#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATG16L1	55054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	234171807	234171807	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr2:234171807C>G	ENST00000392017.4	+	3	498	c.241C>G	c.(241-243)Cag>Gag	p.Q81E	ATG16L1_ENST00000392020.4_Missense_Mutation_p.Q81E|ATG16L1_ENST00000373525.5_Intron|ATG16L1_ENST00000392018.1_Missense_Mutation_p.Q81E|ATG16L1_ENST00000347464.5_Intron	NM_001190266.1|NM_001190267.1|NM_030803.6	NP_001177195.1|NP_001177196.1|NP_110430.5	Q676U5	A16L1_HUMAN	autophagy related 16-like 1 (S. cerevisiae)	81					autophagic vacuole assembly (GO:0000045)|negative stranded viral RNA replication (GO:0039689)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(7)|prostate(3)|skin(1)	25		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		GAATGACAATCAGCTACAAGA	0.458																																					p.Q81E		.											.	ATG16L1	90	0			c.C241G						.						136.0	102.0	114.0					2																	234171807		2203	4300	6503	SO:0001583	missense	55054	exon3			GACAATCAGCTAC	AK000897	CCDS2502.2, CCDS2503.2, CCDS54438.1	2q37.1	2014-02-12	2012-06-06	2005-09-13	ENSG00000085978	ENSG00000085978		"""WD repeat domain containing"""	21498	protein-coding gene	gene with protein product		610767	"""APG16 autophagy 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like 1 (S. cerevisiae)"""	APG16L, ATG16L			Standard	NM_017974		Approved	WDR30, FLJ10035, ATG16A	uc002vty.3	Q676U5	OTTHUMG00000133619	ENST00000392017.4:c.241C>G	2.37:g.234171807C>G	ENSP00000375872:p.Gln81Glu	94.0	0.0		59.0	17.0	NM_017974	A3EXK9|A3EXL0|B6ZDH0|Q6IPN1|Q6UXW4|Q6ZVZ5|Q8NCY2|Q96JV5|Q9H619	Missense_Mutation	SNP	ENST00000392017.4	37	CCDS2503.2	.	.	.	.	.	.	.	.	.	.	C	14.23	2.473236	0.43942	.	.	ENSG00000085978	ENST00000392017;ENST00000417017;ENST00000392020;ENST00000392018	T;T;T	0.50001	0.76;0.8;0.78	5.17	4.28	0.50868	Autophagy-related protein 16 (1);	0.268520	0.30401	U	0.009713	T	0.37073	0.0990	N	0.25890	0.77	0.80722	D	1	B;B	0.29862	0.218;0.259	B;B	0.30943	0.117;0.122	T	0.17167	-1.0378	10	0.38643	T	0.18	.	15.2032	0.73157	0.1419:0.8581:0.0:0.0	.	81;81	Q676U5-2;Q676U5	.;A16L1_HUMAN	E	81	ENSP00000375872:Q81E;ENSP00000375875:Q81E;ENSP00000375873:Q81E	ENSP00000375872:Q81E	Q	+	1	0	ATG16L1	233836546	1.000000	0.71417	0.851000	0.33527	0.874000	0.50279	7.101000	0.76997	1.269000	0.44280	0.650000	0.86243	CAG	.		0.458	ATG16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257069.2	NM_017974	
C1orf94	84970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	34667861	34667861	+	Splice_Site	SNP	G	G	T			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr1:34667861G>T	ENST00000488417.1	+	4	1566		c.e4+1		C1orf94_ENST00000373374.3_Splice_Site	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94											central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				GCAGTATCAGGTCAGTGAGCT	0.547																																					.		.											.	C1orf94	90	0			c.876+1G>T						.						138.0	121.0	127.0					1																	34667861		2203	4300	6503	SO:0001630	splice_region_variant	84970	exon4			TATCAGGTCAGTG	AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.1446+1G>T	1.37:g.34667861G>T		103.0	0.0		77.0	27.0	NM_032884	B3KVT1|D3DPR3|E9PJ76|Q96IC8	Splice_Site	SNP	ENST00000488417.1	37	CCDS44108.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.882573	0.33255	.	.	ENSG00000142698	ENST00000373374;ENST00000488417	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3446	0.74327	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C1orf94	34440448	1.000000	0.71417	1.000000	0.80357	0.138000	0.21146	5.405000	0.66351	2.695000	0.91970	0.462000	0.41574	.	.		0.547	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036845.2	NM_032884	Intron
C2orf44	80304	broad.mit.edu;bcgsc.ca	37	2	24262242	24262242	+	Silent	SNP	A	A	G			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr2:24262242A>G	ENST00000295148.4	-	2	180	c.123T>C	c.(121-123)ctT>ctC	p.L41L	C2orf44_ENST00000406895.3_Silent_p.L41L	NM_025203.2	NP_079479.1	Q9H6R7	CB044_HUMAN	chromosome 2 open reading frame 44	41									C2orf44/ALK(2)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCCACTGTGAAGCCGCAAAT	0.517			T	ALK	NSCLC																																p.L41L		.		Dom	yes		2	2p23.3	80304	chromosome 2 open reading frame 44		E	.	C2orf44	154	0			c.T123C						.						121.0	107.0	111.0					2																	24262242		2203	4300	6503	SO:0001819	synonymous_variant	80304	exon2			ACTGTGAAGCCGC	AK025598	CCDS1705.1, CCDS46229.1	2p23.3	2012-07-30			ENSG00000163026	ENSG00000163026			26157	protein-coding gene	gene with protein product						22327622	Standard	NM_025203		Approved	FLJ21945	uc002rep.2	Q9H6R7	OTTHUMG00000125498	ENST00000295148.4:c.123T>C	2.37:g.24262242A>G		123.0	0.0		108.0	6.0	NM_025203	D6W532|Q8IYK0|Q9HBP5	Silent	SNP	ENST00000295148.4	37	CCDS1705.1																																																																																			.		0.517	C2orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246825.1	NM_025203	
C8orf86	389649	broad.mit.edu;bcgsc.ca	37	8	38370074	38370074	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr8:38370074A>G	ENST00000358138.1	-	3	527	c.503T>C	c.(502-504)cTc>cCc	p.L168P	C8orf86_ENST00000437935.2_Silent_p.S110S	NM_207412.1	NP_997295.1	Q6ZUL3	CH086_HUMAN	chromosome 8 open reading frame 86	168										breast(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						gttcaagcagagaggactgcg	0.522																																					p.L168P		.											.	C8orf86	90	0			c.T503C						.						74.0	76.0	75.0					8																	38370074		2203	4300	6503	SO:0001583	missense	389649	exon3			AAGCAGAGAGGAC	BC137511	CCDS6108.1	8p12-p11.23	2009-03-03			ENSG00000196166	ENSG00000196166			33774	protein-coding gene	gene with protein product							Standard	NM_207412		Approved	FLJ43582	uc003xlx.1	Q6ZUL3	OTTHUMG00000163992	ENST00000358138.1:c.503T>C	8.37:g.38370074A>G	ENSP00000350856:p.Leu168Pro	82.0	0.0		89.0	5.0	NM_207412	A4QPB7	Missense_Mutation	SNP	ENST00000358138.1	37	CCDS6108.1	.	.	.	.	.	.	.	.	.	.	A	4.401	0.073985	0.08485	.	.	ENSG00000196166	ENST00000358138	T	0.58210	0.35	2.82	1.67	0.24075	.	.	.	.	.	T	0.40719	0.1128	N	0.08118	0	0.09310	N	0.999999	D	0.60160	0.987	P	0.55391	0.775	T	0.18587	-1.0332	9	0.87932	D	0	.	4.3993	0.11379	0.8432:0.0:0.1568:0.0	.	168	Q6ZUL3	CH086_HUMAN	P	168	ENSP00000350856:L168P	ENSP00000350856:L168P	L	-	2	0	C8orf86	38489231	0.002000	0.14202	0.001000	0.08648	0.131000	0.20780	0.699000	0.25586	0.511000	0.28236	0.459000	0.35465	CTC	.		0.522	C8orf86-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376668.1	NM_207412	
CA3	761	broad.mit.edu;bcgsc.ca	37	8	86360370	86360370	+	Silent	SNP	T	T	C			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr8:86360370T>C	ENST00000285381.2	+	7	854	c.771T>C	c.(769-771)gcT>gcC	p.A257A	RP11-317J10.2_ENST00000521761.1_RNA|RP11-317J10.2_ENST00000517697.1_RNA	NM_005181.3	NP_005172.1	P07451	CAH3_HUMAN	carbonic anhydrase III, muscle specific	257					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|response to ethanol (GO:0045471)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	carbonate dehydratase activity (GO:0004089)|nickel cation binding (GO:0016151)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23					Acetazolamide(DB00819)|Zonisamide(DB00909)	TGGTGAGAGCTTCCTTCAAAT	0.552																																					p.A257A		.											.	CA3	514	0			c.T771C						.						57.0	52.0	54.0					8																	86360370		2203	4300	6503	SO:0001819	synonymous_variant	761	exon7			GAGAGCTTCCTTC	AJ006473	CCDS6238.1	8q21.2	2012-10-02					4.2.1.1	"""Carbonic anhydrases"""	1374	protein-coding gene	gene with protein product		114750				6221502	Standard	NM_005181		Approved	Car3, CAIII	uc003ydj.3	P07451		ENST00000285381.2:c.771T>C	8.37:g.86360370T>C		72.0	0.0		77.0	5.0	NM_005181	B2R867|B3KUC8|O60842	Silent	SNP	ENST00000285381.2	37	CCDS6238.1																																																																																			.		0.552	CA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381090.1	NM_005181	
CMYA5	202333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	79035108	79035108	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr5:79035108C>A	ENST00000446378.2	+	2	10551	c.10520C>A	c.(10519-10521)tCc>tAc	p.S3507Y		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3507					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CTGAAAAAGTCCCAGATTGAC	0.433																																					p.S3507Y		.											.	CMYA5	77	0			c.C10520A						.						75.0	68.0	70.0					5																	79035108		1945	4141	6086	SO:0001583	missense	202333	exon2			AAAAGTCCCAGAT	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.10520C>A	5.37:g.79035108C>A	ENSP00000394770:p.Ser3507Tyr	51.0	0.0		96.0	38.0	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.447203	0.43429	.	.	ENSG00000164309	ENST00000446378	T	0.24908	1.83	6.03	6.03	0.97812	.	0.949871	0.08775	N	0.895669	T	0.46718	0.1407	L	0.46157	1.445	0.34133	D	0.665476	D	0.69078	0.997	P	0.57283	0.817	T	0.52563	-0.8559	10	0.87932	D	0	.	20.5666	0.99351	0.0:1.0:0.0:0.0	.	3507	Q8N3K9	CMYA5_HUMAN	Y	3507	ENSP00000394770:S3507Y	ENSP00000394770:S3507Y	S	+	2	0	CMYA5	79070864	0.595000	0.26857	0.942000	0.38095	0.047000	0.14425	2.171000	0.42453	2.854000	0.98071	0.655000	0.94253	TCC	.		0.433	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
