#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCB5	340273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	20785063	20785063	+	Splice_Site	SNP	T	T	A	rs373651350		TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr7:20785063T>A	ENST00000404938.2	+	26	4081		c.e26+2		ABCB5_ENST00000258738.6_Splice_Site	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5						antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						CTCCCTGAGGTAAGAAAATTT	0.393																																					.		.											.	ABCB5	158	0			c.3429+2T>A						.						41.0	39.0	39.0					7																	20785063		2203	4300	6503	SO:0001630	splice_region_variant	340273	exon26			CTGAGGTAAGAAA	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.3429+2T>A	7.37:g.20785063T>A		64.0	0.0		72.0	37.0	NM_001163941	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Splice_Site	SNP	ENST00000404938.2	37	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	T	19.46	3.832276	0.71258	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	.	.	.	5.08	3.85	0.44370	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8378	0.46698	0.1411:0.0:0.0:0.8589	.	.	.	.	.	-1	.	.	.	+	.	.	ABCB5	20751588	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.108000	0.71522	2.024000	0.59613	0.533000	0.62120	.	.		0.393	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	Intron
ACTL7A	10881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	111625276	111625276	+	Missense_Mutation	SNP	A	A	G	rs112558776		TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr9:111625276A>G	ENST00000333999.3	+	1	674	c.674A>G	c.(673-675)tAc>tGc	p.Y225C		NM_006687.2	NP_006678.1	Q9Y615	ACL7A_HUMAN	actin-like 7A	225						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|male germ cell nucleus (GO:0001673)|motile cilium (GO:0031514)|nucleus (GO:0005634)|protein complex (GO:0043234)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GGCGTGTCCTACGTGGTCCCC	0.617																																					p.Y225C	Esophageal Squamous(177;1480 3591 17554)	.											.	ACTL7A	90	0			c.A674G						.						73.0	70.0	71.0					9																	111625276		2203	4300	6503	SO:0001583	missense	10881	exon1			TGTCCTACGTGGT	BC014610	CCDS6772.1	9q31	2008-02-05			ENSG00000187003	ENSG00000187003			161	protein-coding gene	gene with protein product		604303				10373328	Standard	NM_006687		Approved		uc004bdj.1	Q9Y615	OTTHUMG00000020461	ENST00000333999.3:c.674A>G	9.37:g.111625276A>G	ENSP00000334300:p.Tyr225Cys	44.0	0.0		47.0	18.0	NM_006687	B2RC83|Q5JSV0	Missense_Mutation	SNP	ENST00000333999.3	37	CCDS6772.1	.	.	.	.	.	.	.	.	.	.	A	15.00	2.703545	0.48412	.	.	ENSG00000187003	ENST00000333999	T	0.30182	1.54	5.68	5.68	0.88126	.	0.000000	0.42172	D	0.000753	T	0.25791	0.0628	L	0.31664	0.95	0.51482	D	0.999923	B	0.15473	0.013	B	0.12837	0.008	T	0.03728	-1.1009	10	0.87932	D	0	.	14.1785	0.65559	1.0:0.0:0.0:0.0	.	225	Q9Y615	ACL7A_HUMAN	C	225	ENSP00000334300:Y225C	ENSP00000334300:Y225C	Y	+	2	0	ACTL7A	110665097	1.000000	0.71417	0.968000	0.41197	0.885000	0.51271	9.261000	0.95576	2.288000	0.76882	0.528000	0.53228	TAC	A|0.500;C|0.500		0.617	ACTL7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053570.1	NM_006687	
ADAMTS19	171019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	128887587	128887587	+	Silent	SNP	A	A	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr5:128887587A>C	ENST00000274487.4	+	7	1486	c.1341A>C	c.(1339-1341)ccA>ccC	p.P447P	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	447	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AAGATGAACCATGTGATACTG	0.313																																					p.P447P		.											.	ADAMTS19	295	0			c.A1341C						.						60.0	61.0	60.0					5																	128887587		2202	4291	6493	SO:0001819	synonymous_variant	171019	exon7			TGAACCATGTGAT	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1341A>C	5.37:g.128887587A>C		76.0	0.0		105.0	36.0	NM_133638		Silent	SNP	ENST00000274487.4	37	CCDS4146.1																																																																																			.		0.313	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
ADCY5	111	broad.mit.edu;mdanderson.org	37	3	123166435	123166435	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr3:123166435G>T	ENST00000462833.1	-	1	2170	c.958C>A	c.(958-960)Ccg>Acg	p.P320T		NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	320					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CGTGGCTGCGGCAGCAGCAGG	0.672																																					p.P320T		.											.	ADCY5	94	0			c.C958A						.						20.0	21.0	21.0					3																	123166435		2196	4293	6489	SO:0001583	missense	111	exon1			GCTGCGGCAGCAG	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.958C>A	3.37:g.123166435G>T	ENSP00000419361:p.Pro320Thr	35.0	1.0		25.0	7.0	NM_183357	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	37	CCDS3022.1	.	.	.	.	.	.	.	.	.	.	G	4.455	0.084337	0.08583	.	.	ENSG00000173175	ENST00000462833	T	0.20332	2.08	5.07	5.07	0.68467	.	0.211314	0.31589	N	0.007387	T	0.08268	0.0206	N	0.02916	-0.46	0.80722	D	1	B	0.15930	0.015	B	0.17098	0.017	T	0.26292	-1.0107	10	0.10377	T	0.69	.	10.662	0.45708	0.0:0.1504:0.7124:0.1372	.	320	O95622	ADCY5_HUMAN	T	320	ENSP00000419361:P320T	ENSP00000419361:P320T	P	-	1	0	ADCY5	124649125	1.000000	0.71417	1.000000	0.80357	0.680000	0.39746	3.209000	0.51122	2.361000	0.80049	0.561000	0.74099	CCG	.		0.672	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
APOB	338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	21249795	21249795	+	Silent	SNP	A	A	G			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr2:21249795A>G	ENST00000233242.1	-	15	2236	c.2109T>C	c.(2107-2109)gcT>gcC	p.A703A	APOB_ENST00000399256.4_Silent_p.A703A	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	703					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCCAAAAAGAGCTTCCAATG	0.428																																					p.A703A		.											.	APOB	175	0			c.T2109C						.						91.0	91.0	91.0					2																	21249795		2203	4300	6503	SO:0001819	synonymous_variant	338	exon15			AAAAAGAGCTTCC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.2109T>C	2.37:g.21249795A>G		212.0	0.0		150.0	78.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	CCDS1703.1																																																																																			.		0.428	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ARHGAP31	57514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	119134792	119134792	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr3:119134792C>A	ENST00000264245.4	+	12	4548	c.4016C>A	c.(4015-4017)tCa>tAa	p.S1339*		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	1339					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						TTCCACAGGTCAAGGCCAGGA	0.512																																					p.S1339X	Pancreas(7;176 297 5394 51128 51241)	.											.	ARHGAP31	92	0			c.C4016A						.						106.0	110.0	109.0					3																	119134792		1931	4119	6050	SO:0001587	stop_gained	57514	exon12			ACAGGTCAAGGCC		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.4016C>A	3.37:g.119134792C>A	ENSP00000264245:p.Ser1339*	98.0	0.0		85.0	31.0	NM_020754	Q9ULL6	Nonsense_Mutation	SNP	ENST00000264245.4	37	CCDS43135.1	.	.	.	.	.	.	.	.	.	.	C	46	12.182408	0.99644	.	.	ENSG00000031081	ENST00000264245	.	.	.	5.74	5.74	0.90152	.	0.684343	0.13377	N	0.392473	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.2859	0.94069	0.0:1.0:0.0:0.0	.	.	.	.	X	1339	.	ENSP00000264245:S1339X	S	+	2	0	ARHGAP31	120617482	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	5.824000	0.69279	2.873000	0.98535	0.563000	0.77884	TCA	.		0.512	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2		
ARPC2	10109	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	219114171	219114171	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr2:219114171A>G	ENST00000295685.10	+	8	1022	c.761A>G	c.(760-762)cAc>cGc	p.H254R	ARPC2_ENST00000315717.5_Missense_Mutation_p.H254R|ARPC2_ENST00000477992.1_3'UTR	NM_005731.2	NP_005722.1	O15144	ARPC2_HUMAN	actin related protein 2/3 complex, subunit 2, 34kDa	254					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	6		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		CTGCACTACCACATCAAGTGC	0.532																																					p.H254R		.											.	ARPC2	91	0			c.A761G						.						141.0	105.0	118.0					2																	219114171		2203	4300	6503	SO:0001583	missense	10109	exon8			ACTACCACATCAA	AF006085	CCDS2410.1	2q36.1	2011-07-06	2002-08-29		ENSG00000163466	ENSG00000163466		"""Actin related protein 2/3 complex subunits"""	705	protein-coding gene	gene with protein product		604224	"""actin related protein 2/3 complex, subunit 2 (34 kD)"""			9359840, 9230079	Standard	NM_005731		Approved	p34-Arc, ARC34	uc002vhd.4	O15144	OTTHUMG00000133618	ENST00000295685.10:c.761A>G	2.37:g.219114171A>G	ENSP00000295685:p.His254Arg	55.0	0.0		45.0	18.0	NM_005731	Q92801|Q9P1D4	Missense_Mutation	SNP	ENST00000295685.10	37	CCDS2410.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.875975	0.91664	.	.	ENSG00000163466	ENST00000315717;ENST00000295685;ENST00000456575	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.87589	0.6215	H	0.95679	3.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91020	0.4856	9	0.87932	D	0	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	254	O15144	ARPC2_HUMAN	R	254;254;69	.	ENSP00000295685:H254R	H	+	2	0	ARPC2	218822416	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.297000	0.96120	2.371000	0.80710	0.533000	0.62120	CAC	.		0.532	ARPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256777.2	NM_005731	
ASAH1	427	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	17921966	17921967	+	Splice_Site	INS	-	-	T	rs200455852		TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr8:17921966_17921967insT	ENST00000262097.6	-	6	767_768	c.456_457insA	c.(454-459)aaaggt>aaaAggt	p.G153fs	ASAH1_ENST00000381733.4_Splice_Site_p.G169fs|ASAH1_ENST00000417108.2_Intron|ASAH1_ENST00000520781.1_Intron|ASAH1_ENST00000314146.10_Splice_Site_p.G147fs	NM_177924.3	NP_808592.2	Q13510	ASAH1_HUMAN	N-acylsphingosine amidohydrolase (acid ceramidase) 1	153					cell death (GO:0008219)|ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|lung development (GO:0030324)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|ceramidase activity (GO:0017040)			breast(1)|endometrium(2)|large_intestine(4)|lung(2)	9				Colorectal(111;0.0646)|COAD - Colon adenocarcinoma(73;0.228)		GCACAATTACCTTTTTTGTCTT	0.312																																					p.G169fs		.											.	ASAH1	90	0			c.505_506insA						.																																			SO:0001630	splice_region_variant	427	exon6			AATTACCTTTTTT	U70063	CCDS6005.1, CCDS6006.1, CCDS47813.1	8p22	2007-03-27	2002-09-11	2002-09-13	ENSG00000104763	ENSG00000104763			735	protein-coding gene	gene with protein product		613468	"""N-acylsphingosine amidohydrolase (acid ceramidase)"""	ASAH		8955159, 10610716	Standard	NM_004315		Approved	AC, PHP32, FLJ21558	uc003wyn.2	Q13510	OTTHUMG00000096997	ENST00000262097.6:c.457+1->A	8.37:g.17921972_17921972dupT		68.0	0.0		45.0	18.0	NM_004315	E9PDS0|Q6W898|Q96AS2	Frame_Shift_Ins	INS	ENST00000262097.6	37	CCDS6006.1																																																																																			.		0.312	ASAH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214077.2	NM_004315	Frame_Shift_Ins
CAMKMT	79823	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	44993577	44993577	+	Silent	SNP	G	G	T	rs201420188		TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr2:44993577G>T	ENST00000378494.3	+	10	815	c.771G>T	c.(769-771)gcG>gcT	p.A257A		NM_024766.4	NP_079042.1	Q7Z624	CMKMT_HUMAN	calmodulin-lysine N-methyltransferase	257						Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	calmodulin-lysine N-methyltransferase activity (GO:0018025)			breast(2)|large_intestine(3)|lung(5)	10						AGGGGAAAGCGATGGTATTTG	0.373																																					p.A257A		.											.	CAMKMT	90	0			c.G771T						.						88.0	83.0	85.0					2																	44993577		2203	4300	6503	SO:0001819	synonymous_variant	79823	exon10			GAAAGCGATGGTA		CCDS1820.1	2p21	2011-06-22	2011-03-10	2011-03-10	ENSG00000143919	ENSG00000143919	2.1.1.60		26276	protein-coding gene	gene with protein product	"""CaM KMT"""	609559	"""chromosome 2 open reading frame 34"""	C2orf34		20975703	Standard	NM_024766		Approved	CLNMT	uc002rum.3	Q7Z624	OTTHUMG00000128761	ENST00000378494.3:c.771G>T	2.37:g.44993577G>T		151.0	1.0		100.0	55.0	NM_024766	Q4ZG15|Q53SS6|Q8N6P5|Q9H5G8	Silent	SNP	ENST00000378494.3	37	CCDS1820.1																																																																																			G|0.999;A|0.001		0.373	CAMKMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250678.2	NM_024766	
CD6	923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	60774061	60774061	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr11:60774061C>T	ENST00000313421.7	+	2	251	c.65C>T	c.(64-66)gCc>gTc	p.A22V	CD6_ENST00000545105.1_3'UTR|CD6_ENST00000344028.5_Missense_Mutation_p.A22V|CD6_ENST00000352009.5_Missense_Mutation_p.A22V|CD6_ENST00000452451.2_Missense_Mutation_p.A22V|CD6_ENST00000346437.4_Missense_Mutation_p.A22V	NM_006725.4	NP_006716.3	P30203	CD6_HUMAN	CD6 molecule	22					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	scavenger receptor activity (GO:0005044)			endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)	18						CCATCTCCAGCCCCACCTGAC	0.577																																					p.A22V	Pancreas(169;904 2017 4767 38890 42505)	.											.	CD6	227	0			c.C65T						.						87.0	77.0	80.0					11																	60774061		2203	4299	6502	SO:0001583	missense	923	exon2			CTCCAGCCCCACC		CCDS7999.1, CCDS58137.1, CCDS58138.1	11q12.2	2006-03-28	2006-03-28		ENSG00000013725	ENSG00000013725		"""CD molecules"""	1691	protein-coding gene	gene with protein product		186720	"""CD6 antigen"""			9013954	Standard	NM_006725		Approved	Tp120	uc001nqq.3	P30203	OTTHUMG00000167823	ENST00000313421.7:c.65C>T	11.37:g.60774061C>T	ENSP00000323280:p.Ala22Val	45.0	0.0		36.0	13.0	NM_006725	A4KAD4|A4KAD5|Q9UMF2|Q9Y4K7|Q9Y4K8|Q9Y4K9|Q9Y4L0	Missense_Mutation	SNP	ENST00000313421.7	37	CCDS7999.1	.	.	.	.	.	.	.	.	.	.	C	15.83	2.948374	0.53186	.	.	ENSG00000013725	ENST00000344028;ENST00000346437;ENST00000313421;ENST00000542157;ENST00000433107;ENST00000452451;ENST00000352009	T;T;T;T;T;T;T	0.01495	4.88;4.89;4.83;4.86;5.0;4.87;4.87	3.94	3.02	0.34903	.	1.862780	0.03623	N	0.236678	T	0.03136	0.0092	L	0.27053	0.805	0.09310	N	1	D;P;P;P;P	0.53151	0.958;0.86;0.775;0.666;0.78	P;P;B;B;B	0.47528	0.549;0.453;0.306;0.194;0.265	T	0.52238	-0.8602	10	0.38643	T	0.18	.	11.4748	0.50291	0.0:0.8166:0.1834:0.0	.	22;22;22;22;22	E7ER04;P30203-5;P30203-4;P30203;Q8N4Q7	.;.;.;CD6_HUMAN;.	V	22	ENSP00000344108:A22V;ENSP00000345566:A22V;ENSP00000323280:A22V;ENSP00000440055:A22V;ENSP00000410638:A22V;ENSP00000390676:A22V;ENSP00000340628:A22V	ENSP00000323280:A22V	A	+	2	0	CD6	60530637	0.001000	0.12720	0.002000	0.10522	0.014000	0.08584	1.059000	0.30517	1.232000	0.43678	0.561000	0.74099	GCC	.		0.577	CD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396449.1	NM_006725	
CDC37	11140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10506763	10506763	+	Silent	SNP	C	C	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr19:10506763C>T	ENST00000222005.2	-	2	272	c.219G>A	c.(217-219)gtG>gtA	p.V73V		NM_007065.3	NP_008996.1	Q16543	CDC37_HUMAN	cell division cycle 37	73					protein targeting (GO:0006605)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	16			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)		CGCCCTCGGCCACCTCCAGCT	0.657																																					p.V73V		.											.	CDC37	522	0			c.G219A						.						90.0	91.0	91.0					19																	10506763		2203	4300	6503	SO:0001819	synonymous_variant	11140	exon2			CTCGGCCACCTCC	U63131	CCDS12237.1	19p13.2	2013-01-17	2013-01-17		ENSG00000105401	ENSG00000105401			1735	protein-coding gene	gene with protein product	"""CDC37 cell division cycle 37 homolog"", ""Hsp90 co-chaperone Cdc37"", ""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"""	605065	"""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"", ""CDC37 cell division cycle 37 homolog (S. cerevisiae)"", ""cell division cycle 37 homolog (S. cerevisiae)"""			8703009, 8666233	Standard	NM_007065		Approved	P50CDC37	uc002mof.1	Q16543		ENST00000222005.2:c.219G>A	19.37:g.10506763C>T		87.0	0.0		95.0	31.0	NM_007065	Q53YA2	Silent	SNP	ENST00000222005.2	37	CCDS12237.1																																																																																			.		0.657	CDC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451987.1	NM_007065	
CDHR3	222256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	105662822	105662822	+	Silent	SNP	T	T	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr7:105662822T>C	ENST00000317716.9	+	14	2084	c.2004T>C	c.(2002-2004)gtT>gtC	p.V668V	CDHR3_ENST00000542731.1_Silent_p.V668V|CDHR3_ENST00000478080.1_Silent_p.V580V|CDHR3_ENST00000343407.5_Intron|CDHR3_ENST00000470188.1_Intron	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	668	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						AGGCTCTTGTTGAGACAGGAA	0.483																																					p.V668V		.											.	CDHR3	23	0			c.T2004C						.						206.0	196.0	200.0					7																	105662822		1994	4174	6168	SO:0001819	synonymous_variant	222256	exon14			TCTTGTTGAGACA	AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.2004T>C	7.37:g.105662822T>C		203.0	0.0		190.0	87.0	NM_152750	Q8TCI7	Silent	SNP	ENST00000317716.9	37	CCDS47684.1	.	.	.	.	.	.	.	.	.	.	T	6.894	0.534379	0.13188	.	.	ENSG00000128536	ENST00000468477	.	.	.	5.39	1.27	0.21489	.	.	.	.	.	T	0.66015	0.2747	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63111	-0.6710	4	.	.	.	-7.3726	12.8312	0.57746	0.0:0.0:0.3901:0.6099	.	.	.	.	S	137	.	.	L	+	2	0	CDHR3	105450058	0.993000	0.37304	1.000000	0.80357	0.575000	0.36095	0.363000	0.20301	0.393000	0.25203	0.533000	0.62120	TTG	.		0.483	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349025.2	NM_152750	
CEP104	9731	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	3753156	3753156	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr1:3753156T>C	ENST00000378230.3	-	10	1544	c.1220A>G	c.(1219-1221)gAt>gGt	p.D407G	CEP104_ENST00000460038.1_Intron	NM_014704.3	NP_055519.1	O60308	CE104_HUMAN	centrosomal protein 104kDa	407						centriole (GO:0005814)	glutamate binding (GO:0016595)|glycine binding (GO:0016594)|thienylcyclohexylpiperidine binding (GO:0016596)			breast(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(14)|lung(8)|prostate(1)|skin(3)	39						CCTCCGAGCATCGCTGATGTC	0.562																																					p.D407G		.											.	CEP104	92	0			c.A1220G						.						122.0	103.0	109.0					1																	3753156		2203	4300	6503	SO:0001583	missense	9731	exon10			CGAGCATCGCTGA	AB011134	CCDS30571.1	1p36.32	2014-02-20	2011-05-06	2011-05-06	ENSG00000116198	ENSG00000116198			24866	protein-coding gene	gene with protein product	"""glycine, glutamate, thienylcyclohexylpiperidine binding protein"""		"""KIAA0562"""	KIAA0562		7488117, 21399614	Standard	NM_014704		Approved	GlyBP, RP1-286D6.4	uc001aky.2	O60308	OTTHUMG00000003507	ENST00000378230.3:c.1220A>G	1.37:g.3753156T>C	ENSP00000367476:p.Asp407Gly	39.0	0.0		37.0	10.0	NM_014704	Q5JSQ3|Q5SR24|Q5SR25|Q6PKF5|Q86W32|Q86X14	Missense_Mutation	SNP	ENST00000378230.3	37	CCDS30571.1	.	.	.	.	.	.	.	.	.	.	T	9.716	1.158297	0.21454	.	.	ENSG00000116198	ENST00000378230;ENST00000443466	T;T	0.44881	1.43;0.91	5.36	-1.83	0.07833	.	1.209250	0.05472	N	0.553328	T	0.31071	0.0785	L	0.46157	1.445	0.09310	N	1	B;B	0.11235	0.004;0.001	B;B	0.11329	0.006;0.002	T	0.21861	-1.0233	10	0.30854	T	0.27	.	2.3825	0.04357	0.1118:0.1328:0.2315:0.5238	.	407;407	O60308-3;O60308	.;CE104_HUMAN	G	407;101	ENSP00000367476:D407G;ENSP00000411927:D101G	ENSP00000367476:D407G	D	-	2	0	CEP104	3743016	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.327000	0.19663	-0.148000	0.11234	-0.280000	0.10049	GAT	.		0.562	CEP104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009747.3	NM_014704	
