#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AARS2	57505	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	44273478	44273478	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr6:44273478G>A	ENST00000244571.4	-	10	1348	c.1346C>T	c.(1345-1347)cCc>cTc	p.P449L	RP11-444E17.6_ENST00000505802.1_Intron|TMEM151B_ENST00000438774.2_Intron	NM_020745.3	NP_065796			alanyl-tRNA synthetase 2, mitochondrial											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(2)|stomach(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CATGTCCAAGGGGAGTCCCAG	0.552																																					p.P449L		.											.	AARS2	91	0			c.C1346T						.						110.0	111.0	111.0					6																	44273478		2203	4300	6503	SO:0001583	missense	57505	exon10			TCCAAGGGGAGTC	AB033096	CCDS34464.1	6p21.1	2012-10-26	2012-10-26	2007-02-23	ENSG00000124608	ENSG00000124608	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	21022	protein-coding gene	gene with protein product	"""alanine tRNA ligase 2, mitochondrial"""	612035	"""alanyl-tRNA synthetase like"", ""alanyl-tRNA synthetase 2, mitochondrial (putative)"""	AARSL		15779907, 21549344	Standard	NM_020745		Approved	KIAA1270, bA444E17.1	uc010jza.1	Q5JTZ9	OTTHUMG00000014766	ENST00000244571.4:c.1346C>T	6.37:g.44273478G>A	ENSP00000244571:p.Pro449Leu	211.0	0.0		339.0	90.0	NM_020745		Missense_Mutation	SNP	ENST00000244571.4	37	CCDS34464.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.413354	0.83449	.	.	ENSG00000124608	ENST00000244571	D	0.82255	-1.59	4.62	4.62	0.57501	Alanyl-tRNA synthetase, class IIc, anti-codon-binding domain (1);Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93132	0.7813	H	0.95402	3.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94982	0.8126	10	0.87932	D	0	-24.2296	16.622	0.84933	0.0:0.0:1.0:0.0	.	449	Q5JTZ9	SYAM_HUMAN	L	449	ENSP00000244571:P449L	ENSP00000244571:P449L	P	-	2	0	AARS2	44381456	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	9.538000	0.98072	2.395000	0.81488	0.655000	0.94253	CCC	.		0.552	AARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040741.2	NM_020745	
ACCSL	390110	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	44073229	44073229	+	Silent	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:44073229T>A	ENST00000378832.1	+	5	788	c.732T>A	c.(730-732)tcT>tcA	p.S244S		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	244					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						GCTGCTGCTCTGTCTTCTGTG	0.498																																					p.S244S		.											.	ACCSL	95	0			c.T732A						.						311.0	302.0	305.0					11																	44073229		2104	4217	6321	SO:0001819	synonymous_variant	390110	exon5			CTGCTCTGTCTTC		CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.732T>A	11.37:g.44073229T>A		152.0	0.0		234.0	10.0	NM_001031854		Silent	SNP	ENST00000378832.1	37	CCDS41636.1																																																																																			.		0.498	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389717.1	NM_001031854	
ACSM2A	123876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	20494379	20494379	+	Splice_Site	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr16:20494379G>A	ENST00000573854.1	+	13	1623		c.e13-1		ACSM2A_ENST00000219054.6_Splice_Site|ACSM2A_ENST00000536134.1_Splice_Site|ACSM2A_ENST00000396104.2_Splice_Site|ACSM2A_ENST00000575690.1_Splice_Site|ACSM2A_ENST00000417235.2_Splice_Site	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A						fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						CTTTTTTGCAGGTGGTGAAGG	0.498																																					.		.											.	ACSM2A	91	0			c.1510-1G>A						.						195.0	177.0	183.0					16																	20494379		2203	4300	6503	SO:0001630	splice_region_variant	123876	exon14			TTTGCAGGTGGTG	AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1510-1G>A	16.37:g.20494379G>A		137.0	0.0		199.0	46.0	NM_001010845	B3KTT9|O75202	Splice_Site	SNP	ENST00000573854.1	37	CCDS32401.1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.636470	0.29068	.	.	ENSG00000183747	ENST00000417235;ENST00000219054;ENST00000536134;ENST00000396104	.	.	.	3.26	3.26	0.37387	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.417	0.67158	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACSM2A	20401880	1.000000	0.71417	0.927000	0.36925	0.359000	0.29487	7.884000	0.87274	1.507000	0.48752	0.305000	0.20034	.	.		0.498	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436764.1	NM_001010845	Intron
ACTG1	71	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	79479128	79479128	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:79479128C>A	ENST00000575842.1	-	2	590	c.164G>T	c.(163-165)gGc>gTc	p.G55V	AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000573283.1_Missense_Mutation_p.G55V|RP13-766D20.2_ENST00000430912.1_RNA|ACTG1_ENST00000575087.1_Missense_Mutation_p.G55V|ACTG1_ENST00000331925.2_Missense_Mutation_p.G55V			P63261	ACTG_HUMAN	actin, gamma 1	55					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			GGCCTCGTCGCCCACGTAGGA	0.642																																					p.G55V		.											.	ACTG1	91	0			c.G164T						.						65.0	64.0	65.0					17																	79479128		2203	4300	6503	SO:0001583	missense	71	exon3			TCGTCGCCCACGT		CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.164G>T	17.37:g.79479128C>A	ENSP00000458162:p.Gly55Val	43.0	0.0		68.0	16.0	NM_001614	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000575842.1	37	CCDS11782.1	.	.	.	.	.	.	.	.	.	.	C	16.85	3.237185	0.58886	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	D	0.96459	-4.02	3.88	3.88	0.44766	Actin, conserved site (1);	0.000000	0.64402	U	0.000001	D	0.99004	0.9660	H	0.99573	4.635	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98686	1.0694	10	0.87932	D	0	.	14.8003	0.69909	0.0:1.0:0.0:0.0	.	55	P63261	ACTG_HUMAN	V	55	ENSP00000331514:G55V	ENSP00000331514:G55V	G	-	2	0	ACTG1	77093723	1.000000	0.71417	0.995000	0.50966	0.966000	0.64601	7.227000	0.78070	2.007000	0.58848	0.563000	0.77884	GGC	.		0.642	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2	NM_001614	
ACTN2	88	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	236850058	236850058	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:236850058G>A	ENST00000366578.4	+	1	251	c.85G>A	c.(85-87)Gac>Aac	p.D29N	ACTN2_ENST00000542672.1_Missense_Mutation_p.D29N|ACTN2_ENST00000492634.1_3'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	29	Actin-binding.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GTGGGACCGCGACCTGCTCCT	0.692																																					p.D29N		.											.	ACTN2	95	0			c.G85A						.						48.0	43.0	45.0					1																	236850058		2203	4300	6503	SO:0001583	missense	88	exon1			GACCGCGACCTGC	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.85G>A	1.37:g.236850058G>A	ENSP00000355537:p.Asp29Asn	92.0	0.0		157.0	11.0	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.247493	0.80024	.	.	ENSG00000077522	ENST00000542672;ENST00000366578	T;T	0.60299	0.2;0.2	3.81	2.86	0.33363	Calponin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.49915	0.1585	L	0.58583	1.82	0.80722	D	1	P;P	0.39157	0.662;0.649	B;B	0.31869	0.137;0.057	T	0.56751	-0.7927	10	0.87932	D	0	.	13.0662	0.59034	0.0:0.163:0.837:0.0	.	29;29	B2RCS5;P35609	.;ACTN2_HUMAN	N	29	ENSP00000443495:D29N;ENSP00000355537:D29N	ENSP00000355537:D29N	D	+	1	0	ACTN2	234916681	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.711000	0.91396	0.757000	0.33036	0.462000	0.41574	GAC	.		0.692	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
ACVR2A	92	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	148657133	148657133	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:148657133C>T	ENST00000241416.7	+	3	1006	c.370C>T	c.(370-372)Cag>Tag	p.Q124*	AC009480.3_ENST00000402410.2_RNA|ACVR2A_ENST00000404590.1_Nonsense_Mutation_p.Q124*|ACVR2A_ENST00000535787.1_Nonsense_Mutation_p.Q16*	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	124					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		GGAAGTCACACAGCGTAAGTT	0.373																																					p.Q124X		.											.	ACVR2A	831	0			c.C370T						.						152.0	160.0	157.0					2																	148657133		2202	4300	6502	SO:0001587	stop_gained	92	exon3			GTCACACAGCGTA		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.370C>T	2.37:g.148657133C>T	ENSP00000241416:p.Gln124*	19.0	0.0		55.0	17.0	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Nonsense_Mutation	SNP	ENST00000241416.7	37	CCDS33301.1	.	.	.	.	.	.	.	.	.	.	C	40	8.231984	0.98717	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	.	.	.	5.56	4.63	0.57726	.	0.426594	0.27572	N	0.018763	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	14.7454	0.69488	0.1435:0.8564:0.0:0.0	.	.	.	.	X	124;16;124	.	ENSP00000241416:Q124X	Q	+	1	0	ACVR2A	148373603	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.585000	0.36600	2.771000	0.95319	0.650000	0.86243	CAG	.		0.373	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
AKR1E2	83592	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	4875659	4875659	+	Splice_Site	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr10:4875659G>T	ENST00000298375.7	+	3	395		c.e3+1		AKR1E2_ENST00000525281.1_Intron|AKR1E2_ENST00000334019.4_Splice_Site|AKR1E2_ENST00000532248.1_Splice_Site|AKR1E2_ENST00000345253.5_Splice_Site	NM_001040177.2	NP_001035267.1	Q96JD6	AKCL2_HUMAN	aldo-keto reductase family 1, member E2							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	1,5-anhydro-D-fructose reductase activity (GO:0050571)			NS(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)	15						GGGTTTCAAGGTACCGTTCAG	0.527																																					.	NSCLC(43;343 1097 20371 28813 45509)	.											.	AKR1E2	68	0			c.324+1G>T						.						233.0	198.0	210.0					10																	4875659		2203	4300	6503	SO:0001630	splice_region_variant	83592	exon3			TTCAAGGTACCGT	AB040820	CCDS31134.1, CCDS59210.1, CCDS59209.1	10p15.2	2009-09-09	2009-09-09	2009-09-09	ENSG00000165568	ENSG00000165568		"""Aldo-keto reductases"""	23437	protein-coding gene	gene with protein product			"""aldo-keto reductase family 1, member C-like 2"""	AKRDC1, AKR1CL2			Standard	NM_001271021		Approved	MGC10612	uc001ihi.4	Q96JD6	OTTHUMG00000017577	ENST00000298375.7:c.324+1G>T	10.37:g.4875659G>T		232.0	1.0		274.0	57.0	NM_001271021	Q86Z16|Q86Z17|Q86Z18|Q9BU71	Splice_Site	SNP	ENST00000298375.7	37	CCDS31134.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.573191	0.45902	.	.	ENSG00000165568	ENST00000462718;ENST00000533295;ENST00000298375;ENST00000532248;ENST00000334019;ENST00000345253	.	.	.	3.29	3.29	0.37713	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8652	0.57936	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AKR1E2	4865659	1.000000	0.71417	0.986000	0.45419	0.696000	0.40369	8.715000	0.91416	2.165000	0.68154	0.561000	0.74099	.	.		0.527	AKR1E2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046520.4	NM_031436	Intron
ALB	213	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	74283832	74283834	+	In_Frame_Del	DEL	GTG	GTG	-			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	GTG	GTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr4:74283832_74283834delGTG	ENST00000503124.1	+	10	1213_1215	c.1006_1008delGTG	c.(1006-1008)gtgdel	p.V336del	ALB_ENST00000509063.1_In_Frame_Del_p.V486del|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000295897.4_In_Frame_Del_p.V486del|ALB_ENST00000401494.3_In_Frame_Del_p.V371del|ALB_ENST00000415165.2_In_Frame_Del_p.V294del			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CCAGTTATGTGTGTTGCATGAGA	0.419																																					p.486_486del		.											.	ALB	96	0			c.1456_1458del						.																																			SO:0001651	inframe_deletion	213	exon12			TTATGTGTGTTGC	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.1006_1008delGTG	4.37:g.74283832_74283834delGTG	ENSP00000421027:p.Val336del	55.0	0.0		96.0	20.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	In_Frame_Del	DEL	ENST00000503124.1	37																																																																																				.		0.419	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
AP3B2	8120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	83357541	83357541	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr15:83357541C>G	ENST00000261722.3	-	4	514	c.307G>C	c.(307-309)Gag>Cag	p.E103Q	AP3B2_ENST00000561455.1_5'UTR|RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535348.1_Intron|AP3B2_ENST00000535359.1_Missense_Mutation_p.E103Q|AP3B2_ENST00000542200.1_Missense_Mutation_p.E103Q	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	103					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			TCTTGCTGCTCCTCAGCGTAG	0.602																																					p.E103Q		.											.	AP3B2	94	0			c.G307C						.						78.0	84.0	82.0					15																	83357541		2117	4237	6354	SO:0001583	missense	8120	exon4			GCTGCTCCTCAGC	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.307G>C	15.37:g.83357541C>G	ENSP00000261722:p.Glu103Gln	152.0	0.0		170.0	31.0	NM_004644	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Missense_Mutation	SNP	ENST00000261722.3	37	CCDS45331.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.225169	0.79576	.	.	ENSG00000103723	ENST00000261722;ENST00000535359;ENST00000541693;ENST00000542200;ENST00000535513	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	5.76	5.76	0.90799	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.108228	0.64402	N	0.000007	T	0.33702	0.0872	L	0.31476	0.935	0.80722	D	1	P;P;B	0.40000	0.698;0.592;0.236	B;P;B	0.45276	0.222;0.475;0.349	T	0.02294	-1.1181	10	0.42905	T	0.14	-24.8029	19.5631	0.95380	0.0:1.0:0.0:0.0	.	103;103;103	F5H0E6;B7ZKS0;Q13367	.;.;AP3B2_HUMAN	Q	103;103;59;103;103	ENSP00000261722:E103Q;ENSP00000440984:E103Q;ENSP00000441961:E59Q;ENSP00000440719:E103Q	ENSP00000261722:E103Q	E	-	1	0	AP3B2	81154595	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.693000	0.84214	2.710000	0.92621	0.655000	0.94253	GAG	.		0.602	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1		
APOC3	345	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	116703552	116703552	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:116703552C>G	ENST00000227667.3	+	4	314	c.252C>G	c.(250-252)ttC>ttG	p.F84L	APOC3_ENST00000375345.1_Missense_Mutation_p.F102L	NM_000040.1	NP_000031.1	P02656	APOC3_HUMAN	apolipoprotein C-III	84	Lipid-binding.				cellular response to glucose stimulus (GO:0071333)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle remodeling (GO:0034375)|inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of cholesterol import (GO:0060621)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of high-density lipoprotein particle clearance (GO:0010987)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of triglyceride catabolic process (GO:0010897)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	cholesterol binding (GO:0015485)|enzyme regulator activity (GO:0030234)|high-density lipoprotein particle receptor binding (GO:0070653)|lipase inhibitor activity (GO:0055102)|phospholipid binding (GO:0005543)			endometrium(1)|lung(6)	7	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		TCTCTGAGTTCTGGGATTTGG	0.552																																					p.F84L	GBM(81;259 1650 7161 35190)	.											.	APOC3	68	0			c.C252G						.						114.0	105.0	108.0					11																	116703552		2201	4296	6497	SO:0001583	missense	345	exon4			TGAGTTCTGGGAT	X01388	CCDS8377.1	11q23.3	2013-01-24			ENSG00000110245	ENSG00000110245		"""Apolipoproteins"""	610	protein-coding gene	gene with protein product		107720					Standard	NM_000040		Approved		uc001ppt.1	P02656	OTTHUMG00000046115	ENST00000227667.3:c.252C>G	11.37:g.116703552C>G	ENSP00000227667:p.Phe84Leu	159.0	1.0		179.0	59.0	NM_000040	Q08E83|Q6Q786	Missense_Mutation	SNP	ENST00000227667.3	37	CCDS8377.1	.	.	.	.	.	.	.	.	.	.	C	9.256	1.041936	0.19748	.	.	ENSG00000110245	ENST00000227667;ENST00000375345	D;D	0.92348	-3.02;-3.02	5.04	0.789	0.18607	.	0.186208	0.26190	N	0.025818	D	0.83617	0.5293	.	.	.	0.30075	N	0.809711	B	0.25563	0.129	B	0.26969	0.075	T	0.74147	-0.3759	9	0.26408	T	0.33	-19.9252	7.245	0.26117	0.3179:0.3726:0.3095:0.0	.	84	P02656	APOC3_HUMAN	L	84;102	ENSP00000227667:F84L;ENSP00000364494:F102L	ENSP00000227667:F84L	F	+	3	2	APOC3	116208762	0.995000	0.38212	0.981000	0.43875	0.039000	0.13416	0.748000	0.26305	0.662000	0.31006	0.555000	0.69702	TTC	.		0.552	APOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106284.2	NM_000040	
ARHGEF11	9826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156937793	156937793	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:156937793A>C	ENST00000361409.2	-	10	1571	c.829T>G	c.(829-831)Tca>Gca	p.S277A	ARHGEF11_ENST00000368194.3_Missense_Mutation_p.S317A	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	277					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCACCGGTTGAGGGGACTGCT	0.582																																					p.S317A		.											.	ARHGEF11	233	0			c.T949G						.						54.0	51.0	52.0					1																	156937793		2203	4300	6503	SO:0001583	missense	9826	exon11			CGGTTGAGGGGAC	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.829T>G	1.37:g.156937793A>C	ENSP00000354644:p.Ser277Ala	152.0	0.0		173.0	37.0	NM_198236	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	37	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	A	6.104	0.387446	0.11581	.	.	ENSG00000132694	ENST00000368194;ENST00000361409	T;T	0.66280	-0.2;-0.13	4.81	-3.32	0.04973	.	1.665720	0.03587	N	0.231258	T	0.09992	0.0245	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.03296	-1.1051	10	0.06757	T	0.87	0.9157	0.1917	0.00135	0.2972:0.2247:0.2488:0.2292	.	277;317	O15085;O15085-2	ARHGB_HUMAN;.	A	317;277	ENSP00000357177:S317A;ENSP00000354644:S277A	ENSP00000354644:S277A	S	-	1	0	ARHGEF11	155204417	0.000000	0.05858	0.000000	0.03702	0.355000	0.29361	0.242000	0.18087	-1.007000	0.03408	-1.313000	0.01306	TCA	.		0.582	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	
ARHGEF18	23370	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	7504866	7504866	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:7504866G>T	ENST00000359920.6	+	1	293	c.40G>T	c.(40-42)Gct>Tct	p.A14S	CTD-2207O23.3_ENST00000593531.1_Intron|ARHGEF18_ENST00000319670.9_Intron	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	14					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				CTCCAGACCCGCTGCTTCAGC	0.512																																					p.A14S		.											.	ARHGEF18	228	0			c.G40T						.						23.0	23.0	23.0					19																	7504866		692	1591	2283	SO:0001583	missense	23370	exon1			AGACCCGCTGCTT	AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.40G>T	19.37:g.7504866G>T	ENSP00000352995:p.Ala14Ser	127.0	1.0		97.0	33.0	NM_001130955	A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	ENST00000359920.6	37	CCDS45946.1	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595496	0.46318	.	.	ENSG00000104880	ENST00000359920	T	0.35973	1.28	5.19	2.65	0.31530	.	0.000000	0.34386	U	0.004020	T	0.20740	0.0499	L	0.27053	0.805	0.80722	D	1	P	0.47762	0.9	B	0.36666	0.23	T	0.02232	-1.1191	10	0.56958	D	0.05	-0.7353	8.0854	0.30769	0.2407:0.0:0.7593:0.0	.	14	Q6ZSZ5	ARHGI_HUMAN	S	14	ENSP00000352995:A14S	ENSP00000352995:A14S	A	+	1	0	ARHGEF18	7410866	0.999000	0.42202	0.182000	0.23118	0.947000	0.59692	1.286000	0.33273	0.355000	0.24131	0.561000	0.74099	GCT	.		0.512	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436340.1	NM_015318	
ARHGEF2	9181	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	155932460	155932460	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:155932460C>T	ENST00000361247.4	-	9	1124	c.1025G>A	c.(1024-1026)tGc>tAc	p.C342Y	ARHGEF2_ENST00000313695.7_Missense_Mutation_p.C314Y|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.C387Y|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.C341Y|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000368316.1_Missense_Mutation_p.C314Y|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.C343Y	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	342	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GTGGCGGCTGCAGAACTCCGA	0.537																																					p.C342Y	Melanoma(178;35 2768 6610 28839)	.											.	ARHGEF2	228	0			c.G1025A						.						65.0	66.0	66.0					1																	155932460		2203	4300	6503	SO:0001583	missense	9181	exon9			CGGCTGCAGAACT	AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.1025G>A	1.37:g.155932460C>T	ENSP00000354837:p.Cys342Tyr	181.0	0.0		287.0	22.0	NM_001162383	D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	ENST00000361247.4	37	CCDS53376.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.659865	0.88154	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000435736;ENST00000543433;ENST00000313667	T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26	5.08	5.08	0.68730	Dbl homology (DH) domain (5);	0.000000	0.52532	D	0.000072	D	0.83326	0.5230	M	0.91140	3.18	0.80722	D	1	D;D;P;D	0.76494	0.999;0.984;0.77;0.966	D;D;B;P	0.76071	0.987;0.954;0.424;0.879	D	0.86301	0.1680	10	0.87932	D	0	-27.6171	16.3414	0.83083	0.0:1.0:0.0:0.0	.	387;386;342;341	B7Z977;D3DVA5;Q92974;Q92974-2	.;.;ARHG2_HUMAN;.	Y	314;342;343;314;387;315;341	ENSP00000315325:C314Y;ENSP00000354837:C342Y;ENSP00000357298:C343Y;ENSP00000357299:C314Y;ENSP00000314787:C341Y	ENSP00000314787:C341Y	C	-	2	0	ARHGEF2	154199084	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.156000	0.77453	2.803000	0.96430	0.609000	0.83330	TGC	.		0.537	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723	
ATG4B	23192	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	242592932	242592932	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:242592932A>G	ENST00000404914.3	+	4	293	c.190A>G	c.(190-192)Aca>Gca	p.T64A	ATG4B_ENST00000396411.3_5'UTR|ATG4B_ENST00000474739.2_Missense_Mutation_p.T50A|ATG4B_ENST00000405546.3_Missense_Mutation_p.T64A|ATG4B_ENST00000402096.1_5'UTR	NM_013325.4|NM_178326.2	NP_037457.3|NP_847896.1	Q9Y4P1	ATG4B_HUMAN	autophagy related 4B, cysteine peptidase	64					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|positive regulation of autophagy (GO:0010508)|positive regulation of protein catabolic process (GO:0045732)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)|endopeptidase activity (GO:0004175)			breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.44e-33)|all cancers(36;5.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.75e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0848)		GACAGGGGGGACAGGCCCCAC	0.657																																					p.T64A	Melanoma(78;458 1323 6342 12171 39523)	.											.	.	.	0			c.A190G						.						18.0	22.0	21.0					2																	242592932		2154	4229	6383	SO:0001583	missense	23192	exon4			GGGGGGACAGGCC	AB023160	CCDS46564.1, CCDS46565.1	2q37.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000168397	ENSG00000168397			20790	protein-coding gene	gene with protein product		611338	"""APG4 autophagy 4 homolog B (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog B (S. cerevisiae)"""	APG4B		12446702	Standard	NM_013325		Approved	Apg4B, KIAA0943, DKFZp586D1822, AUTL1	uc002wbv.3	Q9Y4P1	OTTHUMG00000151514	ENST00000404914.3:c.190A>G	2.37:g.242592932A>G	ENSP00000384259:p.Thr64Ala	207.0	2.0		204.0	42.0	NM_178326	B7WNK2|Q53NU4|Q6ZUV8|Q8WYM9|Q96K07|Q96K96|Q96SZ1|Q9Y2F2	Missense_Mutation	SNP	ENST00000404914.3	37	CCDS46564.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.764050	0.89932	.	.	ENSG00000168397	ENST00000405546;ENST00000337606;ENST00000404914;ENST00000474739;ENST00000425239;ENST00000400771	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	5.6	4.43	0.53597	.	0.000000	0.85682	D	0.000000	T	0.62780	0.2456	M	0.84948	2.725	0.80722	D	1	D;D;D;P	0.62365	0.991;0.988;0.991;0.899	P;P;P;P	0.62184	0.885;0.899;0.885;0.837	T	0.68040	-0.5514	10	0.59425	D	0.04	-24.3566	10.984	0.47513	0.9236:0.0:0.0764:0.0	.	50;181;152;64	F5H7P2;B4DZK0;Q9Y4P1-2;Q9Y4P1	.;.;.;ATG4B_HUMAN	A	64;181;64;50;64;64	ENSP00000383964:T64A;ENSP00000384259:T64A;ENSP00000442378:T50A;ENSP00000409895:T64A;ENSP00000383582:T64A	ENSP00000336547:T181A	T	+	1	0	ATG4B	242241605	1.000000	0.71417	0.776000	0.31678	0.990000	0.78478	6.093000	0.71422	2.143000	0.66587	0.459000	0.35465	ACA	.		0.657	ATG4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322967.3	NM_013325	
ATP13A5	344905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	193029676	193029676	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:193029676A>G	ENST00000342358.4	-	20	2491	c.2374T>C	c.(2374-2376)Tgt>Cgt	p.C792R	ATP13A5_ENST00000495496.1_5'UTR|ATP13A5-AS1_ENST00000414634.1_RNA	NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	792						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.C792R(1)		NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		AAATGGTAACAGCTTCCTCCT	0.393																																					p.C792R		.											.	ATP13A5	144	1	Substitution - Missense(1)	lung(1)	c.T2374C						.						145.0	133.0	137.0					3																	193029676		2203	4300	6503	SO:0001583	missense	344905	exon20			GGTAACAGCTTCC	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.2374T>C	3.37:g.193029676A>G	ENSP00000341942:p.Cys792Arg	92.0	0.0		176.0	29.0	NM_198505	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	37	CCDS33914.1	.	.	.	.	.	.	.	.	.	.	A	6.688	0.495628	0.12762	.	.	ENSG00000187527	ENST00000342358	D	0.83837	-1.77	5.44	-5.59	0.02505	HAD-like domain (1);	1.552730	0.03177	N	0.171566	T	0.65176	0.2666	N	0.24115	0.695	0.09310	N	0.999997	B	0.17268	0.021	B	0.15052	0.012	T	0.48031	-0.9070	10	0.25106	T	0.35	2.2476	0.4128	0.00444	0.2148:0.264:0.1666:0.3546	.	792	Q4VNC0	AT135_HUMAN	R	792	ENSP00000341942:C792R	ENSP00000341942:C792R	C	-	1	0	ATP13A5	194512370	0.000000	0.05858	0.004000	0.12327	0.192000	0.23643	-1.208000	0.03005	-0.555000	0.06142	0.528000	0.53228	TGT	.		0.393	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
ATP8A2	51761	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	26586735	26586735	+	Silent	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr13:26586735C>A	ENST00000381655.2	+	36	3586	c.3444C>A	c.(3442-3444)ggC>ggA	p.G1148G	ATP8A2_ENST00000255283.8_Silent_p.G1083G	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	1108					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TGTTCCGGGGCAGCTCCCTGC	0.687																																					p.G1148G		.											.	ATP8A2	138	0			c.C3444A						.						9.0	10.0	9.0					13																	26586735		1761	3878	5639	SO:0001819	synonymous_variant	51761	exon36			CCGGGGCAGCTCC	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.3444C>A	13.37:g.26586735C>A		38.0	0.0		61.0	35.0	NM_016529	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Silent	SNP	ENST00000381655.2	37	CCDS41873.1																																																																																			.		0.687	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
ATP9A	10079	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	50273555	50273555	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr20:50273555G>T	ENST00000338821.5	-	14	1692	c.1428C>A	c.(1426-1428)aaC>aaA	p.N476K	ATP9A_ENST00000311637.5_Missense_Mutation_p.N340K|ATP9A_ENST00000402822.1_Missense_Mutation_p.N355K	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	476					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.N476N(1)		breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CAGTCACACCGTTGGACTCAT	0.617																																					p.N476K		.											.	ATP9A	94	1	Substitution - coding silent(1)	large_intestine(1)	c.C1428A						.						113.0	83.0	93.0					20																	50273555		2203	4300	6503	SO:0001583	missense	10079	exon14			CACACCGTTGGAC	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.1428C>A	20.37:g.50273555G>T	ENSP00000342481:p.Asn476Lys	152.0	0.0		209.0	22.0	NM_006045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	ENST00000338821.5	37	CCDS33489.1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.375881	0.42105	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	D;D;D	0.96011	-3.88;-3.88;-3.88	5.02	-5.71	0.02413	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.86781	0.6015	N	0.04768	-0.165	0.58432	D	0.999997	B;P	0.46512	0.325;0.879	B;P	0.44597	0.072;0.454	T	0.81874	-0.0732	10	0.32370	T	0.25	-27.125	13.0906	0.59166	0.5748:0.0:0.4252:0.0	.	355;476	O75110-2;O75110	.;ATP9A_HUMAN	K	340;476;355	ENSP00000309086:N340K;ENSP00000342481:N476K;ENSP00000385875:N355K	ENSP00000309086:N340K	N	-	3	2	ATP9A	49706962	0.932000	0.31603	0.799000	0.32177	0.299000	0.27559	-0.051000	0.11885	-0.976000	0.03542	-1.595000	0.00837	AAC	.		0.617	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
B3GNT2	10678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	62449528	62449528	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:62449528A>T	ENST00000301998.4	+	2	425	c.173A>T	c.(172-174)tAc>tTc	p.Y58F	B3GNT2_ENST00000405767.1_Missense_Mutation_p.Y58F	NM_006577.5	NP_006568.2	Q9NY97	B3GN2_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2	58					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)	18	Lung NSC(7;0.031)|all_lung(7;0.0634)		LUSC - Lung squamous cell carcinoma(7;3.55e-06)|Epithelial(17;0.0963)			CCCGAGGCATACTGGAACCGA	0.502																																					p.Y58F		.											.	B3GNT2	23	0			c.A173T						.						146.0	171.0	162.0					2																	62449528		2203	4300	6503	SO:0001583	missense	10678	exon2			AGGCATACTGGAA	AB049584	CCDS1870.1	2p15	2013-02-19	2006-04-12	2006-04-12	ENSG00000170340	ENSG00000170340		"""Beta 3-glycosyltransferases"""	15629	protein-coding gene	gene with protein product		605581	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1"""	B3GNT1		9892646, 11042166	Standard	NM_006577		Approved	B3GNT-2, BETA3GNT, B3GN-T2, B3GN-T1	uc002sbs.3	Q9NY97	OTTHUMG00000129444	ENST00000301998.4:c.173A>T	2.37:g.62449528A>T	ENSP00000305595:p.Tyr58Phe	101.0	0.0		115.0	12.0	NM_006577	Q54AC1|Q9NQQ9|Q9NQR0|Q9NUT9	Missense_Mutation	SNP	ENST00000301998.4	37	CCDS1870.1	.	.	.	.	.	.	.	.	.	.	A	12.60	1.988060	0.35036	.	.	ENSG00000170340	ENST00000301998;ENST00000405767	T;T	0.26373	1.74;1.74	6.02	6.02	0.97574	.	0.120536	0.64402	D	0.000019	T	0.27731	0.0682	L	0.58428	1.81	0.58432	D	0.999996	B	0.09022	0.002	B	0.08055	0.003	T	0.07347	-1.0777	10	0.17369	T	0.5	.	16.5446	0.84426	1.0:0.0:0.0:0.0	.	58	Q9NY97	B3GN2_HUMAN	F	58	ENSP00000305595:Y58F;ENSP00000384692:Y58F	ENSP00000305595:Y58F	Y	+	2	0	B3GNT2	62303032	1.000000	0.71417	0.921000	0.36526	0.827000	0.46813	3.663000	0.54518	2.311000	0.77944	0.533000	0.62120	TAC	.		0.502	B3GNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251606.2	NM_006577	
DQX1	165545	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	74754135	74754135	+	5'Flank	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:74754135T>C	ENST00000404568.3	-	0	0				HTRA2_ENST00000352222.3_5'Flank|AUP1_ENST00000377526.3_Missense_Mutation_p.K377E|HTRA2_ENST00000258080.3_5'Flank|DQX1_ENST00000495597.1_5'Flank|DQX1_ENST00000393951.2_5'Flank	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1							nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						CAGGAAGACTTGGCAAATGTT	0.532																																					p.K377E		.											.	AUP1	90	0			c.A1129G						.						52.0	54.0	54.0					2																	74754135		1948	4141	6089	SO:0001631	upstream_gene_variant	550	exon11			AAGACTTGGCAAA	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965		2.37:g.74754135T>C	Exception_encountered	54.0	0.0		105.0	5.0	NM_181575	Q6B017|Q8NAM8	Missense_Mutation	SNP	ENST00000404568.3	37	CCDS1949.2	.	.	.	.	.	.	.	.	.	.	T	21.8	4.202405	0.79127	.	.	ENSG00000115307	ENST00000377526;ENST00000258081	.	.	.	5.36	5.36	0.76844	.	0.159108	0.56097	D	0.000029	T	0.66247	0.2770	L	0.54323	1.7	0.51012	D	0.999902	D;D;D	0.61080	0.988;0.989;0.986	P;P;P	0.58520	0.76;0.775;0.84	T	0.69292	-0.5183	9	0.72032	D	0.01	-15.7148	11.6678	0.51383	0.0:0.0:0.0:1.0	.	434;443;377	E7EU18;Q9Y679;Q9Y679-2	.;AUP1_HUMAN;.	E	377;441	.	ENSP00000258081:K441E	K	-	1	0	AUP1	74607643	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.088000	0.71371	2.246000	0.74042	0.533000	0.62120	AAG	.		0.532	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3	NM_133637	
BBS7	55212	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	122747089	122747089	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr4:122747089T>C	ENST00000264499.4	-	19	2257	c.2074A>G	c.(2074-2076)Aaa>Gaa	p.K692E	CCNA2_ENST00000274026.5_5'Flank	NM_176824.2	NP_789794.1	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7	692					brain development (GO:0007420)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|digestive tract morphogenesis (GO:0048546)|eye development (GO:0001654)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|limb development (GO:0060173)|melanosome transport (GO:0032402)|nonmotile primary cilium assembly (GO:0035058)|palate development (GO:0060021)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|visual perception (GO:0007601)	axoneme (GO:0005930)|BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						AGGGGTACTTTAGTTTTTACA	0.318									Bardet-Biedl syndrome																												p.K692E		.											.	BBS7	91	0			c.A2074G						.						86.0	90.0	89.0					4																	122747089		2203	4299	6502	SO:0001583	missense	55212	exon19	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	GTACTTTAGTTTT	AF521644	CCDS3724.1, CCDS54799.1	4q27	2013-01-08			ENSG00000138686	ENSG00000138686			18758	protein-coding gene	gene with protein product		607590					Standard	NM_176824		Approved	FLJ10715, BBS2L1	uc003ied.3	Q8IWZ6	OTTHUMG00000133076	ENST00000264499.4:c.2074A>G	4.37:g.122747089T>C	ENSP00000264499:p.Lys692Glu	18.0	0.0		37.0	10.0	NM_176824	Q4W5P8|Q8N581|Q9NVI4	Missense_Mutation	SNP	ENST00000264499.4	37	CCDS3724.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.394128	0.83011	.	.	ENSG00000138686	ENST00000264499;ENST00000507814	T;T	0.77750	-1.12;-1.12	5.81	5.81	0.92471	.	0.049340	0.85682	D	0.000000	D	0.88051	0.6333	M	0.85945	2.785	0.80722	D	1	D	0.69078	0.997	D	0.63113	0.911	D	0.88443	0.3043	10	0.42905	T	0.14	-15.727	16.1773	0.81862	0.0:0.0:0.0:1.0	.	692	Q8IWZ6	BBS7_HUMAN	E	692;115	ENSP00000264499:K692E;ENSP00000423250:K115E	ENSP00000264499:K692E	K	-	1	0	BBS7	122966539	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	6.070000	0.71220	2.217000	0.71921	0.482000	0.46254	AAA	.		0.318	BBS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256716.1		
BTBD19	149478	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	45278683	45278683	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:45278683G>A	ENST00000450269.1	+	5	769	c.430G>A	c.(430-432)Ggc>Agc	p.G144S	BTBD19_ENST00000453418.1_3'UTR|BTBD19_ENST00000409335.2_Missense_Mutation_p.G106S	NM_001136537.1	NP_001130009.1	C9JJ37	BTBDJ_HUMAN	BTB (POZ) domain containing 19	144	BACK.									breast(1)|endometrium(1)	2						CGTAACCTTTGGCCTGGGGCA	0.622																																					p.G144S		.											.	.	.	0			c.G430A						.						76.0	67.0	70.0					1																	45278683		692	1591	2283	SO:0001583	missense	149478	exon5			ACCTTTGGCCTGG			1p34.1	2013-01-08			ENSG00000222009	ENSG00000222009		"""BTB/POZ domain containing"""	27145	protein-coding gene	gene with protein product							Standard	NM_001136537		Approved		uc010ole.1	C9JJ37	OTTHUMG00000008493	ENST00000450269.1:c.430G>A	1.37:g.45278683G>A	ENSP00000395461:p.Gly144Ser	154.0	1.0		187.0	47.0	NM_001136537	B4E384|B7ZC36|B7ZC37	Missense_Mutation	SNP	ENST00000450269.1	37		.	.	.	.	.	.	.	.	.	.	G	23.0	4.359878	0.82353	.	.	ENSG00000222009	ENST00000450269;ENST00000409335	T;T	0.71579	-0.3;-0.58	4.86	4.86	0.63082	BTB/Kelch-associated (2);	.	.	.	.	T	0.57548	0.2061	N	0.05306	-0.075	0.80722	D	1	P	0.48503	0.911	P	0.51516	0.672	T	0.55988	-0.8053	9	0.11182	T	0.66	-12.8747	14.6985	0.69139	0.0:0.0:1.0:0.0	.	144	C9JJ37	BTBDJ_HUMAN	S	144;106	ENSP00000395461:G144S;ENSP00000386506:G106S	ENSP00000386506:G106S	G	+	1	0	BTBD19	45051270	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.467000	0.45093	2.223000	0.72356	0.462000	0.41574	GGC	.		0.622	BTBD19-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001136537	
C1QTNF2	114898	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	5	159797621	159797621	+	Silent	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr5:159797621C>A	ENST00000393975.3	-	1	27	c.24G>T	c.(22-24)ccG>ccT	p.P8P		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	0					activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGCAGAGCGTCGGCCCCAGGC	0.687																																					p.P8P		.											.	C1QTNF2	91	0			c.G24T						.						14.0	17.0	16.0					5																	159797621		1838	4041	5879	SO:0001819	synonymous_variant	114898	exon1			GAGCGTCGGCCCC	AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.24G>T	5.37:g.159797621C>A		18.0	0.0		39.0	14.0	NM_031908		Silent	SNP	ENST00000393975.3	37	CCDS4351.2																																																																																			.		0.687	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252672.2		
C20orf166-AS1	253868	broad.mit.edu;ucsc.edu;mdanderson.org	37	20	61143534	61143534	+	RNA	SNP	C	C	T	rs368429459		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr20:61143534C>T	ENST00000475015.1	-	0	804				C20orf166-AS1_ENST00000436101.1_RNA|C20orf166-AS1_ENST00000412495.1_RNA			Q96NR2	C2AS1_HUMAN	C20orf166 antisense RNA 1																		CCTGCCGGGGCGTGTGTGCCA	0.647																																					.		.											.	.	.	0			.						.	C		0,4406		0,0,2203	39.0	38.0	38.0			-0.6	0.0	20		38	1,8599	1.2+/-3.3	0,1,4299	no	intergenic				0,1,6502	TT,TC,CC		0.0116,0.0,0.0077			61143534	1,13005	2203	4300	6503			253868	.			CCGGGGCGTGTGT	AK054875		20q13.33	2012-10-12	2012-08-15	2011-08-10	ENSG00000174403	ENSG00000174403		"""Long non-coding RNAs"""	26393	non-coding RNA	RNA, long non-coding			"""chromosome 20 open reading frame 200"", ""non-protein coding RNA 335"", ""C20orf166 antisense RNA 1 (non-protein coding)"""	C20orf200, NCRNA00335			Standard	NR_033263		Approved	FLJ30313	uc002ycz.3	Q96NR2	OTTHUMG00000048002		20.37:g.61143534C>T		36.0	0.0		55.0	27.0	.	Q52LN1	RNA	SNP	ENST00000475015.1	37																																																																																				.		0.647	C20orf166-AS1-002	KNOWN	basic	antisense	antisense	OTTHUMT00000109266.2	NR_033263	
