#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	48313397	48313397	+	Silent	SNP	A	A	G			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr7:48313397A>G	ENST00000435803.1	+	17	4158	c.4134A>G	c.(4132-4134)ttA>ttG	p.L1378L		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1378					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TAGACACGTTAAATTCCACAT	0.343																																					p.L1378L		.											.	ABCA13	521	0			c.A4134G						.						52.0	49.0	50.0					7																	48313397		1867	4093	5960	SO:0001819	synonymous_variant	154664	exon17			CACGTTAAATTCC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.4134A>G	7.37:g.48313397A>G		66.0	0.0		82.0	20.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	CCDS47584.1																																																																																			.		0.343	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ADCY10	55811	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	167874253	167874253	+	Silent	SNP	G	G	C			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr1:167874253G>C	ENST00000367851.4	-	2	310	c.126C>G	c.(124-126)gtC>gtG	p.V42V	ADCY10_ENST00000476818.2_Silent_p.V42V|ADCY10_ENST00000367848.1_5'UTR|ADCY10_ENST00000545172.1_Intron	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	42	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						CAAACATCAGGACTCCGTCAA	0.453																																					p.V42V		.											.	ADCY10	493	0			c.C126G						.						111.0	106.0	107.0					1																	167874253		2203	4300	6503	SO:0001819	synonymous_variant	55811	exon2			CATCAGGACTCCG	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.126C>G	1.37:g.167874253G>C		167.0	0.0		375.0	84.0	NM_018417	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Silent	SNP	ENST00000367851.4	37	CCDS1265.1																																																																																			.		0.453	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417	
AGK	55750	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	141333731	141333731	+	Missense_Mutation	SNP	A	A	T	rs561898521	byFrequency	TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr7:141333731A>T	ENST00000355413.4	+	10	879	c.619A>T	c.(619-621)Acc>Tcc	p.T207S	AGK_ENST00000535825.1_Missense_Mutation_p.T204S|AGK_ENST00000473247.1_Missense_Mutation_p.T179S	NM_018238.3	NP_060708.1	Q53H12	AGK_HUMAN	acylglycerol kinase	207					ceramide biosynthetic process (GO:0046513)|glycerolipid metabolic process (GO:0046486)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acylglycerol kinase activity (GO:0047620)|ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(3)	17	Melanoma(164;0.0171)					ATTTGCAATGACCGGCCTTCG	0.348																																					p.T207S		.											.	AGK	290	0			c.A619T						.						122.0	122.0	122.0					7																	141333731		2203	4300	6503	SO:0001583	missense	55750	exon10			GCAATGACCGGCC	BC022777	CCDS5865.1	7q34	2010-05-04	2007-01-11	2007-01-11	ENSG00000006530	ENSG00000006530	2.7.1.94		21869	protein-coding gene	gene with protein product		610345	"""multiple substrate lipid kinase"""	MULK		15252046, 15939762, 17135245	Standard	NM_018238		Approved	FLJ10842	uc003vwi.2	Q53H12	OTTHUMG00000157499	ENST00000355413.4:c.619A>T	7.37:g.141333731A>T	ENSP00000347581:p.Thr207Ser	34.0	0.0		59.0	19.0	NM_018238	Q75KN1|Q96GC3|Q9NP48	Missense_Mutation	SNP	ENST00000355413.4	37	CCDS5865.1	.	.	.	.	.	.	.	.	.	.	A	7.523	0.657045	0.14580	.	.	ENSG00000006530	ENST00000355413;ENST00000473247;ENST00000535825	T;T;T	0.40756	2.61;2.61;1.02	5.85	4.59	0.56863	.	0.356129	0.35436	N	0.003216	T	0.18045	0.0433	N	0.04090	-0.28	0.27369	N	0.955738	B	0.02656	0.0	B	0.06405	0.002	T	0.13072	-1.0523	10	0.06625	T	0.88	.	11.1992	0.48730	0.8531:0.0:0.0:0.1469	.	207	Q53H12	AGK_HUMAN	S	207;179;204	ENSP00000347581:T207S;ENSP00000420776:T179S;ENSP00000444349:T204S	ENSP00000347581:T207S	T	+	1	0	AGK	140980200	1.000000	0.71417	0.980000	0.43619	0.982000	0.71751	3.263000	0.51546	2.246000	0.74042	0.533000	0.62120	ACC	.		0.348	AGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348969.1	NM_018238	
AHDC1	27245	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	27876868	27876868	+	Silent	SNP	G	G	T			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr1:27876868G>T	ENST00000247087.5	-	5	2355	c.1759C>A	c.(1759-1761)Cga>Aga	p.R587R	AHDC1_ENST00000374011.2_Silent_p.R587R			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	587							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		CGCCGCCGTCGTTTTTTTACC	0.652																																					p.R587R		.											.	AHDC1	90	0			c.C1759A						.						65.0	62.0	63.0					1																	27876868		2203	4300	6503	SO:0001819	synonymous_variant	27245	exon6			GCCGTCGTTTTTT	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.1759C>A	1.37:g.27876868G>T		236.0	0.0		257.0	24.0	NM_001029882	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Silent	SNP	ENST00000247087.5	37	CCDS30652.1																																																																																			.		0.652	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3		
ALPK1	80216	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	113356354	113356354	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr4:113356354G>A	ENST00000458497.1	+	12	3364	c.3085G>A	c.(3085-3087)Gaa>Aaa	p.E1029K	ALPK1_ENST00000504176.2_Missense_Mutation_p.E951K|ALPK1_ENST00000177648.9_Missense_Mutation_p.E1029K	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	1029	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		GACGGCCCAGGAAACTATTGT	0.353																																					p.E1029K		.											.	ALPK1	337	0			c.G3085A						.						130.0	155.0	147.0					4																	113356354		2203	4300	6503	SO:0001583	missense	80216	exon12			GCCCAGGAAACTA	AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.3085G>A	4.37:g.113356354G>A	ENSP00000398048:p.Glu1029Lys	130.0	0.0		124.0	20.0	NM_001102406	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	ENST00000458497.1	37	CCDS3697.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.653679	0.88056	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000504176	T;T;T	0.07114	3.22;3.22;3.22	5.84	5.84	0.93424	MHCK/EF2 kinase (2);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.33614	0.0869	M	0.78801	2.425	0.52099	D	0.999943	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.995;0.994	T	0.01301	-1.1391	10	0.62326	D	0.03	-29.2293	20.1393	0.98055	0.0:0.0:1.0:0.0	.	951;951;1029	F5H138;B4E3G1;Q96QP1	.;.;ALPK1_HUMAN	K	1029;1029;951	ENSP00000398048:E1029K;ENSP00000177648:E1029K;ENSP00000426044:E951K	ENSP00000177648:E1029K	E	+	1	0	ALPK1	113575803	1.000000	0.71417	1.000000	0.80357	0.513000	0.34164	8.521000	0.90569	2.759000	0.94783	0.563000	0.77884	GAA	.		0.353	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144	
ATG2A	23130	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	64664282	64664282	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr11:64664282C>A	ENST00000377264.3	-	38	5322	c.5210G>T	c.(5209-5211)cGc>cTc	p.R1737L	ATG2A_ENST00000421419.2_Missense_Mutation_p.R1739L	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1737					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						CTGGTTCTTGCGGATGTCCTG	0.622											OREG0004026	type=REGULATORY REGION|Gene=BC027481|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.R1737L		.											.	ATG2A	69	0			c.G5210T						.						54.0	54.0	54.0					11																	64664282		2201	4297	6498	SO:0001583	missense	23130	exon38			TTCTTGCGGATGT		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.5210G>T	11.37:g.64664282C>A	ENSP00000366475:p.Arg1737Leu	109.0	0.0	1078	143.0	27.0	NM_015104	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	ENST00000377264.3	37	CCDS31602.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165441	0.78339	.	.	ENSG00000110046	ENST00000421419;ENST00000377262;ENST00000377264	T;T	0.07327	3.2;3.2	4.05	3.11	0.35812	.	0.000000	0.64402	D	0.000001	T	0.18964	0.0455	L	0.44542	1.39	0.51482	D	0.99992	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	T	0.00557	-1.1672	10	0.52906	T	0.07	.	11.0151	0.47685	0.1878:0.8122:0.0:0.0	.	1737;1739	Q2TAZ0;Q2TAZ0-3	ATG2A_HUMAN;.	L	1739;130;1737	ENSP00000410522:R1739L;ENSP00000366475:R1737L	ENSP00000366473:R130L	R	-	2	0	ATG2A	64420858	0.920000	0.31207	1.000000	0.80357	0.877000	0.50540	1.424000	0.34848	1.042000	0.40150	-0.314000	0.08810	CGC	.		0.622	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104	
BCL10	8915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	85733444	85733444	+	Missense_Mutation	SNP	T	T	C	rs556621354	byFrequency	TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr1:85733444T>C	ENST00000370580.1	-	3	1305	c.568A>G	c.(568-570)Act>Gct	p.T190A		NM_003921.4	NP_003912.1	O95999	BCL10_HUMAN	B-cell CLL/lymphoma 10	190					adaptive immune response (GO:0002250)|B cell apoptotic process (GO:0001783)|cell death (GO:0008219)|cellular defense response (GO:0006968)|cellular response to mechanical stimulus (GO:0071260)|Fc-epsilon receptor signaling pathway (GO:0038095)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interleukin-6 biosynthetic process (GO:0042226)|lymphotoxin A biosynthetic process (GO:0042109)|negative regulation of mature B cell apoptotic process (GO:0002906)|neural tube closure (GO:0001843)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of mast cell cytokine production (GO:0032765)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|regulation of T cell receptor signaling pathway (GO:0050856)|response to food (GO:0032094)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell apoptotic process (GO:0070231)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor signaling pathway (GO:0002224)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|NF-kappaB binding (GO:0051059)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|protein kinase B binding (GO:0043422)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	19				all cancers(265;0.0114)|Epithelial(280;0.0311)		GGAAGTGTAGTTGAAGAGAAG	0.448			T	IGH@	MALT								T|||	2	0.000399361	0.0	0.0	5008	,	,		14905	0.0		0.0	False		,,,				2504	0.002				p.T190A	NSCLC(34;993 1034 12176 32621 50182)	.		Dom	yes		1	1p22	8915	B-cell CLL/lymphoma 10		L	.	BCL10	659	0			c.A568G						.						96.0	102.0	100.0					1																	85733444		2203	4300	6503	SO:0001583	missense	8915	exon3			GTGTAGTTGAAGA	AJ006288	CCDS704.1	1p22	2008-07-18			ENSG00000142867	ENSG00000142867			989	protein-coding gene	gene with protein product	"""CARD-like apoptotic protein"", ""CARD-containing apoptotic signaling protein"", ""CARD containing molecule enhancing NF-kB"", ""caspase-recruiting domain-containing protein"", ""CARD-containing proapoptotic protein"""	603517				9989495	Standard	NM_003921		Approved	CARMEN, CIPER, mE10, c-E10, CLAP	uc021opd.1	O95999	OTTHUMG00000009965	ENST00000370580.1:c.568A>G	1.37:g.85733444T>C	ENSP00000359612:p.Thr190Ala	74.0	0.0		78.0	15.0	NM_003921	Q5VUF1	Missense_Mutation	SNP	ENST00000370580.1	37	CCDS704.1	.	.	.	.	.	.	.	.	.	.	T	8.104	0.777202	0.16120	.	.	ENSG00000142867	ENST00000370580;ENST00000271015	.	.	.	5.82	-1.91	0.07641	.	0.499537	0.23742	N	0.045015	T	0.04363	0.0120	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38735	-0.9647	9	0.30854	T	0.27	-0.3714	6.7252	0.23353	0.1519:0.5344:0.0:0.3137	.	190	O95999	BCL10_HUMAN	A	190	.	ENSP00000271015:T190A	T	-	1	0	BCL10	85506032	0.056000	0.20664	0.026000	0.17262	0.985000	0.73830	0.587000	0.23909	-0.344000	0.08338	0.383000	0.25322	ACT	.		0.448	BCL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027612.1	NM_003921	
BIRC6	57448	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	32733177	32733177	+	Silent	SNP	T	T	C			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr2:32733177T>C	ENST00000421745.2	+	51	9965	c.9831T>C	c.(9829-9831)gcT>gcC	p.A3277A		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	3277					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TAGCTTCTGCTGTCTGCCTTA	0.458																																					p.A3277A	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6	233	0			c.T9831C						.						96.0	88.0	91.0					2																	32733177		2203	4300	6503	SO:0001819	synonymous_variant	57448	exon51			TTCTGCTGTCTGC	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.9831T>C	2.37:g.32733177T>C		167.0	0.0		217.0	92.0	NM_016252	Q9ULD1	Silent	SNP	ENST00000421745.2	37	CCDS33175.2																																																																																			.		0.458	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
BMPER	168667	hgsc.bcm.edu;ucsc.edu	37	7	33976996	33976996	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr7:33976996C>A	ENST00000297161.2	+	4	689	c.315C>A	c.(313-315)tgC>tgA	p.C105*	BMPER_ENST00000426693.1_Nonsense_Mutation_p.C105*	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	105	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GTGAACAGTGCAAAGGTGATT	0.502																																					p.C105X		.											.	BMPER	92	0			c.C315A						.						118.0	106.0	110.0					7																	33976996		2203	4300	6503	SO:0001587	stop_gained	168667	exon4			ACAGTGCAAAGGT		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.315C>A	7.37:g.33976996C>A	ENSP00000297161:p.Cys105*	109.0	0.0		100.0	24.0	NM_133468	A8K1P8|Q8TF36	Nonsense_Mutation	SNP	ENST00000297161.2	37	CCDS5442.1	.	.	.	.	.	.	.	.	.	.	C	16.35	3.098639	0.56183	.	.	ENSG00000164619	ENST00000297161;ENST00000426693	.	.	.	5.18	3.37	0.38596	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.5775	0.33607	0.0:0.6989:0.0:0.3011	.	.	.	.	X	105	.	ENSP00000297161:C105X	C	+	3	2	BMPER	33943521	1.000000	0.71417	1.000000	0.80357	0.620000	0.37586	0.978000	0.29488	1.165000	0.42670	0.563000	0.77884	TGC	.		0.502	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468	
C14orf23	387978	ucsc.edu;bcgsc.ca;mdanderson.org	37	14	29242038	29242038	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr14:29242038T>G	ENST00000399387.4	+	1	129	c.25T>G	c.(25-27)Tgc>Ggc	p.C9G	C14orf23_ENST00000548213.1_Missense_Mutation_p.C9G|C14orf23_ENST00000552957.1_Missense_Mutation_p.C9G					chromosome 14 open reading frame 23											central_nervous_system(1)	1						CATGAAAATCTGCGCAGCCAT	0.458																																					.		.											.	C14orf23	23	0			.						.																																			SO:0001583	missense	387978	.			AAAATCTGCGCAG			14q11.2	2013-01-15			ENSG00000186960	ENSG00000186960			19828	other	unknown							Standard	NR_026731		Approved		uc001wqf.3	Q86U37	OTTHUMG00000029410	ENST00000399387.4:c.25T>G	14.37:g.29242038T>G	ENSP00000382318:p.Cys9Gly	117.0	0.0		108.0	32.0	.		RNA	SNP	ENST00000399387.4	37		.	.	.	.	.	.	.	.	.	.	T	10.51	1.370347	0.24771	.	.	ENSG00000186960	ENST00000399387;ENST00000552957;ENST00000548213	.	.	.	5.31	1.32	0.21799	.	0.404235	0.18408	N	0.142142	T	0.23014	0.0556	.	.	.	0.23003	N	0.99845	B	0.33044	0.395	B	0.33196	0.159	T	0.19976	-1.0289	8	0.87932	D	0	.	2.2858	0.04125	0.1326:0.1653:0.1222:0.5799	.	9	Q86U37	CN023_HUMAN	G	9	.	ENSP00000382318:C9G	C	+	1	0	C14orf23	28311789	0.995000	0.38212	0.987000	0.45799	0.840000	0.47671	1.021000	0.30040	0.443000	0.26582	-0.435000	0.05868	TGC	.		0.458	C14orf23-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000134019.2	NR_026731	
