#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AADAC	13	ucsc.edu;bcgsc.ca	37	3	151545702	151545702	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:151545702C>A	ENST00000232892.7	+	5	1068	c.942C>A	c.(940-942)ttC>ttA	p.F314L	RP11-454C18.2_ENST00000475855.1_RNA|RP11-454C18.2_ENST00000483843.2_RNA	NM_001086.2	NP_001077.2	P22760	AAAD_HUMAN	arylacetamide deacetylase	314					positive regulation of triglyceride catabolic process (GO:0010898)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|deacetylase activity (GO:0019213)|lipase activity (GO:0016298)|serine hydrolase activity (GO:0017171)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(5)|skin(2)	19		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			ATCCAGGGTTCCTAGATGTGA	0.423																																					p.F314L	Ovarian(30;839 841 2699 32801 46334)	.											.	AADAC	280	0			c.C942A						.						50.0	49.0	49.0					3																	151545702		2203	4300	6503	SO:0001583	missense	13	exon5			AGGGTTCCTAGAT	L32179	CCDS33877.1	3q25.1	2014-03-18	2012-07-13		ENSG00000114771	ENSG00000114771	3.1.1.3		17	protein-coding gene	gene with protein product		600338	"""arylacetamide deacetylase (esterase)"""			8063807	Standard	XM_005247103		Approved	DAC, CES5A1	uc003eze.3	P22760	OTTHUMG00000159876	ENST00000232892.7:c.942C>A	3.37:g.151545702C>A	ENSP00000232892:p.Phe314Leu	39.0	0.0		35.0	4.0	NM_001086	A8K3L3|D3DNJ6|Q8N1A9	Missense_Mutation	SNP	ENST00000232892.7	37	CCDS33877.1	.	.	.	.	.	.	.	.	.	.	C	0.951	-0.706549	0.03230	.	.	ENSG00000114771	ENST00000232892	T	0.57107	0.42	4.81	-0.157	0.13387	.	0.448728	0.25689	N	0.028957	T	0.16385	0.0394	N	0.01505	-0.83	0.20196	N	0.999927	B	0.10296	0.003	B	0.15484	0.013	T	0.34079	-0.9843	10	0.02654	T	1	-11.2991	6.2289	0.20724	0.0:0.4354:0.1246:0.4401	.	314	P22760	AAAD_HUMAN	L	314	ENSP00000232892:F314L	ENSP00000232892:F314L	F	+	3	2	AADAC	153028392	0.000000	0.05858	0.050000	0.19076	0.984000	0.73092	-2.079000	0.01369	0.110000	0.17919	0.591000	0.81541	TTC	.		0.423	AADAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357883.2	NM_001086	
ABCC8	6833	ucsc.edu;bcgsc.ca	37	11	17464837	17464837	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:17464837A>G	ENST00000389817.3	-	9	1423	c.1355T>C	c.(1354-1356)cTc>cCc	p.L452P	ABCC8_ENST00000528202.1_5'Flank|ABCC8_ENST00000302539.4_Missense_Mutation_p.L452P			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	452	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	TATGTAGTAGAGGAGAATCAC	0.537																																					p.L452P		.											.	ABCC8	91	0			c.T1355C						.						116.0	100.0	105.0					11																	17464837		2200	4293	6493	SO:0001583	missense	6833	exon9			TAGTAGAGGAGAA	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.1355T>C	11.37:g.17464837A>G	ENSP00000374467:p.Leu452Pro	28.0	0.0		40.0	4.0	NM_000352	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	CCDS31437.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.680415	0.88542	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	D;D	0.91068	-2.78;-2.78	6.02	6.02	0.97574	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.96886	0.8983	H	0.95645	3.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97950	1.0331	10	0.87932	D	0	.	16.5446	0.84426	1.0:0.0:0.0:0.0	.	451;452	B7Z4N0;Q09428	.;ABCC8_HUMAN	P	452;452;466	ENSP00000374467:L452P;ENSP00000303960:L452P	ENSP00000303960:L452P	L	-	2	0	ABCC8	17421413	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.326000	0.96389	2.311000	0.77944	0.533000	0.62120	CTC	.		0.537	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352	
ACADVL	37	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7124266	7124266	+	Silent	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr17:7124266T>C	ENST00000356839.5	+	6	545	c.366T>C	c.(364-366)aaT>aaC	p.N122N	DLG4_ENST00000399510.2_5'Flank|MIR324_ENST00000362183.1_RNA|ACADVL_ENST00000581562.1_3'UTR|ACADVL_ENST00000543245.2_Silent_p.N145N|ACADVL_ENST00000350303.5_Silent_p.N100N	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain	122	Catalytic.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						CCGCCAAGAATGACGCTCTGG	0.587																																					p.N145N		.											.	ACADVL	93	0			c.T435C						.						84.0	90.0	88.0					17																	7124266		2203	4300	6503	SO:0001819	synonymous_variant	37	exon7			CAAGAATGACGCT	BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.366T>C	17.37:g.7124266T>C		52.0	0.0		40.0	9.0	NM_001270447	B4DEB6|F5H2A9|O76056|Q8WUL0	Silent	SNP	ENST00000356839.5	37	CCDS11090.1																																																																																			.		0.587	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220001.5	NM_000018	
ACAN	176	ucsc.edu;bcgsc.ca	37	15	89386656	89386656	+	Silent	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr15:89386656G>A	ENST00000561243.1	+	5	828	c.828G>A	c.(826-828)ctG>ctA	p.L276L	ACAN_ENST00000558207.1_Silent_p.L276L|ACAN_ENST00000559004.1_Silent_p.L276L|ACAN_ENST00000439576.2_Silent_p.L276L|ACAN_ENST00000352105.7_Silent_p.L276L			P16112	PGCA_HUMAN	aggrecan	276	G1-B'.|Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GCCGGCGGCTGGGTGCCCGGC	0.647																																					p.L276L		.											.	ACAN	25	0			c.G828A						.						16.0	20.0	19.0					15																	89386656		1938	4139	6077	SO:0001819	synonymous_variant	176	exon6			GCGGCTGGGTGCC	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.828G>A	15.37:g.89386656G>A		51.0	0.0		44.0	4.0	NM_001135	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	ENST00000561243.1	37	CCDS53970.1																																																																																			.		0.647	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
ACVRL1	94	ucsc.edu;bcgsc.ca	37	12	52309854	52309854	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:52309854C>T	ENST00000388922.4	+	8	1366	c.1083C>T	c.(1081-1083)taC>taT	p.Y361Y	ACVRL1_ENST00000550683.1_Silent_p.Y375Y|ACVRL1_ENST00000419526.2_Silent_p.Y187Y	NM_000020.2	NP_000011.2	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	361	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|artery development (GO:0060840)|blood circulation (GO:0008015)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|blood vessel maturation (GO:0001955)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|cellular response to transforming growth factor beta stimulus (GO:0071560)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of focal adhesion assembly (GO:0051895)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of blood pressure (GO:0008217)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of DNA replication (GO:0006275)|regulation of endothelial cell proliferation (GO:0001936)|regulation of transcription, DNA-templated (GO:0006355)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|venous blood vessel development (GO:0060841)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	GCAGCGATTACCTGGACATCG	0.622																																					p.Y361Y		.											.	ACVRL1	521	0			c.C1083T						.						90.0	81.0	84.0					12																	52309854		2203	4300	6503	SO:0001819	synonymous_variant	94	exon8			CGATTACCTGGAC	L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567			175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2		8397373, 8640225	Standard	NM_000020		Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	ENST00000388922.4:c.1083C>T	12.37:g.52309854C>T		25.0	0.0		29.0	4.0	NM_000020	A6NGA8	Silent	SNP	ENST00000388922.4	37	CCDS31804.1																																																																																			.		0.622	ACVRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404520.2		
ADAM32	203102	ucsc.edu;bcgsc.ca	37	8	39022554	39022554	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr8:39022554C>T	ENST00000379907.4	+	9	799	c.672C>T	c.(670-672)ttC>ttT	p.F224F	ADAM32_ENST00000437682.2_Silent_p.F231F|ADAM32_ENST00000519315.1_Silent_p.F224F	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	224	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			TTTAGATGTTCACCCAATTTA	0.294																																					p.F224F		.											.	ADAM32	227	0			c.C672T						.						128.0	114.0	119.0					8																	39022554		1790	4065	5855	SO:0001819	synonymous_variant	203102	exon9			GATGTTCACCCAA	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.672C>T	8.37:g.39022554C>T		104.0	0.0		30.0	4.0	NM_145004	Q8TC42	Silent	SNP	ENST00000379907.4	37	CCDS47846.1																																																																																			.		0.294	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004	
ADAMTS14	140766	ucsc.edu;bcgsc.ca	37	10	72511295	72511295	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr10:72511295A>G	ENST00000373207.1	+	17	2489	c.2489A>G	c.(2488-2490)gAg>gGg	p.E830G	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.E833G	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	830	Spacer.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						GTCATCCATGAGGACCTGCTG	0.627																																					p.E833G		.											.	ADAMTS14	232	0			c.A2498G						.						66.0	65.0	66.0					10																	72511295		2203	4300	6503	SO:0001583	missense	140766	exon17			TCCATGAGGACCT	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.2489A>G	10.37:g.72511295A>G	ENSP00000362303:p.Glu830Gly	39.0	0.0		38.0	4.0	NM_139155	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.317571	0.81469	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.63096	-0.02;0.01	4.38	4.38	0.52667	.	0.000000	0.85682	D	0.000000	T	0.68026	0.2956	M	0.64630	1.985	0.49299	D	0.999773	P;P	0.51449	0.609;0.945	B;P	0.52343	0.235;0.696	T	0.68296	-0.5446	10	0.36615	T	0.2	.	13.4488	0.61158	1.0:0.0:0.0:0.0	.	830;833	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	G	833;830	ENSP00000362304:E833G;ENSP00000362303:E830G	ENSP00000362303:E830G	E	+	2	0	ADAMTS14	72181301	1.000000	0.71417	0.993000	0.49108	0.738000	0.42128	8.646000	0.91053	1.851000	0.53745	0.460000	0.39030	GAG	.		0.627	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722	
ADAMTS18	170692	ucsc.edu;bcgsc.ca	37	16	77389917	77389917	+	Silent	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:77389917G>T	ENST00000282849.5	-	9	1798	c.1380C>A	c.(1378-1380)atC>atA	p.I460I		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	460	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						TGGGAGACATGATATTGCCTT	0.448																																					p.I460I		.											.	ADAMTS18	1036	0			c.C1380A						.						137.0	118.0	124.0					16																	77389917		2198	4300	6498	SO:0001819	synonymous_variant	170692	exon9			AGACATGATATTG	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.1380C>A	16.37:g.77389917G>T		87.0	0.0		41.0	4.0	NM_199355	Q6P4R5|Q6ZWJ9	Silent	SNP	ENST00000282849.5	37	CCDS10926.1																																																																																			.		0.448	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
ADAMTS8	11095	ucsc.edu;bcgsc.ca	37	11	130278752	130278752	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:130278752G>A	ENST00000257359.6	-	7	2540	c.1834C>T	c.(1834-1836)Ccc>Tcc	p.P612S		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	612	Cys-rich.				negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		GCATACTTGGGGACCCACTGC	0.547																																					p.P612S		.											.	ADAMTS8	226	0			c.C1834T						.						101.0	101.0	101.0					11																	130278752		1900	4127	6027	SO:0001583	missense	11095	exon7			ACTTGGGGACCCA	AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.1834C>T	11.37:g.130278752G>A	ENSP00000257359:p.Pro612Ser	50.0	0.0		28.0	4.0	NM_007037	Q9NZS0	Missense_Mutation	SNP	ENST00000257359.6	37	CCDS41732.1	.	.	.	.	.	.	.	.	.	.	G	30	5.056543	0.93793	.	.	ENSG00000134917	ENST00000531752;ENST00000257359;ENST00000414575	T	0.62498	0.02	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.82263	0.4999	M	0.85630	2.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.84701	0.0728	10	0.72032	D	0.01	.	19.3068	0.94165	0.0:0.0:1.0:0.0	.	612;93	Q9UP79;B3KVX9	ATS8_HUMAN;.	S	10;612;641	ENSP00000257359:P612S	ENSP00000257359:P612S	P	-	1	0	ADAMTS8	129783962	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.378000	0.97191	2.645000	0.89757	0.655000	0.94253	CCC	.		0.547	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385636.1	NM_007037	
ADAMTSL3	57188	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	84651559	84651559	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr15:84651559T>C	ENST00000286744.5	+	21	3403	c.3179T>C	c.(3178-3180)tTa>tCa	p.L1060S	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.L1060S	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1060						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			AGAGCTCTGTTAGGCCACTGC	0.433																																					p.L1060S		.											.	ADAMTSL3	1153	0			c.T3179C						.						71.0	73.0	72.0					15																	84651559		2203	4300	6503	SO:0001583	missense	57188	exon21			CTCTGTTAGGCCA	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.3179T>C	15.37:g.84651559T>C	ENSP00000286744:p.Leu1060Ser	66.0	1.0		43.0	20.0	NM_207517	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	T	8.890	0.953851	0.18431	.	.	ENSG00000156218	ENST00000286744	T	0.64991	-0.13	5.54	3.26	0.37387	.	0.609169	0.12227	N	0.487815	T	0.51822	0.1697	L	0.54323	1.7	0.09310	N	1	B;B	0.23937	0.082;0.094	B;B	0.27076	0.076;0.023	T	0.48127	-0.9062	10	0.39692	T	0.17	.	1.415	0.02299	0.1859:0.1493:0.1231:0.5418	.	1060;1060	P82987-2;P82987	.;ATL3_HUMAN	S	1060	ENSP00000286744:L1060S	ENSP00000286744:L1060S	L	+	2	0	ADAMTSL3	82442563	0.000000	0.05858	0.017000	0.16124	0.895000	0.52256	0.713000	0.25794	0.932000	0.37266	0.460000	0.39030	TTA	.		0.433	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517	
ADSS	159	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	244595870	244595870	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:244595870A>T	ENST00000366535.3	-	4	699	c.383T>A	c.(382-384)aTt>aAt	p.I128N		NM_001126.3	NP_001117.2			adenylosuccinate synthase											endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(71;2.17e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)	all_cancers(173;0.0896)|all_epithelial(177;0.172)	all cancers(7;9.71e-08)|GBM - Glioblastoma multiforme(7;1.28e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.0014)			GTCAGATATAATAAGCCTTTT	0.254																																					p.I128N		.											.	ADSS	229	0			c.T383A						.						61.0	69.0	66.0					1																	244595870		2198	4276	6474	SO:0001583	missense	159	exon4			GATATAATAAGCC	BC012356	CCDS1624.1	1q44	2008-02-05			ENSG00000035687	ENSG00000035687	6.3.4.4		292	protein-coding gene	gene with protein product		103060				2004783, 1592113	Standard	NM_001126		Approved		uc001iaj.3	P30520	OTTHUMG00000040102	ENST00000366535.3:c.383T>A	1.37:g.244595870A>T	ENSP00000355493:p.Ile128Asn	572.0	0.0		783.0	32.0	NM_001126		Missense_Mutation	SNP	ENST00000366535.3	37	CCDS1624.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.041942	0.75732	.	.	ENSG00000035687	ENST00000366535;ENST00000449326;ENST00000430700	T	0.44881	0.91	5.58	5.58	0.84498	.	0.257041	0.43416	D	0.000577	T	0.59142	0.2172	M	0.75777	2.31	0.53688	D	0.999976	P	0.51240	0.943	P	0.56788	0.806	T	0.57347	-0.7827	10	0.30078	T	0.28	-4.3992	15.7221	0.77721	1.0:0.0:0.0:0.0	.	128	P30520	PURA2_HUMAN	N	128;107;68	ENSP00000355493:I128N	ENSP00000355493:I128N	I	-	2	0	ADSS	242662493	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.521000	0.73778	2.253000	0.74438	0.455000	0.32223	ATT	.		0.254	ADSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096697.1	NM_001126	
AGPAT3	56894	broad.mit.edu;ucsc.edu	37	21	45397993	45397993	+	Nonsense_Mutation	SNP	C	C	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr21:45397993C>G	ENST00000398063.2	+	7	1326	c.834C>G	c.(832-834)taC>taG	p.Y278*	AGPAT3_ENST00000291572.8_Nonsense_Mutation_p.Y278*|AGPAT3_ENST00000398058.1_Nonsense_Mutation_p.Y278*|AGPAT3_ENST00000546158.1_Nonsense_Mutation_p.Y278*|AGPAT3_ENST00000398061.1_Nonsense_Mutation_p.Y278*|AGPAT3_ENST00000327505.2_Nonsense_Mutation_p.Y278*|AGPAT3_ENST00000479117.1_3'UTR	NM_001037553.1	NP_001032642.1	Q9NRZ7	PLCC_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 3	278					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			large_intestine(4)|lung(5)|ovary(1)|prostate(1)	11				STAD - Stomach adenocarcinoma(101;0.18)|Colorectal(79;0.24)		ATAAACTGTACCAGGAGAAGG	0.537																																					p.Y278X	Pancreas(60;623 1650 5574 52796)	.											.	AGPAT3	90	0			c.C834G						.						58.0	52.0	54.0					21																	45397993		2203	4300	6503	SO:0001587	stop_gained	56894	exon7			ACTGTACCAGGAG	AF156774	CCDS13703.1	21q22.3	2013-02-05			ENSG00000160216	ENSG00000160216	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	326	protein-coding gene	gene with protein product		614794					Standard	XM_005261159		Approved	LPAAT-gamma	uc002zdw.3	Q9NRZ7	OTTHUMG00000086892	ENST00000398063.2:c.834C>G	21.37:g.45397993C>G	ENSP00000381140:p.Tyr278*	23.0	0.0		10.0	5.0	NM_001037553	D3DSL2|Q3ZCU2|Q6UWP6|Q6ZUC6|Q8N3Q7|Q9NRZ6	Nonsense_Mutation	SNP	ENST00000398063.2	37	CCDS13703.1	.	.	.	.	.	.	.	.	.	.	C	37	6.575679	0.97676	.	.	ENSG00000160216	ENST00000291572;ENST00000398061;ENST00000327505;ENST00000398063;ENST00000398058;ENST00000546158	.	.	.	4.72	2.85	0.33270	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-29.9356	11.2453	0.48993	0.0:0.8613:0.0:0.1387	.	.	.	.	X	278	.	ENSP00000291572:Y278X	Y	+	3	2	AGPAT3	44222421	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	1.265000	0.33027	2.169000	0.68431	0.411000	0.27672	TAC	.		0.537	AGPAT3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195722.1	NM_020132	
AHNAK	79026	ucsc.edu;bcgsc.ca	37	11	62288148	62288148	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:62288148A>G	ENST00000378024.4	-	5	14015	c.13741T>C	c.(13741-13743)Ttt>Ctt	p.F4581L	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4581					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GGCATTTTAAATTTGGGGCCC	0.468																																					p.F4581L		.											.	AHNAK	109	0			c.T13741C						.						90.0	93.0	92.0					11																	62288148		2202	4299	6501	SO:0001583	missense	79026	exon5			TTTTAAATTTGGG	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.13741T>C	11.37:g.62288148A>G	ENSP00000367263:p.Phe4581Leu	82.0	1.0		36.0	4.0	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	A	14.26	2.480974	0.44044	.	.	ENSG00000124942	ENST00000378024	T	0.11821	2.74	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.31702	0.0805	M	0.76433	2.335	0.42842	D	0.99405	D	0.60575	0.988	D	0.73708	0.981	T	0.23084	-1.0198	10	0.09084	T	0.74	.	11.971	0.53063	0.8554:0.1446:0.0:0.0	.	4581	Q09666	AHNK_HUMAN	L	4581	ENSP00000367263:F4581L	ENSP00000367263:F4581L	F	-	1	0	AHNAK	62044724	0.042000	0.20092	1.000000	0.80357	0.994000	0.84299	0.773000	0.26661	2.052000	0.61016	0.519000	0.50382	TTT	.		0.468	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
AKAP13	11214	ucsc.edu;bcgsc.ca	37	15	86273744	86273744	+	Splice_Site	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr15:86273744A>G	ENST00000394518.2	+	30	7183	c.7088A>G	c.(7087-7089)gAa>gGa	p.E2363G	AKAP13_ENST00000361243.2_Splice_Site_p.E2367G|AKAP13_ENST00000394510.2_Splice_Site_p.E608G|AKAP13_ENST00000560579.1_3'UTR	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2363	Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CTTCCTGCAGAACAACTTCAC	0.438											OREG0023425	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E2367G	Melanoma(94;603 1453 3280 32295 32951)	.											.	AKAP13	258	0			c.A7100G						.						118.0	111.0	113.0					15																	86273744		2202	4299	6501	SO:0001630	splice_region_variant	11214	exon30			CTGCAGAACAACT	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.7088-1A>G	15.37:g.86273744A>G		35.0	0.0	1243	39.0	4.0	NM_006738	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.424856	0.83667	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	T;T;T	0.15256	2.44;2.47;2.95	5.73	5.73	0.89815	.	.	.	.	.	T	0.41213	0.1149	M	0.72894	2.215	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.74348	0.952;0.983	T	0.17167	-1.0378	8	.	.	.	.	15.201	0.73136	1.0:0.0:0.0:0.0	.	2363;2367	Q12802;Q12802-2	AKP13_HUMAN;.	G	2367;2363;2366;2342;608	ENSP00000354718:E2367G;ENSP00000378026:E2363G;ENSP00000378018:E608G	.	E	+	2	0	AKAP13	84074748	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	8.014000	0.88676	2.189000	0.69895	0.528000	0.53228	GAA	.		0.438	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	Missense_Mutation
ALB	213	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	74283297	74283298	+	Frame_Shift_Ins	INS	-	-	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:74283297_74283298insT	ENST00000503124.1	+	9	1096_1097	c.889_890insT	c.(889-891)cttfs	p.L297fs	ALB_ENST00000415165.2_Frame_Shift_Ins_p.L255fs|ALB_ENST00000401494.3_Frame_Shift_Ins_p.L332fs|ALB_ENST00000295897.4_Frame_Shift_Ins_p.L447fs|ALB_ENST00000509063.1_Frame_Shift_Ins_p.L447fs|ALB_ENST00000505649.1_Intron			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AACTCCAACTCTTGTAGAGGTC	0.401																																					p.L447fs		.											.	ALB	96	0			c.1339_1340insT						.																																			SO:0001589	frameshift_variant	213	exon11			CCAACTCTTGTAG	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.891dupT	4.37:g.74283299_74283299dupT	ENSP00000421027:p.Leu297fs	112.0	0.0		51.0	42.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Ins	INS	ENST00000503124.1	37																																																																																				.		0.401	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
ALB	213	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	74283386	74283387	+	Splice_Site	DEL	TG	TG	-	rs78527483		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:74283386_74283387delTG	ENST00000503124.1	+	9	1185	c.978delTG	c.(976-978)tat>ta	p.Y326fs	ALB_ENST00000415165.2_Splice_Site_p.Y284fs|ALB_ENST00000401494.3_Splice_Site_p.Y361fs|ALB_ENST00000295897.4_Splice_Site_p.Y476fs|ALB_ENST00000509063.1_Splice_Site_p.Y476fs|ALB_ENST00000505649.1_Intron			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CAGAAGACTATGTGAGTCttta	0.332																																					p.476_476del		.											.	ALB	96	0			c.1428_1428del						.																																			SO:0001630	splice_region_variant	213	exon11			AGACTATGTGAGT	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.978+1TG>-	4.37:g.74283388_74283389delTG		61.0	0.0		23.0	20.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000503124.1	37																																																																																				.		0.332	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	Frame_Shift_Del
ALK	238	ucsc.edu;bcgsc.ca	37	2	29445233	29445233	+	Silent	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:29445233G>A	ENST00000389048.3	-	22	4398	c.3492C>T	c.(3490-3492)ttC>ttT	p.F1164F	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	1164	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CTTCCATGAGGAAATCCAGTT	0.572			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.F1164F		.	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	ALK	3833	0			c.C3492T						.						83.0	88.0	86.0					2																	29445233		2203	4300	6503	SO:0001819	synonymous_variant	238	exon22	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	CATGAGGAAATCC	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.3492C>T	2.37:g.29445233G>A		43.0	0.0		26.0	4.0	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Silent	SNP	ENST00000389048.3	37	CCDS33172.1																																																																																			.		0.572	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