C3	718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6693493	6693493	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:6693493T>C	ENST00000245907.6	-	25	3252	c.3160A>G	c.(3160-3162)Acc>Gcc	p.T1054A		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1054					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	AGCTGCTGGGTGTACCCTGCA	0.652																																					p.T1054A		.											.	C3	95	0			c.A3160G						.						36.0	33.0	34.0					19																	6693493		2202	4300	6502	SO:0001583	missense	718	exon25			GCTGGGTGTACCC	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.3160A>G	19.37:g.6693493T>C	ENSP00000245907:p.Thr1054Ala	29.0	0.0		40.0	21.0	NM_000064	A7E236	Missense_Mutation	SNP	ENST00000245907.6	37	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	T	0.019	-1.450423	0.01080	.	.	ENSG00000125730	ENST00000245907	T	0.31510	1.49	5.52	2.25	0.28309	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.309452	0.39020	N	0.001481	T	0.14399	0.0348	N	0.20881	0.62	0.09310	N	0.999998	B	0.11235	0.004	B	0.12156	0.007	T	0.16958	-1.0385	10	0.16896	T	0.51	.	1.7163	0.02902	0.1373:0.1575:0.1423:0.5629	.	1054	P01024	CO3_HUMAN	A	1054	ENSP00000245907:T1054A	ENSP00000245907:T1054A	T	-	1	0	C3	6644493	0.567000	0.26626	0.998000	0.56505	0.235000	0.25334	0.338000	0.19858	0.461000	0.27071	-0.280000	0.10049	ACC	.		0.652	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
CADPS2	93664	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	122526154	122526154	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:122526154C>G	ENST00000449022.2	-	1	257	c.238G>C	c.(238-240)Gag>Cag	p.E80Q	CADPS2_ENST00000334010.7_Missense_Mutation_p.E80Q|CADPS2_ENST00000313070.7_Missense_Mutation_p.E80Q|CADPS2_ENST00000412584.2_Missense_Mutation_p.E80Q	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	80					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						ATCCTCCGCTCCTGCTCATCG	0.701																																					p.E80Q		.											.	CADPS2	94	0			c.G238C						.						13.0	19.0	17.0					7																	122526154		2173	4266	6439	SO:0001583	missense	93664	exon1			TCCGCTCCTGCTC		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.238G>C	7.37:g.122526154C>G	ENSP00000398481:p.Glu80Gln	94.0	0.0		143.0	29.0	NM_001167940	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	ENST00000449022.2	37	CCDS55158.1	.	.	.	.	.	.	.	.	.	.	C	19.91	3.914146	0.72983	.	.	ENSG00000081803	ENST00000313070;ENST00000334010;ENST00000420900;ENST00000545465;ENST00000412584;ENST00000449022	D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61	4.71	4.71	0.59529	.	0.074039	0.51477	D	0.000087	T	0.81889	0.4918	M	0.69185	2.1	0.58432	D	0.999997	B;B	0.17038	0.02;0.003	B;B	0.17722	0.019;0.004	T	0.80238	-0.1465	10	0.54805	T	0.06	-5.8539	15.1488	0.72681	0.0:1.0:0.0:0.0	.	80;80	Q86UW7-2;Q86UW7	.;CAPS2_HUMAN	Q	80;80;80;47;80;80	ENSP00000325581:E80Q;ENSP00000333940:E80Q;ENSP00000400401:E80Q;ENSP00000398481:E80Q	ENSP00000325581:E80Q	E	-	1	0	CADPS2	122313390	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.225000	0.58600	2.123000	0.65237	0.508000	0.49915	GAG	.		0.701	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954	
CAPRIN1	4076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	34101204	34101204	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:34101204G>A	ENST00000341394.4	+	7	907	c.718G>A	c.(718-720)Gtt>Att	p.V240I	CAPRIN1_ENST00000530820.1_Missense_Mutation_p.V240I|CAPRIN1_ENST00000532820.1_Missense_Mutation_p.V240I|CAPRIN1_ENST00000529307.1_Missense_Mutation_p.V159I|CAPRIN1_ENST00000389645.3_Missense_Mutation_p.V240I	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	240					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				TGTTGAGCGTGTTTTTCAGTC	0.423																																					p.V240I		.											.	CAPRIN1	91	0			c.G718A						.						94.0	92.0	93.0					11																	34101204		2202	4298	6500	SO:0001583	missense	4076	exon7			GAGCGTGTTTTTC	BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.718G>A	11.37:g.34101204G>A	ENSP00000340329:p.Val240Ile	82.0	0.0		72.0	19.0	NM_203364	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	ENST00000341394.4	37	CCDS31453.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974305	0.34848	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	5.56	4.43	0.53597	.	0.104805	0.64402	D	0.000004	T	0.10809	0.0264	N	0.08118	0	0.44395	D	0.9973	B;B	0.15930	0.015;0.008	B;B	0.15484	0.01;0.013	T	0.30650	-0.9971	10	0.02654	T	1	-6.4504	4.1179	0.10090	0.3154:0.0:0.6846:0.0	.	240;240	Q14444;Q14444-2	CAPR1_HUMAN;.	I	240;240;240;240;159	ENSP00000340329:V240I;ENSP00000374296:V240I;ENSP00000434150:V240I;ENSP00000434204:V240I;ENSP00000431581:V159I	ENSP00000340329:V240I	V	+	1	0	CAPRIN1	34057780	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.115000	0.57865	2.779000	0.95612	0.637000	0.83480	GTT	.		0.423	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388680.2	NM_005898	
CCDC91	55297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	28459739	28459739	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr12:28459739A>G	ENST00000545336.1	+	8	751	c.332A>G	c.(331-333)aAa>aGa	p.K111R	CCDC91_ENST00000540401.1_3'UTR|CCDC91_ENST00000306172.5_Missense_Mutation_p.K81R|CCDC91_ENST00000381256.1_Missense_Mutation_p.K111R|CCDC91_ENST00000539107.1_Missense_Mutation_p.K111R|CCDC91_ENST00000381259.1_Missense_Mutation_p.K111R			Q7Z6B0	CCD91_HUMAN	coiled-coil domain containing 91	111					protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|skin(1)	22	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					ACTGATGAAAAAAGTAATGGA	0.353																																					p.K111R		.											.	CCDC91	90	0			c.A332G						.						89.0	94.0	93.0					12																	28459739		2203	4300	6503	SO:0001583	missense	55297	exon4			ATGAAAAAAGTAA	AK093152	CCDS8716.1	12p11.22	2006-03-17				ENSG00000123106			24855	protein-coding gene	gene with protein product	"""GGA binding partner"""					12808037	Standard	XM_005253413		Approved	p56, FLJ11088, DKFZp779L1558	uc001riq.3	Q7Z6B0		ENST00000545336.1:c.332A>G	12.37:g.28459739A>G	ENSP00000438040:p.Lys111Arg	52.0	0.0		77.0	28.0	NM_018318	B3KSA3|C9JR07|Q68D43|Q6IA78|Q8NEN7|Q9NUW9	Missense_Mutation	SNP	ENST00000545336.1	37	CCDS8716.1	.	.	.	.	.	.	.	.	.	.	A	10.19	1.282892	0.23392	.	.	ENSG00000123106	ENST00000539107;ENST00000536442;ENST00000545336;ENST00000545737;ENST00000381259;ENST00000381256;ENST00000306172	T;T;T;T;T;T;T	0.32988	1.44;1.45;1.44;1.45;1.44;1.44;1.43	5.26	4.17	0.49024	.	0.875326	0.09820	N	0.751623	T	0.17365	0.0417	N	0.14661	0.345	0.21697	N	0.999587	B;B	0.30281	0.144;0.275	B;B	0.27796	0.048;0.083	T	0.23261	-1.0193	10	0.16896	T	0.51	-2.348	8.7619	0.34680	0.7525:0.2475:0.0:0.0	.	111;81	Q7Z6B0;Q7Z6B0-2	CCD91_HUMAN;.	R	111;111;111;111;111;111;81	ENSP00000440513:K111R;ENSP00000445660:K111R;ENSP00000438040:K111R;ENSP00000442544:K111R;ENSP00000370658:K111R;ENSP00000370655:K111R;ENSP00000305075:K81R	ENSP00000305075:K81R	K	+	2	0	CCDC91	28351006	1.000000	0.71417	0.999000	0.59377	0.945000	0.59286	2.074000	0.41529	1.092000	0.41356	0.528000	0.53228	AAA	.		0.353	CCDC91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402447.1	NM_018318	
CAPRIN2	65981	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	30863308	30863308	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr12:30863308G>A	ENST00000298892.5	-	17	3512	c.2762C>T	c.(2761-2763)aCc>aTc	p.T921I	CAPRIN2_ENST00000417045.1_3'UTR|CAPRIN2_ENST00000395805.2_3'UTR|CAPRIN2_ENST00000251071.5_Missense_Mutation_p.T971I|CAPRIN2_ENST00000308433.5_Missense_Mutation_p.T637I	NM_023925.3	NP_076414.2			caprin family member 2											breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					ATCCACAGGGGTCATGCTACG	0.542																																					p.T971I		.											.	CAPRIN2	92	0			c.C2912T						.						227.0	230.0	229.0					12																	30863308		2203	4300	6503	SO:0001583	missense	65981	exon18			ACAGGGGTCATGC	AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000298892.5:c.2762C>T	12.37:g.30863308G>A	ENSP00000298892:p.Thr921Ile	128.0	0.0		184.0	16.0	NM_001002259		Missense_Mutation	SNP	ENST00000298892.5	37	CCDS8720.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.400459	0.83120	.	.	ENSG00000110888	ENST00000298892;ENST00000251071;ENST00000308433	T;T;T	0.76316	-0.65;-0.71;-1.01	5.7	4.76	0.60689	.	0.237281	0.43579	D	0.000548	T	0.77150	0.4088	N	0.19112	0.55	0.36693	D	0.879683	D;D	0.71674	0.997;0.998	P;D	0.65323	0.852;0.934	T	0.81673	-0.0826	10	0.72032	D	0.01	-8.9208	11.2018	0.48745	0.0:0.1374:0.7202:0.1424	.	971;921	Q6IMN6;Q6IMN6-2	CAPR2_HUMAN;.	I	921;971;637	ENSP00000298892:T921I;ENSP00000251071:T971I;ENSP00000309785:T637I	ENSP00000251071:T971I	T	-	2	0	CAPRIN2	30754575	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.337000	0.72958	2.682000	0.91365	0.655000	0.94253	ACC	.		0.542	CAPRIN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402778.1	NM_023925	
CEP76	79959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	12699183	12699183	+	Silent	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr18:12699183C>T	ENST00000262127.2	-	4	540	c.315G>A	c.(313-315)cgG>cgA	p.R105R	CEP76_ENST00000423709.2_Intron|PSMG2_ENST00000585331.2_Intron|CEP76_ENST00000586887.1_Intron	NM_024899.2	NP_079175.2	Q8TAP6	CEP76_HUMAN	centrosomal protein 76kDa	105					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						AAAGATACCTCCGTGTTGGAT	0.353																																					p.R105R		.											.	CEP76	90	0			c.G315A						.						84.0	84.0	84.0					18																	12699183		2203	4300	6503	SO:0001819	synonymous_variant	79959	exon4			ATACCTCCGTGTT	BC026307	CCDS11861.1, CCDS62390.1	18p11.21	2014-02-20	2005-12-01	2005-12-01	ENSG00000101624	ENSG00000101624			25727	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 9"""	C18orf9		14654843	Standard	NM_024899		Approved	HsT1705, FLJ12542	uc002kri.4	Q8TAP6	OTTHUMG00000131701	ENST00000262127.2:c.315G>A	18.37:g.12699183C>T		65.0	0.0		104.0	24.0	NM_024899	B0YJB2|B4DXG5|B4DZW1|Q658N5|Q9H9U7	Silent	SNP	ENST00000262127.2	37	CCDS11861.1																																																																																			.		0.353	CEP76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254611.1	NM_024899	
CHAT	1103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	50863255	50863255	+	Silent	SNP	C	C	T	rs201580702	byFrequency	TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr10:50863255C>T	ENST00000337653.2	+	12	1902	c.1749C>T	c.(1747-1749)gcC>gcT	p.A583A	CHAT_ENST00000351556.3_Silent_p.A465A|CHAT_ENST00000339797.1_Silent_p.A465A|CHAT_ENST00000395559.2_Silent_p.A465A|CHAT_ENST00000395562.2_Silent_p.A501A|CHAT_ENST00000455728.2_Silent_p.A465A	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	583					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	TTGTGAGAGCCGTGACTGACC	0.632																																					p.A583A		.											.	CHAT	514	0			c.C1749T						.						66.0	62.0	64.0					10																	50863255		2203	4300	6503	SO:0001819	synonymous_variant	1103	exon12			GAGAGCCGTGACT	AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.1749C>T	10.37:g.50863255C>T		120.0	0.0		192.0	61.0	NM_020549	A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Silent	SNP	ENST00000337653.2	37	CCDS7232.1																																																																																			C|0.999;G|0.001		0.632	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047997.1	NM_020549	
CHD1L	9557	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	146757007	146757008	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:146757007_146757008insT	ENST00000369258.4	+	17	1881_1882	c.1861_1862insT	c.(1861-1863)atcfs	p.I621fs	CHD1L_ENST00000369259.3_Frame_Shift_Ins_p.I417fs|CHD1L_ENST00000431239.1_Frame_Shift_Ins_p.I527fs|CHD1L_ENST00000467213.1_3'UTR|CHD1L_ENST00000361293.5_Frame_Shift_Ins_p.I340fs	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	621					ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					CTAGGTTCTCATCCCAGGCCTT	0.485																																					p.I621fs		.											.	CHD1L	231	0			c.1861_1862insT						.																																			SO:0001589	frameshift_variant	9557	exon17			GTTCTCATCCCAG	AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.1862dupT	1.37:g.146757008_146757008dupT	ENSP00000358262:p.Ile621fs	149.0	0.0		351.0	40.0	NM_004284	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Frame_Shift_Ins	INS	ENST00000369258.4	37	CCDS927.1																																																																																			.		0.485	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040377.1	NM_004284	
CHL1	10752	bcgsc.ca;mdanderson.org	37	3	433400	433400	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:433400A>C	ENST00000256509.2	+	23	3476	c.2834A>C	c.(2833-2835)aAa>aCa	p.K945T	CHL1_ENST00000397491.2_Missense_Mutation_p.K929T	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		AAAGTTGATAAAGACACTGCC	0.318																																					p.K945T		.											.	CHL1	583	0			c.A2834C						.						84.0	86.0	85.0					3																	433400		2203	4300	6503	SO:0001583	missense	10752	exon21			TTGATAAAGACAC	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.2834A>C	3.37:g.433400A>C	ENSP00000256509:p.Lys945Thr	41.0	1.0		66.0	21.0	NM_001253388	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	CCDS2556.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.95|18.95	3.732106|3.732106	0.69189|0.69189	.|.	.|.	ENSG00000134121|ENSG00000134121	ENST00000445697|ENST00000256509;ENST00000397491	T|T;T	0.57273|0.55930	0.41|0.49;0.49	5.62|5.62	5.62|5.62	0.85841|0.85841	.|Fibronectin, type III (5);Immunoglobulin-like fold (1);	0.051878|0.051878	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.63307|0.63307	0.2500|0.2500	L|L	0.49778|0.49778	1.585|1.585	0.44316|0.44316	D|D	0.997191|0.997191	.|D;D;D	.|0.89917	.|0.964;0.964;1.0	.|P;P;D	.|0.80764	.|0.777;0.777;0.994	T|T	0.59016|0.59016	-0.7533|-0.7533	8|10	0.30078|0.20046	T|T	0.28|0.44	.|.	11.7674|11.7674	0.51939|0.51939	0.8531:0.1469:0.0:0.0|0.8531:0.1469:0.0:0.0	.|.	.|929;929;945	.|B3KX75;O00533;O00533-2	.|.;CHL1_HUMAN;.	Q|T	132|945;929	ENSP00000395239:K132Q|ENSP00000256509:K945T;ENSP00000380628:K929T	ENSP00000395239:K132Q|ENSP00000256509:K945T	K|K	+|+	1|2	0|0	CHL1|CHL1	408400|408400	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	1.728000|1.728000	0.38105|0.38105	2.130000|2.130000	0.65690|0.65690	0.528000|0.528000	0.53228|0.53228	AAG|AAA	.		0.318	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
CHM	1121	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	85302520	85302520	+	Missense_Mutation	SNP	G	G	A	rs201252021		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chrX:85302520G>A	ENST00000357749.2	-	1	46	c.17C>T	c.(16-18)cCt>cTt	p.P6L	CHM_ENST00000467744.2_5'Flank|CHM_ENST00000537751.1_5'UTR|CHM_ENST00000358786.4_Missense_Mutation_p.P6L	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)	6					blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				AAACTCCGAAGGGAGAGTATC	0.458																																					p.P6L		.											.	CHM	131	0			c.C17T	GRCh37	CD022133	CHM	D		.						123.0	72.0	89.0					X																	85302520		2203	4300	6503	SO:0001583	missense	1121	exon1			TCCGAAGGGAGAG	X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.17C>T	X.37:g.85302520G>A	ENSP00000350386:p.Pro6Leu	154.0	0.0		188.0	117.0	NM_001145414	A1L4D2|O43732	Missense_Mutation	SNP	ENST00000357749.2	37	CCDS14454.1	.	.	.	.	.	.	.	.	.	.	G	18.69	3.677800	0.68042	.	.	ENSG00000188419	ENST00000357749;ENST00000358786	T;T	0.61627	0.09;0.09	5.06	4.19	0.49359	.	0.130770	0.53938	D	0.000060	T	0.74966	0.3786	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.78489	-0.2184	10	0.87932	D	0	-10.0809	14.3456	0.66662	0.0:0.1453:0.8547:0.0	.	6;6	A1L4D2;P24386	.;RAE1_HUMAN	L	6	ENSP00000350386:P6L;ENSP00000362228:P6L	ENSP00000350386:P6L	P	-	2	0	CHM	85189176	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	4.355000	0.59424	1.096000	0.41439	0.600000	0.82982	CCT	.		0.458	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057396.3	NM_000390	
CHST12	55501	broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	2472325	2472325	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:2472325C>A	ENST00000258711.6	+	2	186	c.51C>A	c.(49-51)ttC>ttA	p.F17L		NM_001243794.1|NM_001243795.1|NM_018641.4	NP_001230723.1|NP_001230724.1|NP_061111.1	Q9NRB3	CHSTC_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 12	17					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|chondroitin 4-sulfotransferase activity (GO:0047756)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0847)|OV - Ovarian serous cystadenocarcinoma(56;2.25e-13)		GGTCGGTGTTCATGATCCTGC	0.672																																					p.F17L		.											.	CHST12	226	0			c.C51A						.						56.0	48.0	51.0					7																	2472325		2203	4300	6503	SO:0001583	missense	55501	exon2			GGTGTTCATGATC	AF239822	CCDS5333.1	7p22	2007-03-14			ENSG00000136213	ENSG00000136213	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17423	protein-coding gene	gene with protein product		610129				10781601	Standard	NM_018641		Approved	C4S-2, C4ST2	uc021zyu.1	Q9NRB3	OTTHUMG00000023849	ENST00000258711.6:c.51C>A	7.37:g.2472325C>A	ENSP00000258711:p.Phe17Leu	40.0	0.0		87.0	46.0	NM_018641	A4D1Z9|Q502W3|Q9NXY7	Missense_Mutation	SNP	ENST00000258711.6	37	CCDS5333.1	.	.	.	.	.	.	.	.	.	.	C	9.838	1.190260	0.21954	.	.	ENSG00000136213	ENST00000258711;ENST00000432336	T;T	0.66280	-0.2;0.57	5.11	1.75	0.24633	.	0.221247	0.47455	N	0.000229	T	0.50667	0.1629	L	0.46885	1.475	0.43890	D	0.996516	B	0.09022	0.002	B	0.09377	0.004	T	0.45323	-0.9269	10	0.42905	T	0.14	-17.3679	9.1726	0.37091	0.0:0.7198:0.1249:0.1553	.	17	Q9NRB3	CHSTC_HUMAN	L	17	ENSP00000258711:F17L;ENSP00000411207:F17L	ENSP00000258711:F17L	F	+	3	2	CHST12	2438851	1.000000	0.71417	0.866000	0.34008	0.637000	0.38172	1.994000	0.40757	0.539000	0.28788	0.555000	0.69702	TTC	.		0.672	CHST12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060170.3	NM_018641	
COL5A2	1290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	189927932	189927932	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:189927932C>T	ENST00000374866.3	-	27	2109	c.1835G>A	c.(1834-1836)gGg>gAg	p.G612E		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	612					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			GCCCATGCTCCCGGGCTGCCC	0.522																																					p.G612E		.											.	COL5A2	92	0			c.G1835A						.						81.0	92.0	88.0					2																	189927932		2203	4300	6503	SO:0001583	missense	1290	exon27			ATGCTCCCGGGCT	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.1835G>A	2.37:g.189927932C>T	ENSP00000364000:p.Gly612Glu	19.0	0.0		41.0	14.0	NM_000393	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.648970	0.87958	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.99619	-6.28	4.56	4.56	0.56223	.	0.000000	0.46442	D	0.000283	D	0.99768	0.9905	H	0.95950	3.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.96884	0.9648	9	.	.	.	.	17.7045	0.88304	0.0:1.0:0.0:0.0	.	252;612	Q5PR22;P05997	.;CO5A2_HUMAN	E	612;252	ENSP00000364000:G612E	.	G	-	2	0	COL5A2	189636177	1.000000	0.71417	0.990000	0.47175	0.925000	0.55904	7.445000	0.80570	2.244000	0.73946	0.467000	0.42956	GGG	.		0.522	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266110	41266110	+	Missense_Mutation	SNP	A	A	C	rs121913416		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:41266110A>C	ENST00000349496.5	+	3	387	c.107A>C	c.(106-108)cAt>cCt	p.H36P	CTNNB1_ENST00000396185.3_Missense_Mutation_p.H36P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.H29P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.H36P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.H36P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	36					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.H36P(24)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.H36R(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.I35_S37>T(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_K170del(1)|p.H24_G38del(1)|p.S29_H36del(1)|p.I35_T41del(1)|p.I35_G38del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTGGAATCCATTCTGGTGCC	0.498		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.H36P	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0	CTNNB1	24361	159	Deletion - In frame(104)|Substitution - Missense(27)|Complex - deletion inframe(18)|Unknown(7)|Deletion - Frameshift(3)	liver(119)|large_intestine(20)|stomach(7)|kidney(6)|small_intestine(2)|skin(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.A107C						.						95.0	80.0	85.0					3																	41266110		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GAATCCATTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.107A>C	3.37:g.41266110A>C	ENSP00000344456:p.His36Pro	182.0	0.0		283.0	83.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.824526	0.50739	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88	5.76	5.76	0.90799	.	0.093481	0.85682	D	0.000000	T	0.51210	0.1661	M	0.64170	1.965	0.80722	D	1	P	0.40398	0.716	P	0.45946	0.498	T	0.54807	-0.8238	10	0.72032	D	0.01	-2.3155	16.0676	0.80897	1.0:0.0:0.0:0.0	.	36	P35222	CTNB1_HUMAN	P	29;36;36;36;36;29;36;36;36	ENSP00000400508:H29P;ENSP00000385604:H36P;ENSP00000412219:H36P;ENSP00000379486:H36P;ENSP00000344456:H36P;ENSP00000411226:H29P;ENSP00000379488:H36P;ENSP00000409302:H36P;ENSP00000401599:H36P	ENSP00000344456:H36P	H	+	2	0	CTNNB1	41241114	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	CAT	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CYP4F2	8529	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	16000329	16000329	+	Silent	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:16000329C>T	ENST00000221700.6	-	7	917	c.822G>A	c.(820-822)cgG>cgA	p.R274R	CYP4F2_ENST00000011989.7_Silent_p.R125R	NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2											NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GAGTGCGGCGCCGCTCCTGGA	0.562																																					p.R274R		.											CYP4F2,NS,carcinoma,-2	CYP4F2	92	0			c.G822A						.						94.0	90.0	91.0					19																	16000329		2203	4300	6503	SO:0001819	synonymous_variant	8529	exon7			GCGGCGCCGCTCC	U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.822G>A	19.37:g.16000329C>T		185.0	2.0		270.0	110.0	NM_001082		Silent	SNP	ENST00000221700.6	37	CCDS12336.1																																																																																			.		0.562	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460372.3	NM_001082	
DBN1	1627	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	176885388	176885388	+	Missense_Mutation	SNP	C	C	A	rs142184479		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr5:176885388C>A	ENST00000309007.5	-	12	1666	c.1447G>T	c.(1447-1449)Ggg>Tgg	p.G483W	DBN1_ENST00000393563.4_Missense_Mutation_p.G215W|DBN1_ENST00000292385.5_Missense_Mutation_p.G485W|DBN1_ENST00000512501.1_Missense_Mutation_p.G215W|DBN1_ENST00000393565.1_Missense_Mutation_p.G529W	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	483					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCCCTTCCCCGTTGCCAGGC	0.647																																					p.G485W		.											.	DBN1	587	0			c.G1453T						.						79.0	90.0	86.0					5																	176885388		2203	4300	6503	SO:0001583	missense	1627	exon13			CTTCCCCGTTGCC		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.1447G>T	5.37:g.176885388C>A	ENSP00000308532:p.Gly483Trp	158.0	1.0		212.0	85.0	NM_080881	A8MV58|B2RBG0|Q9UFZ5	Missense_Mutation	SNP	ENST00000309007.5	37	CCDS4420.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.285393	0.40394	.	.	ENSG00000113758	ENST00000309007;ENST00000292385;ENST00000393565;ENST00000512501;ENST00000393563	T;T;T;T;T	0.39229	1.11;1.17;1.17;1.09;1.2	4.44	4.44	0.53790	.	0.100000	0.41500	D	0.000874	T	0.49558	0.1564	L	0.27053	0.805	0.29090	N	0.882157	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.996;0.998	T	0.45396	-0.9264	10	0.87932	D	0	-40.9626	12.0857	0.53695	0.1727:0.8273:0.0:0.0	.	433;529;483;485	B3KSQ7;A8MV58;Q16643;Q16643-2	.;.;DREB_HUMAN;.	W	483;485;529;215;215	ENSP00000308532:G483W;ENSP00000292385:G485W;ENSP00000377195:G529W;ENSP00000423208:G215W;ENSP00000377193:G215W	ENSP00000292385:G485W	G	-	1	0	DBN1	176817994	0.000000	0.05858	1.000000	0.80357	0.724000	0.41520	0.272000	0.18644	2.473000	0.83533	0.313000	0.20887	GGG	C|1.000;T|0.000		0.647	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253429.2	NM_080881	
DCHS1	8642	broad.mit.edu;mdanderson.org	37	11	6651029	6651029	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:6651029C>T	ENST00000299441.3	-	11	5320	c.4909G>A	c.(4909-4911)Gtc>Atc	p.V1637I	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1637	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCGACACTGACGGTCAGGACC	0.642																																					p.V1637I		.											.	DCHS1	73	0			c.G4909A						.						47.0	46.0	46.0					11																	6651029		2200	4296	6496	SO:0001583	missense	8642	exon11			CACTGACGGTCAG	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.4909G>A	11.37:g.6651029C>T	ENSP00000299441:p.Val1637Ile	48.0	1.0		39.0	7.0	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	3.483	-0.105429	0.06967	.	.	ENSG00000166341	ENST00000299441	T	0.64260	-0.09	5.25	2.32	0.28847	Cadherin (4);Cadherin-like (1);	0.504604	0.16504	N	0.211536	T	0.35098	0.0920	N	0.11255	0.115	0.46749	D	0.999189	B	0.17852	0.024	B	0.17098	0.017	T	0.21690	-1.0238	10	0.02654	T	1	.	9.0893	0.36601	0.0:0.6752:0.0:0.3248	.	1637	Q96JQ0	PCD16_HUMAN	I	1637	ENSP00000299441:V1637I	ENSP00000299441:V1637I	V	-	1	0	DCHS1	6607605	0.469000	0.25846	0.950000	0.38849	0.001000	0.01503	1.095000	0.30964	0.342000	0.23796	-0.253000	0.11424	GTC	.		0.642	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
DCLK2	166614	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	151168791	151168791	+	Silent	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr4:151168791C>A	ENST00000296550.7	+	13	2569	c.1815C>A	c.(1813-1815)atC>atA	p.I605I	DCLK2_ENST00000302176.8_Silent_p.I622I|DCLK2_ENST00000506325.1_Silent_p.I604I	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	605	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					TCGACCAGATCTTGGCTGGGA	0.468																																					p.I622I	GBM(195;186 2215 13375 16801 37459)	.											.	DCLK2	300	0			c.C1866A						.						77.0	80.0	79.0					4																	151168791		2203	4300	6503	SO:0001819	synonymous_variant	166614	exon14			CCAGATCTTGGCT	BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.1815C>A	4.37:g.151168791C>A		68.0	1.0		107.0	40.0	NM_001040261	C9J5Q9|Q59GC8|Q8N399	Silent	SNP	ENST00000296550.7	37	CCDS34076.1																																																																																			.		0.468	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364952.1	NM_001040260	
DGKH	160851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	42763420	42763420	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr13:42763420G>T	ENST00000337343.4	+	15	1908	c.1887G>T	c.(1885-1887)agG>agT	p.R629S	DGKH_ENST00000261491.5_Missense_Mutation_p.R629S|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000379274.2_Missense_Mutation_p.R493S|DGKH_ENST00000538674.1_Missense_Mutation_p.R384S|DGKH_ENST00000536612.1_Missense_Mutation_p.R493S|DGKH_ENST00000540693.1_Missense_Mutation_p.R629S	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	629					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		AAGCAGTGAGGCAAGTCATTG	0.438																																					p.R629S		.											.	DGKH	652	0			c.G1887T						.						76.0	73.0	74.0					13																	42763420		2203	4300	6503	SO:0001583	missense	160851	exon16			AGTGAGGCAAGTC	AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.1887G>T	13.37:g.42763420G>T	ENSP00000337572:p.Arg629Ser	88.0	0.0		116.0	31.0	NM_001204504	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	37	CCDS9381.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995550	0.74703	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	D;T;D;D;D;T	0.82711	-1.64;-1.46;-1.64;-1.59;-1.6;1.61	5.72	4.88	0.63580	.	0.000000	0.85682	D	0.000000	D	0.89305	0.6677	M	0.71581	2.175	0.58432	D	0.999991	D;D;D;P	0.71674	0.998;0.998;0.995;0.884	D;D;D;P	0.72075	0.956;0.976;0.91;0.54	D	0.89801	0.3975	10	0.66056	D	0.02	.	11.7184	0.51668	0.1415:0.0:0.8585:0.0	.	384;493;629;629	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	S	629;629;629;493;493;384	ENSP00000440823:R629S;ENSP00000337572:R629S;ENSP00000261491:R629S;ENSP00000368576:R493S;ENSP00000445114:R493S;ENSP00000441308:R384S	ENSP00000261491:R629S	R	+	3	2	DGKH	41661420	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.368000	0.52357	1.419000	0.47118	0.655000	0.94253	AGG	.		0.438	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009	
DLEC1	9940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38138132	38138132	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:38138132A>T	ENST00000308059.6	+	15	2265	c.2244A>T	c.(2242-2244)aaA>aaT	p.K748N	DLEC1_ENST00000452631.2_Missense_Mutation_p.K748N|DLEC1_ENST00000346219.3_Missense_Mutation_p.K748N					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		TCGAGGTGAAAGGCTCAGTAG	0.483																																					p.K748N		.											.	DLEC1	161	0			c.A2244T						.						138.0	134.0	135.0					3																	38138132		1935	4144	6079	SO:0001583	missense	9940	exon15			GGTGAAAGGCTCA	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.2244A>T	3.37:g.38138132A>T	ENSP00000308597:p.Lys748Asn	90.0	0.0		133.0	48.0	NM_007337		Missense_Mutation	SNP	ENST00000308059.6	37	CCDS2672.2	.	.	.	.	.	.	.	.	.	.	A	19.51	3.841067	0.71488	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.06449	3.32;3.3;3.55	4.93	-1.51	0.08664	.	0.064020	0.64402	D	0.000012	T	0.18800	0.0451	M	0.77103	2.36	0.50632	D	0.999888	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.70716	0.97;0.954;0.97	T	0.00641	-1.1631	10	0.56958	D	0.05	-18.6292	9.586	0.39517	0.5995:0.0:0.4005:0.0	.	748;748;748	F8W6T4;Q9Y238-3;Q9Y238	.;.;DLEC1_HUMAN	N	748	ENSP00000308597:K748N;ENSP00000315914:K748N;ENSP00000410427:K748N	ENSP00000308597:K748N	K	+	3	2	DLEC1	38113136	1.000000	0.71417	0.988000	0.46212	0.919000	0.55068	1.179000	0.31993	-0.202000	0.10268	0.533000	0.62120	AAA	.		0.483	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
DHX30	22907	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	47888778	47888778	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:47888778G>A	ENST00000445061.1	+	12	2352	c.1945G>A	c.(1945-1947)Gca>Aca	p.A649T	DHX30_ENST00000457607.1_Missense_Mutation_p.A677T|MIR1226_ENST00000408658.1_RNA|DHX30_ENST00000348968.4_Missense_Mutation_p.A621T|DHX30_ENST00000446256.2_Missense_Mutation_p.A610T	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	649						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GGATGAATGCGCACTCGATTT	0.612																																					p.A649T		.											.	DHX30	228	0			c.G1945A						.						181.0	144.0	157.0					3																	47888778		2203	4300	6503	SO:0001583	missense	22907	exon12			GAATGCGCACTCG	AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.1945G>A	3.37:g.47888778G>A	ENSP00000405620:p.Ala649Thr	248.0	1.0		298.0	20.0	NM_138615	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Missense_Mutation	SNP	ENST00000445061.1	37	CCDS2759.1	.	.	.	.	.	.	.	.	.	.	G	8.312	0.822347	0.16678	.	.	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	T;T;T;T	0.02606	4.23;4.23;4.23;4.23	4.23	3.35	0.38373	.	0.502267	0.21404	N	0.075093	T	0.02047	0.0064	N	0.12961	0.28	0.09310	N	1	B;B	0.17852	0.024;0.015	B;B	0.16722	0.003;0.016	T	0.47736	-0.9094	10	0.15066	T	0.55	.	11.3391	0.49523	0.0894:0.0:0.9106:0.0	.	649;610	Q7L2E3;Q7L2E3-3	DHX30_HUMAN;.	T	610;649;621;677	ENSP00000392601:A610T;ENSP00000405620:A649T;ENSP00000343442:A621T;ENSP00000394682:A677T	ENSP00000343442:A621T	A	+	1	0	DHX30	47863782	0.941000	0.31946	0.015000	0.15790	0.858000	0.48976	2.798000	0.47884	0.967000	0.38186	0.462000	0.41574	GCA	.		0.612	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615	
DNHD1	144132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6566625	6566625	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:6566625A>G	ENST00000527990.2	+	19	4456	c.4456A>G	c.(4456-4458)Aag>Gag	p.K1486E	DNHD1_ENST00000254579.6_Missense_Mutation_p.K1486E			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	1486					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GCAACTGCCCAAGCAAAACAA	0.577																																					p.K1486E		.											.	DNHD1	24	0			c.A4456G						.						32.0	33.0	33.0					11																	6566625		692	1591	2283	SO:0001583	missense	144132	exon21			CTGCCCAAGCAAA	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.4456A>G	11.37:g.6566625A>G	ENSP00000436180:p.Lys1486Glu	156.0	0.0		181.0	47.0	NM_144666	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.196522	0.00299	.	.	ENSG00000179532	ENST00000254579;ENST00000527990	T;T	0.26067	1.76;1.76	4.91	2.92	0.33932	.	1.021260	0.07825	N	0.960421	T	0.07503	0.0189	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26155	-1.0111	10	0.02654	T	1	.	7.5823	0.27972	0.149:0.5261:0.3249:0.0	.	1486	Q96M86	DNHD1_HUMAN	E	1486	ENSP00000254579:K1486E;ENSP00000436180:K1486E	ENSP00000254579:K1486E	K	+	1	0	DNHD1	6523201	0.015000	0.18098	0.088000	0.20740	0.003000	0.03518	1.633000	0.37113	1.264000	0.44198	-0.619000	0.04042	AAG	.		0.577	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
DOCK1	1793	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	128796464	128796464	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr10:128796464G>A	ENST00000280333.6	+	8	827	c.718G>A	c.(718-720)Gct>Act	p.A240T	RP11-223P11.3_ENST00000595456.1_RNA|RP11-223P11.3_ENST00000594614.1_RNA|RP11-223P11.3_ENST00000601242.1_RNA	NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	240					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		AGGAGAAGATGCTGAAGTCCT	0.433																																					p.A240T		.											.	DOCK1	698	0			c.G718A						.						204.0	193.0	197.0					10																	128796464		1904	4121	6025	SO:0001583	missense	1793	exon8			GAAGATGCTGAAG	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.718G>A	10.37:g.128796464G>A	ENSP00000280333:p.Ala240Thr	230.0	1.0		214.0	60.0	NM_001380	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	37		.	.	.	.	.	.	.	.	.	.	G	23.6	4.436792	0.83885	.	.	ENSG00000150760	ENST00000280333	T	0.52754	0.65	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.61937	0.2387	L	0.52011	1.625	0.80722	D	1	P;D	0.71674	0.739;0.998	B;D	0.64506	0.348;0.926	T	0.54866	-0.8229	10	0.28530	T	0.3	.	19.0205	0.92912	0.0:0.0:1.0:0.0	.	240;240	B2RUU3;Q14185	.;DOCK1_HUMAN	T	240	ENSP00000280333:A240T	ENSP00000280333:A240T	A	+	1	0	DOCK1	128686454	1.000000	0.71417	0.989000	0.46669	0.971000	0.66376	6.249000	0.72427	2.706000	0.92434	0.655000	0.94253	GCT	.		0.433	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
DOCK1	1793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	129216713	129216713	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr10:129216713G>T	ENST00000280333.6	+	45	4646	c.4537G>T	c.(4537-4539)Gat>Tat	p.D1513Y		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1513	DHR-2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		GCAGCACCTGGATGACCCCAG	0.572																																					p.D1513Y		.											.	DOCK1	698	0			c.G4537T						.						68.0	81.0	77.0					10																	129216713		2202	4300	6502	SO:0001583	missense	1793	exon45			CACCTGGATGACC	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.4537G>T	10.37:g.129216713G>T	ENSP00000280333:p.Asp1513Tyr	77.0	0.0		96.0	33.0	NM_001380	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	37		.	.	.	.	.	.	.	.	.	.	G	12.63	1.994854	0.35226	.	.	ENSG00000150760	ENST00000280333	T	0.03801	3.8	4.8	2.88	0.33553	.	0.286549	0.37012	N	0.002294	T	0.02727	0.0082	N	0.08118	0	0.33355	D	0.571548	B;B;B	0.34015	0.018;0.435;0.085	B;B;B	0.37508	0.011;0.252;0.094	T	0.29305	-1.0016	10	0.56958	D	0.05	.	3.9981	0.09568	0.2509:0.207:0.5421:0.0	.	1513;1579;1513	B2RUU3;A8MU08;Q14185	.;.;DOCK1_HUMAN	Y	1513	ENSP00000280333:D1513Y	ENSP00000280333:D1513Y	D	+	1	0	DOCK1	129106703	0.953000	0.32496	0.989000	0.46669	0.982000	0.71751	2.780000	0.47742	1.230000	0.43646	0.555000	0.69702	GAT	.		0.572	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
DOCK4	9732	hgsc.bcm.edu;broad.mit.edu	37	7	111517084	111517084	+	Splice_Site	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:111517084A>G	ENST00000437633.1	-	17	2001		c.e17+1		DOCK4_ENST00000428084.1_Splice_Site|DOCK4_ENST00000476846.1_Splice_Site	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				ATTATACATTACCATTTTGTG	0.328																																					.		.											.	DOCK4	26	0			c.1744+2T>C						.						53.0	51.0	52.0					7																	111517084		1823	4075	5898	SO:0001630	splice_region_variant	9732	exon18			TACATTACCATTT		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.1744+1T>C	7.37:g.111517084A>G		41.0	0.0		87.0	6.0	NM_014705	O14584|O94824|Q8NB45	Splice_Site	SNP	ENST00000437633.1	37	CCDS47688.1	.	.	.	.	.	.	.	.	.	.	A	19.92	3.915907	0.73098	.	.	ENSG00000128512	ENST00000352877;ENST00000423057;ENST00000428084;ENST00000437633;ENST00000445943;ENST00000342288;ENST00000544250	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DOCK4	111304320	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	8.950000	0.93019	2.367000	0.80283	0.528000	0.53228	.	.		0.328	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	Intron