C3	718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6718129	6718129	+	Silent	SNP	G	G	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr19:6718129G>A	ENST00000245907.6	-	4	572	c.480C>T	c.(478-480)ggC>ggT	p.G160G		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	160					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	TGACCGTCCGGCCCACGGGTA	0.622																																					p.G160G		.											.	C3	95	0			c.C480T						.						100.0	95.0	96.0					19																	6718129		2203	4300	6503	SO:0001819	synonymous_variant	718	exon4			CGTCCGGCCCACG	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.480C>T	19.37:g.6718129G>A		91.0	0.0		98.0	31.0	NM_000064	A7E236	Silent	SNP	ENST00000245907.6	37	CCDS32883.1																																																																																			.		0.622	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
C3orf20	84077	ucsc.edu;bcgsc.ca	37	3	14799024	14799024	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr3:14799024A>G	ENST00000253697.3	+	13	2539	c.2087A>G	c.(2086-2088)gAg>gGg	p.E696G	C3orf20_ENST00000412910.1_Missense_Mutation_p.E574G|C3orf20_ENST00000435614.1_Missense_Mutation_p.E574G	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	696						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						TCTGACGTGGAGCTGGAGCGC	0.632																																					p.E696G		.											.	C3orf20	94	0			c.A2087G						.						62.0	60.0	61.0					3																	14799024		2203	4300	6503	SO:0001583	missense	84077	exon13			ACGTGGAGCTGGA	AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.2087A>G	3.37:g.14799024A>G	ENSP00000253697:p.Glu696Gly	263.0	1.0		341.0	79.0	NM_032137	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	ENST00000253697.3	37	CCDS33706.1	.	.	.	.	.	.	.	.	.	.	A	14.96	2.692001	0.48097	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.16457	2.63;2.34;2.34	4.95	4.95	0.65309	.	0.000000	0.51477	D	0.000097	T	0.40372	0.1114	M	0.76574	2.34	0.38505	D	0.948335	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.44513	-0.9323	10	0.87932	D	0	-35.4742	11.0226	0.47726	1.0:0.0:0.0:0.0	.	574;696	Q8ND61-2;Q8ND61	.;CC020_HUMAN	G	696;574;574	ENSP00000253697:E696G;ENSP00000402933:E574G;ENSP00000396081:E574G	ENSP00000253697:E696G	E	+	2	0	C3orf20	14774028	1.000000	0.71417	1.000000	0.80357	0.096000	0.18686	4.675000	0.61619	1.864000	0.54056	0.247000	0.18012	GAG	.		0.632	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137	
C3orf22	152065	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	126270923	126270923	+	Silent	SNP	G	G	A	rs34760151	byFrequency	TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr3:126270923G>A	ENST00000318225.2	-	3	510	c.132C>T	c.(130-132)ccC>ccT	p.P44P		NM_152533.1	NP_689746.1	Q8N5N4	CC022_HUMAN	chromosome 3 open reading frame 22	44										large_intestine(1)|lung(3)|ovary(2)|prostate(1)	7				GBM - Glioblastoma multiforme(114;0.147)		TGACCTCCCAGGGCTGCAGGG	0.602																																					p.P44P		.											.	C3orf22	90	0			c.C132T						.						83.0	77.0	79.0					3																	126270923		2203	4300	6503	SO:0001819	synonymous_variant	152065	exon3			CTCCCAGGGCTGC		CCDS3040.1	3q21.3	2011-09-30			ENSG00000180697	ENSG00000180697			28534	protein-coding gene	gene with protein product						12477932	Standard	NM_152533		Approved	MGC34728	uc003ejb.3	Q8N5N4	OTTHUMG00000162731	ENST00000318225.2:c.132C>T	3.37:g.126270923G>A		93.0	0.0		113.0	30.0	NM_152533	B3KUS9	Silent	SNP	ENST00000318225.2	37	CCDS3040.1																																																																																			G|0.687;C|0.313		0.602	C3orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370231.2	NM_152533	
CCDC33	80125	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	15	74560701	74560701	+	Missense_Mutation	SNP	G	G	A	rs538969678		TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr15:74560701G>A	ENST00000398814.3	+	5	879	c.448G>A	c.(448-450)Gcc>Acc	p.A150T	CCDC33_ENST00000321288.5_Missense_Mutation_p.A353T	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	353										breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GTCTGGGAAAGCCGATGAAGC	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		15392	0.0		0.0	False		,,,				2504	0.001				p.A150T		.											.	CCDC33	95	0			c.G448A						.						49.0	54.0	53.0					15																	74560701		1961	4161	6122	SO:0001583	missense	80125	exon5			GGGAAAGCCGATG	BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.448G>A	15.37:g.74560701G>A	ENSP00000381795:p.Ala150Thr	131.0	0.0		160.0	42.0	NM_025055	A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Missense_Mutation	SNP	ENST00000398814.3	37	CCDS42058.1	.	.	.	.	.	.	.	.	.	.	G	6.961	0.547158	0.13312	.	.	ENSG00000140481	ENST00000321288;ENST00000398814	T;T	0.23552	1.9;2.23	4.17	-3.93	0.04143	.	3.081050	0.01073	N	0.004855	T	0.18676	0.0448	L	0.47716	1.5	0.09310	N	1	B	0.24426	0.103	B	0.19391	0.025	T	0.09552	-1.0669	10	0.27785	T	0.31	.	1.3327	0.02138	0.195:0.3649:0.2146:0.2255	.	150	Q8N5R6-6	.	T	353;150	ENSP00000325012:A353T;ENSP00000381795:A150T	ENSP00000325012:A353T	A	+	1	0	CCDC33	72347754	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.913000	0.04042	-0.555000	0.06142	0.514000	0.50259	GCC	.		0.572	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419491.2	NM_182791	
CD207	50489	ucsc.edu;bcgsc.ca	37	2	71062835	71062835	+	Splice_Site	SNP	T	T	C	rs79763209		TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr2:71062835T>C	ENST00000410009.3	-	1	117	c.72A>G	c.(70-72)cgA>cgG	p.R24R		NM_015717.3	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 molecule, langerin	24					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|defense response to virus (GO:0051607)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)			endometrium(1)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|stomach(1)	20						TGTGGCTTGCTCGGGGCCAGA	0.547																																					p.R24R		.											.	CD207	46	0			c.A72G						.						71.0	83.0	79.0					2																	71062835		2132	4252	6384	SO:0001630	splice_region_variant	50489	exon1			GCTTGCTCGGGGC	AJ242859	CCDS74520.1	2p13	2011-08-30	2006-03-28		ENSG00000116031	ENSG00000116031		"""C-type lectin domain containing"", ""CD molecules"""	17935	protein-coding gene	gene with protein product		604862	"""CD207 antigen, langerin"""			10661407, 9847074	Standard	NM_015717		Approved	Langerin, CLEC4K	uc002shg.3	Q9UJ71	OTTHUMG00000153176	ENST00000410009.3:c.73+1A>G	2.37:g.71062835T>C		216.0	1.0		250.0	34.0	NM_015717		Silent	SNP	ENST00000410009.3	37																																																																																				.		0.547	CD207-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000329959.4	NM_015717	Silent
CIB3	117286	hgsc.bcm.edu;bcgsc.ca	37	19	16275656	16275656	+	Missense_Mutation	SNP	C	C	T	rs200526470		TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr19:16275656C>T	ENST00000269878.4	-	5	464	c.415G>A	c.(415-417)Ggg>Agg	p.G139R	CIB3_ENST00000541493.1_5'UTR|CIB3_ENST00000379859.3_Missense_Mutation_p.G90R	NM_054113.2	NP_473454.1	Q96Q77	CIB3_HUMAN	calcium and integrin binding family member 3	139			G -> E (in dbSNP:rs6512087). {ECO:0000269|PubMed:15489334}.				calcium ion binding (GO:0005509)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16						GCACTCAGCCCCCCCCGCGTC	0.567																																					p.G139R		.											.	CIB3	131	0			c.G415A						.						130.0	117.0	122.0					19																	16275656		2203	4300	6503	SO:0001583	missense	117286	exon5			TCAGCCCCCCCCG	AB050868	CCDS12340.1, CCDS74305.1	19p13.12	2013-01-10						"""EF-hand domain containing"""	24580	protein-coding gene	gene with protein product		610645					Standard	XM_005259728		Approved	KIP3	uc002nds.3	Q96Q77		ENST00000269878.4:c.415G>A	19.37:g.16275656C>T	ENSP00000269878:p.Gly139Arg	159.0	0.0		171.0	12.0	NM_054113	E7EUX1|Q2M1W0|Q6ISP1	Missense_Mutation	SNP	ENST00000269878.4	37	CCDS12340.1	.	.	.	.	.	.	.	.	.	.	C	12.14	1.848222	0.32699	.	.	ENSG00000141977	ENST00000269878;ENST00000379859	T;T	0.66638	-0.22;2.94	4.78	4.78	0.61160	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.54398	0.1856	N	0.17082	0.46	0.80722	D	1	B;B	0.26318	0.146;0.045	B;B	0.32289	0.094;0.143	T	0.51896	-0.8647	10	0.30078	T	0.28	-34.4259	17.1514	0.86779	0.0:1.0:0.0:0.0	.	90;139	E7EUX1;Q96Q77	.;CIB3_HUMAN	R	139;90	ENSP00000269878:G139R;ENSP00000369188:G90R	ENSP00000269878:G139R	G	-	1	0	CIB3	16136656	1.000000	0.71417	1.000000	0.80357	0.051000	0.14879	7.526000	0.81920	2.385000	0.81259	0.462000	0.41574	GGG	.		0.567	CIB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460351.1	NM_054113	
COL1A2	1278	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	94043219	94043219	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr7:94043219G>T	ENST00000297268.6	+	28	2096	c.1625G>T	c.(1624-1626)gGa>gTa	p.G542V		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	542					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GTTCAAGGTGGAAAAGGTGAA	0.443										HNSCC(75;0.22)																											p.G542V		.											.	COL1A2	521	0			c.G1625T						.						137.0	123.0	128.0					7																	94043219		2203	4300	6503	SO:0001583	missense	1278	exon28			AAGGTGGAAAAGG	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.1625G>T	7.37:g.94043219G>T	ENSP00000297268:p.Gly542Val	157.0	0.0		185.0	20.0	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.853704	0.51270	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.93366	-3.21	5.66	5.66	0.87406	.	0.112949	0.64402	D	0.000011	D	0.84083	0.5394	N	0.03209	-0.39	0.53005	D	0.999965	B	0.22800	0.075	B	0.26864	0.074	T	0.80725	-0.1254	10	0.87932	D	0	.	10.3124	0.43716	0.0718:0.2067:0.7215:0.0	.	542	P08123	CO1A2_HUMAN	V	542;543	ENSP00000297268:G542V	ENSP00000297268:G542V	G	+	2	0	COL1A2	93881155	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	2.969000	0.49232	2.840000	0.97914	0.655000	0.94253	GGA	.		0.443	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
COL6A3	1293	ucsc.edu;bcgsc.ca	37	2	238285641	238285641	+	Silent	SNP	G	G	A	rs567151556		TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr2:238285641G>A	ENST00000295550.4	-	7	3296	c.2844C>T	c.(2842-2844)gtC>gtT	p.V948V	COL6A3_ENST00000472056.1_Silent_p.V341V|COL6A3_ENST00000409809.1_Silent_p.V742V|COL6A3_ENST00000392003.2_Silent_p.V541V|COL6A3_ENST00000347401.3_Silent_p.V747V|COL6A3_ENST00000353578.4_Silent_p.V742V|COL6A3_ENST00000392004.3_Silent_p.V742V|COL6A3_ENST00000346358.4_Silent_p.V748V	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	948	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		ACCTTCCTGCGACCAGCAGCA	0.562																																					p.V948V		.											.	COL6A3	526	0			c.C2844T						.						144.0	113.0	124.0					2																	238285641		2203	4300	6503	SO:0001819	synonymous_variant	1293	exon7			TCCTGCGACCAGC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.2844C>T	2.37:g.238285641G>A		141.0	2.0		226.0	68.0	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1																																																																																			.		0.562	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
DNAJC22	79962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49743118	49743118	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr12:49743118A>G	ENST00000549441.2	+	3	1667	c.463A>G	c.(463-465)Att>Gtt	p.I155V	DNAJC22_ENST00000395069.3_Missense_Mutation_p.I155V			Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22	155						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(1)|ovary(1)|pancreas(1)	10						CATACTGCCCATTAGCGTGGC	0.562																																					p.I155V		.											.	DNAJC22	159	0			c.A463G						.						76.0	74.0	75.0					12																	49743118		2203	4300	6503	SO:0001583	missense	79962	exon2			CTGCCCATTAGCG	AK055747	CCDS8785.1	12q13.12	2011-09-02		2008-07-08	ENSG00000178401	ENSG00000178401		"""Heat shock proteins / DNAJ (HSP40)"""	25802	protein-coding gene	gene with protein product	"""wurst homolog (Drosophila)"""					17558392	Standard	NM_024902		Approved	wus, FLJ13236	uc001rua.3	Q8N4W6		ENST00000549441.2:c.463A>G	12.37:g.49743118A>G	ENSP00000446830:p.Ile155Val	54.0	0.0		86.0	18.0	NM_024902	B3KP54	Missense_Mutation	SNP	ENST00000549441.2	37	CCDS8785.1	.	.	.	.	.	.	.	.	.	.	A	13.46	2.243418	0.39697	.	.	ENSG00000178401	ENST00000549441;ENST00000395069	T;T	0.46063	0.88;0.88	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.40670	0.1126	M	0.64997	1.995	0.50813	D	0.999898	P	0.39748	0.686	B	0.35607	0.206	T	0.46247	-0.9205	10	0.59425	D	0.04	-11.3242	13.7297	0.62781	1.0:0.0:0.0:0.0	.	155	Q8N4W6	DJC22_HUMAN	V	155	ENSP00000446830:I155V;ENSP00000378508:I155V	ENSP00000378508:I155V	I	+	1	0	DNAJC22	48029385	1.000000	0.71417	1.000000	0.80357	0.190000	0.23558	4.345000	0.59360	1.939000	0.56221	0.454000	0.30748	ATT	.		0.562	DNAJC22-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404302.2	NM_024902	
DUOX2	50506	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	45386375	45386375	+	Silent	SNP	G	G	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr15:45386375G>A	ENST00000603300.1	-	34	4822	c.4620C>T	c.(4618-4620)caC>caT	p.H1540H	DUOX2_ENST00000389039.6_Silent_p.H1540H	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	1540					adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		GGTGCATGAAGTGGGCTCGGT	0.577																																					p.H1540H		.											.	DUOX2	95	0			c.C4620T						.						149.0	127.0	134.0					15																	45386375		2198	4298	6496	SO:0001819	synonymous_variant	50506	exon34			CATGAAGTGGGCT	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.4620C>T	15.37:g.45386375G>A		126.0	0.0		171.0	50.0	NM_014080	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Silent	SNP	ENST00000603300.1	37	CCDS10117.1																																																																																			.		0.577	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	
DYNC1H1	1778	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	102489191	102489191	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr14:102489191A>G	ENST00000360184.4	+	43	8775	c.8611A>G	c.(8611-8613)Atc>Gtc	p.I2871V		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2871					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GAGCCGACCCATCTTGTACAG	0.468																																					p.I2871V		.											.	DYNC1H1	98	0			c.A8611G						.						227.0	182.0	197.0					14																	102489191		2203	4300	6503	SO:0001583	missense	1778	exon43			CGACCCATCTTGT	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.8611A>G	14.37:g.102489191A>G	ENSP00000348965:p.Ile2871Val	128.0	0.0		125.0	22.0	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	A	18.15	3.559353	0.65538	.	.	ENSG00000197102	ENST00000360184	T	0.29917	1.55	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.41511	0.1162	M	0.78344	2.41	0.80722	D	1	P	0.45902	0.868	P	0.45167	0.472	T	0.38972	-0.9636	10	0.34782	T	0.22	.	15.0033	0.71492	1.0:0.0:0.0:0.0	.	2871	Q14204	DYHC1_HUMAN	V	2871	ENSP00000348965:I2871V	ENSP00000348965:I2871V	I	+	1	0	DYNC1H1	101558944	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	9.209000	0.95087	1.949000	0.56562	0.383000	0.25322	ATC	.		0.468	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
ELOVL7	79993	hgsc.bcm.edu;mdanderson.org	37	5	60050627	60050627	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr5:60050627G>A	ENST00000508821.1	-	9	984	c.670C>T	c.(670-672)Cag>Tag	p.Q224*	ELOVL7_ENST00000438340.1_Nonsense_Mutation_p.Q224*|ELOVL7_ENST00000505959.1_Nonsense_Mutation_p.Q211*|ELOVL7_ENST00000425382.1_Nonsense_Mutation_p.Q224*	NM_024930.2	NP_079206.2	A1L3X0	ELOV7_HUMAN	ELOVL fatty acid elongase 7	224					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	9		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				AAAAAGAACTGGCTTATGTGG	0.353																																					p.Q224X		.											.	ELOVL7	90	0			c.C670T						.						97.0	89.0	92.0					5																	60050627		2203	4300	6503	SO:0001587	stop_gained	79993	exon8			AGAACTGGCTTAT	AK027216	CCDS34164.1	5q12	2011-05-25	2011-05-25			ENSG00000164181			26292	protein-coding gene	gene with protein product		614451	"""ELOVL family member 7, elongation of long chain fatty acids (yeast)"""			19826053	Standard	NM_024930		Approved	FLJ23563	uc010iwk.3	A1L3X0		ENST00000508821.1:c.670C>T	5.37:g.60050627G>A	ENSP00000424123:p.Gln224*	82.0	0.0		112.0	33.0	NM_001104558	Q589T3|Q9H5D0|Q9NT66	Nonsense_Mutation	SNP	ENST00000508821.1	37	CCDS34164.1	.	.	.	.	.	.	.	.	.	.	G	40	8.445576	0.98815	.	.	ENSG00000164181	ENST00000508821;ENST00000438340;ENST00000425382;ENST00000505959	.	.	.	5.89	5.89	0.94794	.	0.166857	0.53938	D	0.000041	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-2.6046	20.2469	0.98398	0.0:0.0:1.0:0.0	.	.	.	.	X	224;224;224;211	.	ENSP00000402634:Q224X	Q	-	1	0	ELOVL7	60086384	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.428000	0.97476	2.781000	0.95711	0.555000	0.69702	CAG	.		0.353	ELOVL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368195.1		