ALK	238	ucsc.edu;bcgsc.ca	37	2	29455312	29455312	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:29455312C>A	ENST00000389048.3	-	15	3396	c.2490G>T	c.(2488-2490)atG>atT	p.M830I	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	830	Gly-rich.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CTCCATCCTTCATCTGACCAG	0.567			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.M830I		.	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	ALK	3833	0			c.G2490T						.						52.0	49.0	50.0					2																	29455312		2203	4300	6503	SO:0001583	missense	238	exon15	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	ATCCTTCATCTGA	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2490G>T	2.37:g.29455312C>A	ENSP00000373700:p.Met830Ile	33.0	0.0		18.0	5.0	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	37	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.072303	0.55646	.	.	ENSG00000171094	ENST00000389048	T	0.39406	1.08	5.41	3.5	0.40072	.	0.102610	0.42548	D	0.000684	T	0.28632	0.0709	L	0.31065	0.9	0.80722	D	1	B	0.11235	0.004	B	0.21360	0.034	T	0.06320	-1.0833	9	.	.	.	.	9.7713	0.40591	0.1399:0.7872:0.0:0.073	.	830	Q9UM73	ALK_HUMAN	I	830	ENSP00000373700:M830I	.	M	-	3	0	ALK	29308816	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.206000	0.58473	1.280000	0.44463	0.555000	0.69702	ATG	.		0.567	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
ALPI	248	broad.mit.edu;bcgsc.ca	37	2	233322981	233322981	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:233322981A>G	ENST00000295463.3	+	9	1123	c.1046A>G	c.(1045-1047)gAg>gGg	p.E349G		NM_001631.3	NP_001622.2	P09923	PPBI_HUMAN	alkaline phosphatase, intestinal	349					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(2)|upper_aerodigestive_tract(1)	24		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)		GCACTCACTGAGGCGGTCATG	0.642																																					p.E349G		.											.	ALPI	90	0			c.A1046G						.						82.0	75.0	77.0					2																	233322981		2203	4300	6503	SO:0001583	missense	248	exon9			TCACTGAGGCGGT	M15694	CCDS2492.1	2q37.1	2008-02-05			ENSG00000163295	ENSG00000163295	3.1.3.1		437	protein-coding gene	gene with protein product		171740				3468508, 3469665	Standard	NM_001631		Approved		uc002vst.4	P09923	OTTHUMG00000133258	ENST00000295463.3:c.1046A>G	2.37:g.233322981A>G	ENSP00000295463:p.Glu349Gly	100.0	0.0		99.0	5.0	NM_001631	B2R7Y4|Q53S80|Q9UBV5|Q9UCL2	Missense_Mutation	SNP	ENST00000295463.3	37	CCDS2492.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.327379	0.81690	.	.	ENSG00000163295	ENST00000295463	D	0.98987	-5.3	4.46	4.46	0.54185	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.049746	0.85682	D	0.000000	D	0.99521	0.9829	H	0.97440	4.005	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.98016	1.0368	10	0.87932	D	0	.	13.0739	0.59077	1.0:0.0:0.0:0.0	.	349	P09923	PPBI_HUMAN	G	349	ENSP00000295463:E349G	ENSP00000295463:E349G	E	+	2	0	ALPI	233031225	1.000000	0.71417	0.052000	0.19188	0.008000	0.06430	9.023000	0.93683	1.880000	0.54463	0.459000	0.35465	GAG	.		0.642	ALPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257035.2	NM_001631	
AMBRA1	55626	ucsc.edu;bcgsc.ca	37	11	46430118	46430118	+	Silent	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:46430118T>C	ENST00000458649.2	-	17	3766	c.3348A>G	c.(3346-3348)acA>acG	p.T1116T	AMBRA1_ENST00000528950.1_Silent_p.T1087T|AMBRA1_ENST00000298834.3_Silent_p.T1056T|AMBRA1_ENST00000533727.1_Silent_p.T997T|AMBRA1_ENST00000426438.1_Silent_p.T1087T|AMBRA1_ENST00000534300.1_Silent_p.T1056T|AMBRA1_ENST00000314845.3_Silent_p.T1026T			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1116					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		TCTCAGTCTGTGTTTCGGCAT	0.632																																					p.T1119T		.											.	AMBRA1	136	0			c.A3357G						.						67.0	60.0	63.0					11																	46430118		2202	4299	6501	SO:0001819	synonymous_variant	55626	exon19			AGTCTGTGTTTCG	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3348A>G	11.37:g.46430118T>C		50.0	0.0		55.0	5.0	NM_001267782	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Silent	SNP	ENST00000458649.2	37																																																																																				.		0.632	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749	
AMPD1	270	ucsc.edu;bcgsc.ca	37	1	115217493	115217493	+	Splice_Site	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:115217493C>T	ENST00000520113.2	-	13	1794	c.1779G>A	c.(1777-1779)aaG>aaA	p.K593K	AMPD1_ENST00000369538.3_Splice_Site_p.K589K|AMPD1_ENST00000353928.6_Splice_Site_p.K560K			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	593					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	TGCCTCGTTCCCTGGGGAAAT	0.463																																					p.K593K		.											.	AMPD1	293	0			c.G1779A						.						92.0	83.0	86.0					1																	115217493		2203	4300	6503	SO:0001630	splice_region_variant	270	exon13			TCGTTCCCTGGGG	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1779-1G>A	1.37:g.115217493C>T		65.0	0.0		50.0	6.0	NM_000036	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Silent	SNP	ENST00000520113.2	37	CCDS876.2																																																																																			.		0.463	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4		Silent
ANKMY1	51281	ucsc.edu;bcgsc.ca	37	2	241492433	241492433	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:241492433C>T	ENST00000272972.3	-	3	325	c.111G>A	c.(109-111)ctG>ctA	p.L37L	ANKMY1_ENST00000405002.1_Silent_p.L37L|ANKMY1_ENST00000373318.2_Silent_p.L126L|ANKMY1_ENST00000405523.3_Silent_p.L126L|ANKMY1_ENST00000361678.4_Silent_p.L126L|ANKMY1_ENST00000403283.1_Silent_p.L205L|ANKMY1_ENST00000462004.1_5'UTR|ANKMY1_ENST00000406958.1_Silent_p.L126L|ANKMY1_ENST00000373320.4_Silent_p.L37L|ANKMY1_ENST00000401804.1_Silent_p.L126L|ANKMY1_ENST00000391987.1_Silent_p.L37L|ANKMY1_ENST00000536462.1_Silent_p.L79L	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	37							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		TGTAGGTACCCAGGCCATGGC	0.542																																					p.L126L		.											.	ANKMY1	90	0			c.G378A						.						111.0	94.0	100.0					2																	241492433		2203	4300	6503	SO:0001819	synonymous_variant	51281	exon4			GGTACCCAGGCCA	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.111G>A	2.37:g.241492433C>T		51.0	0.0		51.0	6.0	NM_017844	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Silent	SNP	ENST00000272972.3	37	CCDS2536.1																																																																																			.		0.542	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844	
ANKRD10	55608	ucsc.edu;bcgsc.ca	37	13	111536109	111536109	+	Silent	SNP	C	C	T	rs201341958		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr13:111536109C>T	ENST00000267339.2	-	5	857	c.723G>A	c.(721-723)acG>acA	p.T241T	ANKRD10_ENST00000375758.5_3'UTR|ANKRD10_ENST00000489973.2_5'UTR	NM_017664.2	NP_060134.2	Q9NXR5	ANR10_HUMAN	ankyrin repeat domain 10	241										central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)	9	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		all cancers(43;0.0882)|BRCA - Breast invasive adenocarcinoma(86;0.188)|Lung(89;0.208)			TGTCGCCATTCGTGAGTGGCA	0.448																																					p.T241T		.											.	ANKRD10	226	0			c.G723A						.						152.0	117.0	129.0					13																	111536109		2203	4300	6503	SO:0001819	synonymous_variant	55608	exon5			GCCATTCGTGAGT	AK000100	CCDS9520.1, CCDS66580.1	13q33.3	2013-01-10			ENSG00000088448	ENSG00000088448		"""Ankyrin repeat domain containing"""	20265	protein-coding gene	gene with protein product							Standard	NM_017664		Approved	FLJ20093	uc001vrn.3	Q9NXR5	OTTHUMG00000017349	ENST00000267339.2:c.723G>A	13.37:g.111536109C>T		36.0	0.0		20.0	4.0	NM_017664	Q5VW12|Q9BV12	Silent	SNP	ENST00000267339.2	37	CCDS9520.1																																																																																			C|0.999;T|0.001		0.448	ANKRD10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045783.1		
ANKRD26	22852	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	27389068	27389068	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr10:27389068T>C	ENST00000376087.4	-	1	353	c.188A>G	c.(187-189)cAg>cGg	p.Q63R	ANKRD26_ENST00000436985.2_Missense_Mutation_p.Q63R	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	63					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						AAGGATCTGCTGCACTTTCGC	0.592																																					p.Q63R		.											.	ANKRD26	138	0			c.A188G						.						97.0	106.0	103.0					10																	27389068		2038	4197	6235	SO:0001583	missense	22852	exon1			ATCTGCTGCACTT	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.188A>G	10.37:g.27389068T>C	ENSP00000365255:p.Gln63Arg	42.0	0.0		50.0	7.0	NM_014915	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	ENST00000376087.4	37	CCDS41499.1	.	.	.	.	.	.	.	.	.	.	T	17.94	3.510766	0.64522	.	.	ENSG00000107890	ENST00000376087;ENST00000436985	T;T	0.62639	0.01;0.01	4.44	1.96	0.26148	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.44829	0.1312	N	0.21508	0.67	0.38848	D	0.956211	B;B	0.21071	0.041;0.051	B;B	0.28385	0.053;0.089	T	0.23976	-1.0173	9	0.35671	T	0.21	.	6.4468	0.21882	0.0:0.2041:0.0:0.7959	.	63;63	Q9UPS8-3;Q9UPS8	.;ANR26_HUMAN	R	63	ENSP00000365255:Q63R;ENSP00000405112:Q63R	ENSP00000365255:Q63R	Q	-	2	0	ANKRD26	27429074	0.960000	0.32886	0.250000	0.24296	0.972000	0.66771	1.022000	0.30052	0.294000	0.22547	0.402000	0.26972	CAG	.		0.592	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1		
ANKRD30B	374860	broad.mit.edu;bcgsc.ca	37	18	14850376	14850376	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:14850376A>G	ENST00000358984.4	+	35	3382	c.3202A>G	c.(3202-3204)Aat>Gat	p.N1068D		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1068										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						AAGTAATTTGAATCAGGTAAA	0.303																																					p.N1068D		.											.	ANKRD30B	24	0			c.A3202G						.						34.0	34.0	34.0					18																	14850376		691	1568	2259	SO:0001583	missense	374860	exon35			AATTTGAATCAGG	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3202A>G	18.37:g.14850376A>G	ENSP00000351875:p.Asn1068Asp	251.0	0.0		174.0	9.0	NM_001145029	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	A	10.02	1.235836	0.22626	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.14391	2.51	1.48	0.295	0.15752	.	.	.	.	.	T	0.10809	0.0264	L	0.56124	1.755	0.43545	D	0.995843	B;B	0.27166	0.009;0.17	B;B	0.17098	0.003;0.017	T	0.11203	-1.0597	9	0.42905	T	0.14	.	4.6126	0.12409	0.8013:0.0:0.1987:0.0	.	1153;1068	Q9BXX2;F8WAG3	AN30B_HUMAN;.	D	1068;462;488	ENSP00000351875:N1068D	ENSP00000277669:N488D	N	+	1	0	ANKRD30B	14840376	0.280000	0.24249	0.197000	0.23402	0.137000	0.21094	0.430000	0.21428	0.079000	0.16929	0.145000	0.16022	AAT	.		0.303	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
ANKS6	203286	ucsc.edu;bcgsc.ca	37	9	101552846	101552846	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:101552846C>T	ENST00000353234.4	-	2	449	c.402G>A	c.(400-402)ggG>ggA	p.G134G	ANKS6_ENST00000375018.1_Silent_p.G134G|ANKS6_ENST00000471846.1_5'UTR|ANKS6_ENST00000540940.1_5'UTR|ANKS6_ENST00000375019.2_Intron			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	134						cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				TGACATCAGCCCCGTGATCCA	0.602																																					p.G134G		.											.	ANKS6	92	0			c.G402A						.						30.0	34.0	32.0					9																	101552846		2065	4193	6258	SO:0001819	synonymous_variant	203286	exon2			ATCAGCCCCGTGA	AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.402G>A	9.37:g.101552846C>T		106.0	0.0		44.0	4.0	NM_173551	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Silent	SNP	ENST00000353234.4	37	CCDS43856.1																																																																																			.		0.602	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277053.1	NM_173551	
AOC2	314	ucsc.edu;bcgsc.ca	37	17	41001156	41001156	+	Missense_Mutation	SNP	C	C	T	rs138179430		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr17:41001156C>T	ENST00000253799.3	+	2	1669	c.1642C>T	c.(1642-1644)Ccc>Tcc	p.P548S	AOC3_ENST00000308423.2_5'Flank|AOC2_ENST00000452774.2_Missense_Mutation_p.P548S	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	548					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		TGTGGCTGCCCCCTGGAACCC	0.597																																					p.P548S		.											.	AOC2	92	0			c.C1642T						.						51.0	44.0	46.0					17																	41001156		2203	4300	6503	SO:0001583	missense	314	exon2			GCTGCCCCCTGGA	AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.1642C>T	17.37:g.41001156C>T	ENSP00000253799:p.Pro548Ser	45.0	0.0		47.0	4.0	NM_009590	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Missense_Mutation	SNP	ENST00000253799.3	37	CCDS11443.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.415321	0.62511	.	.	ENSG00000131480	ENST00000253799;ENST00000452774	T;T	0.03689	3.84;3.84	5.26	5.26	0.73747	Copper amine oxidase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.21022	0.0506	M	0.80422	2.495	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00147	-1.1990	10	0.52906	T	0.07	-49.5016	19.0748	0.93156	0.0:1.0:0.0:0.0	.	548;548	O75106;O75106-2	AOC2_HUMAN;.	S	548	ENSP00000253799:P548S;ENSP00000406134:P548S	ENSP00000253799:P548S	P	+	1	0	AOC2	38254682	1.000000	0.71417	1.000000	0.80357	0.536000	0.34869	4.182000	0.58310	2.733000	0.93635	0.655000	0.94253	CCC	C|1.000;A|0.000		0.597	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452442.1	NM_009590, NM_001158	
AP3M2	10947	ucsc.edu;bcgsc.ca	37	8	42012433	42012433	+	Silent	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr8:42012433T>C	ENST00000518421.1	+	3	519	c.228T>C	c.(226-228)ccT>ccC	p.P76P	AP3M2_ENST00000174653.3_Silent_p.P76P|AP3M2_ENST00000517922.1_Silent_p.P76P|AP3M2_ENST00000520685.1_Intron|RP11-589C21.5_ENST00000564481.1_RNA|AP3M2_ENST00000396926.3_Silent_p.P76P	NM_001134296.1	NP_001127768.1	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	76					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|stomach(1)	17	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			AGGTCCCCCCTCTGTTTGTCA	0.463																																					p.P76P		.											.	AP3M2	90	0			c.T228C						.						112.0	114.0	114.0					8																	42012433		2203	4300	6503	SO:0001819	synonymous_variant	10947	exon3			CCCCCCTCTGTTT	D38293	CCDS6125.1	8p11.2	2008-07-07			ENSG00000070718	ENSG00000070718			570	protein-coding gene	gene with protein product		610469				7601449	Standard	NM_006803		Approved	CLA20, AP47B	uc003xoo.3	P53677	OTTHUMG00000164060	ENST00000518421.1:c.228T>C	8.37:g.42012433T>C		110.0	1.0		38.0	4.0	NM_001134296	B2RCR0|D3DSY2|Q7Z472	Silent	SNP	ENST00000518421.1	37	CCDS6125.1																																																																																			.		0.463	AP3M2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376996.1		
APOBEC3G	60489	ucsc.edu;bcgsc.ca	37	22	39482347	39482347	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr22:39482347C>A	ENST00000407997.3	+	6	1156	c.799C>A	c.(799-801)Ccc>Acc	p.P267T	APOBEC3G_ENST00000452957.2_Missense_Mutation_p.P267T	NM_021822.3	NP_068594.1	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G	267	CMP/dCMP deaminase zinc-binding 2.|Necessary for homooligomerization.				base conversion or substitution editing (GO:0016553)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral process (GO:0048525)|positive regulation of defense response to virus by host (GO:0002230)|viral process (GO:0016032)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|ribonucleoprotein complex (GO:0030529)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|large_intestine(4)|lung(5)|skin(1)|stomach(1)	12	Melanoma(58;0.04)					GGACGTGATTCCCTTTTGGAA	0.502																																					p.P267T		.											.	APOBEC3G	227	0			c.C799A						.						83.0	84.0	84.0					22																	39482347		2203	4300	6503	SO:0001583	missense	60489	exon6			GTGATTCCCTTTT	AF182420	CCDS13984.1	22q13.1-q13.2	2008-05-15			ENSG00000239713	ENSG00000239713		"""Apolipoprotein B mRNA editing enzymes"""	17357	protein-coding gene	gene with protein product		607113				11863358	Standard	NM_021822		Approved	CEM15, MDS019, dJ494G10.1, FLJ12740, bK150C2.7		Q9HC16	OTTHUMG00000151081	ENST00000407997.3:c.799C>A	22.37:g.39482347C>A	ENSP00000385057:p.Pro267Thr	48.0	0.0		39.0	4.0	NM_021822	B2RDR9|Q45F02|Q5TF77|Q7Z2N1|Q7Z2N4|Q9H9H8	Missense_Mutation	SNP	ENST00000407997.3	37	CCDS13984.1	.	.	.	.	.	.	.	.	.	.	.	0.008	-1.877023	0.00537	.	.	ENSG00000239713	ENST00000452957;ENST00000407997	T;T	0.64991	-0.13;-0.13	1.65	-3.29	0.05017	APOBEC-like, N-terminal (1);APOBEC/CMP deaminase, zinc-binding (1);Cytidine deaminase-like (1);	.	.	.	.	T	0.45054	0.1323	L	0.28344	0.845	0.09310	N	1	B	0.20550	0.046	B	0.32864	0.154	T	0.39881	-0.9592	9	0.37606	T	0.19	.	4.4443	0.11589	0.0:0.4553:0.1668:0.3779	.	267	Q9HC16	ABC3G_HUMAN	T	267	ENSP00000413376:P267T;ENSP00000385057:P267T	ENSP00000385057:P267T	P	+	1	0	APOBEC3G	37812293	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.504000	0.02275	-1.253000	0.02488	-0.263000	0.10527	CCC	.		0.502	APOBEC3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321219.1	NM_021822	
ARHGAP27	201176	ucsc.edu;bcgsc.ca	37	17	43475409	43475409	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr17:43475409C>T	ENST00000428638.1	-	10	1747	c.1748G>A	c.(1747-1749)cGg>cAg	p.R583Q	ARHGAP27_ENST00000376922.2_Missense_Mutation_p.R242Q|ARHGAP27_ENST00000532038.1_Missense_Mutation_p.R361Q|ARHGAP27_ENST00000455881.1_Missense_Mutation_p.R242Q|ARHGAP27_ENST00000528384.1_Missense_Mutation_p.R215Q|ARHGAP27_ENST00000532891.2_Missense_Mutation_p.R561Q|CTB-39G8.3_ENST00000592389.1_RNA|ARHGAP27_ENST00000442348.1_Missense_Mutation_p.R556Q|ARHGAP27_ENST00000582826.1_5'UTR			Q6ZUM4	RHG27_HUMAN	Rho GTPase activating protein 27	583	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of Rac GTPase activity (GO:0032855)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|SH3 domain binding (GO:0017124)			endometrium(4)|large_intestine(9)|lung(3)|skin(1)	17	Renal(3;0.0405)					ATCTCGGCTCCGTAGCTGGAG	0.592																																					p.R242Q		.											.	ARHGAP27	90	0			c.G725A						.						87.0	74.0	78.0					17																	43475409		2203	4300	6503	SO:0001583	missense	201176	exon10			CGGCTCCGTAGCT	AK125535	CCDS11498.1, CCDS74082.1	17q21.31	2013-01-10			ENSG00000159314	ENSG00000159314		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	31813	protein-coding gene	gene with protein product		610591	"""SH3 domain containing 20"""	SH3D20		15147912	Standard	NM_199282		Approved	CAMGAP1, FLJ43547, SH3P20	uc002iix.3	Q6ZUM4	OTTHUMG00000166982	ENST00000428638.1:c.1748G>A	17.37:g.43475409C>T	ENSP00000403323:p.Arg583Gln	46.0	0.0		41.0	4.0	NM_199282	A4FU35|A8K3N5|C9JTF3|Q494U0|Q6NWZ8|Q8WY58	Missense_Mutation	SNP	ENST00000428638.1	37		.	.	.	.	.	.	.	.	.	.	C	16.98	3.271250	0.59649	.	.	ENSG00000159314	ENST00000532038;ENST00000376922;ENST00000528384;ENST00000532891;ENST00000428638;ENST00000442348;ENST00000455881	T;T;T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96	4.72	1.67	0.24075	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.285900	0.33772	N	0.004572	T	0.62672	0.2447	L	0.60455	1.87	0.80722	D	1	P;P;D	0.56035	0.85;0.927;0.974	B;B;B	0.37550	0.137;0.071;0.253	T	0.60732	-0.7205	10	0.66056	D	0.02	.	6.7916	0.23703	0.0:0.6252:0.0:0.3748	.	361;556;583	B7Z6T0;F8WBX1;Q6ZUM4	.;.;RHG27_HUMAN	Q	361;242;215;561;583;556;242	ENSP00000432762:R361Q;ENSP00000366121:R242Q;ENSP00000431591:R215Q;ENSP00000433942:R561Q;ENSP00000403323:R583Q;ENSP00000409330:R556Q;ENSP00000408235:R242Q	ENSP00000366121:R242Q	R	-	2	0	ARHGAP27	40831192	0.790000	0.28787	0.997000	0.53966	0.944000	0.59088	0.373000	0.20484	0.240000	0.21263	0.485000	0.47835	CGG	.		0.592	ARHGAP27-202	KNOWN	basic	protein_coding	protein_coding		NM_199282	
ARHGAP28	79822	ucsc.edu;bcgsc.ca	37	18	6851048	6851048	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:6851048G>A	ENST00000383472.4	+	4	663	c.559G>A	c.(559-561)Ggc>Agc	p.G187S	ARHGAP28_ENST00000531294.1_Missense_Mutation_p.G28S|ARHGAP28_ENST00000419673.2_Missense_Mutation_p.G28S|ARHGAP28_ENST00000532996.1_Missense_Mutation_p.G10S|ARHGAP28_ENST00000418986.1_Missense_Mutation_p.G28S|ARHGAP28_ENST00000400091.2_Missense_Mutation_p.G187S|ARHGAP28_ENST00000262227.3_Missense_Mutation_p.G135S|ARHGAP28_ENST00000314319.3_Missense_Mutation_p.G28S			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	187					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				TGATACCTGTGGCAACCACAC	0.438																																					p.G28S		.											.	ARHGAP28	91	0			c.G82A						.						159.0	135.0	143.0					18																	6851048		2203	4300	6503	SO:0001583	missense	79822	exon3			ACCTGTGGCAACC	BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.559G>A	18.37:g.6851048G>A	ENSP00000372964:p.Gly187Ser	58.0	0.0		42.0	4.0	NM_001010000	A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Missense_Mutation	SNP	ENST00000383472.4	37		.	.	.	.	.	.	.	.	.	.	G	6.306	0.424607	0.11928	.	.	ENSG00000088756	ENST00000400091;ENST00000262227;ENST00000419673;ENST00000531294;ENST00000314319;ENST00000418986;ENST00000532996;ENST00000383472	T;T;T;T;T;T	0.19806	2.12;2.12;3.3;3.3;3.3;3.22	4.41	4.41	0.53225	.	0.629536	0.15062	N	0.282669	T	0.10680	0.0261	N	0.08118	0	0.21897	N	0.999483	B;B;B	0.18310	0.008;0.022;0.027	B;B;B	0.17979	0.011;0.014;0.02	T	0.17349	-1.0372	10	0.11794	T	0.64	.	12.81	0.57635	0.0:0.0:1.0:0.0	.	19;28;135	E9PRP2;F6VKJ9;Q9P2N2-2	.;.;.	S	187;135;28;28;28;28;19;10	ENSP00000382963:G187S;ENSP00000262227:G135S;ENSP00000392660:G28S;ENSP00000437262:G28S;ENSP00000313506:G28S;ENSP00000406907:G28S	ENSP00000262227:G135S	G	+	1	0	ARHGAP28	6841048	0.994000	0.37717	0.918000	0.36340	0.019000	0.09904	2.239000	0.43079	2.739000	0.93911	0.655000	0.94253	GGC	.		0.438	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442123.3	XM_371108	
ARHGEF17	9828	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	73022229	73022229	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:73022229C>T	ENST00000263674.3	+	1	2896	c.2546C>T	c.(2545-2547)cCc>cTc	p.P849L	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	849					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						GGAGGGGAGCCCATCCGAGAA	0.647																																					p.P849L		.											.	ARHGEF17	227	0			c.C2546T						.						41.0	46.0	44.0					11																	73022229		2200	4293	6493	SO:0001583	missense	9828	exon1			GGGAGCCCATCCG	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.2546C>T	11.37:g.73022229C>T	ENSP00000263674:p.Pro849Leu	91.0	0.0		45.0	15.0	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	c	24.8	4.573358	0.86542	.	.	ENSG00000110237	ENST00000263674	T	0.68331	-0.32	5.09	5.09	0.68999	.	0.235946	0.29034	N	0.013356	T	0.74152	0.3679	L	0.29908	0.895	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.77694	-0.2492	10	0.87932	D	0	-17.1115	17.0768	0.86588	0.0:1.0:0.0:0.0	.	849	Q96PE2	ARHGH_HUMAN	L	849	ENSP00000263674:P849L	ENSP00000263674:P849L	P	+	2	0	ARHGEF17	72699877	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.949000	0.70257	2.377000	0.81083	0.556000	0.70494	CCC	.		0.647	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
ARHGEF12	23365	ucsc.edu;bcgsc.ca	37	11	120329986	120329986	+	Silent	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:120329986A>G	ENST00000397843.2	+	26	2650	c.2484A>G	c.(2482-2484)ctA>ctG	p.L828L	AP000758.1_ENST00000595283.1_Missense_Mutation_p.V21A|ARHGEF12_ENST00000356641.3_Silent_p.L809L|ARHGEF12_ENST00000532993.1_Silent_p.L725L	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	828	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		CCTCAGAGCTACGGAAAATTT	0.378			T	MLL	AML																																p.L828L		.		Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	.	ARHGEF12	661	0			c.A2484G						.						115.0	112.0	113.0					11																	120329986		1831	4084	5915	SO:0001819	synonymous_variant	23365	exon26			AGAGCTACGGAAA	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.2484A>G	11.37:g.120329986A>G		52.0	0.0		32.0	4.0	NM_015313	O15086|Q6P526	Silent	SNP	ENST00000397843.2	37	CCDS41727.1																																																																																			.		0.378	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313	