DOPEY1	23033	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	83866961	83866961	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr6:83866961T>C	ENST00000349129.2	+	35	6925	c.6665T>C	c.(6664-6666)cTg>cCg	p.L2222P	DOPEY1_ENST00000237163.5_Intron|DOPEY1_ENST00000369739.3_Missense_Mutation_p.L2213P|DOPEY1_ENST00000484282.1_3'UTR	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	2222					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		CAAGTGTTCCTGTTTTTCAGA	0.388																																					p.L2222P		.											.	DOPEY1	155	0			c.T6665C						.						165.0	148.0	154.0					6																	83866961		2203	4300	6503	SO:0001583	missense	23033	exon35			TGTTCCTGTTTTT	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.6665T>C	6.37:g.83866961T>C	ENSP00000195654:p.Leu2222Pro	78.0	0.0		106.0	7.0	NM_015018	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	37	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.349059	0.82132	.	.	ENSG00000083097	ENST00000349129	T	0.52754	0.65	6.02	6.02	0.97574	.	0.072326	0.56097	D	0.000023	T	0.63943	0.2554	M	0.74467	2.265	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.997;0.997;0.997	T	0.68926	-0.5280	10	0.87932	D	0	.	16.542	0.84395	0.0:0.0:0.0:1.0	.	2113;2213;2222	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	P	2222	ENSP00000195654:L2222P	ENSP00000195654:L2222P	L	+	2	0	DOPEY1	83923680	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	7.698000	0.84413	2.304000	0.77564	0.528000	0.53228	CTG	.		0.388	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
DSG4	147409	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	28971168	28971168	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr18:28971168A>C	ENST00000308128.4	+	7	947	c.812A>C	c.(811-813)aAa>aCa	p.K271T	RP11-534N16.1_ENST00000578477.1_RNA|RP11-534N16.1_ENST00000581856.1_RNA|RP11-534N16.1_ENST00000581452.1_RNA|DSG4_ENST00000359747.4_Missense_Mutation_p.K271T	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	271	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.		Missing (in HYPT6). {ECO:0000269|PubMed:12705872, ECO:0000269|PubMed:15191570}.		anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			ACCTTAGAGAAAACTTCAGTA	0.403																																					p.K271T		.											.	DSG4	177	0			c.A812C						.						131.0	117.0	122.0					18																	28971168		2203	4300	6503	SO:0001583	missense	147409	exon7			TAGAGAAAACTTC	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.812A>C	18.37:g.28971168A>C	ENSP00000311859:p.Lys271Thr	50.0	0.0		93.0	30.0	NM_001134453	A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	ENST00000308128.4	37	CCDS11897.1	.	.	.	.	.	.	.	.	.	.	A	11.89	1.774648	0.31411	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.60920	0.15;0.15	5.9	4.75	0.60458	Cadherin (3);Cadherin-like (1);	0.000000	0.36972	N	0.002316	T	0.47395	0.1443	L	0.33753	1.03	0.32633	N	0.521715	P;B	0.36392	0.551;0.255	B;B	0.37550	0.253;0.122	T	0.59172	-0.7504	10	0.44086	T	0.13	.	11.8916	0.52633	0.9319:0.0:0.0681:0.0	.	271;271	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	T	271	ENSP00000311859:K271T;ENSP00000352785:K271T	ENSP00000311859:K271T	K	+	2	0	DSG4	27225166	1.000000	0.71417	0.999000	0.59377	0.872000	0.50106	5.965000	0.70387	1.061000	0.40601	0.482000	0.46254	AAA	.		0.403	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986	
DSG2	1829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	29115251	29115251	+	Silent	SNP	T	T	C	rs367548984		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr18:29115251T>C	ENST00000261590.8	+	10	1508	c.1299T>C	c.(1297-1299)gaT>gaC	p.D433D		NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	433	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			AATTAGAAGATAGAGATAATT	0.308																																					p.D433D		.											.	DSG2	563	0			c.T1299C						.	T		1,3575		0,1,1787	38.0	35.0	36.0		1299	-4.4	0.0	18		36	0,8102		0,0,4051	no	coding-synonymous	DSG2	NM_001943.3		0,1,5838	CC,CT,TT		0.0,0.028,0.0086		433/1119	29115251	1,11677	1788	4051	5839	SO:0001819	synonymous_variant	1829	exon10			AGAAGATAGAGAT	Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.1299T>C	18.37:g.29115251T>C		88.0	0.0		81.0	19.0	NM_001943	Q4KKU6	Silent	SNP	ENST00000261590.8	37	CCDS42423.1																																																																																			.		0.308	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447506.1	NM_001943	
EML3	256364	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	62376466	62376466	+	Silent	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:62376466T>C	ENST00000394773.2	-	7	1204	c.897A>G	c.(895-897)agA>agG	p.R299R	EML3_ENST00000438258.1_5'Flank|EML3_ENST00000529309.1_Silent_p.R299R|EML3_ENST00000494176.2_Silent_p.R271R|EML3_ENST00000531557.1_Silent_p.R82R|ROM1_ENST00000534093.1_5'Flank|EML3_ENST00000278845.4_Silent_p.R300R|RP11-831H9.3_ENST00000532626.1_RNA	NM_153265.2	NP_694997.2	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like 3	299						cytoplasm (GO:0005737)|microtubule (GO:0005874)				biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						CCCGGTAATGTCTCTGGCCGC	0.632																																					p.R299R		.											.	EML3	91	0			c.A897G						.						131.0	143.0	139.0					11																	62376466		2202	4299	6501	SO:0001819	synonymous_variant	256364	exon7			GTAATGTCTCTGG	AK093146	CCDS8023.2	11q12.3	2013-01-10			ENSG00000149499	ENSG00000149499		"""WD repeat domain containing"""	26666	protein-coding gene	gene with protein product						15225882, 14744259	Standard	NM_153265		Approved	FLJ35827, ELP95	uc001ntu.1	Q32P44	OTTHUMG00000149817	ENST00000394773.2:c.897A>G	11.37:g.62376466T>C		100.0	2.0		140.0	39.0	NM_153265	Q6ZQW7|Q8NA55	Silent	SNP	ENST00000394773.2	37	CCDS8023.2	.	.	.	.	.	.	.	.	.	.	T	9.533	1.111413	0.20714	.	.	ENSG00000149499	ENST00000394776	.	.	.	5.69	2.18	0.27775	.	.	.	.	.	T	0.54806	0.1881	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45600	-0.9250	4	.	.	.	-12.9832	6.8703	0.24117	0.0:0.3515:0.0:0.6485	.	.	.	.	A	294	.	.	T	-	1	0	EML3	62133042	0.184000	0.23200	1.000000	0.80357	0.969000	0.65631	-0.567000	0.05916	0.440000	0.26502	0.533000	0.62120	ACA	.		0.632	EML3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313432.1	NM_153265	
EPRS	2058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	220174520	220174520	+	Missense_Mutation	SNP	C	C	A	rs374231493		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:220174520C>A	ENST00000366923.3	-	17	2410	c.2141G>T	c.(2140-2142)gGg>gTg	p.G714V		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	714	Glutamate--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	TTCCTTTGACCCTGATGTTGG	0.378																																					p.G714V		.											.	EPRS	92	0			c.G2141T						.						167.0	149.0	155.0					1																	220174520		2203	4300	6503	SO:0001583	missense	2058	exon17			TTTGACCCTGATG	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.2141G>T	1.37:g.220174520C>A	ENSP00000355890:p.Gly714Val	123.0	0.0		249.0	65.0	NM_004446	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	ENST00000366923.3	37	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.783887	0.90282	.	.	ENSG00000136628	ENST00000366923;ENST00000536921;ENST00000435048	T	0.06768	3.26	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.29817	0.0745	M	0.67397	2.05	0.80722	D	1	D;P;D;D	0.89917	1.0;0.819;0.995;0.991	D;P;P;P	0.76575	0.988;0.614;0.788;0.858	T	0.00581	-1.1660	10	0.62326	D	0.03	-22.932	19.3764	0.94512	0.0:1.0:0.0:0.0	.	738;721;721;714	E7EMN0;F5H7I7;Q3KQZ8;P07814	.;.;.;SYEP_HUMAN	V	714;721;738	ENSP00000355890:G714V	ENSP00000355890:G714V	G	-	2	0	EPRS	218241143	1.000000	0.71417	0.995000	0.50966	0.931000	0.56810	6.907000	0.75724	2.590000	0.87494	0.563000	0.77884	GGG	.		0.378	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	
FAM58A	92002	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	152858107	152858107	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chrX:152858107C>A	ENST00000406277.2	-	6	610	c.508G>T	c.(508-510)Gcc>Tcc	p.A170S	FAM58A_ENST00000370175.4_5'UTR	NM_001130997.1|NM_152274.3	NP_001124469.1|NP_689487.2	Q8N1B3	FA58A_HUMAN	family with sequence similarity 58, member A	172					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)					endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CGCAGCAGGGCCCAGGCGGTG	0.657																																					.		.											.	FAM58A	130	0			.						.						30.0	26.0	27.0					X																	152858107		2203	4298	6501	SO:0001583	missense	92002	.			GCAGGGCCCAGGC	BC032121	CCDS76054.1	Xq28	2014-08-12	2012-11-30	2012-11-30	ENSG00000147382	ENSG00000262919			28434	protein-coding gene	gene with protein product	"""cyclin M"""	300708				18297069, 24218572	Standard	NM_152274		Approved	MGC29729, FLJ21610	uc011myr.2	Q8N1B3	OTTHUMG00000024206	ENST00000406277.2:c.508G>T	X.37:g.152858107C>A	ENSP00000384396:p.Ala170Ser	78.0	2.0		79.0	52.0	.	Q2I380|Q330J9|Q96IU5|Q9BUU1	Missense_Mutation	SNP	ENST00000406277.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.49|16.49	3.136634|3.136634	0.56936|0.56936	.|.	.|.	ENSG00000147382|ENSG00000147382	ENST00000370175;ENST00000406277;ENST00000370171;ENST00000276345;ENST00000370173|ENST00000440428	T|.	0.33438|.	1.41|.	4.6|4.6	3.73|3.73	0.42828|0.42828	Cyclin-like (3);|.	0.161907|.	0.53938|.	D|.	0.000051|.	T|T	0.48909|0.48909	0.1526|0.1526	N|N	0.26042|0.26042	0.785|0.785	0.53688|0.53688	D|D	0.999976|0.999976	P;P;P|.	0.48998|.	0.918;0.829;0.859|.	P;P;B|.	0.48227|.	0.571;0.45;0.324|.	T|T	0.34204|0.34204	-0.9838|-0.9838	10|5	0.08381|.	T|.	0.77|.	-18.5586|-18.5586	10.9123|10.9123	0.47116|0.47116	0.0:0.9018:0.0:0.0982|0.0:0.9018:0.0:0.0982	.|.	172;172;170|.	Q8N1B3-2;Q8N1B3;B5MD73|.	.;FA58A_HUMAN;.|.	S|V	138;170;138;170;170|64	ENSP00000384396:A170S|.	ENSP00000276345:A170S|.	A|G	-|-	1|2	0|0	FAM58A|FAM58A	152511301|152511301	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.880000|0.880000	0.50808|0.50808	5.300000|5.300000	0.65721|0.65721	0.847000|0.847000	0.35167|0.35167	0.429000|0.429000	0.28392|0.28392	GCC|GGC	.		0.657	FAM58A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152274	
FBN2	2201	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	127674670	127674670	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr5:127674670A>G	ENST00000508053.1	-	32	4401	c.3427T>C	c.(3427-3429)Ttc>Ctc	p.F1143L	FBN2_ENST00000508989.1_Missense_Mutation_p.F1110L|FBN2_ENST00000507835.1_5'UTR|FBN2_ENST00000262464.4_Missense_Mutation_p.F1143L			P35556	FBN2_HUMAN	fibrillin 2	1143	EGF-like 16; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TAGCCTTCGAAGCACTCGCAC	0.498																																					p.F1143L		.											.	FBN2	146	0			c.T3427C						.						107.0	87.0	94.0					5																	127674670		2203	4300	6503	SO:0001583	missense	2201	exon26			CTTCGAAGCACTC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.3427T>C	5.37:g.127674670A>G	ENSP00000424571:p.Phe1143Leu	219.0	0.0		326.0	21.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	A	16.85	3.235757	0.58886	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.86627	-2.15;-2.15;-2.15	5.13	5.13	0.70059	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.73265	0.3565	N	0.04787	-0.16	0.48762	D	0.999701	B;P	0.39216	0.101;0.664	B;B	0.38194	0.267;0.26	T	0.73892	-0.3839	10	0.10377	T	0.69	.	15.396	0.74794	1.0:0.0:0.0:0.0	.	1110;1143	D6RJI3;P35556	.;FBN2_HUMAN	L	1143;1143;1110	ENSP00000262464:F1143L;ENSP00000424571:F1143L;ENSP00000425596:F1110L	ENSP00000262464:F1143L	F	-	1	0	FBN2	127702569	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.860000	0.69546	2.274000	0.75844	0.477000	0.44152	TTC	.		0.498	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
FGGY	55277	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	59844499	59844499	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:59844499G>A	ENST00000303721.7	+	5	718	c.544G>A	c.(544-546)Gtc>Atc	p.V182I	FGGY_ENST00000371218.4_Missense_Mutation_p.V182I|FGGY_ENST00000474476.1_3'UTR|FGGY_ENST00000371212.1_Missense_Mutation_p.V94I	NM_018291.3	NP_060761.3	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing	182					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|neuron cellular homeostasis (GO:0070050)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(7;7.36e-05)					GGCAACAGGTGTCACAGCACG	0.393																																					p.V182I		.											.	FGGY	69	0			c.G544A						.						110.0	105.0	107.0					1																	59844499		2203	4300	6503	SO:0001583	missense	55277	exon5			ACAGGTGTCACAG		CCDS611.2, CCDS44155.1, CCDS58003.1, CCDS60155.1	1p32.1	2008-10-23			ENSG00000172456	ENSG00000172456			25610	protein-coding gene	gene with protein product		611370				17671248	Standard	NM_018291		Approved	FLJ10986	uc009wac.3	Q96C11	OTTHUMG00000008424	ENST00000303721.7:c.544G>A	1.37:g.59844499G>A	ENSP00000305922:p.Val182Ile	71.0	0.0		80.0	5.0	NM_001113411	B1AK92|B1AK93|B1AK94|B2RDR8|D3DQ56|Q9HA63|Q9NV20	Missense_Mutation	SNP	ENST00000303721.7	37	CCDS611.2	.	.	.	.	.	.	.	.	.	.	G	14.14	2.446480	0.43429	.	.	ENSG00000172456	ENST00000413489;ENST00000371218;ENST00000303721;ENST00000371212	T;T;T;T	0.58652	0.78;0.78;0.78;0.32	5.54	5.54	0.83059	Carbohydrate kinase, FGGY, N-terminal (1);	0.269957	0.37483	N	0.002071	T	0.46210	0.1381	N	0.26042	0.785	0.80722	D	1	B;B;B;B	0.09022	0.002;0.002;0.002;0.002	B;B;B;B	0.12837	0.008;0.003;0.008;0.008	T	0.28202	-1.0051	9	.	.	.	-18.3387	17.8435	0.88722	0.0:0.0:1.0:0.0	.	182;94;182;182	Q96C11-3;B1AK94;F2Z2V1;Q96C11	.;.;.;FGGY_HUMAN	I	182;182;182;94	ENSP00000406607:V182I;ENSP00000360262:V182I;ENSP00000305922:V182I;ENSP00000360256:V94I	.	V	+	1	0	FGGY	59617087	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.848000	0.55903	2.880000	0.98712	0.650000	0.86243	GTC	.		0.393	FGGY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023210.2	NM_001113411	
FCRL5	83416	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	157494326	157494326	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:157494326A>T	ENST00000361835.3	-	10	2139	c.1982T>A	c.(1981-1983)cTc>cAc	p.L661H	FCRL5_ENST00000461387.1_5'Flank|FCRL5_ENST00000368191.3_Missense_Mutation_p.L576H|FCRL5_ENST00000356953.4_Missense_Mutation_p.L661H|FCRL5_ENST00000368190.3_Missense_Mutation_p.L661H	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	661	Ig-like C2-type 7.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CCTGAAGGTGAGGATGGGACG	0.507																																					p.L661H		.											.	FCRL5	156	0			c.T1982A						.						49.0	54.0	52.0					1																	157494326		2203	4300	6503	SO:0001583	missense	83416	exon10			AAGGTGAGGATGG	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1982T>A	1.37:g.157494326A>T	ENSP00000354691:p.Leu661His	140.0	0.0		271.0	16.0	NM_031281	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	37	CCDS1165.1	.	.	.	.	.	.	.	.	.	.	A	16.97	3.269824	0.59540	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191	T;T;T;T	0.03951	3.75;3.75;3.75;3.75	4.69	4.69	0.59074	Immunoglobulin-like (1);	17.269200	0.00597	U	0.000372	T	0.27663	0.0680	H	0.97131	3.945	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.81914	0.987;0.951;0.995;0.995	T	0.15093	-1.0449	10	0.72032	D	0.01	.	10.7093	0.45973	1.0:0.0:0.0:0.0	.	576;661;661;661	F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9	.;.;.;FCRL5_HUMAN	H	661;661;661;576	ENSP00000354691:L661H;ENSP00000349434:L661H;ENSP00000357173:L661H;ENSP00000357174:L576H	ENSP00000349434:L661H	L	-	2	0	FCRL5	155760950	0.998000	0.40836	0.224000	0.23877	0.013000	0.08279	4.168000	0.58216	2.097000	0.63578	0.454000	0.30748	CTC	.		0.507	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281	
FLRT2	23768	hgsc.bcm.edu;broad.mit.edu	37	14	86089799	86089799	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr14:86089799C>G	ENST00000330753.4	+	2	2708	c.1941C>G	c.(1939-1941)taC>taG	p.Y647*	FLRT2_ENST00000554746.1_Nonsense_Mutation_p.Y647*	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	647					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		ACATGCGATACTGCAACAGCA	0.507																																					p.Y647X		.											.	FLRT2	94	0			c.C1941G						.						204.0	208.0	207.0					14																	86089799		2189	4266	6455	SO:0001587	stop_gained	23768	exon2			GCGATACTGCAAC	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1941C>G	14.37:g.86089799C>G	ENSP00000332879:p.Tyr647*	92.0	0.0		94.0	6.0	NM_013231	A0AV84|B7ZLP3	Nonsense_Mutation	SNP	ENST00000330753.4	37	CCDS9877.1	.	.	.	.	.	.	.	.	.	.	C	45	11.932692	0.99618	.	.	ENSG00000185070	ENST00000330753;ENST00000554746;ENST00000535800	.	.	.	6.06	6.06	0.98353	.	0.154928	0.48286	D	0.000182	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.7132	14.7494	0.69513	0.0:0.9315:0.0:0.0685	.	.	.	.	X	647;647;300	.	ENSP00000332879:Y647X	Y	+	3	2	FLRT2	85159552	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.311000	0.51919	2.880000	0.98712	0.650000	0.86243	TAC	.		0.507	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
GALNT6	11226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	51758078	51758078	+	Silent	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr12:51758078C>T	ENST00000543196.2	-	5	1081	c.876G>A	c.(874-876)gtG>gtA	p.V292V	GALNT6_ENST00000356317.3_Silent_p.V292V			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	292					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GGCTCACCACCACTGTCTTGT	0.607																																					p.V292V		.											.	GALNT6	92	0			c.G876A						.						77.0	73.0	74.0					12																	51758078		2203	4300	6503	SO:0001819	synonymous_variant	11226	exon6			CACCACCACTGTC	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.876G>A	12.37:g.51758078C>T		174.0	0.0		219.0	65.0	NM_007210	Q8IYH4|Q9H6G2|Q9UIV5	Silent	SNP	ENST00000543196.2	37	CCDS8813.1																																																																																			.		0.607	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210	
GANC	2595	broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	42646624	42646624	+	IGR	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr15:42646624A>G	ENST00000318010.8	+	0	4512				RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000356316.3_Silent_p.L7L	NM_198141.2	NP_937784.2	Q8TET4	GANC_HUMAN	glucosidase, alpha; neutral C						carbohydrate metabolic process (GO:0005975)		alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_cancers(109;3.08e-16)|all_epithelial(112;7.48e-15)|Lung NSC(122;3.08e-09)|all_lung(180;1.48e-08)|Melanoma(134;0.0574)|Colorectal(260;0.153)		GBM - Glioblastoma multiforme(94;1.06e-06)	Miglitol(DB00491)	AAATCAGTTTAAAAACACAAA	0.294																																					.		.											.	GANC	92	0			.						.						56.0	51.0	53.0					15																	42646624		1807	4067	5874	SO:0001628	intergenic_variant	2595	.			CAGTTTAAAAACA	AF545045	CCDS10084.1	15q15.2	2012-10-02			ENSG00000214013	ENSG00000214013	3.2.1.20		4139	protein-coding gene	gene with protein product		104180				6995030, 12370436	Standard	NM_198141		Approved		uc001zpi.3	Q8TET4	OTTHUMG00000130487		15.37:g.42646624A>G		185.0	0.0		288.0	117.0	.	Q52LQ4|Q8IWZ0|Q8IZM4|Q8IZM5	Silent	SNP	ENST00000318010.8	37	CCDS10084.1																																																																																			.		0.294	GANC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252887.2	NM_198141	
GHITM	27069	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	85909939	85909939	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr10:85909939T>C	ENST00000372134.3	+	7	914	c.721T>C	c.(721-723)Ttt>Ctt	p.F241L		NM_014394.2	NP_055209.2	Q9H3K2	GHITM_HUMAN	growth hormone inducible transmembrane protein	241					apoptotic process (GO:0006915)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(2)	10						CAGTGAAAAGTTTCTGAACAT	0.522																																					p.F241L		.											.	GHITM	90	0			c.T721C						.						110.0	120.0	117.0					10																	85909939		2009	4166	6175	SO:0001583	missense	27069	exon7			GAAAAGTTTCTGA	AB009685	CCDS41542.1	10q23.1	2008-02-01			ENSG00000165678	ENSG00000165678			17281	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 5"""					8619474, 9110174	Standard	NM_014394		Approved	HSPC282, PTD010, DERP2, My021, TMBIM5	uc001kcs.1	Q9H3K2	OTTHUMG00000018637	ENST00000372134.3:c.721T>C	10.37:g.85909939T>C	ENSP00000361207:p.Phe241Leu	121.0	1.0		167.0	20.0	NM_014394	A8K9Z9|D3DWE0|O95894|Q5VT95|Q9H0P2	Missense_Mutation	SNP	ENST00000372134.3	37	CCDS41542.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.430177	0.83776	.	.	ENSG00000165678	ENST00000372134;ENST00000538477;ENST00000436406;ENST00000339736	T	0.38401	1.14	6.03	4.88	0.63580	.	0.097761	0.64402	N	0.000001	T	0.55226	0.1907	M	0.67569	2.06	0.58432	D	0.999999	P;D	0.76494	0.811;0.999	P;D	0.79108	0.465;0.992	T	0.53085	-0.8488	10	0.38643	T	0.18	-6.3581	11.4011	0.49871	0.0:0.0:0.1513:0.8487	.	172;241	B4DNL0;Q9H3K2	.;GHITM_HUMAN	L	241;228;241;221	ENSP00000361207:F241L	ENSP00000342214:F221L	F	+	1	0	GHITM	85899919	1.000000	0.71417	0.998000	0.56505	0.843000	0.47879	7.519000	0.81809	1.084000	0.41184	-0.313000	0.08912	TTT	.		0.522	GHITM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049125.1	NM_014394	
GLI2	2736	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	121747481	121747481	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:121747481T>A	ENST00000452319.1	+	14	4051	c.3991T>A	c.(3991-3993)Tcc>Acc	p.S1331T	GLI2_ENST00000314490.11_Intron|GLI2_ENST00000361492.4_Missense_Mutation_p.S1331T					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CCTGGCAGCCTCCATGAGCCA	0.662																																					p.S1331T		.											.	GLI2	954	0			c.T3991A						.						19.0	20.0	19.0					2																	121747481		2200	4294	6494	SO:0001583	missense	2736	exon13			GCAGCCTCCATGA		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.3991T>A	2.37:g.121747481T>A	ENSP00000390436:p.Ser1331Thr	162.0	0.0		181.0	10.0	NM_005270		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	T	7.290	0.610783	0.14066	.	.	ENSG00000074047	ENST00000452319;ENST00000361492	T;T	0.14391	2.51;2.51	4.35	-7.44	0.01379	.	0.674730	0.15033	N	0.284344	T	0.03520	0.0101	N	0.08118	0	0.33388	D	0.575745	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.34950	-0.9808	9	.	.	.	.	1.2355	0.01952	0.1733:0.2848:0.1717:0.3702	.	1331;986	P10070;P10070-2	GLI2_HUMAN;.	T	1331	ENSP00000390436:S1331T;ENSP00000354586:S1331T	.	S	+	1	0	GLI2	121463951	0.000000	0.05858	0.000000	0.03702	0.958000	0.62258	-2.077000	0.01371	-1.744000	0.01338	-0.415000	0.06103	TCC	.		0.662	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
GLTSCR1	29998	broad.mit.edu;mdanderson.org	37	19	48182830	48182830	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:48182830C>T	ENST00000396720.3	+	6	597	c.403C>T	c.(403-405)Cag>Tag	p.Q135*	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	135										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		GCCCACCCTGCAGCCTGCGGA	0.716																																					p.Q135X		.											.	GLTSCR1	48	0			c.C403T						.						12.0	14.0	14.0					19																	48182830		685	1586	2271	SO:0001587	stop_gained	29998	exon6			ACCCTGCAGCCTG	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.403C>T	19.37:g.48182830C>T	ENSP00000379946:p.Gln135*	8.0	0.0		10.0	4.0	NM_015711	A8MW01	Nonsense_Mutation	SNP	ENST00000396720.3	37	CCDS46134.1	.	.	.	.	.	.	.	.	.	.	C	36	5.795397	0.96952	.	.	ENSG00000063169	ENST00000396720	.	.	.	4.77	4.77	0.60923	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	16.5618	0.84568	0.0:1.0:0.0:0.0	.	.	.	.	X	135	.	ENSP00000379946:Q135X	Q	+	1	0	GLTSCR1	52874642	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	7.305000	0.78891	2.193000	0.70182	0.491000	0.48974	CAG	.		0.716	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
GPR133	283383	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	131622709	131622709	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr12:131622709A>G	ENST00000261654.5	+	24	3023	c.2464A>G	c.(2464-2466)Aag>Gag	p.K822E	GPR133_ENST00000540207.1_3'UTR|GPR133_ENST00000535015.1_Missense_Mutation_p.K854E|GPR133_ENST00000376682.4_Missense_Mutation_p.K508E|GPR133_ENST00000543617.1_Missense_Mutation_p.K341E	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	822					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		GCACAAAACCAAGGTCTGGTC	0.602																																					p.K822E		.											.	GPR133	191	0			c.A2464G						.						88.0	72.0	77.0					12																	131622709		2203	4300	6503	SO:0001583	missense	283383	exon24			AAAACCAAGGTCT	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.2464A>G	12.37:g.131622709A>G	ENSP00000261654:p.Lys822Glu	87.0	1.0		94.0	16.0	NM_198827	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	A	17.48	3.399539	0.62177	.	.	ENSG00000111452	ENST00000261654;ENST00000535015;ENST00000376682;ENST00000543617	T;T;T;T	0.44083	0.93;1.23;1.01;1.01	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.32224	0.0822	L	0.29908	0.895	0.58432	D	0.999997	B;B;B	0.25955	0.002;0.138;0.04	B;B;B	0.27076	0.008;0.076;0.068	T	0.13308	-1.0514	10	0.45353	T	0.12	.	11.9742	0.53081	1.0:0.0:0.0:0.0	.	854;175;822	B7ZLF7;Q9NSM3;Q6QNK2	.;.;GP133_HUMAN	E	822;854;508;341	ENSP00000261654:K822E;ENSP00000444425:K854E;ENSP00000365872:K508E;ENSP00000438021:K341E	ENSP00000261654:K822E	K	+	1	0	GPR133	130188662	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.255000	0.78338	1.710000	0.51325	0.459000	0.35465	AAG	.		0.602	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
GPR135	64582	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	59930690	59930690	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr14:59930690C>A	ENST00000395116.1	-	1	1370	c.1255G>T	c.(1255-1257)Ggc>Tgc	p.G419C		NM_022571.5	NP_072093.2	Q8IZ08	GP135_HUMAN	G protein-coupled receptor 135	419						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.134)		AGACCCGGGCCCTGGCTGGGC	0.637																																					p.G419C		.											.	GPR135	90	0			c.G1255T						.						40.0	34.0	36.0					14																	59930690		2203	4300	6503	SO:0001583	missense	64582	exon1			CCGGGCCCTGGCT	AY288418	CCDS9738.1	14q23.1	2012-08-21			ENSG00000181619	ENSG00000181619		"""GPCR / Class A : Orphans"""	19991	protein-coding gene	gene with protein product		607970				14623098	Standard	NM_022571		Approved	HUMNPIIY20, PAFR	uc010apj.3	Q8IZ08	OTTHUMG00000140325	ENST00000395116.1:c.1255G>T	14.37:g.59930690C>A	ENSP00000378548:p.Gly419Cys	87.0	1.0		88.0	30.0	NM_022571	Q7Z604|Q86SM3|Q8NH39	Missense_Mutation	SNP	ENST00000395116.1	37	CCDS9738.1	.	.	.	.	.	.	.	.	.	.	c	18.23	3.578961	0.65878	.	.	ENSG00000181619	ENST00000395116	T	0.63580	-0.05	4.89	1.93	0.25924	.	0.456851	0.20560	U	0.089927	T	0.51753	0.1693	L	0.27053	0.805	0.38467	D	0.947369	D	0.57257	0.979	P	0.46975	0.533	T	0.56780	-0.7922	10	0.52906	T	0.07	-7.6514	11.5851	0.50914	0.0:0.6903:0.2352:0.0745	.	419	Q8IZ08	GP135_HUMAN	C	419	ENSP00000378548:G419C	ENSP00000378548:G419C	G	-	1	0	GPR135	59000443	0.450000	0.25697	0.031000	0.17742	0.138000	0.21146	0.794000	0.26958	0.659000	0.30945	0.651000	0.88453	GGC	.		0.637	GPR135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276941.1	NM_022571	
GPR19	2842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	12815347	12815347	+	Silent	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr12:12815347T>C	ENST00000540510.1	-	2	228	c.36A>G	c.(34-36)ccA>ccG	p.P12P	GPR19_ENST00000332427.2_Silent_p.P12P			P46093	GPR4_HUMAN	G protein-coupled receptor 19	0					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)		TAATCAAATGTGGCTTGCTGT	0.438																																					p.P12P		.											.	GPR19	91	0			c.A36G						.						113.0	109.0	110.0					12																	12815347		2203	4300	6503	SO:0001819	synonymous_variant	2842	exon4			CAAATGTGGCTTG		CCDS8652.1	12p12.3	2014-01-30				ENSG00000183150		"""GPCR / Class A : Orphans"""	4473	protein-coding gene	gene with protein product		602927					Standard	NM_006143		Approved		uc001raq.2	Q15760		ENST00000540510.1:c.36A>G	12.37:g.12815347T>C		60.0	0.0		66.0	9.0	NM_006143	A8K3T3|B0M0K1|Q6NWM4	Silent	SNP	ENST00000540510.1	37	CCDS8652.1																																																																																			.		0.438	GPR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400662.1	NM_006143	
GRAMD4	23151	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	47073042	47073042	+	Splice_Site	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr22:47073042A>T	ENST00000406902.1	+	19	1845		c.e19-1		GRAMD4_ENST00000408031.1_Splice_Site|GRAMD4_ENST00000361034.3_Splice_Site			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4						apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		CTTCCCTGCCAGCCGCTCGTG	0.627																																					.		.											.	GRAMD4	23	0			c.1633-2A>T						.						97.0	87.0	90.0					22																	47073042		2202	4300	6502	SO:0001630	splice_region_variant	23151	exon18			CCTGCCAGCCGCT		CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.1633-1A>T	22.37:g.47073042A>T		71.0	0.0		93.0	6.0	NM_015124	A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Splice_Site	SNP	ENST00000406902.1	37	CCDS33672.1	.	.	.	.	.	.	.	.	.	.	.	16.55	3.154112	0.57259	.	.	ENSG00000075240	ENST00000406902;ENST00000361034;ENST00000408031	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0257	0.58814	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRAMD4	45451706	1.000000	0.71417	0.998000	0.56505	0.553000	0.35397	6.328000	0.72915	1.748000	0.51833	0.374000	0.22700	.	.		0.627	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317969.1	NM_015124	Intron
HDAC9	9734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	18688299	18688299	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:18688299T>A	ENST00000432645.2	+	10	1451	c.1451T>A	c.(1450-1452)aTg>aAg	p.M484K	HDAC9_ENST00000405010.3_Missense_Mutation_p.M484K|HDAC9_ENST00000401921.1_Missense_Mutation_p.M443K|HDAC9_ENST00000406451.4_Missense_Mutation_p.M484K|HDAC9_ENST00000441542.2_Missense_Mutation_p.M487K|HDAC9_ENST00000456174.2_Missense_Mutation_p.M456K|HDAC9_ENST00000417496.2_Missense_Mutation_p.M482K|HDAC9_ENST00000406072.1_Missense_Mutation_p.M471K|HDAC9_ENST00000524023.1_Missense_Mutation_p.M407K|HDAC9_ENST00000428307.2_Missense_Mutation_p.M440K	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	484					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	CAGATCCACATGAACAAAGTA	0.463																																					p.M487K		.											.	HDAC9	227	0			c.T1460A						.						36.0	37.0	37.0					7																	18688299		2021	4180	6201	SO:0001583	missense	9734	exon10			TCCACATGAACAA	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1451T>A	7.37:g.18688299T>A	ENSP00000410337:p.Met484Lys	78.0	0.0		144.0	42.0	NM_178425	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	37	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	T	16.36	3.102219	0.56183	.	.	ENSG00000048052	ENST00000417496;ENST00000262069;ENST00000405010;ENST00000406451;ENST00000428307;ENST00000406072;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000456174;ENST00000524023;ENST00000341009	T;T;T;T;T;T;T;T;T;T	0.58060	0.94;0.95;0.36;0.95;0.95;0.37;0.36;0.36;0.97;0.95	5.28	5.28	0.74379	.	0.121996	0.36972	N	0.002306	T	0.60379	0.2264	L	0.50333	1.59	0.58432	D	0.999996	P;B;D;B;D;D;B;P;D;D;B;D;P;P	0.57899	0.851;0.337;0.978;0.289;0.963;0.978;0.013;0.774;0.981;0.967;0.013;0.981;0.61;0.665	B;B;P;B;B;P;B;B;P;B;B;P;B;B	0.53593	0.11;0.099;0.647;0.045;0.444;0.647;0.01;0.101;0.73;0.439;0.01;0.73;0.201;0.103	T	0.64993	-0.6276	10	0.87932	D	0	-18.3526	15.2052	0.73173	0.0:0.0:0.0:1.0	.	407;456;484;471;482;484;487;443;487;484;456;484;484;462	E7EX34;C9JS87;Q9UKV0-4;B5MCF1;B7Z917;Q9UKV0-2;Q68D71;Q9UKV0-6;Q9UKV0-7;Q9UKV0;B7Z928;Q9UKV0-5;Q9UKV0-3;Q8N879	.;.;.;.;.;.;.;.;.;HDAC9_HUMAN;.;.;.;.	K	482;485;484;484;440;471;443;484;487;456;407;484	ENSP00000401669:M482K;ENSP00000384382:M484K;ENSP00000384657:M484K;ENSP00000395655:M440K;ENSP00000384017:M471K;ENSP00000383912:M443K;ENSP00000410337:M484K;ENSP00000408617:M487K;ENSP00000388568:M456K;ENSP00000430036:M407K	ENSP00000262069:M485K	M	+	2	0	HDAC9	18654824	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.503000	0.81632	2.005000	0.58758	0.455000	0.32223	ATG	.		0.463	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		
HIBCH	26275	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	191159323	191159323	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:191159323T>C	ENST00000359678.5	-	4	547	c.253A>G	c.(253-255)Att>Gtt	p.I85V	HIBCH_ENST00000392332.3_Missense_Mutation_p.I85V	NM_014362.3|NM_198047.2	NP_055177.2|NP_932164.1	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-CoA hydrolase	85					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	3-hydroxyisobutyryl-CoA hydrolase activity (GO:0003860)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|lung(5)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			CCCTTTATAATGATCAGGAAA	0.393																																					p.I85V		.											.	HIBCH	90	0			c.A253G						.						83.0	79.0	81.0					2																	191159323		2203	4300	6503	SO:0001583	missense	26275	exon4			TTATAATGATCAG	U66669	CCDS2304.1, CCDS46475.1	2q32.3	2010-04-29	2010-04-29		ENSG00000198130	ENSG00000198130	3.1.2.4		4908	protein-coding gene	gene with protein product		610690	"""3-hydroxyisobutyryl-Coenzyme A hydrolase"""			8824301	Standard	NM_014362		Approved		uc002uru.3	Q6NVY1	OTTHUMG00000132673	ENST00000359678.5:c.253A>G	2.37:g.191159323T>C	ENSP00000352706:p.Ile85Val	57.0	0.0		81.0	8.0	NM_014362	D3DPI4|Q53GA8|Q53GF2|Q53RF7|Q53TC6|Q92931|Q9BS94	Missense_Mutation	SNP	ENST00000359678.5	37	CCDS2304.1	.	.	.	.	.	.	.	.	.	.	T	12.51	1.959275	0.34565	.	.	ENSG00000198130	ENST00000392332;ENST00000359678;ENST00000409934	T;T;T	0.67523	-0.26;-0.27;-0.26	5.43	2.93	0.34026	Crotonase, core (1);	0.095807	0.64402	D	0.000001	T	0.48114	0.1482	N	0.17564	0.495	0.80722	D	1	B;B	0.19817	0.01;0.039	B;B	0.24701	0.055;0.025	T	0.20605	-1.0270	10	0.23891	T	0.37	-0.3131	10.6221	0.45487	0.0:0.0:0.3037:0.6963	.	85;85	Q6NVY1-2;Q6NVY1	.;HIBCH_HUMAN	V	85;85;139	ENSP00000376144:I85V;ENSP00000352706:I85V;ENSP00000387247:I139V	ENSP00000352706:I85V	I	-	1	0	HIBCH	190867568	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	1.434000	0.34958	0.314000	0.23086	0.460000	0.39030	ATT	.		0.393	HIBCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255933.1		
HIST1H1B	3009	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	27834746	27834746	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr6:27834746T>C	ENST00000331442.3	-	1	613	c.562A>G	c.(562-564)Aag>Gag	p.K188E		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	188					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						GCAGGACTCTTGGTTGCCTTT	0.582																																					p.K188E		.											.	HIST1H1B	585	0			c.A562G						.						76.0	75.0	75.0					6																	27834746		2203	4300	6503	SO:0001583	missense	3009	exon1			GACTCTTGGTTGC	AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.562A>G	6.37:g.27834746T>C	ENSP00000330074:p.Lys188Glu	90.0	0.0		138.0	30.0	NM_005322	Q14529|Q3MJ42	Missense_Mutation	SNP	ENST00000331442.3	37	CCDS4635.1	.	.	.	.	.	.	.	.	.	.	T	13.50	2.255589	0.39896	.	.	ENSG00000184357	ENST00000331442	T	0.20069	2.1	5.19	5.19	0.71726	.	0.053885	0.64402	D	0.000001	T	0.05640	0.0148	N	0.08118	0	0.58432	D	0.999994	P	0.38473	0.633	B	0.33799	0.17	T	0.17623	-1.0363	10	0.72032	D	0.01	-5.6055	14.5461	0.68032	0.0:0.0:0.0:1.0	.	188	P16401	H15_HUMAN	E	188	ENSP00000330074:K188E	ENSP00000330074:K188E	K	-	1	0	HIST1H1B	27942725	1.000000	0.71417	0.857000	0.33713	0.041000	0.13682	4.536000	0.60636	2.103000	0.63969	0.533000	0.62120	AAG	.		0.582	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043371.1	NM_005322	
HK3	3101	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	176318451	176318451	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr5:176318451G>A	ENST00000292432.5	-	3	288	c.197C>T	c.(196-198)gCc>gTc	p.A66V		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	66	Hexokinase type-1 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCAGGGCTGGCCTGTCCCCT	0.622																																					p.A66V		.											.	HK3	294	0			c.C197T						.						95.0	93.0	94.0					5																	176318451		2203	4300	6503	SO:0001583	missense	3101	exon3			GGGCTGGCCTGTC		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.197C>T	5.37:g.176318451G>A	ENSP00000292432:p.Ala66Val	110.0	0.0		143.0	11.0	NM_002115	Q8N1E7	Missense_Mutation	SNP	ENST00000292432.5	37	CCDS4407.1	.	.	.	.	.	.	.	.	.	.	G	8.237	0.805956	0.16467	.	.	ENSG00000160883	ENST00000292432	D	0.98926	-5.24	4.7	0.41	0.16387	Hexokinase, N-terminal (1);	1.279450	0.05344	N	0.530644	D	0.96334	0.8804	L	0.34521	1.04	0.09310	N	1	B	0.06786	0.001	B	0.19666	0.026	D	0.90777	0.4676	10	0.62326	D	0.03	.	7.5648	0.27872	0.0794:0.0:0.4673:0.4532	.	66	P52790	HXK3_HUMAN	V	66	ENSP00000292432:A66V	ENSP00000292432:A66V	A	-	2	0	HK3	176251057	0.004000	0.15560	0.000000	0.03702	0.015000	0.08874	0.413000	0.21148	-0.164000	0.10927	0.561000	0.74099	GCC	.		0.622	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1		