EML6	400954	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	55040425	55040425	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr2:55040425C>T	ENST00000356458.6	+	2	774	c.254C>T	c.(253-255)cCa>cTa	p.P85L		NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	85						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						GGGAAGGAGCCATATATATGC	0.438																																					p.P85L		.											.	.	.	0			c.C254T						.						159.0	124.0	135.0					2																	55040425		692	1591	2283	SO:0001583	missense	400954	exon2			AGGAGCCATATAT		CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.254C>T	2.37:g.55040425C>T	ENSP00000348842:p.Pro85Leu	99.0	0.0		127.0	39.0	NM_001039753	A8MUB5|B6ZDG7	Missense_Mutation	SNP	ENST00000356458.6	37	CCDS46286.1	.	.	.	.	.	.	.	.	.	.	C	33	5.274834	0.95459	.	.	ENSG00000214595	ENST00000356458	T	0.41065	1.01	5.84	5.84	0.93424	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.27567	U	0.018788	T	0.74160	0.3680	M	0.90922	3.16	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79179	-0.1910	10	0.87932	D	0	.	20.1434	0.98067	0.0:1.0:0.0:0.0	.	85	Q6ZMW3	EMAL6_HUMAN	L	85	ENSP00000348842:P85L	ENSP00000348842:P85L	P	+	2	0	EML6	54893929	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.400000	0.79949	2.760000	0.94817	0.591000	0.81541	CCA	.		0.438	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324997.3	XM_001725002	
FER1L6	654463	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	125103757	125103757	+	Silent	SNP	C	C	T			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr8:125103757C>T	ENST00000522917.1	+	34	4691	c.4485C>T	c.(4483-4485)caC>caT	p.H1495H	FER1L6_ENST00000399018.1_Silent_p.H1495H|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1495						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CCTACTTTCACCCTGGGAAAA	0.453																																					p.H1495H		.											.	FER1L6	100	0			c.C4485T						.						122.0	113.0	116.0					8																	125103757		1879	4104	5983	SO:0001819	synonymous_variant	654463	exon34			CTTTCACCCTGGG	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.4485C>T	8.37:g.125103757C>T		99.0	0.0		208.0	122.0	NM_001039112		Silent	SNP	ENST00000522917.1	37	CCDS43767.1																																																																																			.		0.453	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
FGF13	2258	ucsc.edu;bcgsc.ca	37	X	137717737	137717737	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chrX:137717737C>T	ENST00000315930.6	-	4	1143	c.482G>A	c.(481-483)cGt>cAt	p.R161H	FGF13_ENST00000370603.3_Missense_Mutation_p.R171H|FGF13_ENST00000441825.2_Missense_Mutation_p.R142H|FGF13_ENST00000305414.4_Missense_Mutation_p.R108H|FGF13_ENST00000541469.1_Missense_Mutation_p.R115H	NM_004114.3	NP_004105.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13	161	Mediates interaction with sodium channels.				cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					CTGCTGCTGACGGTATATCAT	0.398																																					p.R171H		.											.	FGF13	626	0			c.G512A						.						153.0	128.0	136.0					X																	137717737		2203	4300	6503	SO:0001583	missense	2258	exon6			TGCTGACGGTATA	BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000315930.6:c.482G>A	X.37:g.137717737C>T	ENSP00000322390:p.Arg161His	118.0	1.0		168.0	60.0	NM_001139500	B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	Missense_Mutation	SNP	ENST00000315930.6	37	CCDS14665.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.995021	0.93167	.	.	ENSG00000129682	ENST00000315930;ENST00000305414;ENST00000441825;ENST00000370603;ENST00000541469;ENST00000436198;ENST00000455663	T;T;T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31;-0.31;-0.31	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.82495	0.5049	M	0.75150	2.29	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79108	0.977;0.987;0.96;0.992	D	0.83631	0.0145	10	0.87932	D	0	.	18.5888	0.91200	0.0:1.0:0.0:0.0	.	115;171;108;161	B7Z8N0;B7Z4M7;Q92913-2;Q92913	.;.;.;FGF13_HUMAN	H	161;108;142;171;115;171;177	ENSP00000322390:R161H;ENSP00000303391:R108H;ENSP00000409276:R142H;ENSP00000359635:R171H;ENSP00000437903:R115H;ENSP00000396198:R171H;ENSP00000406916:R177H	ENSP00000303391:R108H	R	-	2	0	FGF13	137545403	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.618000	0.88619	0.600000	0.82982	CGT	.		0.398	FGF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058534.2	NM_004114	
GALR1	2587	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	18	74962810	74962810	+	Silent	SNP	G	G	A	rs5375	byFrequency	TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr18:74962810G>A	ENST00000299727.3	+	1	306	c.306G>A	c.(304-306)gtG>gtA	p.V102V		NM_001480.3	NP_001471.2	P47211	GALR1_HUMAN	galanin receptor 1	102					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|digestion (GO:0007586)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		CCACCTGGGTGCTGGGCGCCT	0.612																																					p.V102V		.											.	GALR1	522	0			c.G306A						.						129.0	114.0	119.0					18																	74962810		2203	4300	6503	SO:0001819	synonymous_variant	2587	exon1			CTGGGTGCTGGGC	U90658	CCDS12012.1	18q23	2012-08-08			ENSG00000166573	ENSG00000166573		"""GPCR / Class A : Galanin receptors"""	4132	protein-coding gene	gene with protein product		600377		GALNR1, GALNR		7524088	Standard	NM_001480		Approved		uc002lms.4	P47211	OTTHUMG00000132875	ENST00000299727.3:c.306G>A	18.37:g.74962810G>A		127.0	0.0		182.0	55.0	NM_001480	Q4VBL7	Silent	SNP	ENST00000299727.3	37	CCDS12012.1																																																																																			G|0.936;T|0.064		0.612	GALR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256362.1		
GHITM	27069	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	85904722	85904722	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr10:85904722A>C	ENST00000372134.3	+	5	626	c.433A>C	c.(433-435)Atc>Ctc	p.I145L		NM_014394.2	NP_055209.2	Q9H3K2	GHITM_HUMAN	growth hormone inducible transmembrane protein	145					apoptotic process (GO:0006915)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(2)	10						TGCCATAGCAATCAGCAGAAC	0.388																																					p.I145L		.											.	GHITM	90	0			c.A433C						.						181.0	167.0	172.0					10																	85904722		1897	4115	6012	SO:0001583	missense	27069	exon5			ATAGCAATCAGCA	AB009685	CCDS41542.1	10q23.1	2008-02-01			ENSG00000165678	ENSG00000165678			17281	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 5"""					8619474, 9110174	Standard	NM_014394		Approved	HSPC282, PTD010, DERP2, My021, TMBIM5	uc001kcs.1	Q9H3K2	OTTHUMG00000018637	ENST00000372134.3:c.433A>C	10.37:g.85904722A>C	ENSP00000361207:p.Ile145Leu	175.0	0.0		182.0	67.0	NM_014394	A8K9Z9|D3DWE0|O95894|Q5VT95|Q9H0P2	Missense_Mutation	SNP	ENST00000372134.3	37	CCDS41542.1	.	.	.	.	.	.	.	.	.	.	A	11.31	1.601023	0.28534	.	.	ENSG00000165678	ENST00000372134;ENST00000538477;ENST00000436406;ENST00000339736	T	0.40476	1.03	6.17	-4.32	0.03688	.	0.565075	0.19863	N	0.104385	T	0.14570	0.0352	N	0.10945	0.07	0.18873	N	0.999982	B;B	0.12013	0.005;0.0	B;B	0.15484	0.013;0.001	T	0.31024	-0.9958	10	0.07325	T	0.83	-31.854	5.9594	0.19291	0.3654:0.0:0.4463:0.1883	.	76;145	B4DNL0;Q9H3K2	.;GHITM_HUMAN	L	145;132;145;125	ENSP00000361207:I145L	ENSP00000342214:I125L	I	+	1	0	GHITM	85894702	0.998000	0.40836	0.017000	0.16124	0.390000	0.30446	1.230000	0.32612	-0.828000	0.04273	-0.290000	0.09829	ATC	.		0.388	GHITM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049125.1	NM_014394	
GOT1L1	137362	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	37791908	37791908	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr8:37791908T>C	ENST00000307599.4	-	9	1268	c.1169A>G	c.(1168-1170)tAc>tGc	p.Y390C		NM_152413.2	NP_689626.2	Q8NHS2	AATC2_HUMAN	glutamic-oxaloacetic transaminase 1-like 1	390					biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)	cytoplasm (GO:0005737)	pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(3)|lung(8)|ovary(1)|prostate(1)	14	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)			CTCAGTGATGTAATTTATGTT	0.423																																					p.Y390C		.											.	GOT1L1	23	0			c.A1169G						.						251.0	241.0	244.0					8																	37791908		1910	4139	6049	SO:0001583	missense	137362	exon9			GTGATGTAATTTA	BC029504	CCDS47839.1	8p12	2005-09-22			ENSG00000169154	ENSG00000169154			28487	protein-coding gene	gene with protein product						12477932	Standard	NM_152413		Approved	MGC33309	uc011lbj.1	Q8NHS2	OTTHUMG00000164027	ENST00000307599.4:c.1169A>G	8.37:g.37791908T>C	ENSP00000303077:p.Tyr390Cys	331.0	0.0		305.0	64.0	NM_152413	A8MWL4	Missense_Mutation	SNP	ENST00000307599.4	37	CCDS47839.1	.	.	.	.	.	.	.	.	.	.	T	14.25	2.480254	0.44044	.	.	ENSG00000169154	ENST00000307599	T	0.26660	1.72	5.37	5.37	0.77165	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.098157	0.42053	D	0.000761	T	0.59032	0.2164	M	0.92169	3.28	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.69224	-0.5201	10	0.87932	D	0	-21.863	13.0005	0.58672	0.0:0.0:0.0:1.0	.	390	Q8NHS2	AATC2_HUMAN	C	390	ENSP00000303077:Y390C	ENSP00000303077:Y390C	Y	-	2	0	GOT1L1	37911066	1.000000	0.71417	1.000000	0.80357	0.101000	0.19017	5.628000	0.67791	2.266000	0.75297	0.528000	0.53228	TAC	.		0.423	GOT1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376823.1	NM_152413	
HAVCR1	26762	hgsc.bcm.edu;bcgsc.ca	37	5	156479571	156479571	+	Missense_Mutation	SNP	C	C	T	rs6149307|rs386693994|rs183130208|rs141023871	byFrequency	TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr5:156479571C>T	ENST00000339252.3	-	3	1006	c.474G>A	c.(472-474)atG>atA	p.M158I	HAVCR1_ENST00000522693.1_Missense_Mutation_p.M158I|HAVCR1_ENST00000425854.1_Missense_Mutation_p.M158I|HAVCR1_ENST00000523175.1_Missense_Mutation_p.M158I|HAVCR1_ENST00000544197.1_Missense_Mutation_p.M158I	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	11 X 6 AA approximate tandem repeats of V-P-T-T-T-T].|Thr-rich.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)			endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAACAGTCGTCATTGGAACAG	0.488																																					p.M158I		.											.	HAVCR1	92	0			c.G474A						.						413.0	302.0	340.0					5																	156479571		2079	3991	6070	SO:0001583	missense	26762	exon4			AGTCGTCATTGGA	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.474G>A	5.37:g.156479571C>T	ENSP00000344844:p.Met158Ile	367.0	0.0		447.0	33.0	NM_001099414	O43656	Missense_Mutation	SNP	ENST00000339252.3	37	CCDS43392.1	.	.	.	.	.	.	.	.	.	.	C	2.575	-0.298775	0.05532	.	.	ENSG00000113249	ENST00000522693;ENST00000523175;ENST00000339252;ENST00000425854;ENST00000544197;ENST00000518745	T;T;T;T;T;T	0.13901	2.55;2.6;2.6;2.55;2.6;2.57	1.56	-3.12	0.05282	.	.	.	.	.	T	0.05181	0.0138	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.31392	-0.9945	7	0.62326	D	0.03	.	0.1239	0.00067	0.2901:0.1916:0.1631:0.3551	.	.	.	.	I	158	ENSP00000428524:M158I;ENSP00000427898:M158I;ENSP00000344844:M158I;ENSP00000403333:M158I;ENSP00000440258:M158I;ENSP00000428422:M158I	ENSP00000344844:M158I	M	-	3	0	HAVCR1	156412149	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	0.878000	0.28126	-1.479000	0.01867	-0.507000	0.04495	ATG	.		0.488	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1		
HECTD1	25831	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	14	31626433	31626433	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr14:31626433C>T	ENST00000399332.1	-	11	2187	c.1699G>A	c.(1699-1701)Gat>Aat	p.D567N	HECTD1_ENST00000553700.1_Missense_Mutation_p.D567N	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	567					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TGACCAACATCAGAATCACAA	0.338																																					p.D567N		.											.	HECTD1	570	0			c.G1699A						.						167.0	159.0	162.0					14																	31626433		1852	4095	5947	SO:0001583	missense	25831	exon11			CAACATCAGAATC	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.1699G>A	14.37:g.31626433C>T	ENSP00000382269:p.Asp567Asn	194.0	0.0		188.0	70.0	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	C	18.24	3.580644	0.65992	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957;ENST00000556224	T;T;T;T	0.64991	-0.13;-0.13;1.44;-0.13	6.17	6.17	0.99709	Armadillo-like helical (1);Armadillo-type fold (1);	0.089401	0.85682	N	0.000000	T	0.54271	0.1848	N	0.22421	0.69	0.80722	D	1	B;B	0.27498	0.008;0.18	B;B	0.27796	0.004;0.083	T	0.50320	-0.8842	10	0.54805	T	0.06	-19.9409	20.8794	0.99867	0.0:1.0:0.0:0.0	.	567;567	D3DS86;Q9ULT8	.;HECD1_HUMAN	N	567;567;567;41;567	ENSP00000450697:D567N;ENSP00000382269:D567N;ENSP00000451860:D41N;ENSP00000452015:D567N	ENSP00000261312:D567N	D	-	1	0	HECTD1	30696184	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.070000	0.71220	2.941000	0.99782	0.655000	0.94253	GAT	.		0.338	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
HTT	3064	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	3241656	3241656	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr4:3241656G>A	ENST00000355072.5	+	67	9444	c.9299G>A	c.(9298-9300)aGa>aAa	p.R3100K		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	3100					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GACTTCTACAGACACCAGATA	0.572																																					p.R3100K		.											.	HTT	281	0			c.G9299A						.						39.0	43.0	41.0					4																	3241656		2170	4250	6420	SO:0001583	missense	3064	exon67			TCTACAGACACCA	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.9299G>A	4.37:g.3241656G>A	ENSP00000347184:p.Arg3100Lys	139.0	0.0		176.0	26.0	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	G	16.94	3.260136	0.59321	.	.	ENSG00000197386	ENST00000355072	T	0.04758	3.56	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.03695	0.0105	N	0.17723	0.515	0.45183	D	0.998196	B	0.13145	0.007	B	0.12837	0.008	T	0.50499	-0.8821	10	0.22109	T	0.4	.	10.8622	0.46833	0.0869:0.0:0.9131:0.0	.	3100	P42858	HD_HUMAN	K	3100	ENSP00000347184:R3100K	ENSP00000347184:R3100K	R	+	2	0	HTT	3211454	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.819000	0.75262	2.284000	0.76573	0.655000	0.94253	AGA	.		0.572	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
HYOU1	10525	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118926262	118926262	+	Silent	SNP	C	C	T	rs376675681		TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr11:118926262C>T	ENST00000404233.3	-	4	331	c.207G>A	c.(205-207)ccG>ccA	p.P69P	HYOU1_ENST00000543287.1_5'UTR|HYOU1_ENST00000525859.1_Silent_p.P69P|HYOU1_ENST00000529972.1_Silent_p.P69P	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	69					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		TCACGATCACCGGTGTTTTCC	0.517																																					p.P69P		.											.	HYOU1	90	0			c.G207A						.	C	,	1,4399	2.1+/-5.4	0,1,2199	99.0	99.0	99.0		207,207	-7.8	0.9	11		99	0,8590		0,0,4295	no	coding-synonymous,coding-synonymous	HYOU1	NM_001130991.1,NM_006389.3	,	0,1,6494	TT,TC,CC		0.0,0.0227,0.0077	,	69/1000,69/1000	118926262	1,12989	2200	4295	6495	SO:0001819	synonymous_variant	10525	exon4			GATCACCGGTGTT	U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.207G>A	11.37:g.118926262C>T		107.0	0.0		152.0	20.0	NM_006389	A8C1Z0|B7Z909|Q2I204|Q53H25	Silent	SNP	ENST00000404233.3	37	CCDS8408.1																																																																																			.		0.517	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389353.1	NM_006389	
