+	RNA	SNP	C	C	T	rs141118373	byFrequency	TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr13:103398453C>T	ENST00000430111.1	+	0	3894									long intergenic non-protein coding RNA 283																		TCTAAAGGACCCATTTGGAGA	0.408																																					p.G1532S		.											.	.	.	0			c.G4594A						.						111.0	96.0	101.0					13																	103398453		692	1590	2282			643677	exon4			AAGGACCCATTTG			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103398453C>T		84.0	0.0		81.0	25.0	NM_001146197		Missense_Mutation	SNP	ENST00000430111.1	37																																																																																				C|0.991;A|0.009		0.408	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
CCDC71	64925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49201424	49201424	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr3:49201424T>C	ENST00000321895.6	-	2	324	c.218A>G	c.(217-219)tAt>tGt	p.Y73C		NM_022903.3	NP_075054.3	Q8IV32	CCD71_HUMAN	coiled-coil domain containing 71	73										endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GCATGAACTATAGCCATAGAC	0.582																																					p.Y73C		.											.	CCDC71	91	0			c.A218G						.						109.0	88.0	95.0					3																	49201424		2203	4300	6503	SO:0001583	missense	64925	exon2			GAACTATAGCCAT	AK022862	CCDS2790.1	3p21.31	2014-02-12			ENSG00000177352	ENSG00000177352			25760	protein-coding gene	gene with protein product						12477932	Standard	NM_022903		Approved	FLJ12800	uc003cwg.4	Q8IV32	OTTHUMG00000156815	ENST00000321895.6:c.218A>G	3.37:g.49201424T>C	ENSP00000319006:p.Tyr73Cys	164.0	0.0		116.0	44.0	NM_022903	Q6IPE2|Q9H8H4|Q9H9F1	Missense_Mutation	SNP	ENST00000321895.6	37	CCDS2790.1	.	.	.	.	.	.	.	.	.	.	T	16.07	3.018752	0.54576	.	.	ENSG00000177352	ENST00000321895	T	0.67698	-0.28	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000003	T	0.80844	0.4701	M	0.68952	2.095	0.58432	D	0.999992	D	0.89917	1.0	D	0.91635	0.999	T	0.82762	-0.0297	10	0.87932	D	0	-5.2511	16.1997	0.82060	0.0:0.0:0.0:1.0	.	73	Q8IV32	CCD71_HUMAN	C	73	ENSP00000319006:Y73C	ENSP00000319006:Y73C	Y	-	2	0	CCDC71	49176428	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.204000	0.77872	2.240000	0.73641	0.528000	0.53228	TAT	.		0.582	CCDC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345980.1	NM_022903	
CCDC81	60494	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	86108768	86108768	+	Silent	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:86108768A>G	ENST00000445632.2	+	6	1013	c.741A>G	c.(739-741)aaA>aaG	p.K247K	CCDC81_ENST00000278487.3_Silent_p.K30K|CCDC81_ENST00000528728.1_Silent_p.K30K|CCDC81_ENST00000354755.1_Silent_p.K157K	NM_001156474.1	NP_001149946.1	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81	247										kidney(3)|large_intestine(8)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	20		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				AGTCAGACAAAGAAGAAGGCA	0.438																																					p.K247K		.											.	CCDC81	91	0			c.A741G						.						104.0	101.0	102.0					11																	86108768		2202	4299	6501	SO:0001819	synonymous_variant	60494	exon6			AGACAAAGAAGAA	AK131331	CCDS8276.1, CCDS53691.1	11q14.2	2006-03-09			ENSG00000149201	ENSG00000149201			26281	protein-coding gene	gene with protein product							Standard	NM_001156474		Approved	FLJ16339, FLJ23514	uc001pbx.2	Q6ZN84	OTTHUMG00000167213	ENST00000445632.2:c.741A>G	11.37:g.86108768A>G		57.0	1.0		50.0	25.0	NM_001156474	A0AVL7|Q53FW3|Q9H5E5	Silent	SNP	ENST00000445632.2	37	CCDS53691.1																																																																																			.		0.438	CCDC81-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393756.1	NM_021827	
CCDC97	90324	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	41822393	41822393	+	Silent	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:41822393C>T	ENST00000269967.3	+	2	273	c.151C>T	c.(151-153)Ctg>Ttg	p.L51L		NM_052848.1	NP_443080.1	Q96F63	CCD97_HUMAN	coiled-coil domain containing 97	51										biliary_tract(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	17						ACCAGTGGCCCTGGACAGTGA	0.617																																					p.L51L		.											.	CCDC97	90	0			c.C151T						.						67.0	59.0	62.0					19																	41822393		2203	4300	6503	SO:0001819	synonymous_variant	90324	exon2			GTGGCCCTGGACA	BC011577	CCDS12578.1	19q13.2	2008-02-05							28289	protein-coding gene	gene with protein product						12477932	Standard	NM_052848		Approved	FLJ40267, MGC20255	uc002oqg.3	Q96F63		ENST00000269967.3:c.151C>T	19.37:g.41822393C>T		142.0	1.0		100.0	70.0	NM_052848	Q658N6|Q96IF3	Silent	SNP	ENST00000269967.3	37	CCDS12578.1																																																																																			.		0.617	CCDC97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463293.1	NM_052848	
CDH20	28316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	59217241	59217241	+	Missense_Mutation	SNP	C	C	A	rs373889945		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr18:59217241C>A	ENST00000262717.4	+	11	2077	c.1679C>A	c.(1678-1680)tCt>tAt	p.S560Y	CDH20_ENST00000538374.1_Missense_Mutation_p.S560Y|CDH20_ENST00000536675.2_Missense_Mutation_p.S560Y			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	560	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				ACCAGGAGGTCTGGTTTCCGG	0.512																																					p.S560Y		.											.	CDH20	155	0			c.C1679A						.						47.0	49.0	49.0					18																	59217241		2203	4300	6503	SO:0001583	missense	28316	exon10			GGAGGTCTGGTTT	AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.1679C>A	18.37:g.59217241C>A	ENSP00000262717:p.Ser560Tyr	95.0	0.0		117.0	48.0	NM_031891	Q495S3	Missense_Mutation	SNP	ENST00000262717.4	37	CCDS11977.1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909440	0.72868	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.53640	0.61;0.61;0.61	5.93	5.93	0.95920	Cadherin (4);Cadherin-like (1);	0.257806	0.40818	N	0.001002	T	0.70002	0.3174	M	0.76574	2.34	0.42829	D	0.99401	D	0.55385	0.971	D	0.65323	0.934	T	0.70769	-0.4782	10	0.66056	D	0.02	.	20.3539	0.98825	0.0:1.0:0.0:0.0	.	560	Q9HBT6	CAD20_HUMAN	Y	560	ENSP00000444767:S560Y;ENSP00000442226:S560Y;ENSP00000262717:S560Y	ENSP00000262717:S560Y	S	+	2	0	CDH20	57368221	0.999000	0.42202	0.998000	0.56505	0.992000	0.81027	5.413000	0.66399	2.826000	0.97356	0.655000	0.94253	TCT	.		0.512	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	NM_031891	
CELA3B	23436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	22304871	22304871	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:22304871A>G	ENST00000337107.6	+	2	72	c.53A>G	c.(52-54)tAt>tGt	p.Y18C	RN7SL421P_ENST00000582599.1_RNA	NM_007352.2	NP_031378.1	P08861	CEL3B_HUMAN	chymotrypsin-like elastase family, member 3B	18					cholesterol metabolic process (GO:0008203)|proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			breast(2)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						GCCTCAGGCTATGGCCCACCT	0.617																																					p.Y18C		.											.	CELA3B	91	0			c.A53G						.						147.0	95.0	113.0					1																	22304871		2203	4300	6503	SO:0001583	missense	23436	exon2			CAGGCTATGGCCC	M18692	CCDS219.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000219073	ENSG00000219073	3.4.21.70		15945	protein-coding gene	gene with protein product	"""proteinase E"", ""elastase 1"", ""cholesterol-binding pancreatic protease"", ""pancreatic endopeptidase E"""		"""elastase 3B, pancreatic"""	ELA3B		2826474, 2460440	Standard	NM_007352		Approved	CBPP	uc001bfk.3	P08861	OTTHUMG00000002758	ENST00000337107.6:c.53A>G	1.37:g.22304871A>G	ENSP00000338369:p.Tyr18Cys	102.0	0.0		108.0	42.0	NM_007352	B2RE44|P11423|Q5VU28|Q5VU29|Q5VU30	Missense_Mutation	SNP	ENST00000337107.6	37	CCDS219.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.219679	0.00286	.	.	ENSG00000219073	ENST00000337107;ENST00000374666	D;D	0.87491	-2.26;-1.97	4.87	-0.968	0.10313	Peptidase cysteine/serine, trypsin-like (1);	0.351400	0.33290	N	0.005062	T	0.43612	0.1255	N	0.00089	-2.185	0.23689	N	0.997105	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.59532	-0.7437	10	0.02654	T	1	-3.9411	2.807	0.05430	0.1603:0.2802:0.4313:0.1282	.	18;18	B1AQ52;P08861	.;CEL3B_HUMAN	C	18;34	ENSP00000338369:Y18C;ENSP00000363798:Y34C	ENSP00000338369:Y18C	Y	+	2	0	CELA3B	22177458	1.000000	0.71417	0.549000	0.28204	0.008000	0.06430	3.343000	0.52167	-0.445000	0.07159	-1.080000	0.02220	TAT	.		0.617	CELA3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007797.1	NM_007352	
CELSR2	1952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	109810616	109810616	+	Silent	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:109810616G>T	ENST00000271332.3	+	17	6313	c.6252G>T	c.(6250-6252)ctG>ctT	p.L2084L		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2084					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCACGCGGCTGCTGGCCCACG	0.667																																					p.L2084L	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2	526	0			c.G6252T						.						30.0	32.0	31.0					1																	109810616		2203	4300	6503	SO:0001819	synonymous_variant	1952	exon17			GCGGCTGCTGGCC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.6252G>T	1.37:g.109810616G>T		45.0	0.0		32.0	9.0	NM_001408	Q5T2Y7|Q92566	Silent	SNP	ENST00000271332.3	37	CCDS796.1																																																																																			.		0.667	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
CHST3	9469	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	73767615	73767615	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:73767615C>A	ENST00000373115.4	+	3	1263	c.826C>A	c.(826-828)Cgc>Agc	p.R276S		NM_004273.4	NP_004264.2	Q7LGC8	CHST3_HUMAN	carbohydrate (chondroitin 6) sulfotransferase 3	276					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)|T cell homeostasis (GO:0043029)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|proteoglycan sulfotransferase activity (GO:0050698)|sulfotransferase activity (GO:0008146)			endometrium(1)|lung(5)	6						CAAGGCGGTGCGCATCCGGCA	0.721																																					p.R276S		.											.	CHST3	90	0			c.C826A						.						8.0	9.0	9.0					10																	73767615		2161	4181	6342	SO:0001583	missense	9469	exon3			GCGGTGCGCATCC	AB017915	CCDS7312.1	10q22.1	2007-03-14			ENSG00000122863	ENSG00000122863		"""Sulfotransferases, membrane-bound"""	1971	protein-coding gene	gene with protein product		603799				9883891, 9714738	Standard	NM_004273		Approved	C6ST, C6ST1	uc001jsn.3	Q7LGC8	OTTHUMG00000018431	ENST00000373115.4:c.826C>A	10.37:g.73767615C>A	ENSP00000362207:p.Arg276Ser	19.0	0.0		25.0	10.0	NM_004273	O75099|Q52M30	Missense_Mutation	SNP	ENST00000373115.4	37	CCDS7312.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.066645	0.76301	.	.	ENSG00000122863	ENST00000373115	D	0.84146	-1.81	5.8	5.8	0.92144	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.94112	0.8112	M	0.91663	3.23	0.80722	D	1	D	0.71674	0.998	D	0.70716	0.97	D	0.94771	0.7945	10	0.87932	D	0	-29.025	19.0419	0.93004	0.0:1.0:0.0:0.0	.	276	Q7LGC8	CHST3_HUMAN	S	276	ENSP00000362207:R276S	ENSP00000362207:R276S	R	+	1	0	CHST3	73437621	0.998000	0.40836	0.994000	0.49952	0.980000	0.70556	3.110000	0.50352	2.758000	0.94735	0.561000	0.74099	CGC	.		0.721	CHST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048563.1	NM_004273	
CNTNAP4	85445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	76592443	76592443	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:76592443A>G	ENST00000476707.1	+	23	3938	c.3799A>G	c.(3799-3801)Att>Gtt	p.I1267V	CNTNAP4_ENST00000307431.8_Missense_Mutation_p.I1263V|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.I1191V|RP11-58C22.1_ENST00000563764.1_Intron|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.I1215V|CNTNAP4_ENST00000469589.1_3'UTR			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	1264					cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						AGCTGTTCGCATTTATCAGCA	0.358																																					p.I1191V		.											.	CNTNAP4	70	0			c.A3571G						.						85.0	84.0	84.0					16																	76592443		1959	4197	6156	SO:0001583	missense	85445	exon23			GTTCGCATTTATC	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.3799A>G	16.37:g.76592443A>G	ENSP00000417628:p.Ile1267Val	172.0	0.0		176.0	52.0	NM_138994	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	A	12.32	1.902010	0.33535	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	5.65	4.54	0.55810	.	0.000000	0.42053	D	0.000772	T	0.43831	0.1265	.	.	.	0.36153	D	0.84761	B;B;B	0.26547	0.017;0.046;0.152	B;B;B	0.25987	0.02;0.023;0.065	T	0.49263	-0.8958	9	0.38643	T	0.18	.	12.1231	0.53903	0.8716:0.0:0.0:0.1284	.	1191;1267;1264	E9PFZ6;E9PDN6;Q9C0A0	.;.;CNTP4_HUMAN	V	1263;1215;1191;1267	ENSP00000306893:I1263V;ENSP00000439733:I1215V;ENSP00000418741:I1191V;ENSP00000417628:I1267V	ENSP00000306893:I1263V	I	+	1	0	CNTNAP4	75149944	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.984000	0.56923	1.111000	0.41721	0.533000	0.62120	ATT	.		0.358	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
COL22A1	169044	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	139737668	139737668	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr8:139737668G>A	ENST00000303045.6	-	24	2601	c.2155C>T	c.(2155-2157)Cct>Tct	p.P719S	COL22A1_ENST00000435777.1_Missense_Mutation_p.P719S	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	719	Collagen-like 5.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GGGACACCAGGGGGTCCTGGA	0.582										HNSCC(7;0.00092)																											p.P719S		.											.	COL22A1	103	0			c.C2155T						.						51.0	59.0	56.0					8																	139737668		2203	4300	6503	SO:0001583	missense	169044	exon24			CACCAGGGGGTCC	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2155C>T	8.37:g.139737668G>A	ENSP00000303153:p.Pro719Ser	92.0	0.0		214.0	10.0	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.054787	0.36277	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.98649	-5.05;-5.05	4.94	4.07	0.47477	.	0.000000	0.49916	D	0.000132	D	0.97414	0.9154	M	0.77820	2.39	0.44485	D	0.997428	B;B	0.31931	0.347;0.186	B;B	0.35859	0.135;0.212	D	0.96101	0.9069	10	0.20046	T	0.44	.	9.9387	0.41567	0.0965:0.0:0.9035:0.0	.	719;719	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	S	719;719;432	ENSP00000303153:P719S;ENSP00000387655:P719S	ENSP00000303153:P719S	P	-	1	0	COL22A1	139806850	0.982000	0.34865	0.638000	0.29380	0.820000	0.46376	2.896000	0.48656	1.390000	0.46547	-0.140000	0.14226	CCT	.		0.582	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
COL23A1	91522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	177669082	177669082	+	Silent	SNP	G	G	T	rs551123931		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:177669082G>T	ENST00000390654.3	-	27	1899	c.1542C>A	c.(1540-1542)ggC>ggA	p.G514G		NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	514	Collagen-like 5.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		GTCCCGGCTCGCCCTTCTGGC	0.662																																					p.G514G		.											.	COL23A1	91	0			c.C1542A						.						14.0	19.0	18.0					5																	177669082		1929	4066	5995	SO:0001819	synonymous_variant	91522	exon27			CGGCTCGCCCTTC	AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.1542C>A	5.37:g.177669082G>T		53.0	0.0		46.0	8.0	NM_173465	Q8IVR4|Q9NT93	Silent	SNP	ENST00000390654.3	37	CCDS4436.1																																																																																			.		0.662	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253475.1	NM_173465	
COL3A1	1281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	189850437	189850437	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:189850437G>C	ENST00000304636.3	+	4	550	c.380G>C	c.(379-381)gGa>gCa	p.G127A	COL3A1_ENST00000317840.5_Missense_Mutation_p.G127A	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	127					aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	GGTATTCCAGGACAACCAGGG	0.443																																					p.G127A		.											.	COL3A1	581	0			c.G380C						.						41.0	44.0	43.0					2																	189850437		2203	4300	6503	SO:0001583	missense	1281	exon4			TTCCAGGACAACC	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.380G>C	2.37:g.189850437G>C	ENSP00000304408:p.Gly127Ala	232.0	0.0		192.0	74.0	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486957	0.84854	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.99329	-5.75;-5.75	4.62	4.62	0.57501	.	0.000000	0.47455	D	0.000238	D	0.99504	0.9823	M	0.91768	3.24	0.49798	D	0.999828	D	0.89917	1.0	D	0.91635	0.999	D	0.98179	1.0456	10	0.87932	D	0	.	15.8159	0.78599	0.0:0.0:1.0:0.0	.	127	P02461	CO3A1_HUMAN	A	127	ENSP00000304408:G127A;ENSP00000315243:G127A	ENSP00000304408:G127A	G	+	2	0	COL3A1	189558682	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	9.010000	0.93611	2.414000	0.81942	0.313000	0.20887	GGA	.		0.443	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
CPT1C	126129	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50200664	50200664	+	Missense_Mutation	SNP	C	C	A	rs201792786		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:50200664C>A	ENST00000392518.4	+	4	595	c.223C>A	c.(223-225)Ctc>Atc	p.L75I	CPT1C_ENST00000323446.5_Missense_Mutation_p.L75I|CPT1C_ENST00000598293.1_Missense_Mutation_p.L75I|CPT1C_ENST00000405931.2_Missense_Mutation_p.L75I|CPT1C_ENST00000354199.5_Missense_Mutation_p.L75I	NM_001199752.1	NP_001186681.1	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C	75					carnitine metabolic process (GO:0009437)|fatty acid beta-oxidation (GO:0006635)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endoplasmic reticulum membrane (GO:0005789)|mitochondrial outer membrane (GO:0005741)|synapse (GO:0045202)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		TGCCTGGTTCCTCCAGCTGGA	0.557																																					p.L75I		.											.	CPT1C	92	0			c.C223A						.						175.0	133.0	147.0					19																	50200664		2203	4300	6503	SO:0001583	missense	126129	exon4			TGGTTCCTCCAGC	AF357970	CCDS12779.1, CCDS46147.1	19q13.33	2014-03-14				ENSG00000169169			18540	protein-coding gene	gene with protein product		608846				12376098, 11001805	Standard	NM_001136052		Approved	FLJ23809, CPTIC, CPT1P	uc010eng.3	Q8TCG5		ENST00000392518.4:c.223C>A	19.37:g.50200664C>A	ENSP00000376303:p.Leu75Ile	99.0	1.0		128.0	22.0	NM_001199752	A8K0Z8|Q5K6N5|Q8N6Q9|Q8NDS6|Q8TE84	Missense_Mutation	SNP	ENST00000392518.4	37	CCDS12779.1	.	.	.	.	.	.	.	.	.	.	c	9.303	1.053518	0.19907	.	.	ENSG00000169169	ENST00000392518;ENST00000354199;ENST00000405931;ENST00000323446	T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02	4.9	-0.105	0.13601	.	0.000000	0.36444	N	0.002582	T	0.56761	0.2007	L	0.28115	0.83	0.43593	D	0.995941	P;B;B	0.38440	0.631;0.024;0.028	B;B;B	0.36608	0.229;0.022;0.032	T	0.41822	-0.9487	10	0.21014	T	0.42	.	5.2501	0.15517	0.1446:0.2652:0.5004:0.0898	.	75;75;75	Q8TCG5-3;Q8TCG5-2;Q8TCG5	.;.;CPT1C_HUMAN	I	75	ENSP00000376303:L75I;ENSP00000346138:L75I;ENSP00000384465:L75I;ENSP00000319343:L75I	ENSP00000319343:L75I	L	+	1	0	CPT1C	54892476	0.005000	0.15991	0.575000	0.28536	0.867000	0.49689	0.827000	0.27421	0.466000	0.27193	0.538000	0.68166	CTC	C|0.999;T|0.000		0.557	CPT1C-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465873.1	NM_152359	
CRELD2	79174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50312939	50312939	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr22:50312939C>T	ENST00000328268.4	+	2	265	c.191C>T	c.(190-192)aCg>aTg	p.T64M	ALG12_ENST00000330817.6_5'Flank|CRELD2_ENST00000404488.3_Missense_Mutation_p.T64M|CRELD2_ENST00000407217.3_Missense_Mutation_p.T64M|CRELD2_ENST00000403427.3_Missense_Mutation_p.T64M	NM_024324.3	NP_077300.3	Q6UXH1	CREL2_HUMAN	cysteine-rich with EGF-like domains 2	64						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|stomach(3)	9		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.198)|LUAD - Lung adenocarcinoma(64;0.247)		GAGGAAAAGACGCTGTCCAAG	0.612																																					p.T64M		.											.	CRELD2	90	0			c.C191T						.						77.0	66.0	70.0					22																	50312939		2203	4300	6503	SO:0001583	missense	79174	exon2			AAAAGACGCTGTC	BC050675	CCDS14082.1, CCDS46730.1, CCDS63515.1, CCDS63516.1	22q13.33	2005-12-08			ENSG00000184164	ENSG00000184164			28150	protein-coding gene	gene with protein product		607171				12137942	Standard	XM_005261737		Approved	MGC11256	uc010hal.2	Q6UXH1	OTTHUMG00000150292	ENST00000328268.4:c.191C>T	22.37:g.50312939C>T	ENSP00000332223:p.Thr64Met	182.0	0.0		268.0	17.0	NM_024324	A5GZA2|A5GZA3|A5GZA4|A5GZA5|A5GZA6|Q4W0V0|Q86UC0|Q9BU47	Missense_Mutation	SNP	ENST00000328268.4	37	CCDS14082.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.305788	0.81247	.	.	ENSG00000184164	ENST00000450207;ENST00000404488;ENST00000328268;ENST00000407217;ENST00000403427	T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27	4.51	4.51	0.55191	.	0.170117	0.50627	D	0.000102	T	0.58018	0.2093	M	0.63428	1.95	0.38075	D	0.936483	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.73380	0.972;0.976;0.972;0.98;0.976;0.978	T	0.65928	-0.6049	10	0.66056	D	0.02	.	17.5664	0.87921	0.0:1.0:0.0:0.0	.	64;64;64;64;64;64	Q6UXH1-2;Q6UXH1-5;Q6UXH1-4;A5GZA6;Q6UXH1;Q6UXH1-3	.;.;.;.;CREL2_HUMAN;.	M	64	ENSP00000387769:T64M;ENSP00000383938:T64M;ENSP00000332223:T64M;ENSP00000386034:T64M;ENSP00000384111:T64M	ENSP00000332223:T64M	T	+	2	0	CRELD2	48698943	0.613000	0.27009	0.940000	0.37924	0.991000	0.79684	1.204000	0.32296	2.216000	0.71823	0.655000	0.94253	ACG	.		0.612	CRELD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317409.1	NM_024324	
CTBP2	1488	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	126715003	126715003	+	Intron	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:126715003G>A	ENST00000337195.5	-	3	458				CTBP2_ENST00000309035.6_Silent_p.P442P|CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000531469.1_Intron|CTBP2_ENST00000411419.2_Intron	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		CGCAAGGGGTGGGAGAGCTGT	0.677																																					p.P442P		.											.	CTBP2	90	0			c.C1326T						.						35.0	38.0	37.0					10																	126715003		2202	4300	6502	SO:0001627	intron_variant	1488	exon1			AGGGGTGGGAGAG	AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+12562C>T	10.37:g.126715003G>A		117.0	0.0		99.0	44.0	NM_022802	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Silent	SNP	ENST00000337195.5	37	CCDS7643.1																																																																																			.		0.677	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050900.3	NM_001083914	
DDX12P	440081	hgsc.bcm.edu;bcgsc.ca	37	12	9580257	9580257	+	IGR	DEL	C	C	-			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:9580257delC								RP13-735L24.1 (30044 upstream) : SNORA75 (17396 downstream)																							GTCGATCTGGCTCTGGAAGAG	0.488																																					.		.											.	.	.	0			.						.						159.0	163.0	162.0					12																	9580257		692	1591	2283	SO:0001628	intergenic_variant	440081	.			ATCTGGCTCTGGA																													12.37:g.9580257delC		377.0	0.0		340.0	51.0	.		RNA	DEL		37																																																																																				.	0	0.488								
DCN	1634	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	91558395	91558395	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:91558395A>G	ENST00000052754.5	-	3	812	c.311T>C	c.(310-312)cTg>cCg	p.L104P	DCN_ENST00000456569.2_Intron|DCN_ENST00000303320.3_Missense_Mutation_p.L104P|DCN_ENST00000420120.2_Intron|DCN_ENST00000552962.1_Missense_Mutation_p.L104P|DCN_ENST00000425043.1_Intron|DCN_ENST00000547568.2_Intron|DCN_ENST00000228329.5_Intron|DCN_ENST00000441303.2_Missense_Mutation_p.L104P|DCN_ENST00000393155.1_Missense_Mutation_p.L104P	NM_001920.3	NP_001911.1	P07585	PGS2_HUMAN	decorin	104					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|kidney development (GO:0001822)|organ morphogenesis (GO:0009887)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|placenta development (GO:0001890)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	collagen type VI trimer (GO:0005589)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|glycosaminoglycan binding (GO:0005539)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|skin(1)	20						AAGGTTCTTCAGGTTCTTAAA	0.378																																					p.L104P		.											.	DCN	555	0			c.T311C						.						141.0	125.0	131.0					12																	91558395		2203	4300	6503	SO:0001583	missense	1634	exon3			TTCTTCAGGTTCT	AF138300	CCDS9039.1, CCDS9040.1, CCDS9041.1, CCDS9042.1, CCDS44951.1	12q21.33	2014-04-16			ENSG00000011465	ENSG00000011465		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	2705	protein-coding gene	gene with protein product	"""decorin proteoglycan"""	125255				8432526	Standard	NM_133507		Approved	DSPG2, SLRR1B	uc001tbt.3	P07585	OTTHUMG00000169998	ENST00000052754.5:c.311T>C	12.37:g.91558395A>G	ENSP00000052754:p.Leu104Pro	93.0	1.0		94.0	17.0	NM_001920	Q9P0Z0|Q9P0Z1|Q9Y5N8|Q9Y5N9	Missense_Mutation	SNP	ENST00000052754.5	37	CCDS9039.1	.	.	.	.	.	.	.	.	.	.	A	18.82	3.705286	0.68615	.	.	ENSG00000011465	ENST00000052754;ENST00000303320;ENST00000393155;ENST00000552962;ENST00000441303;ENST00000547937;ENST00000552145;ENST00000550563;ENST00000549513	T;T;T;T;T;T;T;T;T	0.72167	-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.63	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.89694	0.6789	H	0.96833	3.89	0.80722	D	1	D;P	0.89917	1.0;0.796	D;B	0.81914	0.995;0.397	D	0.92947	0.6377	10	0.87932	D	0	.	16.6512	0.85203	1.0:0.0:0.0:0.0	.	104;104	P07585;P07585-4	PGS2_HUMAN;.	P	104	ENSP00000052754:L104P;ENSP00000302031:L104P;ENSP00000376862:L104P;ENSP00000447654:L104P;ENSP00000399815:L104P;ENSP00000449782:L104P;ENSP00000447886:L104P;ENSP00000449014:L104P;ENSP00000449438:L104P	ENSP00000052754:L104P	L	-	2	0	DCN	90082526	1.000000	0.71417	0.999000	0.59377	0.566000	0.35808	8.962000	0.93254	2.333000	0.79357	0.482000	0.46254	CTG	.		0.378	DCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406799.3	NM_133507	
DGKI	9162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	137080389	137080389	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:137080389C>A	ENST00000288490.5	-	33	3036	c.3036G>T	c.(3034-3036)caG>caT	p.Q1012H	DGKI_ENST00000453654.2_Missense_Mutation_p.Q681H|DGKI_ENST00000446122.1_Missense_Mutation_p.Q994H|DGKI_ENST00000424189.2_Missense_Mutation_p.Q1025H|DGKI_ENST00000494390.1_5'UTR	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	1012					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						CCACCAGAAGCTGGCACACAG	0.567																																					p.Q1012H		.											.	DGKI	228	0			c.G3036T						.						77.0	67.0	71.0					7																	137080389		2203	4300	6503	SO:0001583	missense	9162	exon33			CAGAAGCTGGCAC	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.3036G>T	7.37:g.137080389C>A	ENSP00000288490:p.Gln1012His	132.0	0.0		142.0	37.0	NM_004717	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	C	4.387	0.071385	0.08436	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.65916	-0.18;-0.18;-0.18	5.35	3.16	0.36331	Ankyrin repeat-containing domain (3);	0.127182	0.53938	D	0.000053	T	0.48714	0.1515	L	0.45744	1.44	0.35490	D	0.798896	B;B	0.09022	0.001;0.002	B;B	0.14023	0.006;0.01	T	0.48747	-0.9008	10	0.12103	T	0.63	.	8.9371	0.35706	0.0:0.7282:0.0:0.2718	.	681;1012	E9PFX6;O75912	.;DGKI_HUMAN	H	681;929;1015;1012;994	ENSP00000392161:Q681H;ENSP00000288490:Q1012H;ENSP00000399131:Q994H	ENSP00000288490:Q1012H	Q	-	3	2	DGKI	136730929	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.585000	0.23879	1.384000	0.46424	-0.145000	0.13849	CAG	.		0.567	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
DLGAP2	9228	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	1514022	1514022	+	Silent	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr8:1514022G>T	ENST00000421627.2	+	3	1298	c.1164G>T	c.(1162-1164)ctG>ctT	p.L388L	RP11-666I19.2_ENST00000518063.1_RNA	NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	467					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		AGCCGCTGCTGAAGTCCATCG	0.582																																					p.L388L		.											.	DLGAP2	22	0			c.G1164T						.						32.0	37.0	35.0					8																	1514022		2141	4271	6412	SO:0001819	synonymous_variant	9228	exon3			GCTGCTGAAGTCC	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1164G>T	8.37:g.1514022G>T		104.0	1.0		73.0	31.0	NM_004745	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	37	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	G	6.451	0.451371	0.12223	.	.	ENSG00000198010	ENST00000520901	.	.	.	4.55	-0.578	0.11724	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.3578	1.5784	0.02629	0.3834:0.1642:0.3269:0.1255	.	.	.	.	L	405	.	.	X	+	2	2	DLGAP2	1501429	0.920000	0.31207	0.414000	0.26521	0.718000	0.41266	0.412000	0.21131	-0.127000	0.11661	0.585000	0.79938	TGA	.		0.582	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
DLK2	65989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43418725	43418725	+	Missense_Mutation	SNP	T	T	A	rs80187636		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr6:43418725T>A	ENST00000357338.3	-	6	1404	c.704A>T	c.(703-705)gAc>gTc	p.D235V	DLK2_ENST00000372485.1_Missense_Mutation_p.D229V|DLK2_ENST00000372488.3_Missense_Mutation_p.D235V|DLK2_ENST00000414245.1_Missense_Mutation_p.D229V	NM_206539.1	NP_996262.1	Q6UY11	DLK2_HUMAN	delta-like 2 homolog (Drosophila)	235	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				negative regulation of Notch signaling pathway (GO:0045746)|regulation of fat cell differentiation (GO:0045598)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			GCAGAGGCAGTCGAAGTCGTG	0.632																																					p.D235V		.											.	DLK2	68	0			c.A704T						.						61.0	65.0	63.0					6																	43418725		2203	4300	6503	SO:0001583	missense	65989	exon6			AGGCAGTCGAAGT	AK055380	CCDS4897.1, CCDS75461.1	6p21.1	2008-02-05	2007-07-05	2007-07-05	ENSG00000171462	ENSG00000171462			21113	protein-coding gene	gene with protein product			"""EGF-like-domain, multiple 9"""	EGFL9			Standard	NM_001286656		Approved	MGC2487	uc003ovb.3	Q6UY11	OTTHUMG00000014735	ENST00000357338.3:c.704A>T	6.37:g.43418725T>A	ENSP00000349893:p.Asp235Val	102.0	0.0		114.0	50.0	NM_023932	B3KNZ7|Q5T3T8|Q9BQ54	Missense_Mutation	SNP	ENST00000357338.3	37	CCDS4897.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.51|15.51	2.854689|2.854689	0.51376|0.51376	.|.	.|.	ENSG00000171462|ENSG00000171462	ENST00000372485;ENST00000372488;ENST00000357338;ENST00000414245|ENST00000430324	D;D;D;D|.	0.91407|.	-2.84;-2.84;-2.84;-2.84|.	4.94|4.94	3.77|3.77	0.43336|0.43336	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);|.	0.359485|.	0.32120|.	N|.	0.006554|.	T|T	0.08403|0.08403	0.0209|0.0209	N|N	0.01473|0.01473	-0.845|-0.845	0.50813|0.50813	D|D	0.999896|0.999896	B|.	0.25272|.	0.122|.	B|.	0.25614|.	0.062|.	T|T	0.13629|0.13629	-1.0502|-1.0502	10|5	0.18276|.	T|.	0.48|.	.|.	10.4748|10.4748	0.44659|0.44659	0.0:0.0776:0.0:0.9224|0.0:0.0776:0.0:0.9224	.|.	235|.	Q6UY11|.	DLK2_HUMAN|.	V|S	229;235;235;229|141	ENSP00000361563:D229V;ENSP00000361566:D235V;ENSP00000349893:D235V;ENSP00000398906:D229V|.	ENSP00000349893:D235V|.	D|T	-|-	2|1	0|0	DLK2|DLK2	43526703|43526703	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.693000|0.693000	0.40251|0.40251	2.411000|2.411000	0.44600|0.44600	0.844000|0.844000	0.35094|0.35094	0.379000|0.379000	0.24179|0.24179	GAC|ACT	.		0.632	DLK2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040618.1	NM_023932	