IGF2BP3	10643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	23353255	23353255	+	Silent	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:23353255A>G	ENST00000258729.3	-	13	1769	c.1413T>C	c.(1411-1413)taT>taC	p.Y471Y		NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	471					anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						TAATTTTTCCATAAATTCTTC	0.378																																					p.Y471Y		.											.	IGF2BP3	92	0			c.T1413C						.						79.0	76.0	77.0					7																	23353255		2203	4300	6503	SO:0001819	synonymous_variant	10643	exon13			TTTTCCATAAATT	AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.1413T>C	7.37:g.23353255A>G		35.0	0.0		81.0	38.0	NM_006547	A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Silent	SNP	ENST00000258729.3	37	CCDS5382.1																																																																																			.		0.378	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250243.2	NM_006547	
IL1RL2	8808	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	102836404	102836404	+	Silent	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:102836404A>G	ENST00000264257.2	+	8	1044	c.918A>G	c.(916-918)aaA>aaG	p.K306K	IL1RL2_ENST00000441515.2_Silent_p.K188K|IL1RL2_ENST00000481806.1_3'UTR|IL1RL2_ENST00000539491.1_Silent_p.K306K	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	306	Ig-like C2-type 3.				cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						TGGAAGTGAAAATGGAAGATT	0.398																																					p.K306K		.											.	IL1RL2	92	0			c.A918G						.						131.0	116.0	121.0					2																	102836404		2203	4300	6503	SO:0001819	synonymous_variant	8808	exon8			AGTGAAAATGGAA	U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.918A>G	2.37:g.102836404A>G		93.0	0.0		156.0	65.0	NM_003854	A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Silent	SNP	ENST00000264257.2	37	CCDS2056.1																																																																																			.		0.398	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253290.1	NM_003854	
ITIH1	3697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52824922	52824922	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:52824922A>G	ENST00000273283.2	+	20	2503	c.2479A>G	c.(2479-2481)Acg>Gcg	p.T827A	ITIH1_ENST00000405128.3_Missense_Mutation_p.T193A|ITIH1_ENST00000542827.1_3'UTR|ITIH1_ENST00000540715.1_Missense_Mutation_p.T685A|ITIH1_ENST00000537050.1_Missense_Mutation_p.T539A	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	827	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		GTCAGCCCGGACGCACGGGCT	0.622																																					p.T827A		.											.	ITIH1	93	0			c.A2479G						.						90.0	85.0	87.0					3																	52824922		2203	4300	6503	SO:0001583	missense	3697	exon20			GCCCGGACGCACG		CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.2479A>G	3.37:g.52824922A>G	ENSP00000273283:p.Thr827Ala	152.0	0.0		152.0	45.0	NM_002215	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	ENST00000273283.2	37	CCDS2864.1	.	.	.	.	.	.	.	.	.	.	A	15.43	2.832067	0.50845	.	.	ENSG00000055957	ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133;ENST00000405128	T;T;T;T;T	0.11821	2.74;2.74;2.74;2.74;2.74	5.75	5.75	0.90469	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	0.171869	0.52532	D	0.000071	T	0.24661	0.0598	L	0.45744	1.44	0.36445	D	0.865709	B;D;P;D	0.65815	0.324;0.995;0.953;0.995	B;D;P;D	0.68039	0.219;0.93;0.76;0.955	T	0.18209	-1.0344	10	0.19590	T	0.45	-16.1011	9.4056	0.38460	0.9202:0.0:0.0798:0.0	.	685;193;428;827	F5H165;B5MCP1;Q9P1C5;P19827	.;.;.;ITIH1_HUMAN	A	827;685;539;380;193	ENSP00000273283:T827A;ENSP00000443973:T685A;ENSP00000443847:T539A;ENSP00000395836:T380A;ENSP00000384589:T193A	ENSP00000273283:T827A	T	+	1	0	ITIH1	52799962	1.000000	0.71417	0.994000	0.49952	0.877000	0.50540	6.084000	0.71335	2.195000	0.70347	0.533000	0.62120	ACG	.		0.622	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215	
ITGB5	3693	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	124592297	124592297	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:124592297T>C	ENST00000296181.4	-	2	448	c.152A>G	c.(151-153)aAa>aGa	p.K51R		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	51	PSI.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		ACATACCTCTTTGGAGCACCA	0.483																																					p.K51R		.											.	ITGB5	227	0			c.A152G						.						252.0	236.0	241.0					3																	124592297		2203	4300	6503	SO:0001583	missense	3693	exon2			ACCTCTTTGGAGC	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.152A>G	3.37:g.124592297T>C	ENSP00000296181:p.Lys51Arg	147.0	0.0		172.0	9.0	NM_002213	B0LPF8|B2RD70	Missense_Mutation	SNP	ENST00000296181.4	37	CCDS3030.1	.	.	.	.	.	.	.	.	.	.	T	14.59	2.580171	0.46006	.	.	ENSG00000082781	ENST00000296181	D	0.92699	-3.09	5.04	2.36	0.29203	Integrin beta subunit, N-terminal (2);	0.224693	0.47093	N	0.000258	D	0.87849	0.6281	L	0.60067	1.865	0.34810	D	0.737612	B	0.11235	0.004	B	0.13407	0.009	T	0.82583	-0.0385	10	0.38643	T	0.18	.	6.8438	0.23977	0.0:0.2278:0.0:0.7722	.	51	P18084	ITB5_HUMAN	R	51	ENSP00000296181:K51R	ENSP00000296181:K51R	K	-	2	0	ITGB5	126074987	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	2.262000	0.43285	0.300000	0.22699	0.379000	0.24179	AAA	.		0.483	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	
KBTBD7	84078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	41766715	41766715	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr13:41766715T>C	ENST00000379483.3	-	1	1987	c.1679A>G	c.(1678-1680)cAg>cGg	p.Q560R		NM_032138.4	NP_115514.2	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	560										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(4)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		ATTGACAATCTGGTAGTTGTG	0.433																																					p.Q560R		.											.	KBTBD7	91	0			c.A1679G						.						172.0	169.0	170.0					13																	41766715		2203	4300	6503	SO:0001583	missense	84078	exon1			ACAATCTGGTAGT	AL136782	CCDS9377.1	13q13.3	2013-01-08			ENSG00000120696	ENSG00000120696		"""BTB/POZ domain containing"""	25266	protein-coding gene	gene with protein product						11230166	Standard	NM_032138		Approved	DKFZP434E2318	uc001uxw.1	Q8WVZ9	OTTHUMG00000016789	ENST00000379483.3:c.1679A>G	13.37:g.41766715T>C	ENSP00000368797:p.Gln560Arg	155.0	0.0		187.0	52.0	NM_032138	B5TZ86|Q5T6Y7|Q8NB99|Q9H0I6	Missense_Mutation	SNP	ENST00000379483.3	37	CCDS9377.1	.	.	.	.	.	.	.	.	.	.	T	0.010	-1.755143	0.00663	.	.	ENSG00000120696	ENST00000379483;ENST00000501885	T	0.65732	-0.17	5.37	5.37	0.77165	Kelch-type beta propeller (1);	0.000000	0.64402	U	0.000001	T	0.45696	0.1355	N	0.21448	0.665	0.50171	D	0.999852	B	0.06786	0.001	B	0.06405	0.002	T	0.37709	-0.9694	10	0.12103	T	0.63	.	13.3145	0.60399	0.0:0.0:0.0:1.0	.	560	Q8WVZ9	KBTB7_HUMAN	R	560;462	ENSP00000368797:Q560R	ENSP00000368797:Q560R	Q	-	2	0	KBTBD7	40664715	1.000000	0.71417	1.000000	0.80357	0.121000	0.20230	6.520000	0.73773	2.023000	0.59567	0.455000	0.32223	CAG	.		0.433	KBTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044660.1	NM_032138	
KCNA7	3743	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	49573780	49573780	+	Missense_Mutation	SNP	G	G	A	rs376824241		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:49573780G>A	ENST00000221444.1	-	2	1266	c.911C>T	c.(910-912)aCg>aTg	p.T304M		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	304					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	GGCCCGAAGCGTCTGGCCCAA	0.577																																					p.T304M	Colon(74;686 1235 3793 23366 48562)	.											.	KCNA7	90	0			c.C911T						.	G	MET/THR	0,4406		0,0,2203	59.0	57.0	57.0		911	4.5	1.0	19		57	1,8599	1.2+/-3.3	0,1,4299	no	missense	KCNA7	NM_031886.2	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	304/457	49573780	1,13005	2203	4300	6503	SO:0001583	missense	3743	exon2			CGAAGCGTCTGGC	AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.911C>T	19.37:g.49573780G>A	ENSP00000221444:p.Thr304Met	115.0	1.0		133.0	10.0	NM_031886	A1KYX7|Q9BYS4	Missense_Mutation	SNP	ENST00000221444.1	37	CCDS12755.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.437991	0.83885	0.0	1.16E-4	ENSG00000104848	ENST00000221444	D	0.98512	-4.97	4.54	4.54	0.55810	Ion transport (1);	0.101147	0.64402	D	0.000003	D	0.99381	0.9782	H	0.97940	4.11	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.98294	1.0515	10	0.87932	D	0	.	16.4224	0.83771	0.0:0.0:1.0:0.0	.	304	Q96RP8	KCNA7_HUMAN	M	304	ENSP00000221444:T304M	ENSP00000221444:T304M	T	-	2	0	KCNA7	54265592	1.000000	0.71417	0.954000	0.39281	0.994000	0.84299	9.820000	0.99359	2.264000	0.75181	0.491000	0.48974	ACG	.		0.577	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466263.1	NM_031886	
KCNG4	93107	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	84270993	84270993	+	Silent	SNP	C	C	A	rs374330675		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr16:84270993C>A	ENST00000308251.4	-	2	167	c.99G>T	c.(97-99)acG>acT	p.T33T	KCNG4_ENST00000568181.1_Silent_p.T33T	NM_172347.2	NP_758857.1	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G, member 4	33					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	31						TGATGGACGGCGTCTCCATGG	0.627																																					p.T33T		.											.	KCNG4	93	0			c.G99T						.						39.0	42.0	41.0					16																	84270993		2200	4300	6500	SO:0001819	synonymous_variant	93107	exon2			GGACGGCGTCTCC	AF348984	CCDS10945.1	16q24.1	2011-07-05			ENSG00000168418	ENSG00000168418		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19697	protein-coding gene	gene with protein product		607603				12060745, 16382104	Standard	NM_172347		Approved	Kv6.4	uc010voc.2	Q8TDN1	OTTHUMG00000137638	ENST00000308251.4:c.99G>T	16.37:g.84270993C>A		119.0	1.0		136.0	43.0	NM_172347	Q96H24	Silent	SNP	ENST00000308251.4	37	CCDS10945.1																																																																																			.		0.627	KCNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269079.2	NM_172347	
KCP	375616	broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	128531548	128531548	+	RNA	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:128531548T>C	ENST00000476647.2	-	0	1877							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						GTGGGGGAAGTCCGCTCCGCT	0.692																																					.		.											.	KCP	68	0			.						.						19.0	25.0	24.0					7																	128531548		692	1590	2282			375616	.			GGGAAGTCCGCTC	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128531548T>C		42.0	0.0		41.0	13.0	.	Q8NBE0	RNA	SNP	ENST00000476647.2	37																																																																																				.		0.692	KCP-006	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000403051.1	NM_199349	
KIAA1407	57577	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	113753775	113753775	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:113753775T>G	ENST00000295878.3	-	6	961	c.815A>C	c.(814-816)aAa>aCa	p.K272T	KIAA1407_ENST00000545063.1_Missense_Mutation_p.K103T	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	272										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						GGCTTACATTTTCCATGCTGC	0.438																																					p.K272T		.											.	KIAA1407	92	0			c.A815C						.						183.0	178.0	180.0					3																	113753775		2203	4300	6503	SO:0001583	missense	57577	exon6			TACATTTTCCATG	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.815A>C	3.37:g.113753775T>G	ENSP00000295878:p.Lys272Thr	79.0	1.0		109.0	38.0	NM_020817	B4DYL1|Q9P2E0	Missense_Mutation	SNP	ENST00000295878.3	37	CCDS2977.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.121416	0.77436	.	.	ENSG00000163617	ENST00000295878;ENST00000545063;ENST00000491000	T;T;T	0.51574	1.33;0.7;0.72	5.78	4.63	0.57726	.	0.282712	0.39985	N	0.001214	T	0.61236	0.2331	M	0.62723	1.935	0.80722	D	1	D;D;D	0.67145	0.992;0.996;0.992	D;P;D	0.68039	0.925;0.891;0.955	T	0.61505	-0.7049	10	0.54805	T	0.06	.	9.4157	0.38519	0.0:0.1535:0.0:0.8465	.	259;148;272	C9JA89;B4DIZ9;Q8NCU4	.;.;K1407_HUMAN	T	272;103;259	ENSP00000295878:K272T;ENSP00000446381:K103T;ENSP00000418099:K259T	ENSP00000295878:K272T	K	-	2	0	KIAA1407	115236465	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.286000	0.43496	1.023000	0.39654	0.528000	0.53228	AAA	.		0.438	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	NM_020817	
KIAA1644	85352	broad.mit.edu;mdanderson.org	37	22	44681359	44681359	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr22:44681359C>A	ENST00000381176.4	-	4	680	c.548G>T	c.(547-549)cGg>cTg	p.R183L		NM_001099294.1	NP_001092764.1	Q3SXP7	K1644_HUMAN	KIAA1644	183						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)				AGCATCTCCCCGCAATGTGTG	0.652																																					p.R183L		.											.	KIAA1644	23	0			c.G548T						.						64.0	67.0	66.0					22																	44681359		2091	4229	6320	SO:0001583	missense	85352	exon4			TCTCCCCGCAATG	AB051431	CCDS43025.1	22q13	2009-02-06	2009-02-06		ENSG00000138944	ENSG00000138944			29335	protein-coding gene	gene with protein product						11258795	Standard	NM_001099294		Approved		uc003bet.2	Q3SXP7	OTTHUMG00000030991	ENST00000381176.4:c.548G>T	22.37:g.44681359C>A	ENSP00000370568:p.Arg183Leu	131.0	0.0		126.0	9.0	NM_001099294	A6NHP0|A9Z1Z0|Q3SXP8|Q5JZ71|Q9BYB5	Missense_Mutation	SNP	ENST00000381176.4	37	CCDS43025.1	.	.	.	.	.	.	.	.	.	.	C	10.75	1.438352	0.25900	.	.	ENSG00000138944	ENST00000381176	.	.	.	5.06	0.393	0.16294	.	0.204155	0.38492	N	0.001662	T	0.21801	0.0525	N	0.19112	0.55	0.38626	D	0.951261	B	0.02656	0.0	B	0.04013	0.001	T	0.06552	-1.0820	8	0.66056	D	0.02	-6.6973	3.2124	0.06687	0.1994:0.2784:0.0:0.5221	.	183	Q3SXP7	K1644_HUMAN	L	183	.	ENSP00000370568:R183L	R	-	2	0	KIAA1644	43012692	1.000000	0.71417	0.737000	0.30932	0.162000	0.22319	1.419000	0.34793	0.066000	0.16515	-0.291000	0.09656	CGG	.		0.652	KIAA1644-006	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075879.2	NM_001099294	
KIF19	124602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	72342641	72342641	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:72342641G>T	ENST00000389916.4	+	8	1040	c.902G>T	c.(901-903)aGc>aTc	p.S301I		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	301	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						TATCGCGACAGCAAGCTCACC	0.577																																					p.S301I		.											.	KIF19	90	0			c.G902T						.						68.0	42.0	51.0					17																	72342641		2049	3985	6034	SO:0001583	missense	124602	exon8			GCGACAGCAAGCT	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.902G>T	17.37:g.72342641G>T	ENSP00000374566:p.Ser301Ile	168.0	0.0		303.0	166.0	NM_153209	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803380	0.90623	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	D;D	0.86297	-2.1;-2.1	5.8	5.8	0.92144	Kinesin, motor domain (4);	.	.	.	.	D	0.97081	0.9046	H	0.99726	4.73	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98541	1.0632	9	0.87932	D	0	.	19.7033	0.96063	0.0:0.0:1.0:0.0	.	301;259;259;301	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	I	259;301	ENSP00000449134:S259I;ENSP00000374566:S301I	ENSP00000374566:S301I	S	+	2	0	KIF19	69854236	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	6.141000	0.71744	2.764000	0.94973	0.556000	0.70494	AGC	.		0.577	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209	
KLF15	28999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	126062722	126062722	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:126062722C>T	ENST00000296233.3	-	3	1329	c.1099G>A	c.(1099-1101)Gag>Aag	p.E367K		NM_014079.3	NP_054798.1	Q9UIH9	KLF15_HUMAN	Kruppel-like factor 15	367					cardiac muscle hypertrophy in response to stress (GO:0014898)|cellular response to peptide (GO:1901653)|glial cell differentiation (GO:0010001)|glomerular visceral epithelial cell differentiation (GO:0072112)|glucose transport (GO:0015758)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(7)|ovary(2)|skin(2)	12				GBM - Glioblastoma multiforme(114;0.147)		CGCGACAGCTCGTCAGAGCGC	0.672																																					p.E367K		.											.	KLF15	91	0			c.G1099A						.						32.0	28.0	29.0					3																	126062722		2202	4300	6502	SO:0001583	missense	28999	exon3			ACAGCTCGTCAGA	AB029254	CCDS3036.1	3q21.3	2013-01-08			ENSG00000163884	ENSG00000163884		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	14536	protein-coding gene	gene with protein product	"""kidney-enriched Kruppel-like factor"""	606465				10982849	Standard	NM_014079		Approved	KKLF	uc011bkk.1	Q9UIH9	OTTHUMG00000162689	ENST00000296233.3:c.1099G>A	3.37:g.126062722C>T	ENSP00000296233:p.Glu367Lys	56.0	0.0		74.0	32.0	NM_014079		Missense_Mutation	SNP	ENST00000296233.3	37	CCDS3036.1	.	.	.	.	.	.	.	.	.	.	C	35	5.584838	0.96578	.	.	ENSG00000163884	ENST00000296233	T	0.51071	0.72	5.02	5.02	0.67125	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.53883	0.1824	N	0.16478	0.41	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61446	-0.7061	10	0.87932	D	0	.	15.8427	0.78861	0.0:1.0:0.0:0.0	.	367	Q9UIH9	KLF15_HUMAN	K	367	ENSP00000296233:E367K	ENSP00000296233:E367K	E	-	1	0	KLF15	127545412	1.000000	0.71417	0.976000	0.42696	0.946000	0.59487	7.761000	0.85260	2.327000	0.79052	0.491000	0.48974	GAG	.		0.672	KLF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370096.1	NM_014079	
KRT3	3850	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53189359	53189359	+	Silent	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr12:53189359G>A	ENST00000417996.2	-	1	542	c.468C>T	c.(466-468)ggC>ggT	p.G156G	KRT3_ENST00000309505.3_Silent_p.G156G	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	156	Gly-rich.|Head.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						CACCAGGACTGCCCAAGCTGC	0.622																																					p.G156G		.											.	KRT3	90	0			c.C468T						.						116.0	157.0	143.0					12																	53189359		2203	4300	6503	SO:0001819	synonymous_variant	3850	exon1			AGGACTGCCCAAG		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.468C>T	12.37:g.53189359G>A		118.0	0.0		174.0	65.0	NM_057088	A6NIS2|Q701L8	Silent	SNP	ENST00000417996.2	37	CCDS44895.1																																																																																			.		0.622	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
KRTAP6-3	337968	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca|broad.mit.edu;bcgsc.ca	37	21	31964987	31964988	+	Missense_Mutation	DNP	GG	GG	CC			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown|.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr21:31964987_31964988GG>CC	ENST00000391624.1	+	1	229_230	c.202_203GG>CC	c.(202-204)GGc>CCc	p.G68P	KRTAP22-2_ENST00000382830.2_5'Flank	NM_181605.3	NP_853636.3	Q3LI67	KRA63_HUMAN	keratin associated protein 6-3	68						intermediate filament (GO:0005882)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(7)	10						tggctacagaggcctggactgt	0.604																																					p.G75R|p.G75A		.											.	.	.	0			c.G223C|c.G224C						.																																			SO:0001583	missense	337968	exon1			TACAGAGGCCTGG|ACAGAGGCCTGGA	AP001708		21q22.1	2012-04-19			ENSG00000212938	ENSG00000212938		"""Keratin associated proteins"""	18933	protein-coding gene	gene with protein product						12359730	Standard	NM_181605		Approved	KAP6.3	uc002yom.3	Q3LI67	OTTHUMG00000057791	Exception_encountered	21.37:g.31964987_31964988delinsCC	ENSP00000375482:p.Gly68Pro	132.0|131.0	1.0		175.0|173.0	13.0	NM_181605	A4IF26	Missense_Mutation	SNP	ENST00000391624.1	37																																																																																				.		0.604	KRTAP6-3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128243.2	NM_181605	
LENG8	114823	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54967843	54967843	+	Silent	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:54967843C>A	ENST00000326764.5	+	11	1953	c.1474C>A	c.(1474-1476)Cga>Aga	p.R492R	LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	455										breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		CAAGCGCAGTCGAAAGAAGAT	0.677																																					p.R492R		.											.	LENG8	91	0			c.C1474A						.						16.0	21.0	19.0					19																	54967843		2196	4291	6487	SO:0001819	synonymous_variant	114823	exon11			CGCAGTCGAAAGA	AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.1474C>A	19.37:g.54967843C>A		60.0	0.0		93.0	29.0	NM_052925	B0VJY9|Q8IZ27|Q8NCX6	Silent	SNP	ENST00000326764.5	37	CCDS12894.1																																																																																			.		0.677	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140523.2	NM_052925	
NRROS	375387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	196387008	196387008	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:196387008C>T	ENST00000328557.4	+	3	697	c.494C>T	c.(493-495)gCg>gTg	p.A165V		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	165					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GTGTCCCTGGCGGGGAACACC	0.647																																					p.A165V		.											.	LRRC33	92	0			c.C494T						.						36.0	36.0	36.0					3																	196387008		2203	4300	6503	SO:0001583	missense	375387	exon3			CCCTGGCGGGGAA	AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.494C>T	3.37:g.196387008C>T	ENSP00000328625:p.Ala165Val	70.0	0.0		93.0	50.0	NM_198565		Missense_Mutation	SNP	ENST00000328557.4	37	CCDS3319.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.944793	0.53079	.	.	ENSG00000174004	ENST00000328557	T	0.57752	0.38	5.97	4.19	0.49359	.	0.114073	0.64402	D	0.000009	T	0.39835	0.1093	L	0.35793	1.09	0.80722	D	1	B	0.30973	0.302	B	0.30105	0.111	T	0.30534	-0.9975	10	0.62326	D	0.03	.	7.0601	0.25121	0.1304:0.678:0.1255:0.066	.	165	Q86YC3	LRC33_HUMAN	V	165	ENSP00000328625:A165V	ENSP00000328625:A165V	A	+	2	0	LRRC33	197871405	0.999000	0.42202	0.730000	0.30809	0.196000	0.23810	3.964000	0.56780	0.865000	0.35603	-0.140000	0.14226	GCG	.		0.647	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340676.1	NM_198565	
LRCH3	84859	broad.mit.edu;bcgsc.ca	37	3	197592322	197592322	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:197592322G>T	ENST00000425562.2	+	16	1745	c.1745G>T	c.(1744-1746)aGt>aTt	p.S582I	LRCH3_ENST00000334859.4_Missense_Mutation_p.S582I|LRCH3_ENST00000438796.2_Missense_Mutation_p.S582I|LRCH3_ENST00000414675.2_Missense_Mutation_p.S530I|LRCH3_ENST00000536618.1_Missense_Mutation_p.S177I|LRCH3_ENST00000441090.2_Missense_Mutation_p.S428I			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	582						cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		GCTCTATTAAGTTCACCTGCA	0.269																																					p.S582I		.											.	LRCH3	91	0			c.G1745T						.						41.0	40.0	40.0					3																	197592322		2203	4300	6503	SO:0001583	missense	84859	exon16			TATTAAGTTCACC	AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.1745G>T	3.37:g.197592322G>T	ENSP00000393579:p.Ser582Ile	142.0	1.0		218.0	9.0	NM_032773	B4E0T7|Q96FP9|Q9NT52	Missense_Mutation	SNP	ENST00000425562.2	37		.	.	.	.	.	.	.	.	.	.	G	5.522	0.281268	0.10458	.	.	ENSG00000186001	ENST00000438796;ENST00000441090;ENST00000414675;ENST00000334859;ENST00000425562;ENST00000536618;ENST00000452660;ENST00000433298	T;T;T;T;T;T;T;T	0.54675	1.84;1.17;1.99;2.12;1.86;0.56;0.84;0.88	5.04	2.1	0.27182	.	1.130940	0.06341	N	0.708064	T	0.35913	0.0948	N	0.24115	0.695	0.21897	N	0.999485	B;B;B;B;B	0.30326	0.276;0.121;0.118;0.103;0.253	B;B;B;B;B	0.28638	0.05;0.019;0.043;0.019;0.092	T	0.28618	-1.0038	10	0.37606	T	0.19	0.0239	4.0912	0.09970	0.2837:0.174:0.5423:0.0	.	428;530;582;582;582	E9PD99;B4E0T7;Q96II8-2;Q96II8;Q96II8-3	.;.;.;LRCH3_HUMAN;.	I	582;428;530;582;582;177;93;55	ENSP00000399751:S582I;ENSP00000394609:S428I;ENSP00000394965:S530I;ENSP00000334375:S582I;ENSP00000393579:S582I;ENSP00000439083:S177I;ENSP00000395309:S93I;ENSP00000400164:S55I	ENSP00000334375:S582I	S	+	2	0	LRCH3	199076719	0.994000	0.37717	0.070000	0.20053	0.163000	0.22366	0.846000	0.27682	0.540000	0.28808	0.298000	0.19748	AGT	.		0.269	LRCH3-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000339965.1	NM_032773	
LRRC72	100506049	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	7	16598540	16598540	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:16598540A>G	ENST00000401542.2	+	5	400	c.343A>G	c.(343-345)Ata>Gta	p.I115V		NM_001195280.1	NP_001182209.1	A6NJI9	LRC72_HUMAN	leucine rich repeat containing 72	115																	TTCATTGCATATACTCCTGCT	0.284																																					p.I115V		.											.	.	.	0			c.A343G						.																																			SO:0001583	missense	100506049	exon5			TTGCATATACTCC		CCDS56464.1	7p21.1	2011-10-07			ENSG00000205858	ENSG00000205858			42972	protein-coding gene	gene with protein product							Standard	NM_001195280		Approved		uc022aaf.1	A6NJI9	OTTHUMG00000152446	ENST00000401542.2:c.343A>G	7.37:g.16598540A>G	ENSP00000384971:p.Ile115Val	158.0	0.0		300.0	69.0	NM_001195280		Missense_Mutation	SNP	ENST00000401542.2	37	CCDS56464.1	.	.	.	.	.	.	.	.	.	.	A	0.381	-0.928951	0.02359	.	.	ENSG00000205858	ENST00000401542	T	0.53857	0.6	5.67	2.0	0.26442	.	.	.	.	.	T	0.35941	0.0949	N	0.20445	0.575	0.09310	N	1	.	.	.	.	.	.	T	0.23119	-1.0197	7	0.24483	T	0.36	-5.7839	8.0372	0.30499	0.7722:0.0:0.2278:0.0	.	.	.	.	V	115	ENSP00000384971:I115V	ENSP00000384971:I115V	I	+	1	0	AC005014.4	16565065	0.024000	0.19004	0.003000	0.11579	0.031000	0.12232	0.203000	0.17315	0.167000	0.19631	-0.441000	0.05720	ATA	.		0.284	LRRC72-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326249.2		
LTBP1	4052	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	33246001	33246001	+	Silent	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:33246001T>C	ENST00000404816.2	+	3	944	c.591T>C	c.(589-591)aaT>aaC	p.N197N	LTBP1_ENST00000354476.3_Silent_p.N197N			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	197	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CATGTCAGAATGGAGGGATGT	0.483																																					p.N197N		.											.	LTBP1	230	0			c.T591C						.						197.0	202.0	200.0					2																	33246001		2202	4298	6500	SO:0001819	synonymous_variant	4052	exon3			TCAGAATGGAGGG		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.591T>C	2.37:g.33246001T>C		85.0	0.0		133.0	8.0	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	ENST00000404816.2	37	CCDS33177.2																																																																																			.		0.483	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
MAN1C1	57134	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	25944335	25944335	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:25944335G>A	ENST00000374332.4	+	1	377	c.47G>A	c.(46-48)gGg>gAg	p.G16E	MAN1C1_ENST00000263979.3_5'Flank	NM_020379.2	NP_065112.1	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1	16					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(7)|pancreas(1)|prostate(1)|skin(2)	25		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		TCCCCGTGGGGGCTGCGGCTG	0.692																																					p.G16E		.											.	MAN1C1	91	0			c.G47A						.						14.0	17.0	16.0					1																	25944335		2173	4257	6430	SO:0001583	missense	57134	exon1			CGTGGGGGCTGCG	AF261655	CCDS265.1	1p35	2008-02-05			ENSG00000117643	ENSG00000117643			19080	protein-coding gene	gene with protein product						10915796	Standard	XM_005245945		Approved	HMIC	uc001bkm.2	Q9NR34	OTTHUMG00000004417	ENST00000374332.4:c.47G>A	1.37:g.25944335G>A	ENSP00000363452:p.Gly16Glu	69.0	0.0		53.0	20.0	NM_020379	A6NNE2|B2RNP2|Q9Y545	Missense_Mutation	SNP	ENST00000374332.4	37	CCDS265.1	.	.	.	.	.	.	.	.	.	.	g	21.8	4.196335	0.78902	.	.	ENSG00000117643	ENST00000374332	D	0.98280	-4.84	3.83	2.88	0.33553	.	0.000000	0.46758	U	0.000272	D	0.96800	0.8955	L	0.29908	0.895	0.80722	D	1	D	0.63880	0.993	P	0.57371	0.819	D	0.95174	0.8293	10	0.46703	T	0.11	.	9.1786	0.37127	0.0:0.2226:0.7774:0.0	.	16	Q9NR34	MA1C1_HUMAN	E	16	ENSP00000363452:G16E	ENSP00000363452:G16E	G	+	2	0	MAN1C1	25816922	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	2.847000	0.48270	0.790000	0.33803	0.546000	0.68486	GGG	.		0.692	MAN1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012828.3	NM_020379	
MARCH6	10299	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	10403536	10403536	+	Silent	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr5:10403536T>A	ENST00000274140.5	+	15	1347	c.1215T>A	c.(1213-1215)acT>acA	p.T405T	MARCH6_ENST00000449913.2_Silent_p.T357T|MARCH6_ENST00000510792.1_Silent_p.T103T|MARCH6_ENST00000503788.1_Silent_p.T300T	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	405					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						TTGATGCTACTCTGAAAGATC	0.413																																					p.T405T		.											.	MARCH6	501	0			c.T1215A						.						139.0	127.0	131.0					5																	10403536		2203	4300	6503	SO:0001819	synonymous_variant	10299	exon15			TGCTACTCTGAAA	AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.1215T>A	5.37:g.10403536T>A		108.0	0.0		176.0	12.0	NM_005885	A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Silent	SNP	ENST00000274140.5	37	CCDS34135.1																																																																																			.		0.413	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366919.2	NM_005885	
MGAM	8972	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	141764227	141764227	+	Silent	SNP	T	T	C	rs3087317	byFrequency	TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:141764227T>C	ENST00000549489.2	+	37	4484	c.4389T>C	c.(4387-4389)tgT>tgC	p.C1463C	MGAM_ENST00000475668.2_Silent_p.C1463C	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1463	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AGACCCTTTGTATGGAGAGTC	0.567													N|||	8	0.00159744	0.0045	0.0	5008	,	,		18881	0.0		0.0	False		,,,				2504	0.002				p.C1463C		.											.	MGAM	70	0			c.T4389C						.						33.0	35.0	35.0					7																	141764227		1968	4170	6138	SO:0001819	synonymous_variant	8972	exon37			CCTTTGTATGGAG	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4389T>C	7.37:g.141764227T>C		102.0	0.0		158.0	11.0	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000549489.2	37	CCDS47727.1																																																																																			.		0.567	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
MYBBP1A	10514	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	4446343	4446343	+	Silent	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:4446343G>A	ENST00000254718.4	-	20	3063	c.2757C>T	c.(2755-2757)acC>acT	p.T919T	MYBBP1A_ENST00000381556.2_Silent_p.T919T			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	919					cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						GGTAGAGGGCGGTGGGGGAGT	0.667																																					p.T919T		.											.	MYBBP1A	92	0			c.C2757T						.						50.0	59.0	56.0					17																	4446343		2203	4300	6503	SO:0001819	synonymous_variant	10514	exon20			GAGGGCGGTGGGG	AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.2757C>T	17.37:g.4446343G>A		54.0	0.0		85.0	7.0	NM_014520	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Silent	SNP	ENST00000254718.4	37	CCDS11046.1																																																																																			.		0.667	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207488.2	NM_014520	
NCOA6	23054	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	33334661	33334661	+	Missense_Mutation	SNP	T	T	G	rs17092079	byFrequency	TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr20:33334661T>G	ENST00000374796.2	-	11	5434	c.2864A>C	c.(2863-2865)aAc>aCc	p.N955T	NCOA6_ENST00000359003.2_Missense_Mutation_p.N955T			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	955	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.		N -> S (in dbSNP:rs17092079). {ECO:0000269|PubMed:10567404, ECO:0000269|PubMed:10681503, ECO:0000269|PubMed:10823961, ECO:0000269|PubMed:10866662, ECO:0000269|PubMed:8724849}.		brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						GTTATCCAAGTTAATTCCTTG	0.418																																					p.N955T		.											.	NCOA6	292	0			c.A2864C						.						93.0	91.0	92.0					20																	33334661		2203	4300	6503	SO:0001583	missense	23054	exon10			TCCAAGTTAATTC	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.2864A>C	20.37:g.33334661T>G	ENSP00000363929:p.Asn955Thr	59.0	0.0		58.0	6.0	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	37	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.939720	0.73557	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.23552	1.9;1.9	5.89	4.73	0.59995	.	0.163888	0.42420	D	0.000713	T	0.14227	0.0344	N	0.19112	0.55	0.36170	P	0.15127199999999996	B	0.22346	0.068	B	0.13407	0.009	T	0.12218	-1.0556	9	0.26408	T	0.33	-6.7525	7.6213	0.28187	0.0:0.0698:0.2543:0.6758	.	955	Q14686	NCOA6_HUMAN	T	955	ENSP00000363929:N955T;ENSP00000351894:N955T	ENSP00000351894:N955T	N	-	2	0	NCOA6	32798322	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.065000	0.30592	2.246000	0.74042	0.533000	0.62120	AAC	T|0.927;C|0.073		0.418	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
NEFH	4744	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	29885446	29885446	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr22:29885446C>A	ENST00000310624.6	+	4	1850	c.1817C>A	c.(1816-1818)tCc>tAc	p.S606Y		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	606	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AAGGCCAAGtccccagtgaag	0.562																																					p.S606Y		.											.	NEFH	90	0			c.C1817A						.						66.0	63.0	64.0					22																	29885446		2203	4300	6503	SO:0001583	missense	4744	exon4			CCAAGTCCCCAGT		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1817C>A	22.37:g.29885446C>A	ENSP00000311997:p.Ser606Tyr	155.0	0.0		217.0	61.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.457677	0.43634	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	T	0.42900	0.96	5.81	4.79	0.61399	.	0.137016	0.34088	N	0.004264	T	0.55289	0.1911	M	0.68952	2.095	0.33210	D	0.553233	D	0.71674	0.998	D	0.66196	0.942	T	0.67280	-0.5710	10	0.87932	D	0	.	6.2363	0.20764	0.1565:0.6961:0.0:0.1474	.	606	P12036	NFH_HUMAN	Y	606	ENSP00000311997:S606Y	ENSP00000311997:S606Y	S	+	2	0	NEFH	28215446	0.134000	0.22483	0.984000	0.44739	0.598000	0.36846	1.971000	0.40530	2.747000	0.94245	0.650000	0.86243	TCC	.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NFASC	23114	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	204970404	204970404	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:204970404G>C	ENST00000401399.1	+	25	3325	c.3126G>C	c.(3124-3126)gaG>gaC	p.E1042D	NFASC_ENST00000338515.6_Intron|NFASC_ENST00000367171.4_Missense_Mutation_p.E1134D|NFASC_ENST00000513543.1_Intron|NFASC_ENST00000367170.4_Missense_Mutation_p.E1070D|NFASC_ENST00000367172.4_Missense_Mutation_p.E1149D|NFASC_ENST00000495396.1_Intron|NFASC_ENST00000367169.4_Intron|NFASC_ENST00000404076.1_Intron|NFASC_ENST00000404907.1_Intron|NFASC_ENST00000339876.6_Missense_Mutation_p.E1042D|NFASC_ENST00000338586.6_Intron|NFASC_ENST00000539706.1_Intron|NFASC_ENST00000360049.4_Intron			O94856	NFASC_HUMAN	neurofascin	1149	Thr-rich.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TTGTGGTTGAGTACATCGACA	0.562																																					p.E1042D		.											.	NFASC	139	0			c.G3126C						.						71.0	61.0	64.0					1																	204970404		1567	3582	5149	SO:0001583	missense	23114	exon26			GGTTGAGTACATC	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.3126G>C	1.37:g.204970404G>C	ENSP00000385637:p.Glu1042Asp	198.0	2.0		297.0	25.0	NM_001005388	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	37	CCDS53460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.99|19.99	3.927944|3.927944	0.73327|0.73327	.|.	.|.	ENSG00000163531|ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000339876;ENST00000401399|ENST00000413225	T;T;T;T;T|.	0.58652|.	0.32;0.32;0.32;0.32;0.32|.	5.39|5.39	5.39|5.39	0.77823|0.77823	.|.	0.114947|.	0.38492|.	N|.	0.001677|.	T|T	0.76891|0.76891	0.4051|0.4051	M|M	0.74647|0.74647	2.275|2.275	0.80722|0.80722	D|D	1|1	P|.	0.39181|.	0.663|.	B|.	0.43331|.	0.416|.	T|T	0.76361|0.76361	-0.2987|-0.2987	10|5	0.25751|.	T|.	0.34|.	.|.	18.7791|18.7791	0.91924|0.91924	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1042|.	O94856-9|.	.|.	D|L	1149;1134;1070;1042;1042|89	ENSP00000356140:E1149D;ENSP00000356139:E1134D;ENSP00000356138:E1070D;ENSP00000344786:E1042D;ENSP00000385637:E1042D|.	ENSP00000344786:E1042D|.	E|V	+|+	3|1	2|0	NFASC|NFASC	203237027|203237027	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.774000|6.774000	0.75012|0.75012	2.537000|2.537000	0.85549|0.85549	0.655000|0.655000	0.94253|0.94253	GAG|GTA	.		0.562	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
NFE2L2	4780	hgsc.bcm.edu;broad.mit.edu	37	2	178098968	178098968	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:178098968T>G	ENST00000397062.3	-	2	631	c.77A>C	c.(76-78)cAa>cCa	p.Q26P	NFE2L2_ENST00000446151.2_Missense_Mutation_p.Q10P|NFE2L2_ENST00000397063.4_Missense_Mutation_p.Q10P|NFE2L2_ENST00000464747.1_Missense_Mutation_p.Q10P|NFE2L2_ENST00000423513.1_Missense_Mutation_p.Q10P	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	26					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q26P(1)|p.Q26L(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ATCTATATCTTGCCTCCAAAG	0.348			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.Q26P		.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	.	NFE2L2	90	2	Substitution - Missense(2)	lung(2)	c.A77C						.						59.0	53.0	55.0					2																	178098968		1842	4098	5940	SO:0001583	missense	4780	exon2			ATATCTTGCCTCC		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.77A>C	2.37:g.178098968T>G	ENSP00000380252:p.Gln26Pro	34.0	0.0		64.0	4.0	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	37	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	T	19.38	3.816192	0.70912	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4;1.4;1.4	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.66287	0.2774	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	0.999;0.998;1.0;0.999	D;D;D;D	0.85130	0.996;0.986;0.997;0.996	T	0.72959	-0.4133	10	0.87932	D	0	.	16.098	0.81144	0.0:0.0:0.0:1.0	.	10;10;10;26	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	P	10;26;10;10;10;10;10	ENSP00000380253:Q10P;ENSP00000380252:Q26P;ENSP00000411575:Q10P;ENSP00000391590:Q10P;ENSP00000400073:Q10P;ENSP00000412191:Q10P;ENSP00000410015:Q10P	ENSP00000380252:Q26P	Q	-	2	0	NFE2L2	177807214	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.698000	0.84413	2.210000	0.71456	0.460000	0.39030	CAA	.		0.348	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