IKZF1	10320	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	50467992	50467992	+	Silent	SNP	C	C	T			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr7:50467992C>T	ENST00000331340.3	+	8	1382	c.1227C>T	c.(1225-1227)agC>agT	p.S409S	IKZF1_ENST00000438033.1_Silent_p.S322S|IKZF1_ENST00000440768.2_3'UTR|IKZF1_ENST00000357364.4_Silent_p.S322S|IKZF1_ENST00000346667.4_Silent_p.S179S|IKZF1_ENST00000343574.5_Silent_p.S322S|IKZF1_ENST00000359197.5_Silent_p.S367S|IKZF1_ENST00000439701.1_Silent_p.S367S|IKZF1_ENST00000349824.4_Silent_p.S266S	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	409					B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(28)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				AGCAGCGCAGCGGTCTCATCT	0.677			"""D,T"""	BCL6	"""ALL, DLBCL"""																																p.S409S		.		"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	.	IKZF1	1242	28	Unknown(28)	haematopoietic_and_lymphoid_tissue(28)	c.C1227T						.						31.0	39.0	36.0					7																	50467992		2178	4258	6436	SO:0001819	synonymous_variant	10320	exon8			GCGCAGCGGTCTC	U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.1227C>T	7.37:g.50467992C>T		71.0	0.0		117.0	20.0	NM_006060	A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Silent	SNP	ENST00000331340.3	37																																																																																				.		0.677	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000342242.1	NM_006060	
KANK4	163782	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	62739460	62739460	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr1:62739460C>G	ENST00000371153.4	-	3	1694	c.1316G>C	c.(1315-1317)aGc>aCc	p.S439T	KANK4_ENST00000354381.3_Intron|KANK4_ENST00000371150.1_5'Flank	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	439						cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						AGACTCCATGCTGCCTAGAAG	0.557																																					p.S439T		.											.	KANK4	74	0			c.G1316C						.						191.0	183.0	186.0					1																	62739460		2203	4300	6503	SO:0001583	missense	163782	exon3			TCCATGCTGCCTA	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.1316G>C	1.37:g.62739460C>G	ENSP00000360195:p.Ser439Thr	121.0	0.0		199.0	47.0	NM_181712	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	ENST00000371153.4	37	CCDS620.1	.	.	.	.	.	.	.	.	.	.	C	4.425	0.078600	0.08533	.	.	ENSG00000132854	ENST00000371153	T	0.46063	0.88	5.81	-2.06	0.07298	.	0.996520	0.08124	N	0.994228	T	0.21881	0.0527	N	0.15975	0.35	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.29181	-1.0020	10	0.10902	T	0.67	-0.3381	9.8642	0.41134	0.1688:0.5557:0.2754:0.0	.	439	Q5T7N3	KANK4_HUMAN	T	439	ENSP00000360195:S439T	ENSP00000360195:S439T	S	-	2	0	KANK4	62512048	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.114000	0.15520	-0.006000	0.14370	-0.262000	0.10625	AGC	.		0.557	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712	
KCNAB1	7881	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	155838473	155838473	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr3:155838473delG	ENST00000490337.1	+	1	137	c.73delG	c.(73-75)gggfs	p.G25fs	KCNAB1_ENST00000389636.5_Frame_Shift_Del_p.G25fs	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	25					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GAGACAGTCTGGGTTTTCTGT	0.542																																					p.G25fs		.											.	KCNAB1	94	0			c.73delG						.						98.0	108.0	105.0					3																	155838473		2203	4300	6503	SO:0001589	frameshift_variant	7881	exon1			CAGTCTGGGTTTT	U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.73delG	3.37:g.155838473delG	ENSP00000419952:p.Gly25fs	110.0	0.0		129.0	26.0	NM_172160	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Frame_Shift_Del	DEL	ENST00000490337.1	37	CCDS3174.1																																																																																			.		0.542	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1	NM_003471	
KIAA1731	85459	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	93432541	93432541	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr11:93432541T>A	ENST00000325212.6	+	15	4625	c.4463T>A	c.(4462-4464)tTt>tAt	p.F1488Y	KIAA1731_ENST00000344196.4_5'UTR|KIAA1731_ENST00000411936.1_Missense_Mutation_p.F1488Y|KIAA1731_ENST00000531700.1_Intron			Q9C0D2	K1731_HUMAN	KIAA1731	1488						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CCATGTAAATTTGAGGAAAAG	0.383																																					p.F1488Y		.											.	KIAA1731	22	0			c.T4463A						.						87.0	69.0	74.0					11																	93432541		692	1591	2283	SO:0001583	missense	85459	exon15			GTAAATTTGAGGA	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.4463T>A	11.37:g.93432541T>A	ENSP00000316681:p.Phe1488Tyr	106.0	0.0		149.0	43.0	NM_033395	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	ENST00000325212.6	37	CCDS44708.1	.	.	.	.	.	.	.	.	.	.	T	14.28	2.488399	0.44249	.	.	ENSG00000166004	ENST00000325212;ENST00000411936	T;T	0.21932	1.98;1.98	4.93	-0.153	0.13403	.	0.789539	0.11146	N	0.594641	T	0.15955	0.0384	L	0.48642	1.525	0.38903	D	0.957363	B	0.11235	0.004	B	0.11329	0.006	T	0.13415	-1.0510	10	0.66056	D	0.02	-3.3414	2.7885	0.05380	0.3597:0.188:0.0:0.4523	.	1488	Q9C0D2	K1731_HUMAN	Y	1488	ENSP00000316681:F1488Y;ENSP00000406505:F1488Y	ENSP00000316681:F1488Y	F	+	2	0	KIAA1731	93072189	0.173000	0.23056	0.195000	0.23364	0.592000	0.36648	-0.118000	0.10692	-0.189000	0.10482	0.533000	0.62120	TTT	.		0.383	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394640.1	NM_033395	
LIPH	200879	ucsc.edu;bcgsc.ca	37	3	185252690	185252690	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr3:185252690C>T	ENST00000296252.4	-	2	421	c.280G>A	c.(280-282)Ggt>Agt	p.G94S	LIPH_ENST00000424591.2_Missense_Mutation_p.G94S	NM_139248.2	NP_640341.1	Q8WWY8	LIPH_HUMAN	lipase, member H	94					lipid catabolic process (GO:0016042)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(2)	20	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			GAGAGCAAACCCTTTACTAAG	0.428																																					p.G94S		.											.	LIPH	92	0			c.G280A						.						133.0	126.0	128.0					3																	185252690		2203	4300	6503	SO:0001583	missense	200879	exon2			GCAAACCCTTTAC	AY093498	CCDS3272.1	3q27	2012-07-31			ENSG00000163898	ENSG00000163898			18483	protein-coding gene	gene with protein product		607365				12213196, 12063250	Standard	XM_006713529		Approved	mPA-PLA1, PLA1B, mPA-PLA1alpha, LPDLR	uc003fpm.3	Q8WWY8	OTTHUMG00000156657	ENST00000296252.4:c.280G>A	3.37:g.185252690C>T	ENSP00000296252:p.Gly94Ser	164.0	1.0		208.0	61.0	NM_139248	A2IBA7|Q8TEC7	Missense_Mutation	SNP	ENST00000296252.4	37	CCDS3272.1	.	.	.	.	.	.	.	.	.	.	C	6.321	0.427248	0.11987	.	.	ENSG00000163898	ENST00000296252;ENST00000424591	D;D	0.90620	-2.57;-2.7	5.79	1.84	0.25277	Lipase, N-terminal (1);	0.992321	0.08212	N	0.980495	T	0.77315	0.4112	N	0.11560	0.145	0.09310	N	1	B;B	0.20261	0.043;0.003	B;B	0.19666	0.026;0.014	T	0.63028	-0.6728	10	0.07644	T	0.81	-3.0878	5.0103	0.14310	0.0:0.4534:0.2195:0.3272	.	94;94	A2IBA6;Q8WWY8	.;LIPH_HUMAN	S	94	ENSP00000296252:G94S;ENSP00000396384:G94S	ENSP00000296252:G94S	G	-	1	0	LIPH	186735384	0.000000	0.05858	0.001000	0.08648	0.768000	0.43524	-0.002000	0.12924	0.374000	0.24650	0.655000	0.94253	GGT	.		0.428	LIPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345153.1		
LTBP2	4053	ucsc.edu;bcgsc.ca;mdanderson.org	37	14	75018978	75018978	+	Silent	SNP	C	C	T			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr14:75018978C>T	ENST00000261978.4	-	6	1697	c.1311G>A	c.(1309-1311)gaG>gaA	p.E437E	LTBP2_ENST00000556690.1_Silent_p.E437E|LTBP2_ENST00000557425.1_Intron|CTD-2207P18.1_ENST00000554552.1_lincRNA	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	437					protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TCCCTGGAGGCTCCCTGTCCG	0.682																																					p.E437E		.											.	LTBP2	92	0			c.G1311A						.						30.0	33.0	32.0					14																	75018978		2199	4293	6492	SO:0001819	synonymous_variant	4053	exon6			TGGAGGCTCCCTG		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.1311G>A	14.37:g.75018978C>T		102.0	1.0		117.0	24.0	NM_000428	Q99907|Q9NS51	Silent	SNP	ENST00000261978.4	37	CCDS9831.1																																																																																			.		0.682	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
MAP1B	4131	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	71492183	71492183	+	Missense_Mutation	SNP	G	G	A	rs144088322		TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr5:71492183G>A	ENST00000296755.7	+	5	3299	c.3001G>A	c.(3001-3003)Gaa>Aaa	p.E1001K		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1001					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TGACCGAGCCGAAGAAGACAT	0.542																																					p.E1001K	Melanoma(17;367 822 11631 31730 47712)	.											.	MAP1B	155	0			c.G3001A						.	G	LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	92.0	91.0	91.0		3001	6.1	1.0	5	dbSNP_134	91	0,8600		0,0,4300	no	missense	MAP1B	NM_005909.3	56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1001/2469	71492183	1,13005	2203	4300	6503	SO:0001583	missense	4131	exon5			CGAGCCGAAGAAG	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.3001G>A	5.37:g.71492183G>A	ENSP00000296755:p.Glu1001Lys	128.0	0.0		127.0	43.0	NM_005909	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.872172	0.72180	2.27E-4	0.0	ENSG00000131711	ENST00000296755	T	0.03801	3.8	6.08	6.08	0.98989	.	0.000000	0.64402	D	0.000004	T	0.08935	0.0221	N	0.08118	0	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	T	0.54556	-0.8276	10	0.10111	T	0.7	-23.6485	20.2738	0.98482	0.0:0.0:1.0:0.0	.	875;1001	A2BDK6;P46821	.;MAP1B_HUMAN	K	1001	ENSP00000296755:E1001K	ENSP00000296755:E1001K	E	+	1	0	MAP1B	71527939	1.000000	0.71417	0.957000	0.39632	0.861000	0.49209	5.156000	0.64905	2.894000	0.99253	0.655000	0.94253	GAA	G|1.000;A|0.000		0.542	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
MBD1	4152	ucsc.edu;bcgsc.ca;mdanderson.org	37	18	47796066	47796066	+	3'UTR	SNP	G	G	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr18:47796066G>A	ENST00000591416.1	-	0	4054				MBD1_ENST00000269468.5_3'UTR|MBD1_ENST00000269471.5_Missense_Mutation_p.S565L|MBD1_ENST00000347968.3_3'UTR|MBD1_ENST00000436910.1_3'UTR|MBD1_ENST00000590208.1_Missense_Mutation_p.S634L|MBD1_ENST00000585672.1_Intron|MBD1_ENST00000588937.1_Missense_Mutation_p.S565L|MBD1_ENST00000382948.5_Intron|MBD1_ENST00000587605.1_Missense_Mutation_p.H530Y|MBD1_ENST00000339998.6_3'UTR|MBD1_ENST00000349085.2_3'UTR|MBD1_ENST00000353909.3_3'UTR			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1						negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						tggaggtggtgagagactgac	0.547																																					p.S634L		.											.	MBD1	228	0			c.C1901T						.						133.0	91.0	105.0					18																	47796066		2203	4300	6503	SO:0001624	3_prime_UTR_variant	4152	exon16			GGTGGTGAGAGAC	Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.*1805C>T	18.37:g.47796066G>A		171.0	1.0		207.0	52.0	NM_001204136	A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Missense_Mutation	SNP	ENST00000591416.1	37	CCDS11943.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.666891	0.47677	.	.	ENSG00000141644	ENST00000269471	D	0.96459	-4.02	4.29	3.42	0.39159	.	.	.	.	.	D	0.87947	0.6306	.	.	.	0.80722	D	1	B	0.11235	0.004	B	0.08055	0.003	T	0.80446	-0.1379	8	0.02654	T	1	.	8.04	0.30515	0.1092:0.0:0.8908:0.0	.	565	Q9UIS9-2	.	L	565	ENSP00000269471:S565L	ENSP00000269471:S565L	S	-	2	0	MBD1	46050064	0.885000	0.30320	1.000000	0.80357	0.999000	0.98932	0.590000	0.23954	1.403000	0.46800	0.650000	0.86243	TCA	.		0.547	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255926.3	NM_015846	
MICA	100507436	hgsc.bcm.edu;bcgsc.ca	37	6	31380100	31380100	+	Splice_Site	SNP	A	A	C	rs41558418		TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr6:31380100A>C	ENST00000449934.2	+	5	946		c.e5-1		HCP5_ENST00000414046.2_RNA	NM_001177519.1	NP_001170990.1			MHC class I polypeptide-related sequence A											breast(1)|endometrium(3)|kidney(1)	5		Ovarian(999;0.0253)				CCTTTTTTTCAGGGAAAGTGC	0.502																																					.		.											.	.	.	0			c.893-2A>C						.						241.0	215.0	223.0					6																	31380100		692	1591	2283	SO:0001630	splice_region_variant	100507436	exon5			TTTTTCAGGGAAA	L14848	CCDS56412.1, CCDS75421.1	6p21.3	2013-01-11			ENSG00000204520	ENSG00000204520		"""Immunoglobulin superfamily / C1-set domain containing"""	7090	protein-coding gene	gene with protein product		600169				8022771	Standard	NM_000247		Approved	PERB11.1	uc003ntk.1	Q29983	OTTHUMG00000031073	ENST00000449934.2:c.893-1A>C	6.37:g.31380100A>C		137.0	0.0		218.0	13.0	NM_001177519		Splice_Site	SNP	ENST00000449934.2	37	CCDS56412.1	.	.	.	.	.	.	.	.	.	.	.	3.792	-0.043461	0.07452	.	.	ENSG00000204520	ENST00000376222;ENST00000364810;ENST00000399172;ENST00000449934;ENST00000421350	.	.	.	2.27	1.12	0.20585	.	.	.	.	.	.	.	.	.	.	.	0.20403	N	0.999906	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.3699	0.07217	0.7881:0.0:0.2119:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MICA	31488079	0.044000	0.20184	0.004000	0.12327	0.022000	0.10575	0.965000	0.29319	1.037000	0.40024	0.365000	0.22127	.	.		0.502	MICA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076101.7	NM_001177519	Intron
MSH2	4436	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	47639551	47639551	+	Splice_Site	SNP	A	A	T	rs587779169|rs267607929		TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr2:47639551A>T	ENST00000233146.2	+	4	868		c.e4-1		MSH2_ENST00000543555.1_Splice_Site|MSH2_ENST00000406134.1_Splice_Site	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2						ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CTTTCAAAATAGATAATTCAA	0.299			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												.		.	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	.	MSH2	2445	3	Whole gene deletion(2)|Unknown(1)	haematopoietic_and_lymphoid_tissue(3)	c.646-2A>T						.						32.0	34.0	34.0					2																	47639551		2200	4300	6500	SO:0001630	splice_region_variant	4436	exon4	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	CAAAATAGATAAT	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.646-1A>T	2.37:g.47639551A>T		211.0	0.0		293.0	82.0	NM_000251	B4E2Z2|O75488	Splice_Site	SNP	ENST00000233146.2	37	CCDS1834.1	.	.	.	.	.	.	.	.	.	.	A	10.91	1.483210	0.26598	.	.	ENSG00000095002	ENST00000233146;ENST00000543555;ENST00000406134;ENST00000419559;ENST00000432737;ENST00000453755;ENST00000448533;ENST00000394792;ENST00000413880	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0583	0.71933	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MSH2	47493055	1.000000	0.71417	0.932000	0.37286	0.041000	0.13682	8.975000	0.93437	2.037000	0.60232	0.456000	0.33151	.	.		0.299	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250805.3		Intron