DMD	1756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	32834720	32834720	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chrX:32834720T>A	ENST00000357033.4	-	6	601	c.395A>T	c.(394-396)cAa>cTa	p.Q132L	DMD_ENST00000288447.4_Missense_Mutation_p.Q124L|DMD_ENST00000378677.2_Missense_Mutation_p.Q128L	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	132	Actin-binding.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GTTGGTTTGTTGCAATCCAGC	0.373																																					p.Q132L		.											.	DMD	265	0			c.A395T						.						163.0	141.0	149.0					X																	32834720		2202	4300	6502	SO:0001583	missense	1756	exon6			GTTTGTTGCAATC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.395A>T	X.37:g.32834720T>A	ENSP00000354923:p.Gln132Leu	107.0	0.0		87.0	56.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.528591	0.85706	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	D;D;D	0.95724	-3.79;-3.79;-3.79	5.44	5.44	0.79542	Calponin homology domain (2);	0.000000	0.35495	U	0.003162	D	0.96809	0.8958	M	0.63169	1.94	0.80722	D	1	D;D;D;P;D	0.61080	0.989;0.979;0.988;0.892;0.979	P;P;D;B;P	0.65233	0.841;0.858;0.933;0.237;0.858	D	0.97321	0.9944	10	0.87932	D	0	.	14.5467	0.68035	0.0:0.0:0.0:1.0	.	132;124;124;132;128	F5H6K1;Q4G0X0;P11532-4;P11532;E9PDN5	.;.;.;DMD_HUMAN;.	L	124;128;132;132;9;124	ENSP00000367948:Q128L;ENSP00000354923:Q132L;ENSP00000288447:Q124L	ENSP00000288447:Q124L	Q	-	2	0	DMD	32744641	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.036000	0.88901	1.816000	0.52996	0.486000	0.48141	CAA	.		0.373	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
DNAH2	146754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7721980	7721980	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr17:7721980T>C	ENST00000572933.1	+	70	12016	c.10556T>C	c.(10555-10557)cTg>cCg	p.L3519P	DNAH2_ENST00000389173.2_Missense_Mutation_p.L3519P			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3519	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCCCAGCTGCTGGGCATTGTG	0.592																																					p.L3519P		.											.	DNAH2	102	0			c.T10556C						.						101.0	97.0	98.0					17																	7721980		2203	4300	6503	SO:0001583	missense	146754	exon69			AGCTGCTGGGCAT	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.10556T>C	17.37:g.7721980T>C	ENSP00000458355:p.Leu3519Pro	47.0	0.0		24.0	13.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	T	19.41	3.821380	0.71028	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.35789	1.29	4.34	4.34	0.51931	.	0.000000	0.64402	D	0.000014	T	0.75657	0.3879	H	0.99444	4.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85621	0.1264	10	0.87932	D	0	.	12.6744	0.56884	0.0:0.0:0.0:1.0	.	3480;3519	Q9P225-2;Q9P225	.;DYH2_HUMAN	P	3480;3519	ENSP00000373825:L3519P	ENSP00000353818:L3480P	L	+	2	0	DNAH2	7662705	1.000000	0.71417	0.980000	0.43619	0.854000	0.48673	4.435000	0.59941	1.819000	0.53055	0.460000	0.39030	CTG	.		0.592	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
DOCK10	55619	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	225669789	225669789	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:225669789G>T	ENST00000258390.7	-	37	4171	c.4104C>A	c.(4102-4104)ttC>ttA	p.F1368L	DOCK10_ENST00000409592.3_Missense_Mutation_p.F1362L	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1368					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AGATGCTGAAGAAGTCGGACA	0.398																																					p.F1368L		.											.	DOCK10	92	0			c.C4104A						.						38.0	38.0	38.0					2																	225669789		1831	4081	5912	SO:0001583	missense	55619	exon37			GCTGAAGAAGTCG	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.4104C>A	2.37:g.225669789G>T	ENSP00000258390:p.Phe1368Leu	377.0	1.0		253.0	95.0	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	37	CCDS46528.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.64|15.64	2.893358|2.893358	0.52121|0.52121	.|.	.|.	ENSG00000135905|ENSG00000135905	ENST00000409592;ENST00000258390|ENST00000422684	T;T|.	0.60548|.	4.83;0.18|.	5.87|5.87	4.06|4.06	0.47325|0.47325	.|.	0.047544|.	0.85682|.	D|.	0.000000|.	T|T	0.61211|0.61211	0.2329|0.2329	M|M	0.72894|0.72894	2.215|2.215	0.37996|0.37996	D|D	0.934065|0.934065	D;D;P;B|.	0.64830|.	0.994;0.982;0.874;0.089|.	D;D;P;B|.	0.72338|.	0.977;0.952;0.621;0.143|.	T|T	0.63148|0.63148	-0.6702|-0.6702	10|5	0.41790|.	T|.	0.15|.	.|.	4.6989|4.6989	0.12818|0.12818	0.2594:0.1662:0.5744:0.0|0.2594:0.1662:0.5744:0.0	.|.	1368;222;1362;30|.	Q96BY6;B4DF07;B3FL70;B4DEY4|.	DOC10_HUMAN;.;.;.|.	L|Y	1362;1368|250	ENSP00000386694:F1362L;ENSP00000258390:F1368L|.	ENSP00000258390:F1368L|.	F|S	-|-	3|2	2|0	DOCK10|DOCK10	225378033|225378033	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.791000|0.791000	0.44710|0.44710	2.607000|2.607000	0.46300|0.46300	0.923000|0.923000	0.37045|0.37045	-0.175000|-0.175000	0.13238|0.13238	TTC|TCT	.		0.398	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
DSCAM	1826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	42064797	42064797	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr21:42064797G>A	ENST00000400454.1	-	3	924	c.447C>T	c.(445-447)tcC>tcT	p.S149S		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	149	Ig-like C2-type 2.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CCTCCACCGAGGAGGGGATAA	0.532																																					p.S149S	Melanoma(134;970 1778 1785 21664 32388)	.											.	DSCAM	101	0			c.C447T						.						138.0	134.0	136.0					21																	42064797		2018	4173	6191	SO:0001819	synonymous_variant	1826	exon3			CACCGAGGAGGGG	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.447C>T	21.37:g.42064797G>A		104.0	0.0		64.0	19.0	NM_001271534	O60468	Silent	SNP	ENST00000400454.1	37	CCDS42929.1																																																																																			.		0.532	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
DTX3	196403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	58002913	58002913	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:58002913C>T	ENST00000548198.1	+	5	2526	c.1022C>T	c.(1021-1023)gCg>gTg	p.A341V	DTX3_ENST00000337737.3_Missense_Mutation_p.A341V|AC025165.8_ENST00000356672.3_RNA|DTX3_ENST00000551632.1_Missense_Mutation_p.A344V|ARHGEF25_ENST00000286494.4_5'Flank|ARHGEF25_ENST00000333972.7_5'Flank|DTX3_ENST00000548804.1_Missense_Mutation_p.A341V			Q8N9I9	DTX3_HUMAN	deltex 3, E3 ubiquitin ligase	341					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)|urinary_tract(1)	12	Melanoma(17;0.122)					GAGCTGAGAGCGAAGGGTATC	0.562																																					p.A341V		.											.	DTX3	1083	0			c.C1022T						.						117.0	119.0	118.0					12																	58002913		1991	4159	6150	SO:0001583	missense	196403	exon7			TGAGAGCGAAGGG	AK094385	CCDS41800.1, CCDS66410.1	12q13.2	2014-01-28	2014-01-28			ENSG00000178498		"""RING-type (C3HC4) zinc fingers"""	24457	protein-coding gene	gene with protein product		613142	"""deltex 3 homolog (Drosophila)"", ""deltex homolog 3 (Drosophila)"""			12670957	Standard	XM_005268697		Approved	FLJ34766, RNF154	uc001sow.1	Q8N9I9		ENST00000548198.1:c.1022C>T	12.37:g.58002913C>T	ENSP00000447873:p.Ala341Val	94.0	0.0		87.0	38.0	NM_178502	Q53ZZ2|Q8NAU6|Q8NDS8	Missense_Mutation	SNP	ENST00000548198.1	37	CCDS41800.1	.	.	.	.	.	.	.	.	.	.	c	10.18	1.278463	0.23307	.	.	ENSG00000178498	ENST00000548804;ENST00000337737;ENST00000548198;ENST00000551632	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	3.19	3.19	0.36642	.	0.522770	0.16601	U	0.207326	T	0.41050	0.1142	M	0.71920	2.185	0.32394	N	0.552796	P	0.40302	0.712	B	0.18263	0.021	T	0.63950	-0.6521	10	0.87932	D	0	.	13.9819	0.64310	0.0:1.0:0.0:0.0	.	341	Q8N9I9	DTX3_HUMAN	V	341;341;341;344	ENSP00000449294:A341V;ENSP00000338050:A341V;ENSP00000447873:A341V;ENSP00000448696:A344V	ENSP00000338050:A341V	A	+	2	0	DTX3	56289180	0.999000	0.42202	1.000000	0.80357	0.132000	0.20833	2.113000	0.41902	1.751000	0.51876	0.586000	0.80456	GCG	.		0.562	DTX3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407848.1	NM_178502	
DUOX1	53905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	45437120	45437120	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:45437120C>T	ENST00000321429.4	+	19	2571	c.2164C>T	c.(2164-2166)Cgg>Tgg	p.R722W	DUOX1_ENST00000389037.3_Missense_Mutation_p.R722W|DUOX1_ENST00000561166.1_Missense_Mutation_p.R368W	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	722					cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		GGAGGAAGAGCGGCAGGCGCT	0.567																																					p.R722W		.											.	DUOX1	142	0			c.C2164T						.						83.0	97.0	92.0					15																	45437120		2198	4298	6496	SO:0001583	missense	53905	exon19			GAAGAGCGGCAGG	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.2164C>T	15.37:g.45437120C>T	ENSP00000317997:p.Arg722Trp	84.0	0.0		59.0	25.0	NM_017434	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	ENST00000321429.4	37	CCDS32221.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.111177	0.56398	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	D;D	0.87887	-2.31;-2.31	4.81	2.88	0.33553	.	0.155171	0.53938	D	0.000048	D	0.90445	0.7008	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.88917	0.3363	10	0.62326	D	0.03	-35.7814	8.1009	0.30857	0.1809:0.6448:0.1743:0.0	.	722	Q9NRD9	DUOX1_HUMAN	W	722	ENSP00000317997:R722W;ENSP00000373689:R722W	ENSP00000317997:R722W	R	+	1	2	DUOX1	43224412	0.999000	0.42202	0.997000	0.53966	0.507000	0.33981	1.990000	0.40717	0.713000	0.32060	-0.181000	0.13052	CGG	.		0.567	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
DUS1L	64118	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	80019565	80019565	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr17:80019565C>T	ENST00000354321.7	-	6	1111	c.626G>A	c.(625-627)gGg>gAg	p.G209E	DUS1L_ENST00000306796.5_Missense_Mutation_p.G209E			Q6P1R4	DUS1L_HUMAN	dihydrouridine synthase 1-like (S. cerevisiae)	209							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|lung(2)|ovary(1)|skin(1)	6	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			CTGGATGTTCCCGTTAGCAAA	0.657																																					p.G209E		.											.	DUS1L	91	0			c.G626A						.						96.0	91.0	93.0					17																	80019565		2203	4300	6503	SO:0001583	missense	64118	exon7			ATGTTCCCGTTAG		CCDS32775.1	17q25.3	2005-08-09				ENSG00000169718			30086	protein-coding gene	gene with protein product						12477932	Standard	NM_022156		Approved	PP3111, DUS1	uc002kdr.4	Q6P1R4		ENST00000354321.7:c.626G>A	17.37:g.80019565C>T	ENSP00000346280:p.Gly209Glu	81.0	0.0		50.0	18.0	NM_022156	A6NHV4|Q96AI3	Missense_Mutation	SNP	ENST00000354321.7	37	CCDS32775.1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.883179	0.51908	.	.	ENSG00000169718	ENST00000354321;ENST00000306796;ENST00000542088;ENST00000538833	T;T;T	0.70869	-0.52;-0.52;-0.52	3.83	3.83	0.44106	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.90734	0.7092	H	0.99225	4.475	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94905	0.8060	10	0.87932	D	0	-39.3762	16.2497	0.82475	0.0:1.0:0.0:0.0	.	82;209;78	B4DPG7;Q6P1R4;Q9BTJ3	.;DUS1L_HUMAN;.	E	209;209;82;77	ENSP00000346280:G209E;ENSP00000303515:G209E;ENSP00000445110:G77E	ENSP00000303515:G209E	G	-	2	0	DUS1L	77612854	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	7.093000	0.76937	2.126000	0.65437	0.563000	0.77884	GGG	.		0.657	DUS1L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442347.1	NM_022156	
EGFLAM	133584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	38438475	38438475	+	Silent	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:38438475C>T	ENST00000354891.3	+	17	2728	c.2382C>T	c.(2380-2382)gcC>gcT	p.A794A	EGFLAM_ENST00000397202.2_Silent_p.A160A|EGFLAM_ENST00000322350.5_Silent_p.A794A|EGFLAM_ENST00000336740.6_Silent_p.A560A	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	794	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					CCCCTTGTGCCCATGGGGGCA	0.592																																					p.A794A	Colon(62;485 1295 3347 17454)	.											.	EGFLAM	187	0			c.C2382T						.						43.0	45.0	44.0					5																	38438475		2203	4300	6503	SO:0001819	synonymous_variant	133584	exon17			TTGTGCCCATGGG	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.2382C>T	5.37:g.38438475C>T		151.0	0.0		177.0	104.0	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	ENST00000354891.3	37	CCDS56363.1																																																																																			.		0.592	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
EP400	57634	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	132445446	132445446	+	Silent	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:132445446G>T	ENST00000333577.4	+	2	391	c.282G>T	c.(280-282)ctG>ctT	p.L94L	EP400_ENST00000389562.2_Silent_p.L94L|EP400_ENST00000332482.4_Silent_p.L94L|EP400_ENST00000330386.6_Silent_p.L94L|EP400_ENST00000389561.2_Silent_p.L94L			Q96L91	EP400_HUMAN	E1A binding protein p400	94					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		TGGCCCCACTGCCGCTCCCCA	0.617																																					p.L94L		.											.	EP400	520	0			c.G282T						.						44.0	44.0	44.0					12																	132445446		2203	4300	6503	SO:0001819	synonymous_variant	57634	exon2			CCCACTGCCGCTC	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.282G>T	12.37:g.132445446G>T		304.0	1.0		245.0	126.0	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				.		0.617	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
ESPNL	339768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	239010624	239010624	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:239010624C>T	ENST00000343063.3	+	2	600	c.337C>T	c.(337-339)Cgt>Tgt	p.R113C	ESPNL_ENST00000409169.1_Missense_Mutation_p.R113C	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	113										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		CCTGGCCGCCCGTTTTGGACA	0.697																																					p.R113C		.											.	ESPNL	69	0			c.C337T						.						18.0	21.0	20.0					2																	239010624		2202	4299	6501	SO:0001583	missense	339768	exon2			GCCGCCCGTTTTG	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.337C>T	2.37:g.239010624C>T	ENSP00000339115:p.Arg113Cys	59.0	0.0		46.0	18.0	NM_194312	Q66K27|Q6ZVG1|Q8IVU2	Missense_Mutation	SNP	ENST00000343063.3	37	CCDS2525.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.500345	0.85176	.	.	ENSG00000144488	ENST00000343063;ENST00000409169	T;T	0.66460	-0.21;-0.21	4.45	4.45	0.53987	Ankyrin repeat-containing domain (4);	0.099656	0.40302	U	0.001123	T	0.77425	0.4128	L	0.54908	1.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79490	-0.1782	10	0.62326	D	0.03	-35.566	14.0307	0.64613	0.0:1.0:0.0:0.0	.	113	Q6ZVH7	ESPNL_HUMAN	C	113	ENSP00000339115:R113C;ENSP00000386577:R113C	ENSP00000339115:R113C	R	+	1	0	ESPNL	238675363	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.561000	0.45905	2.039000	0.60335	0.484000	0.47621	CGT	.		0.697	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257164.2	NM_194312	
ESR1	2099	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	6	152129176	152129176	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr6:152129176C>A	ENST00000206249.3	+	1	491	c.129C>A	c.(127-129)taC>taA	p.Y43*	ESR1_ENST00000427531.2_5'Flank|ESR1_ENST00000443427.1_Nonsense_Mutation_p.Y43*|ESR1_ENST00000440973.1_Nonsense_Mutation_p.Y43*|ESR1_ENST00000338799.5_Nonsense_Mutation_p.Y43*|ESR1_ENST00000456483.2_Nonsense_Mutation_p.Y43*|ESR1_ENST00000406599.1_Nonsense_Mutation_p.Y43*	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	43	Interaction with DDX5; self-association.|Modulating (transactivation AF-1); mediates interaction with MACROD1.|Required for interaction with NCOA1.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	GCGAGGTGTACCTGGACAGCA	0.677																																					p.Y43X		.											.	ESR1	1042	0			c.C129A						.						24.0	27.0	26.0					6																	152129176		2203	4300	6503	SO:0001587	stop_gained	2099	exon1			GGTGTACCTGGAC	X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.129C>A	6.37:g.152129176C>A	ENSP00000206249:p.Tyr43*	57.0	0.0		62.0	25.0	NM_000125	Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Nonsense_Mutation	SNP	ENST00000206249.3	37	CCDS5234.1	.	.	.	.	.	.	.	.	.	.	C	39	7.630277	0.98399	.	.	ENSG00000091831	ENST00000404742;ENST00000440973;ENST00000338799;ENST00000456483;ENST00000446550;ENST00000443427;ENST00000206249;ENST00000406599	.	.	.	5.06	4.18	0.49190	.	0.242112	0.43919	D	0.000507	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.9107	0.35552	0.0:0.7734:0.0:0.2265	.	.	.	.	X	43	.	ENSP00000206249:Y43X	Y	+	3	2	ESR1	152170869	0.960000	0.32886	1.000000	0.80357	0.985000	0.73830	-0.056000	0.11787	2.359000	0.80004	0.563000	0.77884	TAC	.		0.677	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043308.1		
ESR2	2100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	64727461	64727461	+	Silent	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr14:64727461G>T	ENST00000341099.4	-	5	1075	c.658C>A	c.(658-660)Cgg>Agg	p.R220R	ESR2_ENST00000267525.6_Silent_p.R220R|ESR2_ENST00000557772.1_Silent_p.R220R|ESR2_ENST00000353772.3_Silent_p.R220R|ESR2_ENST00000542956.1_Silent_p.R220R|ESR2_ENST00000358599.5_Silent_p.R220R|ESR2_ENST00000553796.1_Silent_p.R220R|ESR2_ENST00000357782.2_Silent_p.R220R|ESR2_ENST00000554572.1_Silent_p.R220R|ESR2_ENST00000555278.1_Silent_p.R220R|ESR2_ENST00000555483.1_5'UTR	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	220	Steroid-binding.				brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	CTCTCTCTCCGGGAGCCTGAA	0.577																																					p.R220R		.											.	ESR2	611	0			c.C658A						.						28.0	29.0	29.0					14																	64727461		2191	4281	6472	SO:0001819	synonymous_variant	2100	exon4			CTCTCCGGGAGCC	X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.658C>A	14.37:g.64727461G>T		45.0	0.0		39.0	7.0	NM_001214902	A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Silent	SNP	ENST00000341099.4	37	CCDS9762.1																																																																																			.		0.577	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280621.1		
EVA1C	59271	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	33829933	33829933	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr21:33829933G>A	ENST00000300255.2	+	3	859	c.386G>A	c.(385-387)cGg>cAg	p.R129Q	EVA1C_ENST00000401402.3_Missense_Mutation_p.R129Q|EVA1C_ENST00000382699.3_Missense_Mutation_p.R129Q	NM_058187.3	NP_478067.2	P58658	EVA1C_HUMAN	eva-1 homolog C (C. elegans)	129	SUEL-type lectin 1. {ECO:0000255|PROSITE- ProRule:PRU00260}.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)										CAGAACCAGCGGGCCTGCCAC	0.527																																					p.R129Q		.											.	.	.	0			c.G386A						.						110.0	94.0	100.0					21																	33829933		2203	4300	6503	SO:0001583	missense	59271	exon3			ACCAGCGGGCCTG	AF358258	CCDS13614.1, CCDS68186.1	21q22.11	2012-11-05	2012-11-05	2012-11-05	ENSG00000166979	ENSG00000166979			13239	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 64"", ""chromosome 21 open reading frame 63"", ""family with sequence similarity 176, member C"""	C21orf64, C21orf63, FAM176C		11707072, 19470522	Standard	NM_058187		Approved	B18, PRED34, B19	uc002ypr.1	P58658	OTTHUMG00000064922	ENST00000300255.2:c.386G>A	21.37:g.33829933G>A	ENSP00000300255:p.Arg129Gln	205.0	0.0		160.0	28.0	NM_058187	A6ND58|Q8IXZ0	Missense_Mutation	SNP	ENST00000300255.2	37	CCDS13614.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.712689	0.89112	.	.	ENSG00000166979	ENST00000300255;ENST00000401402;ENST00000382699;ENST00000412833	T;T;T;T	0.16073	2.37;2.37;2.37;2.37	5.07	5.07	0.68467	D-galactoside/L-rhamnose binding SUEL lectin domain (2);	0.000000	0.85682	D	0.000000	T	0.29556	0.0737	N	0.21324	0.655	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.05273	-1.0895	10	0.34782	T	0.22	-15.943	18.4733	0.90782	0.0:0.0:1.0:0.0	.	129;129;129	A6ND58;P58658;B5MC74	.;CU063_HUMAN;.	Q	129;129;129;34	ENSP00000300255:R129Q;ENSP00000384594:R129Q;ENSP00000372146:R129Q;ENSP00000389269:R34Q	ENSP00000300255:R129Q	R	+	2	0	C21orf63	32751804	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.446000	0.97590	2.349000	0.79799	0.462000	0.41574	CGG	.		0.527	EVA1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139403.1	NM_058187	
EVPL	2125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	74014602	74014602	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr17:74014602C>A	ENST00000301607.3	-	12	1617	c.1364G>T	c.(1363-1365)gGg>gTg	p.G455V	EVPL_ENST00000586740.1_Missense_Mutation_p.G455V	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	455	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CTTGGTCTCCCCGCCAGGGCC	0.652																																					p.G455V		.											.	EVPL	93	0			c.G1364T						.						20.0	21.0	21.0					17																	74014602		2202	4298	6500	SO:0001583	missense	2125	exon12			GTCTCCCCGCCAG	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.1364G>T	17.37:g.74014602C>A	ENSP00000301607:p.Gly455Val	108.0	0.0		104.0	32.0	NM_001988	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	37	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768759	0.90020	.	.	ENSG00000167880	ENST00000301607	T	0.74002	-0.8	5.12	5.12	0.69794	.	0.052170	0.85682	D	0.000000	D	0.87334	0.6151	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.945	D	0.88852	0.3320	10	0.87932	D	0	-59.6834	18.9474	0.92627	0.0:1.0:0.0:0.0	.	455;455	B7ZLH8;Q92817	.;EVPL_HUMAN	V	455	ENSP00000301607:G455V	ENSP00000301607:G455V	G	-	2	0	EVPL	71526197	0.983000	0.35010	0.954000	0.39281	0.781000	0.44180	3.524000	0.53495	2.573000	0.86826	0.561000	0.74099	GGG	.		0.652	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
EVX2	344191	broad.mit.edu;mdanderson.org	37	2	176944851	176944851	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:176944851G>T	ENST00000308618.4	-	3	1551	c.1415C>A	c.(1414-1416)gCt>gAt	p.A472D		NM_001080458.1	NP_001073927.1	Q03828	EVX2_HUMAN	even-skipped homeobox 2	472					limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(3)	16			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)		GGTGAGCGGAGCCTCGTCCCT	0.736																																					p.A472D		.											.	EVX2	70	0			c.C1415A						.						7.0	8.0	8.0					2																	176944851		2149	4212	6361	SO:0001583	missense	344191	exon3			AGCGGAGCCTCGT		CCDS33333.1	2q31.1	2012-03-09	2007-02-15		ENSG00000174279	ENSG00000174279		"""Homeoboxes / ANTP class : HOXL subclass"""	3507	protein-coding gene	gene with protein product		142991	"""eve, even-skipped homeobox homolog 2 (Drosophila)"""			1675198	Standard	NM_001080458		Approved		uc010zeu.2	Q03828	OTTHUMG00000154173	ENST00000308618.4:c.1415C>A	2.37:g.176944851G>T	ENSP00000312385:p.Ala472Asp	23.0	0.0		28.0	7.0	NM_001080458		Missense_Mutation	SNP	ENST00000308618.4	37	CCDS33333.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.873510	0.51695	.	.	ENSG00000174279	ENST00000308618	D	0.91843	-2.92	2.87	2.87	0.33458	.	0.522250	0.19073	N	0.123457	D	0.84817	0.5556	N	0.24115	0.695	0.29833	N	0.829856	B	0.33694	0.421	B	0.26969	0.075	D	0.83665	0.0163	10	0.72032	D	0.01	.	14.1637	0.65464	0.0:0.0:1.0:0.0	.	472	Q03828	EVX2_HUMAN	D	472	ENSP00000312385:A472D	ENSP00000312385:A472D	A	-	2	0	EVX2	176653097	0.302000	0.24454	1.000000	0.80357	0.995000	0.86356	0.950000	0.29122	1.611000	0.50210	0.467000	0.42956	GCT	.		0.736	EVX2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359252.1		
EZR	7430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	159210363	159210363	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr6:159210363A>T	ENST00000367075.3	-	3	221	c.53T>A	c.(52-54)tTt>tAt	p.F18Y	EZR_ENST00000476189.1_5'UTR|EZR_ENST00000392177.4_Missense_Mutation_p.F18Y|EZR_ENST00000337147.7_Missense_Mutation_p.F18Y	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	18	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		CTGGATTGCAAACTCCAGCTC	0.378			T	ROS1	NSCLC																																p.F18Y		.		Dom	yes		6	6q25.3	7430	ezrin		E	.	EZR	70	0			c.T53A						.						102.0	92.0	95.0					6																	159210363		2203	4300	6503	SO:0001583	missense	7430	exon2			ATTGCAAACTCCA	AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.53T>A	6.37:g.159210363A>T	ENSP00000356042:p.Phe18Tyr	140.0	0.0		126.0	36.0	NM_003379	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Missense_Mutation	SNP	ENST00000367075.3	37	CCDS5258.1	.	.	.	.	.	.	.	.	.	.	A	31	5.097975	0.94197	.	.	ENSG00000092820	ENST00000337147;ENST00000367075;ENST00000392177	T;T;T	0.78924	-1.22;-1.22;-1.15	4.78	4.78	0.61160	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.000000	0.85682	D	0.000000	D	0.89001	0.6591	M	0.92784	3.345	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.91709	0.5380	10	0.87932	D	0	.	14.7544	0.69552	1.0:0.0:0.0:0.0	.	18;18	E7EQR4;P15311	.;EZRI_HUMAN	Y	18	ENSP00000338934:F18Y;ENSP00000356042:F18Y;ENSP00000376016:F18Y	ENSP00000338934:F18Y	F	-	2	0	EZR	159130351	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.644000	0.91044	2.131000	0.65755	0.454000	0.30748	TTT	.		0.378	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042878.1	NM_003379	
FAM129C	199786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17657556	17657556	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:17657556G>T	ENST00000335393.4	+	14	1847	c.1709G>T	c.(1708-1710)gGc>gTc	p.G570V	FAM129C_ENST00000599124.1_Missense_Mutation_p.G503V|FAM129C_ENST00000599164.1_Missense_Mutation_p.G539V|FAM129C_ENST00000601861.1_Missense_Mutation_p.G539V|FAM129C_ENST00000449408.2_Missense_Mutation_p.G296V|FAM129C_ENST00000352727.3_Missense_Mutation_p.G534V|FAM129C_ENST00000595684.1_Missense_Mutation_p.G570V|FAM129C_ENST00000600871.1_Missense_Mutation_p.G516V|FAM129C_ENST00000332386.5_Missense_Mutation_p.G570V	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C	570										autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						ACCACTGAGGGCATCTATGAG	0.637																																					p.G570V		.											.	FAM129C	90	0			c.G1709T						.						71.0	48.0	56.0					19																	17657556		2203	4299	6502	SO:0001583	missense	199786	exon14			CTGAGGGCATCTA	AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.1709G>T	19.37:g.17657556G>T	ENSP00000335040:p.Gly570Val	42.0	0.0		42.0	12.0	NM_001098524	B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Missense_Mutation	SNP	ENST00000335393.4	37	CCDS12362.1	.	.	.	.	.	.	.	.	.	.	G	10.38	1.335235	0.24253	.	.	ENSG00000167483	ENST00000335393;ENST00000332386;ENST00000352727;ENST00000449408;ENST00000435646	T;T;T;T	0.38077	2.09;2.1;1.16;1.73	4.62	1.09	0.20402	.	0.744958	0.11957	N	0.513183	T	0.51312	0.1667	M	0.72479	2.2	0.09310	N	0.999993	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.77557	0.985;0.99;0.99;0.99;0.985	T	0.29579	-1.0007	10	0.56958	D	0.05	-17.2637	3.9466	0.09350	0.2199:0.2004:0.5797:0.0	.	516;570;570;534;570	E7ENP6;Q86XR2;Q86XR2-3;Q86XR2-4;Q86XR2-2	.;NIBL2_HUMAN;.;.;.	V	570;570;534;296;516	ENSP00000335040:G570V;ENSP00000333447:G570V;ENSP00000341067:G534V;ENSP00000394929:G296V	ENSP00000333447:G570V	G	+	2	0	FAM129C	17518556	0.239000	0.23836	0.006000	0.13384	0.067000	0.16453	0.880000	0.28159	1.086000	0.41228	-0.275000	0.10095	GGC	.		0.637	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464206.1	NM_173544	
FAM208B	54906	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	5803296	5803296	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:5803296T>C	ENST00000328090.5	+	19	7661	c.7036T>C	c.(7036-7038)Ttt>Ctt	p.F2346L		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	2346																	GTTGAAGTCATTTCAGAGTGC	0.318																																					p.F2346L		.											.	.	.	0			c.T7036C						.						114.0	108.0	110.0					10																	5803296		1876	4107	5983	SO:0001583	missense	54906	exon19			AAGTCATTTCAGA	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.7036T>C	10.37:g.5803296T>C	ENSP00000328426:p.Phe2346Leu	54.0	0.0		35.0	13.0	NM_017782	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	T	11.66	1.705558	0.30232	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.44083	0.93	6.06	6.06	0.98353	.	0.546345	0.18169	N	0.149519	T	0.27933	0.0688	N	0.08118	0	0.09310	N	1	B	0.16802	0.019	B	0.14023	0.01	T	0.23691	-1.0181	10	0.49607	T	0.09	.	16.2741	0.82634	0.0:0.0:0.0:1.0	.	2346	Q5VWN6	F208B_HUMAN	L	2346;1541	ENSP00000328426:F2346L	ENSP00000328426:F2346L	F	+	1	0	C10orf18	5843302	0.304000	0.24472	0.026000	0.17262	0.115000	0.19883	3.773000	0.55333	2.322000	0.78497	0.528000	0.53228	TTT	.		0.318	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782	
FAM84A	151354	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	2	14774404	14774404	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:14774404G>T	ENST00000295092.2	+	2	589	c.301G>T	c.(301-303)Ggt>Tgt	p.G101C	FAM84A_ENST00000331243.4_Missense_Mutation_p.G101C|AC011897.1_ENST00000581929.1_5'Flank	NM_145175.2	NP_660158.2	Q96KN4	FA84A_HUMAN	family with sequence similarity 84, member A	101										endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(1;0.00969)			CAAAGTGAGCGGTGGCCCTCA	0.667																																					p.G101C		.											.	FAM84A	91	0			c.G301T						.						14.0	16.0	15.0					2																	14774404		2196	4291	6487	SO:0001583	missense	151354	exon2			GTGAGCGGTGGCC	AJ417080, BC026346	CCDS1684.1	2p24.3	2005-08-09			ENSG00000162981	ENSG00000162981			20743	protein-coding gene	gene with protein product	"""neurological/sensory 1"""	611234				14702039	Standard	NM_145175		Approved	NSE1, FLJ35392	uc002rbz.2	Q96KN4	OTTHUMG00000119093	ENST00000295092.2:c.301G>T	2.37:g.14774404G>T	ENSP00000295092:p.Gly101Cys	13.0	0.0		14.0	7.0	NM_145175	A6NP76|Q86UZ2|Q8NAH7|Q8TAM5	Missense_Mutation	SNP	ENST00000295092.2	37	CCDS1684.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.46|16.46	3.128805|3.128805	0.56721|0.56721	.|.	.|.	ENSG00000162981|ENSG00000162981	ENST00000295092;ENST00000331243;ENST00000359969|ENST00000540701	T;T|.	0.03801|.	3.8;3.8|.	4.44|4.44	3.55|3.55	0.40652|0.40652	.|.	0.106113|.	0.64402|.	D|.	0.000005|.	T|T	0.55321|0.55321	0.1913|0.1913	L|L	0.39898|0.39898	1.24|1.24	0.39690|0.39690	D|D	0.971026|0.971026	D|.	0.64830|.	0.994|.	P|.	0.51385|.	0.668|.	T|T	0.59558|0.59558	-0.7432|-0.7432	10|6	0.49607|0.87932	T|D	0.09|0	-27.4376|-27.4376	8.3319|8.3319	0.32191|0.32191	0.2027:0.0:0.7973:0.0|0.2027:0.0:0.7973:0.0	.|.	101|.	Q96KN4|.	FA84A_HUMAN|.	C|L	101|8	ENSP00000295092:G101C;ENSP00000330681:G101C|.	ENSP00000295092:G101C|ENSP00000443261:R8L	G|R	+|+	1|2	0|0	FAM84A|FAM84A	14691855|14691855	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	2.756000|2.756000	0.47549|0.47549	1.190000|1.190000	0.43042|0.43042	0.655000|0.655000	0.94253|0.94253	GGT|CGG	.		0.667	FAM84A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239308.2	NM_145175	