CHD3	1107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7798720	7798720	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr17:7798720G>A	ENST00000330494.7	+	10	1717	c.1567G>A	c.(1567-1569)Gca>Aca	p.A523T	CHD3_ENST00000380358.4_Missense_Mutation_p.A582T|CHD3_ENST00000358181.4_Missense_Mutation_p.A523T	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	523	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				GCCACCTGTAGCAGTGCCAGC	0.572																																					p.A582T		.											.	CHD3	228	0			c.G1744A						.						99.0	85.0	90.0					17																	7798720		2203	4300	6503	SO:0001583	missense	1107	exon10			CCTGTAGCAGTGC	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.1567G>A	17.37:g.7798720G>A	ENSP00000332628:p.Ala523Thr	88.0	0.0		61.0	32.0	NM_001005271	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	37	CCDS32554.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.350|8.350	0.830587|0.830587	0.16820|0.16820	.|.	.|.	ENSG00000170004|ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494|ENST00000452447	D;D;D|.	0.90133|.	-2.62;-2.56;-2.56|.	5.4|5.4	1.08|1.08	0.20341|0.20341	Chromo domain-like (1);Chromo domain/shadow (1);|.	0.308380|.	0.23250|.	N|.	0.050241|.	T|T	0.28333|0.28333	0.0700|0.0700	N|N	0.20685|0.20685	0.6|0.6	0.21064|0.21064	N|N	0.999799|0.999799	B;B;B|.	0.06786|.	0.001;0.0;0.001|.	B;B;B|.	0.08055|.	0.003;0.001;0.003|.	T|T	0.25152|0.25152	-1.0140|-1.0140	10|5	0.38643|.	T|.	0.18|.	-0.9048|-0.9048	9.4055|9.4055	0.38460|0.38460	0.0648:0.0:0.5507:0.3845|0.0648:0.0:0.5507:0.3845	.|.	523;523;582|.	Q12873-2;Q12873;E9PG89|.	.;CHD3_HUMAN;.|.	T|N	582;523;523|393	ENSP00000369716:A582T;ENSP00000350907:A523T;ENSP00000332628:A523T|.	ENSP00000332628:A523T|.	A|S	+|+	1|2	0|0	CHD3|CHD3	7739445|7739445	0.005000|0.005000	0.15991|0.15991	0.801000|0.801000	0.32222|0.32222	0.197000|0.197000	0.23852|0.23852	0.926000|0.926000	0.28804|0.28804	0.088000|0.088000	0.17205|0.17205	-0.314000|-0.314000	0.08810|0.08810	GCA|AGC	.		0.572	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273	
CHST3	9469	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	73768075	73768075	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr10:73768075G>A	ENST00000373115.4	+	3	1723	c.1286G>A	c.(1285-1287)cGc>cAc	p.R429H		NM_004273.4	NP_004264.2	Q7LGC8	CHST3_HUMAN	carbohydrate (chondroitin 6) sulfotransferase 3	429					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)|T cell homeostasis (GO:0043029)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|proteoglycan sulfotransferase activity (GO:0050698)|sulfotransferase activity (GO:0008146)			endometrium(1)|lung(5)	6						GAGAAGTGGCGCTTCAGCATG	0.657																																					p.R429H		.											.	CHST3	90	0			c.G1286A						.						27.0	23.0	25.0					10																	73768075		2188	4274	6462	SO:0001583	missense	9469	exon3			AGTGGCGCTTCAG	AB017915	CCDS7312.1	10q22.1	2007-03-14			ENSG00000122863	ENSG00000122863		"""Sulfotransferases, membrane-bound"""	1971	protein-coding gene	gene with protein product		603799				9883891, 9714738	Standard	NM_004273		Approved	C6ST, C6ST1	uc001jsn.3	Q7LGC8	OTTHUMG00000018431	ENST00000373115.4:c.1286G>A	10.37:g.73768075G>A	ENSP00000362207:p.Arg429His	66.0	1.0		76.0	37.0	NM_004273	O75099|Q52M30	Missense_Mutation	SNP	ENST00000373115.4	37	CCDS7312.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.885311	0.91814	.	.	ENSG00000122863	ENST00000373115	D	0.83673	-1.75	5.33	5.33	0.75918	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.93344	0.7878	M	0.92268	3.29	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94740	0.7918	10	0.87932	D	0	-27.9145	17.9987	0.89192	0.0:0.0:1.0:0.0	.	429	Q7LGC8	CHST3_HUMAN	H	429	ENSP00000362207:R429H	ENSP00000362207:R429H	R	+	2	0	CHST3	73438081	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.866000	0.99616	2.505000	0.84491	0.462000	0.41574	CGC	.		0.657	CHST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048563.1	NM_004273	
CNGA2	1260	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	150912332	150912332	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chrX:150912332C>T	ENST00000329903.4	+	6	1390	c.1357C>T	c.(1357-1359)Cgc>Tgc	p.R453C		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	453					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.R453S(2)		breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					CAAGAAAGTGCGCATCTTCCA	0.507																																					p.R453C		.											.	CNGA2	193	2	Substitution - Missense(2)	lung(2)	c.C1357T						.						86.0	81.0	83.0					X																	150912332		2203	4300	6503	SO:0001583	missense	1260	exon7			AAAGTGCGCATCT	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.1357C>T	X.37:g.150912332C>T	ENSP00000328478:p.Arg453Cys	75.0	1.0		116.0	37.0	NM_005140	A0AVD0	Missense_Mutation	SNP	ENST00000329903.4	37	CCDS14701.1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.677034	0.47886	.	.	ENSG00000183862	ENST00000329903	D	0.96745	-4.11	5.04	4.17	0.49024	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.000000	0.85682	D	0.000000	D	0.97776	0.9270	M	0.86651	2.83	0.58432	D	0.999999	D	0.89917	1.0	D	0.64506	0.926	D	0.97642	1.0149	10	0.87932	D	0	.	10.5735	0.45214	0.0:0.9025:0.0:0.0975	.	453	Q16280	CNGA2_HUMAN	C	453	ENSP00000328478:R453C	ENSP00000328478:R453C	R	+	1	0	CNGA2	150662988	1.000000	0.71417	0.998000	0.56505	0.801000	0.45260	3.794000	0.55492	0.900000	0.36469	0.529000	0.55759	CGC	.		0.507	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140	
COPS4	51138	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	83984336	83984336	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr4:83984336G>A	ENST00000264389.2	+	7	958	c.823G>A	c.(823-825)Gga>Aga	p.G275R	COPS4_ENST00000511653.1_Missense_Mutation_p.G275R|COPS4_ENST00000503682.1_Missense_Mutation_p.G275R|COPS4_ENST00000509093.1_Missense_Mutation_p.G275R	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	275	PCI.				cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				GATCATCAGAGGAAATCAACT	0.423																																					p.G275R		.											.	COPS4	226	0			c.G823A						.						90.0	87.0	88.0					4																	83984336		2203	4300	6503	SO:0001583	missense	51138	exon7			ATCAGAGGAAATC	AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.823G>A	4.37:g.83984336G>A	ENSP00000264389:p.Gly275Arg	130.0	0.0		99.0	53.0	NM_016129	B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Missense_Mutation	SNP	ENST00000264389.2	37	CCDS3600.1	.	.	.	.	.	.	.	.	.	.	G	10.94	1.493629	0.26774	.	.	ENSG00000138663	ENST00000509093;ENST00000264389;ENST00000509317;ENST00000503682;ENST00000511653	T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7	5.67	5.67	0.87782	Proteasome component (PCI) domain (1);	0.000000	0.85682	D	0.000000	T	0.06462	0.0166	N	0.00061	-2.33	0.80722	D	1	B;B;B;B	0.13145	0.007;0.004;0.002;0.0	B;B;B;B	0.12156	0.007;0.007;0.003;0.003	T	0.46205	-0.9208	10	0.13108	T	0.6	-21.6451	19.7712	0.96366	0.0:0.0:1.0:0.0	.	275;275;275;275	B3KST5;D6RFN0;D6RAX7;Q9BT78	.;.;.;CSN4_HUMAN	R	275;275;163;275;275	ENSP00000425976:G275R;ENSP00000264389:G275R;ENSP00000425486:G163R;ENSP00000424791:G275R;ENSP00000424655:G275R	ENSP00000264389:G275R	G	+	1	0	COPS4	84203360	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.733000	0.84916	2.677000	0.91161	0.585000	0.79938	GGA	.		0.423	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252643.1		
CPAMD8	27151	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17091417	17091417	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr19:17091417C>T	ENST00000443236.1	-	14	1647	c.1616G>A	c.(1615-1617)gGc>gAc	p.G539D	CPAMD8_ENST00000388925.4_Intron	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	492			D -> E (in dbSNP:rs3745335).			extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CACAATATTGCCCCGTGCAGC	0.562																																					p.G539D		.											.	CPAMD8	141	0			c.G1616A						.						71.0	77.0	75.0					19																	17091417		2004	4170	6174	SO:0001583	missense	27151	exon14			ATATTGCCCCGTG	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.1616G>A	19.37:g.17091417C>T	ENSP00000402505:p.Gly539Asp	89.0	0.0		89.0	40.0	NM_015692	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.89|15.89	2.965350|2.965350	0.53507|0.53507	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440	.|.	.|.	.|.	2.9|2.9	2.9|2.9	0.33743|0.33743	.|Alpha-2-macroglobulin, N-terminal 2 (1);	.|0.000000	.|0.64402	.|U	.|0.000004	D|D	0.84566|0.84566	0.5500|0.5500	M|M	0.92784|0.92784	3.345|3.345	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	D|D	0.88464|0.88464	0.3057|0.3057	5|9	.|0.87932	.|D	.|0	.|.	13.7238|13.7238	0.62745|0.62745	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|492	.|Q8IZJ3	.|CPMD8_HUMAN	T|D	550|539	.|.	.|ENSP00000291440:G539D	A|G	-|-	1|2	0|0	CPAMD8|CPAMD8	16952417|16952417	1.000000|1.000000	0.71417|0.71417	0.922000|0.922000	0.36590|0.36590	0.155000|0.155000	0.21991|0.21991	4.624000|4.624000	0.61254|0.61254	1.184000|1.184000	0.42957|0.42957	0.467000|0.467000	0.42956|0.42956	GCA|GGC	.		0.562	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692	
CTNNBL1	56259	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	36431330	36431330	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr20:36431330G>T	ENST00000361383.6	+	11	1210	c.1093G>T	c.(1093-1095)Gaa>Taa	p.E365*	CTNNBL1_ENST00000373473.1_Nonsense_Mutation_p.E178*|CTNNBL1_ENST00000373469.1_Nonsense_Mutation_p.E113*|CTNNBL1_ENST00000473857.1_3'UTR|CTNNBL1_ENST00000405275.2_Nonsense_Mutation_p.E338*	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1	365					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				GATTGGCCCCGAAGGCACAGA	0.468																																					p.E365X	Ovarian(184;582 2038 3273 4106 42608)	.											.	CTNNBL1	228	0			c.G1093T						.						131.0	121.0	124.0					20																	36431330		2203	4300	6503	SO:0001587	stop_gained	56259	exon11			GGCCCCGAAGGCA	AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.1093G>T	20.37:g.36431330G>T	ENSP00000355050:p.Glu365*	154.0	0.0		150.0	68.0	NM_030877	B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	Nonsense_Mutation	SNP	ENST00000361383.6	37	CCDS13298.1	.	.	.	.	.	.	.	.	.	.	G	40	7.969218	0.98588	.	.	ENSG00000132792	ENST00000361383;ENST00000405275;ENST00000373473;ENST00000373469	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-25.273	18.4237	0.90602	0.0:0.0:1.0:0.0	.	.	.	.	X	365;338;178;113	.	ENSP00000355050:E365X	E	+	1	0	CTNNBL1	35864744	1.000000	0.71417	0.972000	0.41901	0.822000	0.46500	9.750000	0.98875	2.593000	0.87608	0.462000	0.41574	GAA	.		0.468	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079125.1	NM_030877	
DBN1	1627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176899177	176899177	+	Intron	SNP	A	A	G			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr5:176899177A>G	ENST00000309007.5	-	1	306				DBN1_ENST00000292385.5_Missense_Mutation_p.L12P|DBN1_ENST00000393565.1_Intron	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1						actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCTGCTGGCCAGTGCTGCAGT	0.657																																					p.L12P		.											.	DBN1	587	0			c.T35C						.						58.0	54.0	55.0					5																	176899177		2203	4300	6503	SO:0001627	intron_variant	1627	exon2			CTGGCCAGTGCTG		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.86+1259T>C	5.37:g.176899177A>G		112.0	0.0		103.0	48.0	NM_080881	A8MV58|B2RBG0|Q9UFZ5	Missense_Mutation	SNP	ENST00000309007.5	37	CCDS4420.1	.	.	.	.	.	.	.	.	.	.	A	14.88	2.666158	0.47677	.	.	ENSG00000113758	ENST00000292385	T	0.34472	1.36	3.16	3.16	0.36331	.	.	.	.	.	T	0.50154	0.1599	.	.	.	0.80722	D	1	D	0.69078	0.997	D	0.78314	0.991	T	0.42464	-0.9450	8	0.29301	T	0.29	.	8.0882	0.30784	1.0:0.0:0.0:0.0	.	12	Q16643-2	.	P	12	ENSP00000292385:L12P	ENSP00000292385:L12P	L	-	2	0	DBN1	176831783	0.977000	0.34250	1.000000	0.80357	0.785000	0.44390	1.462000	0.35266	1.696000	0.51158	0.317000	0.21355	CTG	.		0.657	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253429.2	NM_080881	
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	38838323	38838323	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr6:38838323C>A	ENST00000359357.3	+	47	6578	c.6324C>A	c.(6322-6324)aaC>aaA	p.N2108K	DNAH8_ENST00000441566.1_Missense_Mutation_p.N2072K|DNAH8_ENST00000449981.2_Missense_Mutation_p.N2325K			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2108	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CACCCTGGAACCTGAAACTCG	0.378																																					p.N2325K		.											.	DNAH8	615	0			c.C6975A						.						54.0	52.0	53.0					6																	38838323		2203	4300	6503	SO:0001583	missense	1769	exon49			CTGGAACCTGAAA	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.6324C>A	6.37:g.38838323C>A	ENSP00000352312:p.Asn2108Lys	48.0	0.0		56.0	36.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	C	12.07	1.827304	0.32329	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.23754	1.93;1.92;1.89	5.87	-1.78	0.07957	.	0.100929	0.64402	D	0.000004	T	0.06234	0.0161	L	0.28400	0.85	0.41476	D	0.988135	B	0.13145	0.007	B	0.12156	0.007	T	0.20042	-1.0287	10	0.35671	T	0.21	.	8.8054	0.34934	0.0:0.4647:0.1061:0.4292	.	2108	Q96JB1	DYH8_HUMAN	K	2313;2313;2108;2072	ENSP00000333363:N2313K;ENSP00000352312:N2108K;ENSP00000402294:N2072K	ENSP00000333363:N2313K	N	+	3	2	DNAH8	38946301	0.878000	0.30173	0.993000	0.49108	0.988000	0.76386	-0.087000	0.11215	-0.281000	0.09141	0.655000	0.94253	AAC	.		0.378	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
DONSON	29980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	34958454	34958454	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr21:34958454G>T	ENST00000303071.5	-	3	502	c.436C>A	c.(436-438)Ccg>Acg	p.P146T	DONSON_ENST00000303113.6_Missense_Mutation_p.P146T|DONSON_ENST00000432378.1_Missense_Mutation_p.P146T|AP000304.12_ENST00000429238.1_Missense_Mutation_p.S107Y|DONSON_ENST00000453626.1_Missense_Mutation_p.P146T	NM_017613.3	NP_060083.1	Q9NYP3	DONS_HUMAN	downstream neighbor of SON	146					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|ovary(1)	11						TTTGAGGACGGAATATCAGGC	0.383											OREG0003565	type=REGULATORY REGION|Gene=DONSON|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.P146T		.											.	DONSON	91	0			c.C436A						.						65.0	58.0	60.0					21																	34958454		2203	4300	6503	SO:0001583	missense	29980	exon3			AGGACGGAATATC	AF000002	CCDS13632.1	21q22.1	2008-07-31			ENSG00000159147	ENSG00000159147			2993	protein-coding gene	gene with protein product		611428		C21orf60		10773462, 10950926	Standard	NM_017613		Approved	B17, C2TA, DKFZP434M035	uc002ysk.4	Q9NYP3	OTTHUMG00000065904	ENST00000303071.5:c.436C>A	21.37:g.34958454G>T	ENSP00000307143:p.Pro146Thr	208.0	0.0	851	126.0	40.0	NM_017613	Q8NC53|Q9NSR9|Q9NVZ5|Q9NYP1|Q9NYP2	Missense_Mutation	SNP	ENST00000303071.5	37	CCDS13632.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	8.677|8.677|8.677	0.904206|0.904206|0.904206	0.17760|0.17760|0.17760	.|.|.	.|.|.	ENSG00000159147|ENSG00000159147|ENSG00000159147;ENSG00000249209	ENST00000437395|ENST00000303113;ENST00000453626;ENST00000303071;ENST00000432378|ENST00000440810;ENST00000429238	.|.|.	.|.|.	.|.|.	5.56|5.56|5.56	0.616|0.616|0.616	0.17613|0.17613|0.17613	.|.|.	.|0.492213|.	.|0.22952|.	.|N|.	.|0.053650|.	T|T|T	0.45856|0.45856|0.45856	0.1363|0.1363|0.1363	M|M|M	0.76002|0.76002|0.76002	2.32|2.32|2.32	0.09310|0.09310|0.09310	N|N|N	1|1|1	.|B;B;B|.	.|0.12630|.	.|0.006;0.001;0.0|.	.|B;B;B|.	.|0.10450|.	.|0.004;0.005;0.001|.	T|T|T	0.40001|0.40001|0.40001	-0.9586|-0.9586|-0.9586	5|9|5	.|0.24483|.	.|T|.	.|0.36|.	-0.21|-0.21|-0.21	4.6922|4.6922|4.6922	0.12786|0.12786|0.12786	0.3018:0.0:0.5583:0.1399|0.3018:0.0:0.5583:0.1399|0.3018:0.0:0.5583:0.1399	.|.|.	.|146;146;146|.	.|F8W8A5;C9J4K5;Q9NYP3|.	.|.;.;DONS_HUMAN|.	L|T|Y	116|146|4;107	.|.|.	.|ENSP00000307143:P146T|.	F|P|S	-|-|-	3|1|2	2|0|0	DONSON|DONSON|DONSON;AP000304.12	33880324|33880324|33880324	0.002000|0.002000|0.002000	0.14202|0.14202|0.14202	0.000000|0.000000|0.000000	0.03702|0.03702|0.03702	0.010000|0.010000|0.010000	0.07245|0.07245|0.07245	0.558000|0.558000|0.558000	0.23469|0.23469|0.23469	0.035000|0.035000|0.035000	0.15519|0.15519|0.15519	-0.244000|-0.244000|-0.244000	0.11960|0.11960|0.11960	TTC|CCG|TCC	.		0.383	DONSON-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141184.1	NM_017613	
ELAVL3	1995	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11577461	11577461	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr19:11577461T>C	ENST00000359227.3	-	2	615	c.191A>G	c.(190-192)gAc>gGc	p.D64G	CTC-398G3.6_ENST00000585656.1_3'UTR|RN7SL669P_ENST00000581926.1_RNA|ELAVL3_ENST00000438662.2_Missense_Mutation_p.D64G	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3	64	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						GGACTCGATGTCGCCAATGCT	0.542																																					p.D64G		.											.	ELAVL3	92	0			c.A191G						.						162.0	142.0	149.0					19																	11577461		2203	4300	6503	SO:0001583	missense	1995	exon2			TCGATGTCGCCAA		CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.191A>G	19.37:g.11577461T>C	ENSP00000352162:p.Asp64Gly	67.0	0.0		87.0	44.0	NM_032281	Q16135|Q96CL8|Q96QS9	Missense_Mutation	SNP	ENST00000359227.3	37	CCDS32912.1	.	.	.	.	.	.	.	.	.	.	T	18.40	3.614948	0.66672	.	.	ENSG00000196361	ENST00000359227;ENST00000438662	T;T	0.74842	-0.88;2.38	4.83	4.83	0.62350	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.055425	0.64402	D	0.000001	T	0.70815	0.3267	L	0.37466	1.105	0.58432	D	0.999992	B;B	0.27286	0.005;0.174	B;B	0.37989	0.061;0.262	T	0.72697	-0.4215	10	0.87932	D	0	.	13.5217	0.61572	0.0:0.0:0.0:1.0	.	64;64	Q14576;Q14576-2	ELAV3_HUMAN;.	G	64	ENSP00000352162:D64G;ENSP00000390878:D64G	ENSP00000352162:D64G	D	-	2	0	ELAVL3	11438461	1.000000	0.71417	0.991000	0.47740	0.970000	0.65996	7.705000	0.84606	2.040000	0.60383	0.523000	0.50628	GAC	.		0.542	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458827.2	NM_001420	
EPB41L3	23136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	18	5419718	5419718	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr18:5419718C>A	ENST00000341928.2	-	12	1838	c.1498G>T	c.(1498-1500)Gag>Tag	p.E500*	EPB41L3_ENST00000427684.2_5'UTR|EPB41L3_ENST00000400111.3_Nonsense_Mutation_p.E518*|EPB41L3_ENST00000544123.1_Nonsense_Mutation_p.E518*|EPB41L3_ENST00000542146.1_5'UTR|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000342933.3_Nonsense_Mutation_p.E500*|EPB41L3_ENST00000540638.2_Nonsense_Mutation_p.E518*	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	500	Hydrophilic.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						ACCTTTCCCTCGTGCCGGATG	0.542																																					p.E500X		.											.	EPB41L3	95	0			c.G1498T						.						168.0	122.0	137.0					18																	5419718		2203	4300	6503	SO:0001587	stop_gained	23136	exon12			TTCCCTCGTGCCG	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.1498G>T	18.37:g.5419718C>A	ENSP00000343158:p.Glu500*	42.0	0.0		39.0	23.0	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Nonsense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	C	42	9.250942	0.99115	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111	.	.	.	5.61	5.61	0.85477	.	1.720280	0.02468	N	0.087254	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	18.9964	0.92815	0.0:1.0:0.0:0.0	.	.	.	.	X	500;409;518;409;500;518	.	ENSP00000343158:E500X	E	-	1	0	EPB41L3	5409718	1.000000	0.71417	0.984000	0.44739	0.995000	0.86356	5.481000	0.66826	2.808000	0.96608	0.655000	0.94253	GAG	.		0.542	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