CORO1C	23603	ucsc.edu;bcgsc.ca	37	12	109055931	109055931	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr12:109055931A>G	ENST00000261401.3	-	4	494	c.322T>C	c.(322-324)Tgg>Cgg	p.W108R	CORO1C_ENST00000549384.1_Intron|CORO1C_ENST00000541050.1_Missense_Mutation_p.W108R|CORO1C_ENST00000421578.2_Missense_Mutation_p.W3R|CORO1C_ENST00000420959.2_Missense_Mutation_p.W161R|CORO1C_ENST00000549772.1_Missense_Mutation_p.W114R	NM_001105237.2|NM_001276471.1|NM_014325.2	NP_001098707.1|NP_001263400.1|NP_055140.1	Q9ULV4	COR1C_HUMAN	coronin, actin binding protein, 1C	108					actin cytoskeleton organization (GO:0030036)|phagocytosis (GO:0006909)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|skin(4)	24						GGGATCTGCCATACCTGTTGG	0.443																																					p.P108P		.											.	CORO1C	228	0			c.C322C						.						90.0	73.0	79.0					12																	109055931		2203	4300	6503	SO:0001583	missense	23603	exon4			TCTGCCATACCTG	BC002342	CCDS9120.1, CCDS61236.1	12q24.1	2013-01-10	2001-11-28			ENSG00000110880		"""Coronins"", ""WD repeat domain containing"""	2254	protein-coding gene	gene with protein product		605269	"""coronin, actin-binding protein, 1C"""			9778037, 10461187	Standard	NM_014325		Approved	coronin-3, HCRNN4	uc009zva.4	Q9ULV4		ENST00000261401.3:c.322T>C	12.37:g.109055931A>G	ENSP00000261401:p.Trp108Arg	35.0	0.0		45.0	4.0	NM_014325	A7MAP0|A7MAP1|B3KU12|Q9NSK5	Silent	SNP	ENST00000261401.3	37	CCDS9120.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.279025	0.80692	.	.	ENSG00000110880	ENST00000261401;ENST00000541050;ENST00000421578;ENST00000549772;ENST00000420959;ENST00000552871;ENST00000547294;ENST00000550032;ENST00000551550;ENST00000546571;ENST00000551044	D;D;T;D;D;D;D;D;D;D;D	0.88818	-1.73;-1.73;4.38;-1.73;-1.73;-2.43;-1.73;-1.73;-1.73;-1.73;-1.73	5.01	5.01	0.66863	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.96741	0.8936	H	0.98333	4.205	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.998	D	0.98287	1.0511	10	0.87932	D	0	-13.9521	14.7594	0.69593	1.0:0.0:0.0:0.0	.	108;161;108	B4DMH3;A7MAP1;Q9ULV4	.;.;COR1C_HUMAN	R	108;108;3;114;161;3;108;108;108;108;108	ENSP00000261401:W108R;ENSP00000438341:W108R;ENSP00000415554:W3R;ENSP00000447534:W114R;ENSP00000394496:W161R;ENSP00000449658:W3R;ENSP00000449330:W108R;ENSP00000447989:W108R;ENSP00000448527:W108R;ENSP00000448195:W108R;ENSP00000447049:W108R	ENSP00000261401:W108R	W	-	1	0	CORO1C	107580060	1.000000	0.71417	0.983000	0.44433	0.994000	0.84299	8.833000	0.92089	1.891000	0.54761	0.528000	0.53228	TGG	.		0.443	CORO1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403802.1	NM_014325	
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	2876120	2876120	+	Silent	SNP	C	C	T	rs374916113		TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr8:2876120C>T	ENST00000520002.1	-	53	8466	c.7911G>A	c.(7909-7911)acG>acA	p.T2637T	CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000400186.3_Intron|CSMD1_ENST00000542608.1_Intron|CSMD1_ENST00000602557.1_Silent_p.T2637T|CSMD1_ENST00000537824.1_Silent_p.T2636T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2637	Sushi 17. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.T2636T(2)|p.T2365T(2)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AAACTGTCAACGTTCCAATCT	0.453																																					p.T2636T		.											.	CSMD1	86	4	Substitution - coding silent(4)	large_intestine(2)|prostate(2)	c.G7908A						.	C		1,3869		0,1,1934	146.0	142.0	143.0		7908	-4.7	0.0	8		143	0,8274		0,0,4137	no	coding-synonymous	CSMD1	NM_033225.5		0,1,6071	TT,TC,CC		0.0,0.0258,0.0082		2636/3565	2876120	1,12143	1935	4137	6072	SO:0001819	synonymous_variant	64478	exon52			TGTCAACGTTCCA			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7911G>A	8.37:g.2876120C>T		76.0	0.0		71.0	25.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	C	0.142	-1.101143	0.01843	2.58E-4	0.0	ENSG00000183117	ENST00000335551	.	.	.	5.19	-4.65	0.03339	.	.	.	.	.	T	0.35248	0.0925	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39742	-0.9599	4	.	.	.	.	0.4281	0.00467	0.258:0.1481:0.2267:0.3671	.	.	.	.	I	2054	.	.	V	-	1	0	CSMD1	2863527	0.000000	0.05858	0.013000	0.15412	0.062000	0.15995	-4.050000	0.00305	-0.544000	0.06232	-0.137000	0.14449	GTT	.		0.453	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CTDNEP1	23399	ucsc.edu;bcgsc.ca	37	17	7150596	7150596	+	Splice_Site	SNP	C	C	T			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr17:7150596C>T	ENST00000573600.1	-	3	590	c.169G>A	c.(169-171)Gcc>Acc	p.A57T	CTDNEP1_ENST00000318988.6_Splice_Site_p.A57T|CTDNEP1_ENST00000574322.1_Splice_Site_p.A57T|CTD-2545G14.7_ENST00000570760.2_5'Flank|CTDNEP1_ENST00000572043.1_5'UTR|RP1-4G17.5_ENST00000577138.1_3'UTR			O95476	CNEP1_HUMAN	CTD nuclear envelope phosphatase 1	57	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.				gamete generation (GO:0007276)|mesoderm development (GO:0007498)|nuclear envelope organization (GO:0006998)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of triglyceride biosynthetic process (GO:0010867)|protein dephosphorylation (GO:0006470)|protein localization to nucleus (GO:0034504)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|Nem1-Spo7 phosphatase complex (GO:0071595)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(9)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	15						ACATACTTACCTAGCCGATTC	0.488																																					p.A57T		.											.	CTDNEP1	91	0			c.G169A						.						66.0	61.0	63.0					17																	7150596		2203	4300	6503	SO:0001630	splice_region_variant	23399	exon2			ACTTACCTAGCCG	AJ011916	CCDS11093.1	17p13	2012-11-27	2010-10-27	2010-10-27	ENSG00000175826	ENSG00000175826		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	19085	protein-coding gene	gene with protein product	"""C-terminal domain nuclear envelope phosphatase 1"""	610684	"""dullard homolog (Xenopus laevis)"""	DULLARD		12083771, 17141153	Standard	NM_015343		Approved	HSA011916, NET56	uc002gfd.2	O95476	OTTHUMG00000102180	ENST00000573600.1:c.169+1G>A	17.37:g.7150596C>T		97.0	0.0		70.0	6.0	NM_001143775	D3DTN7|Q96GQ9	Missense_Mutation	SNP	ENST00000573600.1	37	CCDS11093.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.547286	0.27652	.	.	ENSG00000175826	ENST00000318988	T	0.17054	2.3	5.44	3.42	0.39159	NLI interacting factor (1);HAD-like domain (1);	0.325746	0.36591	N	0.002508	T	0.10637	0.0260	L	0.29908	0.895	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.16158	-1.0412	9	.	.	.	-1.2319	6.8981	0.24267	0.0:0.7186:0.0:0.2813	.	57	O95476	CNEP1_HUMAN	T	57	ENSP00000321732:A57T	.	A	-	1	0	CTDNEP1	7091320	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	2.491000	0.45303	0.824000	0.34613	0.650000	0.86243	GCC	.		0.488	CTDNEP1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440215.1	NM_015343	Missense_Mutation
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41268766	41268766	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr3:41268766A>T	ENST00000349496.5	+	7	1284	c.1004A>T	c.(1003-1005)aAa>aTa	p.K335I	CTNNB1_ENST00000396183.3_Missense_Mutation_p.K335I|CTNNB1_ENST00000405570.1_Missense_Mutation_p.K335I|CTNNB1_ENST00000396185.3_Missense_Mutation_p.K335I|CTNNB1_ENST00000453024.1_Missense_Mutation_p.K328I	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	335					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.K335I(8)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACTTACGAAAAACTACTGTGG	0.383		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.K335I	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,Wilms_tumour,0	CTNNB1	24361	8	Substitution - Missense(8)	liver(7)|kidney(1)	c.A1004T						.						110.0	108.0	109.0					3																	41268766		2203	4300	6503	SO:0001583	missense	1499	exon7	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACGAAAAACTACT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1004A>T	3.37:g.41268766A>T	ENSP00000344456:p.Lys335Ile	113.0	0.0		76.0	33.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	29.8	5.040885	0.93685	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.82148	0.4974	M	0.89287	3.02	0.80722	D	1	D;D	0.71674	0.995;0.998	D;D	0.75484	0.97;0.986	D	0.85830	0.1391	10	0.72032	D	0.01	-3.7939	15.5934	0.76558	1.0:0.0:0.0:0.0	.	263;335	B4DSW9;P35222	.;CTNB1_HUMAN	I	335;335;335;328;335	ENSP00000385604:K335I;ENSP00000379486:K335I;ENSP00000344456:K335I;ENSP00000411226:K328I;ENSP00000379488:K335I	ENSP00000344456:K335I	K	+	2	0	CTNNB1	41243770	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	9.339000	0.96797	2.094000	0.63399	0.482000	0.46254	AAA	.		0.383	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CUX2	23316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	111746258	111746258	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr12:111746258C>A	ENST00000261726.6	+	14	1340	c.1186C>A	c.(1186-1188)Ctt>Att	p.L396I		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	396					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						AGACTCACTGCTTATTGCAAA	0.617																																					p.L396I		.											.	CUX2	140	0			c.C1186A						.						46.0	46.0	46.0					12																	111746258		1985	4169	6154	SO:0001583	missense	23316	exon14			TCACTGCTTATTG	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.1186C>A	12.37:g.111746258C>A	ENSP00000261726:p.Leu396Ile	103.0	0.0		88.0	41.0	NM_015267	A7E2Y4	Missense_Mutation	SNP	ENST00000261726.6	37	CCDS41837.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.479041	0.63849	.	.	ENSG00000111249	ENST00000261726	T	0.60797	0.16	5.04	4.05	0.47172	.	0.070259	0.64402	D	0.000015	T	0.51329	0.1668	M	0.69358	2.11	0.41703	D	0.989411	P	0.39424	0.673	B	0.35813	0.211	T	0.59663	-0.7412	10	0.66056	D	0.02	-26.8714	8.6614	0.34095	0.1636:0.748:0.0:0.0884	.	396	O14529	CUX2_HUMAN	I	396	ENSP00000261726:L396I	ENSP00000261726:L396I	L	+	1	0	CUX2	110230641	1.000000	0.71417	0.711000	0.30485	0.972000	0.66771	1.831000	0.39141	2.344000	0.79699	0.313000	0.20887	CTT	.		0.617	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267	
DNAH11	8701	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	21657266	21657266	+	Silent	SNP	C	C	T	rs570983771		TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr7:21657266C>T	ENST00000409508.3	+	23	4156	c.4125C>T	c.(4123-4125)cgC>cgT	p.R1375R	DNAH11_ENST00000328843.6_Silent_p.R1380R	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1380	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						AGGAAGTCCGCGTCTGGGATG	0.483									Kartagener syndrome																												.		.											.	DNAH11	146	0			.						.						54.0	54.0	54.0					7																	21657266		1882	4106	5988	SO:0001819	synonymous_variant	8701	.	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AGTCCGCGTCTGG	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.4125C>T	7.37:g.21657266C>T		73.0	0.0		49.0	17.0	.	Q9UJ82	Silent	SNP	ENST00000409508.3	37																																																																																				.		0.483	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