MYH10	4628	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	8455401	8455401	+	Silent	SNP	A	A	G	rs200432425		TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr17:8455401A>G	ENST00000269243.4	-	8	990	c.852T>C	c.(850-852)ttT>ttC	p.F284F	MYH10_ENST00000379980.4_Silent_p.F300F|MYH10_ENST00000396239.1_Silent_p.F284F|MYH10_ENST00000360416.3_Silent_p.F294F	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	284	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						ACAACTGGTAAAAGATATGAA	0.303																																					p.F294F		.											.	MYH10	92	0			c.T882C						.						47.0	48.0	48.0					17																	8455401		2203	4300	6503	SO:0001819	synonymous_variant	4628	exon9			CTGGTAAAAGATA	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.852T>C	17.37:g.8455401A>G		124.0	0.0		91.0	7.0	NM_001256012	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Silent	SNP	ENST00000269243.4	37	CCDS11144.1																																																																																			A|0.999;G|0.001		0.303	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
NR3C1	2908	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	142680214	142680214	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr5:142680214A>C	ENST00000343796.2	-	5	2576	c.1583T>G	c.(1582-1584)cTc>cGc	p.L528R	NR3C1_ENST00000424646.2_Missense_Mutation_p.L502R|NR3C1_ENST00000504336.1_5'UTR|NR3C1_ENST00000394466.2_Missense_Mutation_p.L529R|NR3C1_ENST00000415690.2_Missense_Mutation_p.L528R|NR3C1_ENST00000504572.1_Missense_Mutation_p.L529R|NR3C1_ENST00000231509.3_Missense_Mutation_p.L529R|NR3C1_ENST00000503201.1_Missense_Mutation_p.L528R|NR3C1_ENST00000416954.2_Missense_Mutation_p.L131R|NR3C1_ENST00000394464.2_Missense_Mutation_p.L528R	NM_001018074.1|NM_001018075.1|NM_001018077.1	NP_001018084.1|NP_001018085.1|NP_001018087.1	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	528	Interaction with CLOCK.|Steroid-binding.				adrenal gland development (GO:0030325)|chromatin modification (GO:0016568)|gene expression (GO:0010467)|glucocorticoid metabolic process (GO:0008211)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of glucocorticoid mediated signaling pathway (GO:1900170)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucocorticoid biosynthetic process (GO:0031946)|regulation of gluconeogenesis (GO:0006111)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	glucocorticoid receptor activity (GO:0004883)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|zinc ion binding (GO:0008270)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	35		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Budesonide(DB01222)|Ciclesonide(DB01410)|Clobetasol propionate(DB01013)|Clocortolone(DB00838)|Cortisone acetate(DB01380)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Difluprednate(DB06781)|Fludrocortisone(DB00687)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Fluoxymesterone(DB01185)|Flurandrenolide(DB00846)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol(DB00873)|Medrysone(DB00253)|Megestrol acetate(DB00351)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Paramethasone(DB01384)|Prednicarbate(DB01130)|Prednisolone(DB00860)|Prednisone(DB00635)|Rimexolone(DB00896)|Spironolactone(DB00421)|Triamcinolone(DB00620)	GGTAGGGGTGAGTTGTGGTAA	0.423																																					p.L529R		.											.	NR3C1	92	0			c.T1586G						.						217.0	197.0	204.0					5																	142680214		2203	4300	6503	SO:0001583	missense	2908	exon5			GGGGTGAGTTGTG	X03225	CCDS4278.1, CCDS34258.1, CCDS47298.1	5q31-q32	2013-01-16	2002-08-27		ENSG00000113580	ENSG00000113580		"""Nuclear hormone receptors"""	7978	protein-coding gene	gene with protein product		138040	"""nuclear receptor subfamily 3, group C, member 1"""	GRL		2867473	Standard	NM_001204258		Approved	GR	uc003lnb.3	P04150	OTTHUMG00000129677	ENST00000343796.2:c.1583T>G	5.37:g.142680214A>C	ENSP00000343205:p.Leu528Arg	234.0	0.0		252.0	76.0	NM_001024094	A0ZXF9|B0LPG8|D3DQF4|P04151|Q53EP5|Q6N0A4	Missense_Mutation	SNP	ENST00000343796.2	37	CCDS4278.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.751525	0.89753	.	.	ENSG00000113580	ENST00000394464;ENST00000343796;ENST00000415690;ENST00000424646;ENST00000504572;ENST00000394466;ENST00000231509;ENST00000416954;ENST00000503201	D;D;D;D;D;D;D;D;D	0.87491	-1.91;-1.91;-1.87;-1.88;-1.91;-1.91;-1.91;-2.26;-1.91	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.94830	0.8330	M	0.91561	3.22	0.80722	D	1	D;D;D	0.89917	1.0;0.987;0.997	D;P;D	0.85130	0.997;0.836;0.995	D	0.95753	0.8793	10	0.72032	D	0.01	.	15.94	0.79747	1.0:0.0:0.0:0.0	.	528;528;529	E5KQF5;P04150;E5KQF6	.;GCR_HUMAN;.	R	528;528;528;502;529;529;529;131;528	ENSP00000377977:L528R;ENSP00000343205:L528R;ENSP00000387672:L528R;ENSP00000405282:L502R;ENSP00000422518:L529R;ENSP00000377979:L529R;ENSP00000231509:L529R;ENSP00000404218:L131R;ENSP00000427672:L528R	ENSP00000231509:L529R	L	-	2	0	NR3C1	142660407	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.979000	0.76154	2.156000	0.67533	0.533000	0.62120	CTC	.		0.423	NR3C1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370829.1		
OR4C16	219428	hgsc.bcm.edu;bcgsc.ca	37	11	55339830	55339830	+	Missense_Mutation	SNP	C	C	G	rs372108090		TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr11:55339830C>G	ENST00000314634.3	+	1	227	c.227C>G	c.(226-228)aCc>aGc	p.T76S		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	76			T -> A (in dbSNP:rs557590). {ECO:0000269|Ref.1}.			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T76S(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				ACTTCCATAACCCCTAGAATG	0.428																																					p.T76S		.											.	OR4C16	70	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.C227G						.						262.0	243.0	249.0					11																	55339830		2201	4296	6497	SO:0001583	missense	219428	exon1			CCATAACCCCTAG	AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.227C>G	11.37:g.55339830C>G	ENSP00000324913:p.Thr76Ser	145.0	0.0		217.0	11.0	NM_001004701	Q6IEV8	Missense_Mutation	SNP	ENST00000314634.3	37	CCDS31502.1	.	.	.	.	.	.	.	.	.	.	C	10.01	1.234160	0.22626	.	.	ENSG00000181935	ENST00000314634	T	0.03035	4.07	4.98	4.98	0.66077	GPCR, rhodopsin-like superfamily (1);	0.092864	0.47852	D	0.000208	T	0.04998	0.0134	L	0.43701	1.375	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.30592	-0.9973	10	0.29301	T	0.29	.	15.7881	0.78326	0.0:1.0:0.0:0.0	.	76	Q8NGL9	OR4CG_HUMAN	S	76	ENSP00000324913:T76S	ENSP00000324913:T76S	T	+	2	0	OR4C16	55096406	0.000000	0.05858	0.278000	0.24718	0.584000	0.36387	-0.144000	0.10280	2.595000	0.87683	0.549000	0.68633	ACC	.		0.428	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382627.1	NM_001004701	
OR6S1	341799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	21109487	21109487	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr14:21109487C>T	ENST00000320704.3	-	1	363	c.364G>A	c.(364-366)Gcg>Acg	p.A122T		NM_001001968.1	NP_001001968.1	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S, member 1	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		TAGCGATCCGCAGACATGACA	0.542																																					p.A122T		.											.	OR6S1	70	0			c.G364A						.						93.0	81.0	85.0					14																	21109487		2203	4300	6503	SO:0001583	missense	341799	exon1			GATCCGCAGACAT	AL163636	CCDS32038.1	14q11.2	2013-09-24			ENSG00000181803	ENSG00000181803		"""GPCR / Class A : Olfactory receptors"""	15363	protein-coding gene	gene with protein product							Standard	NM_001001968		Approved	OR6S1Q	uc001vxv.1	Q8NH40	OTTHUMG00000171010	ENST00000320704.3:c.364G>A	14.37:g.21109487C>T	ENSP00000313110:p.Ala122Thr	114.0	0.0		118.0	23.0	NM_001001968	Q6IFJ9	Missense_Mutation	SNP	ENST00000320704.3	37	CCDS32038.1	.	.	.	.	.	.	.	.	.	.	C	14.45	2.539756	0.45176	.	.	ENSG00000181803	ENST00000320704	T	0.01335	5.0	5.46	3.52	0.40303	GPCR, rhodopsin-like superfamily (1);	0.313169	0.22962	N	0.053534	T	0.01092	0.0036	N	0.14661	0.345	0.22305	N	0.999211	B	0.06786	0.001	B	0.04013	0.001	T	0.46898	-0.9158	10	0.87932	D	0	-5.6108	6.3811	0.21536	0.2803:0.6321:0.0:0.0876	.	122	Q8NH40	OR6S1_HUMAN	T	122	ENSP00000313110:A122T	ENSP00000313110:A122T	A	-	1	0	OR6S1	20179327	0.000000	0.05858	1.000000	0.80357	0.972000	0.66771	0.882000	0.28186	1.439000	0.47511	-0.140000	0.14226	GCG	.		0.542	OR6S1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411227.1		
OR7A10	390892	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14952035	14952035	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr19:14952035A>C	ENST00000248058.1	-	1	654	c.655T>G	c.(655-657)Tct>Gct	p.S219A		NM_001005190.1	NP_001005190.1	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A, member 10	219						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|stomach(1)	19	Ovarian(108;0.203)					ACTATCTTAGAGTAAGAGTAC	0.468																																					p.S219A		.											.	OR7A10	68	0			c.T655G						.						66.0	61.0	63.0					19																	14952035		2203	4300	6503	SO:0001583	missense	390892	exon1			TCTTAGAGTAAGA		CCDS32936.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8356	protein-coding gene	gene with protein product							Standard	NM_001005190		Approved		uc002mzx.1	O76100		ENST00000248058.1:c.655T>G	19.37:g.14952035A>C	ENSP00000248058:p.Ser219Ala	43.0	0.0		65.0	15.0	NM_001005190	Q6IFP0|Q96R97	Missense_Mutation	SNP	ENST00000248058.1	37	CCDS32936.1	.	.	.	.	.	.	.	.	.	.	a	10.12	1.263886	0.23136	.	.	ENSG00000127515	ENST00000248058	T	0.00048	8.82	2.75	0.126	0.14722	GPCR, rhodopsin-like superfamily (1);	0.830271	0.09655	N	0.773210	T	0.00144	0.0004	N	0.25201	0.72	0.09310	N	1	B	0.25486	0.127	B	0.35931	0.214	T	0.09143	-1.0688	10	0.59425	D	0.04	.	5.9723	0.19359	0.3999:0.0:0.0:0.6001	.	219	O76100	OR7AA_HUMAN	A	219	ENSP00000248058:S219A	ENSP00000248058:S219A	S	-	1	0	OR7A10	14813035	0.000000	0.05858	0.010000	0.14722	0.413000	0.31143	-0.733000	0.04898	0.274000	0.22072	0.113000	0.15668	TCT	.		0.468	OR7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466520.1	NM_001005190	
OVGP1	5016	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	111957947	111957947	+	Silent	SNP	T	T	C			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr1:111957947T>C	ENST00000369732.3	-	11	1231	c.1176A>G	c.(1174-1176)ttA>ttG	p.L392L	OVGP1_ENST00000540696.1_3'UTR	NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	392					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		AAAATTGTGGTAAAGAAGTTG	0.418																																					p.L392L		.											.	OVGP1	135	0			c.A1176G						.						46.0	44.0	45.0					1																	111957947		2203	4300	6503	SO:0001819	synonymous_variant	5016	exon11			TTGTGGTAAAGAA	U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.1176A>G	1.37:g.111957947T>C		84.0	0.0		95.0	29.0	NM_002557	A0AV19|B9EGE1|Q15841	Silent	SNP	ENST00000369732.3	37	CCDS834.1																																																																																			.		0.418	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032461.1	NM_002557	
PCBP3	54039	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	21	47320946	47320946	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr21:47320946C>A	ENST00000400314.1	+	7	596	c.258C>A	c.(256-258)tgC>tgA	p.C86*	PCBP3_ENST00000449640.1_Nonsense_Mutation_p.C86*|PCBP3_ENST00000400308.1_Nonsense_Mutation_p.C86*|PCBP3_ENST00000400310.1_Nonsense_Mutation_p.C86*|PCBP3_ENST00000400309.1_Nonsense_Mutation_p.C86*|PCBP3_ENST00000400304.1_Nonsense_Mutation_p.C54*			P57721	PCBP3_HUMAN	poly(rC) binding protein 3	86	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				mRNA metabolic process (GO:0016071)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(3)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		AGGGAAACTGCCCAGAGAGGA	0.557																																					p.C86X		.											.	PCBP3	227	0			c.C258A						.						99.0	111.0	107.0					21																	47320946		2007	4160	6167	SO:0001587	stop_gained	54039	exon5			AAACTGCCCAGAG	AF176329	CCDS42974.2, CCDS46652.1	21q22.3	2013-07-16	2001-11-28		ENSG00000183570	ENSG00000183570			8651	protein-coding gene	gene with protein product		608502	"""poly(rC)-binding protein 3"""			10936052	Standard	NM_020528		Approved		uc002zhq.2	P57721	OTTHUMG00000090399	ENST00000400314.1:c.258C>A	21.37:g.47320946C>A	ENSP00000383168:p.Cys86*	93.0	0.0		90.0	13.0	NM_001130141	A8MPS2|A8MQ26|B7WNN9|B7WPC1|Q8N9K6|Q96EP6	Nonsense_Mutation	SNP	ENST00000400314.1	37	CCDS42974.2	.	.	.	.	.	.	.	.	.	.	C	39	7.893716	0.98548	.	.	ENSG00000183570	ENST00000400314;ENST00000400310;ENST00000400309;ENST00000400308;ENST00000449640;ENST00000346743;ENST00000400305;ENST00000400304	.	.	.	4.86	2.07	0.26955	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.6788	9.6505	0.39895	0.0:0.6423:0.0:0.3577	.	.	.	.	X	86;86;86;86;86;86;62;54	.	ENSP00000330225:C86X	C	+	3	2	PCBP3	46145374	0.884000	0.30299	1.000000	0.80357	0.992000	0.81027	-0.039000	0.12124	0.230000	0.21059	-0.136000	0.14681	TGC	.		0.557	PCBP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206808.2		
PKN2	5586	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	89236054	89236054	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr1:89236054C>A	ENST00000370521.3	+	4	883	c.524C>A	c.(523-525)aCa>aAa	p.T175K	PKN2_ENST00000370505.3_Missense_Mutation_p.T18K|PKN2_ENST00000316005.7_Missense_Mutation_p.T175K|PKN2_ENST00000370513.5_Missense_Mutation_p.T175K	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	175					apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		CTCCATGGTACAGCTCAGCAA	0.353																																					p.T175K		.											.	PKN2	522	0			c.C524A						.						98.0	92.0	94.0					1																	89236054		1890	4110	6000	SO:0001583	missense	5586	exon4			ATGGTACAGCTCA	U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.524C>A	1.37:g.89236054C>A	ENSP00000359552:p.Thr175Lys	132.0	0.0		141.0	34.0	NM_006256	B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Missense_Mutation	SNP	ENST00000370521.3	37	CCDS714.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.980601	0.74474	.	.	ENSG00000065243	ENST00000370521;ENST00000316005;ENST00000370505;ENST00000370513	T;T;T;T	0.28895	2.42;2.42;1.59;2.42	5.45	5.45	0.79879	.	0.000000	0.46442	U	0.000300	T	0.39358	0.1075	M	0.80616	2.505	0.80722	D	1	P;P;P;P	0.45126	0.851;0.586;0.82;0.608	P;B;B;B	0.47603	0.551;0.236;0.397;0.402	T	0.32903	-0.9889	10	0.48119	T	0.1	.	19.6523	0.95822	0.0:1.0:0.0:0.0	.	175;175;175;175	B4DTP5;E7ESL7;Q16513;B1AL79	.;.;PKN2_HUMAN;.	K	175;175;18;175	ENSP00000359552:T175K;ENSP00000317851:T175K;ENSP00000359536:T18K;ENSP00000359544:T175K	ENSP00000317851:T175K	T	+	2	0	PKN2	89008642	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.445000	0.80570	2.706000	0.92434	0.655000	0.94253	ACA	.		0.353	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027828.3	NM_006256	
PPP2R5C	5527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	102349777	102349777	+	Silent	SNP	G	G	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr14:102349777G>A	ENST00000334743.5	+	5	555	c.507G>A	c.(505-507)gaG>gaA	p.E169E	PPP2R5C_ENST00000445439.3_Silent_p.E169E|PPP2R5C_ENST00000350249.3_Silent_p.E169E|PPP2R5C_ENST00000328724.5_Silent_p.E224E|PPP2R5C_ENST00000422945.2_Silent_p.E200E|PPP2R5C_ENST00000557095.1_Silent_p.E169E	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	169					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						AGCTTTTAGAGCTCTTTGACA	0.418																																					p.E224E		.											.	PPP2R5C	659	0			c.G672A						.						90.0	95.0	93.0					14																	102349777		2202	4299	6501	SO:0001819	synonymous_variant	5527	exon7			TTTAGAGCTCTTT	L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.507G>A	14.37:g.102349777G>A		94.0	0.0		91.0	15.0	NM_001161726	B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Silent	SNP	ENST00000334743.5	37	CCDS9964.1																																																																																			.		0.418	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414373.2	NM_002719	