EYS	346007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	65767551	65767551	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr6:65767551T>C	ENST00000370621.3	-	13	2619	c.2093A>G	c.(2092-2094)gAc>gGc	p.D698G	EYS_ENST00000503581.1_Missense_Mutation_p.D698G|EYS_ENST00000370616.2_Missense_Mutation_p.D698G			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	698	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ACCAGGTTGGTCAATGCAGGT	0.368																																					p.D698G		.											.	EYS	660	0			c.A2093G						.						219.0	176.0	189.0					6																	65767551		692	1591	2283	SO:0001583	missense	346007	exon13			GGTTGGTCAATGC		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2093A>G	6.37:g.65767551T>C	ENSP00000359655:p.Asp698Gly	257.0	0.0		241.0	150.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	T	18.81	3.704042	0.68615	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.95554	-3.74;-3.74;-3.74	5.37	4.18	0.49190	.	.	.	.	.	D	0.97114	0.9057	M	0.88310	2.945	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.97095	0.9793	9	0.72032	D	0.01	.	10.2552	0.43392	0.1475:0.0:0.0:0.8525	.	698	Q5T1H1-1	.	G	698	ENSP00000424243:D698G;ENSP00000359655:D698G;ENSP00000359650:D698G	ENSP00000359650:D698G	D	-	2	0	EYS	65824272	1.000000	0.71417	0.858000	0.33744	0.700000	0.40528	4.392000	0.59659	0.838000	0.34948	0.482000	0.46254	GAC	.		0.368	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
FAM189A1	23359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	29429365	29429365	+	Silent	SNP	G	G	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr15:29429365G>A	ENST00000261275.4	-	6	662	c.663C>T	c.(661-663)ccC>ccT	p.P221P		NM_015307.1	NP_056122.1	O60320	F1891_HUMAN	family with sequence similarity 189, member A1	221						integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|kidney(1)|lung(1)|stomach(1)	7						TCACGCAGGTGGGGTTGGCAG	0.547																																					p.P221P		.											.	FAM189A1	22	0			c.C663T						.						56.0	67.0	64.0					15																	29429365		692	1591	2283	SO:0001819	synonymous_variant	23359	exon6			GCAGGTGGGGTTG		CCDS45198.1	15q12	2014-02-12				ENSG00000104059			29075	protein-coding gene	gene with protein product	"""transmembrane protein 228"""					9628581	Standard	NM_015307		Approved	KIAA0574, TMEM228	uc010azk.1	O60320		ENST00000261275.4:c.663C>T	15.37:g.29429365G>A		54.0	0.0		44.0	29.0	NM_015307	A0PK09	Silent	SNP	ENST00000261275.4	37	CCDS45198.1																																																																																			.		0.547	FAM189A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417254.1	NM_015307	
FBXL7	23194	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	15928320	15928320	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr5:15928320A>G	ENST00000504595.1	+	3	930	c.449A>G	c.(448-450)gAc>gGc	p.D150G	FBXL7_ENST00000510662.1_Missense_Mutation_p.D103G|FBXL7_ENST00000329673.7_Missense_Mutation_p.D138G	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	150	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						CTGGCCTGGGACCCGCGGCTC	0.672																																					p.D150G		.											.	FBXL7	228	0			c.A449G						.						15.0	19.0	18.0					5																	15928320		2059	4210	6269	SO:0001583	missense	23194	exon3			CCTGGGACCCGCG	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.449A>G	5.37:g.15928320A>G	ENSP00000423630:p.Asp150Gly	50.0	2.0		56.0	22.0	NM_012304	B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	37	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.166021	0.78339	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.61510	0.1;0.1;0.1	5.46	5.46	0.80206	F-box domain, cyclin-like (3);F-box domain, Skp2-like (1);	0.042677	0.85682	D	0.000000	T	0.72162	0.3426	M	0.87971	2.92	0.80722	D	1	P	0.48911	0.917	P	0.51657	0.676	T	0.74945	-0.3491	10	0.35671	T	0.21	.	15.5305	0.75956	1.0:0.0:0.0:0.0	.	150	Q9UJT9	FBXL7_HUMAN	G	150;103;138	ENSP00000423630:D150G;ENSP00000425184:D103G;ENSP00000329632:D138G	ENSP00000329632:D138G	D	+	2	0	FBXL7	15981320	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	9.300000	0.96151	2.083000	0.62718	0.459000	0.35465	GAC	.		0.672	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304	
FGFR2	2263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	123276885	123276885	+	Silent	SNP	C	C	T	rs121918491		TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr10:123276885C>T	ENST00000358487.5	-	8	1304	c.1032G>A	c.(1030-1032)gcG>gcA	p.A344A	FGFR2_ENST00000369060.4_Intron|FGFR2_ENST00000351936.6_Silent_p.A344A|FGFR2_ENST00000360144.3_Intron|FGFR2_ENST00000457416.2_Intron|FGFR2_ENST00000369061.4_Intron|FGFR2_ENST00000490349.1_5'UTR|FGFR2_ENST00000346997.2_Silent_p.A344A|FGFR2_ENST00000356226.4_Silent_p.A229A|FGFR2_ENST00000369059.1_Intron|FGFR2_ENST00000357555.5_Silent_p.A255A|FGFR2_ENST00000478859.1_Silent_p.A116A|FGFR2_ENST00000369056.1_Intron	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	344	Ig-like C2-type 3.		A -> G (in CS and JWS). {ECO:0000269|PubMed:7581378, ECO:0000269|PubMed:7874170}.|A -> P (in CS and PS). {ECO:0000269|PubMed:8644708}.		angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)			breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	TAGAATTACCCGCCAAGCACG	0.438		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																												p.A344A		.		Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	.	FGFR2	2607	0			c.G1032A	GRCh37	CS941488	FGFR2	S	rs121918491	.						128.0	114.0	119.0					10																	123276885		2203	4300	6503	SO:0001819	synonymous_variant	2263	exon8	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	ATTACCCGCCAAG	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.1032G>A	10.37:g.123276885C>T		78.0	0.0		46.0	41.0	NM_000141	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Silent	SNP	ENST00000358487.5	37	CCDS31298.1																																																																																			.		0.438	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050715.1	NM_022976, NM_000141	
GPHN	10243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	67147861	67147861	+	Missense_Mutation	SNP	G	G	A	rs530173903		TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr14:67147861G>A	ENST00000315266.5	+	2	1222	c.101G>A	c.(100-102)cGc>cAc	p.R34H	GPHN_ENST00000459628.1_Missense_Mutation_p.R34H|GPHN_ENST00000543237.1_Missense_Mutation_p.R34H|GPHN_ENST00000478722.1_Missense_Mutation_p.R34H|GPHN_ENST00000305960.9_Missense_Mutation_p.R34H	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	34	MPT Mo-transferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)	p.R34H(1)		large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		GCAGAAGACCGCAGTGGGATA	0.308			T	MLL	AL								G|||	1	0.000199681	0.0008	0.0	5008	,	,		15274	0.0		0.0	False		,,,				2504	0.0				p.R34H		.		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	GPHN	228	1	Substitution - Missense(1)	large_intestine(1)	c.G101A						.						85.0	89.0	88.0					14																	67147861		2203	4300	6503	SO:0001583	missense	10243	exon2			AAGACCGCAGTGG	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.101G>A	14.37:g.67147861G>A	ENSP00000312771:p.Arg34His	93.0	0.0		92.0	47.0	NM_001024218	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	37	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.643659	0.67244	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000459628;ENST00000543237;ENST00000305960	T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1	5.11	5.11	0.69529	Molybdenum cofactor synthesis (1);Molybdopterin binding (4);	0.000000	0.85682	D	0.000000	D	0.84723	0.5535	L	0.49455	1.56	0.54753	D	0.99998	P;D;P;D;D	0.89917	0.69;1.0;0.507;0.999;0.998	B;D;B;D;P	0.72338	0.182;0.977;0.052;0.951;0.752	D	0.86042	0.1520	10	0.66056	D	0.02	-3.3065	16.0118	0.80409	0.0:0.0:1.0:0.0	.	34;34;34;34;34	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2;G3V582	.;.;GEPH_HUMAN;.;.	H	34	ENSP00000312771:R34H;ENSP00000417901:R34H;ENSP00000452220:R34H;ENSP00000438404:R34H;ENSP00000303019:R34H	ENSP00000303019:R34H	R	+	2	0	GPHN	66217614	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.659000	0.91116	2.374000	0.81015	0.579000	0.79373	CGC	.		0.308	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
GRAMD4	23151	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	47033858	47033858	+	Splice_Site	SNP	G	G	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr22:47033858G>C	ENST00000406902.1	+	3	496		c.e3+1		GRAMD4_ENST00000361034.3_Splice_Site			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4						apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		CATTTCTTACGTGAGTACCAG	0.522																																					.		.											.	GRAMD4	23	0			c.283+1G>C						.						105.0	107.0	106.0					22																	47033858		2203	4300	6503	SO:0001630	splice_region_variant	23151	exon2			TCTTACGTGAGTA		CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.283+1G>C	22.37:g.47033858G>C		114.0	0.0		81.0	7.0	NM_015124	A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Splice_Site	SNP	ENST00000406902.1	37	CCDS33672.1	.	.	.	.	.	.	.	.	.	.	G	18.64	3.666786	0.67814	.	.	ENSG00000075240	ENST00000406902;ENST00000361034	.	.	.	4.12	4.12	0.48240	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3847	0.74687	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRAMD4	45412522	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	8.935000	0.92923	2.046000	0.60703	0.306000	0.20318	.	.		0.522	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317969.1	NM_015124	Intron
GUCA2B	2981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	42620502	42620502	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr1:42620502C>T	ENST00000372581.1	+	2	272	c.242C>T	c.(241-243)gCc>gTc	p.A81V		NM_007102.2	NP_009033.1	Q16661	GUC2B_HUMAN	guanylate cyclase activator 2B (uroguanylin)	81					body fluid secretion (GO:0007589)|cGMP biosynthetic process (GO:0006182)|excretion (GO:0007588)|negative regulation of blood pressure (GO:0045776)|positive regulation of guanylate cyclase activity (GO:0031284)	extracellular vesicular exosome (GO:0070062)	calcium sensitive guanylate cyclase activator activity (GO:0008048)			breast(1)|large_intestine(2)	3	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCTGTCTGCGCCTCGCAGGAG	0.682																																					p.A81V		.											.	GUCA2B	90	0			c.C242T						.						53.0	52.0	52.0					1																	42620502		2203	4300	6503	SO:0001583	missense	2981	exon2			TCTGCGCCTCGCA	BC069301	CCDS464.1	1p34-p33	2014-01-30			ENSG00000044012	ENSG00000044012		"""Endogenous ligands"""	4683	protein-coding gene	gene with protein product	"""prepro-uroguanylin"""	601271				8605041, 9268639	Standard	NM_007102		Approved		uc001chc.1	Q16661	OTTHUMG00000007024	ENST00000372581.1:c.242C>T	1.37:g.42620502C>T	ENSP00000361662:p.Ala81Val	112.0	0.0		123.0	85.0	NM_007102	Q52LV0	Missense_Mutation	SNP	ENST00000372581.1	37	CCDS464.1	.	.	.	.	.	.	.	.	.	.	C	11.75	1.732299	0.30684	.	.	ENSG00000044012	ENST00000372581	T	0.45668	0.89	4.83	3.84	0.44239	.	0.954188	0.08731	N	0.902024	T	0.37999	0.1024	L	0.47716	1.5	0.09310	N	1	B	0.34181	0.44	B	0.35114	0.196	T	0.24512	-1.0158	10	0.45353	T	0.12	-3.245	8.7125	0.34393	0.289:0.711:0.0:0.0	.	81	Q16661	GUC2B_HUMAN	V	81	ENSP00000361662:A81V	ENSP00000361662:A81V	A	+	2	0	GUCA2B	42393089	0.000000	0.05858	0.007000	0.13788	0.465000	0.32709	0.383000	0.20651	2.221000	0.72209	0.609000	0.83330	GCC	.		0.682	GUCA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000018307.1	NM_007102	
HEMK1	51409	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	50609148	50609148	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr3:50609148G>A	ENST00000232854.4	+	3	788	c.236G>A	c.(235-237)aGc>aAc	p.S79N	C3orf18_ENST00000449241.1_5'Flank|HEMK1_ENST00000455834.1_Missense_Mutation_p.S79N|HEMK1_ENST00000434410.1_Missense_Mutation_p.S79N	NM_016173.3	NP_057257.1	Q9Y5R4	HEMK1_HUMAN	HemK methyltransferase family member 1	79					DNA methylation (GO:0006306)	mitochondrion (GO:0005739)	DNA binding (GO:0003677)|N-methyltransferase activity (GO:0008170)|protein methyltransferase activity (GO:0008276)			lung(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000283)|KIRC - Kidney renal clear cell carcinoma(197;0.0179)|Kidney(197;0.0212)		CAGTTTCAGAGCCTGAGGCCG	0.577											OREG0015589	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S79N		.											.	HEMK1	278	0			c.G236A						.						114.0	124.0	121.0					3																	50609148		2203	4300	6503	SO:0001583	missense	51409	exon3			TTCAGAGCCTGAG	AF172244	CCDS2830.1	3p21	2008-02-05			ENSG00000114735	ENSG00000114735			24923	protein-coding gene	gene with protein product						10690633	Standard	XM_005265218		Approved	MTQ1	uc003dav.3	Q9Y5R4	OTTHUMG00000156849	ENST00000232854.4:c.236G>A	3.37:g.50609148G>A	ENSP00000232854:p.Ser79Asn	77.0	0.0	971	56.0	33.0	NM_016173		Missense_Mutation	SNP	ENST00000232854.4	37	CCDS2830.1	.	.	.	.	.	.	.	.	.	.	g	16.07	3.019096	0.54576	.	.	ENSG00000114735	ENST00000434410;ENST00000232854;ENST00000455834	T;T;T	0.13778	2.56;2.56;2.56	5.53	4.66	0.58398	.	0.112508	0.56097	N	0.000022	T	0.13286	0.0322	L	0.51422	1.61	0.35938	D	0.833036	P	0.39044	0.656	B	0.37387	0.248	T	0.21177	-1.0253	10	0.27785	T	0.31	-10.0777	10.6039	0.45384	0.0887:0.0:0.9113:0.0	.	79	Q9Y5R4	HEMK1_HUMAN	N	79	ENSP00000404843:S79N;ENSP00000232854:S79N;ENSP00000404334:S79N	ENSP00000232854:S79N	S	+	2	0	HEMK1	50584152	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.316000	0.51960	1.493000	0.48517	0.651000	0.88453	AGC	.		0.577	HEMK1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346231.1	NM_016173	
HNRNPA2B1	3181	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	26233251	26233251	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr7:26233251G>T	ENST00000354667.4	-	9	989	c.821C>A	c.(820-822)cCt>cAt	p.P274H	HNRNPA2B1_ENST00000356674.7_Missense_Mutation_p.P262H|HNRNPA2B1_ENST00000476233.1_5'Flank	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	274	Gly-rich.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)		HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						GCCATATCCAGGTCCTCCACC	0.438			T	ETV1	prostate																																p.P274H		.		Dom	yes		7	7p15	3181	heterogeneous nuclear ribonucleoprotein A2/B1		E	.	HNRNPA2B1	70	0			c.C821A						.						105.0	103.0	104.0					7																	26233251		2203	4300	6503	SO:0001583	missense	3181	exon9			TATCCAGGTCCTC	D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.821C>A	7.37:g.26233251G>T	ENSP00000346694:p.Pro274His	78.0	0.0		82.0	5.0	NM_031243	A8K064|P22627|Q9UC98|Q9UDJ2	Missense_Mutation	SNP	ENST00000354667.4	37	CCDS43557.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.44|11.44	1.639486|1.639486	0.29157|0.29157	.|.	.|.	ENSG00000122566|ENSG00000122566	ENST00000409814|ENST00000354667;ENST00000356674	.|D;D	.|0.85556	.|-2.0;-2.0	5.94|5.94	5.94|5.94	0.96194|0.96194	.|.	.|0.000000	.|0.64402	.|D	.|0.000002	T|T	0.80670|0.80670	0.4667|0.4667	L|L	0.34521|0.34521	1.04|1.04	0.38441|0.38441	D|D	0.9467|0.9467	.|B;B	.|0.13594	.|0.008;0.005	.|B;B	.|0.13407	.|0.004;0.009	T|T	0.74210|0.74210	-0.3739|-0.3739	6|10	0.45353|0.30078	T|T	0.12|0.28	.|.	19.9542|19.9542	0.97213|0.97213	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|262;274	.|P22626-2;P22626	.|.;ROA2_HUMAN	M|H	208|274;262	.|ENSP00000346694:P274H;ENSP00000349101:P262H	ENSP00000386735:L208M|ENSP00000346694:P274H	L|P	-|-	1|2	2|0	HNRNPA2B1|HNRNPA2B1	26199776|26199776	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.786000|0.786000	0.44442|0.44442	5.168000|5.168000	0.64978|0.64978	2.816000|2.816000	0.96949|0.96949	0.561000|0.561000	0.74099|0.74099	CTG|CCT	.		0.438	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214109.1	NM_002137	
HSPH1	10808	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	13	31715296	31715296	+	Nonsense_Mutation	SNP	A	A	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr13:31715296A>C	ENST00000320027.5	-	13	2161	c.1817T>G	c.(1816-1818)tTa>tGa	p.L606*	HSPH1_ENST00000445273.2_Nonsense_Mutation_p.L608*|HSPH1_ENST00000380405.4_Nonsense_Mutation_p.L562*|HSPH1_ENST00000429785.2_Nonsense_Mutation_p.L425*|HSPH1_ENST00000380406.5_Nonsense_Mutation_p.L565*	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	606					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		GTCTTTCCCTAACTGCCAGAC	0.358																																					p.L606X		.											.	HSPH1	90	0			c.T1817G						.						132.0	124.0	127.0					13																	31715296		2203	4299	6502	SO:0001587	stop_gained	10808	exon13			TTCCCTAACTGCC	AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.1817T>G	13.37:g.31715296A>C	ENSP00000318687:p.Leu606*	96.0	0.0		106.0	52.0	NM_006644	B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Nonsense_Mutation	SNP	ENST00000320027.5	37	CCDS9340.1	.	.	.	.	.	.	.	.	.	.	A	40	8.315047	0.98757	.	.	ENSG00000120694	ENST00000320027;ENST00000380405;ENST00000380406;ENST00000445273;ENST00000429785	.	.	.	6.05	6.05	0.98169	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.4936	16.5932	0.84781	1.0:0.0:0.0:0.0	.	.	.	.	X	606;562;565;608;425	.	ENSP00000318687:L606X	L	-	2	0	HSPH1	30613296	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.917000	0.92751	2.320000	0.78422	0.528000	0.53228	TTA	.		0.358	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044384.1		
IL4	3565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	132009824	132009824	+	Missense_Mutation	SNP	G	G	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr5:132009824G>C	ENST00000231449.2	+	1	147	c.82G>C	c.(82-84)Gat>Cat	p.D28H	IL4_ENST00000350025.2_Missense_Mutation_p.D28H	NM_000589.3	NP_000580.1	P05112	IL4_HUMAN	interleukin 4	28					B cell costimulation (GO:0031296)|B cell differentiation (GO:0030183)|cellular defense response (GO:0006968)|cellular response to mercury ion (GO:0071288)|chemotaxis (GO:0006935)|cholesterol metabolic process (GO:0008203)|connective tissue growth factor biosynthetic process (GO:0045189)|defense response to protozoan (GO:0042832)|dendritic cell differentiation (GO:0097028)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|female pregnancy (GO:0007565)|immune response (GO:0006955)|innate immune response in mucosa (GO:0002227)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chronic inflammatory response (GO:0002677)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of macrophage activation (GO:0043031)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of T-helper 17 cell differentiation (GO:2000320)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of immune response (GO:0050776)|regulation of isotype switching (GO:0045191)|regulation of phosphorylation (GO:0042325)|regulation of proton transport (GO:0010155)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|T-helper 1 cell lineage commitment (GO:0002296)|T-helper 2 cell cytokine production (GO:0035745)|T-helper 2 cell differentiation (GO:0045064)|type 2 immune response (GO:0042092)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|interleukin-4 receptor binding (GO:0005136)			NS(1)|large_intestine(3)|lung(3)|prostate(1)	8		all_cancers(142;2.81e-05)|all_lung(232;1.47e-05)|Lung NSC(810;2.31e-05)|all_neural(839;0.0459)|Ovarian(839;0.0481)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	GBM - Glioblastoma multiforme(465;0.00245)		ACACAAGTGCGATATCACCTT	0.498																																					p.D28H		.											.	IL4	90	0			c.G82C						.						210.0	191.0	197.0					5																	132009824		2203	4300	6503	SO:0001583	missense	3565	exon1			AAGTGCGATATCA	M23442	CCDS4158.1, CCDS4159.1	5q23-q31	2011-07-14			ENSG00000113520	ENSG00000113520		"""Interleukins and interleukin receptors"""	6014	protein-coding gene	gene with protein product	"""B_cell stimulatory factor 1"", ""lymphocyte stimulatory factor 1"", ""B cell growth factor 1"""	147780				3016727	Standard	NM_000589		Approved	BSF1, IL-4, BCGF1, BCGF-1, MGC79402	uc003kxk.2	P05112	OTTHUMG00000059724	ENST00000231449.2:c.82G>C	5.37:g.132009824G>C	ENSP00000231449:p.Asp28His	63.0	0.0		66.0	30.0	NM_172348	Q14630|Q6NZ77	Missense_Mutation	SNP	ENST00000231449.2	37	CCDS4158.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.394897	0.25205	.	.	ENSG00000113520	ENST00000231449;ENST00000350025	T;T	0.51574	0.7;0.7	5.78	-6.56	0.01848	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.515320	0.03939	N	0.286609	T	0.36991	0.0987	L	0.42744	1.35	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.12156	0.007;0.007	T	0.29458	-1.0011	10	0.41790	T	0.15	0.0921	8.51	0.33211	0.3256:0.2684:0.406:0.0	.	28;28	Q5FC01;P05112	.;IL4_HUMAN	H	28	ENSP00000231449:D28H;ENSP00000325190:D28H	ENSP00000231449:D28H	D	+	1	0	IL4	132037723	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.029000	0.01430	-1.530000	0.01751	-0.795000	0.03280	GAT	.		0.498	IL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132786.1	NM_000589	