DTX3	196403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	58001190	58001190	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr12:58001190C>T	ENST00000548198.1	+	3	2048	c.544C>T	c.(544-546)Cat>Tat	p.H182Y	DTX3_ENST00000551632.1_Missense_Mutation_p.H185Y|ARHGEF25_ENST00000333972.7_5'Flank|DTX3_ENST00000548804.1_Missense_Mutation_p.H182Y|DTX3_ENST00000337737.3_Missense_Mutation_p.H182Y			Q8N9I9	DTX3_HUMAN	deltex 3, E3 ubiquitin ligase	182					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)|urinary_tract(1)	12	Melanoma(17;0.122)					GAAGTGCCGGCATTCATTCTG	0.617																																					p.H182Y		.											.	DTX3	1083	0			c.C544T						.						23.0	25.0	25.0					12																	58001190		1917	4111	6028	SO:0001583	missense	196403	exon5			TGCCGGCATTCAT	AK094385	CCDS41800.1, CCDS66410.1	12q13.2	2014-01-28	2014-01-28			ENSG00000178498		"""RING-type (C3HC4) zinc fingers"""	24457	protein-coding gene	gene with protein product		613142	"""deltex 3 homolog (Drosophila)"", ""deltex homolog 3 (Drosophila)"""			12670957	Standard	XM_005268697		Approved	FLJ34766, RNF154	uc001sow.1	Q8N9I9		ENST00000548198.1:c.544C>T	12.37:g.58001190C>T	ENSP00000447873:p.His182Tyr	89.0	0.0		85.0	35.0	NM_178502	Q53ZZ2|Q8NAU6|Q8NDS8	Missense_Mutation	SNP	ENST00000548198.1	37	CCDS41800.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.602260	0.87055	.	.	ENSG00000178498	ENST00000548804;ENST00000549583;ENST00000337737;ENST00000548198;ENST00000551632;ENST00000548478	D;D;D;D;D;D	0.98012	-4.66;-4.66;-4.66;-4.66;-4.66;-4.66	4.41	4.41	0.53225	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	D	0.98960	0.9646	H	0.96333	3.805	0.80722	D	1	P	0.51240	0.943	P	0.60415	0.874	D	0.99353	1.0915	10	0.72032	D	0.01	-10.3154	14.9011	0.70681	0.0:1.0:0.0:0.0	.	182	Q8N9I9	DTX3_HUMAN	Y	182;185;182;182;185;175	ENSP00000449294:H182Y;ENSP00000449688:H185Y;ENSP00000338050:H182Y;ENSP00000447873:H182Y;ENSP00000448696:H185Y;ENSP00000448224:H175Y	ENSP00000338050:H182Y	H	+	1	0	DTX3	56287457	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.640000	0.67875	2.189000	0.69895	0.549000	0.68633	CAT	.		0.617	DTX3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407848.1	NM_178502	
EIF2B5	8893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	183855595	183855595	+	Splice_Site	SNP	T	T	A			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr3:183855595T>A	ENST00000273783.3	+	3	628		c.e3+2		EIF2B5_ENST00000498831.1_Splice_Site|EIF2B5_ENST00000444495.1_Splice_Site|RP11-778D9.12_ENST00000608135.1_RNA|RP11-778D9.12_ENST00000608232.1_RNA	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa						astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			GGAACACAGGTCAGGATGGGA	0.483																																					.		.											.	EIF2B5	95	0			c.506+2T>A						.						114.0	100.0	104.0					3																	183855595		2203	4300	6503	SO:0001630	splice_region_variant	8893	exon3			CACAGGTCAGGAT	U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.506+2T>A	3.37:g.183855595T>A		108.0	0.0		119.0	47.0	NM_003907	Q541Z1|Q96D04	Splice_Site	SNP	ENST00000273783.3	37	CCDS3252.1	.	.	.	.	.	.	.	.	.	.	T	18.26	3.584153	0.65992	.	.	ENSG00000145191	ENST00000273783;ENST00000444495	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1596	0.81693	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	EIF2B5	185338289	1.000000	0.71417	0.995000	0.50966	0.741000	0.42261	7.948000	0.87774	2.216000	0.71823	0.533000	0.62120	.	.		0.483	EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346168.1		Intron
ELOVL7	79993	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	60083199	60083199	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr5:60083199C>A	ENST00000508821.1	-	3	340	c.26G>T	c.(25-27)aGg>aTg	p.R9M	ELOVL7_ENST00000438340.1_Missense_Mutation_p.R9M|ELOVL7_ENST00000425382.1_Missense_Mutation_p.R9M|ELOVL7_ENST00000505959.1_De_novo_Start_OutOfFrame	NM_024930.2	NP_079206.2	A1L3X0	ELOV7_HUMAN	ELOVL fatty acid elongase 7	9					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	9		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				ATGCACAGTCCTCGATGTAAG	0.338																																					p.R9M		.											.	ELOVL7	90	0			c.G26T						.						125.0	120.0	122.0					5																	60083199		2203	4300	6503	SO:0001583	missense	79993	exon2			ACAGTCCTCGATG	AK027216	CCDS34164.1	5q12	2011-05-25	2011-05-25			ENSG00000164181			26292	protein-coding gene	gene with protein product		614451	"""ELOVL family member 7, elongation of long chain fatty acids (yeast)"""			19826053	Standard	NM_024930		Approved	FLJ23563	uc010iwk.3	A1L3X0		ENST00000508821.1:c.26G>T	5.37:g.60083199C>A	ENSP00000424123:p.Arg9Met	73.0	0.0		54.0	28.0	NM_001104558	Q589T3|Q9H5D0|Q9NT66	Missense_Mutation	SNP	ENST00000508821.1	37	CCDS34164.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.635006	0.47049	.	.	ENSG00000164181	ENST00000508821;ENST00000438340;ENST00000425382;ENST00000507047;ENST00000511799	T;T;T	0.23754	1.89;1.89;1.89	5.54	5.54	0.83059	.	0.268678	0.42682	D	0.000676	T	0.19446	0.0467	L	0.38531	1.155	0.37472	D	0.915655	P	0.37038	0.579	B	0.34418	0.182	T	0.05767	-1.0865	10	0.44086	T	0.13	-13.5378	10.2701	0.43479	0.0:0.9131:0.0:0.0869	.	9	A1L3X0	ELOV7_HUMAN	M	9	ENSP00000424123:R9M;ENSP00000411255:R9M;ENSP00000402634:R9M	ENSP00000402634:R9M	R	-	2	0	ELOVL7	60118956	0.756000	0.28383	0.993000	0.49108	0.991000	0.79684	2.504000	0.45416	2.880000	0.98712	0.650000	0.86243	AGG	.		0.338	ELOVL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368195.1		
EPHA6	285220	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	96706703	96706703	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr3:96706703G>A	ENST00000389672.5	+	3	1018	c.980G>A	c.(979-981)cGg>cAg	p.R327Q	EPHA6_ENST00000470610.2_Missense_Mutation_p.R327Q|EPHA6_ENST00000542517.1_Missense_Mutation_p.R233Q	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	233						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						GTTGAAGTACGGGGTTCTTGT	0.478																																					p.R327Q		.											.	EPHA6	1561	0			c.G980A						.						187.0	182.0	183.0					3																	96706703		1955	4164	6119	SO:0001583	missense	285220	exon3			AAGTACGGGGTTC	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.980G>A	3.37:g.96706703G>A	ENSP00000374323:p.Arg327Gln	138.0	2.0		120.0	47.0	NM_001080448	D6RAL5	Missense_Mutation	SNP	ENST00000389672.5	37	CCDS46876.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.095980	0.76870	.	.	ENSG00000080224	ENST00000470610;ENST00000389672;ENST00000542517	T;T;T	0.75050	5.02;-0.9;4.46	5.35	3.54	0.40534	.	0.574193	0.15137	U	0.278528	D	0.84889	0.5572	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.995	T	0.82577	-0.0388	10	0.59425	D	0.04	.	9.2406	0.37493	0.0755:0.0:0.7789:0.1456	.	327;327	B3KS12;E7EU71	.;.	Q	327;327;233	ENSP00000420598:R327Q;ENSP00000374323:R327Q;ENSP00000439758:R233Q	ENSP00000374323:R327Q	R	+	2	0	EPHA6	98189393	1.000000	0.71417	0.800000	0.32199	0.991000	0.79684	6.519000	0.73768	0.616000	0.30141	0.650000	0.86243	CGG	.		0.478	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448	
EPHX3	79852	broad.mit.edu;bcgsc.ca	37	19	15338688	15338688	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr19:15338688T>C	ENST00000221730.3	-	6	971	c.751A>G	c.(751-753)Aca>Gca	p.T251A	EPHX3_ENST00000602233.1_Missense_Mutation_p.T251A|EPHX3_ENST00000435261.1_Missense_Mutation_p.T251A	NM_024794.2	NP_079070.1	Q9H6B9	EPHX3_HUMAN	epoxide hydrolase 3	251						extracellular region (GO:0005576)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(1)	7						GGGATGCCTGTCTTGCGGTGG	0.597																																					p.T251A		.											.	EPHX3	90	0			c.A751G						.						70.0	59.0	63.0					19																	15338688		2203	4300	6503	SO:0001583	missense	79852	exon7			TGCCTGTCTTGCG	AK026061	CCDS12327.1	19p13.13	2011-10-05	2009-04-06	2009-04-06	ENSG00000105131	ENSG00000105131		"""Abhydrolase domain containing"""	23760	protein-coding gene	gene with protein product			"""abhydrolase domain containing 9"""	ABHD9			Standard	NM_024794		Approved	FLJ22408	uc002nap.3	Q9H6B9		ENST00000221730.3:c.751A>G	19.37:g.15338688T>C	ENSP00000221730:p.Thr251Ala	78.0	0.0		86.0	4.0	NM_001142886	A3KMR3	Missense_Mutation	SNP	ENST00000221730.3	37	CCDS12327.1	.	.	.	.	.	.	.	.	.	.	T	10.37	1.330712	0.24167	.	.	ENSG00000105131	ENST00000221730;ENST00000435261	T;T	0.03413	3.94;3.94	5.31	1.91	0.25777	.	1.522510	0.04084	N	0.310078	T	0.03011	0.0089	N	0.21324	0.655	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.46693	-0.9173	10	0.08837	T	0.75	-3.1611	5.2297	0.15414	0.3161:0.0:0.1646:0.5193	.	251	Q9H6B9	EPHX3_HUMAN	A	251	ENSP00000221730:T251A;ENSP00000410323:T251A	ENSP00000221730:T251A	T	-	1	0	EPHX3	15199688	0.832000	0.29368	0.479000	0.27329	0.045000	0.14185	0.888000	0.28268	0.078000	0.16900	-0.516000	0.04426	ACA	.		0.597	EPHX3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465797.1	NM_024794	
FBXW8	26259	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	117465265	117465265	+	Silent	SNP	G	G	A	rs188048498	byFrequency	TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr12:117465265G>A	ENST00000309909.5	+	10	1690	c.1608G>A	c.(1606-1608)acG>acA	p.T536T	FBXW8_ENST00000455858.2_Silent_p.T470T			Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8	536			T -> M (in dbSNP:rs3741466).		cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|labyrinthine layer blood vessel development (GO:0060716)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|spongiotrophoblast layer development (GO:0060712)	Cul7-RING ubiquitin ligase complex (GO:0031467)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)				endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	22	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		CTTACCAGACGGTAATGCGAA	0.567													G|||	2	0.000399361	0.0015	0.0	5008	,	,		18953	0.0		0.0	False		,,,				2504	0.0				p.T536T		.											.	FBXW8	229	0			c.G1608A						.																																			SO:0001819	synonymous_variant	26259	exon10			CCAGACGGTAATG	AF176707	CCDS9182.1, CCDS44988.1	12q24.23	2013-01-09	2007-02-08	2003-06-13				"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13597	protein-coding gene	gene with protein product		609073	"""F-box only protein 29"", ""F-box and WD-40 domain protein 8"""	FBXO29		10531035, 10531037	Standard	NM_012174		Approved	FBX29, FBW6, FBW8	uc001twg.1	Q8N3Y1	OTTHUMG00000169329	ENST00000309909.5:c.1608G>A	12.37:g.117465265G>A		30.0	0.0		37.0	18.0	NM_153348	Q9UK95	Silent	SNP	ENST00000309909.5	37	CCDS9182.1																																																																																			G|0.999;A|0.001		0.567	FBXW8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403561.1	NM_012174	