NFYA	4800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	41048594	41048594	+	Silent	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr6:41048594G>A	ENST00000341376.6	+	3	321	c.120G>A	c.(118-120)caG>caA	p.Q40Q	NFYA_ENST00000353205.5_Intron|OARD1_ENST00000480585.1_Intron	NM_002505.4	NP_002496.1	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha	40	Gln-rich.				cellular lipid metabolic process (GO:0044255)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|large_intestine(4)|lung(2)|urinary_tract(1)	9	Ovarian(28;0.0418)|Colorectal(47;0.196)					CTGAGGCCCAGGTGGCATCCG	0.532																																					p.Q40Q		.											.	NFYA	226	0			c.G120A						.						103.0	95.0	98.0					6																	41048594		2203	4300	6503	SO:0001819	synonymous_variant	4800	exon3			GGCCCAGGTGGCA		CCDS4849.1, CCDS4850.1	6p21.3	2008-11-11			ENSG00000001167	ENSG00000001167			7804	protein-coding gene	gene with protein product		189903				1774067, 9612081	Standard	NM_002505		Approved	HAP2, CBF-B, NF-YA	uc003opo.3	P23511	OTTHUMG00000014669	ENST00000341376.6:c.120G>A	6.37:g.41048594G>A		70.0	0.0		134.0	42.0	NM_002505	Q8IXU0	Silent	SNP	ENST00000341376.6	37	CCDS4849.1																																																																																			.		0.532	NFYA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040496.1		
NKX3-1	4824	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	23538852	23538852	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr8:23538852G>A	ENST00000380871.4	-	2	624	c.587C>T	c.(586-588)tCt>tTt	p.S196F	NKX3-1_ENST00000523261.1_Missense_Mutation_p.S121F	NM_006167.3	NP_006158.2	Q99801	NKX31_HUMAN	NK3 homeobox 1	196				S -> F (in Ref. 2; AAB38747). {ECO:0000305}.	activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|androgen receptor signaling pathway (GO:0030521)|branching involved in prostate gland morphogenesis (GO:0060442)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to drug (GO:0035690)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to steroid hormone stimulus (GO:0071383)|cellular response to tumor necrosis factor (GO:0071356)|dorsal aorta development (GO:0035907)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|heart development (GO:0007507)|male gonad development (GO:0008584)|metanephros development (GO:0001656)|mitotic cell cycle arrest (GO:0071850)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of transcription, DNA-templated (GO:0045892)|pharyngeal system development (GO:0060037)|positive regulation of androgen secretion (GO:2000836)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell death (GO:0010942)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of gene expression (GO:0010628)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein kinase B signaling (GO:0043491)|regulation of transcription, DNA-templated (GO:0006355)|response to testosterone (GO:0033574)|salivary gland development (GO:0007431)|somitogenesis (GO:0001756)|steroid hormone mediated signaling pathway (GO:0043401)	intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|core promoter binding (GO:0001047)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|histone deacetylase binding (GO:0042826)|protein kinase activator activity (GO:0030295)|protein self-association (GO:0043621)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(3)|lung(4)|prostate(5)|skin(2)	14		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)		GGCCGGCAAAGAGGAGTGCTT	0.557																																					p.S196F		.											.	NKX3-1	90	0			c.C587T						.						102.0	103.0	103.0					8																	23538852		2203	4300	6503	SO:0001583	missense	4824	exon2			GGCAAAGAGGAGT		CCDS6042.1, CCDS59095.1	8p21.2	2012-03-09	2007-07-09	2002-10-04	ENSG00000167034	ENSG00000167034		"""Homeoboxes / ANTP class : NKL subclass"""	7838	protein-coding gene	gene with protein product		602041	"""NK homeobox (Drosophila), family 3, A"", ""NK3 transcription factor related, locus 1 (Drosophila)"""	NKX3A		9226374	Standard	NM_006167		Approved	NKX3.1, BAPX2	uc011kzx.2	Q99801	OTTHUMG00000097851	ENST00000380871.4:c.587C>T	8.37:g.23538852G>A	ENSP00000370253:p.Ser196Phe	59.0	1.0		38.0	18.0	NM_006167	O15465|Q9H2P4|Q9H2P5|Q9H2P6|Q9H2P7|Q9HBG0	Missense_Mutation	SNP	ENST00000380871.4	37	CCDS6042.1	.	.	.	.	.	.	.	.	.	.	G	12.03	1.816266	0.32145	.	.	ENSG00000167034	ENST00000380871;ENST00000300332;ENST00000523261	D;D	0.92099	-2.83;-2.97	5.86	4.98	0.66077	.	1.895430	0.02917	N	0.137457	D	0.94115	0.8113	L	0.57536	1.79	0.09310	N	1	D	0.54397	0.966	P	0.50440	0.641	T	0.82900	-0.0228	10	0.51188	T	0.08	.	14.7388	0.69437	0.0:0.1456:0.8544:0.0	.	196	Q99801	NKX31_HUMAN	F	196;152;121	ENSP00000370253:S196F;ENSP00000429729:S121F	ENSP00000300332:S152F	S	-	2	0	NKX3-1	23594797	0.064000	0.20934	0.017000	0.16124	0.050000	0.14768	2.678000	0.46900	1.463000	0.47967	0.655000	0.94253	TCT	.		0.557	NKX3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215141.2		
NPL	80896	hgsc.bcm.edu;broad.mit.edu	37	1	182794948	182794948	+	Silent	SNP	C	C	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:182794948C>G	ENST00000367553.1	+	11	815	c.771C>G	c.(769-771)gtC>gtG	p.V257V	NPL_ENST00000367554.3_Silent_p.V238V|NPL_ENST00000258317.2_Silent_p.V257V|NPL_ENST00000463899.1_3'UTR|NPL_ENST00000367552.2_Silent_p.V213V|NPL_ENST00000367555.1_Silent_p.V213V	NM_001200056.1|NM_030769.2	NP_001186985.1|NP_110396.1	Q9BXD5	NPL_HUMAN	N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)	257					carbohydrate metabolic process (GO:0005975)|N-acetylneuraminate catabolic process (GO:0019262)	cytoplasm (GO:0005737)	N-acetylneuraminate lyase activity (GO:0008747)			breast(1)|central_nervous_system(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(1)|stomach(1)	15						ACTTTGTTGTCAAACTAGGTA	0.348																																					p.S229X		.											.	NPL	92	0			c.C686G						.						154.0	162.0	159.0					1																	182794948		2203	4300	6503	SO:0001819	synonymous_variant	80896	exon11			TGTTGTCAAACTA	AF338436	CCDS1350.1, CCDS55666.1, CCDS55667.1, CCDS72990.1	1q25	2010-11-25	2003-09-16	2003-09-17	ENSG00000135838	ENSG00000135838	4.1.3.3		16781	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 1 (E. coli)"""	611412	"""chromosome 1 open reading frame 13"""	C1orf13		11318611	Standard	NM_001200056		Approved	NPL1, DHDPS1	uc009wyb.3	Q9BXD5	OTTHUMG00000035321	ENST00000367553.1:c.771C>G	1.37:g.182794948C>G		20.0	0.0		44.0	5.0	NM_001200052	B2R839|Q4G0Q8|Q4G0Z2|Q64L88|Q6PEL0	Nonsense_Mutation	SNP	ENST00000367553.1	37	CCDS1350.1																																																																																			.		0.348	NPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085463.1	NM_030769	
NLRP3	114548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	247599337	247599337	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:247599337A>G	ENST00000336119.3	+	6	3310	c.2564A>G	c.(2563-2565)cAt>cGt	p.H855R	NLRP3_ENST00000366497.2_Intron|NLRP3_ENST00000391827.2_Missense_Mutation_p.H798R|NLRP3_ENST00000391828.3_Missense_Mutation_p.H855R|NLRP3_ENST00000348069.2_Intron|NLRP3_ENST00000366496.2_Intron	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	855					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGCACCAGCCATTCCCTGACC	0.483																																					p.H855R		.											.	NLRP3	674	0			c.A2564G						.						128.0	111.0	117.0					1																	247599337		2203	4300	6503	SO:0001583	missense	114548	exon6			CCAGCCATTCCCT	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2564A>G	1.37:g.247599337A>G	ENSP00000337383:p.His855Arg	138.0	0.0		277.0	48.0	NM_004895	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	a	0.828	-0.746385	0.03065	.	.	ENSG00000162711	ENST00000391828;ENST00000336119;ENST00000391827	T;T;T	0.45668	0.89;0.89;0.89	3.63	-4.55	0.03441	.	1.030140	0.07791	N	0.954965	T	0.16041	0.0386	N	0.04373	-0.215	0.09310	N	1	B;B;B	0.12013	0.0;0.0;0.005	B;B;B	0.04013	0.0;0.0;0.001	T	0.20974	-1.0259	10	0.20046	T	0.44	.	5.4132	0.16360	0.3316:0.2976:0.3708:0.0	.	835;798;855	B7ZKS9;Q96P20-4;Q96P20	.;.;NALP3_HUMAN	R	855;855;798	ENSP00000375704:H855R;ENSP00000337383:H855R;ENSP00000375703:H798R	ENSP00000337383:H855R	H	+	2	0	NLRP3	245665960	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.700000	0.05081	-1.155000	0.02822	-2.766000	0.00121	CAT	.		0.483	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
NRXN1	9378	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	50464017	50464017	+	Silent	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:50464017C>A	ENST00000406316.2	-	18	4932	c.3456G>T	c.(3454-3456)ctG>ctT	p.L1152L	NRXN1_ENST00000402717.3_Silent_p.L1144L|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000406859.3_Silent_p.L1152L|NRXN1_ENST00000404971.1_Silent_p.L1192L|NRXN1_ENST00000401669.2_Silent_p.L1152L|NRXN1_ENST00000342183.5_Silent_p.L117L|NRXN1_ENST00000405472.3_Silent_p.L1144L|NRXN1_ENST00000401710.1_Silent_p.L170L	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1152	Laminin G-like 6. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			AACCTATGGCCAGTCTGTCTG	0.468																																					p.L1192L		.											.	NRXN1	92	0			c.G3576T						.						132.0	118.0	123.0					2																	50464017		2203	4300	6503	SO:0001819	synonymous_variant	9378	exon19			TATGGCCAGTCTG	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3456G>T	2.37:g.50464017C>A		196.0	1.0		268.0	71.0	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	37	CCDS54360.1																																																																																			.		0.468	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
NUDT12	83594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	102895039	102895039	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr5:102895039C>T	ENST00000230792.2	-	3	433	c.337G>A	c.(337-339)Gaa>Aaa	p.E113K	NUDT12_ENST00000507423.1_Missense_Mutation_p.E95K	NM_031438.2	NP_113626.1	Q9BQG2	NUD12_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 12	113					NAD catabolic process (GO:0019677)|NADP catabolic process (GO:0006742)	nucleus (GO:0005634)|peroxisome (GO:0005777)	metal ion binding (GO:0046872)|NAD+ diphosphatase activity (GO:0000210)|NADH pyrophosphatase activity (GO:0035529)			endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|urinary_tract(1)	12		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		TCTTCCACTTCATTCGTTAGG	0.398																																					p.E113K		.											.	NUDT12	90	0			c.G337A						.						62.0	66.0	65.0					5																	102895039		2202	4298	6500	SO:0001583	missense	83594	exon3			CCACTTCATTCGT	AL136592	CCDS4096.1, CCDS75284.1	5q15	2013-01-10			ENSG00000112874	ENSG00000112874		"""Nudix motif containing"", ""Ankyrin repeat domain containing"""	18826	protein-coding gene	gene with protein product	"""nucleoside diphosphate linked moiety X-type motif 12"""	609232				11230166	Standard	XM_005272095		Approved	DKFZP761I172	uc003koi.3	Q9BQG2	OTTHUMG00000128739	ENST00000230792.2:c.337G>A	5.37:g.102895039C>T	ENSP00000230792:p.Glu113Lys	67.0	0.0		143.0	35.0	NM_031438	B3KUW2|Q8TAL7	Missense_Mutation	SNP	ENST00000230792.2	37	CCDS4096.1	.	.	.	.	.	.	.	.	.	.	C	8.284	0.816167	0.16607	.	.	ENSG00000112874	ENST00000230792;ENST00000507423	T;T	0.16897	3.52;2.31	6.16	5.2	0.72013	Ankyrin repeat-containing domain (1);	0.896444	0.10080	N	0.718600	T	0.09069	0.0224	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.23332	-1.0191	10	0.13470	T	0.59	-6.0657	10.2597	0.43419	0.0:0.7645:0.1415:0.094	.	95;113	E7EM93;Q9BQG2	.;NUD12_HUMAN	K	113;95	ENSP00000230792:E113K;ENSP00000424521:E95K	ENSP00000230792:E113K	E	-	1	0	NUDT12	102922938	0.016000	0.18221	0.654000	0.29608	0.305000	0.27757	1.315000	0.33608	2.937000	0.99478	0.650000	0.86243	GAA	.		0.398	NUDT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250650.1	NM_031438	
NUFIP1	26747	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	45563368	45563368	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr13:45563368delG	ENST00000379161.4	-	1	250	c.204delC	c.(202-204)cccfs	p.P68fs	GPALPP1_ENST00000379151.4_5'Flank|GPALPP1_ENST00000361121.2_5'Flank|RP11-321C24.1_ENST00000437748.2_lincRNA	NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	68	Pro-rich.				box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		GGGCCTCCATGGGGGGCTGCG	0.672																																					p.P68fs		.											.	NUFIP1	90	0			c.204delC						.						15.0	18.0	17.0					13																	45563368		2198	4292	6490	SO:0001589	frameshift_variant	26747	exon1			CTCCATGGGGGGC	AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.204delC	13.37:g.45563368delG	ENSP00000368459:p.Pro68fs	39.0	0.0		38.0	11.0	NM_012345	Q8WVM5|Q96SG1	Frame_Shift_Del	DEL	ENST00000379161.4	37	CCDS9393.1																																																																																			.		0.672	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044755.2	NM_012345	
NUP133	55746	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	229596501	229596502	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:229596501_229596502insA	ENST00000261396.3	-	20	2791_2792	c.2700_2701insT	c.(2698-2703)tttctcfs	p.L901fs	NUP133_ENST00000537506.1_Frame_Shift_Ins_p.L885fs	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	901					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				CAACGGAAGAGAAAGTCTGAAA	0.337																																					p.L901fs		.											.	NUP133	271	0			c.2701_2702insT						.																																			SO:0001589	frameshift_variant	55746	exon20			GGAAGAGAAAGTC		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.2701dupT	1.37:g.229596504_229596504dupA	ENSP00000261396:p.Leu901fs	65.0	0.0		130.0	33.0	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Frame_Shift_Ins	INS	ENST00000261396.3	37	CCDS1579.1																																																																																			.		0.337	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
NUP188	23511	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	131762026	131762026	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr9:131762026A>T	ENST00000372577.2	+	34	3806	c.3785A>T	c.(3784-3786)aAg>aTg	p.K1262M		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1262					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						ACAGAGGACAAGGACAGCATG	0.587																																					p.K1262M		.											.	NUP188	207	0			c.A3785T						.						90.0	76.0	81.0					9																	131762026		2203	4300	6503	SO:0001583	missense	23511	exon34			AGGACAAGGACAG	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.3785A>T	9.37:g.131762026A>T	ENSP00000361658:p.Lys1262Met	136.0	0.0		138.0	9.0	NM_015354	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.376764	0.82682	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.35236	1.32	5.28	5.28	0.74379	.	0.052075	0.85682	D	0.000000	T	0.47764	0.1463	M	0.65975	2.015	0.52099	D	0.999947	B;D	0.58620	0.233;0.983	B;P	0.50231	0.062;0.635	T	0.53401	-0.8444	10	0.72032	D	0.01	-1.0364	14.3743	0.66862	1.0:0.0:0.0:0.0	.	595;1262	E9PET9;Q5SRE5	.;NU188_HUMAN	M	1151;1262	ENSP00000361658:K1262M	ENSP00000349125:K1151M	K	+	2	0	NUP188	130801847	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	6.259000	0.72494	2.000000	0.58554	0.460000	0.39030	AAG	.		0.587	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		
NUP93	9688	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	56868090	56868090	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr16:56868090C>T	ENST00000308159.5	+	14	1709	c.1588C>T	c.(1588-1590)Cgg>Tgg	p.R530W	NUP93_ENST00000542526.1_Missense_Mutation_p.R407W|NUP93_ENST00000569842.1_Missense_Mutation_p.R530W|NUP93_ENST00000564887.1_Missense_Mutation_p.R407W	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	530					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						GAACTTCGTGCGGCTCCTCAT	0.562																																					p.R530W	Colon(33;610 796 1305 1705 38917)	.											.	NUP93	205	0			c.C1588T						.						89.0	96.0	94.0					16																	56868090		2198	4300	6498	SO:0001583	missense	9688	exon14			TTCGTGCGGCTCC	D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.1588C>T	16.37:g.56868090C>T	ENSP00000310668:p.Arg530Trp	80.0	1.0		91.0	25.0	NM_014669	B3KPQ8|Q14705	Missense_Mutation	SNP	ENST00000308159.5	37	CCDS10769.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.319716	0.81469	.	.	ENSG00000102900	ENST00000308159;ENST00000542526	T;T	0.56275	0.47;0.47	5.91	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.74898	0.3777	M	0.84219	2.685	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.79678	-0.1703	10	0.66056	D	0.02	-17.8071	16.5238	0.84324	0.1318:0.8682:0.0:0.0	.	530	Q8N1F7	NUP93_HUMAN	W	530;407	ENSP00000310668:R530W;ENSP00000440235:R407W	ENSP00000310668:R530W	R	+	1	2	NUP93	55425591	1.000000	0.71417	0.996000	0.52242	0.799000	0.45148	2.498000	0.45363	1.475000	0.48197	0.655000	0.94253	CGG	.		0.562	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257058.4	NM_014669	
NXF5	55998	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	101095774	101095774	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chrX:101095774G>C	ENST00000361708.2	-	9	933	c.574C>G	c.(574-576)Ctc>Gtc	p.L192V	NXF5_ENST00000473265.2_Missense_Mutation_p.L192V|NXF5_ENST00000537026.1_Missense_Mutation_p.L192V			Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	192					mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|skin(1)	30						TTTTTGGAGAGATTCAGGGTC	0.502																																					p.L192V		.											.	NXF5	204	0			c.C574G						.						15.0	14.0	15.0					X																	101095774		1638	3355	4993	SO:0001583	missense	55998	exon9			TGGAGAGATTCAG	AJ277654	CCDS14491.1, CCDS14491.2	Xq22	2008-07-28			ENSG00000126952	ENSG00000126952			8075	protein-coding gene	gene with protein product		300319				11566096	Standard	NM_032946		Approved		uc011mrk.1	Q9H1B4	OTTHUMG00000022042	ENST00000361708.2:c.574C>G	X.37:g.101095774G>C	ENSP00000355286:p.Leu192Val	234.0	0.0		293.0	54.0	NM_032946	A2RRM0|B1AV82|B1AV83|B1AV84|B1AV85|Q9H1B0|Q9H1B1|Q9H1B2|Q9H1B3	Missense_Mutation	SNP	ENST00000361708.2	37		.	.	.	.	.	.	.	.	.	.	.	16.37	3.104363	0.56291	.	.	ENSG00000126952	ENST00000537026;ENST00000473265;ENST00000361708	T;T;T	0.62639	0.01;0.01;0.01	2.05	2.05	0.26809	.	0.000000	0.64402	U	0.000005	T	0.74809	0.3765	M	0.75264	2.295	0.58432	D	0.999998	D	0.76494	0.999	D	0.87578	0.998	T	0.76895	-0.2790	10	0.87932	D	0	.	9.6628	0.39965	0.0:0.0:1.0:0.0	.	192	A2RRM0	.	V	192	ENSP00000442401:L192V;ENSP00000426978:L192V;ENSP00000355286:L192V	ENSP00000263032:L192V	L	-	1	0	NXF5	100982430	1.000000	0.71417	0.929000	0.37066	0.174000	0.22865	5.535000	0.67173	1.365000	0.46057	0.267000	0.19312	CTC	.		0.502	NXF5-201	KNOWN	basic	protein_coding	protein_coding			
NXPE2	120406	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	114577377	114577377	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:114577377A>C	ENST00000389586.4	+	6	1595	c.1405A>C	c.(1405-1407)Att>Ctt	p.I469L	NXPE2_ENST00000375475.5_Intron	NM_182495.5	NP_872301.2	Q96DL1	NXPE2_HUMAN	neurexophilin and PC-esterase domain family, member 2	469						integral component of membrane (GO:0016021)											GGCCATCAATATTCAAAAGGC	0.443																																					p.I469L		.											.	.	.	0			c.A1405C						.						69.0	57.0	61.0					11																	114577377		692	1591	2283	SO:0001583	missense	120406	exon6			ATCAATATTCAAA	AK057953	CCDS44738.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000204361	ENSG00000204361			26331	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member B"""	FAM55B			Standard	NM_182495		Approved	FLJ25224	uc009yyy.2	Q96DL1	OTTHUMG00000168293	ENST00000389586.4:c.1405A>C	11.37:g.114577377A>C	ENSP00000374237:p.Ile469Leu	125.0	0.0		147.0	8.0	NM_182495	Q2NKI8	Missense_Mutation	SNP	ENST00000389586.4	37	CCDS44738.1	.	.	.	.	.	.	.	.	.	.	A	16.46	3.128198	0.56721	.	.	ENSG00000204361	ENST00000389586	T	0.20881	2.04	5.37	-8.12	0.01078	.	0.463681	0.15942	N	0.237143	T	0.14141	0.0342	L	0.54323	1.7	0.53688	D	0.999979	P	0.36753	0.568	B	0.34093	0.175	T	0.09143	-1.0688	10	0.51188	T	0.08	.	9.6192	0.39710	0.1837:0.0:0.6095:0.2068	.	469	Q96DL1	FA55B_HUMAN	L	469	ENSP00000374237:I469L	ENSP00000374237:I469L	I	+	1	0	FAM55B	114082587	0.025000	0.19082	0.017000	0.16124	0.996000	0.88848	-0.015000	0.12634	-1.517000	0.01780	0.454000	0.30748	ATT	.		0.443	NXPE2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399181.1	NM_182495	
OBSL1	23363	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	220432567	220432567	+	Silent	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:220432567C>A	ENST00000404537.1	-	3	1463	c.1407G>T	c.(1405-1407)ccG>ccT	p.P469P	OBSL1_ENST00000265318.4_Silent_p.P469P|OBSL1_ENST00000373876.1_Silent_p.P469P|OBSL1_ENST00000491370.1_5'Flank|OBSL1_ENST00000289656.3_Silent_p.P56P|OBSL1_ENST00000603926.1_Silent_p.P469P|OBSL1_ENST00000373873.4_Silent_p.P469P	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	469					cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		GGCAGATGACCGGCAGCTCCT	0.632																																					p.P469P		.											.	OBSL1	71	0			c.G1407T						.						44.0	49.0	47.0					2																	220432567		2152	4258	6410	SO:0001819	synonymous_variant	23363	exon3			GATGACCGGCAGC	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.1407G>T	2.37:g.220432567C>A		257.0	1.0		276.0	109.0	NM_001173431	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Silent	SNP	ENST00000404537.1	37	CCDS46520.1																																																																																			.		0.632	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1		
OLIG3	167826	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	137815097	137815097	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr6:137815097T>C	ENST00000367734.2	-	1	434	c.211A>G	c.(211-213)Aaa>Gaa	p.K71E		NM_175747.2	NP_786923.1	Q7RTU3	OLIG3_HUMAN	oligodendrocyte transcription factor 3	71					spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron migration (GO:0097476)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II transcription corepressor activity (GO:0001106)			endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	11	Breast(32;0.165)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)		TTCTTGATTTTGTACTTGCTG	0.597																																					p.K71E		.											.	OLIG3	68	0			c.A211G						.						122.0	108.0	113.0					6																	137815097		2203	4300	6503	SO:0001583	missense	167826	exon1			TGATTTTGTACTT	AK096362	CCDS5186.1	6q23.3	2013-05-21			ENSG00000177468	ENSG00000177468		"""Basic helix-loop-helix proteins"""	18003	protein-coding gene	gene with protein product		609323					Standard	NM_175747		Approved	Bhlhb7, bHLHe20	uc003qhp.1	Q7RTU3	OTTHUMG00000015657	ENST00000367734.2:c.211A>G	6.37:g.137815097T>C	ENSP00000356708:p.Lys71Glu	100.0	0.0		130.0	7.0	NM_175747	Q8N8Q0	Missense_Mutation	SNP	ENST00000367734.2	37	CCDS5186.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.002738	0.74932	.	.	ENSG00000177468	ENST00000367734	T	0.72505	-0.66	5.44	4.25	0.50352	.	0.000000	0.85682	D	0.000000	T	0.59985	0.2234	L	0.29908	0.895	0.58432	D	0.999997	D	0.63880	0.993	P	0.55923	0.787	T	0.65768	-0.6088	10	0.62326	D	0.03	-0.0868	11.6284	0.51160	0.1335:0.0:0.0:0.8665	.	71	Q7RTU3	OLIG3_HUMAN	E	71	ENSP00000356708:K71E	ENSP00000356708:K71E	K	-	1	0	OLIG3	137856790	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.182000	0.71995	0.850000	0.35239	0.482000	0.46254	AAA	.		0.597	OLIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042405.1	NM_175747	
OR13C8	138802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	107331510	107331510	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr9:107331510C>A	ENST00000335040.1	+	1	62	c.62C>A	c.(61-63)cCa>cAa	p.P21Q		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	21						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						TCTGCCCACCCAAAGCTCCAG	0.418																																					p.P21Q		.											.	OR13C8	70	0			c.C62A						.						158.0	158.0	158.0					9																	107331510		2203	4300	6503	SO:0001583	missense	138802	exon1			CCCACCCAAAGCT		CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.62C>A	9.37:g.107331510C>A	ENSP00000334068:p.Pro21Gln	51.0	0.0		55.0	11.0	NM_001004483	Q5VVG0|Q96R44	Missense_Mutation	SNP	ENST00000335040.1	37	CCDS35090.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.888628	0.52014	.	.	ENSG00000186943	ENST00000335040	T	0.00428	7.44	4.97	4.97	0.65823	.	0.000000	0.56097	D	0.000024	T	0.01092	0.0036	M	0.73753	2.245	0.31297	N	0.688721	D	0.67145	0.996	D	0.66196	0.942	T	0.37957	-0.9683	10	0.72032	D	0.01	.	16.1185	0.81325	0.0:1.0:0.0:0.0	.	21	Q8NGS7	O13C8_HUMAN	Q	21	ENSP00000334068:P21Q	ENSP00000334068:P21Q	P	+	2	0	OR13C8	106371331	0.000000	0.05858	0.997000	0.53966	0.724000	0.41520	-0.220000	0.09215	2.741000	0.93983	0.655000	0.94253	CCA	.		0.418	OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053480.1		
OR1C1	26188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	247921053	247921053	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:247921053C>A	ENST00000408896.2	-	1	929	c.656G>T	c.(655-657)gGa>gTa	p.G219V		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	219					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GAAGATAAGTCCATAAGATAC	0.483																																					p.G219V		.											.	OR1C1	91	0			c.G656T						.						55.0	54.0	54.0					1																	247921053		2021	4195	6216	SO:0001583	missense	26188	exon1			ATAAGTCCATAAG	X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.656G>T	1.37:g.247921053C>A	ENSP00000386138:p.Gly219Val	119.0	0.0		180.0	39.0	NM_012353	B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	ENST00000408896.2	37	CCDS41481.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.788307	0.00628	.	.	ENSG00000221888	ENST00000408896	T	0.00017	9.09	3.22	-2.25	0.06888	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.02368	-0.58	0.09310	N	1	B	0.10296	0.003	B	0.20184	0.028	T	0.03354	-1.1045	9	0.36615	T	0.2	.	12.9735	0.58525	0.8047:0.1953:0.0:0.0	.	219	Q15619	OR1C1_HUMAN	V	219	ENSP00000386138:G219V	ENSP00000386138:G219V	G	-	2	0	OR1C1	245987676	0.000000	0.05858	0.026000	0.17262	0.096000	0.18686	0.360000	0.20250	-0.166000	0.10890	-0.293000	0.09583	GGA	.		0.483	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1		
OR2Y1	134083	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	180166721	180166721	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr5:180166721A>C	ENST00000307832.2	-	1	378	c.338T>G	c.(337-339)gTg>gGg	p.V113G		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CACCAGGAGCACACACTCTGT	0.597																																					p.V113G		.											.	OR2Y1	68	0			c.T338G						.						75.0	63.0	67.0					5																	180166721		2203	4300	6503	SO:0001583	missense	134083	exon1			AGGAGCACACACT	AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.338T>G	5.37:g.180166721A>C	ENSP00000312403:p.Val113Gly	105.0	0.0		141.0	13.0	NM_001001657	B9EIP1|Q6IFB1|Q96R16	Missense_Mutation	SNP	ENST00000307832.2	37	CCDS34323.1	.	.	.	.	.	.	.	.	.	.	a	10.38	1.333295	0.24167	.	.	ENSG00000174339	ENST00000307832	T	0.01474	4.85	4.41	3.22	0.36961	GPCR, rhodopsin-like superfamily (1);	0.376195	0.19865	N	0.104328	T	0.04272	0.0118	L	0.46567	1.45	0.09310	N	1	D	0.56746	0.977	P	0.55577	0.779	T	0.27157	-1.0082	10	0.87932	D	0	.	8.7168	0.34416	0.83:0.0:0.0:0.17	.	113	Q8NGV0	OR2Y1_HUMAN	G	113	ENSP00000312403:V113G	ENSP00000312403:V113G	V	-	2	0	OR2Y1	180099327	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	0.998000	0.29744	0.800000	0.34041	0.418000	0.28097	GTG	.		0.597	OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368059.2	XM_068682	
PARP14	54625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	122418685	122418685	+	Silent	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:122418685A>T	ENST00000474629.2	+	6	1550	c.1284A>T	c.(1282-1284)acA>acT	p.T428T		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	428					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		AGTTTGATACACTTAAGGAGA	0.353																																					p.T428T		.											.	PARP14	525	0			c.A1284T						.						112.0	107.0	109.0					3																	122418685		1875	4112	5987	SO:0001819	synonymous_variant	54625	exon6			TGATACACTTAAG	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.1284A>T	3.37:g.122418685A>T		87.0	0.0		140.0	31.0	NM_017554	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Silent	SNP	ENST00000474629.2	37	CCDS46894.1																																																																																			.		0.353	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554	
PCDHGC3	5098	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140856170	140856170	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr5:140856170G>T	ENST00000308177.3	+	1	591	c.487G>T	c.(487-489)Gat>Tat	p.D163Y	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA12_ENST00000252085.3_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	163	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D163N(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACGATCCCGATGTGGGAAG	0.567																																					p.D163Y		.											.	PCDHGC3	24	2	Substitution - Missense(2)	urinary_tract(2)	c.G487T						.						53.0	56.0	55.0					5																	140856170		2203	4300	6503	SO:0001583	missense	5098	exon1			GATCCCGATGTGG	AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.487G>T	5.37:g.140856170G>T	ENSP00000312070:p.Asp163Tyr	197.0	2.0		274.0	27.0	NM_032402	O60622|Q08192|Q9Y5C4	Missense_Mutation	SNP	ENST00000308177.3	37	CCDS4261.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.156846	0.78114	.	.	ENSG00000240184	ENST00000308177	T	0.74737	-0.87	5.27	5.27	0.74061	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.93145	0.7817	H	0.99740	4.74	0.48452	D	0.999655	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96057	0.9036	9	0.87932	D	0	.	19.0821	0.93186	0.0:0.0:1.0:0.0	.	163;163	Q9UN70;Q9UN70-2	PCDGK_HUMAN;.	Y	163	ENSP00000312070:D163Y	ENSP00000312070:D163Y	D	+	1	0	PCDHGC3	140836354	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.652000	0.98499	2.722000	0.93159	0.655000	0.94253	GAT	.		0.567	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251808.2	NM_002588	
PCM1	5108	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	17815276	17815276	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr8:17815276A>G	ENST00000519253.1	+	13	2283	c.2032A>G	c.(2032-2034)Atg>Gtg	p.M678V	PCM1_ENST00000325083.8_Missense_Mutation_p.M678V|PCM1_ENST00000524226.1_Missense_Mutation_p.M679V			Q15154	PCM1_HUMAN	pericentriolar material 1	678					centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		TCTTGTTGCTATGGTACAGGT	0.323			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																p.M678V		.		Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	.	PCM1	742	0			c.A2032G						.						92.0	89.0	89.0					8																	17815276		1871	4116	5987	SO:0001583	missense	5108	exon13			GTTGCTATGGTAC		CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.2032A>G	8.37:g.17815276A>G	ENSP00000431099:p.Met678Val	98.0	0.0		69.0	8.0	NM_006197	Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Missense_Mutation	SNP	ENST00000519253.1	37		.	.	.	.	.	.	.	.	.	.	A	14.28	2.488814	0.44249	.	.	ENSG00000078674	ENST00000325083;ENST00000517730;ENST00000519253;ENST00000524226	T;T;T;T	0.28454	3.52;2.61;1.61;1.61	5.25	4.08	0.47627	.	0.000000	0.85682	D	0.000000	T	0.41143	0.1146	L	0.52364	1.645	0.80722	D	1	B;P;B;B	0.40834	0.433;0.73;0.433;0.433	B;P;B;B	0.53224	0.164;0.721;0.164;0.164	T	0.10543	-1.0625	10	0.30854	T	0.27	-9.2044	12.1868	0.54243	0.8718:0.0:0.0:0.1282	.	678;717;679;678	E7ETA6;E7EV93;E7EV56;Q15154	.;.;.;PCM1_HUMAN	V	678;717;678;679	ENSP00000327077:M678V;ENSP00000428131:M717V;ENSP00000431099:M678V;ENSP00000430521:M679V	ENSP00000327077:M678V	M	+	1	0	PCM1	17859556	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.609000	0.67661	1.074000	0.40909	0.477000	0.44152	ATG	.		0.323	PCM1-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374800.1	NM_006197	
PDCL2	132954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	56422846	56422846	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr4:56422846T>A	ENST00000295645.4	-	6	706	c.604A>T	c.(604-606)Ata>Tta	p.I202L		NM_152401.2	NP_689614.2	Q8N4E4	PDCL2_HUMAN	phosducin-like 2	202	Thioredoxin fold. {ECO:0000250}.									endometrium(1)|kidney(1)|lung(4)|ovary(1)	7	Lung NSC(11;0.00256)|Glioma(25;0.08)|all_epithelial(27;0.0863)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.69e-07)|Lung(4;1.03e-06)|Epithelial(7;0.00669)			TCAGTCTGTATTGCTCCAACT	0.318																																					p.I202L		.											.	.	.	0			c.A604T						.						99.0	87.0	91.0					4																	56422846		1835	4077	5912	SO:0001583	missense	132954	exon6			TCTGTATTGCTCC	BC034431	CCDS47059.1	4q12	2008-02-05			ENSG00000163440	ENSG00000163440			29524	protein-coding gene	gene with protein product		611676				12424248	Standard	NM_152401		Approved	GCPHLP	uc003hbb.3	Q8N4E4	OTTHUMG00000160674	ENST00000295645.4:c.604A>T	4.37:g.56422846T>A	ENSP00000295645:p.Ile202Leu	72.0	0.0		87.0	25.0	NM_152401	A8MWA2|B9ZVQ9	Missense_Mutation	SNP	ENST00000295645.4	37	CCDS47059.1	.	.	.	.	.	.	.	.	.	.	T	14.19	2.462565	0.43736	.	.	ENSG00000163440	ENST00000295645	T	0.27557	1.66	5.81	3.4	0.38934	Phosducin, thioredoxin-like domain (1);Thioredoxin-like fold (2);	0.077906	0.56097	D	0.000040	T	0.24044	0.0582	L	0.39566	1.225	0.35652	D	0.811824	B	0.12013	0.005	B	0.30401	0.115	T	0.18272	-1.0342	10	0.14252	T	0.57	-5.8095	8.1421	0.31089	0.0:0.2964:0.0:0.7036	.	202	Q8N4E4	PDCL2_HUMAN	L	202	ENSP00000295645:I202L	ENSP00000295645:I202L	I	-	1	0	PDCL2	56117603	0.969000	0.33509	1.000000	0.80357	0.995000	0.86356	0.763000	0.26517	0.475000	0.27415	0.528000	0.53228	ATA	.		0.318	PDCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361659.1	NM_152401	
PDLIM2	64236	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	22442575	22442575	+	Missense_Mutation	SNP	T	T	A	rs2294049		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr8:22442575T>A	ENST00000397760.4	+	5	761	c.361T>A	c.(361-363)Tcc>Acc	p.S121T	PDLIM2_ENST00000409417.1_Missense_Mutation_p.S121T|PDLIM2_ENST00000448520.1_3'UTR|PDLIM2_ENST00000397761.2_Missense_Mutation_p.S121T|PDLIM2_ENST00000339162.7_Missense_Mutation_p.S121T|PDLIM2_ENST00000308354.7_Missense_Mutation_p.S371T|PDLIM2_ENST00000265810.4_Missense_Mutation_p.S121T|PDLIM2_ENST00000409141.1_Missense_Mutation_p.S121T			Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 (mystique)	121	Ser-rich.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		CTTAAGGTCCTCCTACTCCAG	0.647																																					p.S371T		.											.	PDLIM2	90	0			c.T1111A						.						79.0	76.0	77.0					8																	22442575		2203	4300	6503	SO:0001583	missense	64236	exon5			AGGTCCTCCTACT	AY007729	CCDS34860.1, CCDS6032.1, CCDS34861.1, CCDS6032.2	8p21.3	2012-06-27			ENSG00000120913	ENSG00000120913			13992	protein-coding gene	gene with protein product		609722					Standard	NM_021630		Approved		uc003xby.4	Q96JY6	OTTHUMG00000164270	ENST00000397760.4:c.361T>A	8.37:g.22442575T>A	ENSP00000380867:p.Ser121Thr	192.0	0.0		192.0	12.0	NM_021630	D3DSR5|J3KNH4|Q7Z584|Q86WM8|Q8WZ29|Q9H4L9|Q9H7I2	Missense_Mutation	SNP	ENST00000397760.4	37		.	.	.	.	.	.	.	.	.	.	T	9.292	1.050862	0.19827	.	.	ENSG00000120913	ENST00000456545;ENST00000308354;ENST00000452226;ENST00000397760;ENST00000339162;ENST00000381194;ENST00000397761;ENST00000436754;ENST00000426493;ENST00000429812;ENST00000409141;ENST00000265810;ENST00000409417	T;T;T;T;T;T;T;T;T;T;T;T	0.15603	2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41	5.52	0.299	0.15771	.	0.278041	0.28821	N	0.014026	T	0.13243	0.0321	L	0.48362	1.52	0.19300	N	0.999979	P;P;P;P	0.40731	0.728;0.728;0.455;0.455	B;B;B;B	0.39339	0.297;0.168;0.081;0.081	T	0.13980	-1.0489	10	0.36615	T	0.2	-14.5621	7.1977	0.25862	0.0:0.0846:0.3846:0.5308	rs2294049;rs2294049	121;121;121;121	Q96JY6-3;Q96JY6-4;Q96JY6;C9JS55	.;.;PDLI2_HUMAN;.	T	121;371;121;121;121;121;121;121;121;121;121;121;121	ENSP00000401992:S121T;ENSP00000312634:S371T;ENSP00000394376:S121T;ENSP00000380867:S121T;ENSP00000342035:S121T;ENSP00000380868:S121T;ENSP00000397738:S121T;ENSP00000392920:S121T;ENSP00000407643:S121T;ENSP00000386868:S121T;ENSP00000265810:S121T;ENSP00000387084:S121T	ENSP00000265810:S121T	S	+	1	0	PDLIM2	22498520	0.234000	0.23783	0.167000	0.22817	0.236000	0.25371	0.037000	0.13840	-0.169000	0.10834	0.533000	0.62120	TCC	T|1.000;|0.000		0.647	PDLIM2-202	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000334167.1		