FER1L6	654463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	125074249	125074249	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr8:125074249G>T	ENST00000522917.1	+	25	3510	c.3304G>T	c.(3304-3306)Gtg>Ttg	p.V1102L	FER1L6_ENST00000399018.1_Missense_Mutation_p.V1102L|FER1L6-AS2_ENST00000601180.1_RNA|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1102						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CATCACACAGGTGGATGGAAC	0.517																																					p.V1102L		.											.	FER1L6	100	0			c.G3304T						.						82.0	85.0	84.0					8																	125074249		1956	4151	6107	SO:0001583	missense	654463	exon25			ACACAGGTGGATG	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.3304G>T	8.37:g.125074249G>T	ENSP00000428280:p.Val1102Leu	111.0	0.0		268.0	213.0	NM_001039112		Missense_Mutation	SNP	ENST00000522917.1	37	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	G	2.569	-0.300040	0.05532	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	T;T	0.80824	-1.42;-1.42	5.51	0.735	0.18300	C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.62380	0.2423	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46857	-0.9161	9	0.27785	T	0.31	0.0988	9.3562	0.38168	0.3681:0.0:0.6319:0.0	.	1102	Q2WGJ9	FR1L6_HUMAN	L	1102	ENSP00000428280:V1102L;ENSP00000381982:V1102L	ENSP00000381982:V1102L	V	+	1	0	FER1L6	125143430	0.402000	0.25311	0.003000	0.11579	0.001000	0.01503	0.134000	0.15932	0.142000	0.18901	-0.122000	0.15005	GTG	.		0.517	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
FGR	2268	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	27939760	27939760	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:27939760G>T	ENST00000374005.3	-	12	1639	c.1351C>A	c.(1351-1353)Ctc>Atc	p.L451I	FGR_ENST00000374004.1_Missense_Mutation_p.L451I|FGR_ENST00000399173.1_Missense_Mutation_p.L451I|FGR_ENST00000545953.1_Missense_Mutation_p.L385I	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	451	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		TTGGTGATGAGCTCAGTGAGC	0.602																																					p.L451I		.											.	FGR	547	0			c.C1351A						.						87.0	87.0	87.0					1																	27939760		2203	4300	6503	SO:0001583	missense	2268	exon12			TGATGAGCTCAGT	BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.1351C>A	1.37:g.27939760G>T	ENSP00000363117:p.Leu451Ile	111.0	0.0		127.0	62.0	NM_001042729	D3DPL7|Q9UIQ3	Missense_Mutation	SNP	ENST00000374005.3	37	CCDS305.1	.	.	.	.	.	.	.	.	.	.	g	10.98	1.503947	0.26949	.	.	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003	T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49	4.65	3.7	0.42460	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45867	D	0.000331	T	0.56746	0.2006	N	0.02379	-0.575	0.30346	N	0.785278	B	0.11235	0.004	B	0.28553	0.091	T	0.48747	-0.9008	10	0.06365	T	0.9	.	12.8845	0.58036	0.0:0.0:0.8356:0.1643	.	451	P09769	FGR_HUMAN	I	451;385;451;451;451	ENSP00000363117:L451I;ENSP00000445302:L385I;ENSP00000382126:L451I;ENSP00000363116:L451I;ENSP00000363115:L451I	ENSP00000363115:L451I	L	-	1	0	FGR	27812347	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	5.693000	0.68264	1.053000	0.40415	0.586000	0.80456	CTC	.		0.602	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009772.1	NM_005248	
FLG	2312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152280060	152280060	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:152280060G>T	ENST00000368799.1	-	3	7337	c.7302C>A	c.(7300-7302)agC>agA	p.S2434R	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2434	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCCTCCAGTGCTGGTCCCGG	0.602									Ichthyosis																												p.S2434R		.											.	FLG	106	0			c.C7302A						.						273.0	250.0	258.0					1																	152280060		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TCCAGTGCTGGTC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7302C>A	1.37:g.152280060G>T	ENSP00000357789:p.Ser2434Arg	145.0	0.0		156.0	47.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	10.52	1.373430	0.24857	.	.	ENSG00000143631	ENST00000368799	T	0.01767	4.65	4.03	-8.05	0.01106	.	.	.	.	.	T	0.00754	0.0025	M	0.81682	2.555	0.09310	N	1	B	0.19331	0.035	B	0.09377	0.004	T	0.44034	-0.9354	9	0.52906	T	0.07	.	2.9885	0.05975	0.5332:0.1246:0.2159:0.1262	.	2434	P20930	FILA_HUMAN	R	2434	ENSP00000357789:S2434R	ENSP00000357789:S2434R	S	-	3	2	FLG	150546684	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.532000	0.02217	-1.568000	0.01670	-0.300000	0.09419	AGC	.		0.602	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FRMPD2	143162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	49450281	49450281	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:49450281C>T	ENST00000374201.3	-	5	792	c.490G>A	c.(490-492)Gaa>Aaa	p.E164K	FRMPD2_ENST00000407470.4_Missense_Mutation_p.E133K|FRMPD2_ENST00000305531.3_Missense_Mutation_p.E140K	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	164	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)	p.E164K(1)		NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		ACAGACACTTCTTTCTCATGA	0.557																																					p.E164K		.											.	FRMPD2	153	1	Substitution - Missense(1)	NS(1)	c.G490A						.						105.0	102.0	103.0					10																	49450281		2203	4300	6503	SO:0001583	missense	143162	exon5			ACACTTCTTTCTC	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.490G>A	10.37:g.49450281C>T	ENSP00000363317:p.Glu164Lys	178.0	0.0		112.0	40.0	NM_001018071	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	ENST00000374201.3	37	CCDS31195.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244293	0.79912	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.32988	1.43;1.43;1.43	5.19	5.19	0.71726	KIND (2);	.	.	.	.	T	0.38374	0.1038	L	0.46157	1.445	0.24214	N	0.99546	D;P;D	0.55385	0.971;0.839;0.971	P;B;P	0.49752	0.621;0.298;0.621	T	0.25676	-1.0125	9	0.66056	D	0.02	.	14.2141	0.65781	0.0:1.0:0.0:0.0	.	140;164;133	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	K	164;140;133	ENSP00000363317:E164K;ENSP00000307079:E140K;ENSP00000384339:E133K	ENSP00000307079:E140K	E	-	1	0	FRMPD2	49120287	0.989000	0.36119	0.213000	0.23690	0.979000	0.70002	2.979000	0.49313	2.430000	0.82344	0.655000	0.94253	GAA	.		0.557	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428	
FSHB	2488	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	30255242	30255242	+	Silent	SNP	A	A	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:30255242A>T	ENST00000417547.1	+	3	324	c.285A>T	c.(283-285)ccA>ccT	p.P95P	FSHB_ENST00000533718.1_Silent_p.P95P|FSHB_ENST00000254122.3_Silent_p.P95P	NM_001018080.1	NP_001018090.1	P01225	FSHB_HUMAN	follicle stimulating hormone, beta polypeptide	95					cellular protein metabolic process (GO:0044267)|female gamete generation (GO:0007292)|female pregnancy (GO:0007565)|follicle-stimulating hormone signaling pathway (GO:0042699)|peptide hormone processing (GO:0016486)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone biosynthetic process (GO:0006701)|regulation of osteoclast differentiation (GO:0045670)|Sertoli cell proliferation (GO:0060011)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	hormone activity (GO:0005179)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(3)|skin(1)	12						ATACATACCCAGTGGCCACCC	0.522																																					p.P95P		.											.	FSHB	93	0			c.A285T						.						102.0	83.0	90.0					11																	30255242		2202	4299	6501	SO:0001819	synonymous_variant	2488	exon3			ATACCCAGTGGCC		CCDS7868.1	11p13	2013-02-26				ENSG00000131808		"""Endogenous ligands"""	3964	protein-coding gene	gene with protein product	"""follitropin, beta chain"", ""follicle-stimulating hormone beta subunit"""	136530				2885163, 3151250	Standard	NM_000510		Approved		uc001msm.3	P01225		ENST00000417547.1:c.285A>T	11.37:g.30255242A>T		117.0	0.0		152.0	32.0	NM_000510	A2TF08|A5JVV3|Q14D61	Silent	SNP	ENST00000417547.1	37	CCDS7868.1																																																																																			.		0.522	FSHB-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389757.1	NM_000510	
GABRA5	2558	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	27128577	27128577	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:27128577C>A	ENST00000335625.5	+	6	1258	c.370C>A	c.(370-372)Ctt>Att	p.L124I	GABRA5_ENST00000557449.1_Intron|GABRB3_ENST00000541819.2_Intron|GABRA5_ENST00000400081.3_Missense_Mutation_p.L124I|GABRA5_ENST00000355395.5_Missense_Mutation_p.L124I	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	124					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	CAACAACCTCCTTGCCAGCAA	0.547																																					p.L124I		.											.	GABRA5	91	0			c.C370A						.						91.0	102.0	98.0					15																	27128577		2195	4296	6491	SO:0001583	missense	2558	exon6			AACCTCCTTGCCA		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.370C>A	15.37:g.27128577C>A	ENSP00000335592:p.Leu124Ile	119.0	0.0		89.0	40.0	NM_001165037	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	ENST00000335625.5	37	CCDS45194.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.109478	0.77096	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000555182;ENST00000400081;ENST00000554596;ENST00000554599	T;T;T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14;-1.14;-1.14	5.4	4.47	0.54385	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.83119	0.5185	L	0.50919	1.6	0.53688	D	0.999974	P	0.51147	0.942	P	0.60068	0.868	D	0.85076	0.0943	10	0.87932	D	0	.	14.8695	0.70444	0.1446:0.8554:0.0:0.0	.	124	P31644	GBRA5_HUMAN	I	124;124;92;124;124;124	ENSP00000335592:L124I;ENSP00000347557:L124I;ENSP00000450653:L92I;ENSP00000382953:L124I;ENSP00000450806:L124I;ENSP00000450717:L124I	ENSP00000335592:L124I	L	+	1	0	GABRA5	24679670	0.991000	0.36638	0.042000	0.18584	0.969000	0.65631	2.953000	0.49105	1.384000	0.46424	0.561000	0.74099	CTT	.		0.547	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1		
GDF5	8200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	34025505	34025505	+	Silent	SNP	C	C	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr20:34025505C>G	ENST00000374372.1	-	3	707	c.204G>C	c.(202-204)ggG>ggC	p.G68G	GDF5_ENST00000374369.3_Silent_p.G68G			P43026	GDF5_HUMAN	growth differentiation factor 5	68					cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			CATTGGTGGCCCCCCCACCAT	0.662																																					p.G68G		.											.	GDF5	226	0			c.G204C						.						29.0	28.0	28.0					20																	34025505		2203	4300	6503	SO:0001819	synonymous_variant	8200	exon1			GGTGGCCCCCCCA	X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.204G>C	20.37:g.34025505C>G		60.0	0.0		89.0	38.0	NM_000557	E1P5Q2|Q96SB1	Silent	SNP	ENST00000374372.1	37	CCDS13254.1																																																																																			.		0.662	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078875.2		
GEMIN5	25929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	154287212	154287212	+	Silent	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:154287212T>C	ENST00000285873.7	-	16	2409	c.2334A>G	c.(2332-2334)tcA>tcG	p.S778S		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	778					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CTTCTTGGTCTGACACACCAT	0.498																																					p.S778S		.											.	GEMIN5	228	0			c.A2334G						.						167.0	149.0	155.0					5																	154287212		2203	4300	6503	SO:0001819	synonymous_variant	25929	exon16			TTGGTCTGACACA	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.2334A>G	5.37:g.154287212T>C		172.0	0.0		131.0	44.0	NM_015465	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Silent	SNP	ENST00000285873.7	37	CCDS4330.1																																																																																			.		0.498	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1		
GIMAP8	155038	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	150171330	150171330	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:150171330G>T	ENST00000307271.3	+	4	1487	c.913G>T	c.(913-915)Gac>Tac	p.D305Y		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	305	AIG1-type G 2.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		TGATGCTCCGGACATCTCATC	0.458																																					p.D305Y		.											.	GIMAP8	95	0			c.G913T						.						78.0	85.0	82.0					7																	150171330		2203	4300	6503	SO:0001583	missense	155038	exon4			GCTCCGGACATCT	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.913G>T	7.37:g.150171330G>T	ENSP00000305107:p.Asp305Tyr	105.0	1.0		138.0	74.0	NM_175571		Missense_Mutation	SNP	ENST00000307271.3	37	CCDS34777.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.951312	0.73787	.	.	ENSG00000171115	ENST00000307271	T	0.61158	0.13	4.28	3.4	0.38934	AIG1 (1);	0.153233	0.30060	N	0.010501	T	0.73337	0.3574	M	0.84326	2.69	0.32513	N	0.537271	D	0.89917	1.0	D	0.72982	0.979	T	0.78570	-0.2153	10	0.72032	D	0.01	.	8.0147	0.30374	0.1124:0.0:0.8876:0.0	.	305	Q8ND71	GIMA8_HUMAN	Y	305	ENSP00000305107:D305Y	ENSP00000305107:D305Y	D	+	1	0	GIMAP8	149802263	0.549000	0.26481	0.958000	0.39756	0.361000	0.29550	4.116000	0.57871	1.029000	0.39812	0.650000	0.86243	GAC	.		0.458	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571	
GK2	2712	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	80327763	80327763	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr4:80327763G>A	ENST00000358842.3	-	1	1609	c.1592C>T	c.(1591-1593)cCt>cTt	p.P531L		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	34					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						AAATCCCAAAGGCAGACTAGA	0.423																																					p.P531L		.											.	GK2	94	0			c.C1592T						.						96.0	91.0	93.0					4																	80327763		2203	4300	6503	SO:0001583	missense	2712	exon1			CCCAAAGGCAGAC	BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.1592C>T	4.37:g.80327763G>A	ENSP00000351706:p.Pro531Leu	266.0	1.0		189.0	45.0	NM_033214	Q7Z4Q4	Missense_Mutation	SNP	ENST00000358842.3	37	CCDS3585.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648433	0.67358	.	.	ENSG00000196475	ENST00000358842	T	0.15256	2.44	4.11	4.11	0.48088	.	0.000000	0.85682	D	0.000000	T	0.25901	0.0631	L	0.42245	1.32	0.58432	D	0.999998	P	0.48694	0.914	P	0.52598	0.703	T	0.01356	-1.1376	10	0.87932	D	0	-6.6977	14.652	0.68805	0.0:0.0:1.0:0.0	.	531	Q14410	GLPK2_HUMAN	L	531	ENSP00000351706:P531L	ENSP00000351706:P531L	P	-	2	0	GK2	80546787	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.370000	0.79589	2.584000	0.87258	0.585000	0.79938	CCT	.		0.423	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252517.2	NM_033214	
GNMT	27232	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	6	42928679	42928679	+	Silent	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr6:42928679C>T	ENST00000372808.3	+	1	184	c.174C>T	c.(172-174)tgC>tgT	p.C58C		NM_018960.4	NP_061833.1	Q14749	GNMT_HUMAN	glycine N-methyltransferase	58					cellular protein modification process (GO:0006464)|glycogen metabolic process (GO:0005977)|methionine metabolic process (GO:0006555)|one-carbon metabolic process (GO:0006730)|protein homotetramerization (GO:0051289)|regulation of gluconeogenesis (GO:0006111)|S-adenosylmethionine metabolic process (GO:0046500)	cytoplasm (GO:0005737)	folic acid binding (GO:0005542)|glycine binding (GO:0016594)|glycine N-methyltransferase activity (GO:0017174)			kidney(2)|large_intestine(1)|lung(1)	4	Colorectal(47;0.196)		all cancers(41;0.00196)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0461)		Glycine(DB00145)|S-Adenosylmethionine(DB00118)	AGCACGGCTGCCAGCGGGTGC	0.706																																					p.C58C		.											.	GNMT	514	0			c.C174T						.						4.0	5.0	5.0					6																	42928679		1887	3821	5708	SO:0001819	synonymous_variant	27232	exon1			CGGCTGCCAGCGG	AF101475	CCDS4876.1	6p12	2008-02-05			ENSG00000124713	ENSG00000124713			4415	protein-coding gene	gene with protein product		606628				10843803, 9495250	Standard	NM_018960		Approved		uc003otd.3	Q14749	OTTHUMG00000014712	ENST00000372808.3:c.174C>T	6.37:g.42928679C>T		17.0	0.0		24.0	10.0	NM_018960	Q5T8W2|Q9NNZ1|Q9NS24	Silent	SNP	ENST00000372808.3	37	CCDS4876.1																																																																																			.		0.706	GNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040568.1	NM_018960	
GOLGA6L6	727832	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	20740171	20740171	+	Silent	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:20740171G>T	ENST00000427390.2	-	8	1669	c.1579C>A	c.(1579-1581)Cgg>Agg	p.R527R		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	527	Gln-rich.|Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						tcctgctcccgtatcttctcc	0.547																																					p.R527R		.											.	.	.	0			c.C1579A						.						121.0	121.0	121.0					15																	20740171		674	1564	2238	SO:0001819	synonymous_variant	727832	exon8			GCTCCCGTATCTT	AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1579C>A	15.37:g.20740171G>T		302.0	0.0		213.0	72.0	NM_001145004	D3YTC0	Silent	SNP	ENST00000427390.2	37	CCDS45184.1																																																																																			.		0.547	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414660.3	NM_001145004	
GSG1L	146395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	27840186	27840186	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:27840186G>A	ENST00000447459.2	-	5	838	c.754C>T	c.(754-756)Cgc>Tgc	p.R252C	GSG1L_ENST00000380898.2_Missense_Mutation_p.R97C|GSG1L_ENST00000395724.3_Missense_Mutation_p.R201C|GSG1L_ENST00000569166.1_Missense_Mutation_p.R97C|GSG1L_ENST00000380897.3_Missense_Mutation_p.R97C	NM_001109763.1	NP_001103233.1	Q6UXU4	GSG1L_HUMAN	GSG1-like	252					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	asymmetric synapse (GO:0032279)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(4)	17						AAGACCTTGCGCTTGTGCCGG	0.587																																					p.R252C		.											.	GSG1L	91	0			c.C754T						.						103.0	76.0	85.0					16																	27840186		2197	4300	6497	SO:0001583	missense	146395	exon5			CCTTGCGCTTGTG	AK128775	CCDS10631.1, CCDS45450.1	16p11.2	2014-01-20			ENSG00000169181	ENSG00000169181			28283	protein-coding gene	gene with protein product						22813734	Standard	NM_001109763		Approved	MGC18079, PRO19651, KTSR5831	uc002doz.2	Q6UXU4	OTTHUMG00000131676	ENST00000447459.2:c.754C>T	16.37:g.27840186G>A	ENSP00000394954:p.Arg252Cys	159.0	0.0		145.0	41.0	NM_001109763	Q7Z6F8|Q8TB81	Missense_Mutation	SNP	ENST00000447459.2	37	CCDS45450.1	.	.	.	.	.	.	.	.	.	.	G	33	5.207335	0.95033	.	.	ENSG00000169181	ENST00000447459;ENST00000395724;ENST00000380898;ENST00000380897	T;T	0.35605	1.33;1.3	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.55940	0.1952	L	0.49778	1.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.949;0.967;0.99	T	0.58188	-0.7680	10	0.87932	D	0	0.6619	17.5938	0.88005	0.0:0.0:1.0:0.0	.	201;97;252	Q6UXU4-3;Q6UXU4-4;Q6UXU4	.;.;GSG1L_HUMAN	C	252;201;97;97	ENSP00000394954:R252C;ENSP00000379074:R201C	ENSP00000370282:R97C	R	-	1	0	GSG1L	27747687	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.898000	0.87363	2.455000	0.83008	0.650000	0.86243	CGC	.		0.587	GSG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433832.2	NM_144675	
HDLBP	3069	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	242202212	242202212	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:242202212C>T	ENST00000391975.1	-	5	591	c.364G>A	c.(364-366)Gac>Aac	p.D122N	HDLBP_ENST00000391976.2_Missense_Mutation_p.D122N|HDLBP_ENST00000310931.4_Missense_Mutation_p.D122N|HDLBP_ENST00000427183.2_Missense_Mutation_p.D158N	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	122					cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		AGGCCTTGGTCTTTGGCCAAA	0.488																																					p.D158N		.											.	HDLBP	290	0			c.G472A						.						214.0	180.0	191.0					2																	242202212		2203	4300	6503	SO:0001583	missense	3069	exon6			CTTGGTCTTTGGC		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.364G>A	2.37:g.242202212C>T	ENSP00000375836:p.Asp122Asn	130.0	0.0		96.0	37.0	NM_001243900	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	ENST00000391975.1	37	CCDS2547.1	.	.	.	.	.	.	.	.	.	.	C	32	5.168116	0.94768	.	.	ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183;ENST00000422933;ENST00000428482;ENST00000452065;ENST00000444092;ENST00000430918;ENST00000441124	T;T;T;T;T;T;T;T;T;T	0.62941	2.32;2.32;2.32;2.2;1.28;0.69;-0.01;0.08;0.08;0.1	5.93	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.73938	0.3651	L	0.53780	1.695	0.80722	D	1	P;D	0.89917	0.614;1.0	P;D	0.97110	0.474;1.0	T	0.71457	-0.4587	10	0.27785	T	0.31	-47.1993	15.192	0.73053	0.0:0.9329:0.0:0.0671	.	158;122	E7EM71;Q00341	.;VIGLN_HUMAN	N	122;122;122;158;122;122;122;122;122;122	ENSP00000375836:D122N;ENSP00000375837:D122N;ENSP00000312042:D122N;ENSP00000399139:D158N;ENSP00000403807:D122N;ENSP00000405109:D122N;ENSP00000387782:D122N;ENSP00000416559:D122N;ENSP00000403913:D122N;ENSP00000396964:D122N	ENSP00000312042:D122N	D	-	1	0	HDLBP	241850885	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.755000	0.85180	1.538000	0.49270	0.655000	0.94253	GAC	.		0.488	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346	
HIF3A	64344	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	46825090	46825090	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:46825090C>A	ENST00000377670.4	+	10	1233	c.1202C>A	c.(1201-1203)gCc>gAc	p.A401D	HIF3A_ENST00000339613.2_Missense_Mutation_p.A345D|AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000244303.6_Missense_Mutation_p.A332D|HIF3A_ENST00000472815.1_Missense_Mutation_p.A332D|HIF3A_ENST00000300862.3_Missense_Mutation_p.A399D|HIF3A_ENST00000420102.2_Missense_Mutation_p.A350D|HIF3A_ENST00000600383.1_Missense_Mutation_p.A332D	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	401					cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		AGCGAGGCTGCCCTGGCCGCT	0.687																																					p.A401D		.											.	HIF3A	228	0			c.C1202A						.						41.0	49.0	47.0					19																	46825090		2203	4298	6501	SO:0001583	missense	64344	exon10			AGGCTGCCCTGGC	AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1202C>A	19.37:g.46825090C>A	ENSP00000366898:p.Ala401Asp	91.0	0.0		123.0	68.0	NM_152795	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	ENST00000377670.4	37	CCDS12681.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.441|8.441	0.850781|0.850781	0.17034|0.17034	.|.	.|.	ENSG00000124440|ENSG00000124440	ENST00000244302;ENST00000377670;ENST00000244303;ENST00000339613;ENST00000291300;ENST00000300862;ENST00000420102|ENST00000472815	T;T;T;T;T|.	0.64438|.	0.62;-0.09;0.51;0.62;-0.1|.	4.45|4.45	2.33|2.33	0.28932|0.28932	.|.	1.084810|.	0.07166|.	N|.	0.851496|.	T|.	0.20618|.	0.0496|.	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	P;B;B;B;B;B;B|.	0.37276|.	0.589;0.089;0.152;0.089;0.201;0.201;0.089|.	B;B;B;B;B;B;B|.	0.33454|.	0.164;0.055;0.058;0.055;0.039;0.039;0.016|.	T|.	0.23476|.	-1.0187|.	10|.	0.27082|.	T|.	0.32|.	.|.	6.9583|6.9583	0.24583|0.24583	0.0:0.7906:0.0:0.2094|0.0:0.7906:0.0:0.2094	.|.	350;332;399;350;345;401;401|.	F5H884;B4DNA2;Q9Y2N7-2;B4DSD9;A8MPQ1;Q9Y2N7;B0M185|.	.;.;.;.;.;HIF3A_HUMAN;.|.	D|X	401;401;332;345;345;399;350|373	ENSP00000366898:A401D;ENSP00000244303:A332D;ENSP00000341877:A345D;ENSP00000300862:A399D;ENSP00000407771:A350D|.	ENSP00000244302:A401D|.	A|C	+|+	2|3	0|2	HIF3A|HIF3A	51516930|51516930	0.023000|0.023000	0.18921|0.18921	0.355000|0.355000	0.25773|0.25773	0.799000|0.799000	0.45148|0.45148	0.921000|0.921000	0.28718|0.28718	0.634000|0.634000	0.30469|0.30469	-0.140000|-0.140000	0.14226|0.14226	GCC|TGC	.		0.687	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280556.3		
HSP90AB1	3326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	44218826	44218826	+	Silent	SNP	A	A	G	rs2070694	byFrequency	TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr6:44218826A>G	ENST00000371554.1	+	7	1213	c.999A>G	c.(997-999)ctA>ctG	p.L333L	HSP90AB1_ENST00000353801.3_Silent_p.L333L|HSP90AB1_ENST00000371646.5_Silent_p.L333L			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	333					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GGGCATTGCTATTTATTCCTC	0.423													A|||	7	0.00139776	0.0	0.0	5008	,	,		20608	0.006		0.0	False		,,,				2504	0.001				p.L333L		.											.	HSP90AB1	658	0			c.A999G						.						125.0	127.0	126.0					6																	44218826		2203	4300	6503	SO:0001819	synonymous_variant	3326	exon7			ATTGCTATTTATT	AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.999A>G	6.37:g.44218826A>G		100.0	0.0		96.0	53.0	NM_007355	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Silent	SNP	ENST00000371554.1	37	CCDS4909.1																																																																																			A|0.991;G|0.009		0.423	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040730.1	NM_007355	
IGF2BP3	10643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	23509624	23509624	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:23509624T>A	ENST00000258729.3	-	1	462	c.106A>T	c.(106-108)Aag>Tag	p.K36*	IGF2BP3_ENST00000491719.1_5'Flank	NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	36	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						TAGCCAGTCTTCACCAGGAAG	0.637																																					p.K36X		.											.	IGF2BP3	92	0			c.A106T						.						57.0	64.0	62.0					7																	23509624		2203	4300	6503	SO:0001587	stop_gained	10643	exon1			CAGTCTTCACCAG	AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.106A>T	7.37:g.23509624T>A	ENSP00000258729:p.Lys36*	87.0	0.0		80.0	30.0	NM_006547	A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Nonsense_Mutation	SNP	ENST00000258729.3	37	CCDS5382.1	.	.	.	.	.	.	.	.	.	.	T	41	9.041004	0.99046	.	.	ENSG00000136231	ENST00000258729	.	.	.	3.82	2.59	0.31030	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.4517	9.817	0.40858	0.0:0.0:0.1736:0.8264	.	.	.	.	X	36	.	ENSP00000258729:K36X	K	-	1	0	IGF2BP3	23476149	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	7.613000	0.82986	0.305000	0.22832	0.455000	0.32223	AAG	.		0.637	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250243.2	NM_006547	
IGSF22	283284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	18743087	18743087	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:18743087G>A	ENST00000513874.1	-	4	512	c.373C>T	c.(373-375)Ctg>Ttg	p.L125L	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	125	Ig-like 1.									NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						CGCACCTTCAGCACGTGTTCC	0.602											OREG0020822	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L125L		.											.	IGSF22	140	0			c.C373T						.						125.0	128.0	127.0					11																	18743087		1951	4135	6086	SO:0001819	synonymous_variant	283284	exon4			CCTTCAGCACGTG	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.373C>T	11.37:g.18743087G>A		83.0	0.0	90	101.0	30.0	NM_173588	A6NNA0|D6RGV7	Silent	SNP	ENST00000513874.1	37	CCDS41625.2																																																																																			.		0.602	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588	
ISLR	3671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	74467261	74467261	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:74467261A>G	ENST00000249842.3	+	2	419	c.62A>G	c.(61-63)gAg>gGg	p.E21G	RP11-665J16.1_ENST00000561647.1_RNA|ISLR_ENST00000395118.1_Missense_Mutation_p.E21G	NM_005545.3	NP_005536.1	O14498	ISLR_HUMAN	immunoglobulin superfamily containing leucine-rich repeat	21	LRRNT.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	20						GCCTGCCCTGAGCCCTGCGAC	0.627																																					p.E21G		.											.	ISLR	155	0			c.A62G						.						46.0	43.0	44.0					15																	74467261		2198	4297	6495	SO:0001583	missense	3671	exon2			GCCCTGAGCCCTG	AB003184	CCDS10260.1	15q23-q24	2013-01-11			ENSG00000129009	ENSG00000129009		"""Immunoglobulin superfamily / I-set domain containing"""	6133	protein-coding gene	gene with protein product		602059				9325048	Standard	NM_005545		Approved	HsT17563	uc002axh.1	O14498	OTTHUMG00000137623	ENST00000249842.3:c.62A>G	15.37:g.74467261A>G	ENSP00000249842:p.Glu21Gly	57.0	0.0		41.0	10.0	NM_201526		Missense_Mutation	SNP	ENST00000249842.3	37	CCDS10260.1	.	.	.	.	.	.	.	.	.	.	A	10.78	1.446065	0.25987	.	.	ENSG00000129009	ENST00000249842;ENST00000395118	T;T	0.62105	0.05;0.05	3.91	2.67	0.31697	Leucine-rich repeat-containing N-terminal (1);	0.252672	0.25922	U	0.027435	T	0.43277	0.1240	L	0.28054	0.825	0.45354	D	0.998349	B	0.09022	0.002	B	0.11329	0.006	T	0.32428	-0.9907	10	0.36615	T	0.2	.	6.0472	0.19766	0.6112:0.2978:0.091:0.0	.	21	O14498	ISLR_HUMAN	G	21	ENSP00000249842:E21G;ENSP00000378550:E21G	ENSP00000249842:E21G	E	+	2	0	ISLR	72254314	0.997000	0.39634	0.952000	0.39060	0.597000	0.36814	2.940000	0.49003	1.413000	0.46997	0.260000	0.18958	GAG	.		0.627	ISLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269044.1	NM_005545	
ITGAD	3681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	31405619	31405619	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:31405619G>T	ENST00000389202.2	+	2	143	c.94G>T	c.(94-96)Gca>Tca	p.A32S		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	32					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CCAGGAGGATGCAGGCGGCTT	0.572																																					p.A32S		.											.	ITGAD	226	0			c.G94T						.						103.0	86.0	91.0					16																	31405619		2197	4300	6497	SO:0001583	missense	3681	exon2			GAGGATGCAGGCG	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.94G>T	16.37:g.31405619G>T	ENSP00000373854:p.Ala32Ser	132.0	0.0		104.0	15.0	NM_005353	Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	37	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	G	9.722	1.160041	0.21454	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.72394	-0.65	4.54	4.54	0.55810	.	.	.	.	.	T	0.60856	0.2301	L	0.42581	1.335	0.09310	N	1	B;B;B	0.29590	0.25;0.038;0.021	B;B;B	0.25506	0.061;0.056;0.056	T	0.48258	-0.9051	9	0.20046	T	0.44	.	12.7695	0.57412	0.0:0.0:1.0:0.0	.	32;48;32	B7Z6V7;Q59H14;Q13349	.;.;ITAD_HUMAN	S	48;32	ENSP00000373854:A32S	ENSP00000373854:A32S	A	+	1	0	ITGAD	31313120	0.030000	0.19436	0.048000	0.18961	0.505000	0.33919	2.474000	0.45154	2.064000	0.61679	0.561000	0.74099	GCA	.		0.572	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
ITGAV	3685	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	187455211	187455222	+	In_Frame_Del	DEL	TCGGCTTCGCCG	TCGGCTTCGCCG	-	rs61763606	byFrequency	TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	TCGGCTTCGCCG	TCGGCTTCGCCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:187455211_187455222delTCGGCTTCGCCG	ENST00000261023.3	+	1	420_431	c.146_157delTCGGCTTCGCCG	c.(145-159)ttcggcttcgccgtg>ttg	p.49_53FGFAV>L	ITGAV_ENST00000374907.3_In_Frame_Del_p.49_53FGFAV>L	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	49					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)	p.F51F(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	GGAAGTTACTTCGGCTTCGCCGTGGATTTCTT	0.637																																					p.49_53del	Melanoma(58;108 1995 6081)	.											.	ITGAV	653	1	Substitution - coding silent(1)	urinary_tract(1)	c.146_157del						.																																			SO:0001651	inframe_deletion	3685	exon1			GTTACTTCGGCTT		CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.146_157delTCGGCTTCGCCG	2.37:g.187455211_187455222delTCGGCTTCGCCG	ENSP00000261023:p.Phe49_Val53delinsLeu	222.0	0.0		180.0	36.0	NM_001145000	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	In_Frame_Del	DEL	ENST00000261023.3	37	CCDS2292.1																																																																																			.		0.637	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2	NM_002210	