GGN	199720	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	38877740	38877740	+	Silent	SNP	G	G	A			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr19:38877740G>A	ENST00000334928.6	-	3	294	c.162C>T	c.(160-162)agC>agT	p.S54S	AC005789.9_ENST00000585411.1_RNA|GGN_ENST00000591809.1_Intron|SPRED3_ENST00000587013.1_5'Flank|SPRED3_ENST00000586301.1_5'Flank	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	54	Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGGGTGTGGCGCTGCCAGGGA	0.711																																					p.S54S		.											.	GGN	90	0			c.C162T						.						13.0	14.0	14.0					19																	38877740		2137	4173	6310	SO:0001819	synonymous_variant	199720	exon3			TGTGGCGCTGCCA	AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.162C>T	19.37:g.38877740G>A		25.0	0.0		20.0	4.0	NM_152657	Q7RTU6|Q86UU4|Q8NAA1	Silent	SNP	ENST00000334928.6	37	CCDS12516.1																																																																																			.		0.711	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459205.1	NM_152657	
GPAM	57678	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	113913361	113913364	+	Frame_Shift_Del	DEL	GAGG	GAGG	-			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	GAGG	GAGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr10:113913361_113913364delGAGG	ENST00000348367.4	-	22	2628_2631	c.2431_2434delCCTC	c.(2431-2436)cctcaafs	p.PQ811fs	GPAM_ENST00000423155.1_Frame_Shift_Del_p.PQ811fs			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	811					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		CGGTTGCATTGAGGTAGAAAAGTG	0.373																																					p.811_812del	Ovarian(161;1017 2606 18293 52943)	.											.	GPAM	92	0			c.2431_2434del						.																																			SO:0001589	frameshift_variant	57678	exon22			TGCATTGAGGTAG	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.2431_2434delCCTC	10.37:g.113913361_113913364delGAGG	ENSP00000265276:p.Pro811fs	68.0	0.0		59.0	21.0	NM_020918	Q5VW51|Q86TA3	Frame_Shift_Del	DEL	ENST00000348367.4	37	CCDS7570.1																																																																																			.		0.373	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
GUSB	2990	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	65435332	65435332	+	Silent	SNP	T	T	C			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr7:65435332T>C	ENST00000304895.4	-	9	1543	c.1413A>G	c.(1411-1413)aaA>aaG	p.K471K	GUSB_ENST00000345660.6_Silent_p.K420K|GUSB_ENST00000421103.1_Silent_p.K325K	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	471					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)			breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						GGTCCAAGGATTTGGTGTGAG	0.572																																					p.K471K		.											.	GUSB	90	0			c.A1413G						.						89.0	87.0	88.0					7																	65435332		2203	4300	6503	SO:0001819	synonymous_variant	2990	exon9			CAAGGATTTGGTG	M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.1413A>G	7.37:g.65435332T>C		31.0	0.0		34.0	13.0	NM_000181	B4E1F6|E9PCV0|Q549U0|Q96CL9	Silent	SNP	ENST00000304895.4	37	CCDS5530.1																																																																																			.		0.572	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251637.3	NM_000181	
H2AFY2	55506	hgsc.bcm.edu;bcgsc.ca	37	10	71835423	71835423	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr10:71835423delC	ENST00000373255.4	+	2	273	c.9delC	c.(7-9)ggcfs	p.G3fs		NM_018649.2	NP_061119.1	Q9P0M6	H2AW_HUMAN	H2A histone family, member Y2	3	Histone H2A.				brain development (GO:0007420)|chromatin modification (GO:0016568)|dosage compensation (GO:0007549)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|nucleosome assembly (GO:0006334)	Barr body (GO:0001740)|extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|transcription regulatory region DNA binding (GO:0044212)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(4)|skin(1)	15						AGATGTCGGGCCGGAGTGGGA	0.522																																					p.G3fs		.											.	H2AFY2	91	0			c.9delC						.						189.0	160.0	170.0					10																	71835423		2203	4300	6503	SO:0001589	frameshift_variant	55506	exon2			GTCGGGCCGGAGT	AF336304	CCDS7296.1	10q22.1	2011-01-27			ENSG00000099284	ENSG00000099284		"""Histones / Replication-independent"""	14453	protein-coding gene	gene with protein product						11331621, 11262398	Standard	NM_018649		Approved	macroH2A2	uc001jqm.3	Q9P0M6	OTTHUMG00000018396	ENST00000373255.4:c.9delC	10.37:g.71835423delC	ENSP00000362352:p.Gly3fs	119.0	0.0		90.0	22.0	NM_018649	Q5SQT2	Frame_Shift_Del	DEL	ENST00000373255.4	37	CCDS7296.1																																																																																			.		0.522	H2AFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048480.2	NM_018649	
HPS1	3257	ucsc.edu;bcgsc.ca	37	10	100183612	100183612	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr10:100183612T>C	ENST00000325103.6	-	15	1663	c.1430A>G	c.(1429-1431)cAg>cGg	p.Q477R	HPS1_ENST00000467246.1_5'UTR|HPS1_ENST00000361490.4_Missense_Mutation_p.Q477R	NM_000195.3	NP_000186.2	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1	477					blood coagulation (GO:0007596)|eye pigmentation (GO:0048069)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of natural killer cell activation (GO:0032816)|retina development in camera-type eye (GO:0060041)|secretion of lysosomal enzymes (GO:0033299)|visual perception (GO:0007601)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		GGCGCAGAGCTGCCGCTTCAG	0.642									Hermansky-Pudlak syndrome																												p.Q477R		.											.	HPS1	91	0			c.A1430G						.						39.0	43.0	42.0					10																	100183612		2203	4300	6503	SO:0001583	missense	3257	exon15	Familial Cancer Database	HPS, HPS1-8	CAGAGCTGCCGCT	U79136	CCDS7475.1, CCDS7476.1	10q23.1-q23.3	2014-06-18		2002-05-01	ENSG00000107521	ENSG00000107521			5163	protein-coding gene	gene with protein product		604982	"""Hermansky-Pudlak syndrome"""	HPS		8541858, 7573033	Standard	NM_182639		Approved		uc021pwv.1	Q92902	OTTHUMG00000018876	ENST00000325103.6:c.1430A>G	10.37:g.100183612T>C	ENSP00000326649:p.Gln477Arg	63.0	0.0		40.0	4.0	NM_000195	A8MRT2|O15402|O15502|Q5TAA3|Q8WXE5	Missense_Mutation	SNP	ENST00000325103.6	37	CCDS7475.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.790866	0.90367	.	.	ENSG00000107521	ENST00000325103;ENST00000361490;ENST00000407891;ENST00000359632	T;T;T	0.31769	1.48;1.48;1.48	5.45	5.45	0.79879	.	0.319059	0.35013	N	0.003517	T	0.48333	0.1494	M	0.79123	2.44	0.80722	D	1	P;P;P;P	0.47034	0.604;0.817;0.817;0.889	P;P;P;P	0.52646	0.56;0.561;0.561;0.705	T	0.50320	-0.8842	10	0.48119	T	0.1	.	13.7637	0.62981	0.0:0.0:0.0:1.0	.	115;444;477;477	Q658M9;Q92902-2;Q8WXE5;D3DR62	.;.;.;.	R	477;477;444;272	ENSP00000326649:Q477R;ENSP00000355310:Q477R;ENSP00000352652:Q272R	ENSP00000326649:Q477R	Q	-	2	0	HPS1	100173602	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.375000	0.73137	2.063000	0.61619	0.418000	0.28097	CAG	.		0.642	HPS1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049776.1	NM_000195, NM_182637, NM_182638, NM_182639	
ITGA4	3676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	182350624	182350624	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr2:182350624C>T	ENST00000397033.2	+	10	1488	c.1058C>T	c.(1057-1059)gCa>gTa	p.A353V		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	353					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	GTAATGAATGCAATGGAAACA	0.378																																					p.A353V		.											.	ITGA4	230	0			c.C1058T						.						145.0	136.0	139.0					2																	182350624		1860	4108	5968	SO:0001583	missense	3676	exon10			TGAATGCAATGGA		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.1058C>T	2.37:g.182350624C>T	ENSP00000380227:p.Ala353Val	129.0	0.0		127.0	46.0	NM_000885	D3DPG4|Q7Z4L6	Missense_Mutation	SNP	ENST00000397033.2	37	CCDS42788.1	.	.	.	.	.	.	.	.	.	.	C	4.075	0.011769	0.07912	.	.	ENSG00000115232	ENST00000425522;ENST00000397033;ENST00000233573	T;T	0.71579	-0.58;-0.58	5.87	3.49	0.39957	.	0.046340	0.85682	D	0.000000	T	0.51346	0.1669	N	0.11364	0.135	0.38330	D	0.94376	B;B	0.24368	0.007;0.102	B;B	0.25884	0.009;0.064	T	0.44128	-0.9348	10	0.31617	T	0.26	.	13.1087	0.59261	0.7457:0.2543:0.0:0.0	.	353;353	E7EP60;P13612	.;ITA4_HUMAN	V	353	ENSP00000380227:A353V;ENSP00000233573:A353V	ENSP00000233573:A353V	A	+	2	0	ITGA4	182058869	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.294000	0.65687	0.467000	0.27218	-1.610000	0.00802	GCA	.		0.378	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1		
ITGB8	3696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	20418810	20418810	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr7:20418810A>T	ENST00000222573.4	+	4	1209	c.525A>T	c.(523-525)agA>agT	p.R175S	ITGB8_ENST00000537992.1_Missense_Mutation_p.R40S|SNORD56_ENST00000363883.1_RNA	NM_002214.2	NP_002205.1	P26012	ITB8_HUMAN	integrin, beta 8	175	VWFA.				cartilage development (GO:0051216)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|ganglioside metabolic process (GO:0001573)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of gene expression (GO:0010629)|placenta blood vessel development (GO:0060674)|positive regulation of gene expression (GO:0010628)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	extracellular matrix protein binding (GO:1990430)|receptor activity (GO:0004872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(4)|stomach(2)|urinary_tract(1)	37						ATTTATCTAGAAAAATGGCAT	0.348																																					p.R175S		.											.	ITGB8	227	0			c.A525T						.						95.0	98.0	97.0					7																	20418810		2203	4300	6503	SO:0001583	missense	3696	exon4			ATCTAGAAAAATG		CCDS5370.1	7p15.3	2010-03-23			ENSG00000105855	ENSG00000105855		"""Integrins"""	6163	protein-coding gene	gene with protein product		604160					Standard	XM_005249751		Approved		uc003suu.3	P26012	OTTHUMG00000023594	ENST00000222573.4:c.525A>T	7.37:g.20418810A>T	ENSP00000222573:p.Arg175Ser	113.0	0.0		104.0	47.0	NM_002214	A4D133|B4DHD4	Missense_Mutation	SNP	ENST00000222573.4	37	CCDS5370.1	.	.	.	.	.	.	.	.	.	.	A	11.20	1.569204	0.28003	.	.	ENSG00000105855	ENST00000537992;ENST00000222573	D;D	0.97480	-4.4;-4.4	5.82	4.48	0.54585	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.349225	0.29861	N	0.011001	D	0.90967	0.7160	N	0.11284	0.12	0.24298	N	0.995131	B;B	0.25390	0.077;0.125	B;B	0.24974	0.057;0.053	T	0.82579	-0.0387	10	0.30078	T	0.28	-16.7412	9.6296	0.39772	0.8129:0.0:0.1871:0.0	.	175;175	P26012;Q9BUG9	ITB8_HUMAN;.	S	40;175	ENSP00000441561:R40S;ENSP00000222573:R175S	ENSP00000222573:R175S	R	+	3	2	ITGB8	20385335	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	1.515000	0.35845	2.216000	0.71823	0.528000	0.53228	AGA	.		0.348	ITGB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059915.3	NM_002214	