KCNT2	343450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	196274416	196274416	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr1:196274416A>C	ENST00000294725.9	-	22	3458	c.2543T>G	c.(2542-2544)aTg>aGg	p.M848R	KCNT2_ENST00000367433.5_Missense_Mutation_p.M824R|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000451324.2_Intron|KCNT2_ENST00000609185.1_Missense_Mutation_p.M774R|KCNT2_ENST00000367431.4_Missense_Mutation_p.M774R			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	848					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TCTGAATTGCATGAATCTCAT	0.363																																					p.M848R		.											.	KCNT2	159	0			c.T2543G						.						135.0	125.0	128.0					1																	196274416		2203	4300	6503	SO:0001583	missense	343450	exon22			AATTGCATGAATC	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2543T>G	1.37:g.196274416A>C	ENSP00000294725:p.Met848Arg	113.0	0.0		167.0	58.0	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	37	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.975969	0.74360	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.78707	-1.2;-1.2;-1.2	4.56	4.56	0.56223	.	0.000000	0.64402	D	0.000001	D	0.88142	0.6357	M	0.83953	2.67	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;0.999	D;D;D;D;D	0.78314	0.979;0.991;0.991;0.986;0.979	D	0.90114	0.4194	10	0.87932	D	0	-23.6099	14.3678	0.66817	1.0:0.0:0.0:0.0	.	848;806;824;774;848	A9LNM6;Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;.;KCNT2_HUMAN	R	824;774;848	ENSP00000356403:M824R;ENSP00000356401:M774R;ENSP00000294725:M848R	ENSP00000294725:M848R	M	-	2	0	KCNT2	194541039	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.087000	0.94110	2.042000	0.60477	0.528000	0.53228	ATG	.		0.363	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
KCNU1	157855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	36788612	36788612	+	Silent	SNP	G	G	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr8:36788612G>T	ENST00000399881.3	+	25	2917	c.2880G>T	c.(2878-2880)cgG>cgT	p.R960R	KCNU1_ENST00000518904.1_3'UTR	NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	960					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		GAAGAAACCGGTGTAAGCTGG	0.433																																					p.R960R		.											.	KCNU1	23	0			c.G2880T						.						139.0	134.0	136.0					8																	36788612		1901	4119	6020	SO:0001819	synonymous_variant	157855	exon25			AAACCGGTGTAAG	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.2880G>T	8.37:g.36788612G>T		146.0	0.0		149.0	63.0	NM_001031836		Silent	SNP	ENST00000399881.3	37	CCDS55220.1																																																																																			.		0.433	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836	
KIAA1586	57691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	56918222	56918222	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr6:56918222G>A	ENST00000370733.4	+	4	1132	c.925G>A	c.(925-927)Gaa>Aaa	p.E309K	KIAA1586_ENST00000545356.1_Missense_Mutation_p.E282K	NM_020931.2	NP_065982.1	Q9HCI6	K1586_HUMAN	KIAA1586	309							nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)	18	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GAATATTATAGAAGAGAATGC	0.333																																					p.E309K		.											.	KIAA1586	44	0			c.G925A						.						47.0	51.0	49.0					6																	56918222		2203	4296	6499	SO:0001583	missense	57691	exon4			ATTATAGAAGAGA	AB046806	CCDS34480.1, CCDS69138.1	6p12.1	2014-03-27			ENSG00000168116	ENSG00000168116			21360	protein-coding gene	gene with protein product						10997877	Standard	NM_001286274		Approved		uc003pdj.3	Q9HCI6	OTTHUMG00000014915	ENST00000370733.4:c.925G>A	6.37:g.56918222G>A	ENSP00000359768:p.Glu309Lys	127.0	0.0		78.0	44.0	NM_020931	A8K4M3|Q8IW25	Missense_Mutation	SNP	ENST00000370733.4	37	CCDS34480.1	.	.	.	.	.	.	.	.	.	.	g	12.31	1.900405	0.33535	.	.	ENSG00000168116	ENST00000370733;ENST00000545356	T;T	0.19250	2.16;2.16	3.41	3.41	0.39046	Ribonuclease H-like (1);	.	.	.	.	T	0.09949	0.0244	N	0.08118	0	0.25415	N	0.988322	D;D	0.67145	0.996;0.996	D;D	0.75484	0.986;0.986	T	0.12604	-1.0541	9	0.10902	T	0.67	-17.0673	10.5148	0.44883	0.0:0.0:1.0:0.0	.	282;309	F5H2N6;Q9HCI6	.;K1586_HUMAN	K	309;282	ENSP00000359768:E309K;ENSP00000445507:E282K	ENSP00000359768:E309K	E	+	1	0	KIAA1586	57026181	0.275000	0.24201	0.995000	0.50966	0.988000	0.76386	1.201000	0.32259	1.898000	0.54952	0.467000	0.42956	GAA	.		0.333	KIAA1586-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041033.1	NM_020931	
KIAA2026	158358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	5968170	5968170	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr9:5968170C>A	ENST00000399933.3	-	3	2060	c.2061G>T	c.(2059-2061)aaG>aaT	p.K687N	KIAA2026_ENST00000381461.2_Missense_Mutation_p.K687N	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	687	Lys-rich.									breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TCTTTTTTTTCTTTTTCTTCT	0.343																																					p.K687N		.											.	KIAA2026	92	0			c.G2061T						.						48.0	44.0	45.0					9																	5968170		1811	4073	5884	SO:0001583	missense	158358	exon3			TTTTTTCTTTTTC	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.2061G>T	9.37:g.5968170C>A	ENSP00000382815:p.Lys687Asn	89.0	0.0		76.0	37.0	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	ENST00000399933.3	37		.	.	.	.	.	.	.	.	.	.	C	14.22	2.469582	0.43839	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	5.88	4.05	0.47172	.	0.000000	0.51477	U	0.000095	T	0.49847	0.1581	L	0.32530	0.975	0.27743	N	0.944402	D	0.89917	1.0	D	0.74348	0.983	T	0.42932	-0.9422	9	0.87932	D	0	.	9.8146	0.40844	0.0:0.7915:0.0:0.2085	.	687	Q5HYC2	K2026_HUMAN	N	687	.	ENSP00000370870:K687N	K	-	3	2	KIAA2026	5958170	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.967000	0.40491	0.839000	0.34971	0.491000	0.48974	AAG	.		0.343	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
KLHL2	11275	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	166238988	166238988	+	Silent	SNP	A	A	G			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr4:166238988A>G	ENST00000226725.6	+	14	1879	c.1620A>G	c.(1618-1620)gcA>gcG	p.A540A	KLHL2_ENST00000514860.1_Silent_p.A544A|KLHL2_ENST00000509028.1_3'UTR|KLHL2_ENST00000538127.1_Silent_p.A452A|KLHL2_ENST00000506761.1_Silent_p.A374A|KLHL2_ENST00000421009.2_Silent_p.A443A	NM_007246.3	NP_009177.3	O95198	KLHL2_HUMAN	kelch-like family member 2	540					protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			endometrium(3)|large_intestine(5)|lung(4)|prostate(1)|urinary_tract(1)	14	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		GAGTTTGTGCAGTTAATGGTC	0.348																																					p.A544A		.											.	KLHL2	226	0			c.A1632G						.						138.0	135.0	136.0					4																	166238988		2203	4300	6503	SO:0001819	synonymous_variant	11275	exon14			TTGTGCAGTTAAT	AF059569	CCDS34094.1, CCDS54815.1, CCDS54816.1	4q21.2	2013-01-30	2013-01-30		ENSG00000109466	ENSG00000109466		"""Kelch-like"", ""BTB/POZ domain containing"""	6353	protein-coding gene	gene with protein product	"""mayven"""	605774	"""kelch (Drosophila)-like 2 (Mayven)"", ""kelch-like 2, Mayven (Drosophila)"""			10397770, 16035103	Standard	NM_007246		Approved	MAV	uc011cjm.2	O95198	OTTHUMG00000161294	ENST00000226725.6:c.1620A>G	4.37:g.166238988A>G		134.0	0.0		95.0	33.0	NM_001161521	A6NCM7|B2RD18|B4DFH7|F5H6M3|Q8N484|Q8TBH5	Silent	SNP	ENST00000226725.6	37	CCDS34094.1																																																																																			.		0.348	KLHL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364439.1		
KRT38	8687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39595474	39595474	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr17:39595474A>T	ENST00000246646.3	-	3	712	c.713T>A	c.(712-714)cTc>cAc	p.L238H		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	238	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				GTTGCTCTTGAGGGAGAGCTG	0.652																																					p.L238H		.											.	KRT38	92	0			c.T713A						.						52.0	48.0	49.0					17																	39595474		2203	4300	6503	SO:0001583	missense	8687	exon3			CTCTTGAGGGAGA	Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.713T>A	17.37:g.39595474A>T	ENSP00000246646:p.Leu238His	55.0	0.0		28.0	12.0	NM_006771	A2RRM5|Q6A164	Missense_Mutation	SNP	ENST00000246646.3	37	CCDS11392.1	.	.	.	.	.	.	.	.	.	.	A	17.41	3.382271	0.61845	.	.	ENSG00000171360	ENST00000246646	D	0.91011	-2.77	4.31	4.31	0.51392	Filament (1);	0.000000	0.41500	D	0.000877	D	0.97139	0.9065	H	0.98738	4.315	0.37050	D	0.897551	D	0.89917	1.0	D	0.77557	0.99	D	0.99924	1.1274	10	0.87932	D	0	.	12.7835	0.57491	1.0:0.0:0.0:0.0	.	238	O76015	KRT38_HUMAN	H	238	ENSP00000246646:L238H	ENSP00000246646:L238H	L	-	2	0	KRT38	36849000	1.000000	0.71417	0.988000	0.46212	0.522000	0.34438	7.004000	0.76317	1.812000	0.52913	0.397000	0.26171	CTC	.		0.652	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257307.2	NM_006771	
L3MBTL3	84456	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	130381199	130381199	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr6:130381199A>T	ENST00000529410.1	+	12	1257	c.778A>T	c.(778-780)Aac>Tac	p.N260Y	L3MBTL3_ENST00000526019.1_Missense_Mutation_p.N235Y|L3MBTL3_ENST00000368136.2_Missense_Mutation_p.N260Y|L3MBTL3_ENST00000533560.1_Missense_Mutation_p.N235Y|L3MBTL3_ENST00000368139.2_Missense_Mutation_p.N235Y|L3MBTL3_ENST00000361794.2_Missense_Mutation_p.N260Y			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	260					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		CTTTCCATATAACAAAAATGG	0.388																																					p.N260Y		.											.	L3MBTL3	96	0			c.A778T						.						111.0	101.0	104.0					6																	130381199		2203	4300	6503	SO:0001583	missense	84456	exon10			CCATATAACAAAA	AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.778A>T	6.37:g.130381199A>T	ENSP00000431962:p.Asn260Tyr	135.0	0.0		96.0	24.0	NM_032438	Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	ENST00000529410.1	37	CCDS34537.1	.	.	.	.	.	.	.	.	.	.	A	11.23	1.578220	0.28180	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	D;D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96;-1.96	5.27	5.27	0.74061	.	0.148216	0.64402	D	0.000011	T	0.77942	0.4206	L	0.43923	1.385	0.45307	D	0.998302	D;B	0.69078	0.997;0.128	P;B	0.60609	0.877;0.029	T	0.78780	-0.2070	10	0.02654	T	1	.	10.6949	0.45892	0.8575:0.0:0.0:0.1425	.	235;260	Q96JM7-2;Q96JM7	.;LMBL3_HUMAN	Y	260;235;260;235;235;260	ENSP00000431962:N260Y;ENSP00000437185:N235Y;ENSP00000354526:N260Y;ENSP00000357121:N235Y;ENSP00000436706:N235Y;ENSP00000357118:N260Y	ENSP00000354526:N260Y	N	+	1	0	L3MBTL3	130422892	0.997000	0.39634	1.000000	0.80357	0.719000	0.41307	2.669000	0.46825	2.121000	0.65114	0.374000	0.22700	AAC	.		0.388	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042195.2	XM_027074	
LAMA5	3911	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	60895866	60895866	+	Missense_Mutation	SNP	G	G	C	rs143165168		TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr20:60895866G>C	ENST00000252999.3	-	49	6643	c.6577C>G	c.(6577-6579)Cgt>Ggt	p.R2193G		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2193	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TTGATGCCACGCAGTTGCTCG	0.652																																					p.R2193G		.											.	LAMA5	93	0			c.C6577G						.						49.0	44.0	45.0					20																	60895866		2181	4282	6463	SO:0001583	missense	3911	exon49			TGCCACGCAGTTG	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.6577C>G	20.37:g.60895866G>C	ENSP00000252999:p.Arg2193Gly	171.0	1.0		141.0	48.0	NM_005560	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	-	5.380	0.255375	0.10185	.	.	ENSG00000130702	ENST00000252999	T	0.10099	2.91	4.53	2.37	0.29283	Laminin I (1);	1.429830	0.04028	N	0.300983	T	0.09423	0.0232	L	0.29908	0.895	0.25963	N	0.982597	B	0.32071	0.355	B	0.29942	0.109	T	0.32587	-0.9901	10	0.25106	T	0.35	.	8.2962	0.31986	0.0:0.2093:0.464:0.3266	.	2193	O15230	LAMA5_HUMAN	G	2193	ENSP00000252999:R2193G	ENSP00000252999:R2193G	R	-	1	0	LAMA5	60329261	0.686000	0.27661	0.780000	0.31762	0.039000	0.13416	1.104000	0.31074	1.110000	0.41699	0.537000	0.68136	CGT	G|1.000;A|0.000		0.652	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
LRTM2	654429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	1943454	1943454	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr12:1943454C>T	ENST00000543818.1	+	5	1522	c.680C>T	c.(679-681)gCc>gTc	p.A227V	CACNA2D4_ENST00000382722.5_Intron|LRTM2_ENST00000299194.1_Missense_Mutation_p.A227V|CACNA2D4_ENST00000585732.1_Intron|LRTM2_ENST00000535041.1_Missense_Mutation_p.A227V|LRTM2_ENST00000543730.1_3'UTR|CACNA2D4_ENST00000588077.1_Intron|CACNA2D4_ENST00000585708.1_Intron|CACNA2D4_ENST00000586184.1_Intron|CACNA2D4_ENST00000587995.1_Intron	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2	227	LRRCT.					integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			GACCAGCTTGCCTGCACCCTG	0.582																																					p.A227V		.											.	LRTM2	135	0			c.C680T						.						50.0	46.0	47.0					12																	1943454		2203	4300	6503	SO:0001583	missense	654429	exon5			AGCTTGCCTGCAC	AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.680C>T	12.37:g.1943454C>T	ENSP00000446278:p.Ala227Val	27.0	0.0		31.0	16.0	NM_001039029	A7E2U6	Missense_Mutation	SNP	ENST00000543818.1	37	CCDS31726.1	.	.	.	.	.	.	.	.	.	.	C	13.84	2.357335	0.41801	.	.	ENSG00000166159	ENST00000543818;ENST00000299194;ENST00000535041	T;T;T	0.51325	0.71;0.71;0.71	5.35	5.35	0.76521	Cysteine-rich flanking region, C-terminal (1);	0.225081	0.45126	D	0.000399	T	0.31670	0.0804	N	0.13098	0.295	0.42351	D	0.992373	B	0.10296	0.003	B	0.12156	0.007	T	0.09684	-1.0663	10	0.29301	T	0.29	.	13.9656	0.64207	0.1516:0.8483:0.0:0.0	.	227	Q8N967	LRTM2_HUMAN	V	227	ENSP00000446278:A227V;ENSP00000299194:A227V;ENSP00000444737:A227V	ENSP00000299194:A227V	A	+	2	0	LRTM2	1813715	0.837000	0.29446	0.985000	0.45067	0.997000	0.91878	3.835000	0.55805	2.497000	0.84241	0.563000	0.77884	GCC	.		0.582	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398055.1		
LRRIQ1	84125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	85521764	85521764	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr12:85521764A>G	ENST00000393217.2	+	18	4223	c.4162A>G	c.(4162-4164)Att>Gtt	p.I1388V		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1388										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		AAGAGAAAATATTGTGAATAT	0.343																																					p.I1388V		.											.	LRRIQ1	95	0			c.A4162G						.						121.0	122.0	122.0					12																	85521764		1829	4092	5921	SO:0001583	missense	84125	exon18			GAAAATATTGTGA	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.4162A>G	12.37:g.85521764A>G	ENSP00000376910:p.Ile1388Val	249.0	0.0		285.0	137.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	A	3.049	-0.195710	0.06259	.	.	ENSG00000133640	ENST00000393217	T	0.51071	0.72	4.68	2.31	0.28768	.	.	.	.	.	T	0.21590	0.0520	N	0.08118	0	0.09310	N	1	B	0.14805	0.011	B	0.13407	0.009	T	0.17715	-1.0360	9	0.23302	T	0.38	.	1.6159	0.02703	0.5628:0.1315:0.1622:0.1435	.	1388	Q96JM4	LRIQ1_HUMAN	V	1388	ENSP00000376910:I1388V	ENSP00000376910:I1388V	I	+	1	0	LRRIQ1	84045895	0.000000	0.05858	0.001000	0.08648	0.512000	0.34134	0.700000	0.25601	0.391000	0.25143	-0.326000	0.08463	ATT	.		0.343	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
MAP1B	4131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	71493321	71493321	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr5:71493321T>A	ENST00000296755.7	+	5	4437	c.4139T>A	c.(4138-4140)aTg>aAg	p.M1380K		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1380					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		GTAAGCCCCATGGATGAGCCC	0.463																																					p.M1380K	Melanoma(17;367 822 11631 31730 47712)	.											.	MAP1B	155	0			c.T4139A						.						70.0	72.0	71.0					5																	71493321		2203	4300	6503	SO:0001583	missense	4131	exon5			GCCCCATGGATGA	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.4139T>A	5.37:g.71493321T>A	ENSP00000296755:p.Met1380Lys	108.0	0.0		134.0	50.0	NM_005909	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	T	10.96	1.497796	0.26861	.	.	ENSG00000131711	ENST00000296755	T	0.03330	3.97	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.09291	0.0229	N	0.24115	0.695	0.49299	D	0.999771	D;D	0.60160	0.987;0.987	D;D	0.66196	0.942;0.942	T	0.38929	-0.9638	10	0.41790	T	0.15	-24.5744	15.9994	0.80280	0.0:0.0:0.0:1.0	.	1254;1380	A2BDK6;P46821	.;MAP1B_HUMAN	K	1380	ENSP00000296755:M1380K	ENSP00000296755:M1380K	M	+	2	0	MAP1B	71529077	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.742000	0.55097	2.187000	0.69744	0.459000	0.35465	ATG	.		0.463	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
MGA	23269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42052603	42052603	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr15:42052603G>A	ENST00000570161.1	+	19	7274	c.7274G>A	c.(7273-7275)cGc>cAc	p.R2425H	MGA_ENST00000219905.7_Missense_Mutation_p.R2425H|MGA_ENST00000545763.1_Missense_Mutation_p.R2216H|MGA_ENST00000389936.4_Missense_Mutation_p.R2386H|MGA_ENST00000566586.1_Missense_Mutation_p.R2216H			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GCTTATTATCGCCGGACACAC	0.453																																					p.R2425H		.											.	MGA	522	0			c.G7274A						.						119.0	119.0	119.0					15																	42052603		1907	4120	6027	SO:0001583	missense	23269	exon20			ATTATCGCCGGAC	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.7274G>A	15.37:g.42052603G>A	ENSP00000457035:p.Arg2425His	129.0	0.0		121.0	77.0	NM_001164273	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.992781	0.93167	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.99158	-5.5;-5.5;-5.5	5.53	5.53	0.82687	.	0.000000	0.52532	D	0.000066	D	0.99336	0.9767	M	0.82630	2.6	0.36413	D	0.863838	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.991	D	0.99955	1.1615	10	0.87932	D	0	.	19.4485	0.94857	0.0:0.0:1.0:0.0	.	1041;2216;2425	B4DVS1;F5H7K2;E7ENI0	.;.;.	H	2425;2386;2216	ENSP00000219905:R2425H;ENSP00000374586:R2386H;ENSP00000442467:R2216H	ENSP00000219905:R2425H	R	+	2	0	MGA	39839895	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.778000	0.75043	2.583000	0.87209	0.655000	0.94253	CGC	.		0.453	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