PDPR	55066	hgsc.bcm.edu;broad.mit.edu	37	16	70170122	70170122	+	Silent	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr16:70170122G>A	ENST00000288050.4	+	10	1980	c.1023G>A	c.(1021-1023)agG>agA	p.R341R	PDPR_ENST00000398122.3_Silent_p.R241R|PDPR_ENST00000568530.1_Silent_p.R341R|PDPR_ENST00000562100.1_3'UTR	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	341					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		CCCTTCTGAGGAGGATGCCAG	0.463																																					p.R341R		.											.	PDPR	135	0			c.G1023A						.						31.0	34.0	33.0					16																	70170122		1875	4116	5991	SO:0001819	synonymous_variant	55066	exon10			TCTGAGGAGGATG		CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.1023G>A	16.37:g.70170122G>A		148.0	0.0		158.0	7.0	NM_017990	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Silent	SNP	ENST00000288050.4	37	CCDS45520.1																																																																																			.		0.463	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434502.1	NM_017990	
PECR	55825	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	216946374	216946397	+	In_Frame_Del	DEL	CGATGCCCGTGGCCCCGCCGGTGA	CGATGCCCGTGGCCCCGCCGGTGA	-	rs370096306|rs201164160		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	CGATGCCCGTGGCCCCGCCGGTGA	CGATGCCCGTGGCCCCGCCGGTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:216946374_216946397delCGATGCCCGTGGCCCCGCCGGTGA	ENST00000265322.7	-	1	142_165	c.68_91delTCACCGGCGGGGCCACGGGCATCG	c.(67-93)gtcaccggcggggccacgggcatcgga>gga	p.VTGGATGI23del	TMEM169_ENST00000454545.1_5'Flank|TMEM169_ENST00000437356.2_5'Flank|TMEM169_ENST00000406027.2_5'Flank|PECR_ENST00000497889.1_5'UTR|TMEM169_ENST00000295658.4_5'Flank	NM_018441.5	NP_060911.2	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase	23					fatty acid biosynthetic process (GO:0006633)|oxidation-reduction process (GO:0055114)|phytol metabolic process (GO:0033306)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)			endometrium(2)|kidney(1)|liver(1)|lung(9)|stomach(1)	14		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	ATGGCTTTTCCGATGCCCGTGGCCCCGCCGGTGACGATGGCCAC	0.674																																					p.23_31del		.											.	PECR	90	0			c.68_91del						.																																			SO:0001651	inframe_deletion	55825	exon1			CTTTTCCGATGCC	AF119841	CCDS33375.1	2q35	2011-09-14			ENSG00000115425	ENSG00000115425	1.3.1.38	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18281	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 29C, member 1"""	605843				10811639, 11669066, 19027726	Standard	NM_018441		Approved	HSA250303, TERP, SDR29C1	uc002vft.3	Q9BY49	OTTHUMG00000154825	ENST00000265322.7:c.68_91delTCACCGGCGGGGCCACGGGCATCG	2.37:g.216946374_216946397delCGATGCCCGTGGCCCCGCCGGTGA	ENSP00000265322:p.Val23_Ile30del	184.0	0.0		227.0	42.0	NM_018441	B2RE42|Q53TC4|Q6IAK9|Q9NRD4|Q9NY60|Q9P1A4	In_Frame_Del	DEL	ENST00000265322.7	37	CCDS33375.1																																																																																			.		0.674	PECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337277.1	NM_018441	
PER1	5187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	8047144	8047144	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:8047144T>C	ENST00000317276.4	-	19	2749	c.2512A>G	c.(2512-2514)Aaa>Gaa	p.K838E	PER1_ENST00000578089.1_5'UTR|PER1_ENST00000581082.1_Missense_Mutation_p.K815E	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	838					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CGCTTGGCTTTGGATCGGCAG	0.672			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.K838E		.		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	.	PER1	723	0			c.A2512G						.						43.0	52.0	49.0					17																	8047144		2203	4300	6503	SO:0001583	missense	5187	exon19			TGGCTTTGGATCG	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.2512A>G	17.37:g.8047144T>C	ENSP00000314420:p.Lys838Glu	36.0	0.0		41.0	6.0	NM_002616	B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	ENST00000317276.4	37	CCDS11131.1	.	.	.	.	.	.	.	.	.	.	T	16.68	3.191104	0.58017	.	.	ENSG00000179094	ENST00000317276	T	0.16743	2.32	5.24	5.24	0.73138	.	0.197963	0.42053	D	0.000767	T	0.15739	0.0379	L	0.35854	1.095	0.80722	D	1	P	0.47409	0.895	B	0.41236	0.351	T	0.01553	-1.1326	10	0.54805	T	0.06	-7.4453	13.0668	0.59038	0.0:0.0:0.0:1.0	.	838	O15534	PER1_HUMAN	E	838	ENSP00000314420:K838E	ENSP00000314420:K838E	K	-	1	0	PER1	7987869	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.189000	0.58358	1.982000	0.57802	0.460000	0.39030	AAA	.		0.672	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
PFKFB2	5208	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	207241653	207241653	+	Splice_Site	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:207241653C>T	ENST00000367080.3	+	10	1110	c.986C>T	c.(985-987)gCt>gTt	p.A329V	PFKFB2_ENST00000541914.1_Splice_Site_p.A143V|PFKFB2_ENST00000545806.1_Splice_Site_p.A296V|PFKFB2_ENST00000411990.2_Splice_Site_p.A231V|PFKFB2_ENST00000367079.2_Splice_Site_p.A329V	NM_006212.2	NP_006203.2	O60825	F262_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2	329	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose catabolic process (GO:0006007)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|lactate metabolic process (GO:0006089)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|protein kinase binding (GO:0019901)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	20	Prostate(682;0.19)					GAGATTGATGCTGTGAGTAGG	0.463																																					p.A329V		.											.	PFKFB2	91	0			c.C986T						.						70.0	67.0	68.0					1																	207241653		2203	4300	6503	SO:0001630	splice_region_variant	5208	exon10			TTGATGCTGTGAG		CCDS31003.1, CCDS31004.1	1q31-q32.2	2012-07-13			ENSG00000123836	ENSG00000123836	2.7.1.105, 3.1.3.46		8873	protein-coding gene	gene with protein product		171835					Standard	XM_005273162		Approved		uc001hfg.3	O60825	OTTHUMG00000036033	ENST00000367080.3:c.987+1C>T	1.37:g.207241653C>T		48.0	0.0		89.0	6.0	NM_001018053	O60824|Q5VVQ3|Q5VVQ4|Q9H3P1	Missense_Mutation	SNP	ENST00000367080.3	37	CCDS31004.1	.	.	.	.	.	.	.	.	.	.	C	35	5.420605	0.96111	.	.	ENSG00000123836	ENST00000411990;ENST00000367080;ENST00000367079;ENST00000545806;ENST00000541914	T;T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64;-0.64	5.67	4.77	0.60923	Histidine phosphatase superfamily, clade-1 (2);	0.000000	0.85682	D	0.000000	T	0.79764	0.4502	L	0.52126	1.63	0.80722	D	1	P;D;D;D	0.89917	0.855;0.996;1.0;0.979	B;P;D;P	0.79784	0.381;0.679;0.993;0.722	T	0.81678	-0.0824	10	0.87932	D	0	.	13.6914	0.62549	0.0:0.9261:0.0:0.0739	.	143;231;329;329	B4DI16;B4DY91;Q5VVQ3;O60825	.;.;.;F262_HUMAN	V	231;329;329;296;143	ENSP00000408717:A231V;ENSP00000356047:A329V;ENSP00000356046:A329V;ENSP00000439420:A296V;ENSP00000440878:A143V	ENSP00000356046:A329V	A	+	2	0	PFKFB2	205308276	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.755000	0.85180	1.414000	0.47017	0.650000	0.86243	GCT	.		0.463	PFKFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087838.1		Missense_Mutation
PIK3C2A	5286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	17141377	17141377	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:17141377C>T	ENST00000265970.7	-	15	2801	c.2802G>A	c.(2800-2802)tgG>tgA	p.W934*	PIK3C2A_ENST00000540361.1_Nonsense_Mutation_p.W554*|PIK3C2A_ENST00000531428.1_Intron	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	934	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						ACAATGCAGGCCACTGGTGAA	0.368																																					p.W934X		.											.	PIK3C2A	1310	0			c.G2802A						.						124.0	126.0	125.0					11																	17141377		2200	4293	6493	SO:0001587	stop_gained	5286	exon15			TGCAGGCCACTGG	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.2802G>A	11.37:g.17141377C>T	ENSP00000265970:p.Trp934*	94.0	0.0		116.0	40.0	NM_002645	B0LPH2|B4E2G4|Q14CQ9	Nonsense_Mutation	SNP	ENST00000265970.7	37	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	C	38	6.764357	0.97821	.	.	ENSG00000011405	ENST00000265970;ENST00000540361	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.337	18.4903	0.90844	0.0:1.0:0.0:0.0	.	.	.	.	X	934;554	.	ENSP00000265970:W934X	W	-	3	0	PIK3C2A	17097953	1.000000	0.71417	1.000000	0.80357	0.446000	0.32137	7.435000	0.80391	2.363000	0.80096	0.585000	0.79938	TGG	.		0.368	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
PLCE1	51196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	95791740	95791740	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr10:95791740G>A	ENST00000371380.3	+	1	1172	c.937G>A	c.(937-939)Gac>Aac	p.D313N	PLCE1_ENST00000260766.3_Missense_Mutation_p.D313N			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	313					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TGTAGAAGAAGACGCTTTTAA	0.383																																					p.D313N		.											.	PLCE1	229	0			c.G937A						.						125.0	123.0	124.0					10																	95791740		1860	4089	5949	SO:0001583	missense	51196	exon2			GAAGAAGACGCTT		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.937G>A	10.37:g.95791740G>A	ENSP00000360431:p.Asp313Asn	77.0	0.0		84.0	8.0	NM_016341	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.912625	0.52439	.	.	ENSG00000138193	ENST00000260766;ENST00000371380	T;T	0.70631	-0.5;-0.5	5.28	5.28	0.74379	Ras guanine nucleotide exchange factor, domain (1);	0.280907	0.25288	N	0.031748	T	0.66761	0.2822	N	0.24115	0.695	0.80722	D	1	D;D	0.56035	0.974;0.974	P;P	0.47981	0.563;0.563	T	0.72100	-0.4392	10	0.66056	D	0.02	.	18.9486	0.92632	0.0:0.0:1.0:0.0	.	313;313	B7ZM61;Q9P212	.;PLCE1_HUMAN	N	313	ENSP00000260766:D313N;ENSP00000360431:D313N	ENSP00000260766:D313N	D	+	1	0	PLCE1	95781730	1.000000	0.71417	0.864000	0.33941	0.079000	0.17450	7.224000	0.78042	2.479000	0.83701	0.655000	0.94253	GAC	.		0.383	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
POU5F1B	5462	hgsc.bcm.edu;mdanderson.org	37	8	128428181	128428181	+	Missense_Mutation	SNP	G	G	T	rs551358165		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr8:128428181G>T	ENST00000465342.2	+	2	1227	c.70G>T	c.(70-72)Ggg>Tgg	p.G24W	CASC8_ENST00000501396.1_RNA|POU5F1B_ENST00000391675.1_Missense_Mutation_p.G24W|CASC8_ENST00000523825.1_RNA|CASC8_ENST00000502082.1_RNA			Q06416	P5F1B_HUMAN	POU class 5 homeobox 1B	24				WGA -> GGP (in Ref. 5; ADE48566/ ADE48597). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)|prostate(1)|urinary_tract(1)	3						TGGGCCATGGGGGGCGGAGCC	0.701																																					p.G24W		.											.	.	.	0			c.G70T						.						2.0	4.0	3.0					8																	128428181		506	1360	1866	SO:0001583	missense	5462	exon1			CCATGGGGGGCGG	AF268615	CCDS55274.1	8q24.21	2011-06-20	2009-04-15	2009-04-15	ENSG00000212993	ENSG00000212993		"""Homeoboxes / POU class"""	9223	protein-coding gene	gene with protein product		615739	"""POU domain class 5, transcription factor 1 pseudogene 1"", ""POU class 5 homeobox 1 pseudogene 1"""	OTF3P1, POU5F1P1		1408763	Standard	NM_001159542		Approved	OTF3C	uc003ysf.3	Q06416	OTTHUMG00000157807	ENST00000465342.2:c.70G>T	8.37:g.128428181G>T	ENSP00000419298:p.Gly24Trp	11.0	0.0		19.0	4.0	NM_001159542	D5K9S4|D5K9S9|D5K9T0|D5K9T1|D5K9T3|D5K9U3|D5K9U6|D5K9V4|D5K9V6|D5K9W0|D5K9W2|D5K9W7|D5K9X2|D5K9X3|D5K9X5|D5K9X8|D5K9X9|E9LRB1|E9LRB2|E9LRH5|E9LRH6|E9LRH7|E9LRK4|E9LRK5|E9LRK7|E9LRK8|E9LRM7|E9LRM9|E9LRN2|E9LRN4|E9LRN5|E9LRP8|E9LRQ0|E9LRQ2|E9LRQ3|E9LRQ4|E9LRQ5|E9LRS3|Q2VIK6|Q9BZV7|Q9BZV9	Missense_Mutation	SNP	ENST00000465342.2	37	CCDS55274.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.451068	0.26074	.	.	ENSG00000212993	ENST00000465342;ENST00000391675	D;D	0.81579	-1.51;-1.51	1.21	-1.52	0.08637	.	0.000000	0.36854	N	0.002366	D	0.82884	0.5134	M	0.66939	2.045	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71932	-0.4443	10	0.87932	D	0	.	1.7722	0.03014	0.2475:0.0:0.4295:0.323	.	24	Q06416	P5F1B_HUMAN	W	24	ENSP00000419298:G24W;ENSP00000375557:G24W	ENSP00000375557:G24W	G	+	1	0	POU5F1B	128497363	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.233000	0.02934	-0.394000	0.07727	0.121000	0.15741	GGG	.		0.701	POU5F1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349649.2	NM_001159542	
PRSS1	5644	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	142458441	142458441	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:142458441G>A	ENST00000311737.7	+	2	82	c.76G>A	c.(76-78)Ggg>Agg	p.G26R	PRSS1_ENST00000486171.1_Missense_Mutation_p.G26R	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	26	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	CAAGATCGTTGGGGGCTACAA	0.547																																					p.G26R		.											.	PRSS1	577	0			c.G76A						.						156.0	153.0	154.0					7																	142458441		2203	4300	6503	SO:0001583	missense	5644	exon2			ATCGTTGGGGGCT	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.76G>A	7.37:g.142458441G>A	ENSP00000308720:p.Gly26Arg	326.0	1.0		551.0	62.0	NM_002769	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	37	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	G	15.81	2.943648	0.53079	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243	D;D	0.95554	-3.74;-3.74	3.49	3.49	0.39957	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.98340	0.9449	H	0.95982	3.75	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99346	1.0913	10	0.87932	D	0	.	14.3966	0.67015	0.0:0.0:1.0:0.0	.	26	P07477	TRY1_HUMAN	R	26	ENSP00000417854:G26R;ENSP00000308720:G26R	ENSP00000308720:G26R	G	+	1	0	PRSS1	142138015	1.000000	0.71417	0.986000	0.45419	0.006000	0.05464	9.521000	0.98029	1.879000	0.54435	0.404000	0.27445	GGG	.		0.547	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2		
PSKH1	5681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67943502	67943502	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr16:67943502G>T	ENST00000291041.5	+	2	1020	c.850G>T	c.(850-852)Ggc>Tgc	p.G284C		NM_006742.2	NP_006733.1	P11801	KPSH1_HUMAN	protein serine kinase H1	284	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|large_intestine(1)|lung(7)|pancreas(1)	12		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0044)|Epithelial(162;0.0197)|all cancers(182;0.128)		GTGGGCGCTGGGCGTCATTGC	0.567																																					p.G284C		.											.	PSKH1	333	0			c.G850T						.						98.0	83.0	88.0					16																	67943502		2198	4300	6498	SO:0001583	missense	5681	exon2			GCGCTGGGCGTCA	M14504	CCDS10851.1	16q22.1	2008-02-05			ENSG00000159792	ENSG00000159792			9529	protein-coding gene	gene with protein product		177015				8268911	Standard	NM_006742		Approved		uc002euv.3	P11801	OTTHUMG00000137548	ENST00000291041.5:c.850G>T	16.37:g.67943502G>T	ENSP00000291041:p.Gly284Cys	104.0	0.0		130.0	38.0	NM_006742	Q9NY19	Missense_Mutation	SNP	ENST00000291041.5	37	CCDS10851.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.253978	0.80135	.	.	ENSG00000159792	ENST00000291041	D	0.82167	-1.58	5.45	5.45	0.79879	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95642	0.8583	H	0.99379	4.54	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97744	1.0210	10	0.87932	D	0	-17.3627	18.8712	0.92315	0.0:0.0:1.0:0.0	.	284	P11801	KPSH1_HUMAN	C	284	ENSP00000291041:G284C	ENSP00000291041:G284C	G	+	1	0	PSKH1	66501003	1.000000	0.71417	0.909000	0.35828	0.685000	0.39939	9.869000	0.99810	2.561000	0.86390	0.655000	0.94253	GGC	.		0.567	PSKH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268882.3	NM_006742	
PSMC2	5701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	102988211	102988211	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:102988211A>C	ENST00000435765.1	+	2	464	c.53A>C	c.(52-54)gAc>gCc	p.D18A	DNAJC2_ENST00000412522.1_5'Flank|DNAJC2_ENST00000379263.3_5'Flank|PSMC2_ENST00000292644.3_Missense_Mutation_p.D18A|PSMC2_ENST00000544811.1_5'UTR	NM_002803.3	NP_002794.1	P35998	PRS7_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 2	18					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|osteoblast differentiation (GO:0001649)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	21						GATGAGAAGGACGACAAGCCC	0.587																																					p.D18A		.											.	PSMC2	90	0			c.A53C						.						132.0	113.0	119.0					7																	102988211		2203	4300	6503	SO:0001583	missense	5701	exon1			AGAAGGACGACAA	D11094	CCDS5731.1	7q22.1-q22.3	2010-04-21			ENSG00000161057	ENSG00000161057		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9548	protein-coding gene	gene with protein product	"""proteasome 26S subunit, ATPase, 2"", ""mammalian suppressor of sgv-1 of yeast"", ""protease 26S subunit 7"", ""putative protein product of Nbla10058"""	154365				9473509, 1377363	Standard	NM_002803		Approved	MSS1, S7, Nbla10058	uc003vbs.3	P35998	OTTHUMG00000157206	ENST00000435765.1:c.53A>C	7.37:g.102988211A>C	ENSP00000391211:p.Asp18Ala	155.0	0.0		181.0	79.0	NM_001204453	A4D0Q1|B7Z5E2|Q3LIA5|Q9UDI3	Missense_Mutation	SNP	ENST00000435765.1	37	CCDS5731.1	.	.	.	.	.	.	.	.	.	.	A	16.79	3.220807	0.58560	.	.	ENSG00000161057	ENST00000457587;ENST00000425206;ENST00000435765;ENST00000292644	D;D	0.94417	-3.42;-3.42	4.34	4.34	0.51931	.	0.280303	0.40222	N	0.001155	D	0.91466	0.7306	L	0.52126	1.63	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	D	0.88373	0.2996	10	0.30854	T	0.27	-2.853	13.6346	0.62215	1.0:0.0:0.0:0.0	.	18	P35998	PRS7_HUMAN	A	18	ENSP00000391211:D18A;ENSP00000292644:D18A	ENSP00000292644:D18A	D	+	2	0	PSMC2	102775447	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	5.812000	0.69194	1.950000	0.56595	0.533000	0.62120	GAC	.		0.587	PSMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347922.1	NM_002803	
PTCHD2	57540	ucsc.edu;bcgsc.ca	37	1	11589684	11589684	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:11589684T>G	ENST00000294484.6	+	14	3008	c.2870T>G	c.(2869-2871)cTg>cGg	p.L957R	PTCHD2_ENST00000389575.3_Missense_Mutation_p.L957R	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	957					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CCTGGCTGCCTGCTTAGCTCC	0.622																																					p.L957R		.											.	PTCHD2	209	0			c.T2870G						.						56.0	60.0	59.0					1																	11589684		1974	4148	6122	SO:0001583	missense	57540	exon14			GCTGCCTGCTTAG	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.2870T>G	1.37:g.11589684T>G	ENSP00000294484:p.Leu957Arg	288.0	2.0		415.0	126.0	NM_020780	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	T	12.49	1.953753	0.34471	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.90324	-2.65;-2.65	4.82	3.64	0.41730	.	0.298247	0.27219	N	0.020370	D	0.82742	0.5103	L	0.27053	0.805	0.41829	D	0.990063	B	0.26195	0.144	B	0.19148	0.024	T	0.76828	-0.2815	10	0.48119	T	0.1	-9.7005	9.8395	0.40991	0.1537:0.0:0.0:0.8463	.	957	Q9P2K9	PTHD2_HUMAN	R	957	ENSP00000294484:L957R;ENSP00000374226:L957R	ENSP00000294484:L957R	L	+	2	0	PTCHD2	11512271	0.997000	0.39634	0.999000	0.59377	0.933000	0.57130	3.566000	0.53805	0.632000	0.30432	0.459000	0.35465	CTG	.		0.622	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
PTP4A3	11156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	142435203	142435203	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr8:142435203A>T	ENST00000521578.1	+	3	1106	c.161A>T	c.(160-162)gAc>gTc	p.D54V	PTP4A3_ENST00000520105.1_Missense_Mutation_p.D54V|PTP4A3_ENST00000524028.1_Intron|PTP4A3_ENST00000349124.1_Missense_Mutation_p.D54V|PTP4A3_ENST00000329397.1_Missense_Mutation_p.D54V			O75365	TP4A3_HUMAN	protein tyrosine phosphatase type IVA, member 3	54					peptidyl-tyrosine dephosphorylation (GO:0035335)	endosome (GO:0005768)|plasma membrane (GO:0005886)	prenylated protein tyrosine phosphatase activity (GO:0004727)			endometrium(2)|large_intestine(1)|lung(3)	6	all_cancers(97;2.55e-15)|all_epithelial(106;1.39e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0474)			GTGACCTATGACAAAACGCCG	0.672																																					p.D54V		.											.	PTP4A3	226	0			c.A161T						.						138.0	104.0	116.0					8																	142435203		2202	4300	6502	SO:0001583	missense	11156	exon2			CCTATGACAAAAC	AF041434	CCDS6382.1, CCDS6383.1	8q24.3	2011-06-09				ENSG00000184489		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9636	protein-coding gene	gene with protein product		606449					Standard	NM_032611		Approved	PRL-3, PRL-R, PRL3	uc003ywg.1	O75365		ENST00000521578.1:c.161A>T	8.37:g.142435203A>T	ENSP00000428976:p.Asp54Val	69.0	0.0		127.0	26.0	NM_032611	Q8IVN5|Q99849|Q9BTW5	Missense_Mutation	SNP	ENST00000521578.1	37	CCDS6383.1	.	.	.	.	.	.	.	.	.	.	A	17.33	3.361180	0.61403	.	.	ENSG00000184489	ENST00000521578;ENST00000520105;ENST00000523147;ENST00000329397;ENST00000349124	D;T;D;T	0.83755	-1.76;0.74;-1.76;0.74	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.93588	0.7953	H	0.96048	3.76	0.80722	D	1	D;P	0.89917	1.0;0.951	D;D	0.87578	0.998;0.942	D	0.95282	0.8387	10	0.87932	D	0	-6.4064	13.5462	0.61705	1.0:0.0:0.0:0.0	.	54;54	O75365-2;O75365	.;TP4A3_HUMAN	V	54	ENSP00000428976:D54V;ENSP00000428758:D54V;ENSP00000332274:D54V;ENSP00000331730:D54V	ENSP00000332274:D54V	D	+	2	0	PTP4A3	142504385	1.000000	0.71417	0.999000	0.59377	0.149000	0.21700	5.160000	0.64929	1.945000	0.56424	0.402000	0.26972	GAC	.		0.672	PTP4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378977.1	NM_032611	
PTPN9	5780	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	75782644	75782644	+	Splice_Site	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr15:75782644T>A	ENST00000306726.2	-	8	1481		c.e8-2		PTPN9_ENST00000564970.1_Splice_Site	NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9						peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CCTGGAGACCTGAAGGAAACG	0.438																																					.		.											.	PTPN9	226	0			c.969-2A>T						.						117.0	105.0	109.0					15																	75782644		2197	4294	6491	SO:0001630	splice_region_variant	5780	exon9			GAGACCTGAAGGA		CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.969-2A>T	15.37:g.75782644T>A		79.0	1.0		114.0	26.0	NM_002833	Q53XR9	Splice_Site	SNP	ENST00000306726.2	37	CCDS10280.1	.	.	.	.	.	.	.	.	.	.	t	22.4	4.287212	0.80803	.	.	ENSG00000169410	ENST00000306726;ENST00000544966	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1581	0.59529	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PTPN9	73569699	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	4.424000	0.59868	2.131000	0.65755	0.529000	0.55759	.	.		0.438	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286474.1		Intron
PTPRB	5787	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	70988332	70988332	+	Silent	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr12:70988332C>T	ENST00000261266.5	-	4	806	c.777G>A	c.(775-777)ggG>ggA	p.G259G	PTPRB_ENST00000451516.2_Silent_p.G259G|PTPRB_ENST00000550857.1_Silent_p.G259G|PTPRB_ENST00000538708.1_Silent_p.G259G|PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000550358.1_Silent_p.G477G|PTPRB_ENST00000334414.6_Silent_p.G477G|PTPRB_ENST00000551525.1_Silent_p.G476G	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	259	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CAGGGGTCAGCCCGTGAAAAG	0.507																																					p.G477G		.											.	PTPRB	226	0			c.G1431A						.						152.0	150.0	151.0					12																	70988332		2004	4193	6197	SO:0001819	synonymous_variant	5787	exon6			GGTCAGCCCGTGA	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.777G>A	12.37:g.70988332C>T		222.0	0.0		290.0	82.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	ENST00000261266.5	37	CCDS44944.1																																																																																			.		0.507	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
QRFPR	84109	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	122301704	122301704	+	Silent	SNP	C	C	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr4:122301704C>G	ENST00000394427.2	-	1	510	c.99G>C	c.(97-99)ccG>ccC	p.P33P	QRFPR_ENST00000334383.5_Silent_p.P33P	NM_198179.2	NP_937822.2	Q96P65	QRFPR_HUMAN	pyroglutamylated RFamide peptide receptor	33					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(2)|skin(3)|stomach(1)	28						TGTAGACGAGCGGTCGCAGCC	0.642																																					p.P33P		.											.	QRFPR	90	0			c.G99C						.						21.0	24.0	23.0					4																	122301704		2203	4299	6502	SO:0001819	synonymous_variant	84109	exon1			GACGAGCGGTCGC	AF411117	CCDS3719.1	4q27	2012-08-10	2008-12-18	2008-12-18	ENSG00000186867	ENSG00000186867		"""GPCR / Class A : RF amide peptide receptors"""	15565	protein-coding gene	gene with protein product		606925	"""G protein-coupled receptor 103"""	GPR103		11574155	Standard	NM_198179		Approved		uc010inj.1	Q96P65	OTTHUMG00000133036	ENST00000394427.2:c.99G>C	4.37:g.122301704C>G		91.0	1.0		82.0	22.0	NM_198179		Silent	SNP	ENST00000394427.2	37	CCDS3719.1																																																																																			.		0.642	QRFPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256641.2	NM_198179	
RASGRF1	5923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	79350802	79350802	+	Silent	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr15:79350802C>T	ENST00000419573.3	-	3	679	c.405G>A	c.(403-405)gaG>gaA	p.E135E	RASGRF1_ENST00000558480.2_Silent_p.E135E|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	135					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						ATGCCTCATGCTCTGTGGCGA	0.572																																					p.E135E		.											.	RASGRF1	662	0			c.G405A						.						121.0	100.0	107.0					15																	79350802		2196	4293	6489	SO:0001819	synonymous_variant	5923	exon3			CTCATGCTCTGTG	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.405G>A	15.37:g.79350802C>T		97.0	0.0		154.0	46.0	NM_001145648	F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	ENST00000419573.3	37	CCDS10309.1																																																																																			.		0.572	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
RBM12B	389677	hgsc.bcm.edu;broad.mit.edu	37	8	94747568	94747568	+	Silent	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr8:94747568T>C	ENST00000399300.2	-	3	1284	c.1071A>G	c.(1069-1071)ccA>ccG	p.P357P	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Silent_p.P357P|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	357	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TTCTAGAAATTGGATCAATAT	0.368																																					p.P357P		.											.	RBM12B	90	0			c.A1071G						.						95.0	92.0	93.0					8																	94747568		1853	4086	5939	SO:0001819	synonymous_variant	389677	exon3			AGAAATTGGATCA		CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.1071A>G	8.37:g.94747568T>C		33.0	0.0		78.0	4.0	NM_203390	A8MYB5	Silent	SNP	ENST00000399300.2	37	CCDS43755.1																																																																																			.		0.368	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390	
RNF31	55072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24618693	24618693	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr14:24618693G>T	ENST00000324103.6	+	6	1030	c.710G>T	c.(709-711)tGt>tTt	p.C237F	RP11-468E2.4_ENST00000558468.1_5'Flank|RNF31_ENST00000559275.1_Missense_Mutation_p.C86F|PSME2_ENST00000560410.1_5'Flank|PSME2_ENST00000216802.5_5'Flank|PSME2_ENST00000471700.2_5'Flank|RNF31_ENST00000382687.3_Missense_Mutation_p.C86F	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	237	Polyubiquitin-binding.				CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		CAGGCCCTGTGTCCAGCCTGT	0.637																																					p.C237F		.											.	RNF31	90	0			c.G710T						.						88.0	93.0	91.0					14																	24618693		2094	4219	6313	SO:0001583	missense	55072	exon6			CCCTGTGTCCAGC	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.710G>T	14.37:g.24618693G>T	ENSP00000315112:p.Cys237Phe	106.0	0.0		151.0	44.0	NM_017999	A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	ENST00000324103.6	37	CCDS41931.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185324	0.78677	.	.	ENSG00000092098	ENST00000324103;ENST00000382687	T;T	0.80214	-1.35;-1.31	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.89005	0.6592	L	0.61218	1.895	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.994;0.997	D	0.89095	0.3485	10	0.87932	D	0	-21.2105	19.0767	0.93165	0.0:0.0:1.0:0.0	.	52;237;86	B3KV71;Q96EP0;Q96EP0-3	.;RNF31_HUMAN;.	F	237;86	ENSP00000315112:C237F;ENSP00000372134:C86F	ENSP00000315112:C237F	C	+	2	0	RNF31	23688533	1.000000	0.71417	0.924000	0.36721	0.629000	0.37895	6.467000	0.73547	2.808000	0.96608	0.655000	0.94253	TGT	.		0.637	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999	
ROR2	4920	hgsc.bcm.edu;mdanderson.org	37	9	94495598	94495598	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr9:94495598G>C	ENST00000375708.3	-	6	941	c.743C>G	c.(742-744)cCg>cGg	p.P248R	ROR2_ENST00000550066.1_5'UTR|ROR2_ENST00000375715.1_Missense_Mutation_p.P108R	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	248	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CAGCTCACGCGGCTTGGGTGT	0.647																																					p.P248R		.											.	ROR2	1471	0			c.C743G						.						42.0	40.0	41.0					9																	94495598		2203	4300	6503	SO:0001583	missense	4920	exon6			TCACGCGGCTTGG	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.743C>G	9.37:g.94495598G>C	ENSP00000364860:p.Pro248Arg	25.0	0.0		26.0	10.0	NM_004560	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	ENST00000375708.3	37	CCDS6691.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.547936	0.45383	.	.	ENSG00000169071	ENST00000375715;ENST00000375708	T;T	0.78816	0.48;-1.21	4.37	3.43	0.39272	Frizzled domain (2);Kringle (1);	0.180958	0.25906	N	0.027526	T	0.69269	0.3092	N	0.24115	0.695	0.48571	D	0.999679	B;B;B	0.28512	0.035;0.004;0.214	B;B;B	0.37422	0.088;0.013;0.249	T	0.66548	-0.5896	10	0.27785	T	0.31	.	15.6817	0.77373	0.0:0.1492:0.8508:0.0	.	248;248;108	A1L4F5;Q01974;B1APY4	.;ROR2_HUMAN;.	R	108;248	ENSP00000364867:P108R;ENSP00000364860:P248R	ENSP00000364860:P248R	P	-	2	0	ROR2	93535419	0.951000	0.32395	0.996000	0.52242	0.937000	0.57800	1.499000	0.35671	2.271000	0.75665	0.511000	0.50034	CCG	.		0.647	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1		
RPRD1A	55197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	33573185	33573185	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr18:33573185A>G	ENST00000399022.4	-	7	1039	c.868T>C	c.(868-870)Tct>Cct	p.S290P	RPRD1A_ENST00000590898.1_Missense_Mutation_p.S254P|RPRD1A_ENST00000337059.5_Missense_Mutation_p.S254P|RPRD1A_ENST00000357384.4_Missense_Mutation_p.S290P|RPRD1A_ENST00000588737.1_Missense_Mutation_p.S254P	NM_018170.3	NP_060640.2	Q96P16	RPR1A_HUMAN	regulation of nuclear pre-mRNA domain containing 1A	290					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(2)	12						GGCAATCGAGATAAGTCTGGC	0.537																																					p.S290P		.											.	RPRD1A	154	0			c.T868C						.						110.0	100.0	103.0					18																	33573185		2203	4300	6503	SO:0001583	missense	55197	exon7			ATCGAGATAAGTC	AF419845	CCDS11917.1	18q12.2	2012-02-09	2008-08-15		ENSG00000141425	ENSG00000141425			25560	protein-coding gene	gene with protein product	"""cyclin-dependent kinase 2B-inhibitor-related protein"", ""Cyclin-dependent kinase inhibitor 2B-related protein (p15INK4B-related protein)"""	610347				12470661, 22231121	Standard	NM_018170		Approved	P15RS, FLJ10656, HsT3101	uc002kzg.3	Q96P16	OTTHUMG00000132591	ENST00000399022.4:c.868T>C	18.37:g.33573185A>G	ENSP00000381984:p.Ser290Pro	101.0	0.0		127.0	40.0	NM_018170	A8KA42|B2RBA3|Q7Z5G8|Q96FY9|Q9NVL4	Missense_Mutation	SNP	ENST00000399022.4	37	CCDS11917.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.040668	0.75732	.	.	ENSG00000141425	ENST00000399022;ENST00000357384;ENST00000337059	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.76572	0.4006	M	0.66939	2.045	0.80722	D	1	D;D	0.76494	0.99;0.999	P;D	0.74348	0.811;0.983	T	0.78163	-0.2311	9	0.56958	D	0.05	-10.0903	14.0823	0.64932	1.0:0.0:0.0:0.0	.	290;254	Q96P16;Q96P16-3	RPR1A_HUMAN;.	P	290;290;254	.	ENSP00000337476:S254P	S	-	1	0	RPRD1A	31827183	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.157000	0.94714	2.218000	0.71995	0.533000	0.62120	TCT	.		0.537	RPRD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255802.1	NM_018170	
RXRA	6256	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	137300011	137300011	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr9:137300011A>G	ENST00000481739.1	+	3	348	c.296A>G	c.(295-297)aAc>aGc	p.N99S	RXRA_ENST00000356384.4_3'UTR|RXRA_ENST00000540193.1_Missense_Mutation_p.N2S	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha	99	Modulating. {ECO:0000250}.				camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	TCACCTATGAACCCCGTCAGC	0.642																																					p.N99S		.											.	RXRA	188	0			c.A296G						.						53.0	43.0	47.0					9																	137300011		2203	4300	6503	SO:0001583	missense	6256	exon3			CTATGAACCCCGT	X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000481739.1:c.296A>G	9.37:g.137300011A>G	ENSP00000419692:p.Asn99Ser	118.0	1.0		150.0	49.0	NM_002957	B3KY83|Q2NL52|Q2V504	Missense_Mutation	SNP	ENST00000481739.1	37	CCDS35172.1	.	.	.	.	.	.	.	.	.	.	A	10.92	1.486261	0.26686	.	.	ENSG00000186350	ENST00000481739;ENST00000540193	D;D	0.92446	-2.99;-3.04	4.75	4.75	0.60458	.	0.236467	0.48767	N	0.000176	D	0.89164	0.6637	L	0.56199	1.76	0.58432	D	0.999998	B	0.21071	0.051	B	0.25405	0.06	D	0.85027	0.0915	10	0.15499	T	0.54	.	14.2353	0.65922	1.0:0.0:0.0:0.0	.	99	P19793	RXRA_HUMAN	S	99;2	ENSP00000419692:N99S;ENSP00000442123:N2S	ENSP00000419692:N99S	N	+	2	0	RXRA	136439832	1.000000	0.71417	1.000000	0.80357	0.566000	0.35808	5.508000	0.67006	1.767000	0.52121	0.379000	0.24179	AAC	.		0.642	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054949.1	NM_002957	
RYR3	6263	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	33855053	33855053	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr15:33855053T>A	ENST00000389232.4	+	11	1058	c.988T>A	c.(988-990)Tta>Ata	p.L330I	RYR3_ENST00000415757.3_Missense_Mutation_p.L330I	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	330	MIR 4. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CAAGGAGAAATTAGACTCCAG	0.388																																					p.L330I		.											.	RYR3	520	0			c.T988A						.						63.0	62.0	63.0					15																	33855053		1859	4104	5963	SO:0001583	missense	6263	exon11			GAGAAATTAGACT		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.988T>A	15.37:g.33855053T>A	ENSP00000373884:p.Leu330Ile	66.0	1.0		98.0	33.0	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	T	12.59	1.982327	0.34942	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.91237	-2.81;-2.81	5.27	1.65	0.23941	MIR motif (2);MIR (2);	0.598230	0.15867	N	0.240731	T	0.79958	0.4536	N	0.12746	0.255	0.27952	N	0.937111	P;B	0.39216	0.664;0.312	B;B	0.37888	0.26;0.097	T	0.70788	-0.4777	10	0.38643	T	0.18	.	8.8395	0.35133	0.0:0.3498:0.0:0.6502	.	330;330	Q15413-2;Q15413	.;RYR3_HUMAN	I	330	ENSP00000373884:L330I;ENSP00000399610:L330I	ENSP00000354735:L330I	L	+	1	2	RYR3	31642345	0.985000	0.35326	0.998000	0.56505	0.992000	0.81027	0.130000	0.15850	0.112000	0.17975	0.533000	0.62120	TTA	.		0.388	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SARS2	54938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39421333	39421333	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:39421333C>T	ENST00000221431.6	-	1	203	c.44G>A	c.(43-45)cGt>cAt	p.R15H	SARS2_ENST00000448145.2_Intron|MRPS12_ENST00000407800.2_5'Flank|SARS2_ENST00000594171.1_5'Flank|MRPS12_ENST00000308018.4_5'UTR|MRPS12_ENST00000402029.3_5'Flank|SARS2_ENST00000430193.3_Missense_Mutation_p.R15H|SARS2_ENST00000600042.1_Missense_Mutation_p.R15H|CTC-360G5.8_ENST00000599996.1_Intron	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial	15					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GAACCCCCGACGAGTCAGCAA	0.602											OREG0025455	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R15H		.											.	SARS2	93	0			c.G44A						.						40.0	38.0	39.0					19																	39421333		2203	4299	6502	SO:0001583	missense	54938	exon1			CCCCGACGAGTCA	AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.44G>A	19.37:g.39421333C>T	ENSP00000221431:p.Arg15His	56.0	0.0	885	67.0	33.0	NM_001145901	A6NHW7|B4DE10|Q9BVP3	Missense_Mutation	SNP	ENST00000221431.6	37	CCDS33017.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.028488	0.54790	.	.	ENSG00000104835	ENST00000430193;ENST00000221431;ENST00000455102	T;T;T	0.56941	0.44;0.43;1.28	5.35	-0.894	0.10563	.	1.643000	0.02821	N	0.125534	T	0.44095	0.1277	L	0.44542	1.39	.	.	.	B;B;B	0.21753	0.06;0.019;0.019	B;B;B	0.12837	0.008;0.001;0.001	T	0.34129	-0.9841	9	0.59425	D	0.04	.	5.3226	0.15889	0.1352:0.3443:0.4405:0.08	.	15;15;15	B4DJP6;B4DE10;Q9NP81	.;.;SYSM_HUMAN	H	15	ENSP00000406754:R15H;ENSP00000221431:R15H;ENSP00000414954:R15H	ENSP00000221431:R15H	R	-	2	0	FBXO17	44113173	0.000000	0.05858	0.000000	0.03702	0.209000	0.24338	-0.042000	0.12063	-0.065000	0.13021	-0.140000	0.14226	CGT	.		0.602	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463139.1	NM_017827	
SCAPER	49855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	76994169	76994169	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr15:76994169C>G	ENST00000563290.1	-	20	2533	c.2438G>C	c.(2437-2439)gGg>gCg	p.G813A	SCAPER_ENST00000538941.2_Missense_Mutation_p.G567A|SCAPER_ENST00000324767.7_Missense_Mutation_p.G813A			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	813						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						GTGTTTTCTCCCTTTAACATG	0.353																																					p.G813A		.											.	SCAPER	137	0			c.G2438C						.						87.0	85.0	85.0					15																	76994169		1857	4126	5983	SO:0001583	missense	49855	exon19			TTTCTCCCTTTAA	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.2438G>C	15.37:g.76994169C>G	ENSP00000454973:p.Gly813Ala	52.0	0.0		63.0	17.0	NM_020843	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	37	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.315415	0.81358	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.71103	-0.54;-0.54	5.49	5.49	0.81192	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	D	0.82678	0.5089	M	0.65975	2.015	0.80722	D	1	D;D	0.62365	0.991;0.987	D;P	0.66196	0.942;0.834	T	0.82141	-0.0604	10	0.46703	T	0.11	.	19.3857	0.94555	0.0:1.0:0.0:0.0	.	812;567	Q9BY12;F5H7X8	SCAPE_HUMAN;.	A	813;567;835	ENSP00000326924:G813A;ENSP00000442190:G567A	ENSP00000303560:G835A	G	-	2	0	SCAPER	74781224	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	7.234000	0.78134	2.596000	0.87737	0.557000	0.71058	GGG	.		0.353	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