KIAA1211L	343990	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	99454679	99454679	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr2:99454679A>G	ENST00000397899.2	-	3	473	c.142T>C	c.(142-144)Tcc>Ccc	p.S48P	RNU7-46P_ENST00000459066.1_RNA|KIAA1211L_ENST00000462314.1_5'UTR	NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	48																	CTTCCTGTGGACGACGGCGAT	0.408																																					p.S48P		.											.	.	.	0			c.T142C						.						119.0	110.0	113.0					2																	99454679		1981	4153	6134	SO:0001583	missense	343990	exon3			CTGTGGACGACGG	BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.142T>C	2.37:g.99454679A>G	ENSP00000380996:p.Ser48Pro	96.0	1.0		123.0	59.0	NM_207362		Missense_Mutation	SNP	ENST00000397899.2	37	CCDS42720.1	.	.	.	.	.	.	.	.	.	.	A	8.616	0.890239	0.17613	.	.	ENSG00000196872	ENST00000397899;ENST00000423771;ENST00000428096;ENST00000415261	T	0.43688	0.94	5.53	1.83	0.25207	.	0.282354	0.25975	N	0.027115	T	0.22003	0.0530	N	0.16602	0.42	0.24140	N	0.99573	B	0.24186	0.099	B	0.22753	0.041	T	0.11251	-1.0595	10	0.34782	T	0.22	-15.3365	5.4226	0.16407	0.6858:0.1491:0.1651:0.0	.	48	Q6NV74	CB055_HUMAN	P	48;76;62;62	ENSP00000380996:S48P	ENSP00000380996:S48P	S	-	1	0	C2orf55	98821111	0.439000	0.25610	0.550000	0.28217	0.817000	0.46193	0.891000	0.28309	0.523000	0.28482	0.533000	0.62120	TCC	.		0.408	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329933.1	NM_207362	
KIAA1468	57614	hgsc.bcm.edu;bcgsc.ca	37	18	59947916	59947948	+	Splice_Site	DEL	ATTATGGAAACAGTAATTCAAAGAGAGGTAGGA	ATTATGGAAACAGTAATTCAAAGAGAGGTAGGA	-			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	ATTATGGAAACAGTAATTCAAAGAGAGGTAGGA	ATTATGGAAACAGTAATTCAAAGAGAGGTAGGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr18:59947916_59947948delATTATGGAAACAGTAATTCAAAGAGAGGTAGGA	ENST00000398130.2	+	24	3320_3346	c.3088_3114delATTATGGAAACAGTAATTCAAAGAGAGGTAGGA	c.(3088-3114)attatggaaacagtaattcaaagagagdel	p.IMETVIQRE1030del	KIAA1468_ENST00000256858.6_Splice_Site_p.IMETVIQRE1064del	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	1030										autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				CTTTGGCACTATTATGGAAACAGTAATTCAAAGAGAGGTAGGAATAATTGAAA	0.356																																					p.1030_1038del		.											.	KIAA1468	158	0			c.3088_3114del						.																																			SO:0001630	splice_region_variant	57614	exon24			GGCACTATTATGG	BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.3114+1ATTATGGAAACAGTAATTCAAAGAGAGGTAGGA>-	18.37:g.59947916_59947948delATTATGGAAACAGTAATTCAAAGAGAGGTAGGA		87.0	0.0		72.0	19.0	NM_020854		In_Frame_Del	DEL	ENST00000398130.2	37	CCDS11979.2																																																																																			.		0.356	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256187.1	NM_020854	In_Frame_Del
KIFAP3	22920	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	170007568	170007568	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr1:170007568T>A	ENST00000361580.2	-	5	607	c.380A>T	c.(379-381)gAt>gTt	p.D127V	KIFAP3_ENST00000538366.1_Missense_Mutation_p.D49V|KIFAP3_ENST00000490550.1_5'UTR|KIFAP3_ENST00000367767.1_Missense_Mutation_p.D83V|KIFAP3_ENST00000367765.1_Missense_Mutation_p.D87V	NM_014970.3	NP_055785.2	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	127					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|membrane organization (GO:0061024)|microtubule-based movement (GO:0007018)|microtubule-based process (GO:0007017)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of calcium-dependent cell-cell adhesion (GO:0046587)|protein complex assembly (GO:0006461)|protein localization (GO:0008104)|signal transduction (GO:0007165)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule cytoskeleton (GO:0015630)	kinesin binding (GO:0019894)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|prostate(2)|skin(3)|urinary_tract(2)	35	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AGCAACTTCATCAATCTGAAA	0.353																																					p.D127V		.											.	KIFAP3	91	0			c.A380T						.						95.0	105.0	102.0					1																	170007568		2203	4300	6503	SO:0001583	missense	22920	exon5			ACTTCATCAATCT	U59919	CCDS1288.1, CCDS55659.1, CCDS55660.1, CCDS55661.1	1q24.2	2012-09-20			ENSG00000075945	ENSG00000075945			17060	protein-coding gene	gene with protein product	"""Smg GDS"""	601836				8900189	Standard	NM_014970		Approved	SMAP, KAP3, FLA3, KAP-1	uc001ggv.3	Q92845	OTTHUMG00000035947	ENST00000361580.2:c.380A>T	1.37:g.170007568T>A	ENSP00000354560:p.Asp127Val	135.0	0.0		150.0	46.0	NM_014970	B1AKU4|B1AKU5|B2RDL1|B7Z8A3|F5H591|Q8NHU7|Q9H416	Missense_Mutation	SNP	ENST00000361580.2	37	CCDS1288.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.162824	0.78226	.	.	ENSG00000075945	ENST00000361580;ENST00000367765;ENST00000367767;ENST00000538366	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	5.74	5.74	0.90152	Armadillo-like helical (1);	0.043545	0.85682	D	0.000000	T	0.48786	0.1519	L	0.52573	1.65	0.80722	D	1	D;D;P	0.58970	0.984;0.97;0.928	P;P;P	0.57679	0.825;0.697;0.609	T	0.43621	-0.9380	9	.	.	.	-28.1139	16.0039	0.80344	0.0:0.0:0.0:1.0	.	49;83;127	B7Z8A3;B1AKU5;Q92845	.;.;KIFA3_HUMAN	V	127;87;83;49	ENSP00000354560:D127V;ENSP00000356739:D87V;ENSP00000356741:D83V;ENSP00000444622:D49V	.	D	-	2	0	KIFAP3	168274192	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.502000	0.81614	2.317000	0.78254	0.460000	0.39030	GAT	.		0.353	KIFAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087568.1	NM_014970	
KIFC1	3833	broad.mit.edu;bcgsc.ca	37	6	33372736	33372736	+	Silent	SNP	A	A	G			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr6:33372736A>G	ENST00000428849.2	+	7	1314	c.864A>G	c.(862-864)gaA>gaG	p.E288E		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	288					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						AGCGGGAAGAACGTCTTCATG	0.602																																					p.E288E		.											.	KIFC1	90	0			c.A864G						.						72.0	72.0	72.0					6																	33372736		2203	4300	6503	SO:0001819	synonymous_variant	3833	exon7			GGAAGAACGTCTT	D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.864A>G	6.37:g.33372736A>G		98.0	0.0		131.0	6.0	NM_002263	O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Silent	SNP	ENST00000428849.2	37	CCDS34430.1																																																																																			.		0.602	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076417.1	NM_002263	
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	25398281	25398281	+	Missense_Mutation	SNP	C	C	T	rs112445441		TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr12:25398281C>T	ENST00000256078.4	-	2	101	c.38G>A	c.(37-39)gGc>gAc	p.G13D	KRAS_ENST00000557334.1_Missense_Mutation_p.G13D|KRAS_ENST00000556131.1_Missense_Mutation_p.G13D|KRAS_ENST00000311936.3_Missense_Mutation_p.G13D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	13			G -> D (in a breast carcinoma cell line and GASC; somatic mutation). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:3627975}.|G -> R (in pylocytic astrocytoma; somatic mutation; increase activation of the Ras pathway). {ECO:0000269|PubMed:16247081}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G13D(3223)|p.G13V(33)|p.G13A(28)|p.G13E(3)|p.G13I(1)|p.G13N(1)|p.G13_V14>DI(1)|p.G13R(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTTGCCTACGCCACCAGCTCC	0.338	G13D(DLD1_LARGE_INTESTINE)|G13D(DV90_LUNG)|G13D(HCT116_LARGE_INTESTINE)|G13D(HCT15_LARGE_INTESTINE)|G13D(LOVO_LARGE_INTESTINE)|G13D(MDAMB231_BREAST)|G13D(NCIH647_LUNG)|G13D(NCIH747_LARGE_INTESTINE)|G13D(NOMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G13D(T84_LARGE_INTESTINE)|G13D(TOLEDO_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G13D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	.		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,NS,carcinoma,-1	KRAS	92875	3291	Substitution - Missense(3290)|Complex - compound substitution(1)	large_intestine(2808)|haematopoietic_and_lymphoid_tissue(94)|lung(92)|endometrium(54)|soft_tissue(38)|ovary(38)|stomach(32)|pancreas(30)|thyroid(27)|biliary_tract(21)|prostate(20)|breast(10)|cervix(4)|gastrointestinal_tract_(site_indeterminate)(3)|upper_aerodigestive_tract(3)|urinary_tract(3)|liver(3)|salivary_gland(3)|small_intestine(3)|oesophagus(2)|skin(1)|genital_tract(1)|bone(1)	c.G38A						.						88.0	78.0	82.0					12																	25398281		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	CCTACGCCACCAG	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.38G>A	12.37:g.25398281C>T	ENSP00000256078:p.Gly13Asp	190.0	0.0		138.0	65.0	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867862	0.91587	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	D;T;T;T	0.82803	-1.65;-0.7;-0.7;-0.7	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90079	0.6901	M	0.93062	3.375	0.80722	D	1	B;P	0.43314	0.215;0.803	B;P	0.46172	0.175;0.506	D	0.92106	0.5692	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	13;13	P01116-2;P01116	.;RASK_HUMAN	D	13	ENSP00000308495:G13D;ENSP00000452512:G13D;ENSP00000256078:G13D;ENSP00000451856:G13D	ENSP00000256078:G13D	G	-	2	0	KRAS	25289548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGC	.		0.338	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