ARNT2	9915	ucsc.edu;bcgsc.ca	37	15	80800523	80800523	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr15:80800523A>G	ENST00000303329.4	+	6	814	c.649A>G	c.(649-651)Acg>Gcg	p.T217A	ARNT2_ENST00000533983.1_Missense_Mutation_p.T206A|ARNT2_ENST00000527771.1_Missense_Mutation_p.T206A	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	217					central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			GAAGACTGGGACGGTCAAGAA	0.572																																					p.T217A		.											.	ARNT2	175	0			c.A649G						.						121.0	98.0	106.0					15																	80800523		2203	4300	6503	SO:0001583	missense	9915	exon6			ACTGGGACGGTCA	AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.649A>G	15.37:g.80800523A>G	ENSP00000307479:p.Thr217Ala	79.0	0.0		57.0	5.0	NM_014862	B4DIS7|O15024|Q8IYC2	Missense_Mutation	SNP	ENST00000303329.4	37	CCDS32307.1	.	.	.	.	.	.	.	.	.	.	A	18.72	3.684501	0.68157	.	.	ENSG00000172379	ENST00000360062;ENST00000303329;ENST00000540859	T	0.06768	3.26	4.02	4.02	0.46733	PAS fold (1);	0.062472	0.64402	U	0.000006	T	0.12220	0.0297	M	0.77820	2.39	0.80722	D	1	P	0.40660	0.726	B	0.35899	0.213	T	0.05273	-1.0895	10	0.46703	T	0.11	.	12.7422	0.57259	1.0:0.0:0.0:0.0	.	217	Q9HBZ2	ARNT2_HUMAN	A	206;217;217	ENSP00000307479:T217A	ENSP00000307479:T217A	T	+	1	0	ARNT2	78587578	1.000000	0.71417	0.998000	0.56505	0.922000	0.55478	8.020000	0.88740	1.668000	0.50843	0.240000	0.17902	ACG	.		0.572	ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384389.2		
ASPG	374569	ucsc.edu;bcgsc.ca	37	14	104570684	104570684	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr14:104570684A>G	ENST00000551177.1	+	8	889	c.797A>G	c.(796-798)gAg>gGg	p.E266G	ASPG_ENST00000546892.2_Missense_Mutation_p.E266G|ASPG_ENST00000455920.2_Missense_Mutation_p.E266G	NM_001080464.2	NP_001073933.2	Q86U10	LPP60_HUMAN	asparaginase	266	Asparaginase.|Asparaginase/glutaminase. {ECO:0000255|PROSITE-ProRule:PRU01068}.				asparagine metabolic process (GO:0006528)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)		1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|asparaginase activity (GO:0004067)|lysophospholipase activity (GO:0004622)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	11						GTGGTCATGGAGACCTTCGGT	0.672																																					p.E266G		.											.	.	.	0			c.A797G						.						38.0	46.0	43.0					14																	104570684		2088	4202	6290	SO:0001583	missense	374569	exon8			TCATGGAGACCTT		CCDS45170.1, CCDS45170.2	14q32.33	2014-03-14	2014-03-14	2008-11-06	ENSG00000166183	ENSG00000166183	3.1.1.5, 3.5.1.1	"""Ankyrin repeat domain containing"""	20123	protein-coding gene	gene with protein product	"""60-kDa-lysophospholipase"""		"""chromosome 14 open reading frame 76"", ""asparaginase homolog (S. cerevisiae)"""	C14orf76			Standard	NM_001080464		Approved		uc001yoq.2	Q86U10		ENST00000551177.1:c.797A>G	14.37:g.104570684A>G	ENSP00000450040:p.Glu266Gly	53.0	0.0		29.0	4.0	NM_001080464	B9EGQ2|Q8IV80	Missense_Mutation	SNP	ENST00000551177.1	37	CCDS45170.2	.	.	.	.	.	.	.	.	.	.	A	17.22	3.333633	0.60853	.	.	ENSG00000166183	ENST00000551177;ENST00000299234;ENST00000546892;ENST00000455920	T;T;T	0.28666	1.6;1.6;1.6	4.1	4.1	0.47936	.	0.117882	0.56097	D	0.000029	T	0.63117	0.2484	H	0.94847	3.59	0.54753	D	0.999982	D;D;D;D	0.76494	0.973;0.999;0.999;0.992	P;D;D;D	0.70227	0.848;0.968;0.917;0.944	T	0.72717	-0.4209	10	0.87932	D	0	-13.7116	11.0445	0.47850	1.0:0.0:0.0:0.0	.	266;266;266;294	G3V1Y8;Q86U10;Q86U10-3;E5RFC2	.;LPP60_HUMAN;.;.	G	266;294;266;266	ENSP00000450040:E266G;ENSP00000448911:E266G;ENSP00000389003:E266G	ENSP00000299234:E294G	E	+	2	0	ASPG	103640437	1.000000	0.71417	1.000000	0.80357	0.310000	0.27922	3.153000	0.50685	1.487000	0.48415	0.379000	0.24179	GAG	.		0.672	ASPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407005.1	NM_001080464	
ASXL1	171023	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	31021262	31021262	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr20:31021262A>G	ENST00000375687.4	+	12	1685	c.1261A>G	c.(1261-1263)Aga>Gga	p.R421G	ASXL1_ENST00000306058.5_Missense_Mutation_p.R416G	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	421	Interaction with NCOA1. {ECO:0000250}.				bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						AACCAGAGCCAGAAGGAATCT	0.527			"""F, N, Mis"""		"""MDS, CMML"""																																p.R421G		.		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1	2057	0			c.A1261G						.						87.0	88.0	88.0					20																	31021262		2203	4300	6503	SO:0001583	missense	171023	exon11			AGAGCCAGAAGGA	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.1261A>G	20.37:g.31021262A>G	ENSP00000364839:p.Arg421Gly	51.0	0.0		42.0	5.0	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	ENST00000375687.4	37	CCDS13201.1	.	.	.	.	.	.	.	.	.	.	A	17.06	3.291377	0.59976	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	T;T	0.19105	2.17;2.17	4.49	2.17	0.27698	.	0.362249	0.32314	N	0.006267	T	0.34048	0.0884	M	0.67953	2.075	0.51233	D	0.999919	D;P	0.63880	0.993;0.94	P;P	0.60886	0.88;0.761	T	0.03231	-1.1058	10	0.31617	T	0.26	-8.5392	7.9533	0.30027	0.3998:0.4723:0.0:0.1279	.	416;421	A6NIZ6;Q8IXJ9	.;ASXL1_HUMAN	G	421;421;421;360;416	ENSP00000364839:R421G;ENSP00000305119:R416G	ENSP00000305119:R416G	R	+	1	2	ASXL1	30484923	0.997000	0.39634	1.000000	0.80357	0.949000	0.60115	0.704000	0.25661	0.332000	0.23536	0.533000	0.62120	AGA	.		0.527	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
ATCAY	85300	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3905457	3905457	+	Silent	SNP	C	C	T	rs373392142		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:3905457C>T	ENST00000450849.2	+	4	629	c.162C>T	c.(160-162)aaC>aaT	p.N54N	ATCAY_ENST00000398448.3_Silent_p.N60N|ATCAY_ENST00000301260.6_Silent_p.N54N|ATCAY_ENST00000600960.1_Silent_p.N54N	NM_033064.4	NP_149053.1	Q86WG3	ATCAY_HUMAN	ataxia, cerebellar, Cayman type	54					apoptotic process (GO:0006915)|mitochondrion distribution (GO:0048311)|negative regulation of glutamate metabolic process (GO:2000212)|neuron projection development (GO:0031175)|regulation of protein localization (GO:0032880)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|synapse (GO:0045202)	kinesin binding (GO:0019894)			breast(1)|endometrium(2)|kidney(2)|lung(2)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		TAAATTTCAACGGAGCGCATC	0.498																																					p.N54N		.											.	ATCAY	67	0			c.C162T						.	C		2,3886		0,2,1942	45.0	46.0	46.0		162	-2.9	0.0	19		46	0,8256		0,0,4128	no	coding-synonymous	ATCAY	NM_033064.4		0,2,6070	TT,TC,CC		0.0,0.0514,0.0165		54/372	3905457	2,12142	1944	4128	6072	SO:0001819	synonymous_variant	85300	exon4			TTTCAACGGAGCG		CCDS45923.1	19p13.3	2014-06-24	2008-07-18		ENSG00000167654	ENSG00000167654			779	protein-coding gene	gene with protein product	"""Cayman ataxia"", ""caytaxin"""	608179				8845847, 14556008	Standard	NM_033064		Approved		uc002lyy.4	Q86WG3	OTTHUMG00000181836	ENST00000450849.2:c.162C>T	19.37:g.3905457C>T		61.0	0.0		42.0	10.0	NM_033064	Q8NAQ2|Q8TAQ3|Q96HC6|Q96JF5	Silent	SNP	ENST00000450849.2	37	CCDS45923.1																																																																																			.		0.498	ATCAY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457872.2		
ATM	472	ucsc.edu;bcgsc.ca	37	11	108121612	108121612	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:108121612A>G	ENST00000452508.2	+	11	1609	c.1420A>G	c.(1420-1422)Agc>Ggc	p.S474G	ATM_ENST00000278616.4_Missense_Mutation_p.S474G			Q13315	ATM_HUMAN	ATM serine/threonine kinase	474					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AAACCTAGAAAGCTCACAAAA	0.398			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.S474G		.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM	3419	0			c.A1420G						.						90.0	91.0	90.0					11																	108121612		2201	4298	6499	SO:0001583	missense	472	exon10	Familial Cancer Database	AT, Louis-Bar syndrome	CTAGAAAGCTCAC	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1420A>G	11.37:g.108121612A>G	ENSP00000388058:p.Ser474Gly	70.0	0.0		44.0	5.0	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	A	12.23	1.876506	0.33162	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.54479	0.57;0.57;0.57	5.68	3.31	0.37934	Armadillo-type fold (1);	0.565923	0.20647	N	0.088298	T	0.37183	0.0994	L	0.29908	0.895	0.25112	N	0.990702	B	0.02656	0.0	B	0.01281	0.0	T	0.20140	-1.0284	10	0.33141	T	0.24	.	8.5394	0.33384	0.8015:0.1309:0.0676:0.0	.	474	Q13315	ATM_HUMAN	G	474	ENSP00000435747:S474G;ENSP00000278616:S474G;ENSP00000388058:S474G	ENSP00000278616:S474G	S	+	1	0	ATM	107626822	1.000000	0.71417	0.996000	0.52242	0.947000	0.59692	1.678000	0.37586	0.405000	0.25532	0.402000	0.26972	AGC	.		0.398	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
AZU1	566	ucsc.edu;bcgsc.ca	37	19	831774	831774	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:831774C>T	ENST00000233997.2	+	5	674	c.653C>T	c.(652-654)tCc>tTc	p.S218F		NM_001700.3	NP_001691.1	P20160	CAP7_HUMAN	azurocidin 1	218	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular extravasation (GO:0045123)|defense response to Gram-negative bacterium (GO:0050829)|glial cell migration (GO:0008347)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|macrophage chemotaxis (GO:0048246)|microglial cell activation (GO:0001774)|monocyte activation (GO:0042117)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell adhesion (GO:0045785)|positive regulation of fractalkine biosynthetic process (GO:0050754)|positive regulation of interleukin-1 beta biosynthetic process (GO:0050725)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of phagocytosis (GO:0050766)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of vascular permeability (GO:0043114)	azurophil granule (GO:0042582)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)|toxic substance binding (GO:0015643)			NS(1)|endometrium(1)|kidney(1)|lung(4)|pancreas(1)|upper_aerodigestive_tract(2)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCTCCTTTTCCCTGGGGCCC	0.711																																					p.S218F		.											.	AZU1	91	0			c.C653T						.						22.0	25.0	24.0					19																	831774		2199	4293	6492	SO:0001583	missense	566	exon5			CCTTTTCCCTGGG	X58794	CCDS12044.1	19p13.3	2012-03-30	2008-08-01		ENSG00000172232	ENSG00000172232			913	protein-coding gene	gene with protein product	"""cationic antimicrobial protein 37"", ""heparin-binding protein"", ""neutrophil azurocidin"""	162815				1919011	Standard	NM_001700		Approved	AZU, CAP37, AZAMP, HBP, NAZC, HUMAZUR	uc002lpz.1	P20160		ENST00000233997.2:c.653C>T	19.37:g.831774C>T	ENSP00000233997:p.Ser218Phe	67.0	0.0		32.0	4.0	NM_001700	P80014|Q52LG4|Q9UCM1|Q9UCT5	Missense_Mutation	SNP	ENST00000233997.2	37	CCDS12044.1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.970636	0.34754	.	.	ENSG00000172232	ENST00000233997	D	0.93076	-3.16	1.87	1.87	0.25490	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.93719	0.7993	M	0.74647	2.275	0.09310	N	1	D	0.58970	0.984	P	0.52386	0.697	D	0.86368	0.1721	9	0.87932	D	0	.	7.2253	0.26012	0.0:1.0:0.0:0.0	.	218	P20160	CAP7_HUMAN	F	218	ENSP00000233997:S218F	ENSP00000233997:S218F	S	+	2	0	AZU1	782774	0.000000	0.05858	0.005000	0.12908	0.003000	0.03518	0.210000	0.17455	1.368000	0.46115	0.561000	0.74099	TCC	.		0.711	AZU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457472.2	NM_001700	
ATP4A	495	ucsc.edu;bcgsc.ca	37	19	36050920	36050920	+	Silent	SNP	G	G	A	rs373071179		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:36050920G>A	ENST00000262623.3	-	7	871	c.843C>T	c.(841-843)atC>atT	p.I281I		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	281					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	CCAGCGATGCGATGCGCCCAA	0.642																																					p.I281I		.											.	ATP4A	91	0			c.C843T						.	G		1,4405	2.1+/-5.4	0,1,2202	91.0	70.0	77.0		843	-5.3	0.3	19		77	0,8600		0,0,4300	no	coding-synonymous	ATP4A	NM_000704.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		281/1036	36050920	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	495	exon7			CGATGCGATGCGC		CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.843C>T	19.37:g.36050920G>A		70.0	0.0		43.0	4.0	NM_000704	O00738	Silent	SNP	ENST00000262623.3	37	CCDS12467.1																																																																																			.		0.642	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	
BIK	638	ucsc.edu;bcgsc.ca	37	22	43520125	43520125	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr22:43520125A>G	ENST00000216115.2	+	2	160	c.97A>G	c.(97-99)Act>Gct	p.T33A		NM_001197.4	NP_001188.1	Q13323	BIK_HUMAN	BCL2-interacting killer (apoptosis-inducing)	33					apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|male gonad development (GO:0008584)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)				breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|urinary_tract(1)	5		Ovarian(80;0.0694)				TCTTGGCATGACTGACTCTGA	0.552																																					p.T33A		.											.	BIK	651	0			c.A97G						.						131.0	131.0	131.0					22																	43520125		2203	4300	6503	SO:0001583	missense	638	exon2			GGCATGACTGACT	U34584	CCDS14044.1	22q13.31	2014-03-07			ENSG00000100290	ENSG00000100290			1051	protein-coding gene	gene with protein product		603392				7478623, 10591208	Standard	NM_001197		Approved	NBK	uc003bdk.3	Q13323	OTTHUMG00000150703	ENST00000216115.2:c.97A>G	22.37:g.43520125A>G	ENSP00000216115:p.Thr33Ala	61.0	0.0		37.0	4.0	NM_001197	Q16582|Q6FH93	Missense_Mutation	SNP	ENST00000216115.2	37	CCDS14044.1	.	.	.	.	.	.	.	.	.	.	A	10.36	1.329344	0.24167	.	.	ENSG00000100290	ENST00000216115	T	0.23348	1.91	3.62	3.62	0.41486	.	.	.	.	.	T	0.19927	0.0479	N	0.24115	0.695	0.09310	N	1	P	0.41420	0.749	B	0.42555	0.391	T	0.07829	-1.0752	9	0.59425	D	0.04	-7.0E-4	8.9218	0.35617	1.0:0.0:0.0:0.0	.	33	Q13323	BIK_HUMAN	A	33	ENSP00000216115:T33A	ENSP00000216115:T33A	T	+	1	0	BIK	41850069	0.711000	0.27906	0.064000	0.19789	0.006000	0.05464	3.243000	0.51392	1.881000	0.54492	0.533000	0.62120	ACT	.		0.552	BIK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319676.1	NM_001197	
BLOC1S2	282991	ucsc.edu;bcgsc.ca	37	10	102045885	102045885	+	Silent	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr10:102045885T>C	ENST00000370372.2	-	2	193	c.141A>G	c.(139-141)aaA>aaG	p.K47K	BLOC1S2_ENST00000361832.2_5'UTR|BLOC1S2_ENST00000441611.1_Silent_p.K4K	NM_173809.4	NP_776170.2	Q6QNY1	BL1S2_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 2	47					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|melanosome organization (GO:0032438)|microtubule nucleation (GO:0007020)|mitochondrial outer membrane permeabilization (GO:0097345)|neuron projection development (GO:0031175)|platelet dense granule organization (GO:0060155)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	BLOC-1 complex (GO:0031083)|centrosome (GO:0005813)|gamma-tubulin complex (GO:0000930)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	gamma-tubulin binding (GO:0043015)|protein C-terminus binding (GO:0008022)			large_intestine(1)|lung(2)|ovary(1)	4		Colorectal(252;0.117)		Epithelial(162;2.44e-10)|all cancers(201;1.97e-08)		AAGTGGCCATTTTGGAGAACA	0.602																																					p.K47K		.											.	BLOC1S2	91	0			c.A141G						.						124.0	110.0	115.0					10																	102045885		2203	4300	6503	SO:0001819	synonymous_variant	282991	exon2			GGCCATTTTGGAG	AK054697	CCDS7490.1, CCDS73179.1	10q24.31	2012-08-01	2008-08-11		ENSG00000196072	ENSG00000196072		"""Biogenesis of lysosomal organelles complex-1 subunits"""	20984	protein-coding gene	gene with protein product	"""centrosome protein oncogene"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 2"", ""BLOC-1 subunit 2"""	609768				11483580, 15102850	Standard	NM_173809		Approved	MGC10120, FLJ30135, BLOS2	uc001kqw.2	Q6QNY1	OTTHUMG00000018908	ENST00000370372.2:c.141A>G	10.37:g.102045885T>C		30.0	0.0		36.0	4.0	NM_173809	B4DQV2|Q5W040|Q8WUI8	Silent	SNP	ENST00000370372.2	37	CCDS7490.1																																																																																			.		0.602	BLOC1S2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049861.2	NM_173809	
BRCA2	675	ucsc.edu;bcgsc.ca	37	13	32931936	32931936	+	Missense_Mutation	SNP	T	T	C	rs397507929		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr13:32931936T>C	ENST00000380152.3	+	16	7908	c.7675T>C	c.(7675-7677)Tct>Cct	p.S2559P	BRCA2_ENST00000544455.1_Missense_Mutation_p.S2559P			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2559					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AAATGCAGAGTCTTTTCAGTT	0.343			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.S2559P	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	3153	0			c.T7675C						.						101.0	103.0	102.0					13																	32931936		2203	4300	6503	SO:0001583	missense	675	exon16	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	GCAGAGTCTTTTC	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.7675T>C	13.37:g.32931936T>C	ENSP00000369497:p.Ser2559Pro	65.0	1.0		37.0	5.0	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	T	18.79	3.699947	0.68501	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	D;D	0.86230	-2.09;-2.09	5.15	2.59	0.31030	DNA recombination/repair protein BRCA2, helical domain (2);	0.319517	0.34725	N	0.003722	D	0.91226	0.7235	M	0.79805	2.47	0.36589	D	0.873977	D	0.69078	0.997	D	0.68039	0.955	D	0.89946	0.4076	10	0.45353	T	0.12	.	7.1983	0.25866	0.0:0.0729:0.2787:0.6484	.	2559	P51587	BRCA2_HUMAN	P	2559	ENSP00000369497:S2559P;ENSP00000439902:S2559P	ENSP00000369497:S2559P	S	+	1	0	BRCA2	31829936	1.000000	0.71417	0.993000	0.49108	0.977000	0.68977	2.513000	0.45494	0.257000	0.21650	0.482000	0.46254	TCT	.		0.343	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
BRF1	2972	ucsc.edu;bcgsc.ca	37	14	105739127	105739127	+	Missense_Mutation	SNP	G	G	T	rs199564741		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr14:105739127G>T	ENST00000546474.1	-	3	15329	c.370C>A	c.(370-372)Cgc>Agc	p.R124S	BRF1_ENST00000327359.3_Missense_Mutation_p.R9S|BRF1_ENST00000440513.3_Missense_Mutation_p.R9S|BRF1_ENST00000548421.1_Missense_Mutation_p.R124S|BRF1_ENST00000379937.2_Missense_Mutation_p.R97S	NM_001242787.1|NM_001519.3	NP_001229716.1|NP_001510.2	Q92994	TF3B_HUMAN	BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit	124					gene expression (GO:0010467)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|tRNA transcription (GO:0009304)	nucleoplasm (GO:0005654)|transcription factor TFIIIB complex (GO:0000126)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		TTCCGGCCGCGGGTCAGGTGC	0.637																																					p.R124S		.											.	BRF1	155	0			c.C370A						.						79.0	68.0	72.0					14																	105739127		2203	4300	6503	SO:0001583	missense	2972	exon3			GGCCGCGGGTCAG	U28838	CCDS10001.1, CCDS42001.1, CCDS55949.1, CCDS55950.1, CCDS55951.1, CCDS55952.1, CCDS55953.1	14q32.33	2014-04-02	2013-05-29	2001-12-07	ENSG00000185024	ENSG00000185024		"""General transcription factors"""	11551	protein-coding gene	gene with protein product		604902	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2"", ""BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)"""	TAF3B2, TAF3C, GTF3B		7624363, 8943358	Standard	NM_145685		Approved	TFIIIB90, BRF, hBRF	uc001yqp.2	Q92994	OTTHUMG00000029884	ENST00000546474.1:c.370C>A	14.37:g.105739127G>T	ENSP00000448323:p.Arg124Ser	44.0	0.0		23.0	4.0	NM_001519	B3KU36|B4DIG5|B7Z2N3|F5H5Z7|F8WA46|Q13223|Q3SYD9|Q5PR24|Q6IQ02|Q96KX3|Q9HCW6|Q9HCW7|Q9HCW8	Missense_Mutation	SNP	ENST00000546474.1	37	CCDS10001.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.373491	0.82573	.	.	ENSG00000185024	ENST00000379937;ENST00000546474;ENST00000327359;ENST00000440513;ENST00000550692;ENST00000548421;ENST00000345053	.	.	.	5.03	5.03	0.67393	Transcription factor TFIIB, cyclin-related (1);Cyclin-like (3);	0.114842	0.64402	D	0.000014	T	0.79759	0.4501	M	0.83312	2.635	0.80722	D	1	D;D;D;D	0.67145	0.996;0.963;0.99;0.971	D;P;D;P	0.66979	0.948;0.82;0.924;0.863	T	0.83214	-0.0072	9	0.72032	D	0.01	.	15.8531	0.78952	0.0:0.0:1.0:0.0	.	9;97;124;124	F5H5Z7;Q92994-5;Q96KX3;Q92994	.;.;.;TF3B_HUMAN	S	97;124;9;9;9;124;124	.	ENSP00000329029:R9S	R	-	1	0	BRF1	104810172	1.000000	0.71417	0.956000	0.39512	0.704000	0.40688	5.716000	0.68437	2.333000	0.79357	0.650000	0.86243	CGC	G|0.999;A|0.000		0.637	BRF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074548.4	NM_001519	
BSN	8927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49694892	49694892	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:49694892C>T	ENST00000296452.4	+	5	8017	c.7903C>T	c.(7903-7905)Cgc>Tgc	p.R2635C		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	2635					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.R2635S(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TCGTCTTCCCCGCCACTCAGA	0.647																																					p.R2635C		.											.	BSN	97	1	Substitution - Missense(1)	lung(1)	c.C7903T						.						38.0	45.0	43.0					3																	49694892		2203	4300	6503	SO:0001583	missense	8927	exon5			CTTCCCCGCCACT	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.7903C>T	3.37:g.49694892C>T	ENSP00000296452:p.Arg2635Cys	54.0	0.0		34.0	7.0	NM_003458	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.576314	0.28092	.	.	ENSG00000164061	ENST00000296452	T	0.25085	1.82	6.04	6.04	0.98038	.	0.120057	0.56097	D	0.000038	T	0.50051	0.1593	L	0.55481	1.735	0.58432	D	0.999998	D	0.89917	1.0	D	0.79108	0.992	T	0.40001	-0.9586	10	0.87932	D	0	-16.6587	20.1896	0.98226	0.0:1.0:0.0:0.0	.	2635	Q9UPA5	BSN_HUMAN	C	2635	ENSP00000296452:R2635C	ENSP00000296452:R2635C	R	+	1	0	BSN	49669896	0.706000	0.27856	1.000000	0.80357	0.994000	0.84299	1.335000	0.33839	2.873000	0.98535	0.561000	0.74099	CGC	.		0.647	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
C2CD2L	9854	ucsc.edu;bcgsc.ca	37	11	118983537	118983537	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:118983537C>A	ENST00000528586.1	+	6	654	c.584C>A	c.(583-585)aCc>aAc	p.T195N	C2CD2L_ENST00000336702.3_Missense_Mutation_p.T447N			O14523	C2C2L_HUMAN	C2CD2-like	447						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)	13						ACCATTGTCACCACAGTCACC	0.597																																					p.T447N		.											.	C2CD2L	68	0			c.C1340A						.						102.0	76.0	85.0					11																	118983537		2200	4295	6495	SO:0001583	missense	9854	exon10			TTGTCACCACAGT	AK025223	CCDS8413.1	11q23.3	2008-04-22	2008-04-22	2008-04-22		ENSG00000172375			29000	protein-coding gene	gene with protein product			"""transmembrane protein 24"""	TMEM24		15289880	Standard	XM_005271738		Approved	KIAA0285	uc001pvn.3	O14523		ENST00000528586.1:c.584C>A	11.37:g.118983537C>A	ENSP00000433600:p.Thr195Asn	41.0	0.0		39.0	5.0	NM_014807	Q86UT7|Q86V04|Q8N522|Q8TBN4|Q96G10	Missense_Mutation	SNP	ENST00000528586.1	37		.	.	.	.	.	.	.	.	.	.	C	24.1	4.497877	0.85069	.	.	ENSG00000172375	ENST00000336702;ENST00000528586	T;T	0.45668	0.89;0.89	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.63768	0.2539	M	0.67397	2.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.66799	-0.5832	10	0.66056	D	0.02	-28.2241	17.133	0.86730	0.0:1.0:0.0:0.0	.	447;447	O14523;O14523-2	C2C2L_HUMAN;.	N	447;195	ENSP00000338885:T447N;ENSP00000433600:T195N	ENSP00000338885:T447N	T	+	2	0	C2CD2L	118488747	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.937000	0.75898	2.514000	0.84764	0.557000	0.71058	ACC	.		0.597	C2CD2L-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000388199.2	NM_014807	