MME	4311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	154860094	154860094	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr3:154860094A>T	ENST00000460393.1	+	12	1283	c.1163A>T	c.(1162-1164)aAg>aTg	p.K388M	MME_ENST00000462745.1_Missense_Mutation_p.K388M|MME_ENST00000493237.1_Missense_Mutation_p.K388M|MME_ENST00000492661.1_Missense_Mutation_p.K388M|MME_ENST00000360490.2_Missense_Mutation_p.K388M	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	388					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	CGAACCTACAAGGAGTCCAGA	0.388																																					p.K388M		.											.	MME	516	0			c.A1163T						.						73.0	77.0	75.0					3																	154860094		2203	4300	6503	SO:0001583	missense	4311	exon12			CCTACAAGGAGTC		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.1163A>T	3.37:g.154860094A>T	ENSP00000418525:p.Lys388Met	129.0	0.0		96.0	26.0	NM_007287	A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	37	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	A	17.14	3.314176	0.60414	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	T;T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95;-0.95	5.93	4.74	0.60224	Peptidase M13 (1);Metallopeptidase, catalytic domain (1);	0.144335	0.64402	D	0.000007	D	0.84110	0.5400	M	0.68317	2.08	0.50467	D	0.99987	D	0.89917	1.0	D	0.91635	0.999	D	0.85170	0.0997	10	0.87932	D	0	-25.7891	13.1247	0.59346	0.8663:0.1337:0.0:0.0	.	388	P08473	NEP_HUMAN	M	388	ENSP00000420389:K388M;ENSP00000418525:K388M;ENSP00000419653:K388M;ENSP00000417079:K388M;ENSP00000353679:K388M	ENSP00000353679:K388M	K	+	2	0	MME	156342788	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.974000	0.63771	1.013000	0.39391	0.477000	0.44152	AAG	.		0.388	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	
MMP15	4324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	58074513	58074513	+	Missense_Mutation	SNP	A	A	G	rs147717123		TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr16:58074513A>G	ENST00000219271.3	+	5	1606	c.821A>G	c.(820-822)aAt>aGt	p.N274S		NM_002428.2	NP_002419.1	P51511	MMP15_HUMAN	matrix metallopeptidase 15 (membrane-inserted)	274					cellular protein modification process (GO:0006464)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)|response to estradiol (GO:0032355)	extracellular matrix (GO:0031012)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	18					Marimastat(DB00786)	AGCAACCCCAATGCCATCATG	0.607													A|||	1	0.000199681	0.0008	0.0	5008	,	,		21006	0.0		0.0	False		,,,				2504	0.0				p.N274S		.											.	MMP15	713	0			c.A821G						.	A	SER/ASN	4,4392	8.1+/-20.4	0,4,2194	102.0	85.0	91.0		821	0.5	1.0	16	dbSNP_134	91	0,8600		0,0,4300	yes	missense	MMP15	NM_002428.2	46	0,4,6494	GG,GA,AA		0.0,0.091,0.0308	benign	274/670	58074513	4,12992	2198	4300	6498	SO:0001583	missense	4324	exon5			ACCCCAATGCCAT	Z48482	CCDS10792.1	16q13	2008-05-14	2005-08-08		ENSG00000102996	ENSG00000102996			7161	protein-coding gene	gene with protein product		602261	"""matrix metalloproteinase 15 (membrane-inserted)"""			9070935, 9119382	Standard	NM_002428		Approved	MT2-MMP, MTMMP2, SMCP-2	uc002ena.3	P51511	OTTHUMG00000133466	ENST00000219271.3:c.821A>G	16.37:g.58074513A>G	ENSP00000219271:p.Asn274Ser	71.0	0.0		32.0	24.0	NM_002428	A0A2U6|Q14111	Missense_Mutation	SNP	ENST00000219271.3	37	CCDS10792.1	.	.	.	.	.	.	.	.	.	.	A	1.918	-0.449009	0.04572	9.1E-4	0.0	ENSG00000102996	ENST00000219271	T	0.21361	2.01	5.17	0.52	0.17040	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.402298	0.29987	N	0.010697	T	0.04137	0.0115	N	0.00690	-1.25	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43686	-0.9376	10	0.02654	T	1	.	7.4918	0.27466	0.1477:0.3817:0.4706:0.0	.	274	P51511	MMP15_HUMAN	S	274	ENSP00000219271:N274S	ENSP00000219271:N274S	N	+	2	0	MMP15	56632014	0.033000	0.19621	0.954000	0.39281	0.950000	0.60333	0.463000	0.21972	0.195000	0.20347	-0.313000	0.08912	AAT	A|1.000;G|0.000		0.607	MMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257342.1	NM_002428	
MPHOSPH10	10199	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	71360572	71360572	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr2:71360572G>T	ENST00000244230.2	+	2	986	c.634G>T	c.(634-636)Gcc>Tcc	p.A212S	MPHOSPH10_ENST00000498451.2_Missense_Mutation_p.A212S	NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	212					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						TGAAATGGAGGCCTATTTAGA	0.348																																					p.A212S		.											.	MPHOSPH10	93	0			c.G634T						.						66.0	73.0	71.0					2																	71360572		2201	4300	6501	SO:0001583	missense	10199	exon2			ATGGAGGCCTATT	X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.634G>T	2.37:g.71360572G>T	ENSP00000244230:p.Ala212Ser	278.0	0.0		161.0	91.0	NM_005791	A0AVJ8	Missense_Mutation	SNP	ENST00000244230.2	37	CCDS1916.1	.	.	.	.	.	.	.	.	.	.	G	9.315	1.056662	0.19907	.	.	ENSG00000124383	ENST00000244230;ENST00000425650	T;T	0.09723	2.95;2.95	5.04	-2.54	0.06307	.	0.633297	0.17067	N	0.188303	T	0.05960	0.0155	L	0.27053	0.805	0.30308	N	0.788775	B;B	0.15719	0.014;0.014	B;B	0.17979	0.016;0.02	T	0.28586	-1.0039	10	0.27785	T	0.31	.	6.6831	0.23131	0.2764:0.0:0.5691:0.1544	.	212;212	B3KPV5;O00566	.;MPP10_HUMAN	S	212;72	ENSP00000244230:A212S;ENSP00000393034:A72S	ENSP00000244230:A212S	A	+	1	0	MPHOSPH10	71214080	1.000000	0.71417	0.964000	0.40570	0.864000	0.49448	1.189000	0.32114	-0.026000	0.13895	0.484000	0.47621	GCC	.		0.348	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251924.2	NM_005791	
NBEA	26960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	35806707	35806707	+	Silent	SNP	C	C	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr13:35806707C>T	ENST00000400445.3	+	34	6261	c.5727C>T	c.(5725-5727)ttC>ttT	p.F1909F	NBEA_ENST00000540320.1_Silent_p.F1909F|NBEA_ENST00000379939.2_Silent_p.F1906F|NBEA_ENST00000310336.4_Silent_p.F1909F	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1909					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TTGCCCCATTCCTATCTCGTA	0.328																																					p.F1909F		.											.	NBEA	144	0			c.C5727T						.						50.0	47.0	48.0					13																	35806707		1814	4069	5883	SO:0001819	synonymous_variant	26960	exon34			CCCATTCCTATCT	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.5727C>T	13.37:g.35806707C>T		123.0	0.0		145.0	67.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Silent	SNP	ENST00000400445.3	37	CCDS45026.1																																																																																			.		0.328	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
NLGN3	54413	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	70387139	70387139	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chrX:70387139A>C	ENST00000358741.3	+	7	1495	c.1192A>C	c.(1192-1194)Aac>Cac	p.N398H	NLGN3_ENST00000374051.3_Missense_Mutation_p.N378H|NLGN3_ENST00000536169.1_Missense_Mutation_p.N358H|NLGN3_ENST00000476589.1_3'UTR	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	398					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					CGAGTTCCTCAACTATGACAT	0.552																																					p.N398H	Esophageal Squamous(103;760 1488 16849 22250 40351)	.											.	NLGN3	131	0			c.A1192C						.						117.0	88.0	98.0					X																	70387139		2203	4300	6503	SO:0001583	missense	54413	exon7			TTCCTCAACTATG	AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.1192A>C	X.37:g.70387139A>C	ENSP00000351591:p.Asn398His	184.0	1.0		171.0	85.0	NM_181303	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Missense_Mutation	SNP	ENST00000358741.3	37	CCDS55441.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.035399	0.75617	.	.	ENSG00000196338	ENST00000536169;ENST00000542063;ENST00000374051;ENST00000395855;ENST00000358741	T;T;T;T	0.59224	0.28;0.28;0.28;0.28	5.14	5.14	0.70334	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	T	0.67040	0.2851	L	0.41415	1.275	0.58432	D	0.999999	D;D;P	0.56968	0.957;0.978;0.91	P;D;P	0.67382	0.758;0.951;0.818	T	0.70234	-0.4928	10	0.72032	D	0.01	.	14.1479	0.65362	1.0:0.0:0.0:0.0	.	358;398;378	D3DVV1;Q9NZ94;Q9NZ94-2	.;NLGN3_HUMAN;.	H	358;261;378;358;398	ENSP00000445298:N358H;ENSP00000363163:N378H;ENSP00000379196:N358H;ENSP00000351591:N398H	ENSP00000351591:N398H	N	+	1	0	NLGN3	70303864	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.139000	0.94554	1.916000	0.55485	0.352000	0.21897	AAC	.		0.552	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057121.1	NM_018977	
NLRP9	338321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	56223263	56223263	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr19:56223263T>A	ENST00000332836.2	-	8	2773	c.2746A>T	c.(2746-2748)Agg>Tgg	p.R916W	CTD-2611O12.7_ENST00000597680.1_RNA|CTD-2611O12.8_ENST00000596293.1_RNA	NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	916						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TTCAGGCTCCTCAGTGTTTTG	0.587																																					p.R916W		.											.	NLRP9	294	0			c.A2746T						.						103.0	83.0	90.0					19																	56223263		2202	4299	6501	SO:0001583	missense	338321	exon8			GGCTCCTCAGTGT	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.2746A>T	19.37:g.56223263T>A	ENSP00000331857:p.Arg916Trp	69.0	0.0		80.0	47.0	NM_176820	B2RN12|Q86W27	Missense_Mutation	SNP	ENST00000332836.2	37	CCDS12934.1	.	.	.	.	.	.	.	.	.	.	T	14.26	2.481527	0.44147	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.52754	0.65	3.09	-0.674	0.11369	.	.	.	.	.	T	0.42040	0.1185	M	0.64997	1.995	0.09310	N	1	B	0.19935	0.04	B	0.15870	0.014	T	0.38672	-0.9650	9	0.51188	T	0.08	.	8.9279	0.35652	0.0:0.0:0.6137:0.3863	.	916	Q7RTR0	NALP9_HUMAN	W	916	ENSP00000331857:R916W	ENSP00000331857:R916W	R	-	1	2	NLRP9	60915075	0.016000	0.18221	0.002000	0.10522	0.035000	0.12851	0.104000	0.15313	-0.197000	0.10350	0.529000	0.55759	AGG	.		0.587	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
NOX1	27035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	100104411	100104411	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chrX:100104411T>C	ENST00000372966.3	-	11	1506	c.1301A>G	c.(1300-1302)tAt>tGt	p.Y434C	NOX1_ENST00000372964.1_Intron|NOX1_ENST00000217885.5_Intron|NOX1_ENST00000372960.4_Missense_Mutation_p.Y397C	NM_007052.4|NM_013955.2	NP_008983.2|NP_039249.1	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1	434	Interaction with NOXO1.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|cellular response to hyperoxia (GO:0071455)|cellular stress response to acidic pH (GO:1990451)|extracellular matrix organization (GO:0030198)|hydrogen peroxide metabolic process (GO:0042743)|inflammatory response (GO:0006954)|intracellular pH elevation (GO:0051454)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of JNK cascade (GO:0046330)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation vascular endothelial growth factor production (GO:0010575)|proton transport (GO:0015992)|regulation of blood pressure (GO:0008217)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|respiratory burst (GO:0045730)|signal transduction (GO:0007165)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|invadopodium membrane (GO:0071438)|NADPH oxidase complex (GO:0043020)	metal ion binding (GO:0046872)|NADP binding (GO:0050661)|Rac GTPase binding (GO:0048365)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated proton channel activity (GO:0030171)			cervix(1)|lung(3)|ovary(1)|skin(2)	7						CCAGTAGAAATAGATCTGAAA	0.438																																					p.Y434C		.											.	NOX1	131	0			c.A1301G						.						66.0	52.0	57.0					X																	100104411		2203	4300	6503	SO:0001583	missense	27035	exon11			TAGAAATAGATCT	AF127763	CCDS14474.1, CCDS14475.1, CCDS65298.1	Xq22	2008-08-01			ENSG00000007952	ENSG00000007952			7889	protein-coding gene	gene with protein product	"""mitogenic oxidase (pyridine nucleotide-dependent superoxide-generating)"", ""NADPH oxidase homolog-1"", ""NADPH oxidase 1 variant NOH-1L"""	300225				10485709, 10615049	Standard	NM_007052		Approved	NOH1, NOH-1, MOX1, GP91-2	uc004egj.3	Q9Y5S8	OTTHUMG00000022007	ENST00000372966.3:c.1301A>G	X.37:g.100104411T>C	ENSP00000362057:p.Tyr434Cys	129.0	0.0		130.0	57.0	NM_007052	A8K836|O95691|Q2PP02	Missense_Mutation	SNP	ENST00000372966.3	37	CCDS14474.1	.	.	.	.	.	.	.	.	.	.	T	15.61	2.884711	0.51908	.	.	ENSG00000007952	ENST00000372966;ENST00000372960;ENST00000372957	D;D	0.95238	-3.65;-3.65	4.38	3.15	0.36227	Ferric reductase, NAD binding (1);	0.145948	0.47455	D	0.000228	D	0.97663	0.9234	H	0.95187	3.635	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.993;0.999	D	0.96837	0.9615	10	0.87932	D	0	-7.0052	9.3262	0.37995	0.0:0.0:0.1789:0.8211	.	397;434	A6NGA6;Q9Y5S8	.;NOX1_HUMAN	C	434;397;123	ENSP00000362057:Y434C;ENSP00000362051:Y397C	ENSP00000362048:Y123C	Y	-	2	0	NOX1	99991067	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.094000	0.57721	0.510000	0.28216	0.441000	0.28932	TAT	.		0.438	NOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057495.1	NM_007052	
NOX3	50508	broad.mit.edu;ucsc.edu;mdanderson.org	37	6	155750073	155750073	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr6:155750073C>A	ENST00000159060.2	-	9	1102	c.1000G>T	c.(1000-1002)Gag>Tag	p.E334*		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	334	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		GGGTGCCACTCCAGCGAAGAT	0.582																																					p.E334X		.											.	NOX3	91	0			c.G1000T						.						74.0	76.0	75.0					6																	155750073		2203	4300	6503	SO:0001587	stop_gained	50508	exon9			GCCACTCCAGCGA	AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.1000G>T	6.37:g.155750073C>A	ENSP00000159060:p.Glu334*	127.0	1.0		72.0	51.0	NM_015718	Q9HBJ9	Nonsense_Mutation	SNP	ENST00000159060.2	37	CCDS5250.1	.	.	.	.	.	.	.	.	.	.	C	38	6.689427	0.97764	.	.	ENSG00000074771	ENST00000159060	.	.	.	5.67	3.85	0.44370	.	0.091491	0.47093	D	0.000248	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.0229	16.1903	0.81986	0.0:0.748:0.252:0.0	.	.	.	.	X	334	.	ENSP00000159060:E334X	E	-	1	0	NOX3	155791765	1.000000	0.71417	0.627000	0.29227	0.772000	0.43724	4.590000	0.61013	0.706000	0.31912	0.557000	0.71058	GAG	.		0.582	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042819.1		
NXPE3	91775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	101520122	101520122	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr3:101520122G>A	ENST00000491511.2	+	5	1093	c.137G>A	c.(136-138)aGt>aAt	p.S46N	NXPE3_ENST00000422132.1_Missense_Mutation_p.S46N|NXPE3_ENST00000477909.1_Missense_Mutation_p.S46N|NXPE3_ENST00000273347.5_Missense_Mutation_p.S46N	NM_001134456.1	NP_001127928.1	Q969Y0	NXPE3_HUMAN	neurexophilin and PC-esterase domain family, member 3	46						extracellular region (GO:0005576)											ATCGACAGCAGTGGACAGTTT	0.473																																					p.S46N		.											.	.	.	0			c.G137A						.						137.0	134.0	135.0					3																	101520122		2203	4300	6503	SO:0001583	missense	91775	exon5			ACAGCAGTGGACA	AK054664	CCDS2945.1	3q12.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000144815	ENSG00000144815			28238	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member C"""	FAM55C		12975309	Standard	NM_001134456		Approved	MGC15606	uc003dvn.3	Q969Y0	OTTHUMG00000159179	ENST00000491511.2:c.137G>A	3.37:g.101520122G>A	ENSP00000417485:p.Ser46Asn	229.0	0.0		180.0	51.0	NM_145037	A8K0X4|D3DN53|Q7Z2S8	Missense_Mutation	SNP	ENST00000491511.2	37	CCDS2945.1	.	.	.	.	.	.	.	.	.	.	G	11.94	1.789467	0.31685	.	.	ENSG00000144815	ENST00000273347;ENST00000474165;ENST00000491511;ENST00000477909;ENST00000422132	T;T;T;T	0.12255	2.7;2.7;2.7;2.7	5.82	4.94	0.65067	.	0.268626	0.43747	D	0.000540	T	0.07503	0.0189	N	0.14661	0.345	0.24627	N	0.993647	B	0.02656	0.0	B	0.04013	0.001	T	0.28964	-1.0027	10	0.28530	T	0.3	-6.0747	7.1937	0.25841	0.1042:0.3735:0.5223:0.0	.	46	Q969Y0	FA55C_HUMAN	N	46	ENSP00000273347:S46N;ENSP00000417485:S46N;ENSP00000418369:S46N;ENSP00000396421:S46N	ENSP00000273347:S46N	S	+	2	0	FAM55C	103002812	1.000000	0.71417	0.968000	0.41197	0.973000	0.67179	2.491000	0.45303	1.427000	0.47276	0.655000	0.94253	AGT	.		0.473	NXPE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353711.2	NM_145037	
OR10H4	126541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	16059854	16059854	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr19:16059854A>T	ENST00000322107.1	+	1	37	c.37A>T	c.(37-39)Aac>Tac	p.N13Y		NM_001004465.1	NP_001004465.1	Q8NGA5	O10H4_HUMAN	olfactory receptor, family 10, subfamily H, member 4	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	17						ATCTGAATTTAACCTCTTTGG	0.438																																					p.N13Y		.											.	OR10H4	114	0			c.A37T						.						249.0	217.0	228.0					19																	16059854		2203	4300	6503	SO:0001583	missense	126541	exon1			GAATTTAACCTCT	AC011517	CCDS32941.1	19p13.12	2013-09-24			ENSG00000176231	ENSG00000176231		"""GPCR / Class A : Olfactory receptors"""	15388	protein-coding gene	gene with protein product							Standard	NM_001004465		Approved		uc010xov.2	Q8NGA5	OTTHUMG00000182268	ENST00000322107.1:c.37A>T	19.37:g.16059854A>T	ENSP00000318834:p.Asn13Tyr	73.0	0.0		82.0	38.0	NM_001004465	Q6IFJ2|Q96R57	Missense_Mutation	SNP	ENST00000322107.1	37	CCDS32941.1	.	.	.	.	.	.	.	.	.	.	a	6.992	0.553063	0.13374	.	.	ENSG00000176231	ENST00000322107	T	0.02974	4.09	1.53	0.142	0.14816	.	0.169496	0.27482	U	0.019179	T	0.00906	0.0030	N	0.00436	-1.5	0.09310	N	1	B	0.20887	0.049	B	0.25987	0.065	T	0.47812	-0.9088	10	0.72032	D	0.01	.	5.1888	0.15199	0.4575:0.5425:0.0:0.0	.	13	Q8NGA5	O10H4_HUMAN	Y	13	ENSP00000318834:N13Y	ENSP00000318834:N13Y	N	+	1	0	OR10H4	15920854	0.951000	0.32395	0.013000	0.15412	0.013000	0.08279	0.601000	0.24119	0.691000	0.31592	0.386000	0.25728	AAC	.		0.438	OR10H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460311.1		
OR10R2	343406	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	158449817	158449817	+	Silent	SNP	T	T	A	rs373275320		TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr1:158449817T>A	ENST00000368152.1	+	1	150	c.150T>A	c.(148-150)gtT>gtA	p.V50V	RP11-144L1.4_ENST00000419738.1_RNA|RP11-144L1.4_ENST00000426251.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					TCTTTGTAGTTTTTCTTTTTC	0.448																																					p.V50V		.											.	OR10R2	161	0			c.T150A						.						153.0	142.0	146.0					1																	158449817		2203	4300	6503	SO:0001819	synonymous_variant	343406	exon1			TGTAGTTTTTCTT	AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.150T>A	1.37:g.158449817T>A		104.0	2.0		148.0	61.0	NM_001004472	Q5VWM8|Q6IFS1|Q96R61	Silent	SNP	ENST00000368152.1	37	CCDS30898.1																																																																																			.		0.448	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051847.2	NM_001004472	