MIPEP	4285	ucsc.edu;bcgsc.ca	37	13	24330758	24330758	+	Splice_Site	SNP	C	C	T			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr13:24330758C>T	ENST00000382172.3	-	18	2069		c.e18-1			NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase						protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		CCCGGCAGCCCTGGGGAAGAG	0.517																																					.		.											.	MIPEP	90	0			c.1971-1G>A						.						67.0	65.0	65.0					13																	24330758		2203	4300	6503	SO:0001630	splice_region_variant	4285	exon19			GCAGCCCTGGGGA		CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.1971-1G>A	13.37:g.24330758C>T		42.0	0.0		44.0	4.0	NM_005932	Q5JV15|Q5T9Q9|Q96G65	Splice_Site	SNP	ENST00000382172.3	37	CCDS9303.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.466122	0.84425	.	.	ENSG00000027001	ENST00000382172;ENST00000433710	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1502	0.89672	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MIPEP	23228758	1.000000	0.71417	0.999000	0.59377	0.947000	0.59692	7.405000	0.80007	2.574000	0.86865	0.585000	0.79938	.	.		0.517	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044169.1		Intron
MITF	4286	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	70014270	70014270	+	Silent	SNP	C	C	A			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr3:70014270C>A	ENST00000448226.2	+	10	1579	c.1452C>A	c.(1450-1452)atC>atA	p.I484I	MITF_ENST00000394351.3_Silent_p.I377I|MITF_ENST00000314557.6_Silent_p.I371I|MITF_ENST00000472437.1_Silent_p.I426I|MITF_ENST00000328528.6_Silent_p.I477I|MITF_ENST00000352241.4_Silent_p.I478I|MITF_ENST00000531774.1_Silent_p.I315I|MITF_ENST00000394355.2_Silent_p.I453I|MITF_ENST00000314589.5_Silent_p.I462I			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	484					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		TGGAAGACATCCTGATGGACG	0.542			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														p.I478I	Melanoma(29;269 969 31479 41502 42961)	.		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	.	MITF	524	0			c.C1434A						.						151.0	127.0	135.0					3																	70014270		2203	4300	6503	SO:0001819	synonymous_variant	4286	exon10			AGACATCCTGATG		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.1452C>A	3.37:g.70014270C>A		78.0	1.0		83.0	33.0	NM_198159	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Silent	SNP	ENST00000448226.2	37																																																																																				.		0.542	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
PALD1	27143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	72301249	72301249	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr10:72301249G>A	ENST00000263563.6	+	17	2348	c.2080G>A	c.(2080-2082)Gtg>Atg	p.V694M		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	694						cytosol (GO:0005829)											GGAGGAGCTCGTGAGTGTGCC	0.627																																					p.V694M		.											.	.	.	0			c.G2080A						.						95.0	77.0	83.0					10																	72301249		2203	4300	6503	SO:0001583	missense	27143	exon17			GAGCTCGTGAGTG	AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.2080G>A	10.37:g.72301249G>A	ENSP00000263563:p.Val694Met	50.0	0.0		65.0	20.0	NM_014431	B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Missense_Mutation	SNP	ENST00000263563.6	37	CCDS31215.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.18|18.18	3.566845|3.566845	0.65651|0.65651	.|.	.|.	ENSG00000107719|ENSG00000107719	ENST00000426268|ENST00000263563	.|T	.|0.25749	.|1.78	3.62|3.62	3.62|3.62	0.41486|0.41486	.|.	.|0.221763	.|0.37261	.|U	.|0.002178	T|T	0.36524|0.36524	0.0970|0.0970	M|M	0.74881|0.74881	2.28|2.28	0.58432|0.58432	D|D	0.999997|0.999997	.|D	.|0.54772	.|0.968	.|P	.|0.46885	.|0.53	T|T	0.48258|0.48258	-0.9051|-0.9051	5|10	.|0.59425	.|D	.|0.04	-7.9365|-7.9365	15.1824|15.1824	0.72968|0.72968	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|694	.|Q9ULE6	.|PALD_HUMAN	H|M	74|694	.|ENSP00000263563:V694M	.|ENSP00000263563:V694M	R|V	+|+	2|1	0|0	KIAA1274|KIAA1274	71971255|71971255	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.810000|0.810000	0.45777|0.45777	7.530000|7.530000	0.81962|0.81962	1.890000|1.890000	0.54733|0.54733	0.430000|0.430000	0.28490|0.28490	CGT|GTG	.		0.627	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048515.2	NM_014431	
PGBD2	267002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	249211640	249211640	+	Missense_Mutation	SNP	G	G	T	rs560395632	byFrequency	TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr1:249211640G>T	ENST00000329291.5	+	3	1004	c.857G>T	c.(856-858)aGg>aTg	p.R286M	PGBD2_ENST00000539153.1_Missense_Mutation_p.R283M|PGBD2_ENST00000355360.4_Missense_Mutation_p.R35M	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	286										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CAGCTGCACAGGGGGAAGCCT	0.537																																					p.R286M		.											.	PGBD2	91	0			c.G857T						.						78.0	84.0	82.0					1																	249211640		2203	4300	6503	SO:0001583	missense	267002	exon3			TGCACAGGGGGAA	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.857G>T	1.37:g.249211640G>T	ENSP00000331643:p.Arg286Met	119.0	0.0		122.0	60.0	NM_170725	B3KVR8|Q6MZF8	Missense_Mutation	SNP	ENST00000329291.5	37	CCDS31128.1	.	.	.	.	.	.	.	.	.	.	G	1.931	-0.445936	0.04604	.	.	ENSG00000185220	ENST00000355360;ENST00000329291;ENST00000539153	T;T;T	0.18657	2.2;2.2;2.2	3.76	-4.2	0.03823	.	4.769610	0.00824	N	0.001606	T	0.15046	0.0363	L	0.39898	1.24	0.09310	N	1	P;B	0.38250	0.624;0.01	B;B	0.36808	0.233;0.005	T	0.18935	-1.0321	10	0.62326	D	0.03	2.0361	0.8397	0.01147	0.4296:0.222:0.1467:0.2016	.	283;286	F5H4U7;Q6P3X8	.;PGBD2_HUMAN	M	35;286;283	ENSP00000355424:R35M;ENSP00000331643:R286M;ENSP00000439950:R283M	ENSP00000331643:R286M	R	+	2	0	PGBD2	247178263	0.000000	0.05858	0.000000	0.03702	0.084000	0.17831	-0.270000	0.08584	-0.572000	0.06006	-0.256000	0.11100	AGG	.		0.537	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1		
PHF8	23133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	54044138	54044138	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chrX:54044138A>C	ENST00000357988.5	-	5	876	c.518T>G	c.(517-519)cTg>cGg	p.L173R	PHF8_ENST00000338946.6_Missense_Mutation_p.L137R|PHF8_ENST00000338154.6_Missense_Mutation_p.L137R|PHF8_ENST00000322659.8_Missense_Mutation_p.L137R	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	173					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						TGGCGAGGGCAGCGTCATGCC	0.473																																					p.L173R		.											.	PHF8	133	0			c.T518G						.						156.0	105.0	123.0					X																	54044138		2203	4300	6503	SO:0001583	missense	23133	exon5			GAGGGCAGCGTCA	AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.518T>G	X.37:g.54044138A>C	ENSP00000350676:p.Leu173Arg	63.0	0.0		57.0	42.0	NM_001184896	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	ENST00000357988.5	37	CCDS55420.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.9|25.9	4.688422|4.688422	0.88639|0.88639	.|.	.|.	ENSG00000172943|ENSG00000172943	ENST00000396282|ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000322659	.|T;T;T;T	.|0.71579	.|-0.58;-0.58;-0.58;-0.58	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.85327|0.85327	0.5671|0.5671	M|M	0.86651|0.86651	2.83|2.83	0.52501|0.52501	D|D	0.999959|0.999959	.|D;D;D	.|0.71674	.|0.997;0.998;0.998	.|P;D;D	.|0.69307	.|0.83;0.918;0.963	D|D	0.87928|0.87928	0.2708|0.2708	5|10	.|0.87932	.|D	.|0	-8.7688|-8.7688	14.2623|14.2623	0.66092|0.66092	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|137;173;173	.|B7Z911;Q9UPP1-3;Q9UPP1	.|.;.;PHF8_HUMAN	G|R	41|173;137;137;167;137	.|ENSP00000350676:L173R;ENSP00000338868:L137R;ENSP00000340051:L137R;ENSP00000319473:L137R	.|ENSP00000319473:L137R	C|L	-|-	1|2	0|0	PHF8|PHF8	54060863|54060863	0.973000|0.973000	0.33851|0.33851	0.426000|0.426000	0.26672|0.26672	0.992000|0.992000	0.81027|0.81027	9.195000|9.195000	0.94971|0.94971	2.014000|2.014000	0.59158|0.59158	0.486000|0.486000	0.48141|0.48141	TGC|CTG	.		0.473	PHF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056784.2	NM_015107	
PHKB	5257	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	47630379	47630379	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr16:47630379T>A	ENST00000323584.5	+	13	1324	c.1300T>A	c.(1300-1302)Tgt>Agt	p.C434S	PHKB_ENST00000455779.1_Missense_Mutation_p.C427S|PHKB_ENST00000566044.1_Missense_Mutation_p.C427S|PHKB_ENST00000299167.8_Missense_Mutation_p.C434S	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	434					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				TCCTAGCAACTGTGGCCGTGA	0.388																																					p.C434S		.											.	PHKB	154	0			c.T1300A						.						161.0	164.0	163.0					16																	47630379		2201	4300	6501	SO:0001583	missense	5257	exon13			AGCAACTGTGGCC		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.1300T>A	16.37:g.47630379T>A	ENSP00000313504:p.Cys434Ser	175.0	0.0		167.0	43.0	NM_000293	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	T	7.124	0.578535	0.13686	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.92805	-3.11;-3.11	5.73	4.62	0.57501	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.199255	0.56097	N	0.000035	T	0.72342	0.3448	N	0.01352	-0.895	0.39703	D	0.971213	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.65393	-0.6179	10	0.06494	T	0.89	-14.1591	5.8768	0.18834	0.2753:0.0717:0.0:0.653	.	434;427	Q93100;Q93100-4	KPBB_HUMAN;.	S	427;427;434	ENSP00000414345:C427S;ENSP00000313504:C434S	ENSP00000299167:C427S	C	+	1	0	PHKB	46187880	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.558000	0.36309	0.969000	0.38237	0.533000	0.62120	TGT	.		0.388	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