C3orf30	152405	ucsc.edu;bcgsc.ca	37	3	118870136	118870136	+	Silent	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:118870136A>G	ENST00000295622.1	+	3	1648	c.1608A>G	c.(1606-1608)gtA>gtG	p.V536V	RP11-484M3.5_ENST00000490594.1_Intron	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	536										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		TGTGCCAGGTATAGAATTGGA	0.358																																					p.V536V		.											.	C3orf30	92	0			c.A1608G						.						155.0	166.0	162.0					3																	118870136		2203	4300	6503	SO:0001819	synonymous_variant	152405	exon3			CCAGGTATAGAAT	AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.1608A>G	3.37:g.118870136A>G		41.0	0.0		40.0	5.0	NM_152539	A1L4B7	Silent	SNP	ENST00000295622.1	37	CCDS2984.1	.	.	.	.	.	.	.	.	.	.	A	5.723	0.317968	0.10845	.	.	ENSG00000163424	ENST00000492792	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	T	0.62708	0.2450	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61594	-0.7031	4	.	.	.	-3.1303	11.0329	0.47783	1.0:0.0:0.0:0.0	.	.	.	.	V	222	.	.	I	+	1	0	C3orf30	120352826	1.000000	0.71417	0.999000	0.59377	0.602000	0.36980	4.567000	0.60850	2.108000	0.64289	0.482000	0.46254	ATA	.		0.358	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1	NM_152539	
C9orf91	203197	ucsc.edu;bcgsc.ca	37	9	117386639	117386639	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:117386639A>G	ENST00000288502.4	+	3	553	c.116A>G	c.(115-117)aAt>aGt	p.N39S	C9orf91_ENST00000471206.1_3'UTR|C9orf91_ENST00000374049.4_Missense_Mutation_p.N39S			Q5VZI3	CI091_HUMAN	chromosome 9 open reading frame 91	39						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	13						GAGCTCCACAATGGCCAGGTC	0.577																																					p.N39S		.											.	C9orf91	91	0			c.A116G						.						92.0	70.0	77.0					9																	117386639		2203	4300	6503	SO:0001583	missense	203197	exon3			TCCACAATGGCCA	BX649023	CCDS6808.1	9q33.1	2008-02-05			ENSG00000157693	ENSG00000157693			24513	protein-coding gene	gene with protein product						14702039	Standard	NM_153045		Approved	DKFZp547P234, FLJ38045	uc004bjd.4	Q5VZI3	OTTHUMG00000020541	ENST00000288502.4:c.116A>G	9.37:g.117386639A>G	ENSP00000288502:p.Asn39Ser	81.0	0.0		35.0	4.0	NM_153045	A0PJA3|Q3KNS4|Q5VZI2|Q6P5Z7|Q8N1P3|Q8ND43	Missense_Mutation	SNP	ENST00000288502.4	37	CCDS6808.1	.	.	.	.	.	.	.	.	.	.	A	14.41	2.528382	0.44969	.	.	ENSG00000157693	ENST00000374049;ENST00000288502	.	.	.	5.64	4.5	0.54988	.	0.061222	0.64402	N	0.000011	T	0.44008	0.1273	L	0.31065	0.9	0.38767	D	0.954456	B;B	0.15141	0.012;0.005	B;B	0.17722	0.019;0.019	T	0.41070	-0.9529	9	0.62326	D	0.03	-10.0421	8.3897	0.32520	0.9116:0.0:0.0884:0.0	.	18;39	Q5VZI3-2;Q5VZI3	.;CI091_HUMAN	S	39	.	ENSP00000288502:N39S	N	+	2	0	C9orf91	116426460	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.401000	0.52601	0.973000	0.38340	0.379000	0.24179	AAT	.		0.577	C9orf91-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053780.1	NM_153045	
CABS1	85438	ucsc.edu;bcgsc.ca	37	4	71201464	71201464	+	Silent	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:71201464A>G	ENST00000273936.5	+	1	782	c.708A>G	c.(706-708)gaA>gaG	p.E236E		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	236					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CCCTTGAAGAAGAGAAAATAA	0.428																																					p.E236E		.											.	CABS1	93	0			c.A708G						.						102.0	103.0	102.0					4																	71201464		2203	4300	6503	SO:0001819	synonymous_variant	85438	exon1			TGAAGAAGAGAAA	AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.708A>G	4.37:g.71201464A>G		88.0	0.0		42.0	4.0	NM_033122	B2RCB5|Q86UE0|Q96M17	Silent	SNP	ENST00000273936.5	37	CCDS3539.1																																																																																			.		0.428	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251561.3	NM_033122	
CAMSAP1	157922	ucsc.edu;bcgsc.ca	37	9	138713378	138713378	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:138713378C>A	ENST00000389532.4	-	11	3193	c.3129G>T	c.(3127-3129)caG>caT	p.Q1043H	CAMSAP1_ENST00000409386.3_Missense_Mutation_p.Q1054H|CAMSAP1_ENST00000483991.1_5'UTR|CAMSAP1_ENST00000312405.6_Missense_Mutation_p.Q765H	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	1043					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		GCTCTTGCTGCTGAGAGATTT	0.522																																					p.Q1043H		.											.	CAMSAP1	92	0			c.G3129T						.						70.0	68.0	69.0					9																	138713378		2203	4300	6503	SO:0001583	missense	157922	exon11			TTGCTGCTGAGAG	AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.3129G>T	9.37:g.138713378C>A	ENSP00000374183:p.Gln1043His	63.0	0.0		41.0	4.0	NM_015447	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Missense_Mutation	SNP	ENST00000389532.4	37	CCDS35176.2	.	.	.	.	.	.	.	.	.	.	C	14.82	2.649380	0.47362	.	.	ENSG00000130559	ENST00000389532;ENST00000312405;ENST00000409386	T;T;T	0.15372	2.43;2.43;2.43	4.9	3.75	0.43078	.	0.123645	0.56097	D	0.000030	T	0.39462	0.1079	M	0.74881	2.28	0.40711	D	0.982579	D;D	0.76494	0.999;0.999	D;D	0.76071	0.962;0.987	T	0.34800	-0.9814	10	0.87932	D	0	.	11.9713	0.53065	0.0:0.8781:0.0:0.1219	.	1043;1054	Q5T5Y3;Q5T5Y3-3	CAMP1_HUMAN;.	H	1043;765;1054	ENSP00000374183:Q1043H;ENSP00000312463:Q765H;ENSP00000386420:Q1054H	ENSP00000312463:Q765H	Q	-	3	2	CAMSAP1	137853199	1.000000	0.71417	1.000000	0.80357	0.351000	0.29236	1.120000	0.31271	2.419000	0.82065	0.655000	0.94253	CAG	.		0.522	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2	XM_351857	
CAPG	822	ucsc.edu;bcgsc.ca	37	2	85628952	85628952	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:85628952A>G	ENST00000409921.1	-	3	218	c.152T>C	c.(151-153)cTg>cCg	p.L51P	CAPG_ENST00000483659.1_5'Flank|CAPG_ENST00000409670.1_Missense_Mutation_p.L51P|CAPG_ENST00000409724.1_Missense_Mutation_p.L51P|CAPG_ENST00000263867.4_Missense_Mutation_p.L51P			Q9BPX3	CND3_HUMAN	capping protein (actin filament), gelsolin-like	0					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)	11						GCCATTGTGCAGCACTAGGTA	0.622																																					p.L51P		.											.	CAPG	204	0			c.T152C						.						110.0	106.0	107.0					2																	85628952		2203	4300	6503	SO:0001583	missense	822	exon3			TTGTGCAGCACTA	M94345	CCDS1974.1, CCDS58715.1	2p11.2	2008-06-04			ENSG00000042493	ENSG00000042493			1474	protein-coding gene	gene with protein product	"""macrophage capping protein"""	153615		AFCP		1322908, 12754261	Standard	NM_001747		Approved	MCP	uc010fgi.2	P40121	OTTHUMG00000130183	ENST00000409921.1:c.152T>C	2.37:g.85628952A>G	ENSP00000387063:p.Leu51Pro	87.0	0.0		61.0	7.0	NM_001256140	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	ENST00000409921.1	37	CCDS58715.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.458599	0.84317	.	.	ENSG00000042493	ENST00000542681;ENST00000263867;ENST00000409921;ENST00000409670;ENST00000409724;ENST00000439385;ENST00000449030;ENST00000447219;ENST00000409275	T;T;T;T;T;T;T;T	0.59638	0.25;0.25;0.25;0.25;0.25;0.25;0.25;0.25	5.85	5.85	0.93711	Gelsolin domain (1);	0.068373	0.64402	D	0.000013	D	0.82765	0.5108	H	0.96080	3.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.994	D	0.87674	0.2543	10	0.87932	D	0	.	12.6189	0.56592	1.0:0.0:0.0:0.0	.	51;51	B8ZZS7;P40121	.;CAPG_HUMAN	P	51	ENSP00000263867:L51P;ENSP00000387063:L51P;ENSP00000386315:L51P;ENSP00000386965:L51P;ENSP00000391923:L51P;ENSP00000403330:L51P;ENSP00000398232:L51P;ENSP00000386596:L51P	ENSP00000263867:L51P	L	-	2	0	CAPG	85482463	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.572000	0.90756	2.234000	0.73211	0.460000	0.39030	CTG	.		0.622	CAPG-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000329383.1	NM_001747	
CASP4	837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	104820474	104820474	+	Missense_Mutation	SNP	T	T	C	rs559503139		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:104820474T>C	ENST00000444739.2	-	5	1487	c.577A>G	c.(577-579)Acc>Gcc	p.T193A	CASP4_ENST00000531333.1_5'UTR|CASP4_ENST00000393150.3_Missense_Mutation_p.T137A	NM_001225.3	NP_001216.1	P49662	CASP4_HUMAN	caspase 4, apoptosis-related cysteine peptidase	193					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|IPAF inflammasome complex (GO:0072557)|membrane (GO:0016020)|mitochondrion (GO:0005739)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activity (GO:0004197)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(2)	23		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		TCTGGTCTGGTAGCAAATGCC	0.463													.|||	1	0.000199681	0.0008	0.0	5008	,	,		20995	0.0		0.0	False		,,,				2504	0.0				p.T193A		.											.	CASP4	660	0			c.A577G						.						139.0	123.0	128.0					11																	104820474		2202	4299	6501	SO:0001583	missense	837	exon5			GTCTGGTAGCAAA	U25804	CCDS8327.1, CCDS41704.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000196954	ENSG00000196954		"""Caspases"""	1505	protein-coding gene	gene with protein product		602664	"""caspase 4, apoptosis-related cysteine protease"""			7797510, 9250871	Standard	NM_001225		Approved	ICE(rel)II, ICH-2, TX	uc001pid.1	P49662	OTTHUMG00000166078	ENST00000444739.2:c.577A>G	11.37:g.104820474T>C	ENSP00000388566:p.Thr193Ala	101.0	0.0		50.0	10.0	NM_001225	A2NHL8|A2NHM0	Missense_Mutation	SNP	ENST00000444739.2	37	CCDS8327.1	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.352862	0.00217	.	.	ENSG00000196954	ENST00000444739;ENST00000393150;ENST00000355546	T;T	0.18810	2.19;2.19	4.57	1.56	0.23342	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.561699	0.19933	N	0.102811	T	0.01976	0.0062	N	0.00014	-2.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.45963	-0.9225	10	0.02654	T	1	.	4.8181	0.13376	0.1489:0.6143:0.1457:0.0911	.	193;193	B4E2D2;P49662	.;CASP4_HUMAN	A	193;137;146	ENSP00000388566:T193A;ENSP00000376857:T137A	ENSP00000347741:T146A	T	-	1	0	CASP4	104325684	0.006000	0.16342	0.524000	0.27887	0.002000	0.02628	0.797000	0.26999	1.135000	0.42183	-0.147000	0.13772	ACC	.		0.463	CASP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387751.1	NM_001225	
CBFA2T3	863	ucsc.edu;bcgsc.ca	37	16	88949122	88949122	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:88949122C>T	ENST00000268679.4	-	8	1561	c.1165G>A	c.(1165-1167)Gag>Aag	p.E389K	RP11-830F9.5_ENST00000562574.1_RNA|CBFA2T3_ENST00000448839.1_Missense_Mutation_p.E313K|RP11-830F9.5_ENST00000562405.1_RNA|CBFA2T3_ENST00000436887.2_Missense_Mutation_p.E351K|CBFA2T3_ENST00000360302.2_Missense_Mutation_p.E303K|CBFA2T3_ENST00000327483.5_Missense_Mutation_p.E303K|RP11-830F9.5_ENST00000569249.1_RNA|RP11-830F9.5_ENST00000565053.1_RNA	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	389	Mediates interaction with PDE7A (in isoform 2).|Mediates localization to the nucleus. {ECO:0000250}.				cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		CACTCACGCTCTGTGAGCTTG	0.627			T	RUNX1	AML																																p.E389K		.		Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	.	CBFA2T3	722	0			c.G1165A						.						232.0	131.0	165.0					16																	88949122		2191	4289	6480	SO:0001583	missense	863	exon8			CACGCTCTGTGAG	AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.1165G>A	16.37:g.88949122C>T	ENSP00000268679:p.Glu389Lys	41.0	0.0		31.0	6.0	NM_005187	D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Missense_Mutation	SNP	ENST00000268679.4	37	CCDS10972.1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646229	0.67358	.	.	ENSG00000129993	ENST00000327483;ENST00000268679;ENST00000436887;ENST00000448839;ENST00000360302	T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83	4.96	4.96	0.65561	NHR2-like (1);	0.233430	0.41823	D	0.000817	T	0.50292	0.1607	L	0.36672	1.1	0.58432	D	0.999995	P;P;B	0.37731	0.454;0.607;0.272	B;P;B	0.46389	0.266;0.515;0.287	T	0.53878	-0.8376	10	0.59425	D	0.04	-18.6258	16.9865	0.86341	0.0:1.0:0.0:0.0	.	351;389;303	E7EU24;O75081;O75081-2	.;MTG16_HUMAN;.	K	303;389;351;313;303	ENSP00000332122:E303K;ENSP00000268679:E389K;ENSP00000395739:E351K;ENSP00000401254:E313K;ENSP00000353449:E303K	ENSP00000268679:E389K	E	-	1	0	CBFA2T3	87476623	1.000000	0.71417	0.374000	0.26016	0.995000	0.86356	7.213000	0.77950	2.300000	0.77407	0.462000	0.41574	GAG	.		0.627	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269545.2	NM_005187	
CCDC14	64770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	123665744	123665744	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:123665744A>T	ENST00000488653.2	-	8	1341	c.1251T>A	c.(1249-1251)gaT>gaA	p.D417E	CCDC14_ENST00000433542.2_Missense_Mutation_p.D376E|CCDC14_ENST00000485727.1_Missense_Mutation_p.D217E|CCDC14_ENST00000483247.1_Intron|CCDC14_ENST00000310351.4_Missense_Mutation_p.D257E|CCDC14_ENST00000489746.1_Missense_Mutation_p.D217E			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	417					substantia nigra development (GO:0021762)	centrosome (GO:0005813)				NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		CCTTCTGTACATCCTTCACTG	0.378																																					p.D376E		.											.	CCDC14	68	0			c.T1128A						.						194.0	198.0	197.0					3																	123665744		2203	4300	6503	SO:0001583	missense	64770	exon7			CTGTACATCCTTC	AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.1251T>A	3.37:g.123665744A>T	ENSP00000420180:p.Asp417Glu	74.0	0.0		63.0	9.0	NM_022757	B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Missense_Mutation	SNP	ENST00000488653.2	37		.	.	.	.	.	.	.	.	.	.	A	12.74	2.029283	0.35797	.	.	ENSG00000175455	ENST00000488653;ENST00000310351;ENST00000485727;ENST00000489746;ENST00000433542;ENST00000409697;ENST00000426152	T;T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98;0.98	5.65	1.96	0.26148	.	0.499970	0.20011	N	0.101136	T	0.30324	0.0761	L	0.53249	1.67	0.09310	N	1	B;B;B	0.28850	0.225;0.225;0.091	B;B;B	0.26094	0.048;0.048;0.066	T	0.15037	-1.0451	10	0.15952	T	0.53	.	5.7785	0.18294	0.6498:0.1321:0.218:0.0	.	417;376;217	Q49A88;Q49A88-6;Q49A88-4	CCD14_HUMAN;.;.	E	417;257;217;217;376;398;143	ENSP00000420180:D417E;ENSP00000312031:D257E;ENSP00000418002:D217E;ENSP00000418403:D217E;ENSP00000395706:D376E;ENSP00000386866:D398E;ENSP00000414655:D143E	ENSP00000312031:D257E	D	-	3	2	CCDC14	125148434	0.794000	0.28838	0.704000	0.30370	0.960000	0.62799	0.720000	0.25896	0.567000	0.29293	0.533000	0.62120	GAT	.		0.378	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_022757	
CCDC171	203238	ucsc.edu;bcgsc.ca	37	9	15971645	15971645	+	Silent	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:15971645A>G	ENST00000380701.3	+	26	4120	c.3792A>G	c.(3790-3792)tcA>tcG	p.S1264S	CCDC171_ENST00000486641.2_Intron	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	1264																	CCATTCCTTCAAGAGCTCCTC	0.353																																					p.S1264S		.											.	.	.	0			c.A3792G						.						184.0	171.0	175.0					9																	15971645		2203	4300	6503	SO:0001819	synonymous_variant	203238	exon26			TCCTTCAAGAGCT	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.3792A>G	9.37:g.15971645A>G		77.0	0.0		31.0	4.0	NM_173550	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Silent	SNP	ENST00000380701.3	37	CCDS6481.1																																																																																			.		0.353	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550	
CCDC88B	283234	ucsc.edu;bcgsc.ca	37	11	64111852	64111852	+	Silent	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:64111852A>G	ENST00000356786.5	+	14	1883	c.1839A>G	c.(1837-1839)aaA>aaG	p.K613K	CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000301897.4_5'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	613						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CAGGGACCAAAATTCAGGCCC	0.647																																					p.K613K		.											.	CCDC88B	94	0			c.A1839G						.						30.0	33.0	32.0					11																	64111852		2201	4297	6498	SO:0001819	synonymous_variant	283234	exon14			GACCAAAATTCAG	AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.1839A>G	11.37:g.64111852A>G		96.0	0.0		40.0	4.0	NM_032251	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Silent	SNP	ENST00000356786.5	37	CCDS8072.2																																																																																			.		0.647	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104845.1	NM_032251	
CCT4	10575	ucsc.edu;bcgsc.ca	37	2	62099701	62099701	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:62099701C>T	ENST00000394440.3	-	11	1444	c.1148G>A	c.(1147-1149)gGa>gAa	p.G383E	CCT4_ENST00000544185.1_Missense_Mutation_p.G233E|CCT4_ENST00000538252.1_Missense_Mutation_p.G327E|AC107081.5_ENST00000425779.1_RNA|CCT4_ENST00000461540.2_Intron|CCT4_ENST00000544079.1_Missense_Mutation_p.G353E	NM_006430.3	NP_006421.2	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	383					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(6)|ovary(2)	11	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			AACTGTTTTTCCAGGGCTGGC	0.453																																					p.G383E		.											.	CCT4	92	0			c.G1148A						.						65.0	63.0	64.0					2																	62099701		2203	4300	6503	SO:0001583	missense	10575	exon11			GTTTTTCCAGGGC		CCDS33206.1, CCDS58711.1	2p15	2011-09-02			ENSG00000115484	ENSG00000115484		"""Heat Shock Proteins / Chaperonins"""	1617	protein-coding gene	gene with protein product		605142				9819444	Standard	NM_001256721		Approved	Cctd	uc002sbo.4	P50991	OTTHUMG00000152166	ENST00000394440.3:c.1148G>A	2.37:g.62099701C>T	ENSP00000377958:p.Gly383Glu	98.0	0.0		57.0	6.0	NM_006430	B2R6I3|B7Z8B1|F5H5W3|O14870|Q53QP9|Q96C51	Missense_Mutation	SNP	ENST00000394440.3	37	CCDS33206.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.485235	0.84854	.	.	ENSG00000115484	ENST00000394440;ENST00000544079;ENST00000544185;ENST00000538252	T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29	5.87	4.99	0.66335	.	0.045776	0.85682	D	0.000000	D	0.89904	0.6850	M	0.82923	2.615	0.80722	D	1	D;D	0.62365	0.99;0.991	D;D	0.65684	0.932;0.937	D	0.91676	0.5354	10	0.87932	D	0	-10.6213	17.0158	0.86419	0.0:0.8724:0.1275:0.0	.	353;383	F5H5W3;P50991	.;TCPD_HUMAN	E	383;353;233;327	ENSP00000377958:G383E;ENSP00000443061:G353E;ENSP00000443451:G233E;ENSP00000442174:G327E	ENSP00000377958:G383E	G	-	2	0	CCT4	61953205	0.999000	0.42202	0.997000	0.53966	0.995000	0.86356	3.928000	0.56506	1.597000	0.50072	0.655000	0.94253	GGA	.		0.453	CCT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325548.2		
CD101	9398	ucsc.edu;bcgsc.ca	37	1	117560028	117560028	+	Silent	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:117560028G>A	ENST00000256652.4	+	5	1603	c.1545G>A	c.(1543-1545)gaG>gaA	p.E515E	CD101_ENST00000369470.1_Silent_p.E515E	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	515	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GAGTATCTGAGAAGTCTCGGA	0.498																																					p.E515E		.											.	CD101	94	0			c.G1545A						.						82.0	81.0	81.0					1																	117560028		2203	4300	6503	SO:0001819	synonymous_variant	9398	exon5			ATCTGAGAAGTCT	Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.1545G>A	1.37:g.117560028G>A		68.0	0.0		42.0	4.0	NM_001256109	Q15856	Silent	SNP	ENST00000256652.4	37	CCDS891.1																																																																																			.		0.498	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033274.1	NM_004258	
CD109	135228	ucsc.edu;bcgsc.ca	37	6	74473386	74473386	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:74473386C>T	ENST00000287097.5	+	10	1197	c.1085C>T	c.(1084-1086)cCa>cTa	p.P362L	CD109_ENST00000437994.2_Missense_Mutation_p.P362L|CD109_ENST00000422508.2_Missense_Mutation_p.P285L			Q6YHK3	CD109_HUMAN	CD109 molecule	362					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GTCTTGAAGCCATCTCTCAAC	0.313																																					p.P362L		.											.	CD109	155	0			c.C1085T						.						87.0	88.0	88.0					6																	74473386		2201	4299	6500	SO:0001583	missense	135228	exon10			TGAAGCCATCTCT	AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.1085C>T	6.37:g.74473386C>T	ENSP00000287097:p.Pro362Leu	103.0	0.0		48.0	4.0	NM_133493	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	ENST00000287097.5	37	CCDS4982.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.973665	0.74246	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.38401	1.18;1.41;1.14	4.28	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.55737	0.1939	M	0.79926	2.475	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.995;1.0	D;D;D;D	0.97110	0.999;1.0;0.994;0.988	T	0.63373	-0.6652	10	0.87932	D	0	.	15.9866	0.80157	0.0:1.0:0.0:0.0	.	285;362;362;362	Q6YHK3-2;Q6YHK3-3;Q6YHK3-4;Q6YHK3	.;.;.;CD109_HUMAN	L	362;285;362	ENSP00000388062:P362L;ENSP00000404475:P285L;ENSP00000287097:P362L	ENSP00000287097:P362L	P	+	2	0	CD109	74530107	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.889000	0.63171	2.351000	0.79841	0.591000	0.81541	CCA	.		0.313	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493	
CD163L1	283316	ucsc.edu;bcgsc.ca	37	12	7527298	7527298	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:7527298T>C	ENST00000313599.3	-	13	3206	c.3149A>G	c.(3148-3150)gAg>gGg	p.E1050G	CD163L1_ENST00000544331.1_5'Flank|CD163L1_ENST00000416109.2_Missense_Mutation_p.E1060G|CD163L1_ENST00000396630.1_Missense_Mutation_p.E1050G			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1050	SRCR 10. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						GTGATAGATCTCTACTCTCCC	0.562											OREG0021653	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E1050G		.											.	CD163L1	100	0			c.A3149G						.						53.0	48.0	50.0					12																	7527298		2203	4300	6503	SO:0001583	missense	283316	exon13			TAGATCTCTACTC	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.3149A>G	12.37:g.7527298T>C	ENSP00000315945:p.Glu1050Gly	43.0	0.0	642	30.0	4.0	NM_174941	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.187144	0.78789	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.49139	0.79;0.79;0.79	2.73	2.73	0.32206	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);	0.000000	0.50627	U	0.000119	T	0.78220	0.4249	H	0.98965	4.385	0.35668	D	0.813071	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85951	0.1464	10	0.87932	D	0	.	9.202	0.37265	0.0:0.0:0.0:1.0	.	1060;1050	E7EVK4;Q9NR16	.;C163B_HUMAN	G	1050;1060;1050	ENSP00000315945:E1050G;ENSP00000393474:E1060G;ENSP00000379871:E1050G	ENSP00000315945:E1050G	E	-	2	0	CD163L1	7418565	1.000000	0.71417	0.673000	0.29887	0.327000	0.28475	5.845000	0.69437	1.476000	0.48215	0.379000	0.24179	GAG	.		0.562	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
CD38	952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	15839760	15839760	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:15839760T>C	ENST00000226279.3	+	5	768	c.631T>C	c.(631-633)Tcc>Ccc	p.S211P		NM_001775.2	NP_001766.2	P28907	CD38_HUMAN	CD38 molecule	211					apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|female pregnancy (GO:0007565)|long term synaptic depression (GO:0060292)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone resorption (GO:0045779)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell growth (GO:0030307)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hydroperoxide (GO:0033194)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|phosphorus-oxygen lyase activity (GO:0016849)|transferase activity (GO:0016740)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|stomach(1)	14						GCTCAATGGATCCCGCAGTAA	0.383																																					p.S211P		.											.	CD38	92	0			c.T631C						.						143.0	133.0	136.0					4																	15839760		2203	4300	6503	SO:0001583	missense	952	exon5			AATGGATCCCGCA	D84276	CCDS3417.1	4p15.32	2010-05-04	2006-03-28		ENSG00000004468	ENSG00000004468	3.2.2.5	"""CD molecules"""	1667	protein-coding gene	gene with protein product	"""ADP-ribosyl cyclase 1"", ""NAD(+) nucleosidase"""	107270	"""CD38 antigen (p45)"""			9074508, 2319135	Standard	NM_001775		Approved		uc003gol.1	P28907	OTTHUMG00000048206	ENST00000226279.3:c.631T>C	4.37:g.15839760T>C	ENSP00000226279:p.Ser211Pro	59.0	0.0		54.0	33.0	NM_001775	O00121|O00122|Q96HY4	Missense_Mutation	SNP	ENST00000226279.3	37	CCDS3417.1	.	.	.	.	.	.	.	.	.	.	T	13.69	2.312152	0.40895	.	.	ENSG00000004468	ENST00000226279;ENST00000510674	T;T	0.53857	0.6;0.6	5.4	5.4	0.78164	NAD(P)-binding domain (1);	0.112478	0.64402	D	0.000007	T	0.74703	0.3751	M	0.87381	2.88	0.40730	D	0.982734	D	0.89917	1.0	D	0.91635	0.999	T	0.80169	-0.1494	10	0.87932	D	0	-28.9521	12.0932	0.53739	0.0:0.0:0.0:1.0	.	211	P28907	CD38_HUMAN	P	211;99	ENSP00000226279:S211P;ENSP00000423047:S99P	ENSP00000226279:S211P	S	+	1	0	CD38	15448858	0.010000	0.17322	0.355000	0.25773	0.161000	0.22273	0.907000	0.28531	2.178000	0.69098	0.533000	0.62120	TCC	.		0.383	CD38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250322.2	NM_001775	