PARP9	83666	ucsc.edu;bcgsc.ca	37	3	122271265	122271265	+	Splice_Site	SNP	C	C	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr3:122271265C>T	ENST00000360356.2	-	5	1439	c.1212G>A	c.(1210-1212)caG>caA	p.Q404Q	PARP9_ENST00000462315.1_Splice_Site_p.Q369Q|PARP9_ENST00000471785.1_Splice_Site_p.Q369Q|PARP9_ENST00000492382.1_Intron|PARP9_ENST00000477522.2_Splice_Site_p.Q369Q	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	404	Macro 2. {ECO:0000255|PROSITE- ProRule:PRU00490}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		TTAAACTTACCTGAGGTTTAG	0.303																																					p.Q404Q		.											.	PARP9	525	0			c.G1212A						.						57.0	58.0	57.0					3																	122271265		2203	4300	6503	SO:0001630	splice_region_variant	83666	exon5			ACTTACCTGAGGT	AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.1212+1G>A	3.37:g.122271265C>T		156.0	2.0		106.0	65.0	NM_031458	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Silent	SNP	ENST00000360356.2	37	CCDS3014.1																																																																																			.		0.303	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	NM_031458	Silent
PCDHA13	56136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140262349	140262349	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr5:140262349T>A	ENST00000289272.2	+	1	496	c.496T>A	c.(496-498)Tcg>Acg	p.S166T	PCDHA13_ENST00000409494.1_Missense_Mutation_p.S166T|PCDHA6_ENST00000527624.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000307360.5_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	166	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGAGTAAACTCGGCATTGAC	0.428																																					p.S166T	Melanoma(147;1739 1852 5500 27947 37288)	.											.	PCDHA13	75	0			c.T496A						.						98.0	94.0	95.0					5																	140262349		2203	4300	6503	SO:0001583	missense	56136	exon1			GTAAACTCGGCAT	AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.496T>A	5.37:g.140262349T>A	ENSP00000289272:p.Ser166Thr	144.0	0.0		139.0	70.0	NM_031865	O75277	Missense_Mutation	SNP	ENST00000289272.2	37	CCDS4240.1	.	.	.	.	.	.	.	.	.	.	T	12.96	2.094321	0.36952	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.39997	1.05;1.05	5.49	-5.76	0.02376	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.51873	0.1700	M	0.67397	2.05	0.09310	N	0.999999	B;B;P	0.35411	0.251;0.029;0.5	P;B;P	0.46076	0.486;0.202;0.503	T	0.61397	-0.7071	9	0.56958	D	0.05	.	19.8719	0.96853	0.0:0.0:0.6175:0.3825	.	166;166;166	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	T	166	ENSP00000386821:S166T;ENSP00000289272:S166T	ENSP00000289272:S166T	S	+	1	0	PCDHA13	140242533	0.000000	0.05858	0.002000	0.10522	0.915000	0.54546	-0.130000	0.10498	-0.589000	0.05874	0.402000	0.26972	TCG	.		0.428	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
PCDHB4	56131	broad.mit.edu;bcgsc.ca	37	5	140502767	140502767	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr5:140502767T>C	ENST00000194152.1	+	1	1187	c.1187T>C	c.(1186-1188)tTg>tCg	p.L396S	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	396	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAACCAACTTTGAAGAATTTT	0.448																																					p.L396S		.											.	PCDHB4	93	0			c.T1187C						.						64.0	66.0	66.0					5																	140502767		2203	4300	6503	SO:0001583	missense	56131	exon1			CAACTTTGAAGAA	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1187T>C	5.37:g.140502767T>C	ENSP00000194152:p.Leu396Ser	88.0	2.0		112.0	50.0	NM_018938	Q4V761	Missense_Mutation	SNP	ENST00000194152.1	37	CCDS4246.1	.	.	.	.	.	.	.	.	.	.	T	0.371	-0.934174	0.02340	.	.	ENSG00000081818	ENST00000194152	T	0.35973	1.28	4.25	3.05	0.35203	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.21022	0.0506	N	0.16037	0.36	0.09310	N	1	B	0.16802	0.019	B	0.29440	0.102	T	0.26292	-1.0107	9	0.62326	D	0.03	.	1.8528	0.03172	0.2744:0.0806:0.1418:0.5032	.	396	Q9Y5E5	PCDB4_HUMAN	S	396	ENSP00000194152:L396S	ENSP00000194152:L396S	L	+	2	0	PCDHB4	140482951	0.000000	0.05858	0.961000	0.40146	0.064000	0.16182	-0.153000	0.10144	0.756000	0.33013	0.456000	0.33151	TTG	.		0.448	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938	
PCDHGA10	56106	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140794859	140794859	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr5:140794859G>T	ENST00000398610.2	+	1	2117	c.2117G>T	c.(2116-2118)tGc>tTc	p.C706F	PCDHGA9_ENST00000573521.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB7_ENST00000398594.2_5'Flank	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	706					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGTCTCCTGCGTCTTCCTG	0.642																																					p.C706F		.											.	.	.	0			c.G2117T						.						70.0	81.0	77.0					5																	140794859		2203	4296	6499	SO:0001583	missense	56106	exon1			TCTCCTGCGTCTT		CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.2117G>T	5.37:g.140794859G>T	ENSP00000381611:p.Cys706Phe	113.0	0.0		113.0	57.0	NM_032090	Q9Y5E0	Missense_Mutation	SNP	ENST00000398610.2	37	CCDS47292.1	.	.	.	.	.	.	.	.	.	.	g	2.026	-0.423484	0.04734	.	.	ENSG00000253846	ENST00000398610	T	0.09350	2.99	5.57	3.68	0.42216	.	.	.	.	.	T	0.12220	0.0297	L	0.58101	1.795	0.09310	N	1	P;B	0.38863	0.65;0.162	B;B	0.40636	0.335;0.066	T	0.12967	-1.0527	9	0.13470	T	0.59	.	8.6572	0.34071	0.0908:0.1666:0.7426:0.0	.	706;706	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	F	706	ENSP00000381611:C706F	ENSP00000381611:C706F	C	+	2	0	PCDHGA10	140775043	0.000000	0.05858	0.177000	0.23020	0.001000	0.01503	0.367000	0.20382	1.363000	0.46019	-0.136000	0.14681	TGC	.		0.642	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1	NM_018913	
PDE1C	5137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	31918700	31918700	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr7:31918700G>A	ENST00000396191.1	-	4	789	c.334C>T	c.(334-336)Cgg>Tgg	p.R112W	PDE1C_ENST00000396182.2_Missense_Mutation_p.R112W|PDE1C_ENST00000396184.3_Missense_Mutation_p.R112W|PDE1C_ENST00000321453.7_Missense_Mutation_p.R112W|PDE1C_ENST00000396193.1_Missense_Mutation_p.R172W	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	112					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	CCCATCTGCCGCGTGAAGGTG	0.557																																					p.R172W		.											.	PDE1C	94	0			c.C514T						.						103.0	92.0	96.0					7																	31918700		2203	4300	6503	SO:0001583	missense	5137	exon5			TCTGCCGCGTGAA	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.334C>T	7.37:g.31918700G>A	ENSP00000379494:p.Arg112Trp	42.0	0.0		50.0	23.0	NM_001191058	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	ENST00000396191.1	37	CCDS55099.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.060875	0.76074	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.76316	-0.99;-1.01;-1.01;-0.96;-0.96	5.72	1.46	0.22682	-cyclic nucleotide phosphodiesterase N-terminal (1);5&apos (1);3&apos (1);	0.063961	0.64402	D	0.000006	D	0.87366	0.6159	M	0.82056	2.57	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.996	D	0.88426	0.3032	10	0.87932	D	0	.	15.0182	0.71605	0.0:0.0:0.4909:0.5091	.	112;172;112	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	W	172;112;112;112;112	ENSP00000379496:R172W;ENSP00000379494:R112W;ENSP00000318105:R112W;ENSP00000379487:R112W;ENSP00000379485:R112W	ENSP00000318105:R112W	R	-	1	2	PDE1C	31885225	0.728000	0.28080	0.367000	0.25926	0.870000	0.49936	0.908000	0.28545	0.260000	0.21731	0.655000	0.94253	CGG	.		0.557	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1		
PHF7	51533	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52448577	52448577	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr3:52448577A>G	ENST00000327906.3	+	4	820	c.160A>G	c.(160-162)Aat>Gat	p.N54D	PHF7_ENST00000347025.2_Missense_Mutation_p.N54D|PHF7_ENST00000482327.1_3'UTR	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7	54						Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		TCAGAAAGACAATATCAGCGT	0.428																																					p.N54D		.											.	PHF7	153	0			c.A160G						.						129.0	129.0	129.0					3																	52448577		2203	4300	6503	SO:0001583	missense	51533	exon4			AAAGACAATATCA	AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495	ENST00000327906.3:c.160A>G	3.37:g.52448577A>G	ENSP00000333024:p.Asn54Asp	105.0	0.0		85.0	45.0	NM_016483	K4DI82	Missense_Mutation	SNP	ENST00000327906.3	37	CCDS2854.1	.	.	.	.	.	.	.	.	.	.	A	13.16	2.154905	0.38021	.	.	ENSG00000010318	ENST00000478707;ENST00000327906;ENST00000347025;ENST00000454052	D;D;D	0.92699	-2.11;-2.11;-3.09	5.45	1.58	0.23477	.	0.464026	0.25159	N	0.032681	D	0.85856	0.5794	L	0.43152	1.355	0.31581	N	0.655053	B;B	0.11235	0.004;0.004	B;B	0.06405	0.002;0.002	T	0.77253	-0.2656	10	0.34782	T	0.22	-12.5926	6.9802	0.24698	0.6934:0.0:0.3066:0.0	.	54;54	A8K856;Q9BWX1	.;PHF7_HUMAN	D	54;54;54;19	ENSP00000419316:N54D;ENSP00000333024:N54D;ENSP00000246282:N54D	ENSP00000333024:N54D	N	+	1	0	PHF7	52423617	0.905000	0.30787	0.992000	0.48379	0.922000	0.55478	0.501000	0.22578	0.025000	0.15241	0.460000	0.39030	AAT	.		0.428	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1	NM_016483	
PLEKHA5	54477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	19436617	19436617	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr12:19436617T>C	ENST00000299275.6	+	11	1705	c.1699T>C	c.(1699-1701)Tct>Cct	p.S567P	PLEKHA5_ENST00000424268.1_Missense_Mutation_p.S459P|PLEKHA5_ENST00000539256.1_Missense_Mutation_p.S325P|PLEKHA5_ENST00000359180.3_Missense_Mutation_p.S567P|PLEKHA5_ENST00000429027.2_Missense_Mutation_p.S573P|PLEKHA5_ENST00000510738.2_3'UTR|PLEKHA5_ENST00000317589.4_Missense_Mutation_p.S567P|PLEKHA5_ENST00000543806.1_Missense_Mutation_p.S459P|PLEKHA5_ENST00000309364.4_Missense_Mutation_p.S567P|PLEKHA5_ENST00000538714.1_Missense_Mutation_p.S567P|PLEKHA5_ENST00000355397.3_Missense_Mutation_p.S567P	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	567					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					ATCGGAAGTGTCTTCACCAAT	0.468																																					p.S573P	Pancreas(196;329 2193 11246 14234 19524)	.											.	PLEKHA5	227	0			c.T1717C						.						56.0	56.0	56.0					12																	19436617		2203	4300	6503	SO:0001583	missense	54477	exon12			GAAGTGTCTTCAC	AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.1699T>C	12.37:g.19436617T>C	ENSP00000299275:p.Ser567Pro	73.0	0.0		78.0	33.0	NM_001256470	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Missense_Mutation	SNP	ENST00000299275.6	37	CCDS8682.1	.	.	.	.	.	.	.	.	.	.	T	13.56	2.274787	0.40194	.	.	ENSG00000052126	ENST00000317589;ENST00000355397;ENST00000359180;ENST00000542828;ENST00000309364;ENST00000429027;ENST00000299275;ENST00000539256;ENST00000538714;ENST00000424268;ENST00000543806;ENST00000536974	T;T;T;T;T;T;T;T;T;T;T	0.14893	2.47;2.47;2.47;2.47;2.47;2.47;2.47;2.47;2.47;2.47;2.47	3.86	-2.34	0.06704	.	0.176958	0.51477	D	0.000087	T	0.30696	0.0773	M	0.74258	2.255	0.29973	N	0.818423	D;D;P;P;D;D;D	0.63046	0.988;0.959;0.93;0.84;0.96;0.992;0.987	P;P;P;B;P;P;D	0.63703	0.759;0.882;0.766;0.432;0.634;0.894;0.917	T	0.17776	-1.0358	10	0.27785	T	0.31	-5.3793	10.0627	0.42284	0.5132:0.0:0.0:0.4868	.	567;459;459;573;573;567;567	Q9HAU0-4;F5H0I0;E7EME8;B4DHK5;E9PHQ3;Q9HAU0;Q9HAU0-2	.;.;.;.;.;PKHA5_HUMAN;.	P	567;567;567;574;567;573;567;325;567;459;459;459	ENSP00000325155:S567P;ENSP00000347560:S567P;ENSP00000352104:S567P;ENSP00000311239:S567P;ENSP00000404296:S573P;ENSP00000299275:S567P;ENSP00000440611:S325P;ENSP00000439673:S567P;ENSP00000400411:S459P;ENSP00000439837:S459P;ENSP00000440371:S459P	ENSP00000299275:S567P	S	+	1	0	PLEKHA5	19327884	0.999000	0.42202	0.488000	0.27440	0.427000	0.31564	1.263000	0.33004	-0.541000	0.06257	-0.490000	0.04691	TCT	.		0.468	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	
POPDC3	64208	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	105606476	105606476	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr6:105606476T>C	ENST00000254765.3	-	4	1023	c.745A>G	c.(745-747)Agg>Ggg	p.R249G	POPDC3_ENST00000474760.1_5'UTR|BVES-AS1_ENST00000369120.2_RNA|BVES-AS1_ENST00000580511.1_RNA|BVES-AS1_ENST00000580854.1_RNA|BVES-AS1_ENST00000369122.3_RNA	NM_022361.4	NP_071756.2	Q9HBV1	POPD3_HUMAN	popeye domain containing 3	249					regulation of membrane potential (GO:0042391)	integral component of membrane (GO:0016021)				NS(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(3)|urinary_tract(1)	26		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				ATATATACCCTGTCATTCAAG	0.398																																					p.R249G		.											.	POPDC3	519	0			c.A745G						.						161.0	160.0	161.0					6																	105606476		2203	4300	6503	SO:0001583	missense	64208	exon4			ATACCCTGTCATT	BC022323	CCDS5052.1	6q21	2003-06-12			ENSG00000132429	ENSG00000132429			17649	protein-coding gene	gene with protein product		605824				10882522	Standard	NM_022361		Approved	POP3, MGC22671, bA355M14.1	uc003prb.3	Q9HBV1	OTTHUMG00000015293	ENST00000254765.3:c.745A>G	6.37:g.105606476T>C	ENSP00000254765:p.Arg249Gly	156.0	0.0		138.0	83.0	NM_022361	B2RA98|Q5T3Y8|Q8TBW6	Missense_Mutation	SNP	ENST00000254765.3	37	CCDS5052.1	.	.	.	.	.	.	.	.	.	.	T	17.51	3.407862	0.62399	.	.	ENSG00000132429	ENST00000254765;ENST00000429112	T;T	0.31510	1.49;1.49	5.99	5.99	0.97316	Cyclic nucleotide-binding-like (1);	0.047737	0.85682	D	0.000000	T	0.23846	0.0577	L	0.34521	1.04	0.45056	D	0.998073	P	0.48089	0.905	P	0.48598	0.583	T	0.02424	-1.1161	10	0.72032	D	0.01	-27.2323	16.4719	0.84113	0.0:0.0:0.0:1.0	.	249	Q9HBV1	POPD3_HUMAN	G	249;95	ENSP00000254765:R249G;ENSP00000414409:R95G	ENSP00000254765:R249G	R	-	1	2	POPDC3	105713169	1.000000	0.71417	0.989000	0.46669	0.623000	0.37688	3.882000	0.56160	2.292000	0.77174	0.482000	0.46254	AGG	.		0.398	POPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041651.1	NM_022361	
RAB33A	9363	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	129306277	129306277	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chrX:129306277G>T	ENST00000257017.4	+	1	655	c.241G>T	c.(241-243)Gag>Tag	p.E81*		NM_004794.2	NP_004785.1	Q14088	RB33A_HUMAN	RAB33A, member RAS oncogene family	81					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(5)	11						CGTGGAAATCGAGGGCGAGAA	0.627																																					p.E81X		.											.	RAB33A	227	0			c.G241T						.						73.0	62.0	66.0					X																	129306277		2203	4300	6503	SO:0001587	stop_gained	9363	exon1			GAAATCGAGGGCG	D14889	CCDS14621.1	Xq26	2008-02-05			ENSG00000134594	ENSG00000134594		"""RAB, member RAS oncogene"""	9773	protein-coding gene	gene with protein product		300333				7688322, 9512502	Standard	NM_004794		Approved	RabS10	uc004evl.3	Q14088	OTTHUMG00000022391	ENST00000257017.4:c.241G>T	X.37:g.129306277G>T	ENSP00000257017:p.Glu81*	61.0	0.0		48.0	17.0	NM_004794	Q5JUZ6|Q92465	Nonsense_Mutation	SNP	ENST00000257017.4	37	CCDS14621.1	.	.	.	.	.	.	.	.	.	.	G	41	9.051778	0.99050	.	.	ENSG00000134594	ENST00000257017	.	.	.	4.69	4.69	0.59074	.	0.102867	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-20.474	13.5967	0.61994	0.0:0.1522:0.8478:0.0	.	.	.	.	X	81	.	ENSP00000257017:E81X	E	+	1	0	RAB33A	129133958	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.196000	0.72094	2.314000	0.78098	0.600000	0.82982	GAG	.		0.627	RAB33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058246.1	NM_004794	
RANGAP1	5905	hgsc.bcm.edu;bcgsc.ca	37	22	41650402	41650402	+	Silent	SNP	C	C	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr22:41650402C>T	ENST00000455915.2	-	10	2639	c.1170G>A	c.(1168-1170)gaG>gaA	p.E390E	RANGAP1_ENST00000405486.1_Silent_p.E390E|RANGAP1_ENST00000356244.3_Silent_p.E390E|RANGAP1_ENST00000407260.4_Silent_p.E335E			P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	390	Asp/Glu-rich (highly acidic).				mitotic cell cycle (GO:0000278)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear pore (GO:0005643)|perinuclear region of cytoplasm (GO:0048471)	Ran GTPase activator activity (GO:0005098)	p.E390E(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						cctcctcctcctcttcttcct	0.562																																					p.E390E		.											.	RANGAP1	90	1	Substitution - coding silent(1)	kidney(1)	c.G1170A						.						233.0	159.0	184.0					22																	41650402		2203	4300	6503	SO:0001819	synonymous_variant	5905	exon11			CTCCTCCTCTTCT	X82260	CCDS14012.1	22q13	2013-01-17			ENSG00000100401	ENSG00000100401			9854	protein-coding gene	gene with protein product		602362	"""segregation distorter homolog (Drosophila)"""	SD		7878053	Standard	NM_002883		Approved	Fug1, KIAA1835	uc003azu.3	P46060	OTTHUMG00000150940	ENST00000455915.2:c.1170G>A	22.37:g.41650402C>T		50.0	0.0		47.0	5.0	NM_002883	Q96JJ2	Silent	SNP	ENST00000455915.2	37	CCDS14012.1																																																																																			.		0.562	RANGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320606.1	NM_002883	
RB1	5925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	48951053	48951053	+	Splice_Site	SNP	G	G	A	rs587778831		TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr13:48951053G>A	ENST00000267163.4	+	13	1353		c.e13-1			NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(11)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ACCTCCTAAAGAACTGCACAG	0.318		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											.		.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	RB1,NS,carcinoma,0	RB1	3784	26	Whole gene deletion(15)|Unknown(11)	bone(11)|breast(5)|central_nervous_system(2)|lung(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|ovary(1)	c.1216-1G>A	GRCh37	CS971888	RB1	S		.						83.0	90.0	88.0					13																	48951053		2203	4300	6503	SO:0001630	splice_region_variant	5925	exon13	Familial Cancer Database		CCTAAAGAACTGC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1216-1G>A	13.37:g.48951053G>A		105.0	0.0		62.0	54.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	ENST00000267163.4	37	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.063103	0.76187	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3495	0.98807	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47849054	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	8.600000	0.90860	2.814000	0.96858	0.591000	0.81541	.	.		0.318	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		Intron
RNASE1	6035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	21270068	21270068	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr14:21270068A>G	ENST00000397967.4	-	2	666	c.160T>C	c.(160-162)Tgt>Cgt	p.C54R	RNASE1_ENST00000397970.4_Missense_Mutation_p.C54R|RNASE1_ENST00000412779.2_Missense_Mutation_p.C54R|RNASE1_ENST00000555698.1_Missense_Mutation_p.C14R|RNASE1_ENST00000340900.3_Missense_Mutation_p.C54R	NM_002933.4	NP_002924.1	P07998	RNAS1_HUMAN	ribonuclease, RNase A family, 1 (pancreatic)	54					RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular vesicular exosome (GO:0070062)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	5	all_cancers(95;0.00671)	all_lung(585;0.235)	Epithelial(56;9.21e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0126)	Guanidine(DB00536)|L-Aspartic Acid(DB00128)	ATTTGGTTACAGTAGGTGGAG	0.567																																					p.C54R		.											.	RNASE1	90	0			c.T160C						.						95.0	88.0	90.0					14																	21270068		2203	4300	6503	SO:0001583	missense	6035	exon3			GGTTACAGTAGGT	BC005324	CCDS9559.1	14q11.2	2014-03-13			ENSG00000129538	ENSG00000129538	3.1.27.5	"""Ribonucleases, RNase A"""	10044	protein-coding gene	gene with protein product		180440		RNS1		8588814	Standard	NM_002933		Approved		uc001vyi.3	P07998	OTTHUMG00000029603	ENST00000397967.4:c.160T>C	14.37:g.21270068A>G	ENSP00000381057:p.Cys54Arg	49.0	0.0		52.0	22.0	NM_198235	B2R589|D3DS06|Q16830|Q16869|Q1KHR2|Q6ICS5|Q9UCB4|Q9UCB5	Missense_Mutation	SNP	ENST00000397967.4	37	CCDS9559.1	.	.	.	.	.	.	.	.	.	.	A	15.00	2.703007	0.48412	.	.	ENSG00000129538	ENST00000397967;ENST00000340900;ENST00000412779;ENST00000555698;ENST00000397970	D;D;D;D;D	0.96802	-4.13;-4.13;-4.13;-4.13;-4.13	5.02	5.02	0.67125	Ribonuclease A, domain (4);	0.000000	0.85682	D	0.000000	D	0.98934	0.9638	H	0.99487	4.59	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.98640	1.0675	10	0.72032	D	0.01	-43.7209	11.0542	0.47909	1.0:0.0:0.0:0.0	.	54	P07998	RNAS1_HUMAN	R	54;54;54;14;54	ENSP00000381057:C54R;ENSP00000344193:C54R;ENSP00000399493:C54R;ENSP00000451058:C14R;ENSP00000381060:C54R	ENSP00000344193:C54R	C	-	1	0	RNASE1	20339908	1.000000	0.71417	0.998000	0.56505	0.116000	0.19942	2.562000	0.45914	2.117000	0.64856	0.459000	0.35465	TGT	.		0.567	RNASE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073791.3		