ITIH5	80760	broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	7679202	7679202	+	Missense_Mutation	SNP	C	C	A	rs374950629		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:7679202C>A	ENST00000256861.6	-	5	719	c.641G>T	c.(640-642)gGg>gTg	p.G214V	ITIH5_ENST00000397145.2_Missense_Mutation_p.G214V|ITIH5_ENST00000446830.2_5'UTR|ITIH5_ENST00000397146.2_Missense_Mutation_p.G214V|ITIH5_ENST00000434980.1_5'UTR	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	214					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TTCCCCGCGCCCACTGCCCCT	0.622																																					p.G214V		.											.	ITIH5	92	0			c.G641T						.						97.0	102.0	100.0					10																	7679202		2203	4300	6503	SO:0001583	missense	80760	exon5			CCGCGCCCACTGC			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.641G>T	10.37:g.7679202C>A	ENSP00000256861:p.Gly214Val	51.0	1.0		37.0	15.0	NM_001001851	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37		.	.	.	.	.	.	.	.	.	.	C	2.503	-0.314641	0.05422	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000397145	T;T;T	0.02579	4.78;4.24;4.25	5.88	3.99	0.46301	.	0.601900	0.19381	N	0.115661	T	0.02571	0.0078	.	.	.	0.30486	N	0.771832	B;B	0.14438	0.01;0.009	B;B	0.20384	0.029;0.01	T	0.25779	-1.0122	9	0.30078	T	0.28	-25.4834	7.8408	0.29397	0.0:0.726:0.1343:0.1397	.	214;214	G5E9D8;Q86UX2	.;ITIH5_HUMAN	V	214	ENSP00000256861:G214V;ENSP00000380333:G214V;ENSP00000380332:G214V	ENSP00000256861:G214V	G	-	2	0	ITIH5	7719208	0.000000	0.05858	0.047000	0.18901	0.181000	0.23173	0.735000	0.26115	0.783000	0.33636	0.655000	0.94253	GGG	.		0.622	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
KCNK9	51305	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	140631020	140631020	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr8:140631020G>T	ENST00000520439.1	-	2	669	c.606C>A	c.(604-606)ttC>ttA	p.F202L	KCNK9_ENST00000303015.1_Missense_Mutation_p.F202L|KCNK9_ENST00000523477.1_5'Flank	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	202					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	CGTAGTCCCCGAACCCAATGG	0.587																																					p.F202L		.											.	KCNK9	93	0			c.C606A						.						75.0	76.0	75.0					8																	140631020		2203	4300	6503	SO:0001583	missense	51305	exon2			GTCCCCGAACCCA	AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.606C>A	8.37:g.140631020G>T	ENSP00000430676:p.Phe202Leu	93.0	0.0		283.0	214.0	NM_016601	Q2M290|Q540F2	Missense_Mutation	SNP	ENST00000520439.1	37	CCDS6377.1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.813097	0.70912	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.28069	1.63;1.63;1.63	5.85	1.55	0.23275	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.40743	0.1129	L	0.56340	1.77	0.80722	D	1	D	0.64830	0.994	D	0.64237	0.923	T	0.11743	-1.0575	10	0.41790	T	0.15	.	6.5738	0.22553	0.5716:0.0:0.4284:0.0	.	202	Q9NPC2	KCNK9_HUMAN	L	202	ENSP00000429847:F202L;ENSP00000302166:F202L;ENSP00000430676:F202L	ENSP00000302166:F202L	F	-	3	2	KCNK9	140700202	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.107000	0.31110	0.382000	0.24878	0.655000	0.94253	TTC	.		0.587	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378473.1	NM_016601	
KIAA1211L	343990	broad.mit.edu;bcgsc.ca	37	2	99439605	99439605	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:99439605delG	ENST00000397899.2	-	7	1462	c.1131delC	c.(1129-1131)cccfs	p.P377fs		NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	377	Pro-rich.																ACGGGCCTGCGGGGGGCGCCT	0.751																																					p.P377fs		.											.	.	.	0			c.1131delC						.						6.0	7.0	7.0					2																	99439605		1662	3814	5476	SO:0001589	frameshift_variant	343990	exon7			GCCTGCGGGGGGC	BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.1131delC	2.37:g.99439605delG	ENSP00000380996:p.Pro377fs	64.0	0.0		39.0	8.0	NM_207362		Frame_Shift_Del	DEL	ENST00000397899.2	37	CCDS42720.1																																																																																			.		0.751	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329933.1	NM_207362	
KIAA1644	85352	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	44681337	44681337	+	Silent	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr22:44681337C>A	ENST00000381176.4	-	4	702	c.570G>T	c.(568-570)ccG>ccT	p.P190P		NM_001099294.1	NP_001092764.1	Q3SXP7	K1644_HUMAN	KIAA1644	190						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)				AGGTCATCAGCGGTGGGCTGT	0.617																																					p.P190P		.											.	KIAA1644	23	0			c.G570T						.						68.0	71.0	70.0					22																	44681337		2117	4237	6354	SO:0001819	synonymous_variant	85352	exon4			CATCAGCGGTGGG	AB051431	CCDS43025.1	22q13	2009-02-06	2009-02-06		ENSG00000138944	ENSG00000138944			29335	protein-coding gene	gene with protein product						11258795	Standard	NM_001099294		Approved		uc003bet.2	Q3SXP7	OTTHUMG00000030991	ENST00000381176.4:c.570G>T	22.37:g.44681337C>A		137.0	1.0		129.0	34.0	NM_001099294	A6NHP0|A9Z1Z0|Q3SXP8|Q5JZ71|Q9BYB5	Silent	SNP	ENST00000381176.4	37	CCDS43025.1																																																																																			.		0.617	KIAA1644-006	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075879.2	NM_001099294	
KIAA2026	158358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	5923025	5923025	+	Silent	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr9:5923025A>G	ENST00000399933.3	-	8	2970	c.2971T>C	c.(2971-2973)Ttg>Ctg	p.L991L	KIAA2026_ENST00000381461.2_Silent_p.L961L	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	991										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		ACTGAATCCAATGAGGCAAAT	0.398																																					p.L991L		.											.	KIAA2026	92	0			c.T2971C						.						144.0	135.0	137.0					9																	5923025		1903	4127	6030	SO:0001819	synonymous_variant	158358	exon8			AATCCAATGAGGC	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.2971T>C	9.37:g.5923025A>G		146.0	0.0		167.0	61.0	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Silent	SNP	ENST00000399933.3	37																																																																																				.		0.398	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
KIAA1958	158405	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	115421771	115421771	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr9:115421771G>A	ENST00000337530.6	+	4	1869	c.1573G>A	c.(1573-1575)Gcg>Acg	p.A525T	KIAA1958_ENST00000536272.1_Missense_Mutation_p.A553T	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	525										endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						CATGTCGGGCGCGCGTTCTCG	0.577																																					p.A525T		.											.	KIAA1958	91	0			c.G1573A						.						61.0	50.0	54.0					9																	115421771		2203	4300	6503	SO:0001583	missense	158405	exon4			TCGGGCGCGCGTT	AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.1573G>A	9.37:g.115421771G>A	ENSP00000336940:p.Ala525Thr	117.0	0.0		159.0	69.0	NM_133465	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Missense_Mutation	SNP	ENST00000337530.6	37	CCDS35108.1	.	.	.	.	.	.	.	.	.	.	G	9.400	1.077732	0.20227	.	.	ENSG00000165185	ENST00000337530;ENST00000536272	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	T	0.17577	0.0422	N	0.08118	0	0.23972	N	0.996306	P;B	0.35226	0.491;0.198	B;B	0.25405	0.06;0.016	T	0.07849	-1.0751	8	0.13853	T	0.58	.	14.2383	0.65941	0.0:0.0:0.8507:0.1493	.	553;525	B7ZKW6;Q8N8K9	.;K1958_HUMAN	T	525;553	.	ENSP00000336940:A525T	A	+	1	0	KIAA1958	114461592	1.000000	0.71417	0.961000	0.40146	0.924000	0.55760	4.771000	0.62318	2.676000	0.91093	0.655000	0.94253	GCG	.		0.577	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053690.1	NM_133465	
KLHL6	89857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	183210427	183210427	+	Silent	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr3:183210427G>T	ENST00000341319.3	-	6	1454	c.1419C>A	c.(1417-1419)atC>atA	p.I473I		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	473					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			GCCCTCCCCCGATCACATACA	0.557																																					p.I473I		.											.	KLHL6	93	0			c.C1419A						.						164.0	135.0	145.0					3																	183210427		2203	4300	6503	SO:0001819	synonymous_variant	89857	exon6			TCCCCCGATCACA	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1419C>A	3.37:g.183210427G>T		160.0	0.0		118.0	31.0	NM_130446	B2RB31|D3DNS8|Q8N5I1|Q8N892	Silent	SNP	ENST00000341319.3	37	CCDS3245.2																																																																																			.		0.557	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
KRT76	51350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53170525	53170525	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:53170525C>A	ENST00000332411.2	-	1	604	c.551G>T	c.(550-552)cGg>cTg	p.R184L		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	184	Coil 1A.|Rod.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GATCTGTTCCCGCTCCTGGGC	0.557																																					p.R184L		.											.	KRT76	154	0			c.G551T						.						109.0	113.0	112.0					12																	53170525		2203	4298	6501	SO:0001583	missense	51350	exon1			TGTTCCCGCTCCT	M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.551G>T	12.37:g.53170525C>A	ENSP00000330101:p.Arg184Leu	136.0	0.0		116.0	38.0	NM_015848	B4DRR3|Q7Z795	Missense_Mutation	SNP	ENST00000332411.2	37	CCDS8838.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.451878	0.63290	.	.	ENSG00000185069	ENST00000332411	D	0.90133	-2.62	4.2	2.38	0.29361	Filament (1);	0.187921	0.26140	N	0.026104	D	0.94801	0.8321	M	0.87547	2.89	0.33466	D	0.585523	D	0.89917	1.0	D	0.85130	0.997	D	0.95259	0.8367	10	0.87932	D	0	.	9.2398	0.37489	0.0:0.7323:0.0:0.2677	.	184	Q01546	K22O_HUMAN	L	184	ENSP00000330101:R184L	ENSP00000330101:R184L	R	-	2	0	KRT76	51456792	0.992000	0.36948	0.955000	0.39395	0.985000	0.73830	1.362000	0.34148	0.730000	0.32425	0.462000	0.41574	CGG	.		0.557	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405928.1	NM_015848	
KRT4	3851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53207647	53207647	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:53207647C>T	ENST00000551956.1	-	1	688	c.196G>A	c.(196-198)Gct>Act	p.A66T	KRT4_ENST00000458244.2_Intron|KRT4_ENST00000293774.4_Missense_Mutation_p.A140T			P19013	K2C4_HUMAN	keratin 4	66	Gly-rich.|Head.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CGTGACCCAGCCACACTCATG	0.587																																					p.A66T	Pancreas(190;284 2995 41444 45903)	.											.	KRT4	96	0			c.G196A						.						112.0	130.0	124.0					12																	53207647		2101	4247	6348	SO:0001583	missense	3851	exon1			ACCCAGCCACACT		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.196G>A	12.37:g.53207647C>T	ENSP00000448220:p.Ala66Thr	93.0	0.0		70.0	38.0	NM_002272	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Missense_Mutation	SNP	ENST00000551956.1	37	CCDS41787.2	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735155	0.69189	.	.	ENSG00000170477	ENST00000551956;ENST00000293774	T;T	0.80653	-1.4;2.14	5.0	5.0	0.66597	.	0.000000	0.47852	D	0.000220	D	0.88485	0.6449	M	0.83384	2.64	0.80722	D	1	.	.	.	.	.	.	D	0.89183	0.3545	8	0.56958	D	0.05	.	14.6034	0.68460	0.0:0.8424:0.1576:0.0	.	.	.	.	T	66;140	ENSP00000448220:A66T;ENSP00000293774:A140T	ENSP00000293774:A140T	A	-	1	0	KRT4	51493914	0.000000	0.05858	0.981000	0.43875	0.591000	0.36615	1.006000	0.29847	2.705000	0.92388	0.585000	0.79938	GCT	.		0.587	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
KRTAP5-8	57830	ucsc.edu;mdanderson.org	37	11	71249152	71249152	+	Silent	SNP	C	C	T	rs112809261	byFrequency	TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:71249152C>T	ENST00000398534.3	+	1	82	c.51C>T	c.(49-51)tgC>tgT	p.C17C		NM_021046.2	NP_066384.2	O75690	KRA58_HUMAN	keratin associated protein 5-8	17						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|lung(2)|skin(1)|stomach(1)	6						GTGGGGGCTGCGGCTCTGGCT	0.652																																					p.C17C		.											.	KRTAP5-8	44	0			c.C51T						.						55.0	75.0	68.0					11																	71249152		2195	4284	6479	SO:0001819	synonymous_variant	57830	exon1			GGGCTGCGGCTCT	AB126077	CCDS41683.1	11q13.4	2008-02-05			ENSG00000241233	ENSG00000241233		"""Keratin associated proteins"""	23603	protein-coding gene	gene with protein product						15144888	Standard	NM_021046		Approved	KRTAP5.8, UHSKerB, KRTAP5-2	uc001oqr.1	O75690	OTTHUMG00000057571	ENST00000398534.3:c.51C>T	11.37:g.71249152C>T		44.0	1.0		75.0	37.0	NM_021046	Q6L8G7|Q6UTX6	Silent	SNP	ENST00000398534.3	37	CCDS41683.1																																																																																			C|0.896;T|0.104		0.652	KRTAP5-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127954.1	NM_021046	
LOXL1	4016	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	74235272	74235272	+	Missense_Mutation	SNP	C	C	T	rs566197761		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:74235272C>T	ENST00000261921.7	+	2	1506	c.1180C>T	c.(1180-1182)Cgc>Tgc	p.R394C		NM_005576.2	NP_005567.2	Q08397	LOXL1_HUMAN	lysyl oxidase-like 1	394	Lysyl-oxidase like.				extracellular matrix organization (GO:0030198)|oxidation-reduction process (GO:0055114)|protein deamination (GO:0018277)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor (GO:0016641)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10						GTACTCCCTGCGCTGTGCTGC	0.587													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20777	0.0		0.0	False		,,,				2504	0.0				p.R394C		.											.	LOXL1	226	0			c.C1180T						.						174.0	163.0	166.0					15																	74235272		2198	4297	6495	SO:0001583	missense	4016	exon2			TCCCTGCGCTGTG	L21186	CCDS10253.1	15q24-q25	2008-07-18			ENSG00000129038	ENSG00000129038			6665	protein-coding gene	gene with protein product		153456				7689553	Standard	NM_005576		Approved	LOXL, LOL	uc002awc.1	Q08397	OTTHUMG00000137595	ENST00000261921.7:c.1180C>T	15.37:g.74235272C>T	ENSP00000261921:p.Arg394Cys	136.0	0.0		91.0	29.0	NM_005576	Q6NUL3|Q96BW7	Missense_Mutation	SNP	ENST00000261921.7	37	CCDS10253.1	.	.	.	.	.	.	.	.	.	.	C	19.01	3.744866	0.69418	.	.	ENSG00000129038	ENST00000261921;ENST00000395162	T	0.33438	1.41	3.91	3.91	0.45181	.	0.067785	0.64402	D	0.000019	T	0.53174	0.1780	M	0.80982	2.52	0.58432	D	0.999994	D	0.89917	1.0	D	0.81914	0.995	T	0.57653	-0.7774	10	0.87932	D	0	.	9.0924	0.36619	0.2186:0.7814:0.0:0.0	.	394	Q08397	LOXL1_HUMAN	C	394;256	ENSP00000261921:R394C	ENSP00000261921:R394C	R	+	1	0	LOXL1	72022325	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.752000	0.38349	2.180000	0.69256	0.561000	0.74099	CGC	.		0.587	LOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268995.2	NM_005576	
LRRK2	120892	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	40714888	40714889	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:40714888_40714889insT	ENST00000298910.7	+	35	5126_5127	c.5068_5069insT	c.(5068-5070)attfs	p.I1690fs		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1690					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GAACTCTGAAATTATCATCCGA	0.396																																					p.I1690fs		.											.	LRRK2	533	0			c.5068_5069insT						.																																			SO:0001589	frameshift_variant	120892	exon35			TCTGAAATTATCA	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.5070dupT	12.37:g.40714890_40714890dupT	ENSP00000298910:p.Ile1690fs	108.0	0.0		74.0	33.0	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Frame_Shift_Ins	INS	ENST00000298910.7	37	CCDS31774.1																																																																																			.		0.396	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
MALSU1	115416	broad.mit.edu;ucsc.edu;mdanderson.org	37	7	23338990	23338990	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:23338990G>T	ENST00000466681.1	+	1	172	c.19G>T	c.(19-21)Gtg>Ttg	p.V7L	MALSU1_ENST00000479974.1_Intron	NM_138446.1	NP_612455.1	Q96EH3	MASU1_HUMAN	mitochondrial assembly of ribosomal large subunit 1	7					negative regulation of mitochondrial translation (GO:0070130)|ribosomal large subunit biogenesis (GO:0042273)	mitochondrion (GO:0005739)											GGGCGGCCGTGTGGCGCGGCT	0.721																																					p.V7L		.											.	.	.	0			c.G19T						.						6.0	8.0	7.0					7																	23338990		1933	4016	5949	SO:0001583	missense	115416	exon1			GGCCGTGTGGCGC	BC012331	CCDS5381.1	7p15.3	2013-05-24	2012-02-20	2012-02-20	ENSG00000156928	ENSG00000156928			21721	protein-coding gene	gene with protein product		614624	"""chromosome 7 open reading frame 30"""	C7orf30		22238376, 22238375	Standard	NM_138446		Approved	mtRsfA	uc003swd.1	Q96EH3	OTTHUMG00000128443	ENST00000466681.1:c.19G>T	7.37:g.23338990G>T	ENSP00000419370:p.Val7Leu	12.0	0.0		11.0	6.0	NM_138446	A4D154	Missense_Mutation	SNP	ENST00000466681.1	37	CCDS5381.1	.	.	.	.	.	.	.	.	.	.	G	13.40	2.227352	0.39399	.	.	ENSG00000156928	ENST00000466681	.	.	.	3.57	2.66	0.31614	.	1.321200	0.05328	N	0.527731	T	0.32585	0.0834	L	0.36672	1.1	0.09310	N	1	B	0.25667	0.131	B	0.17433	0.018	T	0.19582	-1.0301	9	0.17369	T	0.5	8.821	8.721	0.34441	0.0:0.2474:0.7526:0.0	.	7	Q96EH3	CG030_HUMAN	L	7	.	ENSP00000419370:V7L	V	+	1	0	C7orf30	23305515	0.004000	0.15560	0.001000	0.08648	0.016000	0.09150	1.346000	0.33964	1.027000	0.39758	0.655000	0.94253	GTG	.		0.721	MALSU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250241.2	NM_138446	
MAP3K1	4214	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	56176951	56176951	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:56176951A>G	ENST00000399503.3	+	13	2221	c.2221A>G	c.(2221-2223)Att>Gtt	p.I741V		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	741					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CTTAAATTGTATTCTTGGAAA	0.308																																					p.I741V		.											.	MAP3K1	956	0			c.A2221G						.						123.0	108.0	113.0					5																	56176951		1826	4079	5905	SO:0001583	missense	4214	exon13			AATTGTATTCTTG	U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.2221A>G	5.37:g.56176951A>G	ENSP00000382423:p.Ile741Val	139.0	1.0		92.0	41.0	NM_005921		Missense_Mutation	SNP	ENST00000399503.3	37	CCDS43318.1	.	.	.	.	.	.	.	.	.	.	A	14.28	2.489502	0.44249	.	.	ENSG00000095015	ENST00000399503	T	0.65364	-0.15	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.72104	0.3419	L	0.47716	1.5	0.58432	D	0.999998	P	0.48640	0.913	P	0.61592	0.891	T	0.69684	-0.5079	10	0.37606	T	0.19	.	16.5764	0.84681	1.0:0.0:0.0:0.0	.	741	Q13233	M3K1_HUMAN	V	741	ENSP00000382423:I741V	ENSP00000382423:I741V	I	+	1	0	MAP3K1	56212708	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.641000	0.83368	2.371000	0.80710	0.533000	0.62120	ATT	.		0.308	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2	XM_042066	
MAP3K4	4216	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	161507445	161507445	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr6:161507445G>T	ENST00000392142.4	+	8	2555	c.2407G>T	c.(2407-2409)Gag>Tag	p.E803*	MAP3K4_ENST00000348824.7_Nonsense_Mutation_p.E803*|MAP3K4_ENST00000366919.2_Nonsense_Mutation_p.E803*|MAP3K4_ENST00000366920.2_Nonsense_Mutation_p.E803*	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	803					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		AGCCCTGAAGGAGCTCTTCCA	0.433																																					p.E803X		.											.	MAP3K4	548	0			c.G2407T						.						57.0	61.0	59.0					6																	161507445		2203	4300	6503	SO:0001587	stop_gained	4216	exon8			CTGAAGGAGCTCT	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.2407G>T	6.37:g.161507445G>T	ENSP00000375986:p.Glu803*	80.0	0.0		95.0	34.0	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Nonsense_Mutation	SNP	ENST00000392142.4	37	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	G	40	8.251123	0.98727	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-36.3925	19.6017	0.95566	0.0:0.0:1.0:0.0	.	.	.	.	X	803	.	ENSP00000297332:E803X	E	+	1	0	MAP3K4	161427435	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	9.476000	0.97823	2.622000	0.88805	0.655000	0.94253	GAG	.		0.433	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
MAP4K1	11184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39105049	39105049	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:39105049A>G	ENST00000591517.1	-	5	378	c.350T>C	c.(349-351)gTc>gCc	p.V117A	MAP4K1_ENST00000589130.1_Missense_Mutation_p.V113A|MAP4K1_ENST00000589002.1_5'Flank|MAP4K1_ENST00000586296.1_Missense_Mutation_p.V117A|MAP4K1_ENST00000423454.2_5'Flank|MAP4K1_ENST00000396857.2_Missense_Mutation_p.V117A	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	117	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TTCCCGGCAGACATAGCTAAT	0.632																																					p.V117A		.											.	MAP4K1	980	0			c.T350C						.						98.0	104.0	102.0					19																	39105049		1926	4141	6067	SO:0001583	missense	11184	exon5			CGGCAGACATAGC	U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.350T>C	19.37:g.39105049A>G	ENSP00000465039:p.Val117Ala	63.0	0.0		206.0	23.0	NM_007181		Missense_Mutation	SNP	ENST00000591517.1	37	CCDS59385.1	.	.	.	.	.	.	.	.	.	.	A	16.75	3.208738	0.58343	.	.	ENSG00000104814	ENST00000396857;ENST00000221409	T	0.25912	1.77	4.87	4.87	0.63330	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.140996	0.47455	D	0.000239	T	0.33614	0.0869	L	0.60067	1.865	0.80722	D	1	P;P	0.43857	0.571;0.819	B;P	0.45913	0.229;0.497	T	0.17018	-1.0383	10	0.87932	D	0	.	13.7588	0.62952	1.0:0.0:0.0:0.0	.	117;117	Q92918-2;Q92918	.;M4K1_HUMAN	A	117	ENSP00000380066:V117A	ENSP00000221409:V117A	V	-	2	0	MAP4K1	43796889	0.992000	0.36948	1.000000	0.80357	0.950000	0.60333	5.549000	0.67261	1.958000	0.56883	0.368000	0.22195	GTC	.		0.632	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000453390.1	NM_001042600	
MAPRE3	22924	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27248563	27248563	+	Silent	SNP	C	C	T	rs113977877		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:27248563C>T	ENST00000233121.2	+	5	780	c.582C>T	c.(580-582)ggC>ggT	p.G194G	MAPRE3_ENST00000405074.3_Silent_p.G179G|MAPRE3_ENST00000402218.1_Silent_p.G179G			Q9UPY8	MARE3_HUMAN	microtubule-associated protein, RP/EB family, member 3	194	EB1 C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00576}.				mitotic nuclear division (GO:0007067)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of microtubule plus-end binding (GO:1903033)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCGAAATGGCGGCCATGAGA	0.577													c|||	1	0.000199681	0.0008	0.0	5008	,	,		19501	0.0		0.0	False		,,,				2504	0.0				p.G194G		.											.	MAPRE3	91	0			c.C582T						.						54.0	52.0	53.0					2																	27248563		2203	4300	6503	SO:0001819	synonymous_variant	22924	exon5			AAATGGCGGCCAT	Y11174	CCDS1731.1	2p23.3-p23.1	2008-06-04			ENSG00000084764	ENSG00000084764			6892	protein-coding gene	gene with protein product		605788				9233623	Standard	NM_012326		Approved	RP3, EB3	uc002rhw.3	Q9UPY8	OTTHUMG00000097067	ENST00000233121.2:c.582C>T	2.37:g.27248563C>T		151.0	1.0		119.0	48.0	NM_012326	B7WPK5|O00265|Q6FHB0|Q6FI15|Q9BZP7|Q9BZP8	Silent	SNP	ENST00000233121.2	37	CCDS1731.1																																																																																			C|0.500;T|0.500		0.577	MAPRE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214183.1	NM_012326	
MARCH6	10299	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	10403615	10403615	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:10403615G>T	ENST00000274140.5	+	15	1426	c.1294G>T	c.(1294-1296)Gtc>Ttc	p.V432F	MARCH6_ENST00000503788.1_Missense_Mutation_p.V327F|MARCH6_ENST00000510792.1_Missense_Mutation_p.V130F|MARCH6_ENST00000449913.2_Missense_Mutation_p.V384F	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	432					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						AATGGTATATGTCTTCTACTT	0.428																																					p.V432F		.											.	MARCH6	501	0			c.G1294T						.						174.0	153.0	160.0					5																	10403615		2203	4300	6503	SO:0001583	missense	10299	exon15			GTATATGTCTTCT	AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.1294G>T	5.37:g.10403615G>T	ENSP00000274140:p.Val432Phe	134.0	1.0		151.0	37.0	NM_005885	A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Missense_Mutation	SNP	ENST00000274140.5	37	CCDS34135.1	.	.	.	.	.	.	.	.	.	.	G	33	5.205390	0.95033	.	.	ENSG00000145495	ENST00000449913;ENST00000503788;ENST00000274140;ENST00000510792	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.70552	0.3237	M	0.85099	2.735	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.87578	0.986;0.978;0.998;0.947	T	0.75107	-0.3434	10	0.87932	D	0	-22.9243	19.4918	0.95052	0.0:0.0:1.0:0.0	.	327;384;12;432	B4DKJ2;B4DT33;B2RBJ1;O60337	.;.;.;MARH6_HUMAN	F	384;327;432;130	ENSP00000414643:V384F;ENSP00000425930:V327F;ENSP00000274140:V432F;ENSP00000424512:V130F	ENSP00000274140:V432F	V	+	1	0	MARCH6	10456615	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	9.505000	0.97989	2.616000	0.88540	0.557000	0.71058	GTC	.		0.428	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366919.2	NM_005885	
KMT2B	9757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36222992	36222992	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:36222992G>T	ENST00000222270.7	+	27	5621	c.5621G>T	c.(5620-5622)cGg>cTg	p.R1874L	KMT2B_ENST00000420124.1_Missense_Mutation_p.R1874L|KMT2B_ENST00000607650.1_RNA	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	1874					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TCGCCATCCCGGAGGCCCTTG	0.687																																					p.R1874L		.											.	MLL4	697	0			c.G5621T						.						12.0	14.0	13.0					19																	36222992		1865	4087	5952	SO:0001583	missense	8085	exon27			CATCCCGGAGGCC	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.5621G>T	19.37:g.36222992G>T	ENSP00000222270:p.Arg1874Leu	71.0	0.0		218.0	50.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	37	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	G	4.654	0.121565	0.08881	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	D;D	0.86562	-2.14;-2.14	5.33	4.29	0.51040	.	0.000000	0.40554	N	0.001069	D	0.83695	0.5310	M	0.63843	1.955	0.51012	D	0.999906	P	0.37122	0.583	B	0.29353	0.101	D	0.84772	0.0768	10	0.66056	D	0.02	.	14.5411	0.67995	0.0:0.0:0.8519:0.1481	.	1874	Q9UMN6	MLL4_HUMAN	L	1874	ENSP00000222270:R1874L;ENSP00000398837:R1874L	ENSP00000222270:R1874L	R	+	2	0	AD000671.1	40914832	1.000000	0.71417	1.000000	0.80357	0.036000	0.12997	5.498000	0.66931	1.366000	0.46076	-0.181000	0.13052	CGG	.		0.687	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
MPEG1	219972	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	58980026	58980026	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:58980026C>T	ENST00000361050.3	-	1	398	c.313G>A	c.(313-315)Gca>Aca	p.A105T	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	105	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.					integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				TGGTAATTTGCCCAGGATTCC	0.448																																					p.A105T		.											.	MPEG1	70	0			c.G313A						.						207.0	194.0	198.0					11																	58980026		1913	4121	6034	SO:0001583	missense	219972	exon1			AATTTGCCCAGGA	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.313G>A	11.37:g.58980026C>T	ENSP00000354335:p.Ala105Thr	84.0	0.0		83.0	7.0	NM_001039396	Q2M1T6|Q8TEF8	Missense_Mutation	SNP	ENST00000361050.3	37	CCDS41650.1	.	.	.	.	.	.	.	.	.	.	C	0.198	-1.047352	0.01981	.	.	ENSG00000197629	ENST00000361050;ENST00000545098	T	0.21932	1.98	5.05	-3.91	0.04168	Membrane attack complex component/perforin (MACPF) domain (1);	0.467745	0.21099	N	0.080188	T	0.07908	0.0198	N	0.08118	0	0.24352	N	0.994912	B	0.02656	0.0	B	0.01281	0.0	T	0.36696	-0.9737	10	0.14252	T	0.57	-1.897	11.2463	0.48998	0.0:0.2422:0.0:0.7578	.	105	Q2M385	MPEG1_HUMAN	T	105	ENSP00000354335:A105T	ENSP00000354335:A105T	A	-	1	0	MPEG1	58736602	0.050000	0.20438	0.174000	0.22961	0.009000	0.06853	0.176000	0.16782	-0.545000	0.06224	-0.825000	0.03093	GCA	.		0.448	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
MRPS2	51116	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	138392921	138392921	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr9:138392921C>T	ENST00000371785.1	+	3	330	c.121C>T	c.(121-123)Ctt>Ttt	p.L41F	RP11-426A6.5_ENST00000415062.1_RNA|C9orf116_ENST00000371789.3_5'Flank|MRPS2_ENST00000488610.1_3'UTR|C9orf116_ENST00000371791.1_Intron|MRPS2_ENST00000241600.5_Missense_Mutation_p.L41F|C9orf116_ENST00000429260.2_5'Flank			Q9Y399	RT02_HUMAN	mitochondrial ribosomal protein S2	41					translation (GO:0006412)	mitochondrion (GO:0005739)|small ribosomal subunit (GO:0015935)	structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.46e-53)|Epithelial(140;2.04e-47)|all cancers(34;1.23e-42)		CCGCAGGACGCTTGGAAGCGC	0.701																																					p.L41F		.											.	MRPS2	90	0			c.C121T						.						9.0	11.0	10.0					9																	138392921		2146	4231	6377	SO:0001583	missense	51116	exon2			AGGACGCTTGGAA	AB051627	CCDS6990.1	9q34	2012-09-13			ENSG00000122140	ENSG00000122140		"""Mitochondrial ribosomal proteins / small subunits"""	14495	protein-coding gene	gene with protein product		611971					Standard	NM_016034		Approved	CGI-91	uc004cfv.5	Q9Y399	OTTHUMG00000020910	ENST00000371785.1:c.121C>T	9.37:g.138392921C>T	ENSP00000360850:p.Leu41Phe	68.0	0.0		89.0	29.0	NM_016034	Q5T899|Q9BSQ4	Missense_Mutation	SNP	ENST00000371785.1	37	CCDS6990.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.306675	0.40795	.	.	ENSG00000122140	ENST00000371785;ENST00000241600;ENST00000453385	T;T;T	0.34667	1.84;1.84;1.35	4.17	-2.89	0.05665	.	2.045970	0.02694	U	0.111049	T	0.24812	0.0602	L	0.48642	1.525	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.06954	-1.0798	10	0.10636	T	0.68	-1.7267	1.6937	0.02857	0.1388:0.3989:0.1476:0.3147	.	41	Q9Y399	RT02_HUMAN	F	41;41;55	ENSP00000360850:L41F;ENSP00000241600:L41F;ENSP00000400082:L55F	ENSP00000241600:L41F	L	+	1	0	MRPS2	137532742	0.000000	0.05858	0.002000	0.10522	0.091000	0.18340	-0.389000	0.07342	-0.154000	0.11118	0.484000	0.47621	CTT	.		0.701	MRPS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054998.1		
MYH3	4621	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	10534941	10534941	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr17:10534941T>C	ENST00000583535.1	-	36	5360	c.5273A>G	c.(5272-5274)aAg>aGg	p.K1758R	MYH3_ENST00000226209.7_Missense_Mutation_p.K1758R	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1758					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						CGTGATGGCCTTCTTGGCCTT	0.567											OREG0024180	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K1758R		.											.	MYH3	95	0			c.A5273G						.						173.0	118.0	137.0					17																	10534941		2203	4300	6503	SO:0001583	missense	4621	exon36			ATGGCCTTCTTGG		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.5273A>G	17.37:g.10534941T>C	ENSP00000464317:p.Lys1758Arg	122.0	0.0	665	48.0	25.0	NM_002470	Q15492	Missense_Mutation	SNP	ENST00000583535.1	37	CCDS11157.1	.	.	.	.	.	.	.	.	.	.	T	29.8	5.040387	0.93630	.	.	ENSG00000109063	ENST00000226209	T	0.80214	-1.35	5.0	5.0	0.66597	Myosin tail (1);	.	.	.	.	D	0.87791	0.6266	M	0.82433	2.59	0.42409	D	0.992596	P	0.45212	0.853	P	0.53760	0.734	D	0.90043	0.4143	9	0.87932	D	0	.	15.1557	0.72739	0.0:0.0:0.0:1.0	.	1758	P11055	MYH3_HUMAN	R	1758	ENSP00000226209:K1758R	ENSP00000226209:K1758R	K	-	2	0	MYH3	10475666	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.864000	0.87037	2.216000	0.71823	0.459000	0.35465	AAG	.		0.567	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