CD4	920	ucsc.edu;bcgsc.ca	37	12	6923451	6923451	+	Silent	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:6923451T>C	ENST00000011653.4	+	4	616	c.358T>C	c.(358-360)Ttg>Ctg	p.L120L	CD4_ENST00000538827.1_3'UTR|CD4_ENST00000541982.1_Silent_p.L65L	NM_000616.4|NM_001195015.2|NM_001195016.2|NM_001195017.2	NP_000607.1|NP_001181944.1|NP_001181945.1|NP_001181946.1	P01730	CD4_HUMAN	CD4 molecule	120	Ig-like V-type.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cytokine production (GO:0001816)|defense response to Gram-negative bacterium (GO:0050829)|entry into host cell (GO:0030260)|enzyme linked receptor protein signaling pathway (GO:0007167)|immune response (GO:0006955)|induction by virus of host cell-cell fusion (GO:0006948)|innate immune response (GO:0045087)|maintenance of protein location in cell (GO:0032507)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase activity (GO:0045860)|protein palmitoleylation (GO:0045234)|regulation of defense response to virus by virus (GO:0050690)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)|T cell selection (GO:0045058)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|enzyme binding (GO:0019899)|extracellular matrix structural constituent (GO:0005201)|glycoprotein binding (GO:0001948)|MHC class II protein binding (GO:0042289)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	23		Myeloproliferative disorder(1001;0.0122)			Antithymocyte globulin(DB00098)	GGAGGTGCAATTGCTAGTGTT	0.517																																					p.L120L		.											.	CD4	90	0			c.T358C						.						159.0	147.0	151.0					12																	6923451		2203	4300	6503	SO:0001819	synonymous_variant	920	exon4			GTGCAATTGCTAG	M35160	CCDS8562.1	12p13.31	2013-01-11	2006-03-28		ENSG00000010610	ENSG00000010610		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1678	protein-coding gene	gene with protein product		186940	"""CD4 antigen (p55)"", ""T-cell surface glycoprotein CD4"""				Standard	NM_000616		Approved		uc001qqv.2	P01730	OTTHUMG00000168514	ENST00000011653.4:c.358T>C	12.37:g.6923451T>C		70.0	0.0		43.0	4.0	NM_000616	B2R737|D3DUS5|Q4ZGK2|Q5U066|Q9UDE5	Silent	SNP	ENST00000011653.4	37	CCDS8562.1																																																																																			.		0.517	CD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399978.1	NM_000616	
CDK9	1025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	130550943	130550943	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:130550943G>T	ENST00000373264.4	+	6	825	c.725G>T	c.(724-726)aGt>aTt	p.S242I	CDK9_ENST00000373265.2_Missense_Mutation_p.S359I|MIR3960_ENST00000583311.1_RNA	NM_001261.3	NP_001252.1	P50750	CDK9_HUMAN	cyclin-dependent kinase 9	242	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|cellular response to cytokine stimulus (GO:0071345)|DNA repair (GO:0006281)|gene expression (GO:0010467)|negative regulation of cell cycle arrest (GO:0071157)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of DNA repair (GO:0006282)|regulation of histone modification (GO:0031056)|replication fork arrest (GO:0043111)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|positive transcription elongation factor complex b (GO:0008024)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|DNA binding (GO:0003677)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			lung(1)	1						GCCCTCATCAGTCAGCTCTGC	0.652																																					p.S242I		.											.	CDK9	521	0			c.G725T						.						60.0	54.0	56.0					9																	130550943		2203	4300	6503	SO:0001583	missense	1025	exon6			TCATCAGTCAGCT	L25676	CCDS6879.1	9q34.1	2011-11-08	2007-11-21		ENSG00000136807	ENSG00000136807		"""Cyclin-dependent kinases"""	1780	protein-coding gene	gene with protein product		603251	"""cyclin-dependent kinase 9 (CDC2-related kinase)"""	CDC2L4		8170997, 9356449	Standard	NM_001261		Approved	PITALRE, C-2k, TAK	uc004bse.2	P50750	OTTHUMG00000020715	ENST00000373264.4:c.725G>T	9.37:g.130550943G>T	ENSP00000362361:p.Ser242Ile	144.0	1.0		59.0	44.0	NM_001261	Q5JU24|Q5JU25|Q5U006|Q96TF1	Missense_Mutation	SNP	ENST00000373264.4	37	CCDS6879.1	.	.	.	.	.	.	.	.	.	.	G	19.71	3.877895	0.72294	.	.	ENSG00000136807	ENST00000373265;ENST00000373264	T;T	0.40225	1.04;1.04	5.13	5.13	0.70059	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.40423	0.1116	N	0.04508	-0.205	0.80722	D	1	D	0.56521	0.976	D	0.65323	0.934	T	0.44711	-0.9310	10	0.22109	T	0.4	-13.7553	17.5564	0.87890	0.0:0.0:1.0:0.0	.	242	P50750	CDK9_HUMAN	I	359;242	ENSP00000362362:S359I;ENSP00000362361:S242I	ENSP00000362361:S242I	S	+	2	0	CDK9	129590764	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.571000	0.98176	2.385000	0.81259	0.491000	0.48974	AGT	.		0.652	CDK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054235.1		
CDKN1A	1026	broad.mit.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	36651880	36651881	+	Start_Codon_SNP	DNP	TG	TG	GT			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T|G	T|G	.	.	.	.	.|Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:36651880_36651881TG>GT	ENST00000405375.1	+	2	237_238	c.2_3TG>GT	c.(1-3)aTG>aGT	p.M1S	CDKN1A_ENST00000478800.1_3'UTR|CDKN1A_ENST00000244741.5_Start_Codon_SNP_p.M1S|CDKN1A_ENST00000448526.2_Missense_Mutation_p.M35S|CDKN1A_ENST00000373711.2_Start_Codon_SNP_p.M1S	NM_001220778.1	NP_001207707.1	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	1					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to ionizing radiation (GO:0071479)|cellular senescence (GO:0090398)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of gene expression (GO:0010629)|negative regulation of phosphorylation (GO:0042326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of DNA biosynthetic process (GO:2000278)|regulation of protein import into nucleus, translocation (GO:0033158)|response to arsenic-containing substance (GO:0046685)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to organonitrogen compound (GO:0010243)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|stress-induced premature senescence (GO:0090400)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA-p21 complex (GO:0070557)	cyclin-dependent protein kinase activating kinase activity (GO:0019912)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|urinary_tract(5)	15						GCAGGCGCCATGTCAGAACCGG	0.629																																					p.M1R|p.M1I		.											.	CDKN1A	872	0			c.T2G|c.G3T						.																																			SO:0001582	initiator_codon_variant	1026	exon2			GCGCCATGTCAGA|CGCCATGTCAGAA	U03106	CCDS4824.1	6p21.1	2009-01-21			ENSG00000124762	ENSG00000124762			1784	protein-coding gene	gene with protein product		116899		CDKN1			Standard	NM_000389		Approved	P21, CIP1, WAF1, SDI1, CAP20, p21CIP1, p21Cip1/Waf1	uc021yzb.1	P38936	OTTHUMG00000014603	Exception_encountered	6.37:g.36651880_36651881delinsGT	ENSP00000384849:p.Met1Ser	57.0|56.0	1.0|0.0		50.0	47.0|45.0	NM_001220778	Q14010|Q6FI05|Q9BUT4	Missense_Mutation	SNP	ENST00000405375.1	37	CCDS4824.1																																																																																			.		0.629	CDKN1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040354.1	NM_078467	Missense_Mutation
CELF3	11189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	151679702	151679702	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:151679702C>T	ENST00000290583.4	-	8	1634	c.841G>A	c.(841-843)Ggc>Agc	p.G281S	CELF3_ENST00000470688.1_5'UTR|CELF3_ENST00000392706.3_Missense_Mutation_p.G98S|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000290585.4_Intron	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	281					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						GGGCTGTAGCCGTTGACGCCC	0.672																																					p.G281S		.											.	CELF3	91	0			c.G841A						.						24.0	24.0	24.0					1																	151679702		2183	4275	6458	SO:0001583	missense	11189	exon8			TGTAGCCGTTGAC	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.841G>A	1.37:g.151679702C>T	ENSP00000290583:p.Gly281Ser	103.0	0.0		125.0	17.0	NM_007185	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Missense_Mutation	SNP	ENST00000290583.4	37	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	.	15.75	2.924379	0.52653	.	.	ENSG00000159409	ENST00000290583;ENST00000392706	T;T	0.16196	2.36;3.38	3.86	3.86	0.44501	.	0.193448	0.47093	D	0.000260	T	0.13200	0.0320	N	0.24115	0.695	0.41455	D	0.988006	D;P;B;P	0.76494	0.999;0.468;0.444;0.761	P;B;B;B	0.58520	0.84;0.18;0.035;0.145	T	0.06972	-1.0797	10	0.33940	T	0.23	-6.5762	14.5324	0.67936	0.0:1.0:0.0:0.0	.	98;281;281;280	B4DQL3;Q5SZQ8-2;Q5SZQ8;Q5SZQ8-3	.;.;CELF3_HUMAN;.	S	281;98	ENSP00000290583:G281S;ENSP00000376470:G98S	ENSP00000290583:G281S	G	-	1	0	CELF3	149946326	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.643000	0.37217	2.008000	0.58898	0.555000	0.69702	GGC	.		0.672	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	NM_007185	
CEP192	55125	ucsc.edu;bcgsc.ca	37	18	13049025	13049025	+	Silent	SNP	C	C	T	rs374786520		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:13049025C>T	ENST00000325971.8	+	14	2040	c.447C>T	c.(445-447)acC>acT	p.T149T	CEP192_ENST00000430049.2_Silent_p.T270T|CEP192_ENST00000506447.1_Silent_p.T745T			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	149					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CAAATAAAACCAGAGACAAGA	0.393																																					p.T745T		.											.	CEP192	27	0			c.C2235T						.	C		1,4405	2.1+/-5.4	0,1,2202	96.0	94.0	95.0		2235	2.0	0.5	18		95	0,8600		0,0,4300	no	coding-synonymous	CEP192	NM_032142.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		745/2538	13049025	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	55125	exon16			TAAAACCAGAGAC	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.447C>T	18.37:g.13049025C>T		81.0	0.0		58.0	5.0	NM_032142	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Silent	SNP	ENST00000325971.8	37																																																																																				.		0.393	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	
CHL1	10752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	423911	423911	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:423911G>T	ENST00000256509.2	+	17	2568	c.1926G>T	c.(1924-1926)agG>agT	p.R642S	CHL1-AS1_ENST00000417612.1_RNA|CHL1_ENST00000397491.2_Missense_Mutation_p.R626S	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		GACAGAACAGGAGTGTTCGGC	0.408																																					p.R642S		.											.	CHL1	583	0			c.G1926T						.						89.0	94.0	92.0					3																	423911		2203	4300	6503	SO:0001583	missense	10752	exon15			GAACAGGAGTGTT	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.1926G>T	3.37:g.423911G>T	ENSP00000256509:p.Arg642Ser	95.0	0.0		78.0	27.0	NM_001253388	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	G	19.70	3.876548	0.72180	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.54479	0.57;0.57	5.13	2.09	0.27110	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.166021	0.49916	D	0.000128	T	0.58538	0.2129	L	0.47716	1.5	0.45464	D	0.998435	P;P;D	0.76494	0.954;0.954;0.999	P;P;D	0.74023	0.87;0.87;0.982	T	0.54609	-0.8268	10	0.52906	T	0.07	.	5.5079	0.16864	0.2909:0.25:0.4591:0.0	.	626;626;642	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	S	642;626	ENSP00000256509:R642S;ENSP00000380628:R626S	ENSP00000256509:R642S	R	+	3	2	CHL1	398911	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	0.575000	0.23729	0.187000	0.20147	0.591000	0.81541	AGG	.		0.408	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
CHRM4	1132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	46406927	46406927	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:46406927C>T	ENST00000433765.2	-	1	1180	c.1181G>A	c.(1180-1182)cGg>cAg	p.R394Q		NM_000741.2	NP_000732.2	P08173	ACM4_HUMAN	cholinergic receptor, muscarinic 4	394					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|regulation of locomotion (GO:0040012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			breast(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	20				GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TTTGCGCTCCCGGGCCGCCAT	0.637																																					p.R394Q	Esophageal Squamous(171;1020 1936 4566 30205 42542)	.											.	.	.	0			c.G1181A						.						73.0	78.0	76.0					11																	46406927		2187	4290	6477	SO:0001583	missense	1132	exon1			CGCTCCCGGGCCG	M16405	CCDS44581.1	11p12-p11.2	2012-08-08			ENSG00000180720	ENSG00000180720		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1953	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 4"""	118495				1577490	Standard	NM_000741		Approved		uc001nct.1	P08173	OTTHUMG00000154371	ENST00000433765.2:c.1181G>A	11.37:g.46406927C>T	ENSP00000409378:p.Arg394Gln	73.0	0.0		89.0	23.0	NM_000741	B2RPP4|Q0VD60|Q4VBK7	Missense_Mutation	SNP	ENST00000433765.2	37	CCDS44581.1	.	.	.	.	.	.	.	.	.	.	c	24.6	4.552364	0.86127	.	.	ENSG00000180720	ENST00000433765	T	0.72505	-0.66	4.58	4.58	0.56647	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	D	0.83394	0.5245	M	0.77820	2.39	0.58432	D	0.999993	D	0.69078	0.997	D	0.64877	0.93	D	0.86282	0.1668	9	0.87932	D	0	-12.9181	17.5685	0.87927	0.0:1.0:0.0:0.0	.	394	P08173	ACM4_HUMAN	Q	394	ENSP00000409378:R394Q	ENSP00000409378:R394Q	R	-	2	0	CHRM4	46363503	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.640000	0.83355	2.395000	0.81488	0.457000	0.33378	CGG	.		0.637	CHRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334985.1	NM_000741	
CNDP2	55748	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	72185845	72185845	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:72185845T>A	ENST00000324262.4	+	10	1496	c.1180T>A	c.(1180-1182)Tac>Aac	p.Y394N	CNDP2_ENST00000324301.8_Missense_Mutation_p.Y310N|CNDP2_ENST00000579847.1_Missense_Mutation_p.Y394N	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	394					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		TCACCCTCATTACCTGGCTGG	0.562																																					p.Y394N		.											.	CNDP2	93	0			c.T1180A						.						109.0	104.0	106.0					18																	72185845		2203	4300	6503	SO:0001583	missense	55748	exon10			CCTCATTACCTGG	AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.1180T>A	18.37:g.72185845T>A	ENSP00000325548:p.Tyr394Asn	45.0	1.0		36.0	7.0	NM_018235	B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Missense_Mutation	SNP	ENST00000324262.4	37	CCDS12006.1	.	.	.	.	.	.	.	.	.	.	T	18.13	3.556025	0.65425	.	.	ENSG00000133313	ENST00000324262;ENST00000324301	T;T	0.52754	0.65;0.65	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.72969	0.3527	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	T	0.78145	-0.2318	10	0.62326	D	0.03	-35.5592	15.6483	0.77070	0.0:0.0:0.0:1.0	.	310;394	Q96KP4-2;Q96KP4	.;CNDP2_HUMAN	N	394;310	ENSP00000325548:Y394N;ENSP00000325756:Y310N	ENSP00000325548:Y394N	Y	+	1	0	CNDP2	70336825	1.000000	0.71417	0.104000	0.21259	0.123000	0.20343	7.840000	0.86819	2.098000	0.63641	0.528000	0.53228	TAC	.		0.562	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256327.1	NM_018235	
CNIH2	254263	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	11	66050758	66050758	+	Nonsense_Mutation	SNP	T	T	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:66050758T>G	ENST00000311445.6	+	5	609	c.351T>G	c.(349-351)taT>taG	p.Y117*	CNIH2_ENST00000530519.1_3'UTR|YIF1A_ENST00000526497.1_5'Flank|CNIH2_ENST00000528852.1_Nonsense_Mutation_p.Y117*	NM_182553.2	NP_872359.1	Q6PI25	CNIH2_HUMAN	cornichon family AMPA receptor auxiliary protein 2	117					intracellular signal transduction (GO:0035556)|localization within membrane (GO:0051668)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	5						AGGTCATGTATGATGCGGTCT	0.547											OREG0021100	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y117X		.											.	CNIH2	90	0			c.T351G						.						223.0	207.0	213.0					11																	66050758		2200	4295	6495	SO:0001587	stop_gained	254263	exon5			CATGTATGATGCG	BC047953	CCDS8131.1	11q13.2	2013-08-28	2013-08-28		ENSG00000174871	ENSG00000174871			28744	protein-coding gene	gene with protein product		611288	"""cornichon homolog 2 (Drosophila)"""			12477932	Standard	NM_182553		Approved	MGC50896, Cnil, CNIH-2	uc001ohi.2	Q6PI25	OTTHUMG00000166919	ENST00000311445.6:c.351T>G	11.37:g.66050758T>G	ENSP00000310003:p.Tyr117*	62.0	0.0	1088	33.0	19.0	NM_182553		Nonsense_Mutation	SNP	ENST00000311445.6	37	CCDS8131.1	.	.	.	.	.	.	.	.	.	.	T	35	5.492071	0.96339	.	.	ENSG00000174871	ENST00000528852;ENST00000311445	.	.	.	5.63	3.04	0.35103	.	0.307408	0.36482	N	0.002566	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.5909	6.963	0.24608	0.0:0.2879:0.0:0.7121	.	.	.	.	X	117	.	ENSP00000310003:Y117X	Y	+	3	2	CNIH2	65807334	0.978000	0.34361	1.000000	0.80357	0.990000	0.78478	0.151000	0.16283	1.075000	0.40932	-0.256000	0.11100	TAT	.		0.547	CNIH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391892.1	NM_182553	
CNKSR3	154043	ucsc.edu;bcgsc.ca	37	6	154727645	154727645	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:154727645C>A	ENST00000607772.1	-	13	2055	c.1511G>T	c.(1510-1512)aGg>aTg	p.R504M	CNKSR3_ENST00000479339.1_Missense_Mutation_p.R424M|CNKSR3_ENST00000433165.2_Missense_Mutation_p.R329M	NM_173515.2	NP_775786.2	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	504	DUF1170.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	15		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		GATGTAGCACCTGCTTCCTCG	0.577																																					p.R504M		.											.	CNKSR3	26	0			c.G1511T						.						154.0	132.0	140.0					6																	154727645		2203	4300	6503	SO:0001583	missense	154043	exon13			TAGCACCTGCTTC	AK055911	CCDS5246.1	6q25.2	2013-01-10	2005-04-11	2005-04-11	ENSG00000153721	ENSG00000153721		"""Sterile alpha motif (SAM) domain containing"""	23034	protein-coding gene	gene with protein product			"""membrane associated guanylate kinase interacting protein-like 1"""	MAGI1			Standard	NM_173515		Approved	FLJ31349		Q6P9H4	OTTHUMG00000015873	ENST00000607772.1:c.1511G>T	6.37:g.154727645C>A	ENSP00000475915:p.Arg504Met	89.0	0.0		43.0	4.0	NM_173515	Q5SGD5|Q96N65	Missense_Mutation	SNP	ENST00000607772.1	37	CCDS5246.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.210444	0.79240	.	.	ENSG00000153721	ENST00000367213;ENST00000433165;ENST00000479339	T;T;T	0.51574	1.3;0.7;0.7	4.93	4.93	0.64822	Connector enhancer of kinase suppressor of ras 2 (1);	0.058478	0.64402	D	0.000010	T	0.48909	0.1526	L	0.54323	1.7	0.24499	N	0.994262	D	0.61080	0.989	P	0.60173	0.87	T	0.43621	-0.9380	10	0.72032	D	0.01	.	14.1592	0.65436	0.0:0.8498:0.1501:0.0	.	504	Q6P9H4	CNKR3_HUMAN	M	504;329;424	ENSP00000356182:R504M;ENSP00000414185:R329M;ENSP00000418975:R424M	ENSP00000356182:R504M	R	-	2	0	CNKSR3	154769337	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.511000	0.60462	2.444000	0.82710	0.655000	0.94253	AGG	.		0.577	CNKSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042792.2	NM_173515	
CNOT1	23019	ucsc.edu;bcgsc.ca	37	16	58568277	58568277	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:58568277T>C	ENST00000317147.5	-	40	6001	c.5669A>G	c.(5668-5670)aAg>aGg	p.K1890R	CNOT1_ENST00000245138.4_Missense_Mutation_p.K741R|CNOT1_ENST00000569240.1_Missense_Mutation_p.K1885R	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1890					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		ATCATCGGTCTTCAGTATTCC	0.408																																					p.K1890R		.											.	CNOT1	95	0			c.A5669G						.						78.0	58.0	65.0					16																	58568277		2198	4300	6498	SO:0001583	missense	23019	exon40			TCGGTCTTCAGTA	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.5669A>G	16.37:g.58568277T>C	ENSP00000320949:p.Lys1890Arg	23.0	0.0		22.0	4.0	NM_016284	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	T	19.28	3.797464	0.70567	.	.	ENSG00000125107	ENST00000317147;ENST00000245138;ENST00000394200	T	0.51325	0.71	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.44623	0.1302	L	0.46157	1.445	0.80722	D	1	B;B;B	0.30686	0.29;0.117;0.284	B;B;B	0.31686	0.063;0.067;0.134	T	0.33266	-0.9875	10	0.37606	T	0.19	.	16.1846	0.81942	0.0:0.0:0.0:1.0	.	741;1890;1885	B5MDN3;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	R	1890;741;1885	ENSP00000320949:K1890R	ENSP00000245138:K741R	K	-	2	0	CNOT1	57125778	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.040000	0.89188	2.229000	0.72834	0.533000	0.62120	AAG	.		0.408	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
CNTNAP2	26047	ucsc.edu;bcgsc.ca	37	7	146818167	146818167	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:146818167A>G	ENST00000361727.3	+	6	1367	c.851A>G	c.(850-852)cAg>cGg	p.Q284R		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	284	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ATTGAGCGCCAGGGGCGGAGC	0.532										HNSCC(39;0.1)																											p.Q284R		.											.	CNTNAP2	100	0			c.A851G						.						159.0	127.0	138.0					7																	146818167		2203	4300	6503	SO:0001583	missense	26047	exon6			AGCGCCAGGGGCG	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.851A>G	7.37:g.146818167A>G	ENSP00000354778:p.Gln284Arg	55.0	0.0		35.0	4.0	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	A	13.99	2.403160	0.42613	.	.	ENSG00000174469	ENST00000361727	T	0.77358	-1.09	5.82	5.82	0.92795	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.197826	0.33875	N	0.004473	T	0.62233	0.2411	N	0.12746	0.255	0.80722	D	1	B	0.12013	0.005	B	0.12156	0.007	T	0.58020	-0.7710	10	0.22109	T	0.4	.	15.0249	0.71663	1.0:0.0:0.0:0.0	.	284	Q9UHC6	CNTP2_HUMAN	R	284	ENSP00000354778:Q284R	ENSP00000354778:Q284R	Q	+	2	0	CNTNAP2	146449100	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	7.244000	0.78228	2.225000	0.72522	0.460000	0.39030	CAG	.		0.532	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
COL15A1	1306	ucsc.edu;bcgsc.ca	37	9	101782702	101782702	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:101782702A>G	ENST00000375001.3	+	12	2102	c.1679A>G	c.(1678-1680)cAg>cGg	p.Q560R		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	560	Triple-helical region 1 (COL1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				ATGAAAGGACAGGCTGGGCCC	0.453																																					p.Q560R		.											.	COL15A1	96	0			c.A1679G						.						148.0	129.0	136.0					9																	101782702		2203	4300	6503	SO:0001583	missense	1306	exon12			AAGGACAGGCTGG	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.1679A>G	9.37:g.101782702A>G	ENSP00000364140:p.Gln560Arg	77.0	0.0		38.0	5.0	NM_001855	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	A	8.588	0.883802	0.17467	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	D	0.89810	-2.57	2.39	2.39	0.29439	.	2.943210	0.02075	N	0.051888	T	0.80221	0.4583	N	0.17082	0.46	0.22457	N	0.999089	B	0.23377	0.084	B	0.24006	0.05	T	0.67581	-0.5634	10	0.11794	T	0.64	2.5591	6.6044	0.22718	1.0:0.0:0.0:0.0	.	560	P39059	COFA1_HUMAN	R	560;530	ENSP00000364140:Q560R	ENSP00000364140:Q560R	Q	+	2	0	COL15A1	100822523	1.000000	0.71417	0.597000	0.28824	0.284000	0.27059	1.939000	0.40213	1.098000	0.41479	0.533000	0.62120	CAG	.		0.453	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	