RORB	6096	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	77286750	77286752	+	In_Frame_Del	DEL	AAA	AAA	-			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	AAA	AAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr9:77286750_77286752delAAA	ENST00000396204.2	+	9	1190_1192	c.1190_1192delAAA	c.(1189-1194)gaaaaa>gaa	p.K398del	RORB_ENST00000376896.3_In_Frame_Del_p.K387del			Q92753	RORB_HUMAN	RAR-related orphan receptor B	398	Ligand-binding. {ECO:0000255}.				amacrine cell differentiation (GO:0035881)|cellular response to retinoic acid (GO:0071300)|eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(1)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	12					Melatonin(DB01065)	AAGCTTCAGGAAAAAATTTATTT	0.438																																					p.386_387del		.											.	RORB	229	0			c.1157_1159del						.																																			SO:0001651	inframe_deletion	6096	exon9			TTCAGGAAAAAAT	Y08639	CCDS6646.1	9q22	2013-01-16			ENSG00000198963	ENSG00000198963		"""Nuclear hormone receptors"""	10259	protein-coding gene	gene with protein product		601972				7926749	Standard	NM_006914		Approved	RZRB, NR1F2, ROR-BETA	uc004ajh.3	Q92753	OTTHUMG00000020026	ENST00000396204.2:c.1190_1192delAAA	9.37:g.77286753_77286755delAAA	ENSP00000379507:p.Lys398del	248.0	0.0		292.0	120.0	NM_006914	Q8WX73	In_Frame_Del	DEL	ENST00000396204.2	37																																																																																				.		0.438	RORB-201	KNOWN	basic	protein_coding	protein_coding			
RPS6KA3	6197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	20181160	20181160	+	Splice_Site	SNP	T	T	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chrX:20181160T>A	ENST00000379565.3	-	19	1972		c.e19-2		RPS6KA3_ENST00000479809.1_Splice_Site|RPS6KA3_ENST00000544447.1_Splice_Site|RPS6KA3_ENST00000379548.4_Splice_Site|RPS6KA3_ENST00000540702.1_Splice_Site	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3						axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	TTTTAAAACCTAGAAAAAGTG	0.328																																					.		.											.	RPS6KA3	1504	0			c.1765-2A>T						.						123.0	107.0	113.0					X																	20181160		2203	4300	6503	SO:0001630	splice_region_variant	6197	exon20			AAAACCTAGAAAA	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1765-2A>T	X.37:g.20181160T>A		208.0	0.0		213.0	108.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Splice_Site	SNP	ENST00000379565.3	37	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	T	18.69	3.677847	0.68042	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9516	0.64121	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RPS6KA3	20091081	1.000000	0.71417	0.996000	0.52242	0.837000	0.47467	8.018000	0.88722	1.670000	0.50864	0.339000	0.21740	.	.		0.328	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	Intron
SCGB2A2	4250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	62038372	62038372	+	Silent	SNP	G	G	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr11:62038372G>A	ENST00000227918.2	+	2	137	c.75G>A	c.(73-75)ttG>ttA	p.L25L	SCGB2A2_ENST00000525380.1_Silent_p.L25L	NM_002411.2	NP_002402.1	Q13296	SG2A2_HUMAN	secretoglobin, family 2A, member 2	25										large_intestine(1)|lung(4)|ovary(1)|prostate(1)	7						GCCCCTTATTGGAGAATGTGA	0.443																																					p.L25L		.											.	SCGB2A2	91	0			c.G75A						.						72.0	66.0	68.0					11																	62038372		2202	4299	6501	SO:0001819	synonymous_variant	4250	exon2			CTTATTGGAGAAT	AF015224	CCDS8018.1	11q13	2011-12-14	2002-03-22	2002-03-22	ENSG00000110484	ENSG00000110484		"""Secretoglobins"""	7050	protein-coding gene	gene with protein product	"""mammaglobin A"""	605562	"""mammaglobin 1"""	MGB1		9488047, 8631025, 22155607	Standard	XM_005274005		Approved	UGB2, MGC71974	uc001ntc.3	Q13296	OTTHUMG00000167509	ENST00000227918.2:c.75G>A	11.37:g.62038372G>A		62.0	0.0		90.0	38.0	NM_002411	A1A522|Q86WH8	Silent	SNP	ENST00000227918.2	37	CCDS8018.1																																																																																			.		0.443	SCGB2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394860.1	NM_002411	
SCN9A	6335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	167149749	167149749	+	Missense_Mutation	SNP	A	A	T	rs200457046		TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr2:167149749A>T	ENST00000409435.1	-	8	1098	c.1099T>A	c.(1099-1101)Tac>Aac	p.Y367N	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.Y368N|SCN9A_ENST00000409672.1_Missense_Mutation_p.Y367N|SCN9A_ENST00000375387.4_Missense_Mutation_p.Y368N			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	367					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACCTGTTGGTAAAGGTTTTCC	0.403																																					p.Y367N		.											.	SCN9A	181	0			c.T1099A						.						35.0	36.0	36.0					2																	167149749		1938	4159	6097	SO:0001583	missense	6335	exon9			GTTGGTAAAGGTT	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.1099T>A	2.37:g.167149749A>T	ENSP00000386330:p.Tyr367Asn	96.0	0.0		85.0	30.0	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.738741	0.89573	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435;ENST00000454569;ENST00000452182	D;D;D;D;D;D	0.98633	-5.04;-5.04;-5.04;-5.04;-5.04;-5.04	5.88	5.88	0.94601	Ion transport (1);	0.312551	0.27871	N	0.017511	D	0.99513	0.9826	H	0.97896	4.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98045	1.0384	10	0.87932	D	0	.	16.275	0.82640	1.0:0.0:0.0:0.0	.	367;367;368	E7EUN6;Q15858;E9PF08	.;SCN9A_HUMAN;.	N	367;368;368;367;232;232	ENSP00000386306:Y367N;ENSP00000364536:Y368N;ENSP00000304748:Y368N;ENSP00000386330:Y367N;ENSP00000413212:Y232N;ENSP00000393141:Y232N	ENSP00000304748:Y368N	Y	-	1	0	SCN9A	166857995	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.331000	0.96430	2.248000	0.74166	0.477000	0.44152	TAC	.		0.403	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
SEZ6	124925	ucsc.edu;bcgsc.ca	37	17	27309008	27309008	+	Silent	SNP	G	G	T	rs371133854		TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr17:27309008G>T	ENST00000317338.12	-	2	533	c.105C>A	c.(103-105)atC>atA	p.I35I	SEZ6_ENST00000335960.6_Silent_p.I35I|SEZ6_ENST00000360295.9_Silent_p.I35I|PIPOX_ENST00000583215.1_Intron|SEZ6_ENST00000442608.3_Silent_p.I35I			Q53EL9	SEZ6_HUMAN	seizure related 6 homolog (mouse)	35					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|negative regulation of dendrite development (GO:2000171)|positive regulation of dendrite development (GO:1900006)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	apical dendrite (GO:0097440)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	29	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			CTGTCTCCTCGATGCCTGGGG	0.587																																					p.I35I		.											.	SEZ6	90	0			c.C105A						.						33.0	37.0	36.0					17																	27309008		2108	4240	6348	SO:0001819	synonymous_variant	124925	exon2			CTCCTCGATGCCT	AY038048	CCDS45638.1, CCDS45639.1	17q11.2	2008-03-06	2001-11-28		ENSG00000063015	ENSG00000063015			15955	protein-coding gene	gene with protein product			"""seizure related gene 6 (mouse) homolog"""			17086543	Standard	NM_178860		Approved		uc002hdp.2	Q53EL9	OTTHUMG00000168010	ENST00000317338.12:c.105C>A	17.37:g.27309008G>T		30.0	0.0		35.0	4.0	NM_001098635	B6ZDN1|Q8N701|Q8NB57|Q8ND50|Q8TD25|Q96NI5|Q96NQ3	Silent	SNP	ENST00000317338.12	37	CCDS45639.1																																																																																			.		0.587	SEZ6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397475.3		
SLITRK6	84189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	86370519	86370519	+	Missense_Mutation	SNP	C	C	G			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr13:86370519C>G	ENST00000400286.2	-	2	723	c.125G>C	c.(124-126)gGc>gCc	p.G42A		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	42	LRRNT 1.				adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		TAGCATTGTGCCATCTTTTTC	0.398																																					p.G42A		.											.	SLITRK6	137	0			c.G125C						.						97.0	91.0	93.0					13																	86370519		1894	4113	6007	SO:0001583	missense	84189	exon2			ATTGTGCCATCTT	AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.125G>C	13.37:g.86370519C>G	ENSP00000383143:p.Gly42Ala	131.0	0.0		74.0	61.0	NM_032229	A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	ENST00000400286.2	37	CCDS41903.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.232781	0.58777	.	.	ENSG00000184564	ENST00000400286	T	0.59502	0.26	6.17	6.17	0.99709	.	0.053590	0.85682	D	0.000000	T	0.64360	0.2591	M	0.62723	1.935	0.47341	D	0.999397	D	0.61697	0.99	P	0.50659	0.647	T	0.67031	-0.5773	10	0.72032	D	0.01	-6.7433	13.6567	0.62341	0.0:0.9262:0.0:0.0738	.	42	Q9H5Y7	SLIK6_HUMAN	A	42	ENSP00000383143:G42A	ENSP00000383143:G42A	G	-	2	0	SLITRK6	85268520	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.984000	0.56923	2.941000	0.99782	0.655000	0.94253	GGC	.		0.398	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045404.2	NM_032229	
SMARCA4	6597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11132515	11132515	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr19:11132515G>A	ENST00000429416.3	+	20	3012	c.2731G>A	c.(2731-2733)Ggc>Agc	p.G911S	SMARCA4_ENST00000413806.3_Missense_Mutation_p.G911S|SMARCA4_ENST00000344626.4_Missense_Mutation_p.G911S|SMARCA4_ENST00000590574.1_Missense_Mutation_p.G911S|SMARCA4_ENST00000450717.3_Missense_Mutation_p.G911S|SMARCA4_ENST00000541122.2_Missense_Mutation_p.G911S|SMARCA4_ENST00000589677.1_Missense_Mutation_p.G911S|SMARCA4_ENST00000358026.2_Missense_Mutation_p.G911S|SMARCA4_ENST00000444061.3_Missense_Mutation_p.G911S	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	911	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GCTGCTGACGGGCACACCGCT	0.592			"""F, N, Mis"""		NSCLC																																p.G911S		.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4	1523	1	Unknown(1)	lung(1)	c.G2731A						.						91.0	69.0	76.0					19																	11132515		2203	4300	6503	SO:0001583	missense	6597	exon19			CTGACGGGCACAC	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2731G>A	19.37:g.11132515G>A	ENSP00000395654:p.Gly911Ser	51.0	0.0		58.0	20.0	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.747479	0.69533	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.95821	-3.82;-3.82;-3.82;-3.82;-3.82;-3.82;-3.82	4.51	4.51	0.55191	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98798	0.9595	H	0.99197	4.465	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.997;0.999;0.999;0.999	D	0.99278	1.0895	10	0.87932	D	0	-36.4224	16.1519	0.81629	0.0:0.0:1.0:0.0	.	911;911;911;911;911;131;911;911	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	S	911;911;975;911;911;911;911;911	ENSP00000395654:G911S;ENSP00000350720:G911S;ENSP00000343896:G911S;ENSP00000445036:G911S;ENSP00000392837:G911S;ENSP00000397783:G911S;ENSP00000414727:G911S	ENSP00000343896:G911S	G	+	1	0	SMARCA4	10993515	1.000000	0.71417	0.988000	0.46212	0.003000	0.03518	9.657000	0.98554	2.348000	0.79779	0.655000	0.94253	GGC	.		0.592	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
SUOX	6821	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	56397423	56397423	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr12:56397423A>G	ENST00000394109.3	+	3	974	c.250A>G	c.(250-252)Ata>Gta	p.I84V	SUOX_ENST00000266971.3_Missense_Mutation_p.I84V|SUOX_ENST00000550478.1_3'UTR|SUOX_ENST00000356124.4_Missense_Mutation_p.I84V|SUOX_ENST00000394115.2_Missense_Mutation_p.I84V|SUOX_ENST00000551841.2_Missense_Mutation_p.I84V|SUOX_ENST00000548274.1_Missense_Mutation_p.I84V			P51687	SUOX_HUMAN	sulfite oxidase	84	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|sulfite oxidase activity (GO:0008482)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)	15			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			GTCAACACACATATACACTAA	0.488																																					p.I84V		.											.	SUOX	90	0			c.A250G						.						75.0	74.0	75.0					12																	56397423		2203	4300	6503	SO:0001583	missense	6821	exon6			ACACACATATACA	BC065193	CCDS8901.2	12q13.13	2011-02-10			ENSG00000139531	ENSG00000139531	1.8.3.1		11460	protein-coding gene	gene with protein product		606887				7599189	Standard	XM_005269112		Approved		uc001siz.3	P51687	OTTHUMG00000128503	ENST00000394109.3:c.250A>G	12.37:g.56397423A>G	ENSP00000377668:p.Ile84Val	97.0	0.0		71.0	25.0	NM_000456		Missense_Mutation	SNP	ENST00000394109.3	37	CCDS8901.2	.	.	.	.	.	.	.	.	.	.	A	0.018	-1.486477	0.01018	.	.	ENSG00000139531	ENST00000356124;ENST00000266971;ENST00000394115;ENST00000552258;ENST00000548274;ENST00000546833;ENST00000551841;ENST00000394109	D;D;D;T;D;T;D	0.91464	-2.85;-2.85;-2.85;-1.16;-2.85;-1.16;-2.85	4.91	-3.56	0.04626	Cytochrome b5 (3);	1.070900	0.07135	N	0.846331	T	0.76421	0.3985	N	0.17872	0.535	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.61729	-0.7003	10	0.12766	T	0.61	-4.0698	0.4729	0.00535	0.3668:0.2453:0.1492:0.2387	.	84	P51687	SUOX_HUMAN	V	84	ENSP00000348440:I84V;ENSP00000266971:I84V;ENSP00000377674:I84V;ENSP00000450049:I84V;ENSP00000450245:I84V;ENSP00000449872:I84V;ENSP00000377668:I84V	ENSP00000266971:I84V	I	+	1	0	SUOX	54683690	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.466000	0.06672	-0.445000	0.07159	-0.353000	0.07706	ATA	.		0.488	SUOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250309.1	NM_000456	
SVIL	6840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	29812533	29812533	+	Missense_Mutation	SNP	C	C	T	rs374116755		TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr10:29812533C>T	ENST00000355867.4	-	15	3762	c.3010G>A	c.(3010-3012)Gcg>Acg	p.A1004T	SVIL_ENST00000375398.2_Missense_Mutation_p.A1004T|SVIL_ENST00000375400.3_Missense_Mutation_p.A578T|SVIL_ENST00000535393.1_5'Flank	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1004					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				GGAGGGTTCGCCCGTTCCAGG	0.527																																					p.A1004T		.											.	SVIL	96	0			c.G3010A						.	C	THR/ALA,THR/ALA	0,4406		0,0,2203	99.0	92.0	95.0		1732,3010	0.8	0.0	10		95	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SVIL	NM_003174.3,NM_021738.2	58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	578/1789,1004/2215	29812533	1,13005	2203	4300	6503	SO:0001583	missense	6840	exon15			GGTTCGCCCGTTC	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.3010G>A	10.37:g.29812533C>T	ENSP00000348128:p.Ala1004Thr	109.0	0.0		98.0	52.0	NM_021738	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	37	CCDS7164.1	.	.	.	.	.	.	.	.	.	.	C	5.567	0.289514	0.10567	0.0	1.16E-4	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867	T;T;T	0.11385	2.78;2.84;2.84	5.01	0.769	0.18492	.	1.300130	0.04940	N	0.458396	T	0.09069	0.0224	L	0.41236	1.265	0.09310	N	1	B;B	0.21071	0.051;0.0	B;B	0.13407	0.009;0.002	T	0.37686	-0.9695	9	.	.	.	-0.3226	3.6715	0.08276	0.1367:0.5773:0.1327:0.1533	.	578;1004	O95425-2;O95425	.;SVIL_HUMAN	T	578;1004;1004	ENSP00000364549:A578T;ENSP00000364547:A1004T;ENSP00000348128:A1004T	.	A	-	1	0	SVIL	29852539	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.173000	0.16724	0.622000	0.30249	0.557000	0.71058	GCG	.		0.527	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
TBX18	9096	ucsc.edu;bcgsc.ca	37	6	85446614	85446614	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr6:85446614G>A	ENST00000369663.5	-	8	1950	c.1613C>T	c.(1612-1614)cCc>cTc	p.P538L	TBX18_ENST00000606784.1_Intron	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	538					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		AGCCAGTTTGGGGGATGTGGA	0.498																																					p.P538L		.											.	TBX18	73	0			c.C1613T						.						85.0	99.0	94.0					6																	85446614		2203	4300	6503	SO:0001583	missense	9096	exon8			AGTTTGGGGGATG	AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.1613C>T	6.37:g.85446614G>A	ENSP00000358677:p.Pro538Leu	153.0	2.0		130.0	77.0	NM_001080508	A2RU13|Q7Z6U4|Q9UJI6	Missense_Mutation	SNP	ENST00000369663.5	37	CCDS34495.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.121000	0.77436	.	.	ENSG00000112837	ENST00000369663	D	0.91792	-2.91	5.26	5.26	0.73747	.	.	.	.	.	D	0.93236	0.7845	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93881	0.7171	9	0.59425	D	0.04	.	18.8443	0.92198	0.0:0.0:1.0:0.0	.	538	O95935	TBX18_HUMAN	L	538	ENSP00000358677:P538L	ENSP00000358677:P538L	P	-	2	0	TBX18	85503333	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.044000	0.93805	2.453000	0.82957	0.585000	0.79938	CCC	.		0.498	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041378.2	NM_001080508	
TFE3	7030	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	48888982	48888982	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chrX:48888982C>T	ENST00000315869.7	-	9	1473	c.1214G>A	c.(1213-1215)cGc>cAc	p.R405H	TFE3_ENST00000487451.1_5'UTR	NM_006521.4	NP_006512.2	P19532	TFE3_HUMAN	transcription factor binding to IGHM enhancer 3	405					humoral immune response (GO:0006959)|positive regulation of cell adhesion (GO:0045785)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of osteoclast differentiation (GO:0045670)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)		NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	central_nervous_system(1)	1						GTCTTTGGAGCGCTGCTGCTC	0.602			T	"""SFPQ, ASPSCR1, PRCC, NONO, CLTC"""	"""papillary renal, alveolar soft part sarcoma, renal"""																																p.R405H		.		Dom	yes		X	Xp11.22	7030	transcription factor binding to IGHM enhancer 3		E	.	TFE3	658	0			c.G1214A						.						34.0	31.0	32.0					X																	48888982		2202	4296	6498	SO:0001583	missense	7030	exon9			TTGGAGCGCTGCT	X96717	CCDS14315.3	Xp11.22	2013-05-21			ENSG00000068323	ENSG00000068323		"""Basic helix-loop-helix proteins"""	11752	protein-coding gene	gene with protein product	transcription factor E family, member A	314310				1672758, 1685140	Standard	NM_006521		Approved	TFEA, bHLHe33	uc004dmb.3	P19532	OTTHUMG00000022690	ENST00000315869.7:c.1214G>A	X.37:g.48888982C>T	ENSP00000314129:p.Arg405His	80.0	0.0		75.0	41.0	NM_006521	A8MZL6|Q5JU74|Q92757|Q92758|Q99964	Missense_Mutation	SNP	ENST00000315869.7	37	CCDS14315.3	.	.	.	.	.	.	.	.	.	.	c	24.7	4.562467	0.86335	.	.	ENSG00000068323	ENST00000315869	D	0.97642	-4.47	5.64	3.88	0.44766	Helix-loop-helix DNA-binding (2);	0.000000	0.85682	D	0.000000	D	0.94430	0.8208	L	0.49455	1.56	0.58432	D	0.999996	B	0.24317	0.101	B	0.17722	0.019	D	0.90485	0.4463	10	0.56958	D	0.05	-7.8538	10.5431	0.45045	0.0:0.8379:0.0:0.1621	.	405	P19532	TFE3_HUMAN	H	405	ENSP00000314129:R405H	ENSP00000314129:R405H	R	-	2	0	TFE3	48775926	1.000000	0.71417	0.962000	0.40283	0.983000	0.72400	7.721000	0.84768	0.549000	0.28973	0.462000	0.41574	CGC	.		0.602	TFE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058872.2	NM_006521	