SCN5A	6331	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	38622799	38622799	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:38622799C>T	ENST00000333535.4	-	17	3000	c.2851G>A	c.(2851-2853)Gat>Aat	p.D951N	SCN5A_ENST00000449557.2_Missense_Mutation_p.D951N|SCN5A_ENST00000414099.2_Missense_Mutation_p.D951N|SCN5A_ENST00000443581.1_Missense_Mutation_p.D951N|SCN5A_ENST00000451551.2_Missense_Mutation_p.D951N|SCN5A_ENST00000413689.1_Missense_Mutation_p.D951N|SCN5A_ENST00000423572.2_Missense_Mutation_p.D951N|SCN5A_ENST00000425664.1_Missense_Mutation_p.D951N|SCN5A_ENST00000455624.2_Missense_Mutation_p.D951N|SCN5A_ENST00000450102.2_Missense_Mutation_p.D951N			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	951					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CTGTCCTCATCAGGGGCTGTG	0.587																																					p.D951N		.											.	SCN5A	98	0			c.G2851A						.						37.0	39.0	38.0					3																	38622799		2107	4254	6361	SO:0001583	missense	6331	exon17			CCTCATCAGGGGC	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.2851G>A	3.37:g.38622799C>T	ENSP00000328968:p.Asp951Asn	219.0	0.0		316.0	29.0	NM_001160160	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.146333	0.77888	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.96685	-3.99;-4.02;-4.02;-4.0;-4.02;-3.99;-4.02;-4.09;-4.0;-4.0	4.59	4.59	0.56863	.	0.057015	0.64402	D	0.000002	D	0.98099	0.9373	M	0.83012	2.62	0.58432	D	0.999993	D;D;D;D;D;D;D	0.76494	0.998;0.997;0.999;0.998;0.998;0.995;0.999	P;D;D;P;P;P;D	0.77004	0.82;0.989;0.913;0.82;0.82;0.894;0.913	D	0.99050	1.0827	10	0.72032	D	0.01	.	17.6188	0.88075	0.0:1.0:0.0:0.0	.	951;951;951;951;951;951;951	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	N	951	ENSP00000398962:D951N;ENSP00000398266:D951N;ENSP00000410257:D951N;ENSP00000388797:D951N;ENSP00000397915:D951N;ENSP00000416634:D951N;ENSP00000328968:D951N;ENSP00000399524:D951N;ENSP00000403355:D951N;ENSP00000413996:D951N	ENSP00000328968:D951N	D	-	1	0	SCN5A	38597803	1.000000	0.71417	0.646000	0.29493	0.416000	0.31233	7.651000	0.83577	2.399000	0.81585	0.655000	0.94253	GAT	.		0.587	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
SDK1	221935	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	4091432	4091432	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:4091432A>T	ENST00000404826.2	+	19	3020	c.2881A>T	c.(2881-2883)Aca>Tca	p.T961S	SDK1_ENST00000389531.3_Missense_Mutation_p.T961S	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	961	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GCCTCCCAGCACACCTCAGCT	0.527																																					p.T961S		.											.	SDK1	138	0			c.A2881T						.						129.0	120.0	123.0					7																	4091432		2203	4300	6503	SO:0001583	missense	221935	exon19			CCCAGCACACCTC	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2881A>T	7.37:g.4091432A>T	ENSP00000385899:p.Thr961Ser	127.0	0.0		193.0	16.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	A	0.015	-1.556530	0.00910	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.52983	0.64;0.64	5.62	-3.18	0.05186	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.437089	0.22169	N	0.063673	T	0.16171	0.0389	N	0.11651	0.15	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.27706	-1.0066	10	0.02654	T	1	.	3.7836	0.08690	0.2295:0.3866:0.2959:0.088	.	961;961	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	S	961	ENSP00000385899:T961S;ENSP00000374182:T961S	ENSP00000374182:T961S	T	+	1	0	SDK1	4057958	0.000000	0.05858	0.002000	0.10522	0.586000	0.36452	-0.103000	0.10940	-0.443000	0.07180	-0.256000	0.11100	ACA	.		0.527	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
SDK2	54549	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	71443757	71443757	+	Missense_Mutation	SNP	C	C	T	rs568104292	byFrequency	TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:71443757C>T	ENST00000392650.3	-	5	610	c.610G>A	c.(610-612)Gag>Aag	p.E204K	SDK2_ENST00000388726.3_Missense_Mutation_p.E204K	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	204					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TACTTACTCTCCACGGTGAGC	0.567																																					p.E204K		.											.	SDK2	24	0			c.G610A						.						154.0	123.0	133.0					17																	71443757		692	1591	2283	SO:0001583	missense	54549	exon5			TACTCTCCACGGT	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.610G>A	17.37:g.71443757C>T	ENSP00000376421:p.Glu204Lys	236.0	1.0		464.0	61.0	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.48|14.48	2.547126|2.547126	0.45383|0.45383	.|.	.|.	ENSG00000069188|ENSG00000069188	ENST00000392650;ENST00000388726;ENST00000316893|ENST00000416616	T;T|.	0.58797|.	0.31;0.33|.	4.8|4.8	4.8|4.8	0.61643|0.61643	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);|.	0.211116|.	0.30101|.	U|.	0.010419|.	T|T	0.66519|0.66519	0.2797|0.2797	L|L	0.44542|0.44542	1.39|1.39	0.58432|0.58432	D|D	0.999991|0.999991	B|.	0.18741|.	0.03|.	B|.	0.12156|.	0.007|.	T|T	0.64149|0.64149	-0.6475|-0.6475	10|5	0.23302|.	T|.	0.38|.	.|.	17.4519|17.4519	0.87594|0.87594	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	204|.	Q58EX2|.	SDK2_HUMAN|.	K|E	204|108	ENSP00000376421:E204K;ENSP00000373378:E204K|.	ENSP00000324967:E204K|.	E|G	-|-	1|2	0|0	SDK2|SDK2	68955352|68955352	1.000000|1.000000	0.71417|0.71417	0.980000|0.980000	0.43619|0.43619	0.326000|0.326000	0.28443|0.28443	7.532000|7.532000	0.81985|0.81985	2.220000|2.220000	0.72140|0.72140	0.313000|0.313000	0.20887|0.20887	GAG|GGA	.		0.567	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
SEMA3A	10371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	83643576	83643576	+	Silent	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:83643576A>G	ENST00000265362.4	-	7	1073	c.759T>C	c.(757-759)gaT>gaC	p.D253D	SEMA3A_ENST00000436949.1_Silent_p.D253D	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	253	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						AGTGTTCTCCATCTATTGCAT	0.398																																					p.D253D		.											.	SEMA3A	156	0			c.T759C						.						115.0	111.0	112.0					7																	83643576		2203	4300	6503	SO:0001819	synonymous_variant	10371	exon7			TTCTCCATCTATT	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.759T>C	7.37:g.83643576A>G		64.0	0.0		100.0	46.0	NM_006080		Silent	SNP	ENST00000265362.4	37	CCDS5599.1																																																																																			.		0.398	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
SERPINC1	462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	173880936	173880936	+	Splice_Site	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:173880936C>T	ENST00000367698.3	-	3	743		c.e3+1		SERPINC1_ENST00000494024.1_5'Flank	NM_000488.3	NP_000479.1	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C (antithrombin), member 1						blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of inflammatory response (GO:0050728)|regulation of blood coagulation, intrinsic pathway (GO:2000266)|regulation of proteolysis (GO:0030162)|response to nutrient (GO:0007584)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(15)|ovary(1)	25					Ardeparin(DB00407)|Dalteparin(DB06779)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Nadroparin(DB08813)|Sulodexide(DB06271)|Tinzaparin(DB06822)	CTGCAACTCACCTTGAAGTCC	0.498																																					.		.											.	SERPINC1	227	0			c.624+1G>A						.						116.0	103.0	108.0					1																	173880936		2203	4300	6503	SO:0001630	splice_region_variant	462	exon4			AACTCACCTTGAA	X68793	CCDS1313.1	1q25.1	2014-02-18	2005-08-18		ENSG00000117601	ENSG00000117601		"""Serine (or cysteine) peptidase inhibitors"""	775	protein-coding gene	gene with protein product	"""antithrombin III"", ""signal peptide antithrombin part 1"", ""coding sequence signal peptide antithrombin part 1"", ""antithrombin (aa 375-432)"""	107300	"""serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1"""	AT3		3979120, 24172014	Standard	NM_000488		Approved	ATIII, MGC22579	uc001gjt.3	P01008	OTTHUMG00000037276	ENST00000367698.3:c.624+1G>A	1.37:g.173880936C>T		126.0	0.0		180.0	71.0	NM_000488	B2R6P0|P78439|P78447|Q13815|Q5TC78|Q7KZ43|Q7KZ97|Q9UC78	Splice_Site	SNP	ENST00000367698.3	37	CCDS1313.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.705364	0.89018	.	.	ENSG00000117601	ENST00000367698	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7525	0.96273	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SERPINC1	172147559	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.487000	0.81328	2.669000	0.90835	0.591000	0.81541	.	.		0.498	SERPINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090734.1	NM_000488	Intron
SEZ6L	23544	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	26706735	26706735	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr22:26706735C>A	ENST00000248933.6	+	7	1709	c.1614C>A	c.(1612-1614)aaC>aaA	p.N538K	SEZ6L_ENST00000404234.3_Missense_Mutation_p.N538K|SEZ6L_ENST00000343706.4_Missense_Mutation_p.N538K|SEZ6L_ENST00000360929.3_Missense_Mutation_p.N538K|SEZ6L_ENST00000403121.1_Missense_Mutation_p.N311K|SEZ6L_ENST00000529632.2_Missense_Mutation_p.N538K|SEZ6L_ENST00000402979.1_Missense_Mutation_p.N311K			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	538	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						GCGAAGGCAACACCATCCGCA	0.582																																					p.N538K		.											.	SEZ6L	95	0			c.C1614A						.						146.0	114.0	125.0					22																	26706735		2203	4300	6503	SO:0001583	missense	23544	exon7			AGGCAACACCATC	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.1614C>A	22.37:g.26706735C>A	ENSP00000248933:p.Asn538Lys	182.0	0.0		194.0	58.0	NM_021115	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	C	1.004	-0.689938	0.03328	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17;1.17	5.04	-3.65	0.04502	CUB (5);	0.757438	0.11620	N	0.545850	T	0.29620	0.0739	M	0.78456	2.415	0.20563	N	0.999886	B;B;B;B;B;B;B	0.31274	0.125;0.149;0.109;0.317;0.317;0.149;0.149	B;B;B;B;B;B;B	0.31390	0.129;0.079;0.049;0.108;0.108;0.079;0.079	T	0.29088	-1.0023	10	0.25751	T	0.34	.	2.7657	0.05319	0.1145:0.3387:0.1123:0.4345	.	538;538;311;538;538;538;538	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	K	538;538;538;538;538;311;311	ENSP00000384772:N538K;ENSP00000437037:N538K;ENSP00000354185:N538K;ENSP00000248933:N538K;ENSP00000342661:N538K;ENSP00000384838:N311K;ENSP00000384733:N311K	ENSP00000248933:N538K	N	+	3	2	SEZ6L	25036735	0.007000	0.16637	0.000000	0.03702	0.065000	0.16274	0.181000	0.16880	-0.192000	0.10432	0.561000	0.74099	AAC	.		0.582	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3		
SLC12A1	6557	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48533795	48533795	+	Splice_Site	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr15:48533795A>G	ENST00000558405.1	+	9	1313	c.1299A>G	c.(1297-1299)gtA>gtG	p.V433V	SLC12A1_ENST00000380993.3_Splice_Site_p.V433V|SLC12A1_ENST00000396577.3_Splice_Site_p.V433V			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	433					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	CAATTTGTGTAGGTAAGTGGT	0.433																																					p.V433V		.											.	SLC12A1	24	0			c.A1299G						.						205.0	190.0	195.0					15																	48533795		2198	4297	6495	SO:0001630	splice_region_variant	6557	exon10			TTGTGTAGGTAAG		CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.1300+1A>G	15.37:g.48533795A>G		100.0	0.0		167.0	58.0	NM_001184832	A8JYA2|E9PDW4	Silent	SNP	ENST00000558405.1	37	CCDS10129.2																																																																																			.		0.433	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417131.1		Silent
SHC4	399694	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	49254841	49254841	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr15:49254841G>T	ENST00000332408.4	-	1	800	c.372C>A	c.(370-372)gaC>gaA	p.D124E		NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	124	CH2.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		TGGAACCTGGGTCCCGGCTTT	0.607																																					p.D124E		.											.	SHC4	95	0			c.C372A						.						49.0	50.0	49.0					15																	49254841		2197	4295	6492	SO:0001583	missense	399694	exon1			ACCTGGGTCCCGG	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.372C>A	15.37:g.49254841G>T	ENSP00000329668:p.Asp124Glu	68.0	0.0		100.0	37.0	NM_203349	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	ENST00000332408.4	37	CCDS10130.1	.	.	.	.	.	.	.	.	.	.	G	0.071	-1.201489	0.01581	.	.	ENSG00000185634	ENST00000332408	T	0.04603	3.59	4.67	-4.35	0.03656	.	0.539396	0.16931	N	0.193641	T	0.01835	0.0058	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.45934	-0.9227	10	0.11485	T	0.65	-18.6904	7.3232	0.26540	0.3112:0.5173:0.1715:0.0	.	124	Q6S5L8	SHC4_HUMAN	E	124	ENSP00000329668:D124E	ENSP00000329668:D124E	D	-	3	2	SHC4	47042133	0.000000	0.05858	0.108000	0.21378	0.114000	0.19823	-2.692000	0.00830	-0.785000	0.04522	-0.165000	0.13383	GAC	.		0.607	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349	
SLC18A2	6571	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	119003680	119003680	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr10:119003680T>C	ENST00000298472.5	+	3	463	c.320T>C	c.(319-321)gTg>gCg	p.V107A	RP11-501J20.5_ENST00000425264.1_RNA|SLC18A2_ENST00000497497.1_3'UTR	NM_003054.4	NP_003045.2	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 2	107					aging (GO:0007568)|cellular response to ammonium ion (GO:0071242)|cellular response to drug (GO:0035690)|death (GO:0016265)|dopamine transport (GO:0015872)|endocytic recycling (GO:0032456)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|negative regulation of neurotransmitter transport (GO:0051589)|neurotransmitter loading into synaptic vesicle (GO:0098700)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to corticosterone (GO:0051412)|response to herbicide (GO:0009635)|response to starvation (GO:0042594)|response to zinc ion (GO:0010043)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)|terminal bouton (GO:0043195)	amine transmembrane transporter activity (GO:0005275)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)|serotonin transmembrane transporter activity (GO:0015222)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)	29		Colorectal(252;0.19)		all cancers(201;0.029)	Amphetamine(DB00182)|Benzphetamine(DB00865)|Deserpidine(DB01089)|Dextroamphetamine(DB01576)|Ephedra(DB01363)|Ephedrine(DB01364)|Isometheptene(DB06706)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Propylhexedrine(DB06714)|Reserpine(DB00206)|Tetrabenazine(DB04844)	CAGCACATGGTGACCAACGCG	0.512																																					p.V107A		.											.	SLC18A2	90	0			c.T320C						.						117.0	101.0	106.0					10																	119003680		2203	4300	6503	SO:0001583	missense	6571	exon3			ACATGGTGACCAA	L14269	CCDS7599.1	10q25	2013-07-18	2013-07-18		ENSG00000165646	ENSG00000165646		"""Solute carriers"""	10935	protein-coding gene	gene with protein product		193001		VMAT2			Standard	NM_003054		Approved	SVMT, SVAT	uc001ldd.2	Q05940	OTTHUMG00000019121	ENST00000298472.5:c.320T>C	10.37:g.119003680T>C	ENSP00000298472:p.Val107Ala	163.0	1.0		176.0	20.0	NM_003054	B2RC96|D3DRC4|Q15876|Q4G147|Q5VW49|Q9H3P6	Missense_Mutation	SNP	ENST00000298472.5	37	CCDS7599.1	.	.	.	.	.	.	.	.	.	.	T	0.818	-0.749743	0.03041	.	.	ENSG00000165646	ENST00000298472	T	0.03831	3.79	5.58	4.45	0.53987	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.471649	0.21747	N	0.069738	T	0.03053	0.0090	N	0.21373	0.66	0.18873	N	0.999989	B	0.02656	0.0	B	0.08055	0.003	T	0.46148	-0.9212	10	0.02654	T	1	-25.5039	8.989	0.36012	0.0:0.1491:0.0:0.8509	.	107	Q05940	VMAT2_HUMAN	A	107	ENSP00000298472:V107A	ENSP00000298472:V107A	V	+	2	0	SLC18A2	118993670	0.004000	0.15560	0.757000	0.31301	0.625000	0.37756	0.396000	0.20867	0.963000	0.38082	0.460000	0.39030	GTG	.		0.512	SLC18A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050563.1	NM_003054	
SLC22A18AS	5003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	2920824	2920824	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:2920824C>G	ENST00000533594.1	-	3	604	c.108G>C	c.(106-108)agG>agC	p.R36S	SLC22A18_ENST00000380574.1_5'Flank|SLC22A18_ENST00000449793.2_5'Flank|SLC22A18_ENST00000312221.5_5'Flank|SLC22A18AS_ENST00000455942.2_Intron|SLC22A18_ENST00000347936.2_5'Flank	NM_007105.2	NP_009036.2	Q8N1D0	BWR1B_HUMAN	solute carrier family 22 (organic cation transporter), member 18 antisense	36										NS(1)|endometrium(2)	3						AAAGCCGCTTCCTCTGGAGGA	0.577																																					p.R36S		.											.	.	.	0			c.G108C						.						53.0	47.0	49.0					11																	2920824		692	1591	2283	SO:0001583	missense	5003	exon3			CCGCTTCCTCTGG	AF035407	CCDS7739.1	11p15.5	2011-02-10	2005-08-23	2005-08-23	ENSG00000254827	ENSG00000254827			10965	protein-coding gene	gene with protein product		603240	"""solute carrier family 22 (organic cation transporter), member 1-like antisense"""	BWSCR1B, ORCTL2S, SLC22A1LS		9570947, 9520460, 15175115	Standard	NM_007105		Approved	BWR1B, p27-BWR1B	uc001lwv.4	Q8N1D0	OTTHUMG00000010038	ENST00000533594.1:c.108G>C	11.37:g.2920824C>G	ENSP00000433282:p.Arg36Ser	49.0	0.0		66.0	17.0	NM_007105	E9PLK8|O43563	Missense_Mutation	SNP	ENST00000533594.1	37	CCDS7739.1	.	.	.	.	.	.	.	.	.	.	C	6.737	0.504739	0.12822	.	.	ENSG00000254827	ENST00000533594	T	0.39056	1.1	2.4	-4.81	0.03180	.	.	.	.	.	T	0.17831	0.0428	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15065	-1.0450	9	0.87932	D	0	.	3.1875	0.06606	0.2076:0.1753:0.5005:0.1166	.	36	E9PLK8	.	S	36	ENSP00000433282:R36S	ENSP00000433282:R36S	R	-	3	2	SLC22A18AS	2877400	0.006000	0.16342	0.000000	0.03702	0.111000	0.19643	-0.598000	0.05706	-1.680000	0.01450	-0.651000	0.03910	AGG	.		0.577	SLC22A18AS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027771.3	NM_007105	
SLC22A8	9376	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	62768191	62768191	+	Splice_Site	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:62768191C>A	ENST00000336232.2	-	3	573		c.e3+1		SLC22A8_ENST00000430500.2_Splice_Site|SLC22A8_ENST00000311438.8_Splice_Site|SLC22A8_ENST00000542795.1_Splice_Site|SLC22A8_ENST00000535878.1_Splice_Site|SLC22A8_ENST00000545207.1_Splice_Site	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8						glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	CCATGTCTCACCTGTCAGACA	0.567																																					.		.											.	SLC22A8	93	0			c.437+1G>T						.						127.0	92.0	104.0					11																	62768191		2201	4298	6499	SO:0001630	splice_region_variant	9376	exon4			GTCTCACCTGTCA	AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.437+1G>T	11.37:g.62768191C>A		125.0	0.0		184.0	8.0	NM_004254	B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Splice_Site	SNP	ENST00000336232.2	37	CCDS8042.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.594840	0.46318	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000545207;ENST00000535878;ENST00000311438;ENST00000430500	.	.	.	4.45	4.45	0.53987	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7761	0.57448	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC22A8	62524767	1.000000	0.71417	1.000000	0.80357	0.588000	0.36517	6.022000	0.70839	2.456000	0.83038	0.313000	0.20887	.	.		0.567	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396191.1	NM_004254	Intron
SLC24A2	25769	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	19528053	19528053	+	Silent	SNP	C	C	T	rs201117303		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr9:19528053C>T	ENST00000341998.2	-	8	1624	c.1563G>A	c.(1561-1563)gcG>gcA	p.A521A	SLC24A2_ENST00000286344.3_Silent_p.A504A	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	521					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		TTACCTGGTGCGCCCACCAGA	0.443													C|||	1	0.000199681	0.0	0.0	5008	,	,		22672	0.001		0.0	False		,,,				2504	0.0				p.A521A		.											.	SLC24A2	517	0			c.G1563A						.						78.0	66.0	70.0					9																	19528053		2201	4300	6501	SO:0001819	synonymous_variant	25769	exon8			CTGGTGCGCCCAC	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.1563G>A	9.37:g.19528053C>T		98.0	1.0		112.0	42.0	NM_020344	B7ZLL8|Q9NTN5|Q9NZQ4	Silent	SNP	ENST00000341998.2	37	CCDS6493.1																																																																																			C|0.999;T|0.000		0.443	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
SNRPN	6638	broad.mit.edu;bcgsc.ca	37	15	25221503	25221503	+	Silent	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr15:25221503G>T	ENST00000400100.1	+	9	1097	c.207G>T	c.(205-207)ctG>ctT	p.L69L	SNRPN_ENST00000390687.4_Silent_p.L69L|SNURF_ENST00000551312.2_Intron|SNRPN_ENST00000400097.1_Silent_p.L69L|SNURF_ENST00000338094.6_3'UTR|SNRPN_ENST00000554227.2_Silent_p.L73L|SNRPN_ENST00000444203.2_Silent_p.L73L|SNRPN_ENST00000577565.1_Silent_p.L69L|SNRPN_ENST00000346403.6_Silent_p.L69L|SNRPN_ENST00000400098.1_Silent_p.L69L	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	69					response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		TTTTGGGTCTGGTGTTGCTGC	0.453									Prader-Willi syndrome																												p.L69L		.											.	SNRPN	469	0			c.G207T						.						93.0	100.0	98.0					15																	25221503		1926	4134	6060	SO:0001819	synonymous_variant	6638	exon9	Familial Cancer Database	Prader-Labhart-Willi syndrome	GGGTCTGGTGTTG	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.207G>T	15.37:g.25221503G>T		128.0	1.0		157.0	7.0	NM_022807	B3KVR1|P14648|P17135|Q0D2Q5	Silent	SNP	ENST00000400100.1	37	CCDS10017.1																																																																																			.		0.453	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413849.10	NM_003097	
SOS1	6654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	39249927	39249927	+	Missense_Mutation	SNP	T	T	C	rs397517149		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:39249927T>C	ENST00000426016.1	-	11	1728	c.1642A>G	c.(1642-1644)Agt>Ggt	p.S548G	SOS1_ENST00000395038.2_Missense_Mutation_p.S548G|SOS1_ENST00000472480.1_5'Flank|SOS1_ENST00000402219.2_Missense_Mutation_p.S548G			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	548	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.		S -> R (in NS4). {ECO:0000269|PubMed:17143282, ECO:0000269|PubMed:17143285, ECO:0000269|PubMed:21387466}.		apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				TCCAGTGTACTCCGGTACTGT	0.383									Noonan syndrome																												p.S548G		.											.	SOS1	851	0			c.A1642G	GRCh37	CM070280	SOS1	M		.						141.0	135.0	137.0					2																	39249927		2203	4300	6503	SO:0001583	missense	6654	exon10	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	GTGTACTCCGGTA	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.1642A>G	2.37:g.39249927T>C	ENSP00000387784:p.Ser548Gly	69.0	0.0		123.0	43.0	NM_005633	A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	37	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	T	17.92	3.506634	0.64410	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038;ENST00000263879	D;D;D	0.88201	-2.35;-2.35;-2.35	5.78	5.78	0.91487	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	D	0.93861	0.8036	M	0.77820	2.39	0.80722	D	1	D;D	0.65815	0.995;0.994	D;P	0.64042	0.921;0.813	D	0.94446	0.7663	10	0.72032	D	0.01	.	16.1027	0.81194	0.0:0.0:0.0:1.0	.	280;548	F5GX06;Q07889	.;SOS1_HUMAN	G	548;548;280;548;548	ENSP00000387784:S548G;ENSP00000384675:S548G;ENSP00000378479:S548G	ENSP00000263879:S548G	S	-	1	0	SOS1	39103431	0.794000	0.28838	1.000000	0.80357	0.924000	0.55760	1.386000	0.34419	2.198000	0.70561	0.455000	0.32223	AGT	.		0.383	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633	
SPI1	6688	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	47381502	47381502	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:47381502G>T	ENST00000378538.3	-	3	454	c.232C>A	c.(232-234)Ccc>Acc	p.P78T	SPI1_ENST00000227163.4_Missense_Mutation_p.P79T|SPI1_ENST00000533968.1_Missense_Mutation_p.P78T|SPI1_ENST00000533030.1_Intron	NM_001080547.1|NM_003120.2	NP_001074016.1|NP_003111.2	P17947	SPI1_HUMAN	Spi-1 proto-oncogene	78					anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|histone H3 acetylation (GO:0043966)|hypermethylation of CpG island (GO:0044027)|lymphocyte differentiation (GO:0030098)|lymphoid progenitor cell differentiation (GO:0002320)|macrophage differentiation (GO:0030225)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of erythrocyte differentiation (GO:0045646)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somatic stem cell maintenance (GO:0035019)	nuclear chromatin (GO:0000790)	core promoter binding (GO:0001047)|NFAT protein binding (GO:0051525)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(4)|ovary(1)	8				Lung(87;0.0967)		AGCTGCGGGGGCTGCACGCTC	0.632																																					p.P79T		.											.	SPI1	226	0			c.C235A						.						52.0	44.0	47.0					11																	47381502		2201	4298	6499	SO:0001583	missense	6688	exon3			GCGGGGGCTGCAC	X52056	CCDS7933.2, CCDS44591.1	11p12-p11.22	2014-06-25	2014-06-25		ENSG00000066336	ENSG00000066336			11241	protein-coding gene	gene with protein product	"""hematopoietic transcription factor PU.1"", ""31 kDa transforming protein"""	165170	"""spleen focus forming virus (SFFV) proviral integration oncogene"""			1693183	Standard	NM_003120		Approved	PU.1, SPI-A, OF, SFPI1, SPI-1	uc001nfb.1	P17947	OTTHUMG00000150150	ENST00000378538.3:c.232C>A	11.37:g.47381502G>T	ENSP00000367799:p.Pro78Thr	23.0	0.0		28.0	9.0	NM_001080547		Missense_Mutation	SNP	ENST00000378538.3	37	CCDS7933.2	.	.	.	.	.	.	.	.	.	.	G	11.36	1.617186	0.28801	.	.	ENSG00000066336	ENST00000378538;ENST00000227163;ENST00000533968	T;T;T	0.46819	0.86;0.86;0.86	3.59	2.66	0.31614	.	0.190216	0.47093	D	0.000247	T	0.59676	0.2211	M	0.65975	2.015	0.39020	D	0.959725	D;B;B	0.76494	0.999;0.003;0.035	D;B;B	0.69479	0.964;0.008;0.029	T	0.60459	-0.7259	10	0.09843	T	0.71	-13.8829	13.3339	0.60505	0.0:0.1594:0.8406:0.0	.	78;78;79	F5H3K6;P17947;P17947-2	.;SPI1_HUMAN;.	T	78;79;78	ENSP00000367799:P78T;ENSP00000227163:P79T;ENSP00000438846:P78T	ENSP00000227163:P79T	P	-	1	0	SPI1	47338078	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.392000	0.34486	0.821000	0.34540	0.655000	0.94253	CCC	.		0.632	SPI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316571.1	NM_003120	
SPCS2	9789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	74676881	74676881	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:74676881C>A	ENST00000263672.6	+	3	311	c.272C>A	c.(271-273)tCc>tAc	p.S91Y	SPCS2_ENST00000528265.1_Intron|RNU6-216P_ENST00000363282.1_RNA|SPCS2_ENST00000530257.1_Intron|SPCS2_ENST00000526361.1_Intron	NM_014752.2	NP_055567.2	Q15005	SPCS2_HUMAN	signal peptidase complex subunit 2 homolog (S. cerevisiae)	91					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)			breast(1)	1						TGTACAATCTCCTGTTTCTTT	0.393																																					p.S91Y		.											.	SPCS2	113	0			c.C272A						.						142.0	132.0	135.0					11																	74676881		1799	4040	5839	SO:0001583	missense	9789	exon3			CAATCTCCTGTTT	D14658	CCDS44681.1	11q13.4	2008-02-05			ENSG00000118363	ENSG00000118363			28962	protein-coding gene	gene with protein product						7788527	Standard	NM_014752		Approved	KIAA0102	uc001ovu.2	Q15005	OTTHUMG00000165517	ENST00000263672.6:c.272C>A	11.37:g.74676881C>A	ENSP00000263672:p.Ser91Tyr	66.0	0.0		68.0	22.0	NM_014752	Q15507|Q3KQT0|Q641R4|Q6FG65|Q6IRX0|Q6P1P4|Q96HU9	Missense_Mutation	SNP	ENST00000263672.6	37	CCDS44681.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.495202	0.85069	.	.	ENSG00000118363	ENST00000263672;ENST00000532972;ENST00000526883	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.79551	0.4465	M	0.80616	2.505	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	T	0.81422	-0.0940	9	0.62326	D	0.03	-1.6163	14.9491	0.71057	0.0:1.0:0.0:0.0	.	91	Q15005	SPCS2_HUMAN	Y	91;122;95	.	ENSP00000263672:S91Y	S	+	2	0	SPCS2	74354529	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.048000	0.76606	2.665000	0.90641	0.563000	0.77884	TCC	.		0.393	SPCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384587.1	NM_014752	
SUN1	23353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	905675	905675	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:905675T>G	ENST00000405266.1	+	17	2086	c.2062T>G	c.(2062-2064)Ttc>Gtc	p.F688V	SUN1_ENST00000456758.2_Missense_Mutation_p.F840V|SUN1_ENST00000425407.2_Missense_Mutation_p.F568V|SUN1_ENST00000401592.1_Missense_Mutation_p.F651V|SUN1_ENST00000413514.2_Missense_Mutation_p.F449V|SUN1_ENST00000389574.3_Missense_Mutation_p.F568V|SUN1_ENST00000452783.2_Missense_Mutation_p.F548V			O94901	SUN1_HUMAN	Sad1 and UNC84 domain containing 1	678	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				cytoskeletal anchoring at nuclear membrane (GO:0090286)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)	acrosomal membrane (GO:0002080)|integral component of nuclear inner membrane (GO:0005639)|nuclear envelope (GO:0005635)|SUN-KASH complex (GO:0034993)				NS(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GCTGTGGTACTTCTCGCAGTC	0.562																																					p.F651V		.											.	SUN1	90	0			c.T1951G						.						89.0	93.0	92.0					7																	905675		2084	4207	6291	SO:0001583	missense	23353	exon16			TGGTACTTCTCGC	AF202724	CCDS43533.1, CCDS47525.1, CCDS55078.1, CCDS55079.1, CCDS55080.1	7p22.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164828	ENSG00000164828			18587	protein-coding gene	gene with protein product	"""Sad1 unc-84 domain protein 1"""	607723	"""unc-84 homolog A (C. elegans)"""	UNC84A		11593002	Standard	NM_001130965		Approved	KIAA0810, FLJ12407	uc021zym.1	O94901	OTTHUMG00000151426	ENST00000405266.1:c.2062T>G	7.37:g.905675T>G	ENSP00000384116:p.Phe688Val	82.0	0.0		189.0	87.0	NM_001130965	A5PL20|B3KMV7|B4DZF7|B7WNY4|B7WP53|E9PDU4|E9PF23|F8WD13|Q96CZ7|Q9HA14|Q9UH98	Missense_Mutation	SNP	ENST00000405266.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.1|22.1	4.239995|4.239995	0.79912|0.79912	.|.	.|.	ENSG00000164828|ENSG00000164828	ENST00000456758;ENST00000389574;ENST00000452783;ENST00000405266;ENST00000401592;ENST00000297445;ENST00000425407;ENST00000429178;ENST00000413514|ENST00000433212	T;T;T;T;T;T;T;T|.	0.43294|.	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95|.	4.94|4.94	4.94|4.94	0.65067|0.65067	Sad1/UNC-like, C-terminal (2);|.	0.252686|.	0.48286|.	D|.	0.000195|.	T|T	0.76300|0.76300	0.3968|0.3968	M|M	0.81682|0.81682	2.555|2.555	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	0.999;0.999;0.996;1.0;0.994;0.994|.	D;D;D;D;P;P|.	0.78314|.	0.985;0.985;0.955;0.991;0.904;0.899|.	T|T	0.78578|0.78578	-0.2150|-0.2150	10|5	0.44086|.	T|.	0.13|.	-27.9778|-27.9778	14.6072|14.6072	0.68489|0.68489	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	449;548;651;840;678;568|.	E7EP45;E9PDU4;E9PF23;A4D2Q0;O94901;O94901-5|.	.;.;.;.;SUN1_HUMAN;.|.	V|R	840;568;548;688;651;678;568;576;449|499	ENSP00000388743:F840V;ENSP00000374225:F568V;ENSP00000413439:F548V;ENSP00000384116:F688V;ENSP00000384015:F651V;ENSP00000392309:F568V;ENSP00000409909:F576V;ENSP00000389313:F449V|.	ENSP00000297445:F678V|.	F|L	+|+	1|2	0|0	SUN1|SUN1	872201|872201	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	2.548000|2.548000	0.45794|0.45794	1.859000|1.859000	0.53934|0.53934	0.533000|0.533000	0.62120|0.62120	TTC|CTT	.		0.562	SUN1-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000322566.1	NM_025154	
SUPT6H	6830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27023949	27023949	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:27023949G>A	ENST00000314616.6	+	30	4341	c.4058G>A	c.(4057-4059)gGt>gAt	p.G1353D	SUPT6H_ENST00000347486.4_Missense_Mutation_p.G1353D	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1353	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					ATGGACCAGGGTGATGTGATT	0.498																																					p.G1353D		.											.	SUPT6H	93	0			c.G4058A						.						169.0	140.0	150.0					17																	27023949		2203	4300	6503	SO:0001583	missense	6830	exon30			ACCAGGGTGATGT	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.4058G>A	17.37:g.27023949G>A	ENSP00000319104:p.Gly1353Asp	183.0	0.0		265.0	91.0	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	34	5.399209	0.96030	.	.	ENSG00000109111	ENST00000314616	D	0.81739	-1.53	5.94	5.94	0.96194	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.93426	0.7903	H	0.95114	3.625	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94444	0.7661	10	0.87932	D	0	-18.8388	20.3594	0.98849	0.0:0.0:1.0:0.0	.	1353	Q7KZ85	SPT6H_HUMAN	D	1353	ENSP00000319104:G1353D	ENSP00000319104:G1353D	G	+	2	0	SUPT6H	24048076	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.359000	0.97115	2.816000	0.96949	0.563000	0.77884	GGT	.		0.498	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
SYNE2	23224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	64457170	64457170	+	Silent	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr14:64457170A>G	ENST00000344113.4	+	20	2567	c.2355A>G	c.(2353-2355)gcA>gcG	p.A785A	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Silent_p.A785A|SYNE2_ENST00000358025.3_Silent_p.A785A	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	785					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGCTTATGGCAAGAAGTGAAG	0.338																																					p.A785A		.											.	SYNE2	164	0			c.A2355G						.						92.0	88.0	89.0					14																	64457170		1835	4098	5933	SO:0001819	synonymous_variant	23224	exon20			TATGGCAAGAAGT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.2355A>G	14.37:g.64457170A>G		139.0	0.0		144.0	18.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	37	CCDS41963.1																																																																																			.		0.338	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
SYNPR	132204	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	63594864	63594864	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:63594864G>A	ENST00000295894.5	+	4	781	c.412G>A	c.(412-414)Gga>Aga	p.G138R	SYNPR_ENST00000465156.1_Intron|SYNPR_ENST00000478744.1_3'UTR|SYNPR_ENST00000460711.1_Missense_Mutation_p.G149R|SYNPR_ENST00000479198.1_Missense_Mutation_p.G138R|SYNPR_ENST00000478300.1_Missense_Mutation_p.G158R	NM_144642.4	NP_653243.1	Q8TBG9	SYNPR_HUMAN	synaptoporin	138	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.					cell junction (GO:0030054)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)	transporter activity (GO:0005215)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	8				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)		TTGGGCAAAAGGACTGTCTGA	0.433																																					p.G158R	NSCLC(29;1052 1116 20025 32519)	.											.	.	.	0			c.G472A						.						163.0	157.0	159.0					3																	63594864		1992	4156	6148	SO:0001583	missense	132204	exon5			GCAAAAGGACTGT	AF411860	CCDS46859.1, CCDS46860.1	3p14.3	2011-07-28			ENSG00000163630	ENSG00000163630			16507	protein-coding gene	gene with protein product						8034131, 12974474	Standard	NM_144642		Approved	MGC26651, SPO	uc003dlp.3	Q8TBG9	OTTHUMG00000158699	ENST00000295894.5:c.412G>A	3.37:g.63594864G>A	ENSP00000295894:p.Gly138Arg	172.0	1.0		219.0	64.0	NM_001130003	B2R675|G5E9W4	Missense_Mutation	SNP	ENST00000295894.5	37	CCDS46860.1	.	.	.	.	.	.	.	.	.	.	G	35	5.459054	0.96240	.	.	ENSG00000163630	ENST00000478300;ENST00000295894;ENST00000479198;ENST00000460711	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	5.86	5.86	0.93980	Marvel (1);MARVEL-like domain (1);	0.150253	0.64402	D	0.000014	T	0.61515	0.2353	M	0.84683	2.71	0.80722	D	1	D;D;D	0.63046	0.992;0.992;0.989	D;D;P	0.65443	0.935;0.935;0.893	T	0.64791	-0.6324	10	0.87932	D	0	-12.0916	19.5509	0.95319	0.0:0.0:1.0:0.0	.	149;138;158	B3KVD8;Q8TBG9;G5E9W4	.;SYNPR_HUMAN;.	R	158;138;138;149	ENSP00000418994:G158R;ENSP00000295894:G138R;ENSP00000418929:G138R;ENSP00000418701:G149R	ENSP00000295894:G138R	G	+	1	0	SYNPR	63569904	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.813000	0.99286	2.937000	0.99478	0.650000	0.86243	GGA	.		0.433	SYNPR-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351787.1		