COL4A2	1284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	111082761	111082761	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr13:111082761A>G	ENST00000360467.5	+	9	869	c.563A>G	c.(562-564)gAg>gGg	p.E188G	COL4A2_ENST00000462309.1_3'UTR	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	188	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GAACCTGGAGAGCCTGGATTG	0.358																																					p.E188G		.											.	COL4A2	95	0			c.A563G						.						86.0	85.0	85.0					13																	111082761		1807	4070	5877	SO:0001583	missense	1284	exon9			CTGGAGAGCCTGG	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.563A>G	13.37:g.111082761A>G	ENSP00000353654:p.Glu188Gly	114.0	0.0		76.0	27.0	NM_001846	Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	ENST00000360467.5	37	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	A	9.789	1.177348	0.21787	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.93906	-3.31	5.19	5.19	0.71726	.	0.504141	0.17796	N	0.161738	D	0.94039	0.8090	M	0.76838	2.35	0.38545	D	0.949315	P	0.41784	0.762	P	0.48063	0.565	D	0.92822	0.6273	10	0.16896	T	0.51	.	13.6015	0.62022	1.0:0.0:0.0:0.0	.	188	P08572	CO4A2_HUMAN	G	188	ENSP00000353654:E188G	ENSP00000257309:E188G	E	+	2	0	COL4A2	109880762	0.899000	0.30636	0.967000	0.41034	0.394000	0.30568	2.243000	0.43115	1.943000	0.56356	0.528000	0.53228	GAG	.		0.358	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846	
COL5A2	1290	ucsc.edu;bcgsc.ca	37	2	189927993	189927993	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:189927993C>A	ENST00000374866.3	-	27	2048	c.1774G>T	c.(1774-1776)Gcg>Tcg	p.A592S		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	592					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TCCCCTGGCGCACCCTATAGA	0.507																																					p.A592S		.											.	COL5A2	92	0			c.G1774T						.						48.0	53.0	51.0					2																	189927993		2203	4300	6503	SO:0001583	missense	1290	exon27			CTGGCGCACCCTA	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.1774G>T	2.37:g.189927993C>A	ENSP00000364000:p.Ala592Ser	28.0	0.0		23.0	4.0	NM_000393	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	C	15.78	2.933069	0.52866	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.94280	-3.39	4.82	3.93	0.45458	.	0.147776	0.31071	N	0.008302	D	0.88112	0.6349	N	0.10874	0.06	0.58432	D	0.999995	P;P	0.40211	0.455;0.707	B;P	0.46585	0.099;0.521	D	0.85443	0.1156	9	.	.	.	.	13.6162	0.62110	0.0:0.9236:0.0:0.0764	.	232;592	Q5PR22;P05997	.;CO5A2_HUMAN	S	592;232	ENSP00000364000:A592S	.	A	-	1	0	COL5A2	189636238	1.000000	0.71417	0.995000	0.50966	0.644000	0.38419	3.662000	0.54510	1.126000	0.42016	0.460000	0.39030	GCG	.		0.507	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	
COL6A6	131873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	130289820	130289820	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:130289820G>A	ENST00000358511.6	+	6	2591	c.2560G>A	c.(2560-2562)Gct>Act	p.A854T	COL6A6_ENST00000453409.2_Missense_Mutation_p.A854T	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	854	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TCTGAAGTATGCTGATGACCC	0.433																																					p.A854T		.											.	COL6A6	76	0			c.G2560A						.						75.0	76.0	76.0					3																	130289820		1880	4118	5998	SO:0001583	missense	131873	exon6			AAGTATGCTGATG	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2560G>A	3.37:g.130289820G>A	ENSP00000351310:p.Ala854Thr	93.0	0.0		88.0	16.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.507212	0.64410	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.79454	-1.27;-1.27	4.87	3.85	0.44370	von Willebrand factor, type A (3);	0.108239	0.41294	D	0.000905	T	0.64832	0.2634	N	0.25380	0.74	0.29826	N	0.830448	P	0.34462	0.454	B	0.38156	0.266	T	0.65401	-0.6177	10	0.87932	D	0	.	5.8236	0.18540	0.0996:0.0:0.5249:0.3754	.	854	A6NMZ7	CO6A6_HUMAN	T	854	ENSP00000351310:A854T;ENSP00000399236:A854T	ENSP00000351310:A854T	A	+	1	0	COL6A6	131772510	0.002000	0.14202	0.932000	0.37286	0.924000	0.55760	0.555000	0.23422	2.424000	0.82194	0.561000	0.74099	GCT	.		0.433	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
CPN1	1369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	101802222	101802222	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr10:101802222C>T	ENST00000370418.3	-	9	1590	c.1339G>A	c.(1339-1341)Gaa>Aaa	p.E447K		NM_001308.2	NP_001299.1	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1	447					response to glucocorticoid (GO:0051384)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	33		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		ATCTCCATTTCTTTCTTTCTG	0.552																																					p.E447K		.											.	CPN1	227	0			c.G1339A						.						97.0	86.0	90.0					10																	101802222		2203	4300	6503	SO:0001583	missense	1369	exon9			CCATTTCTTTCTT	X14329	CCDS7486.1	10q24.2	2012-02-10	2007-02-23		ENSG00000120054	ENSG00000120054	3.4.17.3		2312	protein-coding gene	gene with protein product	"""anaphylatoxin inactivator"", ""arginine carboxypeptidase"", ""carboxypeptidase K"", ""kininase I"", ""lysine carboxypeptidase"""	603103	"""carboxypeptidase N, polypeptide 1, 50kD"""			9628828, 2912725	Standard	NM_001308		Approved		uc001kql.2	P15169	OTTHUMG00000018896	ENST00000370418.3:c.1339G>A	10.37:g.101802222C>T	ENSP00000359446:p.Glu447Lys	80.0	0.0		83.0	35.0	NM_001308	B1AP59	Missense_Mutation	SNP	ENST00000370418.3	37	CCDS7486.1	.	.	.	.	.	.	.	.	.	.	C	7.828	0.719197	0.15372	.	.	ENSG00000120054	ENST00000370418	T	0.16457	2.34	4.02	1.14	0.20703	.	.	.	.	.	T	0.06142	0.0159	N	0.08118	0	0.09310	N	1	B	0.16166	0.016	B	0.14578	0.011	T	0.42310	-0.9459	9	0.07990	T	0.79	-13.8138	3.3415	0.07120	0.2046:0.5783:0.0:0.2171	.	447	P15169	CBPN_HUMAN	K	447	ENSP00000359446:E447K	ENSP00000359446:E447K	E	-	1	0	CPN1	101792212	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.022000	0.12480	0.252000	0.21531	-0.145000	0.13849	GAA	.		0.552	CPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049828.1	NM_001308	
CR2	1380	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207641906	207641906	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:207641906C>T	ENST00000367058.3	+	3	669	c.480C>T	c.(478-480)atC>atT	p.I160I	CR2_ENST00000458541.2_Silent_p.I160I|CR2_ENST00000367057.3_Silent_p.I160I|CR2_ENST00000485707.1_3'UTR|CR2_ENST00000367059.3_Silent_p.I160I	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	160	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						TTCCTATGATCCACAATGGAC	0.433																																					p.I160I		.											.	CR2	232	0			c.C480T						.						202.0	188.0	192.0					1																	207641906		2203	4300	6503	SO:0001819	synonymous_variant	1380	exon3			TATGATCCACAAT	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.480C>T	1.37:g.207641906C>T		239.0	0.0		293.0	160.0	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Silent	SNP	ENST00000367058.3	37	CCDS1478.1																																																																																			.		0.433	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
CREBBP	1387	ucsc.edu;bcgsc.ca	37	16	3801728	3801728	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:3801728T>C	ENST00000262367.5	-	20	4587	c.3778A>G	c.(3778-3780)Acg>Gcg	p.T1260A	CREBBP_ENST00000382070.3_Splice_Site_p.T1222A	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1260	Cys/His-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GGTACTTACGTCTGGGGCTGT	0.488			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.T1260A		.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	1807	0			c.A3778G						.						205.0	148.0	167.0					16																	3801728		2197	4300	6497	SO:0001630	splice_region_variant	1387	exon20			CTTACGTCTGGGG	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3779+1A>G	16.37:g.3801728T>C		53.0	0.0		38.0	4.0	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	T	16.37	3.105222	0.56291	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.85088	-1.94;-1.86	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.91057	0.7186	M	0.70595	2.14	0.80722	D	1	D;D	0.58970	0.984;0.984	D;D	0.65443	0.935;0.935	D	0.91663	0.5344	10	0.56958	D	0.05	-17.3473	15.3428	0.74311	0.0:0.0:0.0:1.0	.	1290;1260	Q4LE28;Q92793	.;CBP_HUMAN	A	1260;1290;1222	ENSP00000262367:T1260A;ENSP00000371502:T1222A	ENSP00000262367:T1260A	T	-	1	0	CREBBP	3741729	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.655000	0.83696	2.008000	0.58898	0.533000	0.62120	ACG	.		0.488	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	Missense_Mutation
CRIP3	401262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	43274043	43274043	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:43274043C>T	ENST00000274990.4	-	6	413	c.409G>A	c.(409-411)Gtg>Atg	p.V137M	ZNF318_ENST00000607252.1_5'Flank|CRIP3_ENST00000372569.3_Missense_Mutation_p.V137M			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	137	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			AATGACATCACCTTCTCAGCT	0.572																																					p.V137M		.											.	CRIP3	91	0			c.G409A						.						99.0	92.0	95.0					6																	43274043		2203	4300	6503	SO:0001583	missense	401262	exon6			ACATCACCTTCTC	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.409G>A	6.37:g.43274043C>T	ENSP00000274990:p.Val137Met	43.0	0.0		53.0	50.0	NM_206922	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Missense_Mutation	SNP	ENST00000274990.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.9|22.9	4.343643|4.343643	0.82022|0.82022	.|.	.|.	ENSG00000146215|ENSG00000146215	ENST00000416431|ENST00000372569;ENST00000451294;ENST00000274990	.|D;D;D	.|0.89050	.|-2.46;-2.46;-2.46	4.94|4.94	4.94|4.94	0.65067|0.65067	.|Zinc finger, LIM-type (5);	.|0.000000	.|0.64402	.|D	.|0.000009	D|D	0.91942|0.91942	0.7448|0.7448	M|M	0.68952|0.68952	2.095|2.095	0.54753|0.54753	D|D	0.999985|0.999985	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;0.999	D|D	0.90761|0.90761	0.4665|0.4665	5|10	.|0.34782	.|T	.|0.22	-0.8605|-0.8605	15.6476|15.6476	0.77068|0.77068	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|137;137	.|Q6Q6R5;Q6Q6R5-3	.|CRIP3_HUMAN;.	D|M	60|137;9;137	.|ENSP00000361650:V137M;ENSP00000397775:V9M;ENSP00000274990:V137M	.|ENSP00000274990:V137M	G|V	-|-	2|1	0|0	CRIP3|CRIP3	43382021|43382021	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	6.947000|6.947000	0.75959|0.75959	2.283000|2.283000	0.76528|0.76528	0.561000|0.561000	0.74099|0.74099	GGT|GTG	.		0.572	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1		
CRTC3	64784	ucsc.edu;bcgsc.ca	37	15	91185335	91185335	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr15:91185335C>A	ENST00000268184.6	+	15	1827	c.1823C>A	c.(1822-1824)cCc>cAc	p.P608H	RP11-387D10.2_ENST00000559531.1_RNA|CRTC3_ENST00000420329.2_Missense_Mutation_p.P607H			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3	608					energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)		CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			CTGCTGGACCCCTCTGTTGAA	0.493			T	MAML2	salivary gland mucoepidermoid																																p.P608H		.		Dom	yes		15	15q26.1	64784	CREB regulated transcription coactivator 3		E	.	CRTC3	393	0			c.C1823A						.						71.0	67.0	68.0					15																	91185335		2198	4298	6496	SO:0001583	missense	64784	exon15			TGGACCCCTCTGT		CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.1823C>A	15.37:g.91185335C>A	ENSP00000268184:p.Pro608His	61.0	2.0		31.0	4.0	NM_022769	Q6DK61|Q6DK62|Q8NF38|Q9H6U2	Missense_Mutation	SNP	ENST00000268184.6	37	CCDS32331.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.566818	0.86439	.	.	ENSG00000140577	ENST00000437186;ENST00000268184;ENST00000420329	T;T	0.62498	0.03;0.02	4.93	4.93	0.64822	Transducer of regulated CREB activity, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.75925	0.3916	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.78198	-0.2297	10	0.87932	D	0	-26.3479	15.6788	0.77352	0.0:1.0:0.0:0.0	.	608;607	Q6UUV7;Q6UUV7-3	CRTC3_HUMAN;.	H	571;608;607	ENSP00000268184:P608H;ENSP00000416573:P607H	ENSP00000268184:P608H	P	+	2	0	CRTC3	88986339	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.901000	0.75693	2.572000	0.86782	0.655000	0.94253	CCC	.		0.493	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417716.2	NM_022769	
CSMD1	64478	ucsc.edu;bcgsc.ca	37	8	2999990	2999990	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr8:2999990G>T	ENST00000520002.1	-	42	6796	c.6241C>A	c.(6241-6243)Caa>Aaa	p.Q2081K	CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000539096.1_Missense_Mutation_p.Q2080K|CSMD1_ENST00000537824.1_Missense_Mutation_p.Q2080K|CSMD1_ENST00000602723.1_Missense_Mutation_p.Q2081K|CSMD1_ENST00000400186.3_Missense_Mutation_p.Q2081K|CSMD1_ENST00000542608.1_Missense_Mutation_p.Q2080K|CSMD1_ENST00000602557.1_Missense_Mutation_p.Q2081K			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2081	CUB 12. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCCATACCTTGGTAAGCAAGT	0.428																																					p.Q2080K		.											.	CSMD1	86	0			c.C6238A						.						55.0	58.0	57.0					8																	2999990		1943	4154	6097	SO:0001583	missense	64478	exon41			TACCTTGGTAAGC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6241C>A	8.37:g.2999990G>T	ENSP00000430733:p.Gln2081Lys	100.0	0.0		37.0	5.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.6|21.6	4.179111|4.179111	0.78564|0.78564	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.|T;T;T;T;T	.|0.51325	.|0.71;0.71;0.71;0.71;1.59	5.24|5.24	5.24|5.24	0.73138|0.73138	.|CUB (4);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.65790|0.65790	0.2725|0.2725	L|L	0.58925|0.58925	1.835|1.835	0.53688|0.53688	D|D	0.999977|0.999977	.|P;P;D	.|0.61080	.|0.891;0.867;0.989	.|P;B;D	.|0.77004	.|0.877;0.406;0.989	T|T	0.60378|0.60378	-0.7275|-0.7275	5|10	.|0.30078	.|T	.|0.28	.|.	19.2056|19.2056	0.93729|0.93729	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|2081;2081;2080	.|E5RIG2;Q96PZ7;F5H2I8	.|.;CSMD1_HUMAN;.	Q|K	1560|2081;2081;1942;2080;2080;2080	.|ENSP00000383047:Q2081K;ENSP00000430733:Q2081K;ENSP00000441462:Q2080K;ENSP00000446243:Q2080K;ENSP00000441675:Q2080K	.|ENSP00000320445:Q1942K	P|Q	-|-	2|1	0|0	CSMD1|CSMD1	2987397|2987397	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.745000|0.745000	0.42441|0.42441	7.604000|7.604000	0.82830|0.82830	2.605000|2.605000	0.88082|0.88082	0.591000|0.591000	0.81541|0.81541	CCA|CAA	.		0.428	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CTDSP2	10106	ucsc.edu;bcgsc.ca	37	12	58221372	58221372	+	Splice_Site	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:58221372G>A	ENST00000398073.2	-	3	518	c.215C>T	c.(214-216)tCg>tTg	p.S72L	CTDSP2_ENST00000547701.1_5'UTR|CTDSP2_ENST00000548823.1_Intron|MIR26A2_ENST00000385054.1_RNA	NM_005730.3	NP_005721.3	O14595	CTDS2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2	72					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein dephosphorylation (GO:0006470)	nucleoplasm (GO:0005654)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(1)|prostate(2)	7	all_neural(12;0.00559)|Glioma(12;0.0143)|Melanoma(17;0.122)					GAGCAGATCCGACTGAGGAAG	0.557																																					p.S72L		.											.	CTDSP2	514	0			c.C215T						.						77.0	74.0	75.0					12																	58221372		2043	4196	6239	SO:0001630	splice_region_variant	10106	exon3			AGATCCGACTGAG	AF000152	CCDS41801.1	12q14.1	2012-06-14			ENSG00000175215	ENSG00000175215		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	17077	protein-coding gene	gene with protein product	"""conserved gene amplified in osteosarcoma"", ""nuclear LIM interactor-interacting factor 2"", ""NLI-interacting factor 2"", ""small CTD phosphatase 2"""	608711				9315096, 12721286	Standard	XM_005268556		Approved	OS4, SCP2, PSR2	uc001sqm.3	O14595	OTTHUMG00000170483	ENST00000398073.2:c.214-1C>T	12.37:g.58221372G>A		51.0	0.0		42.0	4.0	NM_005730	A8K5H4|Q53ZR2|Q6NZY3|Q9UEX1	Missense_Mutation	SNP	ENST00000398073.2	37	CCDS41801.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.861587	0.51482	.	.	ENSG00000175215	ENST00000398073	T	0.17528	2.27	4.35	4.35	0.52113	.	0.291610	0.28595	N	0.014781	T	0.13243	0.0321	N	0.21448	0.665	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	T	0.06789	-1.0807	10	0.34782	T	0.22	-5.1244	16.1276	0.81406	0.0:0.0:1.0:0.0	.	72	O14595	CTDS2_HUMAN	L	72	ENSP00000381148:S72L	ENSP00000381148:S72L	S	-	2	0	CTDSP2	56507639	1.000000	0.71417	1.000000	0.80357	0.172000	0.22775	5.751000	0.68720	2.409000	0.81822	0.467000	0.42956	TCG	.		0.557	CTDSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409353.1	NM_005730	Missense_Mutation
CTNNB1	1499	broad.mit.edu;bcgsc.ca	37	3	41266097	41266097	+	Missense_Mutation	SNP	G	G	A	rs28931588|rs121913416|rs121913417		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:41266097G>A	ENST00000349496.5	+	3	374	c.94G>A	c.(94-96)Gac>Aac	p.D32N	CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32N|CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32N|CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32N|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25N	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32Y(128)|p.D32N(82)|p.A5_A80del(53)|p.D32H(40)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.Q28fs*20(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.D32fs*9(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GTCTTACCTGGACTCTGGAAT	0.478	D32N(KE39_STOMACH)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32N	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0	CTNNB1	24361	397	Substitution - Missense(250)|Deletion - In frame(120)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Complex - frameshift(1)	liver(155)|central_nervous_system(55)|endometrium(40)|stomach(36)|pancreas(28)|large_intestine(22)|pituitary(22)|skin(11)|ovary(9)|soft_tissue(4)|prostate(4)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|bone(2)|adrenal_gland(1)|biliary_tract(1)|urinary_tract(1)|lung(1)|NS(1)	c.G94A						.						92.0	77.0	82.0					3																	41266097		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TACCTGGACTCTG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.94G>A	3.37:g.41266097G>A	ENSP00000344456:p.Asp32Asn	144.0	0.0		155.0	8.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	G	30	5.054970	0.93793	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.71567	0.3355	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.73824	-0.3861	10	0.87932	D	0	0.3843	19.9596	0.97236	0.0:0.0:1.0:0.0	.	32	P35222	CTNB1_HUMAN	N	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25N;ENSP00000385604:D32N;ENSP00000412219:D32N;ENSP00000379486:D32N;ENSP00000344456:D32N;ENSP00000411226:D25N;ENSP00000379488:D32N;ENSP00000409302:D32N;ENSP00000401599:D32N	ENSP00000344456:D32N	D	+	1	0	CTNNB1	41241101	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.726000	0.93360	0.655000	0.94253	GAC	G|1.000;T|0.000		0.478	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTTNBP2	83992	ucsc.edu;bcgsc.ca	37	7	117451007	117451007	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:117451007C>T	ENST00000160373.3	-	3	317	c.226G>A	c.(226-228)Ggg>Agg	p.G76R		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	76					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TTAAATCTCCCATACCGTTCC	0.408																																					p.G76R		.											.	CTTNBP2	94	0			c.G226A						.						82.0	80.0	81.0					7																	117451007		2203	4300	6503	SO:0001583	missense	83992	exon3			ATCTCCCATACCG		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.226G>A	7.37:g.117451007C>T	ENSP00000160373:p.Gly76Arg	53.0	0.0		45.0	4.0	NM_033427	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	C	33	5.254405	0.95336	.	.	ENSG00000077063	ENST00000160373;ENST00000434890;ENST00000454375;ENST00000412853	T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78	5.77	5.77	0.91146	Cortactin-binding protein-2, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87525	0.6199	M	0.81682	2.555	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86011	0.1501	10	0.44086	T	0.13	0.2142	20.3627	0.98863	0.0:1.0:0.0:0.0	.	76	Q8WZ74	CTTB2_HUMAN	R	76;34;34;34	ENSP00000160373:G76R;ENSP00000396014:G34R;ENSP00000405831:G34R;ENSP00000393373:G34R	ENSP00000160373:G76R	G	-	1	0	CTTNBP2	117238243	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.676000	0.68131	2.885000	0.99019	0.655000	0.94253	GGG	.		0.408	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
CXorf58	254158	ucsc.edu;bcgsc.ca	37	X	23953505	23953505	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chrX:23953505A>G	ENST00000379211.3	+	7	1297	c.748A>G	c.(748-750)Atc>Gtc	p.I250V		NM_001169574.1|NM_152761.2	NP_001163045.1|NP_689974.2	Q96LI9	CX058_HUMAN	chromosome X open reading frame 58	250										breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)	14						AACGCAAGAGATCCATAAGCA	0.388																																					p.I250V		.											.	CXorf58	130	0			c.A748G						.						72.0	60.0	64.0					X																	23953505		2203	4300	6503	SO:0001583	missense	254158	exon7			CAAGAGATCCATA	AK058173	CCDS14209.1	Xp22.11	2012-11-28			ENSG00000165182	ENSG00000165182			26356	protein-coding gene	gene with protein product							Standard	NM_152761		Approved	FLJ25444	uc004daz.1	Q96LI9	OTTHUMG00000021258	ENST00000379211.3:c.748A>G	X.37:g.23953505A>G	ENSP00000368511:p.Ile250Val	32.0	0.0		37.0	4.0	NM_152761		Missense_Mutation	SNP	ENST00000379211.3	37	CCDS14209.1	.	.	.	.	.	.	.	.	.	.	a	1.818	-0.473012	0.04445	.	.	ENSG00000165182	ENST00000379211	T	0.33438	1.41	5.84	5.84	0.93424	.	0.278296	0.36167	N	0.002742	T	0.20047	0.0482	L	0.38175	1.15	0.22017	N	0.999413	B;B	0.12013	0.005;0.005	B;B	0.09377	0.004;0.004	T	0.22173	-1.0224	10	0.16420	T	0.52	-6.9374	5.4966	0.16805	0.7379:0.1739:0.0882:0.0	.	250;250	B7ZLS7;Q96LI9	.;CX058_HUMAN	V	250	ENSP00000368511:I250V	ENSP00000368511:I250V	I	+	1	0	CXorf58	23863426	1.000000	0.71417	1.000000	0.80357	0.033000	0.12548	1.401000	0.34589	1.971000	0.57363	0.378000	0.23410	ATC	.		0.388	CXorf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056071.1	NM_152761	
CYP11B1	1584	ucsc.edu;bcgsc.ca	37	8	143958298	143958298	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr8:143958298C>T	ENST00000292427.4	-	4	631	c.599G>A	c.(598-600)aGc>aAc	p.S200N	CYP11B1_ENST00000377675.3_Missense_Mutation_p.S271N|CYP11B1_ENST00000517471.1_Missense_Mutation_p.S200N	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	200					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	AGCCAAGTTGCTGGCTGCGGG	0.642									Familial Hyperaldosteronism type I																												p.S200N		.											.	CYP11B1	94	0			c.G599A						.						37.0	38.0	38.0					8																	143958298		2203	4300	6503	SO:0001583	missense	1584	exon4	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	AAGTTGCTGGCTG	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.599G>A	8.37:g.143958298C>T	ENSP00000292427:p.Ser200Asn	45.0	0.0		44.0	4.0	NM_000497	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	.	21.3	4.127917	0.77549	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.69306	-0.39;-0.39;-0.39	4.3	4.3	0.51218	.	0.189241	0.37437	N	0.002100	T	0.82051	0.4953	M	0.83953	2.67	0.43714	D	0.996183	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.81914	0.995;0.995;0.982	D	0.85003	0.0901	10	0.62326	D	0.03	.	14.6015	0.68445	0.0:1.0:0.0:0.0	.	271;200;200	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	N	200;200;271	ENSP00000292427:S200N;ENSP00000428043:S200N;ENSP00000366903:S271N	ENSP00000292427:S200N	S	-	2	0	CYP11B1	143955300	0.001000	0.12720	0.973000	0.42090	0.298000	0.27526	0.573000	0.23699	2.086000	0.62901	0.650000	0.86243	AGC	.		0.642	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
RPP25L	138716	ucsc.edu;bcgsc.ca	37	9	34614117	34614117	+	5'Flank	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:34614117G>A	ENST00000297613.4	-	0	0				DCTN3_ENST00000477738.2_Intron|DCTN3_ENST00000378916.4_Intron|DCTN3_ENST00000447983.2_Intron|DCTN3_ENST00000259632.7_Intron|RPP25L_ENST00000378959.4_5'Flank|DCTN3_ENST00000479399.1_5'UTR|DCTN3_ENST00000341694.2_Silent_p.L164L	NM_148179.2	NP_680545.1	Q8N5L8	RP25L_HUMAN	ribonuclease P/MRP 25kDa subunit-like							nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										CCAAAGTGTAGCACAGAAAGG	0.502																																					p.L164L		.											.	DCTN3	90	0			c.C490T						.						102.0	96.0	98.0					9																	34614117		2203	4300	6503	SO:0001631	upstream_gene_variant	11258	exon6			AGTGTAGCACAGA	BC032136	CCDS6559.1	9p11.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164967	ENSG00000164967			19909	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 23"""	C9orf23		16998185	Standard	NM_148178		Approved	bA296L22.5, MGC29635	uc003zuv.3	Q8N5L8	OTTHUMG00000000443		9.37:g.34614117G>A	Exception_encountered	34.0	0.0		31.0	4.0	NM_024348	D3DRM5	Silent	SNP	ENST00000297613.4	37	CCDS6559.1																																																																																			.		0.502	RPP25L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001130.1	NM_148179	