TNC	3371	broad.mit.edu;bcgsc.ca	37	9	117810717	117810717	+	Missense_Mutation	SNP	G	G	T	rs148223175	byFrequency	TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr9:117810717G>T	ENST00000350763.4	-	16	5085	c.4674C>A	c.(4672-4674)agC>agA	p.S1558R	TNC_ENST00000537320.1_Intron|TNC_ENST00000535648.1_Intron|TNC_ENST00000481475.1_5'UTR|TNC_ENST00000341037.4_Intron|TNC_ENST00000542877.1_Intron|TNC_ENST00000340094.3_Missense_Mutation_p.S1194R|TNC_ENST00000346706.3_Intron|TNC_ENST00000345230.3_Intron|TNC_ENST00000423613.2_Intron	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1558	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						TTACTAGAAAGCTGTCAAAGG	0.512																																					p.S1558R		.											.	TNC	517	0			c.C4674A						.						67.0	66.0	66.0					9																	117810717		2203	4300	6503	SO:0001583	missense	3371	exon16			TAGAAAGCTGTCA		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.4674C>A	9.37:g.117810717G>T	ENSP00000265131:p.Ser1558Arg	49.0	0.0		73.0	5.0	NM_002160	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	37	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.229177	0.58777	.	.	ENSG00000041982	ENST00000340094;ENST00000350763	T;T	0.57273	0.41;0.41	5.83	3.99	0.46301	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.148268	0.46442	D	0.000283	T	0.48132	0.1483	L	0.55990	1.75	0.80722	D	1	P	0.36027	0.533	B	0.40602	0.334	T	0.30794	-0.9966	10	0.23302	T	0.38	.	9.4958	0.38986	0.0717:0.0:0.7859:0.1424	.	1558	P24821	TENA_HUMAN	R	1194;1558	ENSP00000344400:S1194R;ENSP00000265131:S1558R	ENSP00000344400:S1194R	S	-	3	2	TNC	116850538	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.235000	0.43044	0.793000	0.33875	0.655000	0.94253	AGC	G|1.000;A|0.000		0.512	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
TOP2B	7155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	25654029	25654029	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr3:25654029T>C	ENST00000264331.4	-	28	3762	c.3763A>G	c.(3763-3765)Aaa>Gaa	p.K1255E	TOP2B_ENST00000475717.1_5'Flank|TOP2B_ENST00000540199.1_Missense_Mutation_p.K107E|TOP2B_ENST00000542520.1_Missense_Mutation_p.K107E|TOP2B_ENST00000435706.2_Missense_Mutation_p.K1250E	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	1255					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	AGCAACTTTTTGCTGGCATCT	0.348																																					p.K1250E		.											.	TOP2B	273	0			c.A3748G						.						137.0	135.0	136.0					3																	25654029		1852	4086	5938	SO:0001583	missense	7155	exon28			ACTTTTTGCTGGC	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.3763A>G	3.37:g.25654029T>C	ENSP00000264331:p.Lys1255Glu	43.0	0.0		48.0	28.0	NM_001068	Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	ENST00000264331.4	37		.	.	.	.	.	.	.	.	.	.	T	16.75	3.210851	0.58343	.	.	ENSG00000077097	ENST00000542520;ENST00000435706;ENST00000264331;ENST00000540199	T;T;T;T	0.54675	0.56;0.86;0.85;0.56	6.16	6.16	0.99307	.	0.081183	0.85682	D	0.000000	T	0.51736	0.1692	M	0.66297	2.02	0.52099	D	0.99994	B;B	0.32918	0.27;0.39	B;B	0.36504	0.113;0.226	T	0.51260	-0.8728	10	0.05620	T	0.96	-15.984	16.8061	0.85666	0.0:0.0:0.0:1.0	.	1255;1250	Q02880;Q02880-2	TOP2B_HUMAN;.	E	107;1250;1255;107	ENSP00000446023:K107E;ENSP00000396704:K1250E;ENSP00000264331:K1255E;ENSP00000437352:K107E	ENSP00000264331:K1255E	K	-	1	0	TOP2B	25629033	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.576000	0.82467	2.367000	0.80283	0.528000	0.53228	AAA	.		0.348	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
TOR1AIP2	163590	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	179815558	179815558	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr1:179815558C>T	ENST00000367612.3	-	6	1448	c.1061G>A	c.(1060-1062)gGg>gAg	p.G354E	TOR1AIP2_ENST00000609928.1_Missense_Mutation_p.G354E	NM_145034.4	NP_659471.1	Q9H496	IFG15_HUMAN	torsin A interacting protein 2	0										cervix(1)|endometrium(3)|large_intestine(1)|lung(10)|ovary(1)|skin(2)	18						ATTCTCAAACCCATAGCTCAG	0.507																																					p.G354E		.											.	TOR1AIP2	69	0			c.G1061A						.						89.0	87.0	88.0					1																	179815558		2203	4300	6503	SO:0001583	missense	163590	exon7			TCAAACCCATAGC		CCDS1334.1	1q25.2	2012-02-09			ENSG00000169905	ENSG00000169905			24055	protein-coding gene	gene with protein product		614513				15767459	Standard	NM_145034		Approved	LULL1, NET9, IFRG15	uc001gnk.3	Q8NFQ8	OTTHUMG00000035265	ENST00000367612.3:c.1061G>A	1.37:g.179815558C>T	ENSP00000356584:p.Gly354Glu	51.0	0.0		80.0	32.0	NM_001199260	Q05BU2	Missense_Mutation	SNP	ENST00000367612.3	37	CCDS1334.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.126128	0.77549	.	.	ENSG00000169905	ENST00000367612	T	0.46819	0.86	5.63	5.63	0.86233	.	0.062803	0.64402	D	0.000008	T	0.71584	0.3357	M	0.82630	2.6	0.42341	D	0.992334	D	0.71674	0.998	D	0.85130	0.997	T	0.75972	-0.3129	10	0.87932	D	0	-20.1791	15.9248	0.79609	0.0:0.8649:0.1351:0.0	.	354	Q8NFQ8	TOIP2_HUMAN	E	354	ENSP00000356584:G354E	ENSP00000356584:G354E	G	-	2	0	TOR1AIP2	178082181	0.998000	0.40836	0.941000	0.38009	0.969000	0.65631	3.418000	0.52721	2.652000	0.90054	0.655000	0.94253	GGG	.		0.507	TOR1AIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085304.1	NM_145034	
TRIO	7204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	14270940	14270940	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr5:14270940G>A	ENST00000344204.4	+	2	188	c.164G>A	c.(163-165)cGa>cAa	p.R55Q	TRIO_ENST00000509967.2_Missense_Mutation_p.R6Q|TRIO_ENST00000537187.1_Missense_Mutation_p.R55Q	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	55					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					TCAGGGTTTCGAAAAAACGAT	0.353																																					p.R55Q		.											.	TRIO	562	0			c.G164A						.						71.0	75.0	74.0					5																	14270940		2203	4300	6503	SO:0001583	missense	7204	exon2			GGTTTCGAAAAAA	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.164G>A	5.37:g.14270940G>A	ENSP00000339299:p.Arg55Gln	85.0	0.0		70.0	43.0	NM_007118	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.376758	0.61735	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967	T;T;T	0.64085	-0.08;-0.08;0.55	5.18	5.18	0.71444	.	0.000000	0.46758	D	0.000277	T	0.43433	0.1247	N	0.19112	0.55	0.41943	D	0.990624	P;P	0.43352	0.479;0.804	B;B	0.33392	0.07;0.163	T	0.43766	-0.9371	10	0.26408	T	0.33	.	15.9884	0.80179	0.0:0.0:1.0:0.0	.	6;55	F5H228;O75962	.;TRIO_HUMAN	Q	55;55;6	ENSP00000339299:R55Q;ENSP00000446348:R55Q;ENSP00000445592:R6Q	ENSP00000339299:R55Q	R	+	2	0	TRIO	14323940	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.456000	0.53000	2.576000	0.86940	0.655000	0.94253	CGA	.		0.353	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
TRIP12	9320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	230657707	230657707	+	Nonsense_Mutation	SNP	T	T	A			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr2:230657707T>A	ENST00000283943.5	-	26	4076	c.3898A>T	c.(3898-3900)Aga>Tga	p.R1300*	TRIP12_ENST00000389045.3_Nonsense_Mutation_p.R1030*|TRIP12_ENST00000389044.4_Nonsense_Mutation_p.R1348*	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1300					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		ACAAGGTATCTCTCGATGGCT	0.383																																					p.R1300X		.											.	TRIP12	572	0			c.A3898T						.						106.0	100.0	102.0					2																	230657707		2203	4300	6503	SO:0001587	stop_gained	9320	exon26			GGTATCTCTCGAT	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.3898A>T	2.37:g.230657707T>A	ENSP00000283943:p.Arg1300*	90.0	0.0		68.0	40.0	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Nonsense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	T	45	11.751387	0.99599	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.4378	0.50078	0.0:0.0:0.2765:0.7235	.	.	.	.	X	1300;1030;1348	.	ENSP00000283943:R1300X	R	-	1	2	TRIP12	230365951	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.039000	0.49791	2.157000	0.67596	0.528000	0.53228	AGA	.		0.383	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
TRMT10B	158234	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	37762014	37762014	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr9:37762014A>C	ENST00000297994.3	+	2	151	c.86A>C	c.(85-87)gAa>gCa	p.E29A	TRMT10B_ENST00000377753.2_Missense_Mutation_p.E29A|TRMT10B_ENST00000537911.1_Missense_Mutation_p.E29A|TRMT10B_ENST00000377754.2_5'UTR|RP11-613M10.9_ENST00000540557.1_Intron	NM_144964.2	NP_659401.2	Q6PF06	TM10B_HUMAN	tRNA methyltransferase 10 homolog B (S. cerevisiae)	29							methyltransferase activity (GO:0008168)										GAGACAGGTGAAGATGGACTT	0.557																																					p.E29A		.											.	.	.	0			c.A86C						.						61.0	65.0	64.0					9																	37762014		2046	4190	6236	SO:0001583	missense	158234	exon2			CAGGTGAAGATGG	BC057774	CCDS43804.1, CCDS69598.1, CCDS69600.1, CCDS69601.1	9p13.1	2012-06-28	2012-06-28	2012-06-28	ENSG00000165275	ENSG00000165275			26454	protein-coding gene	gene with protein product			"""RNA (guanine-9-) methyltransferase domain containing 3"""	RG9MTD3		14702039	Standard	XM_005251373		Approved	FLJ31455, bA3J10.9	uc004aai.3	Q6PF06	OTTHUMG00000019933	ENST00000297994.3:c.86A>C	9.37:g.37762014A>C	ENSP00000297994:p.Glu29Ala	145.0	0.0		139.0	62.0	NM_144964	B7Z216|B7Z3D3|Q05DJ4|Q5QP83|Q8NAG2|Q96N36	Missense_Mutation	SNP	ENST00000297994.3	37	CCDS43804.1	.	.	.	.	.	.	.	.	.	.	A	13.02	2.110977	0.37242	.	.	ENSG00000165275	ENST00000377753;ENST00000537911;ENST00000297994	T;T;T	0.36878	1.42;1.23;1.77	5.52	-1.2	0.09554	.	0.781997	0.11921	N	0.516711	T	0.19287	0.0463	L	0.27053	0.805	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.002;0.002;0.001	T	0.24012	-1.0172	10	0.20519	T	0.43	-1.3102	4.7347	0.12982	0.4656:0.289:0.2455:0.0	.	29;29;29	B7Z216;B7Z3D3;Q6PF06	.;.;RG9D3_HUMAN	A	29	ENSP00000366982:E29A;ENSP00000444997:E29A;ENSP00000297994:E29A	ENSP00000297994:E29A	E	+	2	0	RG9MTD3	37752014	0.855000	0.29742	0.025000	0.17156	0.125000	0.20455	0.445000	0.21677	-0.164000	0.10927	-0.313000	0.08912	GAA	.		0.557	TRMT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052482.1	NM_144964	
UBR4	23352	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	19478351	19478351	+	Silent	SNP	G	G	A	rs144919897	byFrequency	TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr1:19478351G>A	ENST00000375254.3	-	48	7026	c.6999C>T	c.(6997-6999)ccC>ccT	p.P2333P	UBR4_ENST00000375217.2_Silent_p.P2333P|UBR4_ENST00000375226.2_Silent_p.P2333P|UBR4_ENST00000375267.2_Silent_p.P2333P	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2333					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TGAAGCCTCCGGGCTGTAGGG	0.458													G|||	21	0.00419329	0.0151	0.0	5008	,	,		21073	0.0		0.0	False		,,,				2504	0.001				p.P2333P		.											.	UBR4	612	0			c.C6999T						.	G		48,4358	49.6+/-84.7	0,48,2155	90.0	85.0	86.0		6999	-1.7	1.0	1	dbSNP_134	86	0,8600		0,0,4300	no	coding-synonymous	UBR4	NM_020765.2		0,48,6455	AA,AG,GG		0.0,1.0894,0.3691		2333/5184	19478351	48,12958	2203	4300	6503	SO:0001819	synonymous_variant	23352	exon48			GCCTCCGGGCTGT	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.6999C>T	1.37:g.19478351G>A		92.0	0.0		56.0	32.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	37	CCDS189.1																																																																																			G|0.995;A|0.005		0.458	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
USP34	9736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	61430400	61430400	+	Splice_Site	SNP	T	T	G			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr2:61430400T>G	ENST00000398571.2	-	75	9461		c.e75-2		RP11-493E12.2_ENST00000609422.1_RNA	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34						positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			ATCTTTGCCCTGAAGGTTAAA	0.308																																					.		.											.	USP34	579	0			c.9385-2A>C						.						91.0	82.0	84.0					2																	61430400		1837	4085	5922	SO:0001630	splice_region_variant	9736	exon76			TTGCCCTGAAGGT	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.9385-2A>C	2.37:g.61430400T>G		57.0	0.0		55.0	35.0	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Splice_Site	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	T	16.32	3.090177	0.55968	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1912	0.73047	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	USP34	61283904	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.040000	0.89188	1.981000	0.57761	0.377000	0.23210	.	.		0.308	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		Intron
VIM	7431	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	17277885	17277885	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr10:17277885A>T	ENST00000224237.5	+	7	1415	c.1270A>T	c.(1270-1272)Agg>Tgg	p.R424W	RP11-124N14.3_ENST00000456355.1_RNA|VIM_ENST00000544301.1_Missense_Mutation_p.R424W			P08670	VIME_HUMAN	vimentin	424	Tail.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCTGAACCTGAGGGGTAAGCA	0.368																																					p.R424W		.											.	VIM	291	0			c.A1270T						.						121.0	108.0	112.0					10																	17277885		2203	4300	6503	SO:0001583	missense	7431	exon8			AACCTGAGGGGTA	M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.1270A>T	10.37:g.17277885A>T	ENSP00000224237:p.Arg424Trp	110.0	1.0		131.0	58.0	NM_003380	B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Missense_Mutation	SNP	ENST00000224237.5	37	CCDS7120.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.336005	0.81801	.	.	ENSG00000026025	ENST00000544301;ENST00000224237	D;D	0.85861	-2.04;-2.04	5.49	4.33	0.51752	.	0.000000	0.51477	D	0.000093	D	0.91253	0.7243	M	0.81341	2.54	0.80722	D	1	D;D;D	0.76494	0.999;0.992;0.999	D;P;D	0.66847	0.947;0.782;0.947	D	0.91615	0.5306	10	0.87932	D	0	.	11.6724	0.51411	0.8399:0.1601:0.0:0.0	.	424;424;424	Q53HU8;B0YJC4;P08670	.;.;VIME_HUMAN	W	424	ENSP00000446007:R424W;ENSP00000224237:R424W	ENSP00000224237:R424W	R	+	1	2	VIM	17317891	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.816000	0.55658	1.044000	0.40200	0.523000	0.50628	AGG	.		0.368	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380	
ZBTB14	7541	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	5290910	5290910	+	Frame_Shift_Del	DEL	C	C	-			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr18:5290910delC	ENST00000357006.4	-	4	1635	c.1297delG	c.(1297-1299)gcafs	p.A434fs	ZBTB14_ENST00000400143.3_Frame_Shift_Del_p.A434fs	NM_001143823.2|NM_001243704.1	NP_001137295.1|NP_001230633.1	O43829	ZBT14_HUMAN	zinc finger and BTB domain containing 14	434					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)										GCCATCGCTGCCGCCTGCAAC	0.552																																					p.A433fs		.											.	.	.	0			c.1297delG						.						118.0	95.0	102.0					18																	5290910		2203	4300	6503	SO:0001589	frameshift_variant	7541	exon4			TCGCTGCCGCCTG	D89859	CCDS11837.1	18p11.31	2013-09-19	2013-01-08	2013-01-08	ENSG00000198081	ENSG00000198081		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12860	protein-coding gene	gene with protein product		602126	"""zinc finger protein 161 homolog (mouse)"", ""zinc finger protein 161"", ""ZFP161 zinc finger protein"""	ZFP161		9244432	Standard	NM_001243702		Approved	ZNF478	uc010dkp.3	O43829	OTTHUMG00000131563	ENST00000357006.4:c.1297delG	18.37:g.5290910delC	ENSP00000349503:p.Ala434fs	74.0	0.0		49.0	23.0	NM_001243702	O00403|Q2TB80	Frame_Shift_Del	DEL	ENST00000357006.4	37	CCDS11837.1																																																																																			.		0.552	ZBTB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254425.1	NM_003409	
ZNF30	90075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35435350	35435350	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr19:35435350A>G	ENST00000601142.1	+	5	1717	c.1480A>G	c.(1480-1482)Agt>Ggt	p.S494G	ZNF30_ENST00000426813.2_Missense_Mutation_p.S413G|ZNF30_ENST00000439785.1_Missense_Mutation_p.S495G|ZNF30_ENST00000601957.1_3'UTR|ZNF30_ENST00000303586.7_Missense_Mutation_p.S495G			P17039	ZNF30_HUMAN	zinc finger protein 30	494					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)	16	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		AAAGACTTTTAGTCGAGCCTC	0.453																																					p.S495G		.											.	ZNF30	24	0			c.A1483G						.						84.0	91.0	89.0					19																	35435350		2199	4299	6498	SO:0001583	missense	90075	exon5			ACTTTTAGTCGAG	X52359	CCDS46044.1, CCDS46045.1	19q13.13	2013-01-08	2006-05-10			ENSG00000168661		"""Zinc fingers, C2H2-type"", ""-"""	13090	protein-coding gene	gene with protein product			"""zinc finger protein 30 (KOX 28)"""				Standard	NM_001099437		Approved	KOX28, DKFZp686N19164, FLJ20562	uc010edq.1	P17039		ENST00000601142.1:c.1480A>G	19.37:g.35435350A>G	ENSP00000469954:p.Ser494Gly	79.0	0.0		64.0	31.0	NM_001099438	A5PLP1|A8K320|B4DIC0|Q6N068	Missense_Mutation	SNP	ENST00000601142.1	37	CCDS46045.1	.	.	.	.	.	.	.	.	.	.	a	9.150	1.016152	0.19355	.	.	ENSG00000168661	ENST00000439785;ENST00000303586;ENST00000426813;ENST00000342559	T;T	0.07567	3.18;3.18	2.42	1.2	0.21068	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05777	0.0151	L	0.34521	1.04	0.09310	N	1	B;B	0.30281	0.236;0.275	B;B	0.20577	0.028;0.03	T	0.33189	-0.9878	9	0.49607	T	0.09	.	5.7624	0.18207	0.7624:0.0:0.0:0.2376	.	495;494	P17039-2;P17039	.;ZNF30_HUMAN	G	495;494;413;203	ENSP00000403441:S495G;ENSP00000416457:S413G	ENSP00000303889:S494G	S	+	1	0	ZNF30	40127190	0.000000	0.05858	0.001000	0.08648	0.053000	0.15095	0.316000	0.19469	1.111000	0.41721	0.416000	0.27883	AGT	.		0.453	ZNF30-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464432.1	NM_194325	
OR5I1	10798	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	55703708	55703709	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	GG	GG	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr11:55703708_55703709GG>AT	ENST00000301532.3	-	1	167_168	c.168_169CC>AT	c.(166-171)caCCtt>caATtt	p.56_57HL>QF		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	56					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						GGGGTTTGAAGGTGAGGATCAA	0.401																																					p.HL56QF		.											.	.	.	0			.						.																																			SO:0001583	missense	10798	.			TTTGAAGGTGAGG	BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.168_169delinsAT	11.37:g.55703708_55703709delinsAT	ENSP00000301532:p.H56_L57delinsQF	129.0	1.0		152.0	73.0	.	Q6IEU4	Missense_Mutation	DNP	ENST00000301532.3	37	CCDS7949.1																																																																																			.		0.401	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	NM_006637	
DNAH1	25981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52415808	52415809	+	Missense_Mutation	DNP	GG	GG	TC			TCGA-ED-A66Y-01A-11D-A30V-10	TCGA-ED-A66Y-10A-01D-A30V-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	934fcec3-38d8-46e9-b760-15fc041e8284	88b29a81-2646-4944-88a9-6dc6dd70aaa7	g.chr3:52415808_52415809GG>TC	ENST00000420323.2	+	49	8022_8023	c.7761_7762GG>TC	c.(7759-7764)gtGGgt>gtTCgt	p.G2588R		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2588	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TGCTGGGCGTGGGTGGCAGCGG	0.678																																					p.G2588R		.											.	.	.	0			.						.																																			SO:0001583	missense	25981	.			GGGCGTGGGTGGC	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	Exception_encountered	3.37:g.52415808_52415809delinsTC	ENSP00000401514:p.Gly2588Arg	112.0	0.0		78.0	23.0	.	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	DNP	ENST00000420323.2	37	CCDS46842.1																																																																																			.		0.678	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