MYO18B	84700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	26298603	26298603	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr22:26298603C>A	ENST00000407587.2	+	30	5019	c.4850C>A	c.(4849-4851)gCc>gAc	p.A1617D	MYO18B_ENST00000536204.1_3'UTR|CTA-125H2.2_ENST00000600211.1_RNA|MYO18B_ENST00000536101.1_Missense_Mutation_p.A1616D|CTA-125H2.2_ENST00000607895.1_RNA|CTA-125H2.2_ENST00000599080.1_RNA|CTA-125H2.2_ENST00000609275.1_RNA|CTA-125H2.2_ENST00000597548.1_RNA|CTA-125H2.2_ENST00000600269.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA|CTA-125H2.2_ENST00000453457.3_RNA|MYO18B_ENST00000335473.7_Missense_Mutation_p.A1616D|CTA-125H2.2_ENST00000594585.1_RNA|CTA-125H2.2_ENST00000599792.1_RNA|CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000609157.1_RNA|CTA-125H2.2_ENST00000595093.1_RNA|CTA-125H2.2_ENST00000609889.1_RNA|CTA-125H2.2_ENST00000609570.1_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000609823.1_RNA			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1616	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CTGGCCCAGGCCCTAGGTGAG	0.622																																					p.A1616D		.											.	MYO18B	142	0			c.C4847A						.						41.0	44.0	43.0					22																	26298603		1981	4162	6143	SO:0001583	missense	84700	exon30			CCCAGGCCCTAGG	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.4850C>A	22.37:g.26298603C>A	ENSP00000386096:p.Ala1617Asp	66.0	0.0		50.0	13.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	C	26.7	4.760173	0.89932	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.87729	-2.27;-2.27;-2.29	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.93481	0.7920	M	0.80422	2.495	0.52501	D	0.999956	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.993;0.989;0.988;0.995	D	0.94151	0.7405	10	0.72032	D	0.01	.	16.4582	0.84029	0.0:1.0:0.0:0.0	.	1129;1616;1617;1616	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	D	1616;1616;1617	ENSP00000441229:A1616D;ENSP00000334563:A1616D;ENSP00000386096:A1617D	ENSP00000334563:A1616D	A	+	2	0	MYO18B	24628603	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.860000	0.62961	2.464000	0.83262	0.655000	0.94253	GCC	.		0.622	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
MYO1F	4542	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	8619381	8619395	+	In_Frame_Del	DEL	CTCACAGTCGATAAG	CTCACAGTCGATAAG	-	rs201539438		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	CTCACAGTCGATAAG	CTCACAGTCGATAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:8619381_8619395delCTCACAGTCGATAAG	ENST00000338257.8	-	4	559_573	c.292_306delCTTATCGACTGTGAG	c.(292-306)cttatcgactgtgagdel	p.LIDCE98del		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	98	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						CACACTGGTTCTCACAGTCGATAAGCATGTTCCGG	0.609																																					p.98_102del		.											.	MYO1F	93	0			c.292_306del						.																																			SO:0001651	inframe_deletion	4542	exon4			CTGGTTCTCACAG	X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.292_306delCTTATCGACTGTGAG	19.37:g.8619381_8619395delCTCACAGTCGATAAG	ENSP00000344871:p.Leu98_Glu102del	55.0	0.0		46.0	14.0	NM_012335	Q8WWN7	In_Frame_Del	DEL	ENST00000338257.8	37	CCDS42494.1																																																																																			.		0.609	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2		
NCDN	23154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	36025987	36025987	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:36025987G>T	ENST00000373243.2	+	3	618	c.235G>T	c.(235-237)Gct>Tct	p.A79S	KIAA0319L_ENST00000325722.3_5'Flank|NCDN_ENST00000356090.4_Missense_Mutation_p.A79S|NCDN_ENST00000459931.1_3'UTR|NCDN_ENST00000373253.3_Missense_Mutation_p.A62S	NM_014284.2	NP_055099.1	Q9UBB6	NCDN_HUMAN	neurochondrin	79					bone resorption (GO:0045453)|neuron projection development (GO:0031175)|regulation of neuronal synaptic plasticity (GO:0048168)	cytosol (GO:0005829)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|pancreas(1)|skin(2)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GATCTTCGATGCTGTCGGCTT	0.572																																					p.A79S		.											.	NCDN	155	0			c.G235T						.						142.0	141.0	141.0					1																	36025987		2203	4300	6503	SO:0001583	missense	23154	exon4			TTCGATGCTGTCG	AB011179	CCDS392.1, CCDS30672.1	1p34.3	2008-02-05			ENSG00000020129	ENSG00000020129			17597	protein-coding gene	gene with protein product		608458				15007648	Standard	NM_014284		Approved	NCDN-1, NCDN-2	uc001bza.3	Q9UBB6	OTTHUMG00000059204	ENST00000373243.2:c.235G>T	1.37:g.36025987G>T	ENSP00000362340:p.Ala79Ser	129.0	0.0		109.0	36.0	NM_001014839	D3DPR9|Q9UBY2|Q9Y4A6|Q9Y4D9	Missense_Mutation	SNP	ENST00000373243.2	37	CCDS392.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.388735	0.82902	.	.	ENSG00000020129	ENST00000373253;ENST00000356090;ENST00000373243;ENST00000437806	T;T;T	0.70749	-0.51;-0.51;-0.51	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.82646	0.5082	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80686	-0.1272	10	0.33141	T	0.24	-11.8617	17.9511	0.89053	0.0:0.0:1.0:0.0	.	79	Q9UBB6	NCDN_HUMAN	S	62;79;79;62	ENSP00000362350:A62S;ENSP00000348394:A79S;ENSP00000362340:A79S	ENSP00000348394:A79S	A	+	1	0	NCDN	35798574	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	8.955000	0.93058	2.480000	0.83734	0.561000	0.74099	GCT	.		0.572	NCDN-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131298.1	NM_014284	
NCOA6	23054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	33329288	33329288	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr20:33329288G>A	ENST00000374796.2	-	12	7342	c.4772C>T	c.(4771-4773)cCc>cTc	p.P1591L	NCOA6_ENST00000359003.2_Missense_Mutation_p.P1591L			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1591					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						TGGGGGCAAGGGAGTGGAAAT	0.468																																					p.P1591L		.											.	NCOA6	292	0			c.C4772T						.						130.0	117.0	122.0					20																	33329288		2203	4300	6503	SO:0001583	missense	23054	exon11			GGCAAGGGAGTGG	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.4772C>T	20.37:g.33329288G>A	ENSP00000363929:p.Pro1591Leu	71.0	0.0		130.0	54.0	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	37	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.532212	0.64972	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.25579	1.79;1.79	5.55	5.55	0.83447	.	0.077816	0.56097	D	0.000034	T	0.21590	0.0520	N	0.24115	0.695	0.80722	D	1	P	0.43094	0.799	B	0.38378	0.272	T	0.02391	-1.1166	10	0.62326	D	0.03	-7.102	19.7069	0.96076	0.0:0.0:1.0:0.0	.	1591	Q14686	NCOA6_HUMAN	L	1591	ENSP00000363929:P1591L;ENSP00000351894:P1591L	ENSP00000351894:P1591L	P	-	2	0	NCOA6	32792949	1.000000	0.71417	0.982000	0.44146	0.910000	0.53928	8.686000	0.91250	2.894000	0.99253	0.591000	0.81541	CCC	.		0.468	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
NEURL1	9148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	105350084	105350084	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:105350084C>A	ENST00000369780.4	+	6	2089	c.1680C>A	c.(1678-1680)tgC>tgA	p.C560*	SH3PXD2A_ENST00000427662.2_Intron|NEURL_ENST00000369777.2_Nonsense_Mutation_p.C543*	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		560					brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		GCCCCATCTGCCGCCGCCCCA	0.637																																					p.C560X		.											.	NEURL	226	0			c.C1680A						.						67.0	55.0	59.0					10																	105350084		2203	4300	6503	SO:0001587	stop_gained	9148	exon6			CATCTGCCGCCGC																												ENST00000369780.4:c.1680C>A	10.37:g.105350084C>A	ENSP00000358795:p.Cys560*	77.0	0.0		63.0	17.0	NM_004210	Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Nonsense_Mutation	SNP	ENST00000369780.4	37	CCDS7551.1	.	.	.	.	.	.	.	.	.	.	C	36	5.739640	0.96873	.	.	ENSG00000107954	ENST00000369780;ENST00000369777	.	.	.	5.84	4.89	0.63831	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.168	10.3372	0.43856	0.0:0.8432:0.0:0.1568	.	.	.	.	X	560;543	.	ENSP00000358792:C543X	C	+	3	2	NEURL	105340074	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.507000	0.45442	1.383000	0.46405	-0.367000	0.07326	TGC	.		0.637	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1		
NLRP5	126206	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	56539232	56539232	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:56539232G>T	ENST00000390649.3	+	7	1633	c.1633G>T	c.(1633-1635)Gtg>Ttg	p.V545L		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	545	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TAGGAAGTCAGTGTTTGACGG	0.562																																					p.V545L		.											.	NLRP5	162	0			c.G1633T						.						58.0	60.0	59.0					19																	56539232		2123	4250	6373	SO:0001583	missense	126206	exon7			AAGTCAGTGTTTG	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1633G>T	19.37:g.56539232G>T	ENSP00000375063:p.Val545Leu	120.0	1.0		116.0	62.0	NM_153447	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.901579	0.33535	.	.	ENSG00000171487	ENST00000390649	T	0.72282	-0.64	2.82	1.73	0.24493	.	0.247193	0.21203	N	0.078426	T	0.66684	0.2814	L	0.33093	0.98	0.09310	N	1	P	0.47545	0.897	P	0.54924	0.764	T	0.55464	-0.8137	10	0.39692	T	0.17	.	7.5959	0.28048	0.0:0.2647:0.7353:0.0	.	545	P59047	NALP5_HUMAN	L	545	ENSP00000375063:V545L	ENSP00000375063:V545L	V	+	1	0	NLRP5	61231044	0.127000	0.22367	0.018000	0.16275	0.007000	0.05969	0.156000	0.16382	0.702000	0.31825	0.555000	0.69702	GTG	.		0.562	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
NOS3	4846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150696315	150696315	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:150696315G>C	ENST00000484524.1	+	8	994	c.994G>C	c.(994-996)Gcc>Ccc	p.A332P	NOS3_ENST00000461406.1_Missense_Mutation_p.A126P|NOS3_ENST00000467517.1_Missense_Mutation_p.A332P|NOS3_ENST00000297494.3_Missense_Mutation_p.A332P	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCGCTGGTACGCCCTCCCGGC	0.642																																					p.A332P		.											.	NOS3	1011	0			c.G994C						.						61.0	68.0	66.0					7																	150696315		2201	4295	6496	SO:0001583	missense	4846	exon8			TGGTACGCCCTCC		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.994G>C	7.37:g.150696315G>C	ENSP00000420215:p.Ala332Pro	42.0	0.0		51.0	32.0	NM_001160111	Q495E5	Missense_Mutation	SNP	ENST00000484524.1	37	CCDS55182.1	.	.	.	.	.	.	.	.	.	.	N	28.3	4.911772	0.92178	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.35605	1.3;1.47;1.3;1.3	5.59	5.59	0.84812	Nitric oxide synthase, oxygenase domain (2);	0.000000	0.64402	D	0.000014	T	0.67373	0.2886	M	0.89353	3.025	0.58432	D	0.999996	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.997;0.995;0.973	T	0.73681	-0.3906	10	0.87932	D	0	-9.7199	17.0996	0.86645	0.0:0.0:1.0:0.0	.	332;332;332;126;332	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	P	332;126;332;332	ENSP00000297494:A332P;ENSP00000417143:A126P;ENSP00000420215:A332P;ENSP00000420551:A332P	ENSP00000297494:A332P	A	+	1	0	NOS3	150327248	0.997000	0.39634	0.958000	0.39756	0.847000	0.48162	6.771000	0.74996	2.620000	0.88729	0.639000	0.83563	GCC	.		0.642	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	NM_000603	
NPHP3	27031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	132438610	132438610	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr3:132438610T>G	ENST00000337331.5	-	2	544	c.458A>C	c.(457-459)cAa>cCa	p.Q153P	NPHP3_ENST00000326682.8_Missense_Mutation_p.Q153P|NPHP3_ENST00000343113.4_Missense_Mutation_p.Q153P|NPHP3-AS1_ENST00000489343.1_RNA|NPHP3-AS1_ENST00000504440.1_RNA|NPHP3_ENST00000476742.1_5'Flank	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	153					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTCCATTGCTTGGTATTTCGC	0.333																																					p.Q153P		.											.	NPHP3	91	0			c.A458C						.						149.0	141.0	144.0					3																	132438610		2203	4299	6502	SO:0001583	missense	27031	exon2			ATTGCTTGGTATT	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.458A>C	3.37:g.132438610T>G	ENSP00000338766:p.Gln153Pro	107.0	0.0		64.0	28.0	NM_153240	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Missense_Mutation	SNP	ENST00000337331.5	37	CCDS3078.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.453686	0.84209	.	.	ENSG00000113971	ENST00000326682;ENST00000337331;ENST00000343113	D;D;D	0.93763	-3.28;-3.23;-2.01	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.94568	0.8250	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.95442	0.8526	10	0.87932	D	0	-21.2615	15.689	0.77436	0.0:0.0:0.0:1.0	.	153	Q7Z494	NPHP3_HUMAN	P	153	ENSP00000319909:Q153P;ENSP00000338766:Q153P;ENSP00000344802:Q153P	ENSP00000319909:Q153P	Q	-	2	0	NPHP3	133921300	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.102000	0.63906	0.455000	0.32223	CAA	.		0.333	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	NM_153240	
NPTX2	4885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	98256508	98256508	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:98256508G>T	ENST00000265634.3	+	4	1085	c.920G>T	c.(919-921)gGc>gTc	p.G307V		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	307	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			GTCAGTGACGGCAAGTGGCAC	0.642																																					p.G307V		.											.	NPTX2	515	0			c.G920T						.						86.0	72.0	76.0					7																	98256508		2203	4300	6503	SO:0001583	missense	4885	exon4			GTGACGGCAAGTG		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.920G>T	7.37:g.98256508G>T	ENSP00000265634:p.Gly307Val	64.0	0.0		64.0	30.0	NM_002523	A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	ENST00000265634.3	37	CCDS5657.1	.	.	.	.	.	.	.	.	.	.	G	31	5.099807	0.94197	.	.	ENSG00000106236	ENST00000265634	T	0.66099	-0.19	5.38	5.38	0.77491	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.86661	0.5986	H	0.96777	3.88	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90623	0.4561	10	0.66056	D	0.02	-12.8195	18.4772	0.90797	0.0:0.0:1.0:0.0	.	307	P47972	NPTX2_HUMAN	V	307	ENSP00000265634:G307V	ENSP00000265634:G307V	G	+	2	0	NPTX2	98094444	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.813000	0.99286	2.677000	0.91161	0.650000	0.86243	GGC	.		0.642	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523	
NXF3	56000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	102334693	102334693	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chrX:102334693G>A	ENST00000395065.3	-	13	1259	c.1158C>T	c.(1156-1158)gcC>gcT	p.A386A	NXF3_ENST00000425644.1_Silent_p.A58A	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	386	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						ATACTCACGGGGCTGAGTCCT	0.572																																					p.A386A		.											.	NXF3	205	0			c.C1158T						.						99.0	91.0	94.0					X																	102334693		2203	4300	6503	SO:0001819	synonymous_variant	56000	exon13			TCACGGGGCTGAG	AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.1158C>T	X.37:g.102334693G>A		108.0	0.0		77.0	58.0	NM_022052	B4DYS7|Q5H9I1|Q9H1A9	Silent	SNP	ENST00000395065.3	37	CCDS14503.1	.	.	.	.	.	.	.	.	.	.	G	7.117	0.577203	0.13686	.	.	ENSG00000147206	ENST00000427570	.	.	.	4.44	0.315	0.15852	.	.	.	.	.	T	0.32406	0.0828	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.27971	-1.0058	4	.	.	.	12.3355	8.1428	0.31093	0.4187:0.0:0.5813:0.0	.	.	.	.	S	263	.	.	P	-	1	0	NXF3	102221349	0.331000	0.24713	0.000000	0.03702	0.026000	0.11368	0.695000	0.25527	-0.202000	0.10268	-0.380000	0.06706	CCC	.		0.572	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057684.1	NM_022052	
OBSCN	84033	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228503597	228503597	+	Silent	SNP	C	C	A	rs369546661		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:228503597C>A	ENST00000422127.1	+	50	13106	c.13062C>A	c.(13060-13062)ggC>ggA	p.G4354G	OBSCN_ENST00000570156.2_Silent_p.G5311G|OBSCN_ENST00000366709.4_Silent_p.G1473G|OBSCN_ENST00000366707.4_Silent_p.G1988G|OBSCN_ENST00000284548.11_Silent_p.G4354G	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4354	Ig-like 45.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CGCTGGAGGGCGGCGAGGCGC	0.697																																					p.G5311G		.											.	OBSCN	403	0			c.C15933A						.						17.0	23.0	21.0					1																	228503597		2081	4197	6278	SO:0001819	synonymous_variant	84033	exon61			GGAGGGCGGCGAG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13062C>A	1.37:g.228503597C>A		63.0	1.0		51.0	16.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			.		0.697	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228525079	228525079	+	Missense_Mutation	SNP	G	G	A	rs34771878		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:228525079G>A	ENST00000422127.1	+	66	16839	c.16795G>A	c.(16795-16797)Ggc>Agc	p.G5599S	OBSCN_ENST00000570156.2_Missense_Mutation_p.G6556S|OBSCN_ENST00000366709.4_Missense_Mutation_p.G2718S|OBSCN_ENST00000366707.4_Missense_Mutation_p.G3233S|OBSCN_ENST00000284548.11_Missense_Mutation_p.G5599S	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5599					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CGATGCCCGAGGCGAGGTGGG	0.652																																					p.G6556S		.											.	OBSCN	403	0			c.G19666A						.						20.0	23.0	22.0					1																	228525079		2052	4173	6225	SO:0001583	missense	84033	exon77			GCCCGAGGCGAGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.16795G>A	1.37:g.228525079G>A	ENSP00000409493:p.Gly5599Ser	223.0	0.0		165.0	55.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.4|21.4	4.139130|4.139130	0.77775|0.77775	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709|ENST00000441106	T;T;T;T|T	0.62941|0.66638	0.33;-0.01;0.04;0.48|-0.22	4.37|4.37	4.37|4.37	0.52481|0.52481	Src homology-3 domain (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.74801|0.74801	0.3764|0.3764	L|L	0.54323|0.54323	1.7|1.7	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.999;1.0|.	T|T	0.77395|0.77395	-0.2604|-0.2604	10|7	0.45353|0.59425	T|D	0.12|0.04	.|.	17.4671|17.4671	0.87635|0.87635	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	5599;5599|.	Q5VST9;Q5VST9-3|.	OBSCN_HUMAN;.|.	S|K	5599;5599;3233;2718|214	ENSP00000284548:G5599S;ENSP00000409493:G5599S;ENSP00000355668:G3233S;ENSP00000355670:G2718S|ENSP00000388554:R214K	ENSP00000284548:G5599S|ENSP00000388554:R214K	G|R	+|+	1|2	0|0	OBSCN|OBSCN	226591702|226591702	1.000000|1.000000	0.71417|0.71417	0.407000|0.407000	0.26434|0.26434	0.003000|0.003000	0.03518|0.03518	8.939000|8.939000	0.92951|0.92951	2.437000|2.437000	0.82529|0.82529	0.655000|0.655000	0.94253|0.94253	GGC|AGG	.		0.652	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OBSCN	84033	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	228560614	228560614	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:228560614G>T	ENST00000422127.1	+	94	22179	c.22135G>T	c.(22135-22137)Gca>Tca	p.A7379S	OBSCN_ENST00000570156.2_Missense_Mutation_p.A8336S|OBSCN_ENST00000366707.4_Missense_Mutation_p.A5013S	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	7379					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CGCGCTGCTGGCAGAGGCTGC	0.682																																					p.A8336S		.											.	OBSCN	403	0			c.G25006T						.						19.0	24.0	22.0					1																	228560614		2195	4297	6492	SO:0001583	missense	84033	exon105			CTGCTGGCAGAGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.22135G>T	1.37:g.228560614G>T	ENSP00000409493:p.Ala7379Ser	72.0	1.0		58.0	19.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.37|14.37	2.514255|2.514255	0.44763|0.44763	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000422127;ENST00000366707|ENST00000441106	T;T|.	0.61392|.	0.11;0.15|.	5.15|5.15	2.21|2.21	0.28008|0.28008	.|.	.|.	.|.	.|.	.|.	T|T	0.18299|0.18299	0.0439|0.0439	N|N	0.08118|0.08118	0|0	0.19575|0.19575	N|N	0.999969|0.999969	B|.	0.16396|.	0.017|.	B|.	0.09377|.	0.004|.	T|T	0.26087|0.26087	-1.0113|-1.0113	9|5	0.06891|.	T|.	0.86|.	.|.	8.7256|8.7256	0.34467|0.34467	0.2442:0.0:0.7558:0.0|0.2442:0.0:0.7558:0.0	.|.	7379|.	Q5VST9|.	OBSCN_HUMAN|.	S|V	7379;5013|1995	ENSP00000409493:A7379S;ENSP00000355668:A5013S|.	ENSP00000355668:A5013S|.	A|G	+|+	1|2	0|0	OBSCN|OBSCN	226627237|226627237	0.000000|0.000000	0.05858|0.05858	0.182000|0.182000	0.23118|0.23118	0.011000|0.011000	0.07611|0.07611	0.127000|0.127000	0.15790|0.15790	0.571000|0.571000	0.29365|0.29365	0.313000|0.313000	0.20887|0.20887	GCA|GGC	.		0.682	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR51G1	79324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	4945191	4945191	+	Missense_Mutation	SNP	C	C	A	rs148836962	byFrequency	TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:4945191C>A	ENST00000321961.2	-	1	446	c.379G>T	c.(379-381)Gcc>Tcc	p.A127S	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	127						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTGCAGACGGCCACGTAGCGG	0.517																																					p.A127S		.											.	OR51G1	70	0			c.G379T						.						112.0	98.0	103.0					11																	4945191		2201	4298	6499	SO:0001583	missense	79324	exon1			AGACGGCCACGTA	AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.379G>T	11.37:g.4945191C>A	ENSP00000322546:p.Ala127Ser	103.0	0.0		104.0	26.0	NM_001005237	B9EGW8|Q6IFH6	Missense_Mutation	SNP	ENST00000321961.2	37	CCDS31366.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.678186	0.47886	.	.	ENSG00000176879	ENST00000321961	T	0.52983	0.64	4.2	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39020	U	0.001481	T	0.77994	0.4214	H	0.96175	3.78	0.38309	D	0.943194	D	0.89917	1.0	D	0.91635	0.999	D	0.87237	0.2264	10	0.87932	D	0	.	15.2651	0.73654	0.0:1.0:0.0:0.0	.	127	Q8NGK1	O51G1_HUMAN	S	127	ENSP00000322546:A127S	ENSP00000322546:A127S	A	-	1	0	OR51G1	4901767	1.000000	0.71417	1.000000	0.80357	0.090000	0.18270	4.450000	0.60041	2.169000	0.68431	0.557000	0.71058	GCC	C|0.999;T|0.001		0.517	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142345.1	NM_001005237	
OR4D5	219875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	123811018	123811018	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:123811018G>T	ENST00000307033.2	+	1	769	c.695G>T	c.(694-696)gGc>gTc	p.G232V		NM_001001965.1	NP_001001965.1	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D, member 5	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TCACGGGAGGGCCGCAGCAAG	0.527																																					p.G232V		.											.	OR4D5	69	0			c.G695T						.						224.0	194.0	204.0					11																	123811018		2202	4299	6501	SO:0001583	missense	219875	exon1			GGGAGGGCCGCAG	BK004316	CCDS31699.1	11q24.1	2012-08-09			ENSG00000171014	ENSG00000171014		"""GPCR / Class A : Olfactory receptors"""	14852	protein-coding gene	gene with protein product							Standard	NM_001001965		Approved		uc001pzk.1	Q8NGN0	OTTHUMG00000165961	ENST00000307033.2:c.695G>T	11.37:g.123811018G>T	ENSP00000305970:p.Gly232Val	145.0	0.0		143.0	35.0	NM_001001965	B9EGZ4|Q6IFE6	Missense_Mutation	SNP	ENST00000307033.2	37	CCDS31699.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.891291	0.33442	.	.	ENSG00000171014	ENST00000307033	T	0.00299	8.22	5.49	-0.146	0.13432	GPCR, rhodopsin-like superfamily (1);	0.720448	0.12266	N	0.484316	T	0.00754	0.0025	H	0.94964	3.605	0.48571	D	0.999678	P	0.46020	0.871	D	0.64687	0.928	T	0.59542	-0.7435	10	0.87932	D	0	0.0461	5.36	0.16083	0.3139:0.1613:0.5248:0.0	.	232	Q8NGN0	OR4D5_HUMAN	V	232	ENSP00000305970:G232V	ENSP00000305970:G232V	G	+	2	0	OR4D5	123316228	0.004000	0.15560	0.176000	0.23000	0.284000	0.27059	0.438000	0.21559	-0.323000	0.08602	-0.355000	0.07637	GGC	.		0.527	OR4D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387263.1	NM_001001965	
OTOF	9381	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	26699163	26699163	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:26699163C>A	ENST00000272371.2	-	23	2825	c.2699G>T	c.(2698-2700)gGc>gTc	p.G900V	OTOF_ENST00000402415.3_Missense_Mutation_p.G210V|OTOF_ENST00000339598.3_Missense_Mutation_p.G153V|OTOF_ENST00000338581.6_Missense_Mutation_p.G153V|OTOF_ENST00000403946.3_Missense_Mutation_p.G900V	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	900					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCCTGCCGAGCCGAAGCCCCG	0.697																																					p.G900V	GBM(102;732 1451 20652 24062 31372)	.											.	OTOF	135	0			c.G2699T						.						25.0	25.0	25.0					2																	26699163		2089	4116	6205	SO:0001583	missense	9381	exon23			GCCGAGCCGAAGC	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.2699G>T	2.37:g.26699163C>A	ENSP00000272371:p.Gly900Val	27.0	0.0		27.0	10.0	NM_194248	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856946	0.71834	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63	5.41	5.41	0.78517	Ferlin B-domain (1);	0.000000	0.85682	D	0.000000	D	0.91670	0.7367	M	0.84326	2.69	0.80722	D	1	D;D;D;D	0.89917	1.0;0.994;1.0;1.0	D;P;D;D	0.97110	1.0;0.828;1.0;0.999	D	0.91667	0.5347	10	0.48119	T	0.1	-40.8975	17.7511	0.88434	0.0:1.0:0.0:0.0	.	900;153;210;153	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	V	153;153;210;900;900	ENSP00000345137:G153V;ENSP00000344521:G153V;ENSP00000383906:G210V;ENSP00000272371:G900V;ENSP00000385255:G900V	ENSP00000272371:G900V	G	-	2	0	OTOF	26552667	1.000000	0.71417	1.000000	0.80357	0.383000	0.30230	7.630000	0.83225	2.546000	0.85860	0.561000	0.74099	GGC	.		0.697	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
PACSIN3	29763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	47201773	47201773	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:47201773C>A	ENST00000539589.1	-	6	909	c.567G>T	c.(565-567)caG>caT	p.Q189H	PACSIN3_ENST00000298838.6_Missense_Mutation_p.Q189H	NM_001184975.1	NP_001171904.1	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in neurons 3	189	F-BAR domain. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endocytosis (GO:0045806)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|cytoskeletal protein binding (GO:0008092)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)	11						CCACCCGTTCCTGCAGTTTGC	0.652											OREG0020952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q189H		.											.	PACSIN3	68	0			c.G567T						.						105.0	90.0	95.0					11																	47201773		2201	4298	6499	SO:0001583	missense	29763	exon6			CCGTTCCTGCAGT	AF130979	CCDS31481.1	11p12-p11	2008-02-05				ENSG00000165912			8572	protein-coding gene	gene with protein product	"""syndapin III"""	606513				10531379	Standard	NM_016223		Approved	SDPIII	uc001ndx.3	Q9UKS6		ENST00000539589.1:c.567G>T	11.37:g.47201773C>A	ENSP00000440945:p.Gln189His	23.0	0.0	945	30.0	13.0	NM_016223	A6NH84|Q9H331|Q9NWV9	Missense_Mutation	SNP	ENST00000539589.1	37	CCDS31481.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.25|13.25	2.180563|2.180563	0.38511|0.38511	.|.	.|.	ENSG00000165912|ENSG00000165912	ENST00000298838;ENST00000539589;ENST00000528462|ENST00000415232	T;T;T|.	0.45668|.	0.89;0.89;0.89|.	5.52|5.52	3.31|3.31	0.37934|0.37934	.|.	0.186773|.	0.53938|.	D|.	0.000053|.	T|T	0.56659|0.56659	0.2000|0.2000	L|L	0.34521|0.34521	1.04|1.04	0.39448|0.39448	D|D	0.967355|0.967355	P|.	0.46327|.	0.876|.	B|.	0.34093|.	0.175|.	T|T	0.62927|0.62927	-0.6750|-0.6750	10|6	0.41790|0.62326	T|D	0.15|0.03	-40.0996|-40.0996	13.0496|13.0496	0.58948|0.58948	0.0:0.8465:0.0:0.1535|0.0:0.8465:0.0:0.1535	.|.	189|.	Q9UKS6|.	PACN3_HUMAN|.	H|M	189|188	ENSP00000298838:Q189H;ENSP00000440945:Q189H;ENSP00000437252:Q189H|.	ENSP00000298838:Q189H|ENSP00000405352:R188M	Q|R	-|-	3|2	2|0	PACSIN3|PACSIN3	47158349|47158349	0.937000|0.937000	0.31787|0.31787	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	0.134000|0.134000	0.15932|0.15932	1.351000|1.351000	0.45789|0.45789	0.561000|0.561000	0.74099|0.74099	CAG|AGG	.		0.652	PACSIN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391632.1	NM_016223	
PAN3	255967	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	28794511	28794511	+	Silent	SNP	G	G	A	rs45530141	byFrequency	TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr13:28794511G>A	ENST00000380958.3	+	6	1148	c.996G>A	c.(994-996)gcG>gcA	p.A332A	PAN3_ENST00000399613.1_Silent_p.A132A	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit											endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		CTGGATTAGCGCCAGGTAAGT	0.428													G|||	38	0.00758786	0.0023	0.0115	5008	,	,		15213	0.0		0.0229	False		,,,				2504	0.0041				p.A332A		.											.	PAN3	69	0			c.G996A						.	G		14,4392	21.2+/-45.6	0,14,2189	157.0	159.0	158.0		996	-5.6	1.0	13	dbSNP_127	158	153,8447	74.2+/-136.8	1,151,4148	no	coding-synonymous	PAN3	NM_175854.7		1,165,6337	AA,AG,GG		1.7791,0.3177,1.284		332/888	28794511	167,12839	2203	4300	6503	SO:0001819	synonymous_variant	255967	exon6			ATTAGCGCCAGGT	AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.996G>A	13.37:g.28794511G>A		77.0	0.0		67.0	28.0	NM_175854		Silent	SNP	ENST00000380958.3	37	CCDS9329.2																																																																																			G|0.988;A|0.012		0.428	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044318.4	NM_175854	
PCDHA8	56140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140222692	140222692	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:140222692G>T	ENST00000531613.1	+	1	1786	c.1786G>T	c.(1786-1788)Gca>Tca	p.A596S	PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.A596S|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	596	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGGTGCGCGCAGTGGACGC	0.701																																					p.A596S		.											.	PCDHA8	92	0			c.G1786T						.						70.0	72.0	71.0					5																	140222692		2196	4266	6462	SO:0001583	missense	56140	exon1			GTGCGCGCAGTGG	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1786G>T	5.37:g.140222692G>T	ENSP00000434655:p.Ala596Ser	64.0	0.0		42.0	21.0	NM_031856	B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	37	CCDS54919.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.479331	0.63849	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.61510	0.1;0.1	3.71	3.71	0.42584	Cadherin (4);Cadherin-like (1);	0.000000	0.36444	U	0.002583	D	0.83018	0.5163	H	0.98178	4.165	0.43372	D	0.99546	D;D	0.71674	0.998;0.99	P;P	0.62435	0.902;0.782	D	0.90541	0.4502	10	0.87932	D	0	.	15.9009	0.79377	0.0:0.0:1.0:0.0	.	596;596	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	S	596	ENSP00000434655:A596S;ENSP00000367363:A596S	ENSP00000367363:A596S	A	+	1	0	PCDHA8	140202876	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	5.926000	0.70070	1.789000	0.52484	0.306000	0.20318	GCA	.		0.701	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