DCTN6	10671	ucsc.edu;bcgsc.ca	37	8	30038060	30038060	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr8:30038060A>G	ENST00000221114.3	+	6	475	c.388A>G	c.(388-390)Aac>Gac	p.N130D	DCTN6_ENST00000520829.1_Missense_Mutation_p.N130D|RP11-51J9.4_ENST00000523733.1_RNA	NM_006571.3	NP_006562.1	O00399	DCTN6_HUMAN	dynactin 6	130					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|mitotic spindle organization (GO:0007052)	centrosome (GO:0005813)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|kinetochore (GO:0000776)				endometrium(1)|lung(1)|ovary(1)|prostate(1)	4				KIRC - Kidney renal clear cell carcinoma(542;0.099)|Kidney(114;0.119)		GGCTTGTTGCAACCTAAATAC	0.438																																					p.N130D		.											.	DCTN6	91	0			c.A388G						.						152.0	125.0	134.0					8																	30038060		2203	4300	6503	SO:0001583	missense	10671	exon6			TGTTGCAACCTAA	D84145	CCDS6076.1	8p12-p11	2003-03-20			ENSG00000104671	ENSG00000104671			16964	protein-coding gene	gene with protein product		612963				9168138	Standard	NM_006571		Approved	WS-3	uc003xhy.3	O00399	OTTHUMG00000163828	ENST00000221114.3:c.388A>G	8.37:g.30038060A>G	ENSP00000221114:p.Asn130Asp	132.0	1.0		46.0	4.0	NM_006571	B2RAC1	Missense_Mutation	SNP	ENST00000221114.3	37	CCDS6076.1	.	.	.	.	.	.	.	.	.	.	A	13.37	2.217996	0.39201	.	.	ENSG00000104671	ENST00000221114;ENST00000520829	T;T	0.76448	-1.02;-1.02	5.33	5.33	0.75918	Trimeric LpxA-like (1);	0.494993	0.24518	N	0.037826	T	0.55178	0.1904	N	0.08118	0	0.27301	N	0.957583	B	0.02656	0.0	B	0.06405	0.002	T	0.40059	-0.9583	10	0.12766	T	0.61	-13.0875	9.4823	0.38908	0.8219:0.1781:0.0:0.0	.	130	O00399	DCTN6_HUMAN	D	130	ENSP00000221114:N130D;ENSP00000431017:N130D	ENSP00000221114:N130D	N	+	1	0	DCTN6	30157602	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.359000	0.52292	2.015000	0.59207	0.383000	0.25322	AAC	.		0.438	DCTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375815.2	NM_006571	
DHX34	9704	ucsc.edu;bcgsc.ca	37	19	47856347	47856347	+	Missense_Mutation	SNP	C	C	A	rs184418357		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:47856347C>A	ENST00000328771.4	+	2	409	c.60C>A	c.(58-60)agC>agA	p.S20R		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	20					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		GGGCTCCCAGCGAGGAAGAGG	0.547																																					p.S20R		.											.	DHX34	231	0			c.C60A						.						39.0	37.0	38.0					19																	47856347		2203	4300	6503	SO:0001583	missense	9704	exon2			TCCCAGCGAGGAA	D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.60C>A	19.37:g.47856347C>A	ENSP00000331907:p.Ser20Arg	45.0	0.0		36.0	4.0	NM_014681	B4DMY8	Missense_Mutation	SNP	ENST00000328771.4	37	CCDS12700.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.190368	0.00302	.	.	ENSG00000134815	ENST00000328771;ENST00000257252	T	0.02525	4.26	5.52	-7.71	0.01254	.	2.258140	0.01449	N	0.015384	T	0.01320	0.0043	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.47018	-0.9149	10	0.02654	T	1	4.1259	6.2974	0.21093	0.095:0.2118:0.5452:0.148	.	20;20	Q14147;B4E3G3	DHX34_HUMAN;.	R	20	ENSP00000331907:S20R	ENSP00000257252:S20R	S	+	3	2	DHX34	52548187	0.000000	0.05858	0.010000	0.14722	0.010000	0.07245	-0.852000	0.04308	-0.927000	0.03766	-1.601000	0.00813	AGC	C|0.999;T|0.000		0.547	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681	
DHX9	1660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	182852382	182852382	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:182852382A>T	ENST00000367549.3	+	25	3133	c.3023A>T	c.(3022-3024)gAa>gTa	p.E1008V	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	1008					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						TATCATAAGGAAAAGAGGAAG	0.413																																					p.E1008V	Colon(69;210 1162 3697 13559 39565)	.											.	DHX9	92	0			c.A3023T						.						155.0	132.0	139.0					1																	182852382		1900	4120	6020	SO:0001583	missense	1660	exon25			ATAAGGAAAAGAG	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.3023A>T	1.37:g.182852382A>T	ENSP00000356520:p.Glu1008Val	129.0	0.0		156.0	83.0	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.848970	0.91277	.	.	ENSG00000135829	ENST00000367549	T	0.04275	3.66	5.39	5.39	0.77823	Domain of unknown function DUF1605 (1);	0.000000	0.85682	D	0.000000	T	0.18964	0.0455	M	0.85197	2.74	0.80722	D	1	P;P	0.47604	0.898;0.885	P;P	0.53722	0.733;0.665	T	0.00728	-1.1591	10	0.48119	T	0.1	.	15.4176	0.74983	1.0:0.0:0.0:0.0	.	287;1008	B3KU66;Q08211	.;DHX9_HUMAN	V	1008	ENSP00000356520:E1008V	ENSP00000356520:E1008V	E	+	2	0	DHX9	181119005	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.699000	0.91316	2.027000	0.59764	0.533000	0.62120	GAA	.		0.413	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
DMXL1	1657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	118485268	118485268	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:118485268C>T	ENST00000311085.8	+	18	3826	c.3746C>T	c.(3745-3747)cCt>cTt	p.P1249L	DMXL1_ENST00000539542.1_Missense_Mutation_p.P1249L	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1249										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		AAACAAGAACCTGTTATAACA	0.423																																					p.P1249L		.											.	DMXL1	92	0			c.C3746T						.						85.0	79.0	81.0					5																	118485268		2202	4300	6502	SO:0001583	missense	1657	exon18			AAGAACCTGTTAT	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.3746C>T	5.37:g.118485268C>T	ENSP00000309690:p.Pro1249Leu	56.0	0.0		56.0	35.0	NM_005509		Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	C	1.114	-0.657206	0.03480	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.09350	2.99;2.99	5.39	3.61	0.41365	.	0.469142	0.25487	N	0.030325	T	0.07683	0.0193	N	0.25647	0.755	0.34149	D	0.667335	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.17592	-1.0364	10	0.27785	T	0.31	-4.4666	9.6826	0.40078	0.0:0.7593:0.0:0.2407	.	1249;1249	F5H269;Q9Y485	.;DMXL1_HUMAN	L	1249	ENSP00000309690:P1249L;ENSP00000439479:P1249L	ENSP00000309690:P1249L	P	+	2	0	DMXL1	118513167	0.001000	0.12720	0.922000	0.36590	0.995000	0.86356	1.124000	0.31320	0.773000	0.33404	0.655000	0.94253	CCT	.		0.423	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
DNAH10	196385	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	124257438	124257438	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:124257438C>T	ENST00000409039.3	+	4	296	c.271C>T	c.(271-273)Ccc>Tcc	p.P91S		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	91	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TACCCCTCTTCCCGAGGAGTT	0.463																																					p.P91S		.											.	DNAH10	95	0			c.C271T						.						174.0	169.0	170.0					12																	124257438		1943	4158	6101	SO:0001583	missense	196385	exon4			CCTCTTCCCGAGG	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.271C>T	12.37:g.124257438C>T	ENSP00000386770:p.Pro91Ser	53.0	0.0		59.0	32.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	12.33	1.905933	0.33628	.	.	ENSG00000197653	ENST00000409039	T	0.23552	1.9	5.93	4.09	0.47781	.	.	.	.	.	T	0.16727	0.0402	N	0.24115	0.695	0.09310	N	1	B	0.10296	0.003	B	0.12837	0.008	T	0.25082	-1.0142	9	0.26408	T	0.33	.	8.4702	0.32980	0.0:0.7595:0.0:0.2405	.	91	Q8IVF4	DYH10_HUMAN	S	91	ENSP00000386770:P91S	ENSP00000386770:P91S	P	+	1	0	DNAH10	122823391	0.198000	0.23374	0.042000	0.18584	0.003000	0.03518	1.018000	0.30002	0.820000	0.34516	0.655000	0.94253	CCC	.		0.463	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
DNAH10	196385	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	124257449	124257449	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:124257449C>T	ENST00000409039.3	+	4	307	c.282C>T	c.(280-282)ttC>ttT	p.F94F		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	94	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CCGAGGAGTTCCTGGACCAAA	0.468																																					p.F94F		.											.	DNAH10	95	0			c.C282T						.						165.0	162.0	163.0					12																	124257449		1950	4163	6113	SO:0001819	synonymous_variant	196385	exon4			GGAGTTCCTGGAC	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.282C>T	12.37:g.124257449C>T		58.0	0.0		58.0	33.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	37	CCDS9255.2																																																																																			.		0.468	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
DNAH6	1768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	84852030	84852030	+	Missense_Mutation	SNP	G	G	T	rs368034415		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:84852030G>T	ENST00000237449.6	+	28	4366	c.4358G>T	c.(4357-4359)cGc>cTc	p.R1453L	DNAH6_ENST00000389394.3_Missense_Mutation_p.R1453L|DNAH6_ENST00000398278.2_Missense_Mutation_p.R1453L			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1453	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						CTTCAGGATCGCTGCTATCTT	0.468																																					p.R1453L		.											.	DNAH6	69	0			c.G4358T						.						43.0	39.0	40.0					2																	84852030		692	1591	2283	SO:0001583	missense	1768	exon29			AGGATCGCTGCTA	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.4358G>T	2.37:g.84852030G>T	ENSP00000237449:p.Arg1453Leu	129.0	0.0		86.0	34.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.888389	0.91814	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.14640	2.49;2.49;2.49	5.73	5.73	0.89815	.	.	.	.	.	T	0.49287	0.1548	M	0.92219	3.285	0.52501	D	0.999957	D	0.89917	1.0	D	0.74023	0.982	T	0.60347	-0.7281	9	0.87932	D	0	.	18.6778	0.91535	0.0:0.0:1.0:0.0	.	1453	Q9C0G6	DYH6_HUMAN	L	1453	ENSP00000374045:R1453L;ENSP00000381326:R1453L;ENSP00000237449:R1453L	ENSP00000237449:R1453L	R	+	2	0	DNAH6	84705541	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.483000	0.81158	2.693000	0.91896	0.655000	0.94253	CGC	.		0.468	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DNAH6	1768	broad.mit.edu;bcgsc.ca	37	2	84896485	84896485	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:84896485A>T	ENST00000237449.6	+	37	6165	c.6157A>T	c.(6157-6159)Atc>Ttc	p.I2053F	DNAH6_ENST00000389394.3_Missense_Mutation_p.I2053F|DNAH6_ENST00000602588.1_Missense_Mutation_p.I74F|DNAH6_ENST00000398278.2_Missense_Mutation_p.I2053F			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2053					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						CTGGGAACGAATCATACCTAC	0.413																																					p.I2053F		.											.	DNAH6	69	0			c.A6157T						.						149.0	125.0	132.0					2																	84896485		692	1591	2283	SO:0001583	missense	1768	exon38			GAACGAATCATAC	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.6157A>T	2.37:g.84896485A>T	ENSP00000237449:p.Ile2053Phe	141.0	0.0		106.0	5.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.216745	0.79352	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.25085	1.82;1.94;1.82	5.25	4.09	0.47781	.	.	.	.	.	T	0.52484	0.1737	M	0.88842	2.985	0.53005	D	0.999961	D;D	0.67145	0.984;0.996	P;D	0.69654	0.851;0.965	T	0.55736	-0.8094	9	0.44086	T	0.13	.	10.4054	0.44254	0.9207:0.0:0.0793:0.0	.	2053;2053	Q9C0G6;Q9C0G6-4	DYH6_HUMAN;.	F	2053	ENSP00000374045:I2053F;ENSP00000381326:I2053F;ENSP00000237449:I2053F	ENSP00000237449:I2053F	I	+	1	0	DNAH6	84749996	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.325000	0.59234	0.926000	0.37118	0.523000	0.50628	ATC	.		0.413	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DNAH9	1770	ucsc.edu;bcgsc.ca	37	17	11806049	11806049	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr17:11806049T>C	ENST00000262442.4	+	60	11488	c.11420T>C	c.(11419-11421)aTg>aCg	p.M3807T	DNAH9_ENST00000608377.1_Missense_Mutation_p.M119T|DNAH9_ENST00000454412.2_Missense_Mutation_p.M3807T|DNAH9_ENST00000396001.2_3'UTR	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3807					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CTTTCATCAATGGAAGAATTC	0.453																																					p.M3807T		.											.	DNAH9	168	0			c.T11420C						.						71.0	79.0	76.0					17																	11806049		2203	4300	6503	SO:0001583	missense	1770	exon60			CATCAATGGAAGA	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.11420T>C	17.37:g.11806049T>C	ENSP00000262442:p.Met3807Thr	47.0	0.0		36.0	4.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	T	14.08	2.428982	0.43122	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703;ENST00000396001;ENST00000361801	T;T;T	0.08807	3.05;3.05;3.05	4.83	4.83	0.62350	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.13500	0.0327	L	0.46157	1.445	0.80722	D	1	B;B	0.28055	0.199;0.108	B;B	0.39465	0.093;0.3	T	0.06862	-1.0803	10	0.44086	T	0.13	.	14.585	0.68317	0.0:0.0:0.0:1.0	.	160;3807	B7Z7H0;Q9NYC9	.;DYH9_HUMAN	T	3807;3807;2389;119;160	ENSP00000262442:M3807T;ENSP00000414874:M3807T;ENSP00000379323:M119T	ENSP00000262442:M3807T	M	+	2	0	DNAH9	11746774	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	5.568000	0.67385	2.021000	0.59480	0.459000	0.35465	ATG	.		0.453	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
DNAJC18	202052	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	138764241	138764241	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:138764241G>T	ENST00000302060.5	-	3	439	c.359C>A	c.(358-360)aCa>aAa	p.T120K		NM_152686.3	NP_689899.1	Q9H819	DJC18_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 18	120	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GAAAGCATCTGTTGCTCCAGG	0.443																																					p.T120K		.											.	DNAJC18	227	0			c.C359A						.						260.0	262.0	261.0					5																	138764241		2203	4300	6503	SO:0001583	missense	202052	exon3			GCATCTGTTGCTC	AK024054	CCDS4214.1	5q31.2	2011-09-02		2005-08-09	ENSG00000170464	ENSG00000170464		"""Heat shock proteins / DNAJ (HSP40)"""	28429	protein-coding gene	gene with protein product							Standard	NM_152686		Approved	MGC29463	uc003len.3	Q9H819	OTTHUMG00000129225	ENST00000302060.5:c.359C>A	5.37:g.138764241G>T	ENSP00000302843:p.Thr120Lys	60.0	0.0		81.0	26.0	NM_152686		Missense_Mutation	SNP	ENST00000302060.5	37	CCDS4214.1	.	.	.	.	.	.	.	.	.	.	G	32	5.124859	0.94429	.	.	ENSG00000170464	ENST00000302060;ENST00000515581;ENST00000515277	T;T;T	0.72505	-0.66;-0.66;-0.66	6.04	6.04	0.98038	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	T	0.76955	0.4060	L	0.31804	0.96	0.80722	D	1	D;D	0.67145	0.996;0.993	D;P	0.70487	0.969;0.883	T	0.73219	-0.4052	10	0.32370	T	0.25	-12.0825	19.1586	0.93522	0.0:0.0:1.0:0.0	.	120;120	D6RB03;Q9H819	.;DJC18_HUMAN	K	120	ENSP00000302843:T120K;ENSP00000424572:T120K;ENSP00000425523:T120K	ENSP00000302843:T120K	T	-	2	0	DNAJC18	138792140	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.777000	0.99008	2.873000	0.98535	0.563000	0.77884	ACA	.		0.443	DNAJC18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374191.1	NM_152686	
DSG4	147409	ucsc.edu;bcgsc.ca	37	18	28991246	28991246	+	Silent	SNP	G	G	A	rs143025218		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:28991246G>A	ENST00000308128.4	+	15	2325	c.2190G>A	c.(2188-2190)tcG>tcA	p.S730S	RP11-534N16.1_ENST00000581856.1_RNA|DSG4_ENST00000359747.4_Silent_p.S749S|RP11-534N16.1_ENST00000578477.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	730					anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GAGGTGTATCGGGAGTGGAGC	0.607																																					p.S749S		.											.	DSG4	177	0			c.G2247A						.						88.0	81.0	83.0					18																	28991246		2203	4300	6503	SO:0001819	synonymous_variant	147409	exon14			TGTATCGGGAGTG	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.2190G>A	18.37:g.28991246G>A		54.0	0.0		50.0	5.0	NM_001134453	A2RUI1|Q6Y9L9|Q8IXV4	Silent	SNP	ENST00000308128.4	37	CCDS11897.1																																																																																			A|0.000;C|0.000;G|1.000		0.607	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986	
DSEL	92126	ucsc.edu;bcgsc.ca	37	18	65181701	65181701	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:65181701C>A	ENST00000310045.7	-	2	1648	c.175G>T	c.(175-177)Gat>Tat	p.D59Y	CTD-2541J13.2_ENST00000583493.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	49					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				GGTCTGAAATCTTGCACTTTC	0.373																																					p.D59Y		.											.	DSEL	157	0			c.G175T						.						119.0	111.0	114.0					18																	65181701		2203	4300	6503	SO:0001583	missense	92126	exon2			TGAAATCTTGCAC	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.175G>T	18.37:g.65181701C>A	ENSP00000310565:p.Asp59Tyr	54.0	0.0		38.0	5.0	NM_032160	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	37	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.712507	0.68730	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.25414	1.8	4.54	4.54	0.55810	.	0.542019	0.16716	U	0.202459	T	0.22820	0.0551	L	0.44542	1.39	0.30099	N	0.807614	P	0.44090	0.826	B	0.37943	0.261	T	0.16719	-1.0393	10	0.62326	D	0.03	-9.8959	13.1699	0.59591	0.0:0.9192:0.0:0.0808	.	49	Q8IZU8	DSEL_HUMAN	Y	59;49	ENSP00000310565:D59Y	ENSP00000310565:D59Y	D	-	1	0	DSEL	63332681	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	2.528000	0.45624	2.261000	0.74972	0.561000	0.74099	GAT	.		0.373	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
DYNC1H1	1778	ucsc.edu;bcgsc.ca	37	14	102469021	102469021	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr14:102469021G>A	ENST00000360184.4	+	22	4854	c.4690G>A	c.(4690-4692)Gaa>Aaa	p.E1564K		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1564	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GCTGCCAGTGGAAACCCAGCG	0.512																																					p.E1564K		.											.	DYNC1H1	98	0			c.G4690A						.						120.0	116.0	117.0					14																	102469021		2203	4300	6503	SO:0001583	missense	1778	exon22			CCAGTGGAAACCC	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.4690G>A	14.37:g.102469021G>A	ENSP00000348965:p.Glu1564Lys	111.0	0.0		43.0	4.0	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	36	5.784136	0.96937	.	.	ENSG00000197102	ENST00000360184	T	0.68331	-0.32	5.76	5.76	0.90799	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	D	0.89856	0.6836	H	0.98646	4.29	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93236	0.6622	10	0.87932	D	0	.	19.9813	0.97326	0.0:0.0:1.0:0.0	.	1564	Q14204	DYHC1_HUMAN	K	1564	ENSP00000348965:E1564K	ENSP00000348965:E1564K	E	+	1	0	DYNC1H1	101538774	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.720000	0.98763	2.726000	0.93360	0.655000	0.94253	GAA	.		0.512	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
DYSF	8291	ucsc.edu;bcgsc.ca;mdanderson.org	37	2	71778194	71778194	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:71778194C>A	ENST00000258104.3	+	18	1823	c.1546C>A	c.(1546-1548)Ccc>Acc	p.P516T	DYSF_ENST00000409366.1_Missense_Mutation_p.P517T|DYSF_ENST00000394120.2_Missense_Mutation_p.P517T|DYSF_ENST00000409651.1_Missense_Mutation_p.P548T|DYSF_ENST00000410041.1_Missense_Mutation_p.P534T|DYSF_ENST00000413539.2_Missense_Mutation_p.P547T|DYSF_ENST00000429174.2_Missense_Mutation_p.P516T|DYSF_ENST00000409744.1_Missense_Mutation_p.P503T|DYSF_ENST00000409582.3_Missense_Mutation_p.P533T|DYSF_ENST00000409762.1_Missense_Mutation_p.P533T|DYSF_ENST00000410020.3_Missense_Mutation_p.P534T	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	516					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GGGCTTCCTCCCCACTTTTGG	0.587																																					p.P548T		.											.	DYSF	158	0			c.C1642A						.						113.0	109.0	110.0					2																	71778194		2203	4300	6503	SO:0001583	missense	8291	exon19			TTCCTCCCCACTT	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.1546C>A	2.37:g.71778194C>A	ENSP00000258104:p.Pro516Thr	92.0	2.0		79.0	24.0	NM_001130982	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.699363	0.88830	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.92199	-2.99;-2.26;-2.26;-2.94;-2.93;-2.98;-2.91;-2.22;-2.92;-2.26;-2.25	5.34	5.34	0.76211	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.96750	0.8939	M	0.89534	3.04	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;0.999;1.0;1.0;1.0;0.999	D	0.97483	1.0048	10	0.87932	D	0	-25.1975	16.5394	0.84381	0.0:1.0:0.0:0.0	.	548;534;517;503;534;503;533;502;547;533;516;502;517;516	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	T	547;533;533;516;516;548;517;503;517;534;534	ENSP00000407046:P547T;ENSP00000387137:P533T;ENSP00000386547:P533T;ENSP00000398305:P516T;ENSP00000258104:P516T;ENSP00000386683:P548T;ENSP00000377678:P517T;ENSP00000386285:P503T;ENSP00000386512:P517T;ENSP00000386881:P534T;ENSP00000386617:P534T	ENSP00000258104:P516T	P	+	1	0	DYSF	71631702	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.797000	0.85911	2.476000	0.83614	0.655000	0.94253	CCC	.		0.587	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
EDC4	23644	ucsc.edu;bcgsc.ca	37	16	67911468	67911468	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:67911468G>T	ENST00000358933.5	+	6	937	c.698G>T	c.(697-699)cGc>cTc	p.R233L	EDC4_ENST00000574770.1_3'UTR|AC040162.1_ENST00000408599.1_RNA	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	233					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		AACCACTTTCGCAGGATCATC	0.572																																					p.R233L		.											.	EDC4	92	0			c.G698T						.						82.0	85.0	84.0					16																	67911468		2198	4300	6498	SO:0001583	missense	23644	exon6			ACTTTCGCAGGAT	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.698G>T	16.37:g.67911468G>T	ENSP00000351811:p.Arg233Leu	34.0	0.0		45.0	4.0	NM_014329	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Missense_Mutation	SNP	ENST00000358933.5	37	CCDS10849.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.873222	0.91664	.	.	ENSG00000038358	ENST00000358933;ENST00000536072	T	0.06371	3.31	5.56	5.56	0.83823	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.14098	0.0341	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.987;0.999	P;D	0.79784	0.488;0.993	T	0.28554	-1.0040	10	0.10377	T	0.69	-16.1778	19.1287	0.93396	0.0:0.0:1.0:0.0	.	165;233	B7Z7V8;Q6P2E9	.;EDC4_HUMAN	L	233;165	ENSP00000351811:R233L	ENSP00000351811:R233L	R	+	2	0	EDC4	66468969	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.869000	0.99810	2.631000	0.89168	0.462000	0.41574	CGC	.		0.572	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329	
CRACR2A	84766	ucsc.edu;bcgsc.ca	37	12	3782653	3782653	+	Silent	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:3782653T>C	ENST00000252322.1	-	7	1098	c.630A>G	c.(628-630)gaA>gaG	p.E210E	EFCAB4B_ENST00000444507.1_Silent_p.E210E|EFCAB4B_ENST00000440314.2_Silent_p.E210E	NM_032680.3	NP_116069.1	Q9BSW2	EFC4B_HUMAN		210					activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			CCTCATGGGCTTCTTGGAGCT	0.488																																					p.E210E		.											.	EFCAB4B	92	0			c.A630G						.						149.0	141.0	144.0					12																	3782653		2203	4300	6503	SO:0001819	synonymous_variant	84766	exon7			ATGGGCTTCTTGG																												ENST00000252322.1:c.630A>G	12.37:g.3782653T>C		55.0	0.0		40.0	4.0	NM_001144958	B4E1X0|B9EK63	Silent	SNP	ENST00000252322.1	37	CCDS8522.1																																																																																			.		0.488	EFCAB4B-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000398673.1		