PSIP1	11168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	15506558	15506558	+	Splice_Site	SNP	C	C	A			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr9:15506558C>A	ENST00000380733.4	-	3	493		c.e3+1		PSIP1_ENST00000380738.4_Splice_Site|PSIP1_ENST00000380715.1_Splice_Site|PSIP1_ENST00000380716.4_Splice_Site|PSIP1_ENST00000484265.1_5'UTR|PSIP1_ENST00000397519.2_Splice_Site			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1						establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)			breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		ACAGGACTTACGTCTCATGAG	0.373																																					.		.											.	PSIP1	658	0			c.149+1G>T						.						92.0	99.0	97.0					9																	15506558		2203	4300	6503	SO:0001630	splice_region_variant	11168	exon4			GACTTACGTCTCA	AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.149+1G>T	9.37:g.15506558C>A		47.0	0.0		58.0	14.0	NM_001128217	D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	Splice_Site	SNP	ENST00000380733.4	37	CCDS6479.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102754	0.76983	.	.	ENSG00000164985	ENST00000380733;ENST00000380738;ENST00000380715;ENST00000380716;ENST00000397519	.	.	.	5.88	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.841	0.63439	0.0:0.9257:0.0:0.0743	.	.	.	.	.	-1	.	.	.	-	.	.	PSIP1	15496558	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.718000	0.74713	1.483000	0.48342	0.655000	0.94253	.	.		0.373	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055445.1	NM_033222	Intron
PXDNL	137902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	52384855	52384855	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr8:52384855C>T	ENST00000356297.4	-	8	804	c.704G>A	c.(703-705)cGa>cAa	p.R235Q	PXDNL_ENST00000543296.1_Missense_Mutation_p.R235Q	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	235	Ig-like C2-type 1.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				AAAAGTAATTCGGGGGCTCTC	0.413																																					p.R235Q		.											.	PXDNL	70	0			c.G704A						.						96.0	90.0	92.0					8																	52384855		1837	4075	5912	SO:0001583	missense	137902	exon8			GTAATTCGGGGGC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.704G>A	8.37:g.52384855C>T	ENSP00000348645:p.Arg235Gln	72.0	0.0		80.0	30.0	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	C	8.831	0.940018	0.18281	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.66815	-0.23;-0.23	3.84	2.96	0.34315	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.51975	0.1706	N	0.25332	0.735	0.24906	N	0.992072	P	0.47350	0.894	B	0.42495	0.389	T	0.30909	-0.9962	9	0.27785	T	0.31	.	9.0746	0.36513	0.0:0.8869:0.0:0.1131	.	235	A1KZ92	PXDNL_HUMAN	Q	235	ENSP00000348645:R235Q;ENSP00000444865:R235Q	ENSP00000348645:R235Q	R	-	2	0	PXDNL	52547408	0.542000	0.26426	0.060000	0.19600	0.164000	0.22412	3.613000	0.54152	0.627000	0.30340	-0.350000	0.07774	CGA	.		0.413	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
RGL1	23179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	183885770	183885770	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr1:183885770G>T	ENST00000360851.3	+	16	2117	c.1939G>T	c.(1939-1941)Gaa>Taa	p.E647*	RGL1_ENST00000539189.1_Nonsense_Mutation_p.E618*|RGL1_ENST00000304685.4_Nonsense_Mutation_p.E682*|RGL1_ENST00000536277.1_Nonsense_Mutation_p.E645*			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	647					cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						CCAACAGAATGAAGACACCTG	0.527																																					p.E682X		.											.	RGL1	725	0			c.G2044T						.						142.0	134.0	137.0					1																	183885770		2203	4300	6503	SO:0001587	stop_gained	23179	exon17			CAGAATGAAGACA	AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.1939G>T	1.37:g.183885770G>T	ENSP00000354097:p.Glu647*	99.0	0.0		75.0	30.0	NM_015149	Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Nonsense_Mutation	SNP	ENST00000360851.3	37		.	.	.	.	.	.	.	.	.	.	G	43	10.299247	0.99378	.	.	ENSG00000143344	ENST00000304685;ENST00000367531;ENST00000536277;ENST00000360851;ENST00000539189	.	.	.	5.43	5.43	0.79202	.	0.113427	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	18.8583	0.92262	0.0:0.0:1.0:0.0	.	.	.	.	X	682;682;645;647;618	.	ENSP00000303192:E682X	E	+	1	0	RGL1	182152393	1.000000	0.71417	0.986000	0.45419	0.996000	0.88848	3.633000	0.54295	2.555000	0.86185	0.650000	0.86243	GAA	.		0.527	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000085742.1	NM_015149	
RGS22	26166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	101054142	101054142	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr8:101054142G>A	ENST00000360863.6	-	12	2020	c.1826C>T	c.(1825-1827)tCa>tTa	p.S609L	RGS22_ENST00000523287.1_Missense_Mutation_p.S428L|RGS22_ENST00000523437.1_Missense_Mutation_p.S597L	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	609					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			CATGTACTTTGACCTAAATTA	0.338																																					p.S609L		.											.	RGS22	140	0			c.C1826T						.						67.0	61.0	62.0					8																	101054142		1851	4098	5949	SO:0001583	missense	26166	exon12			TACTTTGACCTAA	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.1826C>T	8.37:g.101054142G>A	ENSP00000354109:p.Ser609Leu	80.0	0.0		73.0	26.0	NM_015668	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	ENST00000360863.6	37	CCDS43758.1	.	.	.	.	.	.	.	.	.	.	G	6.468	0.454593	0.12283	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000523437	T;T;T	0.32988	1.44;1.43;1.43	5.63	1.8	0.24995	.	0.853073	0.10106	N	0.715279	T	0.17789	0.0427	N	0.14661	0.345	0.27179	N	0.960714	B;B;B	0.10296	0.003;0.003;0.002	B;B;B	0.11329	0.002;0.002;0.006	T	0.26395	-1.0104	10	0.38643	T	0.18	.	7.3362	0.26611	0.3663:0.0:0.6337:0.0	.	597;609;428	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	L	609;597;428;597	ENSP00000354109:S609L;ENSP00000429382:S428L;ENSP00000428212:S597L	ENSP00000354109:S609L	S	-	2	0	RGS22	101123318	0.998000	0.40836	0.590000	0.28732	0.054000	0.15201	1.149000	0.31626	0.046000	0.15833	-0.140000	0.14226	TCA	.		0.338	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668	
SP6	80320	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	45925436	45925436	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr17:45925436C>A	ENST00000536300.1	-	2	691	c.360G>T	c.(358-360)tgG>tgT	p.W120C	SP6_ENST00000342234.2_Missense_Mutation_p.W120C	NM_001258248.1	NP_001245177.1	Q3SY56	SP6_HUMAN	Sp6 transcription factor	120					positive regulation of cell proliferation (GO:0008284)|regulation of odontogenesis (GO:0042481)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(5)|prostate(1)|skin(1)	8						GAAGGTCCCACCACGAGCCAT	0.677																																					p.W120C		.											.	SP6	91	0			c.G360T						.						28.0	26.0	27.0					17																	45925436		2202	4300	6502	SO:0001583	missense	80320	exon2			GTCCCACCACGAG		CCDS11520.1	17q21.32	2013-01-08			ENSG00000189120	ENSG00000189120		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14530	protein-coding gene	gene with protein product	"""epiprofin"""	608613				11087666, 14551215	Standard	NM_001258248		Approved	KLF14, Epfn	uc002img.2	Q3SY56	OTTHUMG00000132067	ENST00000536300.1:c.360G>T	17.37:g.45925436C>A	ENSP00000438209:p.Trp120Cys	37.0	0.0		20.0	8.0	NM_001258248	B3KXS4	Missense_Mutation	SNP	ENST00000536300.1	37	CCDS11520.1	.	.	.	.	.	.	.	.	.	.	C	19.48	3.836195	0.71373	.	.	ENSG00000189120	ENST00000342234;ENST00000536300	T;T	0.14516	2.5;2.5	4.35	4.35	0.52113	.	0.000000	0.41001	D	0.000975	T	0.33089	0.0851	M	0.64997	1.995	0.80722	D	1	D	0.76494	0.999	D	0.68039	0.955	T	0.04481	-1.0948	10	0.51188	T	0.08	.	15.8112	0.78565	0.0:1.0:0.0:0.0	.	120	Q3SY56	SP6_HUMAN	C	120	ENSP00000340799:W120C;ENSP00000438209:W120C	ENSP00000340799:W120C	W	-	3	0	SP6	43280435	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.504000	0.60414	2.253000	0.74438	0.462000	0.41574	TGG	.		0.677	SP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441395.1	NM_199262	
ST8SIA2	8128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	92988127	92988127	+	Silent	SNP	C	C	T			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr15:92988127C>T	ENST00000268164.3	+	5	1047	c.810C>T	c.(808-810)taC>taT	p.Y270Y	ST8SIA2_ENST00000539113.1_Silent_p.Y249Y	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	270					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			GCACTGCATACCCCTCGCTGC	0.622																																					p.Y270Y		.											.	ST8SIA2	90	0			c.C810T						.						94.0	79.0	84.0					15																	92988127		2198	4298	6496	SO:0001819	synonymous_variant	8128	exon5			TGCATACCCCTCG	U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	ENST00000268164.3:c.810C>T	15.37:g.92988127C>T		43.0	0.0		41.0	19.0	NM_006011	Q4VAZ0|Q92470|Q92746	Silent	SNP	ENST00000268164.3	37	CCDS10372.1																																																																																			.		0.622	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313526.1	NM_006011	
TCF20	6942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	42608580	42608580	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr22:42608580G>C	ENST00000359486.3	-	1	2868	c.2732C>G	c.(2731-2733)cCt>cGt	p.P911R	TCF20_ENST00000335626.4_Missense_Mutation_p.P911R|TCF20_ENST00000404876.1_5'Flank	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	911					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						CAAACCACCAGGAAGAATGAC	0.488																																					p.P911R		.											.	TCF20	95	0			c.C2732G						.						54.0	51.0	52.0					22																	42608580		2203	4300	6503	SO:0001583	missense	6942	exon1			CCACCAGGAAGAA	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.2732C>G	22.37:g.42608580G>C	ENSP00000352463:p.Pro911Arg	143.0	0.0		160.0	62.0	NM_181492	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	37	CCDS14033.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.578016	0.45902	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.62232	0.05;0.04	5.36	5.36	0.76844	.	0.080565	0.52532	D	0.000062	T	0.70168	0.3193	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.73930	-0.3827	10	0.87932	D	0	-9.6423	19.2789	0.94044	0.0:0.0:1.0:0.0	.	911;911	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	R	911	ENSP00000352463:P911R;ENSP00000335561:P911R	ENSP00000335561:P911R	P	-	2	0	TCF20	40938524	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.355000	0.66046	2.774000	0.95407	0.655000	0.94253	CCT	.		0.488	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492	