PCNXL3	399909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65394885	65394885	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:65394885G>A	ENST00000355703.3	+	22	4073	c.3534G>A	c.(3532-3534)gcG>gcA	p.A1178A		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1178						integral component of membrane (GO:0016021)		p.A1178A(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						GCTGCCGGGCGCTGCTGATGA	0.662																																					p.A1178A		.											.	PCNXL3	46	1	Substitution - coding silent(1)	lung(1)	c.G3534A						.						50.0	54.0	52.0					11																	65394885		2098	4214	6312	SO:0001819	synonymous_variant	399909	exon22			CCGGGCGCTGCTG	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.3534G>A	11.37:g.65394885G>A		21.0	0.0		29.0	7.0	NM_032223	Q6MZN8	Silent	SNP	ENST00000355703.3	37	CCDS44650.1																																																																																			.		0.662	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223	
PDE8A	5151	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	85681082	85681082	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:85681082G>T	ENST00000310298.4	+	23	2690	c.2438G>T	c.(2437-2439)tGg>tTg	p.W813L	PDE8A_ENST00000339708.5_Missense_Mutation_p.W767L|PDE8A_ENST00000394553.1_Missense_Mutation_p.W813L|PDE8A_ENST00000557957.1_Missense_Mutation_p.W741L			O60658	PDE8A_HUMAN	phosphodiesterase 8A	813	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	TTTAAATACTGGAAAGGACTG	0.468																																					p.W813L		.											.	PDE8A	94	0			c.G2438T						.						101.0	85.0	91.0					15																	85681082		2203	4299	6502	SO:0001583	missense	5151	exon22			AATACTGGAAAGG	AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.2438G>T	15.37:g.85681082G>T	ENSP00000311453:p.Trp813Leu	146.0	0.0		103.0	36.0	NM_002605	B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Missense_Mutation	SNP	ENST00000310298.4	37	CCDS10336.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725813	0.69074	.	.	ENSG00000073417	ENST00000310298;ENST00000394553;ENST00000339708	T;T;T	0.81330	-1.48;-1.48;-1.48	5.49	5.49	0.81192	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.000000	0.85682	D	0.000000	D	0.90068	0.6898	M	0.80746	2.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.90735	0.4645	10	0.87932	D	0	.	16.9239	0.86170	0.0:0.0:1.0:0.0	.	767;813	O60658-2;O60658	.;PDE8A_HUMAN	L	813;813;767	ENSP00000311453:W813L;ENSP00000378056:W813L;ENSP00000340679:W767L	ENSP00000311453:W813L	W	+	2	0	PDE8A	83482086	1.000000	0.71417	1.000000	0.80357	0.013000	0.08279	9.185000	0.94900	2.865000	0.98341	0.655000	0.94253	TGG	.		0.468	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309018.1	NM_002605	
PDZRN4	29951	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	41966302	41966302	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:41966302C>A	ENST00000402685.2	+	10	1729	c.1721C>A	c.(1720-1722)gCc>gAc	p.A574D	PDZRN4_ENST00000539469.2_Missense_Mutation_p.A316D|PDZRN4_ENST00000298919.7_Missense_Mutation_p.A314D	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	574							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GAGAATGCAGCCGAGGACCCC	0.498																																					p.A574D		.											.	PDZRN4	296	0			c.C1721A						.						101.0	89.0	93.0					12																	41966302		2203	4300	6503	SO:0001583	missense	29951	exon10			ATGCAGCCGAGGA	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1721C>A	12.37:g.41966302C>A	ENSP00000384197:p.Ala574Asp	200.0	1.0		161.0	81.0	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	37	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	C	7.081	0.570320	0.13560	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.72505	-0.66;3.83;3.82	5.05	3.21	0.36854	.	1.424160	0.04150	N	0.321150	T	0.68192	0.2974	L	0.50333	1.59	0.09310	N	1	P;B;B	0.34462	0.454;0.061;0.061	B;B;B	0.32022	0.105;0.139;0.139	T	0.57763	-0.7755	10	0.59425	D	0.04	-3.8108	11.4137	0.49939	0.0:0.8482:0.0:0.1518	.	574;314;316	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	D	574;316;314	ENSP00000384197:A574D;ENSP00000439990:A316D;ENSP00000298919:A314D	ENSP00000298919:A314D	A	+	2	0	PDZRN4	40252569	0.186000	0.23225	0.006000	0.13384	0.505000	0.33919	1.444000	0.35068	0.776000	0.33473	-0.143000	0.13931	GCC	.		0.498	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
PHF21B	112885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	45279146	45279146	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr22:45279146C>A	ENST00000313237.5	-	13	1566	c.1416G>T	c.(1414-1416)caG>caT	p.Q472H	PHF21B_ENST00000396103.3_Missense_Mutation_p.Q430H|PHF21B_ENST00000403565.1_Missense_Mutation_p.Q268H|PHF21B_ENST00000404079.2_Missense_Mutation_p.Q418H	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	472							zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		GGGTGCCCCTCTGGCGGGCCA	0.627																																					p.Q472H		.											.	PHF21B	93	0			c.G1416T						.						44.0	51.0	48.0					22																	45279146		2203	4300	6503	SO:0001583	missense	112885	exon13			GCCCCTCTGGCGG	AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.1416G>T	22.37:g.45279146C>A	ENSP00000324403:p.Gln472His	29.0	0.0		38.0	10.0	NM_138415	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Missense_Mutation	SNP	ENST00000313237.5	37	CCDS14061.1	.	.	.	.	.	.	.	.	.	.	c	17.64	3.439142	0.63067	.	.	ENSG00000056487	ENST00000403565;ENST00000313237;ENST00000396103;ENST00000404079	D;D;D;D	0.88046	-2.33;-1.66;-1.71;-1.71	3.49	0.682	0.17992	.	0.094539	0.42420	U	0.000705	D	0.89315	0.6680	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.58970	0.984;0.973;0.973;0.966	P;P;P;P	0.62740	0.906;0.807;0.807;0.751	D	0.86671	0.1910	10	0.87932	D	0	-28.2465	7.8319	0.29347	0.0:0.7522:0.0:0.2478	.	430;418;472;268	Q96EK2-3;B7Z4F8;Q96EK2;B1AHC5	.;.;PF21B_HUMAN;.	H	268;472;430;418	ENSP00000385053:Q268H;ENSP00000324403:Q472H;ENSP00000379410:Q430H;ENSP00000385105:Q418H	ENSP00000324403:Q472H	Q	-	3	2	PHF21B	43657810	1.000000	0.71417	0.998000	0.56505	0.950000	0.60333	2.556000	0.45862	-0.002000	0.14469	0.299000	0.19835	CAG	.		0.627	PHF21B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321731.2	NM_138415	
PLCD3	113026	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	43196348	43196348	+	Silent	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr17:43196348C>A	ENST00000322765.5	-	5	860	c.747G>T	c.(745-747)cgG>cgT	p.R249R	PLCD3_ENST00000540511.1_5'UTR	NM_133373.3	NP_588614.1	Q8N3E9	PLCD3_HUMAN	phospholipase C, delta 3	249	EF-hand 2.				angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(2)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	17						GCTTCAGCAGCCGCCGCAGGA	0.637																																					.		.											.	PLCD3	703	0			.						.						13.0	16.0	15.0					17																	43196348		1939	4089	6028	SO:0001819	synonymous_variant	113026	.			CAGCAGCCGCCGC	AC002117	CCDS74077.1	17q21	2012-04-20			ENSG00000161714	ENSG00000161714	3.1.4.11		9061	protein-coding gene	gene with protein product		608795				10702670, 9056492	Standard	NM_133373		Approved		uc002iib.3	Q8N3E9	OTTHUMG00000168029	ENST00000322765.5:c.747G>T	17.37:g.43196348C>A		39.0	0.0		36.0	15.0	.	Q8TEC1|Q8TF37|Q96FL6	Silent	SNP	ENST00000322765.5	37																																																																																				.		0.637	PLCD3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_133373	
PLEKHG4B	153478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	143613	143613	+	Silent	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:143613C>A	ENST00000283426.6	+	3	788	c.738C>A	c.(736-738)atC>atA	p.I246I	Y_RNA_ENST00000362670.1_RNA	NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	246							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		TCCATAGCATCCCCAGGTGGG	0.662																																					p.I246I		.											.	PLEKHG4B	228	0			c.C738A						.						44.0	46.0	45.0					5																	143613		2202	4298	6500	SO:0001819	synonymous_variant	153478	exon3			TAGCATCCCCAGG	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.738C>A	5.37:g.143613C>A		74.0	0.0		64.0	15.0	NM_052909		Silent	SNP	ENST00000283426.6	37	CCDS34124.1																																																																																			.		0.662	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365359.1	NM_052909	
POLDIP3	84271	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	42983538	42983538	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr22:42983538delA	ENST00000252115.5	-	8	1166	c.1062delT	c.(1060-1062)gttfs	p.V354fs	POLDIP3_ENST00000348657.2_Frame_Shift_Del_p.V325fs|POLDIP3_ENST00000339677.6_Intron|POLDIP3_ENST00000451060.2_Intron|POLDIP3_ENST00000491021.1_5'UTR	NM_032311.3	NP_115687.2	Q9BY77	PDIP3_HUMAN	polymerase (DNA-directed), delta interacting protein 3	354					poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	16						CTGAGGTGATAACATTCCCAT	0.512																																					p.V354fs	Ovarian(52;967 1128 5875 19997 42537)	.											.	POLDIP3	90	0			c.1062delT						.						157.0	156.0	156.0					22																	42983538		2203	4300	6503	SO:0001589	frameshift_variant	84271	exon8			GGTGATAACATTC		CCDS14038.1, CCDS14039.1, CCDS74873.1	22q13.31	2013-02-12			ENSG00000100227	ENSG00000100227		"""RNA binding motif (RRM) containing"""	23782	protein-coding gene	gene with protein product		611520				12522211	Standard	NM_032311		Approved	PDIP46, KIAA1649	uc003bcu.3	Q9BY77	OTTHUMG00000150887	ENST00000252115.5:c.1062delT	22.37:g.42983538delA	ENSP00000252115:p.Val354fs	140.0	0.0		126.0	37.0	NM_032311	A8K6F8|A8K6V9|Q009A7|Q5H972|Q6PGN6|Q7Z6Z0|Q9NSP5|Q9NSP6	Frame_Shift_Del	DEL	ENST00000252115.5	37	CCDS14038.1																																																																																			.		0.512	POLDIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320433.1	NM_032311	
POLR3D	661	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	8	22105780	22105780	+	Nonsense_Mutation	SNP	G	G	T	rs199704064		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr8:22105780G>T	ENST00000397802.4	+	4	690	c.475G>T	c.(475-477)Gag>Tag	p.E159*	POLR3D_ENST00000306433.4_Nonsense_Mutation_p.E159*			P05423	RPC4_HUMAN	polymerase (RNA) III (DNA directed) polypeptide D, 44kDa	159					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)	13				Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		GCGTATGCTGGAGAAGGACGA	0.502																																					p.E159X		.											.	POLR3D	90	0			c.G475T						.						102.0	109.0	107.0					8																	22105780		2203	4300	6503	SO:0001587	stop_gained	661	exon5			ATGCTGGAGAAGG	M17754	CCDS34858.1	8q21	2013-01-21	2003-04-01	2003-04-04	ENSG00000168495	ENSG00000168495		"""RNA polymerase subunits"""	1080	protein-coding gene	gene with protein product		187280	"""BN51 (BHK21) temperature sensitivity complementing"""	BN51T		12391170, 11279001	Standard	NM_001722		Approved	TSBN51, RPC4	uc003xbl.3	P05423	OTTHUMG00000163778	ENST00000397802.4:c.475G>T	8.37:g.22105780G>T	ENSP00000380904:p.Glu159*	117.0	0.0		966.0	46.0	NM_001722	Q6FI28|Q9BPV7|Q9BPZ1|Q9BXB3	Nonsense_Mutation	SNP	ENST00000397802.4	37	CCDS34858.1	.	.	.	.	.	.	.	.	.	.	G	38	6.713816	0.97784	.	.	ENSG00000168495	ENST00000306433;ENST00000519237;ENST00000397802	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	-36.3725	18.7009	0.91620	0.0:0.0:1.0:0.0	.	.	.	.	X	159	.	ENSP00000303088:E159X	E	+	1	0	POLR3D	22161725	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	7.373000	0.79623	2.695000	0.91970	0.655000	0.94253	GAG	G|1.000;A|0.000		0.502	POLR3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375434.2	NM_001722	
PRAMEF17	391004	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	13716967	13716967	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:13716967G>T	ENST00000376098.4	+	2	480	c.454G>T	c.(454-456)Gac>Tac	p.D152Y		NM_001099851.1	NP_001093321.1	Q5VTA0	PRA17_HUMAN	PRAME family member 17	152					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					kidney(1)|lung(2)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;9.86e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|COAD - Colon adenocarcinoma(227;0.000502)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGTGTTCATAGACCTCTGCCA	0.537																																					p.D152Y		.											.	.	.	0			c.G454T						.						39.0	47.0	44.0					1																	13716967		2122	4224	6346	SO:0001583	missense	391004	exon2			TTCATAGACCTCT		CCDS41264.1	1p36.21	2013-01-17			ENSG00000204479	ENSG00000204479		"""-"""	29485	protein-coding gene	gene with protein product							Standard	NM_001099851		Approved	OTTHUMG00000007909	uc009vnz.1	Q5VTA0	OTTHUMG00000007909	ENST00000376098.4:c.454G>T	1.37:g.13716967G>T	ENSP00000365266:p.Asp152Tyr	209.0	0.0		212.0	96.0	NM_001099851	B2RUU4	Missense_Mutation	SNP	ENST00000376098.4	37	CCDS41264.1	.	.	.	.	.	.	.	.	.	.	G	8.520	0.868451	0.17322	.	.	ENSG00000204479	ENST00000376098	T	0.44881	0.91	1.09	0.124	0.14714	.	0.377307	0.21405	N	0.075061	T	0.61899	0.2384	M	0.92026	3.265	0.09310	N	1	D	0.69078	0.997	D	0.68192	0.956	T	0.52442	-0.8575	10	0.87932	D	0	.	3.641	0.08166	0.2714:0.0:0.7286:0.0	.	152	Q5VTA0	PRA17_HUMAN	Y	152	ENSP00000365266:D152Y	ENSP00000365266:D152Y	D	+	1	0	PRAMEF17	13589554	0.004000	0.15560	0.004000	0.12327	0.006000	0.05464	0.457000	0.21875	0.047000	0.15862	-0.391000	0.06502	GAC	.		0.537	PRAMEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021780.2	NM_001099851	
PRKD1	5587	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	30100159	30100159	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr14:30100159G>A	ENST00000331968.5	-	10	1690	c.1461C>T	c.(1459-1461)gcC>gcT	p.A487A	PRKD1_ENST00000415220.2_Silent_p.A495A	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	487	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		AATGAGGATTGGCCCCATTAG	0.363																																					p.A487A		.											.	PRKD1	1534	0			c.C1461T						.						115.0	111.0	112.0					14																	30100159		2203	4300	6503	SO:0001819	synonymous_variant	5587	exon10			AGGATTGGCCCCA		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.1461C>T	14.37:g.30100159G>A		188.0	0.0		130.0	43.0	NM_002742	A6NL64|B2RAF6	Silent	SNP	ENST00000331968.5	37	CCDS9637.1																																																																																			.		0.363	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742	
PTGDS	5730	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	139873558	139873558	+	Silent	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr9:139873558C>A	ENST00000371625.3	+	2	302	c.228C>A	c.(226-228)ggC>ggA	p.G76G	RP11-229P13.19_ENST00000413913.2_RNA|PTGDS_ENST00000224167.2_Silent_p.G76G|PTGDS_ENST00000460340.1_3'UTR	NM_000954.5	NP_000945.3	P41222	PTGDS_HUMAN	prostaglandin D2 synthase 21kDa (brain)	76					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|prostaglandin biosynthetic process (GO:0001516)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|rough endoplasmic reticulum (GO:0005791)	fatty acid binding (GO:0005504)|prostaglandin-D synthase activity (GO:0004667)|retinoid binding (GO:0005501)|transporter activity (GO:0005215)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CGGATGGTGGCCTCAACCTGA	0.662																																					p.G76G		.											.	PTGDS	91	0			c.C228A						.						70.0	71.0	71.0					9																	139873558		2203	4300	6503	SO:0001819	synonymous_variant	5730	exon2			TGGTGGCCTCAAC	AA621632	CCDS7019.1	9q34.2-q34.3	2011-11-15	2002-08-29		ENSG00000107317	ENSG00000107317	5.3.99.2	"""Lipocalins"""	9592	protein-coding gene	gene with protein product	"""lipocalin-type prostaglandin D synthase"""	176803	"""prostaglandin D2 synthase (21kD, brain)"""			1902577	Standard	NM_000954		Approved	PGDS, L-PGDS	uc004cke.3	P41222	OTTHUMG00000020957	ENST00000371625.3:c.228C>A	9.37:g.139873558C>A		67.0	0.0		79.0	28.0	NM_000954	B2R727|Q5SQ10|Q7M4P3|Q9UC22|Q9UCC9|Q9UCD9	Silent	SNP	ENST00000371625.3	37	CCDS7019.1	.	.	.	.	.	.	.	.	.	.	c	7.848	0.723455	0.15439	.	.	ENSG00000107317	ENST00000446677	.	.	.	4.44	-2.1	0.07210	.	.	.	.	.	T	0.20901	0.0503	.	.	.	0.09310	N	0.999994	.	.	.	.	.	.	T	0.28933	-1.0028	4	.	.	.	-7.4149	3.3462	0.07136	0.4232:0.3251:0.1661:0.0856	.	.	.	.	T	99	.	.	P	+	1	0	PTGDS	138993379	0.001000	0.12720	0.004000	0.12327	0.050000	0.14768	0.583000	0.23849	-0.016000	0.14127	0.457000	0.33378	CCT	.		0.662	PTGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055188.1	NM_000954	
PTGER4	5734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	40692406	40692406	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:40692406C>A	ENST00000302472.3	+	3	2417	c.1393C>A	c.(1393-1395)Cct>Act	p.P465T		NM_000958.2	NP_000949.1	P35408	PE2R4_HUMAN	prostaglandin E receptor 4 (subtype EP4)	465				GPA -> WAC (in Ref. 2; AAA36438). {ECO:0000305}.	adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|bone development (GO:0060348)|cellular response to mechanical stimulus (GO:0071260)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|JNK cascade (GO:0007254)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of eosinophil extravasation (GO:2000420)|negative regulation of inflammatory response (GO:0050728)|negative regulation of integrin activation (GO:0033624)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|regulation of ossification (GO:0030278)|regulation of stress fiber assembly (GO:0051492)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|T-helper cell differentiation (GO:0042093)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)			breast(1)|endometrium(3)|liver(1)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23					Dinoprostone(DB00917)|Misoprostol(DB00929)	CAGGGCTGGGCCTGCCCCTAA	0.498																																					p.P465T		.											.	PTGER4	658	0			c.C1393A						.						30.0	32.0	31.0					5																	40692406		2203	4300	6503	SO:0001583	missense	5734	exon3			GCTGGGCCTGCCC	L28175	CCDS3930.1	5p13.1	2012-08-08			ENSG00000171522	ENSG00000171522		"""GPCR / Class A : Prostanoid receptors"""	9596	protein-coding gene	gene with protein product		601586				7759114, 8661119	Standard	NM_000958		Approved	EP4	uc003jlz.3	P35408	OTTHUMG00000094769	ENST00000302472.3:c.1393C>A	5.37:g.40692406C>A	ENSP00000302846:p.Pro465Thr	114.0	0.0		111.0	30.0	NM_000958	Q3MJ87	Missense_Mutation	SNP	ENST00000302472.3	37	CCDS3930.1	.	.	.	.	.	.	.	.	.	.	C	8.588	0.883973	0.17467	.	.	ENSG00000171522	ENST00000302472	T	0.51325	0.71	5.81	0.569	0.17340	.	0.216989	0.39909	N	0.001236	T	0.29850	0.0746	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.16041	-1.0416	10	0.54805	T	0.06	-1.3758	2.4748	0.04573	0.1178:0.4355:0.1158:0.3309	.	465	P35408	PE2R4_HUMAN	T	465	ENSP00000302846:P465T	ENSP00000302846:P465T	P	+	1	0	PTGER4	40728163	0.000000	0.05858	0.030000	0.17652	0.614000	0.37383	-0.284000	0.08422	0.055000	0.16094	0.655000	0.94253	CCT	.		0.498	PTGER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211578.2	NM_000958	
PTPRQ	374462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	80887176	80887176	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:80887176C>A	ENST00000266688.5	+	15	1470	c.1470C>A	c.(1468-1470)agC>agA	p.S490R				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	536	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						TATATAACAGCCATCCAGATA	0.378																																					p.S322R		.											.	.	.	0			c.C966A						.						103.0	94.0	96.0					12																	80887176		692	1591	2283	SO:0001583	missense	374462	exon7			TAACAGCCATCCA	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.1470C>A	12.37:g.80887176C>A	ENSP00000266688:p.Ser490Arg	78.0	0.0		77.0	21.0	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.023|4.023	0.001752|0.001752	0.07819|0.07819	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000532722|ENST00000266688	.|T	.|0.36520	.|1.25	5.73|5.73	-4.29|-4.29	0.03721|0.03721	.|Fibronectin, type III (2);	.|.	.|.	.|.	.|.	T|T	0.16385|0.16385	0.0394|0.0394	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.28552	.|0.215	.|B	.|0.26517	.|0.07	T|T	0.30031|0.30031	-0.9992|-0.9992	4|8	.|0.16420	.|T	.|0.52	.|.	6.1889|6.1889	0.20513|0.20513	0.217:0.4185:0.0:0.3645|0.217:0.4185:0.0:0.3645	.|.	.|536	.|Q9UMZ3	.|PTPRQ_HUMAN	D|R	191|490	.|ENSP00000266688:S490R	.|ENSP00000266688:S490R	A|S	+|+	2|3	0|2	PTPRQ|PTPRQ	79411307|79411307	0.001000|0.001000	0.12720|0.12720	0.012000|0.012000	0.15200|0.15200	0.004000|0.004000	0.04260|0.04260	0.042000|0.042000	0.13949|0.13949	-0.723000|-0.723000	0.04915|0.04915	-0.294000|-0.294000	0.09567|0.09567	GCC|AGC	.		0.378	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
RNF123	63891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49744294	49744294	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr3:49744294G>T	ENST00000327697.6	+	26	2603	c.2459G>T	c.(2458-2460)cGc>cTc	p.R820L	RNF123_ENST00000432042.1_Missense_Mutation_p.R674L	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	820					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		CACCTGAGCCGCCGTCTTGCC	0.567																																					p.R820L		.											.	RNF123	584	0			c.G2459T						.						151.0	125.0	134.0					3																	49744294		2203	4300	6503	SO:0001583	missense	63891	exon26			TGAGCCGCCGTCT	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.2459G>T	3.37:g.49744294G>T	ENSP00000328287:p.Arg820Leu	115.0	0.0		92.0	25.0	NM_022064	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.602678	0.87157	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000432042	D;D	0.94897	-2.95;-3.55	5.3	5.3	0.74995	.	0.162806	0.41294	D	0.000912	D	0.95300	0.8475	L	0.32530	0.975	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.74023	0.982;0.982	D	0.95987	0.8982	10	0.87932	D	0	-22.7933	16.0911	0.81090	0.0:0.0:1.0:0.0	.	674;820	C9J266;Q5XPI4	.;RN123_HUMAN	L	820;820;674	ENSP00000328287:R820L;ENSP00000392443:R674L	ENSP00000328287:R820L	R	+	2	0	RNF123	49719298	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	8.678000	0.91211	2.460000	0.83146	0.491000	0.48974	CGC	.		0.567	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
RNF17	56163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	25416232	25416232	+	Missense_Mutation	SNP	C	C	T	rs140457030		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr13:25416232C>T	ENST00000255324.5	+	19	2588	c.2536C>T	c.(2536-2538)Cct>Tct	p.P846S	RNF17_ENST00000381921.1_Missense_Mutation_p.P846S|RNF17_ENST00000339524.3_5'Flank	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	846					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TCTTGGTGCTCCTGAAATGAC	0.343																																					p.P846S		.											.	RNF17	228	0			c.C2536T						.	C	SER/PRO,SER/PRO	4,4402	8.1+/-20.4	0,4,2199	158.0	149.0	152.0		2536,2536	5.3	1.0	13	dbSNP_134	152	0,8600		0,0,4300	yes	missense,missense	RNF17	NM_001184993.1,NM_031277.2	74,74	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	possibly-damaging,possibly-damaging	846/1620,846/1624	25416232	4,13002	2203	4300	6503	SO:0001583	missense	56163	exon19			GGTGCTCCTGAAA	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.2536C>T	13.37:g.25416232C>T	ENSP00000255324:p.Pro846Ser	78.0	0.0		63.0	20.0	NM_001184993	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	37	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	C	8.103	0.777141	0.16120	9.08E-4	0.0	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120	T;T;T	0.11712	3.55;3.55;2.75	5.29	5.29	0.74685	Staphylococcal nuclease (SNase-like) (1);	0.277119	0.29459	N	0.012097	T	0.19366	0.0465	L	0.27053	0.805	0.80722	D	1	B;D;B	0.89917	0.068;1.0;0.083	B;D;B	0.87578	0.014;0.998;0.02	T	0.07233	-1.0783	10	0.12430	T	0.62	-8.1118	16.2019	0.82087	0.0:1.0:0.0:0.0	.	846;846;846	B7Z7S1;Q9BXT8-5;Q9BXT8	.;.;RNF17_HUMAN	S	846;846;705;170	ENSP00000255324:P846S;ENSP00000371346:P846S;ENSP00000388892:P170S	ENSP00000255324:P846S	P	+	1	0	RNF17	24314232	0.663000	0.27448	0.996000	0.52242	0.013000	0.08279	0.689000	0.25437	2.638000	0.89438	0.585000	0.79938	CCT	C|1.000;T|0.000		0.343	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	237947437	237947437	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:237947437C>T	ENST00000366574.2	+	90	12742	c.12425C>T	c.(12424-12426)gCc>gTc	p.A4142V	RYR2_ENST00000360064.6_Missense_Mutation_p.A4148V|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.A4126V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4142					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATGGGAAGCGCCAAACGCATC	0.498																																					p.A4142V		.											.	RYR2	158	0			c.C12425T						.						76.0	76.0	76.0					1																	237947437		1916	4139	6055	SO:0001583	missense	6262	exon90			GAAGCGCCAAACG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12425C>T	1.37:g.237947437C>T	ENSP00000355533:p.Ala4142Val	155.0	0.0		106.0	44.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.221274	0.79464	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.97850	-4.57;-4.57;-4.57	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000006	D	0.97936	0.9321	L	0.47716	1.5	0.80722	D	1	D;D	0.69078	0.997;0.987	D;P	0.79784	0.993;0.87	D	0.98561	1.0641	10	0.72032	D	0.01	.	15.0213	0.71632	0.0:0.8581:0.1419:0.0	.	1116;4142	B4DGV4;Q92736	.;RYR2_HUMAN	V	4142;4148;4126;1116	ENSP00000355533:A4142V;ENSP00000353174:A4148V;ENSP00000443798:A4126V	ENSP00000353174:A4148V	A	+	2	0	RYR2	236014060	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	4.853000	0.62911	2.610000	0.88304	0.655000	0.94253	GCC	.		0.498	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
SCG2	7857	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	224462635	224462635	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:224462635G>T	ENST00000305409.2	-	2	1598	c.1366C>A	c.(1366-1368)Cca>Aca	p.P456T		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		TGGTTATATGGATTGGGAAAA	0.463																																					p.P456T		.											.	SCG2	69	0			c.C1366A						.						110.0	110.0	110.0					2																	224462635		2203	4300	6503	SO:0001583	missense	7857	exon2			TATATGGATTGGG	M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.1366C>A	2.37:g.224462635G>T	ENSP00000304133:p.Pro456Thr	74.0	1.0		62.0	25.0	NM_003469	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Missense_Mutation	SNP	ENST00000305409.2	37	CCDS2457.1	.	.	.	.	.	.	.	.	.	.	G	2.971	-0.212542	0.06140	.	.	ENSG00000171951	ENST00000305409;ENST00000450330	T	0.01474	4.85	5.86	5.86	0.93980	.	0.235802	0.37261	N	0.002176	T	0.01765	0.0056	N	0.08118	0	0.09310	N	0.999994	B	0.14438	0.01	B	0.18871	0.023	T	0.55379	-0.8150	10	0.40728	T	0.16	.	20.1986	0.98248	0.0:0.0:1.0:0.0	.	456	P13521	SCG2_HUMAN	T	456;316	ENSP00000304133:P456T	ENSP00000304133:P456T	P	-	1	0	SCG2	224170879	0.999000	0.42202	0.969000	0.41365	0.236000	0.25371	5.972000	0.70448	2.781000	0.95711	0.650000	0.86243	CCA	.		0.463	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256870.2	NM_003469	
SCN10A	6336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38743417	38743417	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr3:38743417C>A	ENST00000449082.2	-	26	4569	c.4570G>T	c.(4570-4572)Gtc>Ttc	p.V1524F		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1524					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	ATCTTCATGACACATTCGCCT	0.458																																					p.V1524F		.											.	SCN10A	99	0			c.G4570T						.						151.0	126.0	135.0					3																	38743417		2203	4300	6503	SO:0001583	missense	6336	exon26			TCATGACACATTC	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.4570G>T	3.37:g.38743417C>A	ENSP00000390600:p.Val1524Phe	111.0	0.0		97.0	28.0	NM_006514	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	C	17.13	3.311079	0.60414	.	.	ENSG00000185313	ENST00000449082	D	0.98807	-5.15	4.96	4.06	0.47325	Ion transport (1);	0.224065	0.38663	N	0.001603	D	0.98757	0.9582	M	0.64630	1.985	0.42012	D	0.990943	D	0.76494	0.999	D	0.74348	0.983	D	0.99881	1.1113	10	0.87932	D	0	.	15.1927	0.73060	0.0:0.8585:0.1415:0.0	.	1524	Q9Y5Y9	SCNAA_HUMAN	F	1524	ENSP00000390600:V1524F	ENSP00000390600:V1524F	V	-	1	0	SCN10A	38718421	0.319000	0.24607	0.994000	0.49952	0.978000	0.69477	0.651000	0.24873	1.261000	0.44149	0.557000	0.71058	GTC	.		0.458	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
SCRIB	23513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	144891811	144891811	+	Silent	SNP	G	G	A	rs546935238		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr8:144891811G>A	ENST00000320476.3	-	14	1614	c.1608C>T	c.(1606-1608)ccC>ccT	p.P536P	SCRIB_ENST00000356994.2_Silent_p.P536P|SCRIB_ENST00000377533.3_Silent_p.P455P	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	536	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			ACGGGCCCTCGGGCTCAGCCT	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		16028	0.0		0.0	False		,,,				2504	0.001				p.P536P	Pancreas(51;966 1133 10533 14576 29674)	.											.	SCRIB	228	0			c.C1608T						.						57.0	55.0	55.0					8																	144891811		2203	4300	6503	SO:0001819	synonymous_variant	23513	exon14			GCCCTCGGGCTCA	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.1608C>T	8.37:g.144891811G>A		51.0	0.0		121.0	94.0	NM_015356	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Silent	SNP	ENST00000320476.3	37	CCDS6411.1																																																																																			.		0.662	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
SLC16A12	387700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	91196032	91196032	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:91196032C>A	ENST00000341233.4	-	7	1373	c.983G>T	c.(982-984)gGa>gTa	p.G328V	SLC16A12_ENST00000371790.4_Missense_Mutation_p.G358V	NM_213606.3	NP_998771.3	Q6ZSM3	MOT12_HUMAN	solute carrier family 16, member 12	328						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(4)|skin(1)|stomach(1)	14						CCCATCCATTCCCACGGCAAA	0.458																																					p.G358V		.											.	SLC16A12	69	0			c.G1073T						.						124.0	110.0	115.0					10																	91196032		2203	4300	6503	SO:0001583	missense	387700	exon7			TCCATTCCCACGG		CCDS7404.1, CCDS7404.2	10q23.32	2013-07-18	2013-07-18		ENSG00000152779	ENSG00000152779		"""Solute carriers"""	23094	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 12"""	611910	"""solute carrier family 16 (monocarboxylic acid transporters), member 12"", ""solute carrier family 16, member 12 (monocarboxylic acid transporter 12)"""				Standard	NM_213606		Approved	MCT12	uc001kgm.3	Q6ZSM3	OTTHUMG00000018714	ENST00000341233.4:c.983G>T	10.37:g.91196032C>A	ENSP00000343022:p.Gly328Val	122.0	0.0		80.0	37.0	NM_213606	Q5M9M9|Q5T7J2|Q6ZV76	Missense_Mutation	SNP	ENST00000341233.4	37		.	.	.	.	.	.	.	.	.	.	C	19.04	3.749959	0.69533	.	.	ENSG00000152779	ENST00000341233;ENST00000371790	T;T	0.79554	-1.28;-1.28	5.81	4.9	0.64082	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.352154	0.29165	N	0.012949	T	0.77691	0.4168	L	0.39898	1.24	0.80722	D	1	P	0.41748	0.761	P	0.48368	0.575	T	0.72962	-0.4132	10	0.07175	T	0.84	.	15.6609	0.77188	0.0:0.8579:0.1421:0.0	.	328	Q6ZSM3	MOT12_HUMAN	V	328;358	ENSP00000343022:G328V;ENSP00000360855:G358V	ENSP00000343022:G328V	G	-	2	0	SLC16A12	91186012	0.980000	0.34600	1.000000	0.80357	0.972000	0.66771	1.655000	0.37345	1.418000	0.47098	0.591000	0.81541	GGA	.		0.458	SLC16A12-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_213606	