SYT5	6861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55686689	55686689	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:55686689C>A	ENST00000354308.3	-	6	928	c.559G>T	c.(559-561)Ggg>Tgg	p.G187W	SYT5_ENST00000592935.1_5'Flank|SYT5_ENST00000537500.1_Missense_Mutation_p.G187W|SYT5_ENST00000590851.1_Missense_Mutation_p.G184W|CTD-2587H24.5_ENST00000591665.1_RNA	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	187	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		ACCCTGCCCCCCAGCTCCACG	0.617																																					p.G187W		.											.	SYT5	90	0			c.G559T						.						35.0	30.0	32.0					19																	55686689		2202	4300	6502	SO:0001583	missense	6861	exon6			TGCCCCCCAGCTC	X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.559G>T	19.37:g.55686689C>A	ENSP00000346265:p.Gly187Trp	35.0	0.0		56.0	12.0	NM_003180	B3KWJ8|B7Z300|Q86X72	Missense_Mutation	SNP	ENST00000354308.3	37	CCDS12919.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.016193	0.93404	.	.	ENSG00000129990	ENST00000537500;ENST00000354308;ENST00000543844	T;T	0.69435	-0.4;-0.4	4.26	4.26	0.50523	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.000000	0.85682	D	0.000000	T	0.76877	0.4049	L	0.46947	1.48	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	0.995;1.0;0.995	T	0.79490	-0.1782	10	0.66056	D	0.02	.	16.3268	0.82986	0.0:1.0:0.0:0.0	.	184;187;187	B7Z300;Q4FD32;O00445	.;.;SYT5_HUMAN	W	187;187;184	ENSP00000442896:G187W;ENSP00000346265:G187W	ENSP00000346265:G187W	G	-	1	0	SYT5	60378501	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	5.861000	0.69553	2.329000	0.79093	0.555000	0.69702	GGG	.		0.617	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452501.1	NM_003180	
TAAR9	134860	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	132859671	132859671	+	RNA	SNP	G	G	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr6:132859671G>C	ENST00000434551.1	+	0	243					NM_175057.3	NP_778227.3	Q96RI9	TAAR9_HUMAN	trace amine associated receptor 9 (gene/pseudogene)						G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)					Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)		ACTTCTTGGTGGGAGTCACTG	0.463																																					.	Colon(10;433 445 15992 45047 47213)	.											.	.	.	0			.						.						190.0	185.0	186.0					6																	132859671		2181	4291	6472			134860	.			CTTGGTGGGAGTC	AF380189	CCDS75520.1	6q23.2	2013-10-02	2010-03-12	2005-02-24	ENSG00000237110	ENSG00000237110		"""GPCR / Class A : Trace amine associated receptors"""	20977	protein-coding gene	gene with protein product		608282	"""trace amine receptor 3"", ""trace amine associated receptor 9"""	TRAR3		15718104	Standard	NM_175057		Approved	TA3, TAR3	uc011eci.2	Q96RI9	OTTHUMG00000015578		6.37:g.132859671G>C		205.0	0.0		312.0	119.0	.		RNA	SNP	ENST00000434551.1	37																																																																																				.		0.463	TAAR9-001	KNOWN	mRNA_end_NF|cds_end_NF|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000042254.2	NM_175057	
TBX20	57057	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	35242186	35242186	+	Silent	SNP	C	C	A	rs541075247	byFrequency	TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:35242186C>A	ENST00000408931.3	-	8	1726	c.1200G>T	c.(1198-1200)tcG>tcT	p.S400S		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	400					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						TGGCAATGGCCGATGGTGTCA	0.562																																					p.S400S		.											.	TBX20	90	0			c.G1200T						.						82.0	80.0	80.0					7																	35242186		1998	4185	6183	SO:0001819	synonymous_variant	57057	exon8			AATGGCCGATGGT	AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.1200G>T	7.37:g.35242186C>A		270.0	1.0		425.0	95.0	NM_001077653	A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Silent	SNP	ENST00000408931.3	37	CCDS43568.1																																																																																			.		0.562	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216870.2	NM_020417	
TEX2	55852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	62248484	62248484	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:62248484A>T	ENST00000583097.1	-	7	2819	c.2647T>A	c.(2647-2649)Ttc>Atc	p.F883I	TEX2_ENST00000258991.3_Missense_Mutation_p.F890I|TEX2_ENST00000584379.1_Missense_Mutation_p.F883I			Q8IWB9	TEX2_HUMAN	testis expressed 2	883					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		TAAGGCTTGAAGGCCTGGAGG	0.448																																					p.F890I		.											.	TEX2	91	0			c.T2668A						.						130.0	106.0	114.0					17																	62248484		2203	4300	6503	SO:0001583	missense	55852	exon7			GCTTGAAGGCCTG	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.2647T>A	17.37:g.62248484A>T	ENSP00000462665:p.Phe883Ile	131.0	0.0		219.0	30.0	NM_018469	Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	ENST00000583097.1	37		.	.	.	.	.	.	.	.	.	.	A	17.10	3.302815	0.60195	.	.	ENSG00000136478	ENST00000258991	T	0.42900	0.96	6.03	6.03	0.97812	Domain of unknown function DUF2404 (1);	0.052460	0.85682	D	0.000000	T	0.42040	0.1185	N	0.22421	0.69	0.58432	D	0.999998	P;P	0.42375	0.778;0.719	P;P	0.48738	0.452;0.588	T	0.25779	-1.0122	10	0.41790	T	0.15	-21.5077	16.5602	0.84551	1.0:0.0:0.0:0.0	.	890;883	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	I	890	ENSP00000258991:F890I	ENSP00000258991:F890I	F	-	1	0	TEX2	59602216	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.932000	0.92897	2.313000	0.78055	0.454000	0.30748	TTC	.		0.448	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
TEX26	122046	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	31549019	31549019	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr13:31549019G>A	ENST00000380473.3	+	7	858	c.845G>A	c.(844-846)tGt>tAt	p.C282Y	TEX26_ENST00000530916.1_3'UTR|RP11-252M21.6_ENST00000433788.1_RNA	NM_152325.1	NP_689538.1	Q8N6G2	TEX26_HUMAN	testis expressed 26	282																	CGTACTCACTGTGACACTAAC	0.303																																					p.C282Y		.											.	.	.	0			c.G845A						.						60.0	55.0	57.0					13																	31549019		2194	4294	6488	SO:0001583	missense	122046	exon7			CTCACTGTGACAC	BC030277	CCDS9339.1	13q12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000175664	ENSG00000175664			28622	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 26"""	C13orf26		12477932	Standard	NM_152325		Approved	MGC40178	uc001uti.3	Q8N6G2	OTTHUMG00000016682	ENST00000380473.3:c.845G>A	13.37:g.31549019G>A	ENSP00000369840:p.Cys282Tyr	58.0	0.0		101.0	20.0	NM_152325		Missense_Mutation	SNP	ENST00000380473.3	37	CCDS9339.1	.	.	.	.	.	.	.	.	.	.	G	1.967	-0.437424	0.04636	.	.	ENSG00000175664	ENST00000380473	T	0.41400	1.0	4.09	2.11	0.27256	.	0.722447	0.13951	N	0.351502	T	0.22742	0.0549	L	0.29908	0.895	0.09310	N	1	B	0.20550	0.046	B	0.17722	0.019	T	0.30679	-0.9970	10	0.02654	T	1	-1.8397	5.5663	0.17173	0.2927:0.0:0.7073:0.0	.	282	Q8N6G2	CM026_HUMAN	Y	282	ENSP00000369840:C282Y	ENSP00000369840:C282Y	C	+	2	0	C13orf26	30447019	0.750000	0.28316	0.106000	0.21319	0.035000	0.12851	0.213000	0.17521	0.535000	0.28714	0.655000	0.94253	TGT	.		0.303	TEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044380.2	NM_152325	
TGFB1I1	7041	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	31487440	31487440	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr16:31487440C>A	ENST00000394863.3	+	8	952	c.822C>A	c.(820-822)ttC>ttA	p.F274L	TGFB1I1_ENST00000567607.1_Missense_Mutation_p.F257L|TGFB1I1_ENST00000361773.3_Missense_Mutation_p.F257L|TGFB1I1_ENST00000394858.2_Missense_Mutation_p.F257L	NM_001042454.2	NP_001035919.1	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced transcript 1	274	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				androgen receptor signaling pathway (GO:0030521)|cell adhesion (GO:0007155)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|response to heat (GO:0009408)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|I-SMAD binding (GO:0070411)|Roundabout binding (GO:0048495)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(8)|upper_aerodigestive_tract(1)	9						GAGCCCCCTTCTGCCCCGAGT	0.677																																					p.F274L		.											.	TGFB1I1	90	0			c.C822A						.						66.0	59.0	61.0					16																	31487440		2197	4300	6497	SO:0001583	missense	7041	exon8			CCCCTTCTGCCCC	AB007836	CCDS10713.1, CCDS42156.1	16p11	2008-02-05			ENSG00000140682	ENSG00000140682			11767	protein-coding gene	gene with protein product		602353				9422762, 10075738	Standard	NM_015927		Approved	Hic-5, TSC-5, ARA55, HIC-5	uc002ecd.2	O43294	OTTHUMG00000132467	ENST00000394863.3:c.822C>A	16.37:g.31487440C>A	ENSP00000378332:p.Phe274Leu	63.0	0.0		76.0	19.0	NM_001042454	B2R8D5|Q9BPW3|Q9Y2V5	Missense_Mutation	SNP	ENST00000394863.3	37	CCDS42156.1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767115	0.69878	.	.	ENSG00000140682	ENST00000394863;ENST00000361773;ENST00000394858	D;D;D	0.87412	-2.25;-2.25;-2.25	5.4	2.06	0.26882	Zinc finger, LIM-type (4);	0.054439	0.85682	D	0.000000	T	0.77198	0.4095	N	0.16066	0.365	0.46774	D	0.999196	B	0.26445	0.149	B	0.36766	0.232	T	0.66364	-0.5942	10	0.39692	T	0.17	.	7.5762	0.27937	0.0:0.623:0.0:0.377	.	274	O43294	TGFI1_HUMAN	L	274;257;257	ENSP00000378332:F274L;ENSP00000355117:F257L;ENSP00000378327:F257L	ENSP00000355117:F257L	F	+	3	2	TGFB1I1	31394941	0.999000	0.42202	1.000000	0.80357	0.988000	0.76386	0.719000	0.25881	0.240000	0.21263	0.655000	0.94253	TTC	.		0.677	TGFB1I1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255630.3		
THSD7B	80731	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	137990568	137990568	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:137990568C>T	ENST00000409968.1	+	9	2193	c.2015C>T	c.(2014-2016)cCt>cTt	p.P672L	THSD7B_ENST00000272643.3_Missense_Mutation_p.P672L|THSD7B_ENST00000413152.2_Missense_Mutation_p.P641L|THSD7B_ENST00000543459.1_Intron			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	672	TSP type-1 8. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)		p.P672L(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CCTTGGGGCCCTTGTTCTGAG	0.522																																					.		.											.	THSD7B	75	1	Substitution - Missense(1)	skin(1)	.						.						116.0	115.0	115.0					2																	137990568		2001	4182	6183	SO:0001583	missense	80731	.			GGGGCCCTTGTTC			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.2015C>T	2.37:g.137990568C>T	ENSP00000387145:p.Pro672Leu	227.0	1.0		344.0	86.0	.		Missense_Mutation	SNP	ENST00000409968.1	37		.	.	.	.	.	.	.	.	.	.	C	7.813	0.716160	0.15306	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.61859	0.07;0.07;0.07	5.65	5.65	0.86999	.	0.254310	0.47455	D	0.000239	T	0.49423	0.1556	L	0.38733	1.17	0.80722	D	1	B;B	0.15719	0.012;0.014	B;B	0.23419	0.023;0.046	T	0.35822	-0.9773	10	0.29301	T	0.29	.	14.8661	0.70416	0.1436:0.8564:0.0:0.0	.	672;641	Q9C0I4;C9JKN6	THS7B_HUMAN;.	L	672;672;641	ENSP00000387145:P672L;ENSP00000272643:P672L;ENSP00000413841:P641L	ENSP00000272643:P672L	P	+	2	0	THSD7B	137707038	0.001000	0.12720	0.935000	0.37517	0.149000	0.21700	0.935000	0.28924	2.826000	0.97356	0.491000	0.48974	CCT	.		0.522	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
TICAM1	148022	broad.mit.edu;mdanderson.org	37	19	4818030	4818030	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:4818030T>G	ENST00000248244.5	-	2	589	c.360A>C	c.(358-360)gaA>gaC	p.E120D		NM_182919.3	NP_891549.1	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	120					apoptotic signaling pathway (GO:0097190)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of protein homodimerization activity (GO:0043496)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|ripoptosome (GO:0097342)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		TGCGGACGGCTTCCTGGTAGG	0.672																																					p.E120D		.											.	TICAM1	153	0			c.A360C						.						53.0	52.0	52.0					19																	4818030		2203	4300	6503	SO:0001583	missense	148022	exon2			GACGGCTTCCTGG	AB086380	CCDS12136.1	19p13.3	2014-09-17				ENSG00000127666			18348	protein-coding gene	gene with protein product		607601				12539043, 12471095	Standard	NM_182919		Approved	TRIF, TICAM-1, MGC35334, PRVTIRB	uc002mbi.4	Q8IUC6		ENST00000248244.5:c.360A>C	19.37:g.4818030T>G	ENSP00000248244:p.Glu120Asp	36.0	0.0		30.0	5.0	NM_182919	B3Y691|O75532|Q86XP8|Q96GA0	Missense_Mutation	SNP	ENST00000248244.5	37	CCDS12136.1	.	.	.	.	.	.	.	.	.	.	T	13.30	2.196096	0.38806	.	.	ENSG00000127666	ENST00000248244	T	0.45276	0.9	4.61	-9.22	0.00675	.	0.967588	0.08396	N	0.952163	T	0.13713	0.0332	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.13361	-1.0512	10	0.24483	T	0.36	-2.4074	1.4102	0.02290	0.3736:0.2591:0.0826:0.2846	.	120	Q8IUC6	TCAM1_HUMAN	D	120	ENSP00000248244:E120D	ENSP00000248244:E120D	E	-	3	2	TICAM1	4769030	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-1.828000	0.01702	-1.466000	0.01897	-0.425000	0.05940	GAA	.		0.672	TICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450435.1	NM_014261	
TMEM194B	100131211	broad.mit.edu;bcgsc.ca	37	2	191383480	191383480	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:191383480T>C	ENST00000409150.3	-	4	566	c.500A>G	c.(499-501)tAt>tGt	p.Y167C	TMEM194B_ENST00000492292.1_5'UTR	NM_001142645.1	NP_001136117.1	A6NFY4	T194B_HUMAN	transmembrane protein 194B	167						integral component of membrane (GO:0016021)											GGTCCTTGCATAAAAGAAAAG	0.318																																					p.Y167C		.											.	.	.	0			c.A500G						.						92.0	75.0	80.0					2																	191383480		692	1590	2282	SO:0001583	missense	100131211	exon4			CTTGCATAAAAGA		CCDS46476.1	2q32.2	2008-06-10			ENSG00000189362	ENSG00000189362			33700	protein-coding gene	gene with protein product							Standard	NM_001142645		Approved		uc010zgf.2	A6NFY4	OTTHUMG00000154454	ENST00000409150.3:c.500A>G	2.37:g.191383480T>C	ENSP00000386292:p.Tyr167Cys	90.0	0.0		113.0	6.0	NM_001142645	B4DYG6	Missense_Mutation	SNP	ENST00000409150.3	37	CCDS46476.1	.	.	.	.	.	.	.	.	.	.	T	6.687	0.495412	0.12762	.	.	ENSG00000189362	ENST00000409150	T	0.42131	0.98	4.67	2.23	0.28157	Domain of unknown function DUF2215 (1);	1.017390	0.07848	N	0.964102	T	0.50411	0.1614	L	0.49126	1.545	0.24003	N	0.996202	D	0.71674	0.998	P	0.61275	0.886	T	0.27773	-1.0064	10	0.35671	T	0.21	.	4.6004	0.12350	0.2958:0.0851:0.0:0.6191	.	167	A6NFY4	T194B_HUMAN	C	167	ENSP00000386292:Y167C	ENSP00000386292:Y167C	Y	-	2	0	TMEM194B	191091725	0.986000	0.35501	0.548000	0.28192	0.171000	0.22731	0.422000	0.21296	0.283000	0.22279	0.459000	0.35465	TAT	.		0.318	TMEM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335299.1	XM_001723498	
TNRC6A	27327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	24834929	24834929	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr16:24834929T>G	ENST00000395799.3	+	25	5819	c.5690T>G	c.(5689-5691)cTc>cGc	p.L1897R	TNRC6A_ENST00000432286.2_Missense_Mutation_p.L375R|TNRC6A_ENST00000315183.7_Missense_Mutation_p.L1848R	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1897	Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		CGGACCGATCTCAATCACTGG	0.612																																					p.L1897R		.											.	TNRC6A	92	0			c.T5690G						.						114.0	113.0	114.0					16																	24834929		2197	4300	6497	SO:0001583	missense	27327	exon25			CCGATCTCAATCA	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.5690T>G	16.37:g.24834929T>G	ENSP00000379144:p.Leu1897Arg	122.0	0.0		138.0	27.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	t	8.042	0.764075	0.15914	.	.	ENSG00000090905	ENST00000315183;ENST00000395799;ENST00000432286	T;T	0.13089	2.63;2.62	5.64	5.64	0.86602	.	0.227351	0.39341	N	0.001385	T	0.15089	0.0364	L	0.39898	1.24	0.33298	D	0.564448	D;B	0.54207	0.965;0.412	P;B	0.47981	0.563;0.121	T	0.16808	-1.0390	10	0.21540	T	0.41	-0.1468	10.9817	0.47499	0.0:0.0724:0.0:0.9276	.	1848;1897	Q8NDV7-6;Q8NDV7	.;TNR6A_HUMAN	R	1848;1897;375	ENSP00000326900:L1848R;ENSP00000379144:L1897R	ENSP00000326900:L1848R	L	+	2	0	TNRC6A	24742430	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.545000	0.60698	2.132000	0.65825	0.529000	0.55759	CTC	.		0.612	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
TNXB	7148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32036335	32036335	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr6:32036335G>C	ENST00000375244.3	-	17	6253	c.6052C>G	c.(6052-6054)Ctg>Gtg	p.L2018V	TNXB_ENST00000375247.2_Missense_Mutation_p.L2018V			P22105	TENX_HUMAN	tenascin XB	2100	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TACTGGACCAGGAAGTGGTCA	0.617																																					p.L2018V		.											.	TNXB	90	0			c.C6052G						.						42.0	46.0	45.0					6																	32036335		2005	4172	6177	SO:0001583	missense	7148	exon17			GGACCAGGAAGTG	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.6052C>G	6.37:g.32036335G>C	ENSP00000364393:p.Leu2018Val	163.0	0.0		239.0	37.0	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	G	9.639	1.138385	0.21123	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.57107	0.42;0.42	5.33	-0.283	0.12874	.	0.809168	0.10468	N	0.671168	T	0.13372	0.0324	N	0.21324	0.655	0.19300	N	0.999979	B	0.22003	0.063	B	0.21360	0.034	T	0.25676	-1.0125	10	0.25751	T	0.34	.	4.2941	0.10892	0.0774:0.3566:0.3359:0.2301	.	2018	P22105-3	.	V	2018	ENSP00000364393:L2018V;ENSP00000364396:L2018V	ENSP00000364393:L2018V	L	-	1	2	TNXB	32144313	0.001000	0.12720	0.999000	0.59377	0.647000	0.38526	-1.333000	0.02667	0.183000	0.20059	0.655000	0.94253	CTG	.		0.617	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
TRIP12	9320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	230632438	230632438	+	Silent	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:230632438T>A	ENST00000283943.5	-	41	5989	c.5811A>T	c.(5809-5811)acA>acT	p.T1937T	TRIP12_ENST00000389044.4_Silent_p.T1985T|TRIP12_ENST00000389045.3_Silent_p.T1667T	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1937	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TTCGGACAATTGTCAAAGGTG	0.373																																					p.T1937T		.											.	TRIP12	572	0			c.A5811T						.						100.0	101.0	101.0					2																	230632438		2203	4300	6503	SO:0001819	synonymous_variant	9320	exon41			GACAATTGTCAAA	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.5811A>T	2.37:g.230632438T>A		37.0	0.0		71.0	18.0	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	ENST00000283943.5	37	CCDS33391.1																																																																																			.		0.373	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
UPF3A	65110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	115052106	115052106	+	Splice_Site	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr13:115052106T>C	ENST00000375299.3	+	5	687		c.e5+2		UPF3A_ENST00000351487.5_Splice_Site|UPF3A_ENST00000475218.2_Splice_Site	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)						gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		AGCTCATTGGTCTGTTTTGCT	0.408																																					.		.											.	UPF3A	91	0			c.532+2T>C						.						52.0	48.0	49.0					13																	115052106		2203	4300	6503	SO:0001630	splice_region_variant	65110	exon4			CATTGGTCTGTTT	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.631+2T>C	13.37:g.115052106T>C		175.0	0.0		237.0	23.0	NM_080687	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Splice_Site	SNP	ENST00000375299.3	37	CCDS9543.1	.	.	.	.	.	.	.	.	.	.	T	13.34	2.207740	0.39003	.	.	ENSG00000169062	ENST00000375299;ENST00000351487;ENST00000543577	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1071	0.72329	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	UPF3A	114070208	1.000000	0.71417	1.000000	0.80357	0.283000	0.27025	7.172000	0.77604	1.978000	0.57642	0.459000	0.35465	.	.		0.408	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		Intron
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	216040372	216040372	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:216040372A>G	ENST00000307340.3	-	44	9208	c.8822T>C	c.(8821-8823)aTc>aCc	p.I2941T	USH2A_ENST00000366943.2_Missense_Mutation_p.I2941T	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2941	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CCTCACGTCGATGGCTGTGTG	0.453										HNSCC(13;0.011)																											p.I2941T		.											.	USH2A	115	0			c.T8822C						.						166.0	136.0	146.0					1																	216040372		2203	4300	6503	SO:0001583	missense	7399	exon44			ACGTCGATGGCTG	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.8822T>C	1.37:g.216040372A>G	ENSP00000305941:p.Ile2941Thr	127.0	0.0		218.0	22.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.436146	0.83885	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.59502	0.26;0.26	5.72	4.56	0.56223	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.142993	0.30949	N	0.008560	T	0.59569	0.2203	M	0.77103	2.36	0.19300	N	0.999976	P	0.39717	0.684	B	0.38378	0.272	T	0.58278	-0.7664	10	0.72032	D	0.01	.	12.7915	0.57537	0.8631:0.1368:0.0:0.0	.	2941	O75445	USH2A_HUMAN	T	2941	ENSP00000305941:I2941T;ENSP00000355910:I2941T	ENSP00000305941:I2941T	I	-	2	0	USH2A	214106995	0.996000	0.38824	0.357000	0.25798	0.840000	0.47671	3.970000	0.56824	0.952000	0.37798	0.455000	0.32223	ATC	.		0.453	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	216371756	216371756	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:216371756C>T	ENST00000307340.3	-	18	4368	c.3982G>A	c.(3982-3984)Ggc>Agc	p.G1328S	USH2A_ENST00000366942.3_Missense_Mutation_p.G1328S|RP5-1099E6.3_ENST00000420867.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.G1328S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1328	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGCTCCAAGCCAGTGATGGTT	0.453										HNSCC(13;0.011)																											p.G1328S		.											.	USH2A	115	0			c.G3982A						.						138.0	128.0	131.0					1																	216371756		2203	4300	6503	SO:0001583	missense	7399	exon18			CCAAGCCAGTGAT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3982G>A	1.37:g.216371756C>T	ENSP00000305941:p.Gly1328Ser	115.0	0.0		191.0	13.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850455	0.71719	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.61274	0.12;0.34;0.34	5.69	5.69	0.88448	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.309756	0.22942	N	0.053763	T	0.66376	0.2783	M	0.76433	2.335	0.35137	D	0.768545	P;P	0.45715	0.837;0.865	P;P	0.49999	0.628;0.61	T	0.73927	-0.3828	10	0.36615	T	0.2	.	13.0738	0.59075	0.0:0.9268:0.0:0.0732	.	1328;1328	O75445-2;O75445	.;USH2A_HUMAN	S	1328	ENSP00000305941:G1328S;ENSP00000355910:G1328S;ENSP00000355909:G1328S	ENSP00000305941:G1328S	G	-	1	0	USH2A	214438379	0.788000	0.28762	0.989000	0.46669	0.449000	0.32228	2.716000	0.47219	2.688000	0.91661	0.650000	0.86243	GGC	.		0.453	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
USP17L2	377630	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	11995368	11995368	+	Missense_Mutation	SNP	A	A	G	rs528142888		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr8:11995368A>G	ENST00000333796.3	-	1	1218	c.902T>C	c.(901-903)cTt>cCt	p.L301P	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	301	USP.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						CTGCATGTCAAGGCACTCAGG	0.493													A|||	1	0.000199681	0.0	0.0	5008	,	,		25383	0.0		0.001	False		,,,				2504	0.0				p.L301P		.											.	USP17L2	435	0			c.T902C						.						17.0	18.0	18.0					8																	11995368		1135	2717	3852	SO:0001583	missense	377630	exon1			ATGTCAAGGCACT	BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.902T>C	8.37:g.11995368A>G	ENSP00000333329:p.Leu301Pro	176.0	0.0		220.0	22.0	NM_201402		Missense_Mutation	SNP	ENST00000333796.3	37	CCDS43713.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.595360	0.46318	.	.	ENSG00000223443	ENST00000333796	T	0.19806	2.12	0.935	0.935	0.19483	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.45867	D	0.000332	T	0.58466	0.2124	H	0.99415	4.555	0.58432	D	0.999994	D	0.71674	0.998	D	0.72982	0.979	T	0.63056	-0.6722	10	0.87932	D	0	.	6.158	0.20348	1.0:0.0:0.0:0.0	.	301	Q6R6M4	U17L2_HUMAN	P	301	ENSP00000333329:L301P	ENSP00000333329:L301P	L	-	2	0	USP17L2	12032777	0.891000	0.30450	0.071000	0.20095	0.320000	0.28249	5.778000	0.68940	0.728000	0.32382	0.386000	0.25728	CTT	.		0.493	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383303.2	NM_201402	
VWDE	221806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	12409576	12409576	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:12409576C>A	ENST00000275358.3	-	12	2544	c.2356G>T	c.(2356-2358)Gat>Tat	p.D786Y		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	786						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						TGCTGTACATCCTCAGCATGG	0.498																																					p.D786Y		.											.	VWDE	68	0			c.G2356T						.						86.0	69.0	74.0					7																	12409576		692	1591	2283	SO:0001583	missense	221806	exon12			GTACATCCTCAGC		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.2356G>T	7.37:g.12409576C>A	ENSP00000275358:p.Asp786Tyr	112.0	0.0		158.0	65.0	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	37	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	C	13.42	2.231088	0.39399	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	D	0.82893	-1.66	4.93	4.05	0.47172	.	0.782162	0.11761	N	0.532120	T	0.80914	0.4715	L	0.51422	1.61	0.09310	N	0.999999	P	0.45283	0.855	B	0.42214	0.38	T	0.71540	-0.4562	10	0.62326	D	0.03	.	13.1308	0.59380	0.0:0.9229:0.0:0.0771	.	786	Q8N2E2	VWDE_HUMAN	Y	786;240	ENSP00000275358:D786Y	ENSP00000275358:D786Y	D	-	1	0	VWDE	12376101	0.035000	0.19736	0.404000	0.26397	0.301000	0.27625	2.668000	0.46816	1.312000	0.45043	0.655000	0.94253	GAT	.		0.498	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
WIZ	58525	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15538010	15538010	+	Silent	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:15538010G>A	ENST00000389282.4	-	6	3648	c.3435C>T	c.(3433-3435)ggC>ggT	p.G1145G	WIZ_ENST00000545156.1_Silent_p.G459G|WIZ_ENST00000599686.3_Silent_p.G329G|WIZ_ENST00000263381.7_Silent_p.G288G|WIZ_ENST00000599910.2_Silent_p.G462G			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	1145	Pro-rich.				positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						CCAGGGGGCTGCCCGGTGGTG	0.647																																					p.G288G		.											.	WIZ	68	0			c.C864T						.						42.0	48.0	46.0					19																	15538010		2029	4181	6210	SO:0001819	synonymous_variant	58525	exon4			GGGGCTGCCCGGT	AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.3435C>T	19.37:g.15538010G>A		94.0	1.0		107.0	34.0	NM_021241	B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Silent	SNP	ENST00000389282.4	37																																																																																				.		0.647	WIZ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021241	
XPO6	23214	broad.mit.edu;ucsc.edu	37	16	28167815	28167815	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr16:28167815C>T	ENST00000304658.5	-	7	1177	c.677G>A	c.(676-678)aGt>aAt	p.S226N	XPO6_ENST00000565698.1_Missense_Mutation_p.S212N|XPO6_ENST00000561488.1_5'Flank	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	226					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						TTTGGCTGAACTGGGACTCTG	0.428																																					p.S226N		.											.	XPO6	227	0			c.G677A						.						84.0	80.0	82.0					16																	28167815		1899	4142	6041	SO:0001583	missense	23214	exon7			GCTGAACTGGGAC	AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.677G>A	16.37:g.28167815C>T	ENSP00000302790:p.Ser226Asn	64.0	1.0		93.0	11.0	NM_015171	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	ENST00000304658.5	37	CCDS42135.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.522962	0.44866	.	.	ENSG00000169180	ENST00000304658	T	0.49139	0.79	5.87	5.87	0.94306	Exportin-1/Importin-beta-like (1);Armadillo-type fold (1);	0.132588	0.64402	D	0.000001	T	0.28928	0.0718	N	0.11560	0.145	0.40309	D	0.978693	B;B	0.13145	0.007;0.001	B;B	0.15052	0.012;0.005	T	0.09818	-1.0657	10	0.37606	T	0.19	-11.0042	11.3604	0.49640	0.0:0.918:0.0:0.082	.	226;226	B7ZM10;Q96QU8	.;XPO6_HUMAN	N	226	ENSP00000302790:S226N	ENSP00000302790:S226N	S	-	2	0	XPO6	28075316	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.834000	0.39171	2.941000	0.99782	0.655000	0.94253	AGT	.		0.428	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195	
ZAN	7455	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100364744	100364744	+	RNA	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:100364744G>T	ENST00000348028.3	+	0	4889				ZAN_ENST00000542585.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000349350.6_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TGCTGGTCCAGGTCCCAAGAC	0.597																																					.		.											.	ZAN	142	0			.						.						59.0	61.0	61.0					7																	100364744		2113	4235	6348			7455	.			GGTCCAGGTCCCA	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100364744G>T		141.0	0.0		196.0	24.0	.	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	RNA	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	G	17.63	3.437620	0.62955	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	T;T;T;T	0.60299	0.2;0.2;0.2;0.2	4.59	-7.12	0.01537	von Willebrand factor, type D domain (3);	1.654650	0.03406	N	0.203997	T	0.67720	0.2923	M	0.78344	2.41	0.09310	N	1	D;D	0.56746	0.972;0.977	P;P	0.58520	0.752;0.84	T	0.70288	-0.4913	10	0.66056	D	0.02	.	7.0657	0.25151	0.4843:0.3427:0.173:0.0	.	1575;1575	F5H0T8;Q9Y493	.;ZAN_HUMAN	M	1575;1575;1575;152	ENSP00000445943:R1575M;ENSP00000445091:R1575M;ENSP00000444427:R1575M;ENSP00000441117:R152M	ENSP00000423579:R1575M	R	+	2	0	ZAN	100202680	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.835000	0.04386	-1.333000	0.02247	-0.300000	0.09419	AGG	.		0.597	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
ZBTB4	57659	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	7370078	7370078	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:7370078C>T	ENST00000311403.4	-	3	382	c.43G>A	c.(43-45)Gcc>Acc	p.A15T	ZBTB4_ENST00000380599.4_Missense_Mutation_p.A15T	NM_020899.3	NP_065950.2	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	15					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|methyl-CpNpG binding (GO:0010428)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(3)|skin(6)	36		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		CGCAGGACGGCGGGGGCATGG	0.657																																					p.A15T		.											.	ZBTB4	93	0			c.G43A						.						20.0	17.0	18.0					17																	7370078		2199	4299	6498	SO:0001583	missense	57659	exon3			GGACGGCGGGGGC	AB040971	CCDS11107.1	17p13.2	2013-01-09			ENSG00000174282	ENSG00000174282		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23847	protein-coding gene	gene with protein product		612308				12477932	Standard	NM_020899		Approved	KIAA1538, KAISO-L1, ZNF903	uc002ghd.4	Q9P1Z0	OTTHUMG00000108137	ENST00000311403.4:c.43G>A	17.37:g.7370078C>T	ENSP00000307858:p.Ala15Thr	40.0	0.0		45.0	13.0	NM_001128833	B3KVL6|Q7Z697|Q86XJ4|Q8N4V8	Missense_Mutation	SNP	ENST00000311403.4	37	CCDS11107.1	.	.	.	.	.	.	.	.	.	.	C	4.358	0.065871	0.08388	.	.	ENSG00000174282	ENST00000311403;ENST00000380599	T;T	0.70282	-0.47;-0.47	5.0	5.0	0.66597	BTB/POZ fold (2);	0.178800	0.37483	N	0.002077	T	0.46795	0.1411	N	0.05230	-0.09	0.34910	D	0.747394	D	0.58620	0.983	P	0.44422	0.449	T	0.54873	-0.8228	10	0.25106	T	0.35	-16.4127	6.3793	0.21525	0.1828:0.7267:0.0:0.0905	.	15	Q9P1Z0	ZBTB4_HUMAN	T	15	ENSP00000307858:A15T;ENSP00000369973:A15T	ENSP00000307858:A15T	A	-	1	0	ZBTB4	7310802	0.121000	0.22262	0.850000	0.33497	0.302000	0.27658	0.590000	0.23954	2.605000	0.88082	0.561000	0.74099	GCC	.		0.657	ZBTB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226940.2	NM_020899	
ZC3H10	84872	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56515237	56515237	+	Silent	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr12:56515237C>T	ENST00000257940.2	+	3	1167	c.891C>T	c.(889-891)ccC>ccT	p.P297P	RP11-603J24.5_ENST00000550947.1_RNA|RP11-603J24.6_ENST00000550840.1_RNA|RP11-603J24.5_ENST00000549438.1_RNA	NM_032786.1	NP_116175.1	Q96K80	ZC3HA_HUMAN	zinc finger CCCH-type containing 10	297							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|large_intestine(1)|lung(2)|prostate(2)|skin(1)	11			OV - Ovarian serous cystadenocarcinoma(18;0.12)			CTCTGGCCCCCACTGTGGGCA	0.552																																					p.P297P		.											.	ZC3H10	90	0			c.C891T						.						68.0	62.0	64.0					12																	56515237		2203	4300	6503	SO:0001819	synonymous_variant	84872	exon3			GGCCCCCACTGTG	BC018708	CCDS8903.1	12q13.2	2012-07-05	2005-06-02	2005-06-02		ENSG00000135482		"""Zinc fingers, CCCH-type domain containing"""	25893	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 10"""	ZC3HDC10		12477932	Standard	NM_032786		Approved	FLJ14451	uc001sjp.1	Q96K80		ENST00000257940.2:c.891C>T	12.37:g.56515237C>T		91.0	1.0		85.0	33.0	NM_032786		Silent	SNP	ENST00000257940.2	37	CCDS8903.1																																																																																			.		0.552	ZC3H10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407826.1	NM_032786	
ZNF180	7733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44980916	44980916	+	Silent	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:44980916T>A	ENST00000221327.4	-	5	2063	c.1782A>T	c.(1780-1782)gtA>gtT	p.V594V	AC069278.4_ENST00000591684.1_lincRNA|ZNF180_ENST00000585514.1_5'Flank|ZNF180_ENST00000592529.1_Silent_p.V567V|ZNF180_ENST00000391956.4_Silent_p.V569V	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	594					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				TTCTCTGATGTACAACAAGAA	0.418																																					p.V594V	Esophageal Squamous(180;1353 2003 32862 46574 49854)	.											.	ZNF180	92	0			c.A1782T						.						108.0	110.0	109.0					19																	44980916		2203	4300	6503	SO:0001819	synonymous_variant	7733	exon5			CTGATGTACAACA	AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.1782A>T	19.37:g.44980916T>A		62.0	0.0		92.0	39.0	NM_013256	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Silent	SNP	ENST00000221327.4	37	CCDS12639.1																																																																																			.		0.418	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451601.1	NM_013256	
ZNF518A	9849	broad.mit.edu;ucsc.edu;mdanderson.org	37	10	97917317	97917317	+	RNA	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr10:97917317G>A	ENST00000534948.1	+	0	2095							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		GCTAGTTCAGGTTTCATGAAG	0.418																																					.		.											.	ZNF518A	23	0			.						.						76.0	74.0	75.0					10																	97917317		1902	4104	6006			9849	.			GTTCAGGTTTCAT	AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97917317G>A		131.0	0.0		196.0	47.0	.	A0PJI5|O15044|Q32MP4	RNA	SNP	ENST00000534948.1	37																																																																																				.		0.418	ZNF518A-202	KNOWN	basic	processed_transcript	processed_transcript		NM_014803	
ZNF658	26149	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	40773313	40773313	+	Silent	SNP	C	C	A	rs138850783	byFrequency	TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr9:40773313C>A	ENST00000602553.1	-	5	2256	c.1962G>T	c.(1960-1962)ggG>ggT	p.G654G	ZNF658_ENST00000377626.3_Silent_p.G654G|ZNF658_ENST00000441795.1_Intron			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	654					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		AGGGTTTCTCCCCTGTGTGAA	0.408																																					p.G654G		.											.	ZNF658	45	0			c.G1962T						.						162.0	170.0	167.0					9																	40773313		2202	4297	6499	SO:0001819	synonymous_variant	26149	exon5			TTTCTCCCCTGTG	AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.1962G>T	9.37:g.40773313C>A		134.0	1.0		130.0	20.0	NM_033160	Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Silent	SNP	ENST00000602553.1	37	CCDS35023.1																																																																																			C|1.000;G|0.000		0.408	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467800.1	NM_033160	
TUBB4A	10382	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	6495192	6495193	+	Missense_Mutation	DNP	CC	CC	GG	rs201070507		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:6495192_6495193CC>GG	ENST00000264071.2	-	4	1688_1689	c.1317_1318GG>CC	c.(1315-1320)gcGGag>gcCCag	p.E440Q	CTD-2396E7.10_ENST00000596027.1_RNA|TUBB4A_ENST00000540257.1_Missense_Mutation_p.E440Q|CTD-2396E7.9_ENST00000599292.1_RNA			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	440					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)										ACCTCCTCCTCCGCCTCCTCCT	0.624																																					p.E440Q		.											.	.	.	0			.						.																																			SO:0001583	missense	10382	.			CCTCCTCCGCCTC	AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.1317_1318delinsGG	19.37:g.6495192_6495193delinsGG	ENSP00000264071:p.Glu440Gln	142.0	0.0		164.0	35.0	.	B3KQP4|Q969E5	Missense_Mutation	DNP	ENST00000264071.2	37	CCDS12168.1																																																																																			.		0.624	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1	NM_006087	
ZNF99	7652	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	22940609	22940610	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:22940609_22940610CC>AA	ENST00000596209.1	-	4	2191_2192	c.2101_2102GG>TT	c.(2101-2103)GGa>TTa	p.G701L	ZNF99_ENST00000397104.3_Missense_Mutation_p.G610L|CTC-451A6.4_ENST00000442497.2_lincRNA	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	701					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GGGTTTCTTTCCAGTATGAATT	0.361																																					p.G701V|p.G701X		.											.	ZNF99	24	0			c.G2102T|c.G2101T						.																																			SO:0001583	missense	7652	exon4			TTCTTTCCAGTAT|TCTTTCCAGTATG	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.2101_2102delinsAA	19.37:g.22940609_22940610delinsAA	ENSP00000472969:p.Gly701Leu	21.0	0.0		33.0	9.0	NM_001080409	M0R335	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000596209.1	37	CCDS59369.1																																																																																			.		0.361	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