RANBP2	5903	hgsc.bcm.edu;bcgsc.ca	37	2	109379816	109379816	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr2:109379816C>A	ENST00000283195.6	+	20	2947	c.2821C>A	c.(2821-2823)Cct>Act	p.P941T		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	941					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						GATGTATGGTCCTCCTGCATT	0.473																																					p.P941T		.											.	RANBP2	675	0			c.C2821A						.						130.0	120.0	124.0					2																	109379816		2203	4300	6503	SO:0001583	missense	5903	exon20			TATGGTCCTCCTG	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.2821C>A	2.37:g.109379816C>A	ENSP00000283195:p.Pro941Thr	174.0	0.0		247.0	11.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	C	13.96	2.392009	0.42410	.	.	ENSG00000153201	ENST00000283195	T	0.23147	1.92	5.19	5.19	0.71726	.	.	.	.	.	T	0.20292	0.0488	L	0.29908	0.895	0.32255	N	0.570945	B	0.22276	0.067	B	0.15052	0.012	T	0.08764	-1.0706	9	0.28530	T	0.3	-17.2047	14.6488	0.68780	0.2118:0.7882:0.0:0.0	.	941	P49792	RBP2_HUMAN	T	941	ENSP00000283195:P941T	ENSP00000283195:P941T	P	+	1	0	RANBP2	108746248	0.996000	0.38824	1.000000	0.80357	0.893000	0.52053	1.412000	0.34714	2.570000	0.86706	0.563000	0.77884	CCT	.		0.473	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
RANBP2	5903	hgsc.bcm.edu;bcgsc.ca	37	2	109379840	109379840	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr2:109379840C>G	ENST00000283195.6	+	20	2971	c.2845C>G	c.(2845-2847)Cct>Gct	p.P949A		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	949					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						TTTTGAGTCTCCTGCAACGGG	0.468																																					p.P949A		.											.	RANBP2	675	0			c.C2845G						.						121.0	115.0	117.0					2																	109379840		2203	4300	6503	SO:0001583	missense	5903	exon20			GAGTCTCCTGCAA	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.2845C>G	2.37:g.109379840C>G	ENSP00000283195:p.Pro949Ala	140.0	0.0		224.0	10.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.826229	0.71143	.	.	ENSG00000153201	ENST00000283195	T	0.26660	1.72	5.08	5.08	0.68730	.	.	.	.	.	T	0.40979	0.1139	L	0.34521	1.04	0.49299	D	0.999771	D	0.89917	1.0	D	0.67548	0.952	T	0.18999	-1.0319	9	0.49607	T	0.09	-19.2482	18.8287	0.92128	0.0:1.0:0.0:0.0	.	949	P49792	RBP2_HUMAN	A	949	ENSP00000283195:P949A	ENSP00000283195:P949A	P	+	1	0	RANBP2	108746272	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.339000	0.52135	2.511000	0.84671	0.563000	0.77884	CCT	.		0.468	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
RBM5	10181	ucsc.edu;bcgsc.ca;mdanderson.org	37	3	50152926	50152926	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr3:50152926G>T	ENST00000347869.3	+	21	2080	c.1905G>T	c.(1903-1905)gaG>gaT	p.E635D	RP11-493K19.3_ENST00000437204.1_RNA|RP11-493K19.3_ENST00000425674.1_RNA	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	635	Required for interaction with U2AF2.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AGAGACTTGAGAGTGAGGAAG	0.542																																					p.E635D		.											.	RBM5	278	0			c.G1905T						.						127.0	126.0	126.0					3																	50152926		2203	4300	6503	SO:0001583	missense	10181	exon21			ACTTGAGAGTGAG	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.1905G>T	3.37:g.50152926G>T	ENSP00000343054:p.Glu635Asp	117.0	1.0		124.0	37.0	NM_005778	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Missense_Mutation	SNP	ENST00000347869.3	37	CCDS2810.1	.	.	.	.	.	.	.	.	.	.	G	11.10	1.540053	0.27563	.	.	ENSG00000003756	ENST00000347869;ENST00000543047;ENST00000544851	T	0.14640	2.49	5.7	1.42	0.22433	.	0.154445	0.56097	D	0.000027	T	0.07999	0.0200	N	0.25201	0.72	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.28870	-1.0030	10	0.15066	T	0.55	-20.775	10.4897	0.44744	0.3313:0.0:0.6687:0.0	.	325;635	Q59HE6;P52756	.;RBM5_HUMAN	D	635;634;325	ENSP00000343054:E635D	ENSP00000343054:E635D	E	+	3	2	RBM5	50127930	0.991000	0.36638	0.999000	0.59377	0.995000	0.86356	0.366000	0.20365	0.357000	0.24183	0.655000	0.94253	GAG	.		0.542	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345797.3	NM_005778	
RCBTB1	55213	broad.mit.edu;bcgsc.ca	37	13	50118925	50118925	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr13:50118925A>G	ENST00000378302.2	-	10	1380	c.1120T>C	c.(1120-1122)Ttt>Ctt	p.F374L	RCBTB1_ENST00000258646.3_Missense_Mutation_p.F374L	NM_018191.3	NP_060661.3	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1	374	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(1)	16		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		TCAATTCGAAACTTCAGATCA	0.328																																					p.F374L		.											.	RCBTB1	91	0			c.T1120C						.						106.0	97.0	100.0					13																	50118925		2202	4300	6502	SO:0001583	missense	55213	exon10			TTCGAAACTTCAG	AF334406	CCDS9418.1	13q14	2013-01-08			ENSG00000136144	ENSG00000136144		"""BTB/POZ domain containing"""	18243	protein-coding gene	gene with protein product		607867				11306461	Standard	XM_005266441		Approved	FLJ10716, CLLD7, CLLL7	uc001vde.1	Q8NDN9	OTTHUMG00000016915	ENST00000378302.2:c.1120T>C	13.37:g.50118925A>G	ENSP00000367552:p.Phe374Leu	72.0	0.0		88.0	4.0	NM_018191	Q8IY29|Q969U9	Missense_Mutation	SNP	ENST00000378302.2	37	CCDS9418.1	.	.	.	.	.	.	.	.	.	.	A	29.4	5.001329	0.93227	.	.	ENSG00000136144	ENST00000258646;ENST00000378302	T;T	0.62498	0.02;0.02	5.44	5.44	0.79542	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.70456	0.3226	L	0.53671	1.685	0.80722	D	1	P	0.51933	0.949	P	0.56648	0.803	T	0.69624	-0.5095	10	0.37606	T	0.19	-18.7715	15.5123	0.75793	1.0:0.0:0.0:0.0	.	374	Q8NDN9	RCBT1_HUMAN	L	374	ENSP00000258646:F374L;ENSP00000367552:F374L	ENSP00000258646:F374L	F	-	1	0	RCBTB1	49016926	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.962000	0.93254	2.056000	0.61249	0.528000	0.53228	TTT	.		0.328	RCBTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044912.2	NM_018191	
SENP1	29843	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	48482714	48482714	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr12:48482714A>G	ENST00000004980.5	-	5	728	c.250T>C	c.(250-252)Tca>Cca	p.S84P	SENP1_ENST00000549595.1_Missense_Mutation_p.S84P|SENP1_ENST00000551330.1_Missense_Mutation_p.S84P|SENP1_ENST00000549518.1_Missense_Mutation_p.S84P|SENP1_ENST00000448372.1_Missense_Mutation_p.S84P|SENP1_ENST00000339976.6_Silent_p.A159A|SENP1_ENST00000547886.1_5'UTR			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	84	Ser-rich.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				AAATCGCCTGAGCCAAGAAAA	0.383																																					p.S84P		.											.	SENP1	660	0			c.T250C						.						92.0	76.0	81.0					12																	48482714		1811	4071	5882	SO:0001583	missense	29843	exon5			CGCCTGAGCCAAG	AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.250T>C	12.37:g.48482714A>G	ENSP00000004980:p.Ser84Pro	67.0	0.0		100.0	38.0	NM_001267594	A8K7P5|Q86XC8	Missense_Mutation	SNP	ENST00000004980.5	37	CCDS44868.2	.	.	.	.	.	.	.	.	.	.	A	16.13	3.035373	0.54896	.	.	ENSG00000079387	ENST00000004980;ENST00000448372;ENST00000551330;ENST00000549595;ENST00000549518;ENST00000551798	T;T;T;T;T	0.17054	2.3;2.3;2.3;2.3;2.3	4.91	3.73	0.42828	.	0.394176	0.21727	N	0.070034	T	0.17408	0.0418	N	0.19112	0.55	0.80722	D	1	D;D	0.58268	0.969;0.982	P;P	0.53549	0.54;0.729	T	0.02358	-1.1171	10	0.36615	T	0.2	-9.3972	10.0544	0.42237	0.8303:0.1697:0.0:0.0	.	84;84	Q9P0U3;Q9P0U3-2	SENP1_HUMAN;.	P	84;84;84;84;84;77	ENSP00000004980:S84P;ENSP00000394791:S84P;ENSP00000446681:S84P;ENSP00000450076:S84P;ENSP00000447328:S84P	ENSP00000004980:S84P	S	-	1	0	SENP1	46768981	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.298000	0.43602	0.934000	0.37316	0.454000	0.30748	TCA	.		0.383	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406471.1	NM_014554	
SLC36A3	285641	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	150666921	150666921	+	Silent	SNP	G	G	T			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr5:150666921G>T	ENST00000335230.3	-	6	1005	c.594C>A	c.(592-594)ccC>ccA	p.P198P	SLC36A3_ENST00000377713.3_Silent_p.P239P	NM_181774.3	NP_861439.3	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3	198						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	21		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGATCAGGAAGGGCAGGATTA	0.527																																					p.P239P		.											.	SLC36A3	93	0			c.C717A						.						168.0	156.0	160.0					5																	150666921		2203	4300	6503	SO:0001819	synonymous_variant	285641	exon7			CAGGAAGGGCAGG	AY162215	CCDS4314.1, CCDS47316.1	5q33.1	2013-07-17	2013-07-17		ENSG00000186334	ENSG00000186334		"""Solute carriers"""	19659	protein-coding gene	gene with protein product		608332				12809675	Standard	NM_181774		Approved	PAT3, TRAMD2, tramdorin2	uc003ltw.2	Q495N2	OTTHUMG00000130128	ENST00000335230.3:c.594C>A	5.37:g.150666921G>T		165.0	0.0		224.0	60.0	NM_001145017	Q495N3|Q6ZMU7|Q6ZRU4|Q7Z6B4	Silent	SNP	ENST00000335230.3	37	CCDS4314.1																																																																																			.		0.527	SLC36A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252436.1	NM_181774	
SLC45A4	57210	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	142231725	142231725	+	Silent	SNP	G	G	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr8:142231725G>A	ENST00000024061.3	-	2	535	c.228C>T	c.(226-228)tgC>tgT	p.C76C	SLC45A4_ENST00000517878.1_Silent_p.C127C|SLC45A4_ENST00000433583.2_Silent_p.C69C|SLC45A4_ENST00000519067.1_Silent_p.C76C	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			GGACGCCAACGCAGAGGGCGA	0.622																																					p.C76C		.											.	SLC45A4	70	0			c.C228T						.						74.0	81.0	79.0					8																	142231725		2203	4300	6503	SO:0001819	synonymous_variant	57210	exon2			GCCAACGCAGAGG	AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.228C>T	8.37:g.142231725G>A		101.0	0.0		217.0	32.0	NM_001080431	Q6ZRI2|Q9ULU3	Silent	SNP	ENST00000024061.3	37	CCDS34948.1																																																																																			.		0.622	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3	XM_050325	
SLITRK6	84189	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	86369434	86369434	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr13:86369434C>T	ENST00000400286.2	-	2	1808	c.1210G>A	c.(1210-1212)Gaa>Aaa	p.E404K		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	404					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		AACGATCCTTCTTCAAGAACT	0.353																																					p.E404K		.											.	SLITRK6	137	0			c.G1210A						.						74.0	69.0	71.0					13																	86369434		1846	4091	5937	SO:0001583	missense	84189	exon2			ATCCTTCTTCAAG	AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.1210G>A	13.37:g.86369434C>T	ENSP00000383143:p.Glu404Lys	40.0	0.0		107.0	13.0	NM_032229	A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	ENST00000400286.2	37	CCDS41903.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.820070	0.50633	.	.	ENSG00000184564	ENST00000400286	T	0.02421	4.3	5.76	5.76	0.90799	.	0.151890	0.43747	U	0.000536	T	0.07234	0.0183	L	0.31371	0.925	0.52501	D	0.999956	D	0.53312	0.959	P	0.57846	0.828	T	0.54925	-0.8220	10	0.23302	T	0.38	-12.071	18.5388	0.91020	0.0:1.0:0.0:0.0	.	404	Q9H5Y7	SLIK6_HUMAN	K	404	ENSP00000383143:E404K	ENSP00000383143:E404K	E	-	1	0	SLITRK6	85267435	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	5.956000	0.70315	2.724000	0.93272	0.585000	0.79938	GAA	.		0.353	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045404.2	NM_032229	
SMARCC2	6601	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56565643	56565643	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr12:56565643G>C	ENST00000267064.4	-	20	1998	c.1912C>G	c.(1912-1914)Cat>Gat	p.H638D	RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000550164.1_Missense_Mutation_p.H669D|SMARCC2_ENST00000394023.3_Missense_Mutation_p.H669D|SMARCC2_ENST00000347471.4_Missense_Mutation_p.H669D	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	638	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CGAAGAAAATGCAAGATGCAC	0.547																																					p.H669D		.											.	SMARCC2	229	0			c.C2005G						.						98.0	85.0	89.0					12																	56565643		2203	4300	6503	SO:0001583	missense	6601	exon21			GAAAATGCAAGAT	U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.1912C>G	12.37:g.56565643G>C	ENSP00000267064:p.His638Asp	93.0	0.0		106.0	20.0	NM_139067	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	ENST00000267064.4	37	CCDS8907.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419195	0.83559	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T;T	0.55052	0.54;0.54;0.54;0.54	3.73	3.73	0.42828	Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);SANT, eukarya (1);	0.000000	0.85682	D	0.000000	T	0.77974	0.4211	M	0.92880	3.355	0.58432	D	0.999999	D;D;D;D;D	0.62365	0.991;0.96;0.968;0.968;0.96	D;D;D;D;D	0.76071	0.987;0.923;0.954;0.954;0.923	D	0.84481	0.0605	10	0.87932	D	0	-8.9217	15.4916	0.75611	0.0:0.0:1.0:0.0	.	558;669;673;638;669	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	D	669;669;669;638	ENSP00000377591:H669D;ENSP00000449396:H669D;ENSP00000302919:H669D;ENSP00000267064:H638D	ENSP00000267064:H638D	H	-	1	0	SMARCC2	54851910	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.601000	0.98297	2.385000	0.81259	0.655000	0.94253	CAT	.		0.547	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1		
SPATA19	219938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	133711936	133711936	+	Nonstop_Mutation	SNP	A	A	G			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr11:133711936A>G	ENST00000299140.3	-	6	556	c.502T>C	c.(502-504)Tga>Cga	p.*168R	SPATA19_ENST00000532889.1_Nonstop_Mutation_p.*168R	NM_174927.1	NP_777587.1	Q7Z5L4	SPT19_HUMAN	spermatogenesis associated 19	0					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	mitochondrial outer membrane (GO:0005741)				cervix(1)|endometrium(2)|large_intestine(2)|lung(5)|prostate(1)	11	all_hematologic(175;0.127)	all_cancers(12;5.59e-17)|all_epithelial(12;2.65e-12)|all_lung(97;0.00045)|Lung NSC(97;0.000861)|Breast(109;0.000873)|Medulloblastoma(222;0.0425)|Esophageal squamous(93;0.0844)|all_neural(223;0.117)		Epithelial(10;4.36e-10)|all cancers(11;7.1e-09)|BRCA - Breast invasive adenocarcinoma(10;8.45e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00286)|Lung(977;0.207)		TGTTGCTCTCAGCAGTCTGAG	0.562																																					p.X168R		.											.	SPATA19	90	0			c.T502C						.						136.0	126.0	129.0					11																	133711936		2201	4297	6498	SO:0001578	stop_lost	219938	exon6			GCTCTCAGCAGTC	AK098717	CCDS8493.1	11q25	2010-04-23				ENSG00000166118			30614	protein-coding gene	gene with protein product	"""spergen 1"", ""cancer/testis antigen 132"""	609805				12477932	Standard	XM_005271448		Approved	FLJ25851, spergen1, SPAS1, CT132	uc001qgv.1	Q7Z5L4		ENST00000299140.3:c.502T>C	11.37:g.133711936A>G	ENSP00000299140:p.*168Glyext*61	66.0	0.0		117.0	41.0	NM_174927	Q8N7A9	Missense_Mutation	SNP	ENST00000299140.3	37	CCDS8493.1	.	.	.	.	.	.	.	.	.	.	A	10.17	1.277183	0.23307	.	.	ENSG00000166118	ENST00000299140;ENST00000532889	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9127	0.52747	1.0:0.0:0.0:0.0	.	.	.	.	R	168	.	.	X	-	1	0	SPATA19	133217146	0.998000	0.40836	1.000000	0.80357	0.530000	0.34684	4.100000	0.57762	2.062000	0.61559	0.459000	0.35465	TGA	.		0.562	SPATA19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393281.1	NM_174927	