SLC6A3	6531	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	1411361	1411361	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:1411361G>T	ENST00000270349.9	-	9	1393	c.1266C>A	c.(1264-1266)agC>agA	p.S422R	SLC6A3_ENST00000453492.2_Missense_Mutation_p.S422R	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	422					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	TACTCACGGCGCTGTCGATAC	0.647																																					p.S422R		.											.	SLC6A3	157	0			c.C1266A						.						70.0	55.0	60.0					5																	1411361		2117	4150	6267	SO:0001583	missense	6531	exon9			CACGGCGCTGTCG		CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.1266C>A	5.37:g.1411361G>T	ENSP00000270349:p.Ser422Arg	54.0	0.0		41.0	26.0	NM_001044	A2RUN4|Q14996	Missense_Mutation	SNP	ENST00000270349.9	37	CCDS3863.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.264169	0.23136	.	.	ENSG00000142319	ENST00000270349;ENST00000453492	T;T	0.81163	-1.46;-1.46	4.5	-9.01	0.00744	.	0.000000	0.85682	D	0.000000	D	0.91975	0.7458	H	0.98218	4.175	0.39335	D	0.965488	D	0.65815	0.995	D	0.74674	0.984	D	0.94058	0.7324	10	0.87932	D	0	.	20.113	0.97915	0.8189:0.0:0.1811:0.0	.	422	Q01959	SC6A3_HUMAN	R	422	ENSP00000270349:S422R;ENSP00000399806:S422R	ENSP00000270349:S422R	S	-	3	2	SLC6A3	1464361	0.004000	0.15560	0.020000	0.16555	0.120000	0.20174	-0.956000	0.03865	-3.115000	0.00240	-2.612000	0.00159	AGC	.		0.647	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253650.3	NM_001044	
SMC4	10051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	160134114	160134114	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr3:160134114G>T	ENST00000357388.3	+	10	1799	c.1348G>T	c.(1348-1350)Gag>Tag	p.E450*	RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000469762.1_Nonsense_Mutation_p.E425*|SMC4_ENST00000462787.1_Nonsense_Mutation_p.E450*|SMC4_ENST00000360111.2_Nonsense_Mutation_p.E450*|SMC4_ENST00000344722.5_Nonsense_Mutation_p.E450*	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	450					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CAATGCCCTCGAGAAGGAAAA	0.313																																					p.E450X		.											.	SMC4	291	0			c.G1348T						.						57.0	63.0	61.0					3																	160134114		2201	4291	6492	SO:0001587	stop_gained	10051	exon9			GCCCTCGAGAAGG	AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.1348G>T	3.37:g.160134114G>T	ENSP00000349961:p.Glu450*	374.0	0.0		307.0	119.0	NM_005496	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Nonsense_Mutation	SNP	ENST00000357388.3	37	CCDS3189.1	.	.	.	.	.	.	.	.	.	.	G	37	6.020685	0.97211	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000469762;ENST00000462787;ENST00000344722;ENST00000545277	.	.	.	6.07	5.2	0.72013	.	0.087770	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-22.4133	16.5359	0.84373	0.0:0.0:0.8682:0.1318	.	.	.	.	X	450;450;425;450;450;44	.	ENSP00000341382:E450X	E	+	1	0	SMC4	161616808	1.000000	0.71417	0.977000	0.42913	0.135000	0.20990	6.667000	0.74451	1.567000	0.49668	-0.169000	0.13324	GAG	.		0.313	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1		
SOCS6	9306	broad.mit.edu;ucsc.edu	37	18	67992706	67992706	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr18:67992706C>T	ENST00000397942.3	+	2	1118	c.802C>T	c.(802-804)Cag>Tag	p.Q268*	SOCS6_ENST00000582322.1_Nonsense_Mutation_p.Q268*	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	268					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				GGATGAGAGTCAGGTAGACCA	0.572																																					p.Q268X	Melanoma(84;1024 1361 24382 36583 42651)	.											.	SOCS6	721	0			c.C802T						.						141.0	120.0	127.0					18																	67992706		2203	4300	6503	SO:0001587	stop_gained	9306	exon2			GAGAGTCAGGTAG	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.802C>T	18.37:g.67992706C>T	ENSP00000381034:p.Gln268*	173.0	1.0		160.0	91.0	NM_004232	Q8WUM3	Nonsense_Mutation	SNP	ENST00000397942.3	37	CCDS11998.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.856898	0.91433	.	.	ENSG00000170677	ENST00000397942	.	.	.	5.0	4.13	0.48395	.	1.005720	0.07995	N	0.987871	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-6.0645	13.0892	0.59158	0.0:0.9225:0.0:0.0775	.	.	.	.	X	268	.	ENSP00000381034:Q268X	Q	+	1	0	SOCS6	66143686	1.000000	0.71417	0.188000	0.23233	0.490000	0.33462	5.531000	0.67148	1.096000	0.41439	0.561000	0.74099	CAG	.		0.572	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2		
SORCS1	114815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	108431023	108431023	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:108431023A>G	ENST00000263054.6	-	16	2168	c.2161T>C	c.(2161-2163)Tgt>Cgt	p.C721R	SORCS1_ENST00000344440.6_Missense_Mutation_p.C721R|SORCS1_ENST00000369698.1_Missense_Mutation_p.C256R	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	721					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GTGCAGACACAGGGTTCAGAT	0.433																																					p.C721R		.											.	SORCS1	153	0			c.T2161C						.						224.0	192.0	203.0					10																	108431023		2203	4300	6503	SO:0001583	missense	114815	exon16			AGACACAGGGTTC	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2161T>C	10.37:g.108431023A>G	ENSP00000263054:p.Cys721Arg	129.0	0.0		83.0	26.0	NM_001206572	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.192206	0.78902	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.61274	0.12;0.32;0.31	5.45	5.45	0.79879	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.81074	0.4747	M	0.91561	3.22	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;0.999;1.0	D	0.85414	0.1139	9	.	.	.	-16.8096	15.8205	0.78638	1.0:0.0:0.0:0.0	.	721;721;721;721;721	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	R	256;721;721	ENSP00000358712:C256R;ENSP00000263054:C721R;ENSP00000345964:C721R	.	C	-	1	0	SORCS1	108421013	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.910000	0.92685	2.201000	0.70794	0.533000	0.62120	TGT	.		0.433	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
SORT1	6272	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	109883462	109883462	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:109883462C>A	ENST00000256637.6	-	10	1206	c.1148G>T	c.(1147-1149)gGc>gTc	p.G383V	SORT1_ENST00000538502.1_Missense_Mutation_p.G246V	NM_002959.5	NP_002950.3	Q99523	SORT_HUMAN	sortilin 1	383					endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|endosome transport via multivesicular body sorting pathway (GO:0032509)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose import (GO:0046323)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|negative regulation of lipoprotein lipase activity (GO:0051005)|nerve growth factor signaling pathway (GO:0038180)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|plasma membrane to endosome transport (GO:0048227)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|vesicle organization (GO:0016050)	cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	enzyme binding (GO:0019899)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotensin receptor activity, non-G-protein coupled (GO:0030379)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		ATAGACAATGCCTCGATCATC	0.453																																					p.G383V		.											.	SORT1	91	0			c.G1148T						.						154.0	125.0	135.0					1																	109883462		2203	4300	6503	SO:0001583	missense	6272	exon10			ACAATGCCTCGAT	BC023542	CCDS798.1, CCDS55618.1	1p13.3	2008-05-14			ENSG00000134243	ENSG00000134243			11186	protein-coding gene	gene with protein product		602458					Standard	NM_002959		Approved	Gp95, NT3	uc001dxm.2	Q99523	OTTHUMG00000011999	ENST00000256637.6:c.1148G>T	1.37:g.109883462C>A	ENSP00000256637:p.Gly383Val	246.0	1.0		255.0	82.0	NM_002959	B4DWI3|C0JYZ0|Q8IZ49	Missense_Mutation	SNP	ENST00000256637.6	37	CCDS798.1	.	.	.	.	.	.	.	.	.	.	c	32	5.111159	0.94339	.	.	ENSG00000134243	ENST00000256637;ENST00000538502	T;T	0.28666	1.6;1.6	5.69	5.69	0.88448	VPS10 (1);	0.110120	0.64402	D	0.000005	T	0.55257	0.1909	M	0.83384	2.64	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.60495	-0.7252	10	0.87932	D	0	-18.9633	18.5756	0.91154	0.0:1.0:0.0:0.0	.	246;383	B4DWI3;Q99523	.;SORT_HUMAN	V	383;246	ENSP00000256637:G383V;ENSP00000438597:G246V	ENSP00000256637:G383V	G	-	2	0	SORT1	109684985	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.604000	0.82830	2.687000	0.91594	0.651000	0.88453	GGC	.		0.453	SORT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033179.1	NM_002959	
SSH1	54434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	109192797	109192797	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:109192797T>C	ENST00000326495.5	-	13	1421	c.1328A>G	c.(1327-1329)tAt>tGt	p.Y443C	SSH1_ENST00000551165.1_Missense_Mutation_p.Y443C|SSH1_ENST00000360239.3_Missense_Mutation_p.Y131C|SSH1_ENST00000326470.5_Missense_Mutation_p.Y454C	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	443	Tyrosine-protein phosphatase.				actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GATGCCTTCATACTCAGACAG	0.577																																					p.Y454C		.											.	SSH1	94	0			c.A1361G						.						72.0	70.0	70.0					12																	109192797		2203	4300	6503	SO:0001583	missense	54434	exon12			CCTTCATACTCAG	BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.1328A>G	12.37:g.109192797T>C	ENSP00000315713:p.Tyr443Cys	55.0	0.0		60.0	18.0	NM_001161331	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Missense_Mutation	SNP	ENST00000326495.5	37	CCDS9121.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.445052	0.83993	.	.	ENSG00000084112	ENST00000360239;ENST00000326495;ENST00000551165;ENST00000326470	T;T;T;T	0.63096	1.01;-0.02;-0.02;-0.02	5.11	5.11	0.69529	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.84955	0.5587	H	0.95574	3.69	0.58432	D	0.999991	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.89698	0.3903	10	0.87932	D	0	-20.7526	15.2215	0.73313	0.0:0.0:0.0:1.0	.	454;443;443;131	Q8WYL5-5;Q8WYL5-2;Q8WYL5;Q8WYL5-4	.;.;SSH1_HUMAN;.	C	131;443;443;454	ENSP00000353374:Y131C;ENSP00000315713:Y443C;ENSP00000448824:Y443C;ENSP00000326107:Y454C	ENSP00000326107:Y454C	Y	-	2	0	SSH1	107716926	1.000000	0.71417	0.950000	0.38849	0.988000	0.76386	8.040000	0.89188	2.066000	0.61787	0.533000	0.62120	TAT	.		0.577	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403724.1	NM_018984	
SSTR5	6755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	1129560	1129560	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:1129560C>A	ENST00000293897.4	+	1	780	c.692C>A	c.(691-693)gCg>gAg	p.A231E	SSTR5_ENST00000562758.1_Intron|SSTR5_ENST00000397547.2_Missense_Mutation_p.A231E|SSTR5-AS1_ENST00000569832.1_RNA	NM_001053.3	NP_001044.1	P35346	SSR5_HUMAN	somatostatin receptor 5	231					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytokinesis (GO:0032467)|regulation of insulin secretion (GO:0050796)|somatostatin signaling pathway (GO:0038170)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			endometrium(2)|lung(5)|prostate(1)|skin(1)	9		Hepatocellular(780;0.00369)			Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	GTGAGGGCGGCGGGCGTGCGC	0.672																																					p.A231E		.											.	SSTR5	522	0			c.C692A						.						78.0	75.0	76.0					16																	1129560		2190	4294	6484	SO:0001583	missense	6755	exon2			GGGCGGCGGGCGT	D16827	CCDS10429.1	16p13.3	2012-08-08			ENSG00000162009	ENSG00000162009		"""GPCR / Class A : Somatostatin receptors"""	11334	protein-coding gene	gene with protein product		182455				7607700	Standard	NM_001053		Approved		uc021taf.1	P35346	OTTHUMG00000047842	ENST00000293897.4:c.692C>A	16.37:g.1129560C>A	ENSP00000293897:p.Ala231Glu	70.0	0.0		63.0	46.0	NM_001172560	P34988|Q541E0|Q9UJI5	Missense_Mutation	SNP	ENST00000293897.4	37	CCDS10429.1	.	.	.	.	.	.	.	.	.	.	C	11.16	1.556218	0.27827	.	.	ENSG00000162009	ENST00000397547;ENST00000293897	T;T	0.39056	1.1;1.1	4.76	3.79	0.43588	GPCR, rhodopsin-like superfamily (1);	0.229561	0.37955	N	0.001875	T	0.48132	0.1483	L	0.45744	1.44	0.09310	N	1	P	0.40107	0.703	P	0.50570	0.644	T	0.41106	-0.9527	10	0.56958	D	0.05	.	12.4082	0.55451	0.0:0.9164:0.0:0.0836	.	231	P35346	SSR5_HUMAN	E	231	ENSP00000380680:A231E;ENSP00000293897:A231E	ENSP00000293897:A231E	A	+	2	0	SSTR5	1069561	0.017000	0.18338	0.002000	0.10522	0.004000	0.04260	2.500000	0.45381	0.980000	0.38523	0.561000	0.74099	GCG	.		0.672	SSTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420836.1		
SYT1	6857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	79689884	79689884	+	Silent	SNP	C	C	T	rs369758844		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:79689884C>T	ENST00000261205.4	+	7	1167	c.510C>T	c.(508-510)ccC>ccT	p.P170P	SYT1_ENST00000552744.1_Silent_p.P170P|SYT1_ENST00000457153.2_Silent_p.P167P|SYT1_ENST00000393240.3_Silent_p.P170P	NM_005639.2	NP_005630.1	P21579	SYT1_HUMAN	synaptotagmin I	170	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000305}.				calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|detection of calcium ion (GO:0005513)|glutamate secretion (GO:0014047)|neurotransmitter secretion (GO:0007269)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of vesicle fusion (GO:0031340)|protein homooligomerization (GO:0051260)|regulation of exocytosis (GO:0017157)|regulation of regulated secretory pathway (GO:1903305)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|vesicle docking (GO:0048278)	cell junction (GO:0030054)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|endocytic vesicle membrane (GO:0030666)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol binding (GO:0005545)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|transporter activity (GO:0005215)	p.P170P(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|pancreas(2)|skin(6)	25						CCGAACTGCCCGCCTTGGACA	0.428																																					p.P170P		.											SYT1,NS,NS,0	SYT1	655	1	Substitution - coding silent(1)	pancreas(1)	c.C510T						.	C	,,	0,4406		0,0,2203	97.0	92.0	94.0		510,510,510	-5.2	0.9	12		94	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	SYT1	NM_001135805.1,NM_001135806.1,NM_005639.2	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	170/423,170/423,170/423	79689884	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6857	exon8			ACTGCCCGCCTTG		CCDS9017.1	12q21.2	2013-09-20			ENSG00000067715	ENSG00000067715		"""Synaptotagmins"""	11509	protein-coding gene	gene with protein product		185605		SYT, SVP65		1840599	Standard	NM_001135805		Approved	P65	uc001syv.3	P21579	OTTHUMG00000134326	ENST00000261205.4:c.510C>T	12.37:g.79689884C>T		107.0	1.0		71.0	28.0	NM_001135805	Q6AI31	Silent	SNP	ENST00000261205.4	37	CCDS9017.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825609	0.16749	0.0	1.16E-4	ENSG00000067715	ENST00000549559	T	0.16897	2.31	5.52	-5.19	0.02832	.	0.000000	0.85682	D	0.000000	T	0.25457	0.0619	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.13176	-1.0519	7	0.72032	D	0.01	.	11.069	0.47993	0.1104:0.1236:0.0:0.766	.	.	.	.	L	72	ENSP00000449415:P72L	ENSP00000449415:P72L	P	+	2	0	SYT1	78214015	0.004000	0.15560	0.919000	0.36401	0.947000	0.59692	-1.268000	0.02836	-0.888000	0.03956	-1.134000	0.01955	CCG	.		0.428	SYT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259415.1	NM_005639	
STAB2	55576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	104077060	104077060	+	Silent	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:104077060C>A	ENST00000388887.2	+	26	3087	c.2883C>A	c.(2881-2883)acC>acA	p.T961T		NM_017564.9	NP_060034.9			stabilin 2									p.T961T(2)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TGGAACAAACCGGGAAATGTC	0.333																																					p.T961T		.											.	STAB2	104	2	Substitution - coding silent(2)	lung(2)	c.C2883A						.						171.0	156.0	161.0					12																	104077060		2203	4300	6503	SO:0001819	synonymous_variant	55576	exon26			ACAAACCGGGAAA	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.2883C>A	12.37:g.104077060C>A		141.0	0.0		183.0	59.0	NM_017564		Silent	SNP	ENST00000388887.2	37	CCDS31888.1																																																																																			.		0.333	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
TATDN3	128387	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	212965299	212965315	+	Frame_Shift_Del	DEL	CTGCCACCTCTCCGCCC	CTGCCACCTCTCCGCCC	-	rs377084448		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	CTGCCACCTCTCCGCCC	CTGCCACCTCTCCGCCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:212965299_212965315delCTGCCACCTCTCCGCCC	ENST00000366974.4	+	1	130_146	c.36_52delCTGCCACCTCTCCGCCC	c.(34-54)cactgccacctctccgccccgfs	p.CHLSAP13fs	NSL1_ENST00000473995.1_5'Flank|NSL1_ENST00000366977.3_5'Flank|TATDN3_ENST00000531963.1_Frame_Shift_Del_p.CHLSAP13fs|TATDN3_ENST00000530441.1_Frame_Shift_Del_p.CHLSAP13fs|NSL1_ENST00000422588.2_5'Flank|TATDN3_ENST00000366973.4_Frame_Shift_Del_p.CHLSAP13fs|NSL1_ENST00000366976.1_5'Flank|TATDN3_ENST00000526997.1_Frame_Shift_Del_p.CHLSAP13fs|NSL1_ENST00000366975.6_5'Flank|NSL1_ENST00000366978.1_5'Flank|TATDN3_ENST00000532324.1_Frame_Shift_Del_p.CHLSAP13fs|TATDN3_ENST00000526641.1_Frame_Shift_Del_p.CHLSAP13fs	NM_001042552.2|NM_001042553.2|NM_001146169.1|NM_001146171.1	NP_001036017.1|NP_001036018.1|NP_001139641.1|NP_001139643.1	Q17R31	TATD3_HUMAN	TatD DNase domain containing 3	13					DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(6)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00699)|all cancers(67;0.0118)|GBM - Glioblastoma multiforme(131;0.0801)|Epithelial(68;0.104)		TGGACTGTCACTGCCACCTCTCCGCCCCGGACTTTGA	0.659																																					p.12_18del		.											.	TATDN3	22	0			c.36_52del						.																																			SO:0001589	frameshift_variant	128387	exon1			CTGTCACTGCCAC	AL832248	CCDS31019.1, CCDS41465.1, CCDS53475.1, CCDS53476.1, CCDS53477.1	1q32.3	2008-02-05			ENSG00000203705	ENSG00000203705			27010	protein-coding gene	gene with protein product							Standard	NM_001042552		Approved		uc001hjo.2	Q17R31	OTTHUMG00000036805	ENST00000366974.4:c.36_52delCTGCCACCTCTCCGCCC	1.37:g.212965299_212965315delCTGCCACCTCTCCGCCC	ENSP00000355941:p.Cys13fs	182.0	0.0		141.0	25.0	NM_001146170	A6NGS3|B7Z1C1|B7Z978|B7ZLQ6|E9PJE5|E9PNH3|G3V151|Q4G0L1	Frame_Shift_Del	DEL	ENST00000366974.4	37	CCDS31019.1																																																																																			.		0.659	TATDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089396.2	XM_375838	
TBX21	30009	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	45820045	45820045	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr17:45820045G>A	ENST00000177694.1	+	2	772	c.561G>A	c.(559-561)gtG>gtA	p.V187V		NM_013351.1	NP_037483.1	Q9UL17	TBX21_HUMAN	T-box 21	187					cellular response to organic substance (GO:0071310)|lymphocyte migration (GO:0072676)|multicellular organismal development (GO:0007275)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(1)|large_intestine(3)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	22						GGATGTTTGTGGACGTGGTCT	0.632																																					p.V187V		.											.	TBX21	90	0			c.G561A						.						46.0	37.0	40.0					17																	45820045		2203	4300	6503	SO:0001819	synonymous_variant	30009	exon2			GTTTGTGGACGTG	AF093098	CCDS11514.1	17q21.2	2008-06-23				ENSG00000073861		"""T-boxes"""	11599	protein-coding gene	gene with protein product		604895					Standard	NM_013351		Approved	TBLYM, T-bet	uc002ilv.1	Q9UL17		ENST00000177694.1:c.561G>A	17.37:g.45820045G>A		93.0	0.0		56.0	7.0	NM_013351		Silent	SNP	ENST00000177694.1	37	CCDS11514.1																																																																																			.		0.632	TBX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441365.1	NM_013351	
TBX4	9496	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	59560529	59560529	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr17:59560529C>A	ENST00000240335.1	+	8	1335	c.1290C>A	c.(1288-1290)agC>agA	p.S430R	TBX4_ENST00000393853.4_Missense_Mutation_p.S431R|TBX4_ENST00000589449.1_3'UTR	NM_018488.2	NP_060958.2	P57082	TBX4_HUMAN	T-box 4	430					angiogenesis (GO:0001525)|embryonic limb morphogenesis (GO:0030326)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(15)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CCAGCTATAGCGTGCAGACGA	0.652																																					p.S430R		.											.	TBX4	227	0			c.C1290A						.						104.0	91.0	96.0					17																	59560529		2203	4300	6503	SO:0001583	missense	9496	exon8			CTATAGCGTGCAG	AF188703	CCDS11629.1	17q21-q22	2005-10-11				ENSG00000121075		"""T-boxes"""	11603	protein-coding gene	gene with protein product		601719				10945475	Standard	NM_018488		Approved		uc002izi.3	P57082		ENST00000240335.1:c.1290C>A	17.37:g.59560529C>A	ENSP00000240335:p.Ser430Arg	106.0	2.0		76.0	27.0	NM_018488	A5PKU7|B2RMT1|B7ZLV3	Missense_Mutation	SNP	ENST00000240335.1	37	CCDS11629.1	.	.	.	.	.	.	.	.	.	.	C	17.60	3.429967	0.62844	.	.	ENSG00000121075	ENST00000393853;ENST00000240335	T;T	0.52983	0.64;0.64	5.49	0.836	0.18891	.	0.213180	0.56097	D	0.000023	T	0.46073	0.1374	N	0.19112	0.55	0.40395	D	0.979586	D;D	0.76494	0.999;0.991	D;P	0.77557	0.99;0.65	T	0.30995	-0.9959	9	.	.	.	.	8.32	0.32124	0.0:0.4681:0.0:0.5319	.	431;430	A5PKU7;P57082	.;TBX4_HUMAN	R	431;430	ENSP00000377435:S431R;ENSP00000240335:S430R	.	S	+	3	2	TBX4	56915311	0.042000	0.20092	0.999000	0.59377	0.963000	0.63663	-1.013000	0.03645	0.294000	0.22547	-0.137000	0.14449	AGC	.		0.652	TBX4-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449649.1	NM_018488	
TCF20	6942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	42608089	42608089	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr22:42608089G>C	ENST00000359486.3	-	1	3359	c.3223C>G	c.(3223-3225)Cct>Gct	p.P1075A	TCF20_ENST00000404876.1_5'Flank|TCF20_ENST00000335626.4_Missense_Mutation_p.P1075A	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1075					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						CCTGCGTTAGGGTCCCCATAA	0.493																																					p.P1075A		.											.	TCF20	95	0			c.C3223G						.						68.0	68.0	68.0					22																	42608089		2203	4300	6503	SO:0001583	missense	6942	exon1			CGTTAGGGTCCCC	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.3223C>G	22.37:g.42608089G>C	ENSP00000352463:p.Pro1075Ala	101.0	0.0		115.0	54.0	NM_181492	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	37	CCDS14033.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.123331	0.77436	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.72394	-0.65;-0.65	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000002	T	0.77545	0.4146	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.79923	-0.1598	10	0.87932	D	0	-14.2081	20.0628	0.97684	0.0:0.0:1.0:0.0	.	1075;1075	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	A	1075	ENSP00000352463:P1075A;ENSP00000335561:P1075A	ENSP00000335561:P1075A	P	-	1	0	TCF20	40938033	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	6.716000	0.74702	2.745000	0.94114	0.655000	0.94253	CCT	.		0.493	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492	
TECTA	7007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	120996428	120996428	+	Missense_Mutation	SNP	G	G	A	rs370652301		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:120996428G>A	ENST00000392793.1	+	8	1892	c.1621G>A	c.(1621-1623)Gtg>Atg	p.V541M	TECTA_ENST00000264037.2_Missense_Mutation_p.V541M			O75443	TECTA_HUMAN	tectorin alpha	541					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TGGCACTGTCGTGGACCCCAC	0.587																																					p.V541M		.											.	TECTA	225	0			c.G1621A						.	G	MET/VAL	0,4406		0,0,2203	136.0	135.0	135.0		1621	3.0	0.5	11		135	1,8597	1.2+/-3.3	0,1,4298	no	missense	TECTA	NM_005422.2	21	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	541/2156	120996428	1,13003	2203	4299	6502	SO:0001583	missense	7007	exon7			ACTGTCGTGGACC	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.1621G>A	11.37:g.120996428G>A	ENSP00000376543:p.Val541Met	88.0	0.0		77.0	11.0	NM_005422		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030471	0.54790	0.0	1.16E-4	ENSG00000109927	ENST00000392793;ENST00000264037	D;D	0.83419	-1.72;-1.72	4.91	3.04	0.35103	Uncharacterised domain, cysteine-rich (2);	0.136631	0.49305	N	0.000153	D	0.91019	0.7175	M	0.91510	3.215	0.34529	D	0.708962	D	0.76494	0.999	D	0.63192	0.912	D	0.93874	0.7165	10	0.72032	D	0.01	.	11.3331	0.49487	0.1492:0.0:0.8508:0.0	.	541	O75443	TECTA_HUMAN	M	541	ENSP00000376543:V541M;ENSP00000264037:V541M	ENSP00000264037:V541M	V	+	1	0	TECTA	120501638	1.000000	0.71417	0.546000	0.28166	0.829000	0.46940	3.367000	0.52350	0.613000	0.30089	-0.251000	0.11542	GTG	.		0.587	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
TET1	80312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	70405127	70405127	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:70405127A>G	ENST00000373644.4	+	4	2850	c.2641A>G	c.(2641-2643)Atg>Gtg	p.M881V		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	881					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						CTTATCGTTAATGAAAGATAG	0.418																																					p.M881V		.											.	TET1	663	0			c.A2641G						.						114.0	119.0	117.0					10																	70405127		2203	4300	6503	SO:0001583	missense	80312	exon4			TCGTTAATGAAAG	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.2641A>G	10.37:g.70405127A>G	ENSP00000362748:p.Met881Val	71.0	0.0		62.0	24.0	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	A	7.620	0.676566	0.14841	.	.	ENSG00000138336	ENST00000373644	T	0.06608	3.28	5.79	3.43	0.39272	.	0.315990	0.29884	N	0.010949	T	0.05456	0.0144	L	0.34521	1.04	0.28600	N	0.909208	B	0.09022	0.002	B	0.08055	0.003	T	0.27606	-1.0069	10	0.31617	T	0.26	.	9.2148	0.37339	0.8572:0.0:0.1428:0.0	.	881	Q8NFU7	TET1_HUMAN	V	881	ENSP00000362748:M881V	ENSP00000362748:M881V	M	+	1	0	TET1	70075133	1.000000	0.71417	0.477000	0.27303	0.555000	0.35460	4.048000	0.57390	0.449000	0.26747	0.455000	0.32223	ATG	.		0.418	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
TLR5	7100	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	223285710	223285710	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:223285710G>A	ENST00000540964.1	-	4	1125	c.664C>T	c.(664-666)Cca>Tca	p.P222S	TLR5_ENST00000342210.6_Missense_Mutation_p.P222S			O60602	TLR5_HUMAN	toll-like receptor 5	222					cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		TTTCTGAATGGGTTCATACAT	0.473																																					p.P222S		.											.	TLR5	525	0			c.C664T						.						79.0	74.0	76.0					1																	223285710		2203	4300	6503	SO:0001583	missense	7100	exon6			TGAATGGGTTCAT		CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.664C>T	1.37:g.223285710G>A	ENSP00000440643:p.Pro222Ser	112.0	0.0		129.0	33.0	NM_003268	B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Missense_Mutation	SNP	ENST00000540964.1	37	CCDS31033.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.417289	0.83449	.	.	ENSG00000187554	ENST00000540964;ENST00000366881;ENST00000342210	T;T;T	0.35789	1.29;1.29;1.29	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.67505	0.2900	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72928	-0.4143	10	0.66056	D	0.02	.	19.2927	0.94108	0.0:0.0:1.0:0.0	.	222	O60602	TLR5_HUMAN	S	222	ENSP00000440643:P222S;ENSP00000355846:P222S;ENSP00000340089:P222S	ENSP00000340089:P222S	P	-	1	0	TLR5	221352333	1.000000	0.71417	0.996000	0.52242	0.763000	0.43281	9.129000	0.94430	2.546000	0.85860	0.655000	0.94253	CCA	.		0.473	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003268	
TMPRSS11BNL	401136	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	69057145	69057145	+	Silent	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr4:69057145A>G	ENST00000432593.3	-	3	388	c.222T>C	c.(220-222)ctT>ctC	p.L74L	RP11-646E20.6_ENST00000510782.1_RNA|FTLP10_ENST00000503647.1_RNA					TMPRSS11B N-terminal like, pseudogene											autonomic_ganglia(1)	1						GAATTTGGCTAAGATAGTTAT	0.313																																					p.L74L		.											.	.	.	0			c.T222C						.						159.0	139.0	145.0					4																	69057145		692	1590	2282	SO:0001819	synonymous_variant	401136	exon3			TTGGCTAAGATAG			4q13.2	2014-05-09	2014-05-08		ENSG00000226894	ENSG00000250026			37262	pseudogene	pseudogene			"""TMPRSS11B N terminal-like"", ""TMPRSS11B N-terminal like"""				Standard	NR_104048		Approved	FLJ41562	uc003hdv.1		OTTHUMG00000160802	ENST00000432593.3:c.222T>C	4.37:g.69057145A>G		50.0	0.0		42.0	8.0	NM_001129907		Silent	SNP	ENST00000432593.3	37	CCDS47066.1																																																																																			.		0.313	TMPRSS11BNL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001129907	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7577534	7577534	+	Missense_Mutation	SNP	C	C	A	rs28934571		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr17:7577534C>A	ENST00000269305.4	-	7	936	c.747G>T	c.(745-747)agG>agT	p.R249S	TP53_ENST00000445888.2_Missense_Mutation_p.R249S|TP53_ENST00000359597.4_Missense_Mutation_p.R249S|TP53_ENST00000455263.2_Missense_Mutation_p.R249S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.R249S|TP53_ENST00000420246.2_Missense_Mutation_p.R249S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	249	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934571). {ECO:0000269|PubMed:1694291, ECO:0000269|PubMed:16959974}.|R -> T (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R249S(348)|p.0?(8)|p.R249R(5)|p.?(5)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R249_P250>SS(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*14(1)|p.R249_T256delRPILTIIT(1)|p.P250fs*14(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGAGGATGGGCCTCCGGTTCA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R249S	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,mouth,carcinoma,0	TP53	70225	378	Substitution - Missense(348)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Substitution - coding silent(5)|Insertion - Frameshift(1)|Insertion - In frame(1)|Deletion - Frameshift(1)|Complex - compound substitution(1)	liver(240)|lung(44)|upper_aerodigestive_tract(12)|breast(12)|central_nervous_system(10)|stomach(7)|ovary(6)|prostate(6)|cervix(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(5)|biliary_tract(5)|urinary_tract(5)|bone(4)|endometrium(3)|oesophagus(3)|skin(2)|peritoneum(1)|kidney(1)|salivary_gland(1)|pancreas(1)	c.G747T						.						155.0	113.0	127.0					17																	7577534		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GATGGGCCTCCGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.747G>T	17.37:g.7577534C>A	ENSP00000269305:p.Arg249Ser	87.0	0.0		50.0	22.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344264	0.61073	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99865	-7.29;-7.29;-7.29;-7.29;-7.29;-7.29;-7.29	4.62	-0.0929	0.13654	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	M	0.92367	3.3	0.50039	D	0.999848	D;D;D;D;D	0.89917	0.996;0.996;0.997;0.99;1.0	D;D;D;D;D	0.79108	0.968;0.966;0.981;0.955;0.992	D	0.98720	1.0708	10	0.72032	D	0.01	-3.0658	3.2479	0.06803	0.1392:0.5551:0.1362:0.1695	rs28934571	249;249;249;249;249	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	S	249;249;249;249;249;249;238;117	ENSP00000410739:R249S;ENSP00000352610:R249S;ENSP00000269305:R249S;ENSP00000398846:R249S;ENSP00000391127:R249S;ENSP00000391478:R249S;ENSP00000425104:R117S	ENSP00000269305:R249S	R	-	3	2	TP53	7518259	0.011000	0.17503	0.998000	0.56505	0.783000	0.44284	-1.379000	0.02554	0.253000	0.21552	0.462000	0.41574	AGG	C|1.000;|0.000		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TPK1	27010	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	144150676	144150676	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:144150676C>A	ENST00000360057.3	-	9	796	c.694G>T	c.(694-696)Gac>Tac	p.D232Y	TPK1_ENST00000378099.3_Missense_Mutation_p.D183Y|TPK1_ENST00000549981.1_3'UTR|RNU6ATAC40P_ENST00000408580.1_RNA|TPK1_ENST00000547966.1_5'UTR|TPK1_ENST00000538212.2_Missense_Mutation_p.D178Y	NM_022445.3	NP_071890.2	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1	232					small molecule metabolic process (GO:0044281)|thiamine diphosphate biosynthetic process (GO:0009229)|thiamine metabolic process (GO:0006772)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|thiamine binding (GO:0030975)|thiamine diphosphokinase activity (GO:0004788)			large_intestine(3)|lung(12)|ovary(2)|urinary_tract(2)	19					Thiamine(DB00152)	AGTGGGTGGTCAGTTTCCACA	0.453																																					p.D232Y	Ovarian(45;88 1034 2073 5829 28455)	.											.	TPK1	188	0			c.G694T						.						204.0	180.0	188.0					7																	144150676		2203	4300	6503	SO:0001583	missense	27010	exon9			GGTGGTCAGTTTC	AB028138	CCDS5888.1, CCDS55178.1	7q34-q35	2008-07-18			ENSG00000196511	ENSG00000196511			17358	protein-coding gene	gene with protein product	"""placental protein 20"", ""thiamine pyrophosphokinase 1"", ""thiamine kinase"", ""thiamine diphosphokinase"""	606370				11342111	Standard	NM_022445		Approved	HTPK1, PP20	uc003weq.3	Q9H3S4	OTTHUMG00000152774	ENST00000360057.3:c.694G>T	7.37:g.144150676C>A	ENSP00000353165:p.Asp232Tyr	119.0	0.0		122.0	29.0	NM_022445	A8K0T7|D3DWG0|I6L9B8|Q6NUR5|Q9H602	Missense_Mutation	SNP	ENST00000360057.3	37	CCDS5888.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.563419	0.86335	.	.	ENSG00000196511	ENST00000360057;ENST00000538212;ENST00000378099	T;T;T	0.78707	-1.2;-1.2;-1.2	5.79	5.79	0.91817	Thiamin pyrophosphokinase, vitamin B1-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.90738	0.7093	M	0.91872	3.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.995	D	0.92218	0.5782	10	0.87932	D	0	-24.9542	17.5252	0.87798	0.0:1.0:0.0:0.0	.	183;232;178	F5GZG6;Q9H3S4;Q6ZQX6	.;TPK1_HUMAN;.	Y	232;178;183	ENSP00000353165:D232Y;ENSP00000438813:D178Y;ENSP00000367339:D183Y	ENSP00000353165:D232Y	D	-	1	0	TPK1	143781609	0.977000	0.34250	0.969000	0.41365	0.967000	0.64934	3.298000	0.51818	2.746000	0.94184	0.655000	0.94253	GAC	.		0.453	TPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327777.1	NM_022445	