TJP1	7082	broad.mit.edu;bcgsc.ca	37	15	30025368	30025368	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr15:30025368A>G	ENST00000346128.6	-	13	2140	c.1666T>C	c.(1666-1668)Tct>Cct	p.S556P	TJP1_ENST00000545208.2_Missense_Mutation_p.S556P|TJP1_ENST00000356107.6_Missense_Mutation_p.S556P|TJP1_ENST00000400011.2_Missense_Mutation_p.S560P	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	556	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		GCAAGCCAAGAGCCCAGTTTT	0.393																																					p.S556P	Melanoma(77;681 1843 6309 6570)	.											.	TJP1	95	0			c.T1666C						.						146.0	130.0	135.0					15																	30025368		1874	4105	5979	SO:0001583	missense	7082	exon13			GCCAAGAGCCCAG		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.1666T>C	15.37:g.30025368A>G	ENSP00000281537:p.Ser556Pro	114.0	0.0		121.0	5.0	NM_175610	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	37	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.773180	0.90108	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T;T;T	0.17213	2.29;2.29;2.29;2.29	5.54	5.54	0.83059	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.41003	0.1140	M	0.68317	2.08	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.997	T	0.12708	-1.0537	9	.	.	.	.	15.9596	0.79918	1.0:0.0:0.0:0.0	.	549;556;556;560	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	P	556;560;556;556;556	ENSP00000281537:S556P;ENSP00000382890:S560P;ENSP00000441202:S556P;ENSP00000348416:S556P	.	S	-	1	0	TJP1	27812660	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	9.287000	0.95975	2.220000	0.72140	0.533000	0.62120	TCT	.		0.393	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
TMEM132E	124842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	32959873	32959873	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr17:32959873G>C	ENST00000321639.5	+	7	1691	c.1363G>C	c.(1363-1365)Gat>Cat	p.D455H		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	455						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		TGAGCTCTCAGATGCCCGCCT	0.602																																					p.D455H		.											.	TMEM132E	68	0			c.G1363C						.						147.0	136.0	140.0					17																	32959873		2203	4300	6503	SO:0001583	missense	124842	exon7			CTCTCAGATGCCC	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.1363G>C	17.37:g.32959873G>C	ENSP00000316532:p.Asp455His	43.0	0.0		64.0	14.0	NM_207313	Q8WUF4|Q8WVA5	Missense_Mutation	SNP	ENST00000321639.5	37	CCDS11283.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.261448	0.80358	.	.	ENSG00000181291	ENST00000321639	T	0.26660	1.72	4.71	3.75	0.43078	.	0.148429	0.64402	D	0.000019	T	0.45875	0.1364	M	0.86502	2.82	0.80722	D	1	P	0.45126	0.851	P	0.51355	0.667	T	0.54609	-0.8268	10	0.87932	D	0	-16.6363	11.8049	0.52150	0.0841:0.0:0.9159:0.0	.	455	Q6IEE7	T132E_HUMAN	H	455	ENSP00000316532:D455H	ENSP00000316532:D455H	D	+	1	0	TMEM132E	29983986	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.823000	0.86660	1.211000	0.43351	0.551000	0.68910	GAT	.		0.602	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	NM_207313	
UXT	8409	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	47516683	47516683	+	Silent	SNP	A	A	G			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chrX:47516683A>G	ENST00000333119.3	-	5	310	c.255T>C	c.(253-255)gaT>gaC	p.D85D	UXT_ENST00000335890.2_Silent_p.D97D|UXT_ENST00000460840.1_5'UTR|RP1-212G6.7_ENST00000591832.1_RNA|RP1-212G6.7_ENST00000590504.1_RNA	NM_004182.3	NP_004173.1	Q9UBK9	UXT_HUMAN	ubiquitously-expressed, prefoldin-like chaperone	85					centrosome organization (GO:0051297)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	beta-tubulin binding (GO:0048487)|chromatin binding (GO:0003682)|microtubule binding (GO:0008017)|RNA polymerase II transcription corepressor activity (GO:0001106)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(1)	6						TGCGTGAAGTATCTGGGCTGA	0.478																																					p.D97D		.											.	UXT	130	0			c.T291C						.						54.0	41.0	45.0					X																	47516683		2203	4300	6503	SO:0001819	synonymous_variant	8409	exon4			TGAAGTATCTGGG	AF092737	CCDS14284.1, CCDS14285.1	Xp11.23-p11.22	2011-11-21	2011-11-21		ENSG00000126756	ENSG00000126756			12641	protein-coding gene	gene with protein product	"""androgen receptor trapped clone 27"", ""SKP2-associated alpha PFD 1"""	300234	"""ubiquitously-expressed transcript"""			10087202, 16221885	Standard	NM_004182		Approved	ART-27, STAP1	uc004dim.3	Q9UBK9	OTTHUMG00000021453	ENST00000333119.3:c.255T>C	X.37:g.47516683A>G		63.0	1.0		53.0	40.0	NM_153477	B2R561|Q5JZG3|Q9Y6E5	Silent	SNP	ENST00000333119.3	37	CCDS14285.1																																																																																			.		0.478	UXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056440.1	NM_153477	
ZNF415	55786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	53612315	53612315	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr19:53612315T>A	ENST00000500065.4	-	4	1316	c.983A>T	c.(982-984)tAc>tTc	p.Y328F	ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000421033.1_Missense_Mutation_p.Y340F|ZNF415_ENST00000455735.2_Missense_Mutation_p.Y376F|ZNF415_ENST00000243643.4_Missense_Mutation_p.Y328F|ZNF415_ENST00000601493.1_Missense_Mutation_p.Y98F|ZNF415_ENST00000448501.1_Missense_Mutation_p.Y376F|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000440291.1_Missense_Mutation_p.Y315F|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000597748.1_3'UTR	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	376					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		TTTACATGTGTAAGGTTTCTC	0.393																																					p.Y328F		.											.	ZNF415	91	0			c.A983T						.						82.0	76.0	78.0					19																	53612315		2203	4300	6503	SO:0001583	missense	55786	exon4			CATGTGTAAGGTT	AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.983A>T	19.37:g.53612315T>A	ENSP00000439435:p.Tyr328Phe	79.0	0.0		54.0	19.0	NM_018355	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	ENST00000500065.4	37	CCDS54313.1	.	.	.	.	.	.	.	.	.	.	T	13.50	2.256052	0.39896	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	T;T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22;2.22	2.78	2.78	0.32641	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15089	0.0364	N	0.02830	-0.485	0.09310	N	1	B;B;B;B;B;P	0.50710	0.131;0.261;0.044;0.005;0.131;0.938	B;P;B;B;B;D	0.64595	0.069;0.641;0.049;0.014;0.069;0.927	T	0.10823	-1.0613	9	0.59425	D	0.04	.	6.2652	0.20922	0.2231:0.0:0.0:0.7769	.	328;376;376;328;315;340	F5H287;B3KTG1;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;.;ZN415_HUMAN;.;.;.	F	328;328;376;340;376;315	ENSP00000243643:Y328F;ENSP00000439435:Y328F;ENSP00000396492:Y376F;ENSP00000395055:Y340F;ENSP00000388787:Y376F;ENSP00000414601:Y315F	ENSP00000243643:Y328F	Y	-	2	0	ZNF415	58304127	0.000000	0.05858	0.017000	0.16124	0.118000	0.20060	0.167000	0.16602	1.286000	0.44565	0.402000	0.26972	TAC	.		0.393	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464043.1	NM_018355	
ZNF862	643641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	149557718	149557719	+	Missense_Mutation	DNP	GC	GC	TA			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr7:149557718_149557719GC>TA	ENST00000223210.4	+	7	1714_1715	c.1469_1470GC>TA	c.(1468-1470)tGC>tTA	p.C490L	RP4-751H13.7_ENST00000608963.1_RNA	NM_001099220.1	NP_001092690.1	O60290	ZN862_HUMAN	zinc finger protein 862	490					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(1)	34						TGCTCAGCCTGCATAGAAAGAC	0.45																																					p.C490F|p.C490X		.											.	ZNF862	69	0			c.G1469T|c.C1470A						.																																			SO:0001583	missense	643641	exon7			CAGCCTGCATAGA|AGCCTGCATAGAA	AB011115	CCDS47741.1	7q36.1	2013-01-11			ENSG00000106479	ENSG00000106479		"""Zinc fingers, C2H2-type"", ""-"""	34519	protein-coding gene	gene with protein product							Standard	NM_001099220		Approved		uc010lpn.3	O60290	OTTHUMG00000158093	Exception_encountered	7.37:g.149557718_149557719delinsTA	ENSP00000223210:p.Cys490Leu	75.0|76.0	0.0		79.0|78.0	22.0	NM_001099220	A0AUL8	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000223210.4	37	CCDS47741.1																																																																																			.		0.450	ZNF862-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350165.1	NM_001099220	
ZSCAN29	146050	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	43656356	43656356	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A4-01A-11D-A22F-10	TCGA-DD-A3A4-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f5d3f616-5fb1-47a0-9c01-f2fb90568df4	1a2c1ffc-b1b7-48a0-a94a-ecd67bdfe211	g.chr15:43656356T>G	ENST00000396976.2	-	4	1581	c.1447A>C	c.(1447-1449)Acc>Ccc	p.T483P	ZSCAN29_ENST00000396972.1_Intron|ZSCAN29_ENST00000562072.1_Missense_Mutation_p.T482P|ZSCAN29_ENST00000568898.1_Intron	NM_152455.3	NP_689668.3	Q8IWY8	ZSC29_HUMAN	zinc finger and SCAN domain containing 29	483					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(7)|skin(2)	24		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		AAGGGACAGGTCTCTGGTGCC	0.527																																					p.T483P		.											.	ZSCAN29	91	0			c.A1447C						.						95.0	91.0	92.0					15																	43656356		2201	4299	6500	SO:0001583	missense	146050	exon4			GACAGGTCTCTGG	AF525399	CCDS10095.2	15q15.3	2013-01-08	2007-03-08	2007-03-08	ENSG00000140265	ENSG00000140265		"""-"", ""Zinc fingers, C2H2-type"""	26673	protein-coding gene	gene with protein product			"""zinc finger protein 690"""	ZNF690		12434312	Standard	NM_152455		Approved	FLJ35867, Zfp690	uc001zrk.1	Q8IWY8	OTTHUMG00000130767	ENST00000396976.2:c.1447A>C	15.37:g.43656356T>G	ENSP00000380174:p.Thr483Pro	63.0	0.0		78.0	28.0	NM_152455	B3KVB9|Q32M75|Q32M76|Q8NA40	Missense_Mutation	SNP	ENST00000396976.2	37	CCDS10095.2	.	.	.	.	.	.	.	.	.	.	T	12.64	1.999581	0.35320	.	.	ENSG00000140265	ENST00000396976	T	0.44881	0.91	5.22	4.07	0.47477	.	0.083032	0.52532	D	0.000069	T	0.39517	0.1081	N	0.05259	-0.085	0.80722	D	1	B;D	0.89917	0.209;1.0	B;D	0.87578	0.161;0.998	T	0.36817	-0.9732	10	0.41790	T	0.15	-6.2437	9.5918	0.39550	0.1567:0.0:0.0:0.8433	.	482;483	C9K0J8;Q8IWY8	.;ZSC29_HUMAN	P	483	ENSP00000380174:T483P	ENSP00000380174:T483P	T	-	1	0	ZSCAN29	41443648	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.479000	0.35453	0.964000	0.38108	0.533000	0.62120	ACC	.		0.527	ZSCAN29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253278.1	NM_152455	