SSPO	23145	hgsc.bcm.edu;bcgsc.ca	37	7	149506213	149506213	+	RNA	SNP	T	T	C			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr7:149506213T>C	ENST00000378016.2	+	0	9204							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGGCAGCAGCTGCGCAGCCTC	0.672																																					.		.											.	.	.	0			c.9204+1T>C						.						12.0	19.0	17.0					7																	149506213		2031	4171	6202			23145	exon63			AGCAGCTGCGCAG	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149506213T>C		329.0	0.0		310.0	15.0	NM_198455	Q76B61	Splice_Site	SNP	ENST00000378016.2	37																																																																																				.		0.672	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
SYT12	91683	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66811279	66811279	+	Silent	SNP	G	G	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr11:66811279G>A	ENST00000393946.2	+	8	1954	c.792G>A	c.(790-792)ccG>ccA	p.P264P	SYT12_ENST00000527043.1_Silent_p.P264P|SYT12_ENST00000525457.1_Silent_p.P264P			Q8IV01	SYT12_HUMAN	synaptotagmin XII	264	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|synapse (GO:0045202)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	20						TTGACCTCCCGCTGCAGCCCT	0.552																																					p.P264P	Ovarian(65;2862 3307)	.											.	SYT12	91	0			c.G792A						.						97.0	74.0	82.0					11																	66811279		2200	4295	6495	SO:0001819	synonymous_variant	91683	exon5			CCTCCCGCTGCAG	AK024280	CCDS8154.1	11q13.2	2014-07-02			ENSG00000173227	ENSG00000173227		"""Synaptotagmins"""	18381	protein-coding gene	gene with protein product		606436				8987811	Standard	NM_177963		Approved	SRG1	uc001oju.3	Q8IV01	OTTHUMG00000167101	ENST00000393946.2:c.792G>A	11.37:g.66811279G>A		84.0	0.0		109.0	16.0	NM_001177880		Silent	SNP	ENST00000393946.2	37	CCDS8154.1																																																																																			.		0.552	SYT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393129.1	NM_177963	
TENM2	57451	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	167553853	167553853	+	Silent	SNP	C	C	T			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr5:167553853C>T	ENST00000518659.1	+	12	2343	c.2304C>T	c.(2302-2304)cgC>cgT	p.R768R	TENM2_ENST00000520394.1_Silent_p.R536R|TENM2_ENST00000519204.1_Silent_p.R647R|CTB-178M22.1_ENST00000517408.1_RNA|TENM2_ENST00000403607.2_Silent_p.R601R|TENM2_ENST00000545108.1_Silent_p.R768R	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	768					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										GTGACCAGCGCGTGTGCCACC	0.597																																					p.R768R		.											.	.	.	0			c.C2304T						.						45.0	51.0	49.0					5																	167553853		2036	4168	6204	SO:0001819	synonymous_variant	57451	exon12			CCAGCGCGTGTGC	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.2304C>T	5.37:g.167553853C>T		199.0	0.0		231.0	66.0	NM_001122679	Q9ULU2	Silent	SNP	ENST00000518659.1	37																																																																																				.		0.597	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
TMEM62	80021	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	43446967	43446967	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr15:43446967G>C	ENST00000260403.2	+	9	1399	c.1120G>C	c.(1120-1122)Gta>Cta	p.V374L		NM_024956.3	NP_079232.3	Q0P6H9	TMM62_HUMAN	transmembrane protein 62	374						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		all_cancers(109;1.16e-10)|all_epithelial(112;2.01e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;4.23e-07)		TCCCATTTTCGTACTGAAGTG	0.373																																					p.V374L		.											.	TMEM62	136	0			c.G1120C						.						127.0	110.0	116.0					15																	43446967		2203	4299	6502	SO:0001583	missense	80021	exon9			ATTTTCGTACTGA	BC009981	CCDS32210.1	15q15.2	2014-09-11			ENSG00000137842	ENSG00000137842			26269	protein-coding gene	gene with protein product							Standard	NM_024956		Approved	FLJ23375	uc001zqr.3	Q0P6H9	OTTHUMG00000176485	ENST00000260403.2:c.1120G>C	15.37:g.43446967G>C	ENSP00000260403:p.Val374Leu	101.0	0.0		152.0	15.0	NM_024956	Q6I9Y5|Q9H5J6	Missense_Mutation	SNP	ENST00000260403.2	37	CCDS32210.1	.	.	.	.	.	.	.	.	.	.	G	14.80	2.642270	0.47153	.	.	ENSG00000137842	ENST00000260403	.	.	.	5.67	1.92	0.25849	.	0.486384	0.25130	N	0.032911	T	0.49983	0.1589	M	0.64997	1.995	0.34404	D	0.695626	B	0.26744	0.158	B	0.28465	0.09	T	0.54139	-0.8338	9	0.33940	T	0.23	-0.6828	7.7929	0.29131	0.6476:0.0:0.3524:0.0	.	374	Q0P6H9	TMM62_HUMAN	L	374	.	ENSP00000260403:V374L	V	+	1	0	TMEM62	41234259	1.000000	0.71417	0.996000	0.52242	0.857000	0.48899	3.399000	0.52586	0.499000	0.27970	-0.438000	0.05819	GTA	.		0.373	TMEM62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432227.1	NM_024956	
TMPRSS15	5651	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	19770597	19770597	+	Silent	SNP	T	T	C			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr21:19770597T>C	ENST00000284885.3	-	2	228	c.195A>G	c.(193-195)acA>acG	p.T65T		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	65	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.		T -> I (in dbSNP:rs35987974).			brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TAACTCCGGATGTTATTTTAA	0.378																																					p.T65T		.											.	TMPRSS15	160	0			c.A195G						.						79.0	81.0	80.0					21																	19770597		2203	4300	6503	SO:0001819	synonymous_variant	5651	exon2			TCCGGATGTTATT		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.195A>G	21.37:g.19770597T>C		44.0	0.0		71.0	23.0	NM_002772	Q2NKL7	Silent	SNP	ENST00000284885.3	37	CCDS13571.1																																																																																			.		0.378	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	
TNRC6A	27327	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	24826473	24826473	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr16:24826473A>C	ENST00000395799.3	+	19	4807	c.4678A>C	c.(4678-4680)Att>Ctt	p.I1560L	TNRC6A_ENST00000315183.7_Missense_Mutation_p.I1511L|TNRC6A_ENST00000432286.2_Missense_Mutation_p.I38L|CTD-2515A14.1_ENST00000568895.1_RNA	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1560					cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		GTTAGGTGCTATTTCAAGTGG	0.383																																					p.I1560L		.											.	TNRC6A	92	0			c.A4678C						.						141.0	133.0	136.0					16																	24826473		2197	4300	6497	SO:0001583	missense	27327	exon19			GGTGCTATTTCAA	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.4678A>C	16.37:g.24826473A>C	ENSP00000379144:p.Ile1560Leu	178.0	0.0		214.0	60.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	CCDS10624.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.6|20.6	4.010138|4.010138	0.75046|0.75046	.|.	.|.	ENSG00000090905|ENSG00000090905	ENST00000315183;ENST00000395799;ENST00000432286|ENST00000450465	T;T|.	0.13089|.	2.66;2.62|.	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	0.125092|.	0.64402|.	D|.	0.000005|.	T|T	0.72358|0.72358	0.3450|0.3450	M|M	0.64997|0.64997	1.995|1.995	0.54753|0.54753	D|D	0.999982|0.999982	B;B;B;P|.	0.39480|.	0.194;0.003;0.028;0.675|.	B;B;B;B|.	0.35413|.	0.107;0.01;0.047;0.202|.	T|T	0.71144|0.71144	-0.4678|-0.4678	10|5	0.51188|.	T|.	0.08|.	-12.8497|-12.8497	16.3631|16.3631	0.83280|0.83280	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	227;699;1511;1560|.	B3KSX2;C9JA83;Q8NDV7-6;Q8NDV7|.	.;.;.;TNR6A_HUMAN|.	L|S	1511;1560;38|450	ENSP00000326900:I1511L;ENSP00000379144:I1560L|.	ENSP00000326900:I1511L|.	I|Y	+|+	1|2	0|0	TNRC6A|TNRC6A	24733974|24733974	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	7.975000|7.975000	0.88055|0.88055	2.266000|2.266000	0.75297|0.75297	0.533000|0.533000	0.62120|0.62120	ATT|TAT	.		0.383	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
TNS4	84951	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	38652631	38652631	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr17:38652631A>G	ENST00000254051.6	-	2	205	c.47T>C	c.(46-48)gTc>gCc	p.V16A		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	16					apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			CGCCAAGCTGACAGCATGGCC	0.622																																					p.V16A		.											.	TNS4	155	0			c.T47C						.						29.0	29.0	29.0					17																	38652631		2203	4299	6502	SO:0001583	missense	84951	exon2			AAGCTGACAGCAT	AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.47T>C	17.37:g.38652631A>G	ENSP00000254051:p.Val16Ala	77.0	1.0		67.0	15.0	NM_032865	A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Missense_Mutation	SNP	ENST00000254051.6	37	CCDS11368.1	.	.	.	.	.	.	.	.	.	.	A	9.903	1.207491	0.22205	.	.	ENSG00000131746	ENST00000377816;ENST00000254051	T	0.26067	1.76	5.35	5.35	0.76521	.	4.812410	0.00166	N	0.000009	T	0.23094	0.0558	L	0.27053	0.805	0.19300	N	0.999978	B	0.28900	0.227	B	0.24848	0.056	T	0.26849	-1.0091	10	0.21540	T	0.41	-34.0548	11.7335	0.51752	1.0:0.0:0.0:0.0	.	16	Q8IZW8	TENS4_HUMAN	A	16	ENSP00000254051:V16A	ENSP00000254051:V16A	V	-	2	0	TNS4	35906157	0.039000	0.19947	0.418000	0.26571	0.042000	0.13812	2.451000	0.44952	2.013000	0.59113	0.528000	0.53228	GTC	.		0.622	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257154.3	NM_032865	
TOMM70A	9868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	100093979	100093979	+	Silent	SNP	G	G	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr3:100093979G>A	ENST00000284320.5	-	7	1558	c.1110C>T	c.(1108-1110)ctC>ctT	p.L370L		NM_014820.4	NP_055635.3	O94826	TOM70_HUMAN	translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)	370					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)			endometrium(11)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	32						CTCTTTTGATGAGAGCATTTG	0.398																																					p.L370L		.											.	TOMM70A	91	0			c.C1110T						.						129.0	126.0	127.0					3																	100093979		2203	4300	6503	SO:0001819	synonymous_variant	9868	exon7			TTTGATGAGAGCA	AB018262	CCDS33807.1	3q12.2	2013-01-10	2006-04-04		ENSG00000154174	ENSG00000154174		"""Tetratricopeptide (TTC) repeat domain containing"""	11985	protein-coding gene	gene with protein product		606081	"""translocase of outer mitochondrial membrane 70 (yeast) homolog A"", ""translocase of outer mitochondrial membrane 70 homolog A (yeast)"""			10582581	Standard	NM_014820		Approved	KIAA0719	uc003dtw.3	O94826	OTTHUMG00000159065	ENST00000284320.5:c.1110C>T	3.37:g.100093979G>A		58.0	0.0		54.0	18.0	NM_014820	D3DN48	Silent	SNP	ENST00000284320.5	37	CCDS33807.1																																																																																			.		0.398	TOMM70A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353141.2		
TP53	7157	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7578460	7578460	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr17:7578460A>C	ENST00000269305.4	-	5	659	c.470T>G	c.(469-471)gTc>gGc	p.V157G	TP53_ENST00000359597.4_Missense_Mutation_p.V157G|TP53_ENST00000445888.2_Missense_Mutation_p.V157G|TP53_ENST00000413465.2_Missense_Mutation_p.V157G|TP53_ENST00000455263.2_Missense_Mutation_p.V157G|TP53_ENST00000420246.2_Missense_Mutation_p.V157G|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	157	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9419979}.|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V157D(8)|p.0?(8)|p.V157G(7)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156_V157del(1)|p.V157A(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CATGGCGCGGACGCGGGTGCC	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.V157G	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,head_neck,carcinoma,-1	TP53	70225	53	Substitution - Missense(16)|Deletion - In frame(14)|Deletion - Frameshift(14)|Whole gene deletion(8)|Complex - frameshift(1)	lung(8)|stomach(6)|oesophagus(6)|breast(5)|ovary(5)|upper_aerodigestive_tract(4)|central_nervous_system(4)|bone(4)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|pancreas(2)|biliary_tract(1)|prostate(1)|liver(1)	c.T470G						.						51.0	52.0	51.0					17																	7578460		2203	4300	6503	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GCGCGGACGCGGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.470T>G	17.37:g.7578460A>C	ENSP00000269305:p.Val157Gly	145.0	0.0		93.0	34.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	17.25	3.342925	0.61073	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99825	-6.97;-6.97;-6.97;-6.97;-6.97;-6.97;-6.97;-6.97;-6.97	5.47	5.47	0.80525	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.216722	0.39210	N	0.001429	D	0.99816	0.9919	M	0.86420	2.815	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.996;0.99;0.988;0.998;0.999;1.0	D	0.96765	0.9564	10	0.87932	D	0	-16.7152	13.8032	0.63214	1.0:0.0:0.0:0.0	.	118;157;157;64;157;157;157	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	G	157;157;157;157;157;157;146;64;25;64;25;157	ENSP00000410739:V157G;ENSP00000352610:V157G;ENSP00000269305:V157G;ENSP00000398846:V157G;ENSP00000391127:V157G;ENSP00000391478:V157G;ENSP00000425104:V25G;ENSP00000423862:V64G;ENSP00000424104:V157G	ENSP00000269305:V157G	V	-	2	0	TP53	7519185	1.000000	0.71417	0.032000	0.17829	0.165000	0.22458	9.287000	0.95975	2.208000	0.71279	0.460000	0.39030	GTC	.		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TTLL4	9654	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	219604821	219604821	+	Missense_Mutation	SNP	G	G	T	rs371385094	byFrequency	TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr2:219604821G>T	ENST00000392102.1	+	4	1868	c.1528G>T	c.(1528-1530)Gat>Tat	p.D510Y	TTLL4_ENST00000442769.1_Missense_Mutation_p.D510Y|TTLL4_ENST00000258398.4_Missense_Mutation_p.D510Y|TTLL4_ENST00000457313.1_Missense_Mutation_p.D345Y	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	510					protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		TGAGACTGAAGATACAGAAGA	0.458																																					p.D510Y	GBM(172;1818 2053 15407 20943 49753)	.											.	TTLL4	93	0			c.G1528T						.						122.0	117.0	118.0					2																	219604821		2203	4300	6503	SO:0001583	missense	9654	exon4			ACTGAAGATACAG		CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.1528G>T	2.37:g.219604821G>T	ENSP00000375951:p.Asp510Tyr	185.0	0.0		231.0	25.0	NM_014640	A8K6V5|Q8WW29	Missense_Mutation	SNP	ENST00000392102.1	37	CCDS2422.1	.	.	.	.	.	.	.	.	.	.	G	19.28	3.796399	0.70567	.	.	ENSG00000135912	ENST00000457313;ENST00000392102;ENST00000442769;ENST00000258398	T;T;T;T	0.06294	3.49;3.71;3.32;3.71	4.69	4.69	0.59074	.	0.793840	0.11423	N	0.565537	T	0.16938	0.0407	L	0.34521	1.04	0.44531	D	0.997485	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.74023	0.936;0.927;0.982	T	0.01879	-1.1255	10	0.62326	D	0.03	.	14.4975	0.67700	0.0:0.0:1.0:0.0	.	345;510;510	E9PH58;E7EX20;Q14679	.;.;TTLL4_HUMAN	Y	345;510;510;510	ENSP00000393332:D345Y;ENSP00000375951:D510Y;ENSP00000396555:D510Y;ENSP00000258398:D510Y	ENSP00000258398:D510Y	D	+	1	0	TTLL4	219313065	1.000000	0.71417	0.996000	0.52242	0.908000	0.53690	5.584000	0.67490	2.433000	0.82419	0.561000	0.74099	GAT	.		0.458	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1	NM_014640	