TPM1	7168	broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	63335126	63335126	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:63335126A>G	ENST00000403994.3	+	1	178	c.98A>G	c.(97-99)gAa>gGa	p.E33G	TPM1_ENST00000358278.3_Missense_Mutation_p.E33G|TPM1_ENST00000559397.1_Missense_Mutation_p.E33G|TPM1_ENST00000288398.6_Missense_Mutation_p.E33G|TPM1_ENST00000560445.1_Missense_Mutation_p.E33G|TPM1_ENST00000267996.7_Missense_Mutation_p.E33G|TPM1_ENST00000357980.4_Missense_Mutation_p.E33G|TPM1_ENST00000559556.1_Missense_Mutation_p.E33G	NM_001018005.1	NP_001018005.1	P09493	TPM1_HUMAN	tropomyosin 1 (alpha)	33					cardiac muscle contraction (GO:0060048)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|negative regulation of cell migration (GO:0030336)|positive regulation of ATPase activity (GO:0032781)|positive regulation of cell adhesion (GO:0045785)|positive regulation of heart rate by epinephrine (GO:0003065)|positive regulation of stress fiber assembly (GO:0051496)|regulation of heart contraction (GO:0008016)|regulation of muscle contraction (GO:0006937)|ruffle organization (GO:0031529)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|wound healing (GO:0042060)	bleb (GO:0032059)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|muscle thin filament tropomyosin (GO:0005862)|ruffle membrane (GO:0032587)|sarcomere (GO:0030017)|stress fiber (GO:0001725)	actin binding (GO:0003779)|cytoskeletal protein binding (GO:0008092)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(1)|large_intestine(1)|lung(2)	4						AAGGCGGCGGAAGACAGGAGC	0.672																																					p.E33G		.											.	TPM1	90	0			c.A98G						.						27.0	24.0	25.0					15																	63335126		2196	4299	6495	SO:0001583	missense	7168	exon1			CGGCGGAAGACAG	AB209041	CCDS10181.1, CCDS32262.1, CCDS32263.1, CCDS32264.1, CCDS45273.1, CCDS58368.1, CCDS58369.1	15q22.1	2014-09-17			ENSG00000140416	ENSG00000140416		"""Tropomyosins"""	12010	protein-coding gene	gene with protein product		191010	"""chromosome 15 open reading frame 13"", ""cardiomyopathy, hypertrophic 3"""	C15orf13, CMH3		10343096, 8205619	Standard	XM_005254637		Approved		uc002all.3	P09493	OTTHUMG00000132803	ENST00000403994.3:c.98A>G	15.37:g.63335126A>G	ENSP00000385107:p.Glu33Gly	151.0	1.0		165.0	30.0	NM_001018007	B7Z5T7|D9YZV2|D9YZV3|D9YZV8|P09494|P10469|Q6DV89|Q6DV90|Q7Z6L8|Q86W64|Q96IK2|Q9UCI1|Q9UCI2|Q9UCY9|Q9Y427	Missense_Mutation	SNP	ENST00000403994.3	37	CCDS45273.1	.	.	.	.	.	.	.	.	.	.	A	18.49	3.636410	0.67130	.	.	ENSG00000140416	ENST00000288398;ENST00000267996;ENST00000358278;ENST00000403994;ENST00000357980	D;D;D;D;D	0.98075	-2.81;-2.81;-2.81;-2.81;-4.7	4.61	4.61	0.57282	.	0.000000	0.50627	D	0.000115	D	0.98896	0.9626	M	0.93150	3.385	0.80722	D	1	D;P;D;D;P;D;P;D;P	0.67145	0.962;0.935;0.986;0.996;0.934;0.996;0.795;0.98;0.935	D;P;D;D;P;D;P;D;P	0.71870	0.932;0.856;0.951;0.913;0.813;0.944;0.76;0.975;0.856	D	0.99517	1.0957	10	0.72032	D	0.01	-8.8336	13.3586	0.60642	1.0:0.0:0.0:0.0	.	33;33;33;33;33;33;33;33;33	P09493-6;D9YZV4;Q6ZN40;D9YZV8;D9YZV5;Q9Y427;D9YZV3;D9YZV2;P09493	.;.;.;.;.;.;.;.;TPM1_HUMAN	G	33	ENSP00000288398:E33G;ENSP00000267996:E33G;ENSP00000351022:E33G;ENSP00000385107:E33G;ENSP00000350667:E33G	ENSP00000267996:E33G	E	+	2	0	TPM1	61122179	1.000000	0.71417	0.977000	0.42913	0.598000	0.36846	8.954000	0.93051	1.933000	0.56026	0.460000	0.39030	GAA	.		0.672	TPM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000417083.2	NM_001018004	
TRPM2	7226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	45820191	45820191	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr21:45820191T>A	ENST00000397928.1	+	15	2703	c.2258T>A	c.(2257-2259)cTg>cAg	p.L753Q	TRPM2_ENST00000300482.5_Missense_Mutation_p.L753Q|TRPM2_ENST00000300481.9_Missense_Mutation_p.L733Q|TRPM2_ENST00000397932.2_Missense_Mutation_p.L753Q|TRPM2_ENST00000498430.1_3'UTR	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	753					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						GACAATGGGCTGTGGCGTGTG	0.677																																					p.L753Q		.											.	TRPM2	92	0			c.T2258A						.						121.0	86.0	98.0					21																	45820191		2203	4299	6502	SO:0001583	missense	7226	exon15			ATGGGCTGTGGCG	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2258T>A	21.37:g.45820191T>A	ENSP00000381023:p.Leu753Gln	53.0	0.0		46.0	15.0	NM_003307	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	T	9.357	1.066995	0.20067	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54	4.87	2.45	0.29901	.	0.510940	0.18958	N	0.126464	T	0.71367	0.3331	M	0.72894	2.215	0.09310	N	1	D;P;D	0.60160	0.987;0.918;0.977	P;P;P	0.50896	0.653;0.472;0.653	T	0.61969	-0.6953	10	0.46703	T	0.11	-14.3568	5.8132	0.18477	0.1486:0.0837:0.0:0.7678	.	753;539;753	E9PGK7;Q5KTC1;O94759	.;.;TRPM2_HUMAN	Q	753;753;733;753	ENSP00000300482:L753Q;ENSP00000381023:L753Q;ENSP00000300481:L733Q;ENSP00000381026:L753Q	ENSP00000300481:L733Q	L	+	2	0	TRPM2	44644619	0.039000	0.19947	0.096000	0.21009	0.272000	0.26649	1.619000	0.36965	0.217000	0.20800	0.496000	0.49642	CTG	.		0.677	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
UQCRH	7388	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	46782226	46782226	+	Silent	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:46782226G>T	ENST00000311672.5	+	4	382	c.246G>T	c.(244-246)gtG>gtT	p.V82V		NM_001089591.1|NM_006004.2	NP_001083060.1|NP_005995.2	P07919	QCR6_HUMAN	ubiquinol-cytochrome c reductase hinge protein	82					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|oxidation-reduction process (GO:0055114)|oxidative phosphorylation (GO:0006119)|protein heterooligomerization (GO:0051291)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	ubiquinol-cytochrome-c reductase activity (GO:0008121)			large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	4	Acute lymphoblastic leukemia(166;0.155)					CCATCTAGGTGGCCCACAAAC	0.418																																					p.V82V		.											.	UQCRH	90	0			c.G246T						.						163.0	156.0	158.0					1																	46782226		2203	4300	6503	SO:0001819	synonymous_variant	7388	exon4			CTAGGTGGCCCAC	BC001934	CCDS30704.1	1p34.1	2011-07-04			ENSG00000173660	ENSG00000173660	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12590	protein-coding gene	gene with protein product	"""ubiquinol-cytochrome c reductase, complex III subunit VIII"""	613844				2826252	Standard	XM_005271167		Approved	QCR6, UQCR8	uc001cpp.3	P07919	OTTHUMG00000007813	ENST00000311672.5:c.246G>T	1.37:g.46782226G>T		217.0	0.0		228.0	118.0	NM_006004	B2R4V9|D3DQ18|Q5TDF6|Q6LDB8|Q9BQ91	Silent	SNP	ENST00000311672.5	37	CCDS30704.1																																																																																			.		0.418	UQCRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021451.1	NM_006004	
VCP	7415	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	35068346	35068346	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr9:35068346C>T	ENST00000358901.6	-	2	926	c.31G>A	c.(31-33)Gac>Aac	p.D11N		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	11					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GTTGATAGGTCATCACCTTTT	0.458																																					p.D11N		.											.	VCP	228	0			c.G31A						.						222.0	202.0	209.0					9																	35068346		2203	4300	6503	SO:0001583	missense	7415	exon2			ATAGGTCATCACC	AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.31G>A	9.37:g.35068346C>T	ENSP00000351777:p.Asp11Asn	57.0	0.0		93.0	34.0	NM_007126	B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Missense_Mutation	SNP	ENST00000358901.6	37	CCDS6573.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168585	0.78339	.	.	ENSG00000165280	ENST00000358901	D	0.95137	-3.62	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.94778	0.8314	M	0.80746	2.51	0.80722	D	1	B	0.15719	0.014	B	0.19946	0.027	D	0.91181	0.4976	10	0.52906	T	0.07	-6.7381	18.8014	0.92018	0.0:1.0:0.0:0.0	.	11	P55072	TERA_HUMAN	N	11	ENSP00000351777:D11N	ENSP00000351777:D11N	D	-	1	0	VCP	35058346	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.703000	0.84585	2.882000	0.98803	0.655000	0.94253	GAC	.		0.458	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052290.1	NM_007126	
WDR17	116966	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	177041113	177041113	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr4:177041113C>A	ENST00000280190.4	+	5	631	c.475C>A	c.(475-477)Cca>Aca	p.P159T	WDR17_ENST00000508596.1_Missense_Mutation_p.P135T|WDR17_ENST00000393643.2_Missense_Mutation_p.P135T|WDR17_ENST00000507824.2_Missense_Mutation_p.P159T			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	159										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CATCTCAGGACCAGATAGTGG	0.468																																					p.P159T		.											.	WDR17	95	0			c.C475A						.						213.0	198.0	203.0					4																	177041113		2203	4300	6503	SO:0001583	missense	116966	exon5			TCAGGACCAGATA	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.475C>A	4.37:g.177041113C>A	ENSP00000280190:p.Pro159Thr	123.0	1.0		41.0	11.0	NM_170710	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	37	CCDS3825.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.22|14.22	2.469909|2.469909	0.43839|0.43839	.|.	.|.	ENSG00000150627|ENSG00000150627	ENST00000505894|ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	.|T;T;T	.|0.65178	.|-0.14;-0.14;-0.14	5.33|5.33	5.33|5.33	0.75918|0.75918	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.|0.196102	.|0.45361	.|D	.|0.000364	T|T	0.57315|0.57315	0.2045|0.2045	M|M	0.70595|0.70595	2.14|2.14	0.49915|0.49915	D|D	0.999835|0.999835	.|P;P	.|0.38300	.|0.626;0.626	.|B;B	.|0.36186	.|0.219;0.219	T|T	0.55237|0.55237	-0.8172|-0.8172	5|10	.|0.12766	.|T	.|0.61	-14.5655|-14.5655	12.3778|12.3778	0.55289|0.55289	0.0:0.9226:0.0:0.0774|0.0:0.9226:0.0:0.0774	.|.	.|135;159	.|E7EQX0;Q8IZU2	.|.;WDR17_HUMAN	E|T	32|135;135;159;159	.|ENSP00000422763:P135T;ENSP00000377258:P135T;ENSP00000280190:P159T	.|ENSP00000280190:P159T	D|P	+|+	3|1	2|0	WDR17|WDR17	177278107|177278107	0.975000|0.975000	0.34042|0.34042	0.998000|0.998000	0.56505|0.56505	0.747000|0.747000	0.42532|0.42532	1.828000|1.828000	0.39111|0.39111	2.473000|2.473000	0.83533|0.83533	0.655000|0.655000	0.94253|0.94253	GAC|CCA	.		0.468	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		
WDR33	55339	broad.mit.edu;bcgsc.ca	37	2	128495606	128495606	+	Intron	SNP	A	A	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:128495606A>C	ENST00000322313.4	-	8	883				WDR33_ENST00000393006.1_Silent_p.R249R	NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33						mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		GGAAGTAACAACGGCAGTGAT	0.418																																					p.R249R		.											.	WDR33	90	0			c.T747G						.						96.0	89.0	91.0					2																	128495606		1901	4120	6021	SO:0001627	intron_variant	55339	exon8			GTAACAACGGCAG		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.725-11255T>G	2.37:g.128495606A>C		96.0	2.0		71.0	37.0	NM_001006623	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Silent	SNP	ENST00000322313.4	37	CCDS2150.1																																																																																			.		0.418	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
XRCC4	7518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	82406962	82406962	+	Silent	SNP	G	G	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:82406962G>C	ENST00000511817.1	+	3	335	c.255G>C	c.(253-255)acG>acC	p.T85T	XRCC4_ENST00000509268.1_3'UTR|XRCC4_ENST00000338635.6_Silent_p.T85T|XRCC4_ENST00000396027.4_Silent_p.T85T|XRCC4_ENST00000282268.3_Silent_p.T85T			Q13426	XRCC4_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 4	85					cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|immunoglobulin V(D)J recombination (GO:0033152)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ligase activity (GO:0051351)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytosol (GO:0005829)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(2)|skin(3)	17		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		ATGTATACACGTTTAATTTTT	0.348								Non-homologous end-joining																													p.T85T		.											.	XRCC4	229	0			c.G255C						.						96.0	96.0	96.0					5																	82406962		2203	4300	6503	SO:0001819	synonymous_variant	7518	exon3			ATACACGTTTAAT	AB017445	CCDS4058.1, CCDS4059.1	5q14.2	2008-02-05			ENSG00000152422	ENSG00000152422			12831	protein-coding gene	gene with protein product	"""X-ray repair, complementing defective, repair in Chinese hamster"", ""DNA repair protein XRCC4"""	194363				1697445, 7665175	Standard	NM_022406		Approved		uc003kib.3	Q13426	OTTHUMG00000131319	ENST00000511817.1:c.255G>C	5.37:g.82406962G>C		111.0	0.0		93.0	20.0	NM_003401	A8K3X4|Q9BS72|Q9UP94	Silent	SNP	ENST00000511817.1	37	CCDS4059.1																																																																																			.		0.348	XRCC4-003	NOVEL	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369624.1	NM_022550	
ZBTB25	7597	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	64954580	64954580	+	Silent	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr14:64954580C>A	ENST00000608382.1	-	3	560	c.369G>T	c.(367-369)gtG>gtT	p.V123V	ZBTB25_ENST00000555424.1_Intron|ZBTB25_ENST00000394715.1_Silent_p.V123V|ZBTB25_ENST00000555220.1_Intron	NM_006977.2	NP_008908.2	P24278	ZBT25_HUMAN	zinc finger and BTB domain containing 25	123					gene expression (GO:0010467)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	10				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)		TTGAGGACTGCACAGTCTCTG	0.428																																					p.V123V		.											.	ZBTB25	92	0			c.G369T						.						116.0	109.0	112.0					14																	64954580		2203	4300	6503	SO:0001819	synonymous_variant	7597	exon3			GGACTGCACAGTC	X16576	CCDS9765.1	14q23-q24	2013-01-08	2005-05-22	2005-05-22	ENSG00000089775	ENSG00000089775		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13112	protein-coding gene	gene with protein product		194541	"""zinc finger protein 46 (KUP)"", ""chromosome 14 open reading frame 51"""	ZNF46, C14orf51			Standard	NM_006977		Approved	KUP	uc001xhf.3	P24278	OTTHUMG00000141310	ENST00000608382.1:c.369G>T	14.37:g.64954580C>A		194.0	1.0		168.0	77.0	NM_006977	B3KUX6|Q8IYH9	Silent	SNP	ENST00000608382.1	37	CCDS9765.1																																																																																			.		0.428	ZBTB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280649.2	NM_006977	
ZFP91	80829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	58384203	58384203	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:58384203A>G	ENST00000316059.6	+	10	1288	c.1117A>G	c.(1117-1119)Atc>Gtc	p.I373V	ZFP91-CNTF_ENST00000389919.4_Missense_Mutation_p.I373V	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein	373					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				AAGGGATTATATCTGTGAATA	0.408																																					p.I373V		.											.	ZFP91	91	0			c.A1117G						.						69.0	68.0	69.0					11																	58384203		2201	4295	6496	SO:0001583	missense	80829	exon10			GATTATATCTGTG	AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391	ENST00000316059.6:c.1117A>G	11.37:g.58384203A>G	ENSP00000339030:p.Ile373Val	81.0	0.0		102.0	21.0	NM_053023	A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Missense_Mutation	SNP	ENST00000316059.6	37	CCDS31553.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.480550	0.84747	.	.	ENSG00000186660	ENST00000316059;ENST00000389918	T	0.14391	2.51	5.79	5.79	0.91817	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.16085	0.0387	N	0.03084	-0.415	0.58432	D	0.999993	P;D	0.53151	0.948;0.958	D;D	0.70716	0.949;0.97	T	0.45991	-0.9223	10	0.25106	T	0.35	-10.1966	15.127	0.72489	1.0:0.0:0.0:0.0	.	373;373	Q96JP5-2;Q96JP5	.;ZFP91_HUMAN	V	373	ENSP00000339030:I373V	ENSP00000374569:I373V	I	+	1	0	ZFP91	58140779	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.962000	0.93254	2.223000	0.72356	0.455000	0.32223	ATC	.		0.408	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268674.1	NM_053023	
ZNF28	7576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53302982	53302982	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:53302982G>C	ENST00000457749.2	-	4	2235	c.2116C>G	c.(2116-2118)Ctt>Gtt	p.L706V	ZNF28_ENST00000360272.4_Missense_Mutation_p.L653V|ZNF28_ENST00000438150.2_Missense_Mutation_p.L653V|ZNF28_ENST00000414252.2_Missense_Mutation_p.L653V	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	706					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TGGTATACAAGGTTTGACATC	0.413																																					p.L706V		.											.	ZNF28	91	0			c.C2116G						.						111.0	105.0	107.0					19																	53302982		2203	4298	6501	SO:0001583	missense	7576	exon4			ATACAAGGTTTGA	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.2116C>G	19.37:g.53302982G>C	ENSP00000397693:p.Leu706Val	73.0	0.0		71.0	41.0	NM_006969	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	ENST00000457749.2	37	CCDS33093.2	.	.	.	.	.	.	.	.	.	.	-	7.267	0.606462	0.14002	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252	T;T;T;T	0.12255	2.7;2.7;2.7;2.7	1.65	0.473	0.16763	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23094	0.0558	M	0.85299	2.745	0.09310	N	1	P	0.38223	0.623	B	0.41666	0.363	T	0.12811	-1.0533	9	0.87932	D	0	.	8.8067	0.34943	0.0:0.2347:0.7653:0.0	.	706	P17035	ZNF28_HUMAN	V	653;706;653;653	ENSP00000412143:L653V;ENSP00000397693:L706V;ENSP00000353410:L653V;ENSP00000444965:L653V	ENSP00000353410:L653V	L	-	1	0	ZNF28	57994794	0.381000	0.25140	0.001000	0.08648	0.001000	0.01503	0.308000	0.19314	0.041000	0.15688	-0.989000	0.02550	CTT	.		0.413	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	NM_006969	
ZNF645	158506	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	22291221	22291221	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chrX:22291221G>T	ENST00000323684.1	+	1	157	c.113G>T	c.(112-114)tGg>tTg	p.W38L		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	38					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						GGTTACCGTTGGGGGGACATT	0.348																																					p.W38L		.											.	ZNF645	131	0			c.G113T						.						73.0	69.0	70.0					X																	22291221		2203	4300	6503	SO:0001583	missense	158506	exon1			ACCGTTGGGGGGA	AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.113G>T	X.37:g.22291221G>T	ENSP00000323348:p.Trp38Leu	103.0	1.0		92.0	73.0	NM_152577	A0AV29|A0AV31|E3SBK4|Q6DJY9	Missense_Mutation	SNP	ENST00000323684.1	37	CCDS14205.1	.	.	.	.	.	.	.	.	.	.	G	7.070	0.568076	0.13560	.	.	ENSG00000175809	ENST00000323684	T	0.37752	1.18	3.11	-3.83	0.04269	.	0.595869	0.15423	N	0.263119	T	0.18257	0.0438	N	0.22421	0.69	0.09310	N	1	B	0.14012	0.009	B	0.13407	0.009	T	0.07597	-1.0764	10	0.66056	D	0.02	.	4.0091	0.09615	0.2985:0.0:0.215:0.4865	.	38	Q8N7E2	ZN645_HUMAN	L	38	ENSP00000323348:W38L	ENSP00000323348:W38L	W	+	2	0	ZNF645	22201142	0.000000	0.05858	0.000000	0.03702	0.167000	0.22549	-0.100000	0.10990	-1.285000	0.02387	-0.351000	0.07748	TGG	.		0.348	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056037.1	NM_152577	
ZNF677	342926	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53740851	53740851	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:53740851A>G	ENST00000598513.1	-	5	1279	c.1129T>C	c.(1129-1131)Tgt>Cgt	p.C377R	ZNF677_ENST00000333952.4_Missense_Mutation_p.C377R	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	377					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		CATTCATTACATTTGTAAGGT	0.393																																					p.C377R		.											.	ZNF677	91	0			c.T1129C						.						92.0	85.0	87.0					19																	53740851		2203	4300	6503	SO:0001583	missense	342926	exon5			CATTACATTTGTA	BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.1129T>C	19.37:g.53740851A>G	ENSP00000469391:p.Cys377Arg	122.0	0.0		118.0	25.0	NM_182609		Missense_Mutation	SNP	ENST00000598513.1	37	CCDS12861.1	.	.	.	.	.	.	.	.	.	.	A	16.58	3.162684	0.57368	.	.	ENSG00000197928	ENST00000333952	D	0.85258	-1.96	2.14	2.14	0.27477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38111	N	0.001810	D	0.94308	0.8171	H	0.98594	4.275	0.54753	D	0.999981	D	0.89917	1.0	D	0.97110	1.0	D	0.93465	0.6814	10	0.87932	D	0	.	8.2235	0.31556	1.0:0.0:0.0:0.0	.	377	Q86XU0	ZN677_HUMAN	R	377	ENSP00000334394:C377R	ENSP00000334394:C377R	C	-	1	0	ZNF677	58432663	1.000000	0.71417	0.977000	0.42913	0.976000	0.68499	7.473000	0.81007	1.249000	0.43950	0.496000	0.49642	TGT	.		0.393	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464189.1	NM_182609	
ZNF71	58491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	57133835	57133835	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:57133835C>A	ENST00000328070.6	+	3	1414	c.1180C>A	c.(1180-1182)Cgc>Agc	p.R394S		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	394					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R394S(1)		endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		CTTCACGGGGCGCTCGTCCCT	0.627																																					p.R394S		.											.	ZNF71	91	1	Substitution - Missense(1)	prostate(1)	c.C1180A						.						88.0	70.0	76.0					19																	57133835		2203	4300	6503	SO:0001583	missense	58491	exon3			ACGGGGCGCTCGT	X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.1180C>A	19.37:g.57133835C>A	ENSP00000328245:p.Arg394Ser	56.0	0.0		55.0	28.0	NM_021216	Q15919|Q9UC09|Q9UQD3	Missense_Mutation	SNP	ENST00000328070.6	37	CCDS12947.1	.	.	.	.	.	.	.	.	.	.	C	2.611	-0.290711	0.05568	.	.	ENSG00000197951	ENST00000328070	T	0.08102	3.13	3.58	2.45	0.29901	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02119	0.0066	N	0.01209	-0.955	0.09310	N	1	B	0.29301	0.241	B	0.20184	0.028	T	0.34453	-0.9828	9	0.02654	T	1	.	8.5263	0.33307	0.3659:0.6341:0.0:0.0	.	394	Q9NQZ8	ZNF71_HUMAN	S	394	ENSP00000328245:R394S	ENSP00000328245:R394S	R	+	1	0	ZNF71	61825647	0.000000	0.05858	0.994000	0.49952	0.995000	0.86356	-0.497000	0.06428	1.815000	0.52974	0.561000	0.74099	CGC	.		0.627	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459798.2	NM_021216	
ZNF74	7625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	20749677	20749677	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr22:20749677C>G	ENST00000400451.2	+	2	603	c.89C>G	c.(88-90)tCg>tGg	p.S30W	ZNF74_ENST00000356671.5_Missense_Mutation_p.S30W|ZNF74_ENST00000403682.3_Intron|ZNF74_ENST00000357502.5_Missense_Mutation_p.I35M|ZNF74_ENST00000405993.1_Missense_Mutation_p.S30W	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	30					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GAGGATATATCGGGTTGGGGT	0.542																																					p.S30W		.											.	ZNF74	91	0			c.C89G						.						141.0	147.0	145.0					22																	20749677		1964	4140	6104	SO:0001583	missense	7625	exon2			ATATATCGGGTTG	X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.89C>G	22.37:g.20749677C>G	ENSP00000383301:p.Ser30Trp	161.0	0.0		138.0	62.0	NM_003426	B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Missense_Mutation	SNP	ENST00000400451.2	37	CCDS42982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	9.387|9.387	1.074424|1.074424	0.20227|0.20227	.|.	.|.	ENSG00000185252|ENSG00000185252	ENST00000357502|ENST00000400451;ENST00000356671;ENST00000405993	.|T;T;T	.|0.06068	.|3.41;3.41;3.35	3.8|3.8	0.075|0.075	0.14397|0.14397	.|.	.|1.382960	.|0.05998	.|N	.|0.647249	T|T	0.03263|0.03263	0.0095|0.0095	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B	.|0.12630	.|0.006	.|B	.|0.06405	.|0.002	T|T	0.44390|0.44390	-0.9331|-0.9331	6|10	0.56958|0.37606	D|T	0.05|0.19	-0.2226|-0.2226	2.9108|2.9108	0.05736|0.05736	0.0:0.2863:0.2435:0.4702|0.0:0.2863:0.2435:0.4702	.|.	.|30	.|Q16587	.|ZNF74_HUMAN	M|W	35|30	.|ENSP00000383301:S30W;ENSP00000349098:S30W;ENSP00000385855:S30W	ENSP00000350101:I35M|ENSP00000349098:S30W	I|S	+|+	3|2	3|0	ZNF74|ZNF74	19079677|19079677	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.010000|0.010000	0.07245|0.07245	0.130000|0.130000	0.15850|0.15850	0.037000|0.037000	0.15575|0.15575	0.591000|0.591000	0.81541|0.81541	ATC|TCG	.		0.542	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319648.2	NM_003426	
ZNF829	374899	hgsc.bcm.edu;broad.mit.edu	37	19	37383281	37383281	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:37383281delT	ENST00000391711.3	-	6	776	c.412delA	c.(412-414)attfs	p.I138fs	ZNF345_ENST00000432005.2_Intron|ZNF829_ENST00000520965.1_Frame_Shift_Del_p.I219fs|ZNF345_ENST00000526123.1_Intron	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	138					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GTGGGCTGAATAAAAGTAGAC	0.338																																					p.I219fs		.											.	ZNF829	90	0			c.655delA						.						63.0	55.0	58.0					19																	37383281		1837	4084	5921	SO:0001589	frameshift_variant	374899	exon6			GCTGAATAAAAGT	BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.412delA	19.37:g.37383281delT	ENSP00000429266:p.Ile138fs	39.0	0.0		97.0	15.0	NM_001171979	Q3KNS7|Q6ZNN0|Q7Z657	Frame_Shift_Del	DEL	ENST00000391711.3	37	CCDS42557.1																																																																																			.		0.338	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109575.3	NM_001037232	
ZNF831	128611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	57768554	57768554	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr20:57768554T>C	ENST00000371030.2	+	1	2480	c.2480T>C	c.(2479-2481)gTg>gCg	p.V827A		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	827							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					AAGCTGAAAGTGGAGGACCTG	0.622																																					p.V827A		.											.	ZNF831	126	0			c.T2480C						.						33.0	41.0	39.0					20																	57768554		2039	4193	6232	SO:0001583	missense	128611	exon1			TGAAAGTGGAGGA	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.2480T>C	20.37:g.57768554T>C	ENSP00000360069:p.Val827Ala	81.0	0.0		140.0	62.0	NM_178457	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	T	13.34	2.208871	0.39003	.	.	ENSG00000124203	ENST00000371030	T	0.13538	2.58	4.92	3.82	0.43975	.	0.389415	0.21720	N	0.070134	T	0.14570	0.0352	L	0.36672	1.1	0.19300	N	0.999977	P	0.51791	0.948	P	0.47786	0.557	T	0.06661	-1.0814	10	0.66056	D	0.02	-11.5444	8.2457	0.31686	0.0:0.0909:0.0:0.9091	.	827	Q5JPB2	ZN831_HUMAN	A	827	ENSP00000360069:V827A	ENSP00000360069:V827A	V	+	2	0	ZNF831	57201949	0.984000	0.35163	0.952000	0.39060	0.150000	0.21749	1.615000	0.36922	0.737000	0.32582	0.368000	0.22195	GTG	.		0.622	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
FAM83E	54854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49104612	49104613	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:49104612_49104613CC>AA	ENST00000263266.3	-	5	1379_1380	c.1190_1191GG>TT	c.(1189-1191)tGG>tTT	p.W397F		NM_017708.3	NP_060178.2	Q2M2I3	FA83E_HUMAN	family with sequence similarity 83, member E	397										NS(1)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(2)	10		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		CCTTGGAGCCCCAGGATTTCTT	0.673																																					p.W397F		.											.	.	.	0			.						.																																			SO:0001583	missense	54854	.			GGAGCCCCAGGAT	AK000207	CCDS42587.1	19q13.33	2013-10-24			ENSG00000105523	ENSG00000105523			25972	protein-coding gene	gene with protein product							Standard	NM_017708		Approved	FLJ20200	uc002pjn.2	Q2M2I3	OTTHUMG00000183315	ENST00000263266.3:c.1190_1191delinsAA	19.37:g.49104612_49104613delinsAA	ENSP00000263266:p.Trp397Phe	146.0	0.0		175.0	38.0	.	Q9NXK1	Missense_Mutation	DNP	ENST00000263266.3	37	CCDS42587.1																																																																																			.		0.673	FAM83E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466145.1	NM_017708	
SMARCA2	6595	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	2097384	2097385	+	Splice_Site	DNP	GG	GG	TC			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr9:2097384_2097385GG>TC	ENST00000382203.1	+	21	3200_3201	c.2991_2992GG>TC	c.(2989-2994)aaGGgg>aaTCgg	p.997_998KG>NR	SMARCA2_ENST00000349721.2_Splice_Site_p.997_998KG>NR|SMARCA2_ENST00000357248.2_Splice_Site_p.997_998KG>NR|SMARCA2_ENST00000382194.1_Splice_Site_p.997_998KG>NR			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	997					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CTGGTTCTTAGGGGAAAGGAGG	0.381																																					.		.											.	.	.	0			.						.																																			SO:0001630	splice_region_variant	6595	.			TTCTTAGGGGAAA	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	Exception_encountered	9.37:g.2097384_2097385delinsTC		50.0	0.0		84.0	38.0	.	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	DNP	ENST00000382203.1	37	CCDS34977.1																																																																																			.		0.381	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	Missense_Mutation