TUSC3	7991	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	8	15398006	15398006	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr8:15398006G>A	ENST00000503731.1	+	1	215	c.67G>A	c.(67-69)Ggg>Agg	p.G23R	TUSC3_ENST00000509380.1_Missense_Mutation_p.G23R|TUSC3_ENST00000503191.1_Intron|TUSC3_ENST00000506802.1_Missense_Mutation_p.G23R|TUSC3_ENST00000382020.4_Missense_Mutation_p.G23R	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	23					cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		CCTGCCCACCGGGAGCTTTCC	0.672																																					p.G23R		.											.	TUSC3	516	0			c.G67A						.						26.0	26.0	26.0					8																	15398006		2200	4298	6498	SO:0001583	missense	7991	exon1			CCCACCGGGAGCT	AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.67G>A	8.37:g.15398006G>A	ENSP00000424544:p.Gly23Arg	152.0	0.0		198.0	79.0	NM_178234	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Missense_Mutation	SNP	ENST00000503731.1	37	CCDS5994.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.788938	0.49997	.	.	ENSG00000104723	ENST00000382020;ENST00000506802;ENST00000509380;ENST00000503731	T;T;T;T	0.46819	0.87;0.86;0.86;0.86	4.2	3.31	0.37934	.	0.301186	0.27645	N	0.018454	T	0.23766	0.0575	N	0.08118	0	0.29524	N	0.853302	B;B;B;B;B;B	0.26195	0.031;0.012;0.021;0.012;0.012;0.144	B;B;B;B;B;B	0.13407	0.001;0.001;0.003;0.001;0.001;0.009	T	0.12502	-1.0545	10	0.25106	T	0.35	-5.3103	10.034	0.42118	0.0:0.2049:0.7951:0.0	.	23;23;23;23;23;23	D6RDV0;D6RIY7;Q13454-2;Q13454;D6RA37;A8MSM0	.;.;.;TUSC3_HUMAN;.;.	R	23	ENSP00000371450:G23R;ENSP00000425777:G23R;ENSP00000423426:G23R;ENSP00000424544:G23R	ENSP00000221167:G23R	G	+	1	0	TUSC3	15442377	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	3.994000	0.56994	1.335000	0.45486	0.563000	0.77884	GGG	.		0.672	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1	NM_006765	
VCAN	1462	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	82833962	82833962	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr5:82833962T>C	ENST00000265077.3	+	8	5705	c.5140T>C	c.(5140-5142)Tgg>Cgg	p.W1714R	VCAN_ENST00000343200.5_Missense_Mutation_p.W727R|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000512590.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1714	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CACTTCTGAGTGGATTTCCAG	0.428																																					p.W1714R		.											.	VCAN	238	0			c.T5140C						.						85.0	86.0	86.0					5																	82833962		2203	4299	6502	SO:0001583	missense	1462	exon8			TCTGAGTGGATTT	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.5140T>C	5.37:g.82833962T>C	ENSP00000265077:p.Trp1714Arg	77.0	0.0		89.0	30.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	T	11.53	1.665094	0.29604	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	D;D;T	0.84660	-1.86;-1.88;3.26	5.96	2.37	0.29283	.	0.511459	0.18635	N	0.135473	T	0.77631	0.4159	M	0.62723	1.935	0.09310	N	1	P;P	0.46457	0.878;0.806	B;B	0.40285	0.325;0.269	T	0.64943	-0.6288	10	0.12766	T	0.61	.	5.2198	0.15362	0.0:0.1645:0.3648:0.4707	.	727;1714	P13611-2;P13611	.;CSPG2_HUMAN	R	1714;727;727	ENSP00000265077:W1714R;ENSP00000340062:W727R;ENSP00000426251:W727R	ENSP00000265077:W1714R	W	+	1	0	VCAN	82869718	0.023000	0.18921	0.503000	0.27626	0.054000	0.15201	0.285000	0.18883	0.512000	0.28257	0.533000	0.62120	TGG	.		0.428	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
VCAN	1462	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	82836233	82836233	+	Missense_Mutation	SNP	G	G	T	rs370712172		TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr5:82836233G>T	ENST00000265077.3	+	8	7976	c.7411G>T	c.(7411-7413)Gtg>Ttg	p.V2471L	VCAN_ENST00000343200.5_Missense_Mutation_p.V1484L|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000512590.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2471	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	ACATCCTGAGGTGCCAAGCGC	0.458																																					p.V2471L		.											.	VCAN	238	0			c.G7411T						.						94.0	91.0	92.0					5																	82836233		2203	4300	6503	SO:0001583	missense	1462	exon8			CCTGAGGTGCCAA	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.7411G>T	5.37:g.82836233G>T	ENSP00000265077:p.Val2471Leu	116.0	0.0		190.0	55.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	G	8.393	0.840202	0.16891	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.40476	1.03;1.03	5.97	1.77	0.24775	.	0.697942	0.12964	N	0.424758	T	0.35770	0.0943	M	0.64997	1.995	0.09310	N	1	B;B	0.17667	0.023;0.013	B;B	0.16722	0.016;0.007	T	0.24657	-1.0154	10	0.25106	T	0.35	.	6.7271	0.23363	0.1472:0.0:0.5844:0.2684	.	1484;2471	P13611-2;P13611	.;CSPG2_HUMAN	L	2471;1484	ENSP00000265077:V2471L;ENSP00000340062:V1484L	ENSP00000265077:V2471L	V	+	1	0	VCAN	82871989	0.000000	0.05858	0.001000	0.08648	0.128000	0.20619	0.194000	0.17135	0.819000	0.34492	0.655000	0.94253	GTG	.		0.458	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
WDR49	151790	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	167254660	167254660	+	Missense_Mutation	SNP	G	G	A	rs200695837		TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr3:167254660G>A	ENST00000308378.3	-	7	1201	c.896C>T	c.(895-897)aCg>aTg	p.T299M	WDR49_ENST00000479765.1_Intron|WDR49_ENST00000476376.1_Missense_Mutation_p.T124M|WDR49_ENST00000453925.2_Missense_Mutation_p.T363M	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	299										breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						CAATTTACCCGTAACAAGAGT	0.373																																					p.T299M		.											.	WDR49	155	0			c.C896T						.						64.0	60.0	62.0					3																	167254660		2203	4300	6503	SO:0001583	missense	151790	exon7			TTACCCGTAACAA	AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.896C>T	3.37:g.167254660G>A	ENSP00000311343:p.Thr299Met	81.0	0.0		75.0	19.0	NM_178824	Q8N297	Missense_Mutation	SNP	ENST00000308378.3	37	CCDS3201.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.00|15.00	2.702932|2.702932	0.48412|0.48412	.|.	.|.	ENSG00000174776|ENSG00000174776	ENST00000472600|ENST00000308378;ENST00000476376;ENST00000453925	.|T;T;T	.|0.68181	.|-0.31;-0.31;-0.31	5.69|5.69	5.69|5.69	0.88448|0.88448	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.88559|0.88559	0.6469|0.6469	H|H	0.96633|0.96633	3.855|3.855	0.39988|0.39988	D|D	0.975001|0.975001	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.87578	.|0.998;0.997	D|D	0.92253|0.92253	0.5810|0.5810	5|10	.|0.87932	.|D	.|0	.|.	18.5851|18.5851	0.91187|0.91187	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|363;299	.|E7EQK3;Q8IV35	.|.;WDR49_HUMAN	W|M	375|299;124;363	.|ENSP00000311343:T299M;ENSP00000420508:T124M;ENSP00000410863:T363M	.|ENSP00000311343:T299M	R|T	-|-	1|2	2|0	WDR49|WDR49	168737354|168737354	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.003000|0.003000	0.03518|0.03518	6.671000|6.671000	0.74472|0.74472	2.700000|2.700000	0.92200|0.92200	0.655000|0.655000	0.94253|0.94253	CGG|ACG	G|0.999;A|0.001		0.373	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824	
WNT3A	89780	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	228238561	228238561	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr1:228238561G>A	ENST00000284523.1	+	3	596	c.518G>A	c.(517-519)cGg>cAg	p.R173Q	WNT3A_ENST00000366753.2_Missense_Mutation_p.R173Q	NM_033131.3	NP_149122.1	P56704	WNT3A_HUMAN	wingless-type MMTV integration site family, member 3A	173					axis elongation involved in somitogenesis (GO:0090245)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cellular response to retinoic acid (GO:0071300)|COP9 signalosome assembly (GO:0010387)|dorsal/ventral neural tube patterning (GO:0021904)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|mammary gland development (GO:0030879)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesodermal cell fate commitment (GO:0048343)|platelet aggregation (GO:0070527)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000081)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dermatome development (GO:0061184)|positive regulation of mesodermal cell fate specification (GO:0048337)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of receptor internalization (GO:0002092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|regulation of microtubule cytoskeleton organization (GO:0070507)|skeletal muscle cell differentiation (GO:0035914)|spinal cord association neuron differentiation (GO:0021527)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription coactivator activity (GO:0003713)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		Prostate(94;0.0405)				GCCGACGCCCGGGAGAACCGG	0.657																																					p.R173Q		.											.	WNT3A	91	0			c.G518A						.						56.0	56.0	56.0					1																	228238561		2203	4300	6503	SO:0001583	missense	89780	exon3			ACGCCCGGGAGAA	AB060284	CCDS1564.1	1q42	2013-02-28			ENSG00000154342	ENSG00000154342		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	15983	protein-coding gene	gene with protein product		606359				11414706	Standard	NM_033131		Approved		uc001hrq.2	P56704	OTTHUMG00000037593	ENST00000284523.1:c.518G>A	1.37:g.228238561G>A	ENSP00000284523:p.Arg173Gln	123.0	0.0		237.0	46.0	NM_033131	Q3SY79|Q3SY80|Q969P2	Missense_Mutation	SNP	ENST00000284523.1	37	CCDS1564.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.127804	0.77549	.	.	ENSG00000154342	ENST00000284523;ENST00000366753	T;T	0.76578	-1.03;-1.03	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.76169	0.3950	L	0.57130	1.785	0.80722	D	1	B;B	0.27416	0.059;0.178	B;B	0.28139	0.025;0.086	T	0.75181	-0.3408	10	0.45353	T	0.12	.	17.8158	0.88634	0.0:0.0:1.0:0.0	.	173;173	P56704;Q3SY79	WNT3A_HUMAN;.	Q	173	ENSP00000284523:R173Q;ENSP00000355715:R173Q	ENSP00000284523:R173Q	R	+	2	0	WNT3A	226305184	1.000000	0.71417	0.876000	0.34364	0.740000	0.42216	9.787000	0.99055	2.221000	0.72209	0.591000	0.81541	CGG	.		0.657	WNT3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091648.1	NM_033131	
ZFYVE27	118813	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	99517436	99517436	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr10:99517436G>T	ENST00000393677.4	+	12	1331	c.1127G>T	c.(1126-1128)cGa>cTa	p.R376L	ZFYVE27_ENST00000477521.1_3'UTR|ZFYVE27_ENST00000356257.4_Missense_Mutation_p.R381L|ZFYVE27_ENST00000370610.3_Missense_Mutation_p.R276L|ZFYVE27_ENST00000359980.3_Missense_Mutation_p.R369L|ZFYVE27_ENST00000453958.2_3'UTR|ZFYVE27_ENST00000357540.4_Missense_Mutation_p.R283L|ZFYVE27_ENST00000370613.3_Missense_Mutation_p.R251L|ZFYVE27_ENST00000337540.7_Missense_Mutation_p.R337L	NM_144588.6	NP_653189.3	Q5T4F4	ZFY27_HUMAN	zinc finger, FYVE domain containing 27	376					cell death (GO:0008219)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein localization to plasma membrane (GO:0072659)	axon (GO:0030424)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)	metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	8		Colorectal(252;0.0846)		Epithelial(162;7.08e-10)|all cancers(201;5.18e-08)		TTCTGCTCTCGATGCTGCTCC	0.592																																					p.R381L		.											.	ZFYVE27	91	0			c.G1142T						.						123.0	118.0	120.0					10																	99517436		2203	4300	6503	SO:0001583	missense	118813	exon11			GCTCTCGATGCTG	BC030621	CCDS31263.1, CCDS31264.1, CCDS53562.1, CCDS53563.1, CCDS53564.1, CCDS53565.1	10q24.2	2013-09-11			ENSG00000155256	ENSG00000155256		"""Zinc fingers, FYVE domain containing"""	26559	protein-coding gene	gene with protein product	"""protrudin"""	610243				14702039	Standard	NM_144588		Approved	FLJ32919, SPG33	uc001kol.2	Q5T4F4	OTTHUMG00000018867	ENST00000393677.4:c.1127G>T	10.37:g.99517436G>T	ENSP00000377282:p.Arg376Leu	158.0	0.0		172.0	57.0	NM_001002261	B7Z3S0|B7Z404|B7Z626|G8JLC3|G8JLF0|J3KP98|Q5T4F1|Q5T4F2|Q5T4F3|Q8N1K0|Q8N6D6|Q8NCA0|Q8NDE4|Q96M08	Missense_Mutation	SNP	ENST00000393677.4	37	CCDS31263.1	.	.	.	.	.	.	.	.	.	.	G	33	5.208201	0.95033	.	.	ENSG00000155256	ENST00000337540;ENST00000357540;ENST00000370613;ENST00000370610;ENST00000393677;ENST00000359980;ENST00000356257;ENST00000423811	T;T;T;T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07;-1.07;-1.07	5.52	5.52	0.82312	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.87261	0.6133	M	0.67953	2.075	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.997;0.996;1.0;0.999;1.0	D;D;D;D;D;D;D	0.91635	0.998;0.999;0.994;0.995;0.998;0.996;0.999	D	0.87894	0.2686	10	0.66056	D	0.02	-20.3208	17.6242	0.88090	0.0:0.0:1.0:0.0	.	337;276;251;283;381;369;376	B7Z404;B7Z3S0;B7Z626;Q5T4F4-5;Q5T4F4-3;Q5T4F4-2;Q5T4F4	.;.;.;.;.;.;ZFY27_HUMAN	L	337;283;251;276;376;369;381;359	ENSP00000337993:R337L;ENSP00000350148:R283L;ENSP00000359646:R251L;ENSP00000359642:R276L;ENSP00000377282:R376L;ENSP00000353069:R369L;ENSP00000348593:R381L;ENSP00000409594:R359L	ENSP00000337993:R337L	R	+	2	0	ZFYVE27	99507426	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.507000	0.90522	2.600000	0.87896	0.561000	0.74099	CGA	.		0.592	ZFYVE27-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049745.2	NM_144588	
ZNF862	643641	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	149558251	149558251	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr7:149558251G>A	ENST00000223210.4	+	7	2247	c.2002G>A	c.(2002-2004)Gat>Aat	p.D668N	RP4-751H13.7_ENST00000608963.1_RNA	NM_001099220.1	NP_001092690.1	O60290	ZN862_HUMAN	zinc finger protein 862	668					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(1)	34						TGAGACAGCAGATGGGTACTT	0.587																																					p.D668N		.											.	ZNF862	69	0			c.G2002A						.						28.0	30.0	29.0					7																	149558251		2070	4216	6286	SO:0001583	missense	643641	exon7			ACAGCAGATGGGT	AB011115	CCDS47741.1	7q36.1	2013-01-11			ENSG00000106479	ENSG00000106479		"""Zinc fingers, C2H2-type"", ""-"""	34519	protein-coding gene	gene with protein product							Standard	NM_001099220		Approved		uc010lpn.3	O60290	OTTHUMG00000158093	ENST00000223210.4:c.2002G>A	7.37:g.149558251G>A	ENSP00000223210:p.Asp668Asn	177.0	0.0		187.0	63.0	NM_001099220	A0AUL8	Missense_Mutation	SNP	ENST00000223210.4	37	CCDS47741.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.848402	0.32699	.	.	ENSG00000106479	ENST00000223210	T	0.22539	1.95	5.17	5.17	0.71159	Ribonuclease H-like (1);	0.000000	0.52532	D	0.000075	T	0.39489	0.1080	L	0.50333	1.59	0.34382	D	0.693181	D	0.89917	1.0	D	0.80764	0.994	T	0.48559	-0.9025	10	0.41790	T	0.15	-21.8278	14.1976	0.65682	0.0:0.0:1.0:0.0	.	668	O60290	ZN862_HUMAN	N	668	ENSP00000223210:D668N	ENSP00000223210:D668N	D	+	1	0	ZNF862	149189184	0.985000	0.35326	0.163000	0.22734	0.026000	0.11368	4.329000	0.59260	2.407000	0.81776	0.655000	0.94253	GAT	.		0.587	ZNF862-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350165.1	NM_001099220	
CD207	50489	hgsc.bcm.edu;bcgsc.ca	37	2	71062836	71062837	+	Missense_Mutation	DNP	CG	CG	TC	rs202094824	byFrequency	TCGA-DD-A1EG-01A-11D-A20W-10	TCGA-DD-A1EG-10A-01D-A20W-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	50ee360c-e3df-4888-9999-ebb88e271d08	636fb0c9-ce48-45f0-a066-45004952b47f	g.chr2:71062836_71062837CG>TC	ENST00000410009.3	-	1	115_116	c.70_71CG>GA	c.(70-72)CGa>GAa	p.R24E		NM_015717.3	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 molecule, langerin	24					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|defense response to virus (GO:0051607)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)			endometrium(1)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|stomach(1)	20						GTGGCTTGCTCGGGGCCAGAGG	0.545																																					p.R24E		.											.	.	.	0			.						.																																			SO:0001583	missense	50489	.			CTTGCTCGGGGCC	AJ242859	CCDS74520.1	2p13	2011-08-30	2006-03-28		ENSG00000116031	ENSG00000116031		"""C-type lectin domain containing"", ""CD molecules"""	17935	protein-coding gene	gene with protein product		604862	"""CD207 antigen, langerin"""			10661407, 9847074	Standard	NM_015717		Approved	Langerin, CLEC4K	uc002shg.3	Q9UJ71	OTTHUMG00000153176	ENST00000410009.3:c.70_71delinsTC	2.37:g.71062836_71062837delinsTC	ENSP00000386378:p.Arg24Glu	219.0	0.0		253.0	21.0	.		Missense_Mutation	DNP	ENST00000410009.3	37																																																																																				.		0.545	CD207-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000329959.4	NM_015717	