EIF4G3	8672	ucsc.edu;bcgsc.ca	37	1	21133841	21133841	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:21133841C>T	ENST00000264211.8	-	31	4923	c.4729G>A	c.(4729-4731)Gaa>Aaa	p.E1577K	EIF4G3_ENST00000537738.1_Missense_Mutation_p.E1067K|EIF4G3_ENST00000602326.1_Missense_Mutation_p.E1583K|EIF4G3_ENST00000374937.3_Missense_Mutation_p.E1583K|EIF4G3_ENST00000400422.1_Missense_Mutation_p.E1577K|EIF4G3_ENST00000374935.3_Missense_Mutation_p.E1297K|EIF4G3_ENST00000536266.1_Missense_Mutation_p.E1181K	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	1577	EIF4A-binding. {ECO:0000250}.|Necessary but not sufficient for MKNK1- binding. {ECO:0000250}.|W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		TCTTCTGCTTCCCGCAGCCAC	0.438																																					p.E1613K		.											.	EIF4G3	91	0			c.G4837A						.						178.0	180.0	179.0					1																	21133841		2203	4300	6503	SO:0001583	missense	8672	exon35			CTGCTTCCCGCAG	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.4729G>A	1.37:g.21133841C>T	ENSP00000264211:p.Glu1577Lys	72.0	0.0		46.0	4.0	NM_001198801	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	37	CCDS214.1	.	.	.	.	.	.	.	.	.	.	C	33	5.223700	0.95139	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266	D;D;D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98;-1.98;-1.98	5.72	5.72	0.89469	eIF4-gamma/eIF5/eIF2-epsilon (3);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	D	0.93077	0.7796	M	0.81112	2.525	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.988;0.985;0.999;0.972	D;D;D;D;P	0.87578	0.998;0.934;0.918;0.996;0.899	D	0.93333	0.6703	10	0.87932	D	0	-19.249	19.8722	0.96854	0.0:1.0:0.0:0.0	.	1772;1297;1181;1583;1577	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	K	1577;1773;1577;1297;1067;1583;1181	ENSP00000264211:E1577K;ENSP00000383274:E1577K;ENSP00000364071:E1297K;ENSP00000442010:E1067K;ENSP00000364073:E1583K;ENSP00000444693:E1181K	ENSP00000264211:E1577K	E	-	1	0	EIF4G3	21006428	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.792000	0.85828	2.700000	0.92200	0.585000	0.79938	GAA	.		0.438	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760	
ELL2	22936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	95226823	95226823	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:95226823C>A	ENST00000237853.4	-	10	2094	c.1745G>T	c.(1744-1746)gGc>gTc	p.G582V	ELL2_ENST00000431061.2_Missense_Mutation_p.G332V	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	582					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		CTCTTTTGAGCCTGGAGAAAG	0.428																																					p.G582V		.											.	ELL2	90	0			c.G1745T						.						198.0	195.0	196.0					5																	95226823		2203	4300	6503	SO:0001583	missense	22936	exon10			TTTGAGCCTGGAG	U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.1745G>T	5.37:g.95226823C>A	ENSP00000237853:p.Gly582Val	119.0	0.0		145.0	86.0	NM_012081	B4DNK7	Missense_Mutation	SNP	ENST00000237853.4	37	CCDS4080.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.1|28.1	4.888928|4.888928	0.91814|0.91814	.|.	.|.	ENSG00000118985|ENSG00000118985	ENST00000508757|ENST00000237853;ENST00000431061	.|T;T	.|0.26223	.|1.75;1.75	6.16|6.16	6.16|6.16	0.99307|0.99307	.|Occludin/RNA polymerase II elongation factor, ELL domain (1);	.|0.043393	.|0.85682	.|D	.|0.000000	T|T	0.62490|0.62490	0.2432|0.2432	M|M	0.90369|0.90369	3.11|3.11	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.67225|0.67225	-0.5724|-0.5724	5|10	.|0.87932	.|D	.|0	-1.8572|-1.8572	20.4549|20.4549	0.99139|0.99139	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|582	.|O00472	.|ELL2_HUMAN	S|V	100|582;332	.|ENSP00000237853:G582V;ENSP00000399704:G332V	.|ENSP00000237853:G582V	A|G	-|-	1|2	0|0	ELL2|ELL2	95252579|95252579	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.989000|0.989000	0.77384|0.77384	6.066000|6.066000	0.71185|0.71185	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GCT|GGC	.		0.428	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242846.1	NM_012081	
EPHA1	2041	ucsc.edu;bcgsc.ca	37	7	143096773	143096773	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:143096773T>C	ENST00000275815.3	-	4	892	c.806A>G	c.(805-807)gAg>gGg	p.E269G		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	269	Cys-rich.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				GCCACCTTCCTCATAGCCAGG	0.637																																					p.E269G		.											.	EPHA1	1436	0			c.A806G						.						56.0	60.0	58.0					7																	143096773		2203	4300	6503	SO:0001583	missense	2041	exon4			CCTTCCTCATAGC	M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.806A>G	7.37:g.143096773T>C	ENSP00000275815:p.Glu269Gly	43.0	1.0		43.0	4.0	NM_005232	A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	ENST00000275815.3	37	CCDS5884.1	.	.	.	.	.	.	.	.	.	.	T	16.55	3.155700	0.57259	.	.	ENSG00000146904	ENST00000275815	T	0.76839	-1.05	5.22	5.22	0.72569	Tyrosine-protein kinase, receptor class V, conserved site (1);Growth factor, receptor (1);	0.208941	0.33144	N	0.005240	T	0.79476	0.4452	M	0.86805	2.84	0.45139	D	0.998151	B	0.32302	0.363	B	0.21546	0.035	T	0.82106	-0.0621	10	0.87932	D	0	.	15.2618	0.73628	0.0:0.0:0.0:1.0	.	269	P21709	EPHA1_HUMAN	G	269	ENSP00000275815:E269G	ENSP00000275815:E269G	E	-	2	0	EPHA1	142806895	1.000000	0.71417	0.600000	0.28864	0.119000	0.20118	7.841000	0.86834	2.177000	0.69029	0.533000	0.62120	GAG	.		0.637	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342154.1		
ESRP2	80004	ucsc.edu;bcgsc.ca	37	16	68265213	68265213	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:68265213G>T	ENST00000565858.1	-	12	1695	c.1609C>A	c.(1609-1611)Cgt>Agt	p.R537S	RP11-96D1.11_ENST00000571197.1_RNA|ESRP2_ENST00000473183.2_Missense_Mutation_p.R527S	NM_024939.2	NP_079215.2	Q9H6T0	ESRP2_HUMAN	epithelial splicing regulatory protein 2	537	RRM 3.				mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	16						TTATGGCAACGCTGAGCAGCA	0.592																																					p.R527S		.											.	ESRP2	91	0			c.C1579A						.						89.0	67.0	74.0					16																	68265213		2198	4300	6498	SO:0001583	missense	80004	exon12			GGCAACGCTGAGC	AK025571	CCDS10863.1	16q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000103067	ENSG00000103067		"""RNA binding motif (RRM) containing"""	26152	protein-coding gene	gene with protein product		612960	"""RNA binding motif protein 35B"""	RBM35B		12477932	Standard	NM_024939		Approved	FLJ21918	uc002evq.1	Q9H6T0	OTTHUMG00000137557	ENST00000565858.1:c.1609C>A	16.37:g.68265213G>T	ENSP00000454554:p.Arg537Ser	83.0	0.0		49.0	4.0	NM_024939	Q8N6H8|Q8WZ15|Q9H6I4	Missense_Mutation	SNP	ENST00000565858.1	37		.	.	.	.	.	.	.	.	.	.	G	17.31	3.356476	0.61293	.	.	ENSG00000103067	ENST00000473183	T	0.07800	3.16	5.79	3.75	0.43078	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.053756	0.64402	D	0.000001	T	0.13157	0.0319	L	0.40543	1.245	0.41372	D	0.987494	P;P	0.51147	0.942;0.706	P;B	0.50405	0.64;0.296	T	0.03060	-1.1077	10	0.56958	D	0.05	-8.3715	14.2481	0.66001	0.0:0.0:0.5085:0.4915	.	537;527	Q9H6T0;Q9H6T0-2	ESRP2_HUMAN;.	S	527	ENSP00000418748:R527S	ENSP00000418748:R527S	R	-	1	0	ESRP2	66822714	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	3.219000	0.51200	1.438000	0.47492	0.563000	0.77884	CGT	.		0.592	ESRP2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000433083.1	NM_024939	
EXOC2	55770	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	592543	592543	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:592543C>T	ENST00000230449.4	-	11	1253	c.1118G>A	c.(1117-1119)tGc>tAc	p.C373Y	EXOC2_ENST00000448181.3_Intron	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	373					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		GGCTCCAATGCATTGCCAAGC	0.468																																					p.C373Y		.											.	EXOC2	662	0			c.G1118A						.						132.0	108.0	116.0					6																	592543		2203	4300	6503	SO:0001583	missense	55770	exon11			CCAATGCATTGCC	AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.1118G>A	6.37:g.592543C>T	ENSP00000230449:p.Cys373Tyr	56.0	0.0		95.0	14.0	NM_018303	B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Missense_Mutation	SNP	ENST00000230449.4	37	CCDS34327.1	.	.	.	.	.	.	.	.	.	.	C	19.46	3.831209	0.71258	.	.	ENSG00000112685	ENST00000230449	T	0.38401	1.14	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.43277	0.1240	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	T	0.12993	-1.0526	10	0.10636	T	0.68	-15.1372	19.627	0.95680	0.0:1.0:0.0:0.0	.	373	Q96KP1	EXOC2_HUMAN	Y	373	ENSP00000230449:C373Y	ENSP00000230449:C373Y	C	-	2	0	EXOC2	537543	1.000000	0.71417	0.984000	0.44739	0.353000	0.29299	7.169000	0.77578	2.632000	0.89209	0.655000	0.94253	TGC	.		0.468	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039627.1	NM_018303	
EZR	7430	ucsc.edu;bcgsc.ca	37	6	159197498	159197498	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:159197498C>T	ENST00000367075.3	-	8	905	c.737G>A	c.(736-738)aGg>aAg	p.R246K	EZR_ENST00000392177.4_Missense_Mutation_p.R214K|EZR_ENST00000337147.7_Missense_Mutation_p.R246K	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	246	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with SCYL3.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		AGAGATGTTCCTGATTTCACT	0.383			T	ROS1	NSCLC																																p.R246K		.		Dom	yes		6	6q25.3	7430	ezrin		E	.	EZR	70	0			c.G737A						.						121.0	120.0	120.0					6																	159197498		2203	4300	6503	SO:0001583	missense	7430	exon7			ATGTTCCTGATTT	AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.737G>A	6.37:g.159197498C>T	ENSP00000356042:p.Arg246Lys	68.0	0.0		43.0	4.0	NM_003379	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Missense_Mutation	SNP	ENST00000367075.3	37	CCDS5258.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.775316	0.90108	.	.	ENSG00000092820	ENST00000337147;ENST00000367075;ENST00000392177	D;D;D	0.87650	-2.28;-2.28;-2.28	4.83	3.94	0.45596	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.85991	0.5826	L	0.37697	1.125	0.80722	D	1	P;P	0.50156	0.932;0.698	P;P	0.61722	0.893;0.659	D	0.87902	0.2691	10	0.66056	D	0.02	.	14.5406	0.67990	0.1476:0.8524:0.0:0.0	.	214;246	E7EQR4;P15311	.;EZRI_HUMAN	K	246;246;214	ENSP00000338934:R246K;ENSP00000356042:R246K;ENSP00000376016:R214K	ENSP00000338934:R246K	R	-	2	0	EZR	159117486	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.662000	0.83803	1.128000	0.42052	0.655000	0.94253	AGG	.		0.383	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042878.1	NM_003379	
FAF1	11124	ucsc.edu;bcgsc.ca	37	1	50941323	50941323	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:50941323A>G	ENST00000396153.2	-	18	2133	c.1682T>C	c.(1681-1683)cTg>cCg	p.L561P	FAF1_ENST00000545823.1_Missense_Mutation_p.L319P|FAF1_ENST00000371778.4_Missense_Mutation_p.L561P	NM_007051.2	NP_008982.1	Q9UNN5	FAF1_HUMAN	Fas (TNFRSF6) associated factor 1	561					apoptotic process (GO:0006915)|cell death (GO:0008219)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein complex assembly (GO:0031334)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of cell adhesion (GO:0030155)|regulation of protein catabolic process (GO:0042176)|regulation of protein kinase activity (GO:0045859)	CD95 death-inducing signaling complex (GO:0031265)|Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	heat shock protein binding (GO:0031072)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		CTCAGGAGGCAGGGCTTGCTC	0.562																																					p.L561P		.											.	FAF1	652	0			c.T1682C						.						36.0	36.0	36.0					1																	50941323		2203	4300	6503	SO:0001583	missense	11124	exon18			GGAGGCAGGGCTT	AF132938	CCDS554.1	1p32.3	2012-09-20			ENSG00000185104	ENSG00000185104		"""UBX domain containing"""	3578	protein-coding gene	gene with protein product	"""TNFRSF6-associated factor 1"", ""UBX domain protein 3A"""	604460				10462485	Standard	NM_007051		Approved	CGI-03, hFAF1, HFAF1s, UBXD12, UBXN3A	uc001cse.1	Q9UNN5	OTTHUMG00000007930	ENST00000396153.2:c.1682T>C	1.37:g.50941323A>G	ENSP00000379457:p.Leu561Pro	36.0	0.0		34.0	4.0	NM_007051	Q549F0|Q9UF34|Q9UNT3|Q9Y2Z3	Missense_Mutation	SNP	ENST00000396153.2	37	CCDS554.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.320984	0.81580	.	.	ENSG00000185104	ENST00000396153;ENST00000371778;ENST00000545823;ENST00000371780;ENST00000543607	.	.	.	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.78387	0.4275	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.71184	0.972;0.956	T	0.81482	-0.0913	9	0.87932	D	0	-25.4699	15.4507	0.75271	1.0:0.0:0.0:0.0	.	319;561	B4DEJ6;Q9UNN5	.;FAF1_HUMAN	P	561;561;319;401;409	.	ENSP00000360843:L561P	L	-	2	0	FAF1	50713911	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.890000	0.92477	2.045000	0.60652	0.533000	0.62120	CTG	.		0.562	FAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021807.1	NM_007051	
FAM120C	54954	ucsc.edu;bcgsc.ca	37	X	54160309	54160309	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chrX:54160309G>T	ENST00000375180.2	-	8	1843	c.1787C>A	c.(1786-1788)aCc>aAc	p.T596N	FAM120C_ENST00000328235.4_Missense_Mutation_p.T596N	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	596							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GGGTGGAATGGTGATATCCAT	0.498																																					p.T596N		.											.	FAM120C	131	0			c.C1787A						.						121.0	94.0	103.0					X																	54160309		2203	4300	6503	SO:0001583	missense	54954	exon8			GGAATGGTGATAT	AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.1787C>A	X.37:g.54160309G>T	ENSP00000364324:p.Thr596Asn	32.0	0.0		47.0	4.0	NM_017848	B2RMT7	Missense_Mutation	SNP	ENST00000375180.2	37	CCDS14356.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057822	0.76074	.	.	ENSG00000184083	ENST00000375180;ENST00000328235	T;T	0.55413	0.52;0.52	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.63558	0.2521	L	0.34521	1.04	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.75484	0.986;0.986	T	0.63488	-0.6626	10	0.46703	T	0.11	-11.0386	17.3597	0.87346	0.0:0.0:1.0:0.0	.	596;596	F8W881;Q9NX05	.;F120C_HUMAN	N	596	ENSP00000364324:T596N;ENSP00000329896:T596N	ENSP00000329896:T596N	T	-	2	0	FAM120C	54177034	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.167000	0.94773	2.454000	0.82982	0.600000	0.82982	ACC	.		0.498	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056795.2	NM_017848	
FAM179A	165186	ucsc.edu;bcgsc.ca	37	2	29259442	29259442	+	Silent	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:29259442C>A	ENST00000379558.4	+	18	2805	c.2454C>A	c.(2452-2454)tcC>tcA	p.S818S	FAM179A_ENST00000465300.1_3'UTR|FAM179A_ENST00000403861.2_Silent_p.S763S	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	818										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TTCAGGATTCCAACAAGAAAG	0.537																																					p.S818S		.											.	FAM179A	26	0			c.C2454A						.						104.0	93.0	97.0					2																	29259442		2203	4300	6503	SO:0001819	synonymous_variant	165186	exon18			GGATTCCAACAAG	AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.2454C>A	2.37:g.29259442C>A		74.0	0.0		56.0	5.0	NM_199280	Q6ZUF5	Silent	SNP	ENST00000379558.4	37	CCDS1769.2																																																																																			.		0.537	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317848.4	NM_199280	
FAM179B	23116	ucsc.edu;bcgsc.ca	37	14	45432959	45432959	+	Silent	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr14:45432959G>A	ENST00000361577.3	+	1	1549	c.1335G>A	c.(1333-1335)gcG>gcA	p.A445A	FAM179B_ENST00000382233.2_Silent_p.A445A|FAM179B_ENST00000361462.2_Silent_p.A445A|KLHL28_ENST00000355081.2_5'Flank|KLHL28_ENST00000553817.1_5'Flank|KLHL28_ENST00000396128.4_5'Flank	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	445										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						AAGTGCTGGCGGACAACAAGT	0.453																																					p.A445A		.											.	FAM179B	93	0			c.G1335A						.						102.0	105.0	104.0					14																	45432959		2203	4300	6503	SO:0001819	synonymous_variant	23116	exon1			GCTGGCGGACAAC	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.1335G>A	14.37:g.45432959G>A		51.0	1.0		26.0	4.0	NM_015091	Q68D66|Q6PG27	Silent	SNP	ENST00000361577.3	37	CCDS9681.1																																																																																			.		0.453	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781	
FAM221B	392307	ucsc.edu;bcgsc.ca	37	9	35826000	35826000	+	Silent	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:35826000G>T	ENST00000423537.2	-	2	428	c.159C>A	c.(157-159)acC>acA	p.T53T	TMEM8B_ENST00000377996.1_Intron	NM_001012446.3	NP_001012448.2	A6H8Z2	F221B_HUMAN	family with sequence similarity 221, member B	53										endometrium(2)|kidney(1)|lung(4)	7						GGGATTCAGAGGTATGGGGCT	0.542											OREG0019180	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T53T		.											.	.	.	0			c.C159A						.						95.0	96.0	96.0					9																	35826000		1877	4095	5972	SO:0001819	synonymous_variant	392307	exon2			TTCAGAGGTATGG	BX648702	CCDS43799.1, CCDS43799.2	9p13.3	2012-04-02	2012-04-02	2012-04-02	ENSG00000204930	ENSG00000204930			30762	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 128"""	C9orf128			Standard	NM_001012446		Approved		uc010mlc.2	A6H8Z2	OTTHUMG00000019880	ENST00000423537.2:c.159C>A	9.37:g.35826000G>T		59.0	0.0	858	33.0	4.0	NM_001012446	Q5TCW2	Silent	SNP	ENST00000423537.2	37	CCDS43799.2																																																																																			.		0.542	FAM221B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355861.1	NM_001012446	
FAM189A2	9413	ucsc.edu;bcgsc.ca	37	9	71992542	71992542	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:71992542T>C	ENST00000257515.8	+	6	796	c.376T>C	c.(376-378)Tct>Cct	p.S126P	FAM189A2_ENST00000455972.1_Missense_Mutation_p.S126P|FAM189A2_ENST00000303068.7_5'UTR	NM_004816.3	NP_004807.3	Q15884	F1892_HUMAN	family with sequence similarity 189, member A2	126						integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(5)|liver(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12						ATCCCAGATTTCTGCTGAAGA	0.522																																					p.S126P		.											.	FAM189A2	90	0			c.T376C						.						114.0	101.0	106.0					9																	71992542		2203	4300	6503	SO:0001583	missense	9413	exon6			CAGATTTCTGCTG	L27479	CCDS6629.1	9q21.11	2009-07-09	2009-07-09	2009-07-09	ENSG00000135063	ENSG00000135063			24820	protein-coding gene	gene with protein product		607710	"""chromosome 9 open reading frame 61"""	C9orf61		7951235	Standard	NM_004816		Approved	X123	uc010mon.1	Q15884	OTTHUMG00000019979	ENST00000257515.8:c.376T>C	9.37:g.71992542T>C	ENSP00000257515:p.Ser126Pro	58.0	1.0		36.0	4.0	NM_004816	Q14CN5|Q5T6C8|Q5T6C9|Q6ZTX4|Q96N10	Missense_Mutation	SNP	ENST00000257515.8	37	CCDS6629.1	.	.	.	.	.	.	.	.	.	.	T	11.54	1.668105	0.29604	.	.	ENSG00000135063	ENST00000455972;ENST00000257515;ENST00000377225	T;T	0.03124	4.04;4.04	5.85	3.54	0.40534	.	0.438432	0.25546	N	0.029936	T	0.05135	0.0137	L	0.53249	1.67	0.21499	N	0.99967	B	0.09022	0.002	B	0.10450	0.005	T	0.28681	-1.0036	10	0.48119	T	0.1	-11.7798	9.7915	0.40708	0.0:0.1394:0.0:0.8606	.	126	Q15884	F1892_HUMAN	P	126;126;125	ENSP00000395675:S126P;ENSP00000257515:S126P	ENSP00000257515:S126P	S	+	1	0	FAM189A2	71182362	0.864000	0.29904	0.149000	0.22428	0.925000	0.55904	1.179000	0.31993	0.492000	0.27815	0.459000	0.35465	TCT	.		0.522	FAM189A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052576.2	NM_004816	
FAM49B	51571	ucsc.edu;bcgsc.ca	37	8	130874579	130874579	+	Splice_Site	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr8:130874579G>A	ENST00000519824.2	-	5	470	c.197C>T	c.(196-198)gCa>gTa	p.A66V	FAM49B_ENST00000522250.1_5'UTR|FAM49B_ENST00000522941.1_Intron|FAM49B_ENST00000518879.1_5'UTR|FAM49B_ENST00000523509.1_Splice_Site_p.A66V|FAM49B_ENST00000519540.1_Splice_Site_p.A66V|FAM49B_ENST00000401979.2_Splice_Site_p.A66V|FAM49B_ENST00000517654.1_Splice_Site_p.A66V|FAM49B_ENST00000522746.1_Splice_Site_p.A66V|FAM49B_ENST00000519110.1_Splice_Site_p.A66V	NM_016623.4	NP_057707.3	Q9NUQ9	FA49B_HUMAN	family with sequence similarity 49, member B	66						cilium (GO:0005929)|extracellular vesicular exosome (GO:0070062)				kidney(1)|large_intestine(6)|lung(4)|prostate(1)	12	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			ATGCTGGATTGCCTTCAAAAT	0.343																																					p.A66V		.											.	FAM49B	90	0			c.C197T						.						80.0	80.0	80.0					8																	130874579		2203	4300	6503	SO:0001630	splice_region_variant	51571	exon5			TGGATTGCCTTCA	AF208851	CCDS6361.1	8q24	2004-08-20				ENSG00000153310			25216	protein-coding gene	gene with protein product							Standard	NM_001256763		Approved	BM-009	uc003ysu.4	Q9NUQ9		ENST00000519824.2:c.196-1C>T	8.37:g.130874579G>A		43.0	0.0		53.0	4.0	NM_016623	Q96AZ5|Q9NW21|Q9NZE7	Missense_Mutation	SNP	ENST00000519824.2	37	CCDS6361.1	.	.	.	.	.	.	.	.	.	.	G	33	5.262857	0.95399	.	.	ENSG00000153310	ENST00000522746;ENST00000523509;ENST00000401979;ENST00000519110;ENST00000519824;ENST00000517654;ENST00000519540;ENST00000311292;ENST00000519142;ENST00000520204;ENST00000518283;ENST00000523993;ENST00000520254;ENST00000519020	T;T;T;T;T;T;T;T;T;T;T;T;T	0.58652	0.32;0.32;0.32;0.32;0.32;0.32;0.32;0.32;0.32;0.32;0.32;0.32;0.32	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.81522	0.4840	M	0.90082	3.085	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84722	0.0740	10	0.87932	D	0	-19.6556	18.877	0.92341	0.0:0.0:1.0:0.0	.	66	Q9NUQ9	FA49B_HUMAN	V	66;66;66;66;66;66;66;22;66;66;66;66;66;66	ENSP00000428117:A66V;ENSP00000429802:A66V;ENSP00000384880:A66V;ENSP00000429078:A66V;ENSP00000429150:A66V;ENSP00000430674:A66V;ENSP00000429499:A66V;ENSP00000430806:A66V;ENSP00000429051:A66V;ENSP00000430694:A66V;ENSP00000429074:A66V;ENSP00000430127:A66V;ENSP00000429659:A66V	ENSP00000311651:A22V	A	-	2	0	FAM49B	130943761	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.837000	0.99465	2.777000	0.95525	0.591000	0.81541	GCA	.		0.343	FAM49B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380390.2	NM_016623	Missense_Mutation
FAM71E1	112703	ucsc.edu;bcgsc.ca	37	19	50979111	50979111	+	Silent	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:50979111G>T	ENST00000600100.1	-	2	703	c.339C>A	c.(337-339)atC>atA	p.I113I	FAM71E1_ENST00000595790.1_Silent_p.I113I|EMC10_ENST00000598585.1_5'Flank|EMC10_ENST00000334976.6_5'Flank|EMC10_ENST00000376918.3_5'Flank			Q6IPT2	F71E1_HUMAN	family with sequence similarity 71, member E1	113										breast(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.0077)|GBM - Glioblastoma multiforme(134;0.026)		TGCTCTCAAAGATGGGGAAGT	0.622																																					p.I113I		.											.	FAM71E1	44	0			c.C339A						.						52.0	51.0	51.0					19																	50979111		2203	4300	6503	SO:0001819	synonymous_variant	112703	exon2			CTCAAAGATGGGG		CCDS33081.1	19q13.33	2007-11-20				ENSG00000142530			25107	protein-coding gene	gene with protein product							Standard	XM_005258472		Approved		uc002psg.3	Q6IPT2		ENST00000600100.1:c.339C>A	19.37:g.50979111G>T		44.0	0.0		41.0	4.0	NM_138411	Q96EJ5|Q9BSM9	Silent	SNP	ENST00000600100.1	37																																																																																				.		0.622	FAM71E1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464754.2		
FBN1	2200	ucsc.edu;bcgsc.ca	37	15	48766571	48766571	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr15:48766571A>T	ENST00000316623.5	-	34	4546	c.4091T>A	c.(4090-4092)cTg>cAg	p.L1364Q		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1364	EGF-like 23; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ACATTCGTCCAGATCTTATAG	0.348																																					p.L1364Q		.											.	FBN1	92	0			c.T4091A						.						90.0	78.0	82.0					15																	48766571		2198	4296	6494	SO:0001583	missense	2200	exon34			TCGTCCAGATCTT	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.4091T>A	15.37:g.48766571A>T	ENSP00000325527:p.Leu1364Gln	40.0	0.0		40.0	4.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	A	10.75	1.439196	0.25900	.	.	ENSG00000166147	ENST00000316623;ENST00000544030	D	0.87650	-2.28	4.75	4.75	0.60458	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.067806	0.64402	D	0.000010	D	0.91425	0.7294	M	0.64676	1.99	0.80722	D	1	D	0.69078	0.997	D	0.65874	0.939	D	0.92412	0.5938	10	0.87932	D	0	.	14.0884	0.64973	1.0:0.0:0.0:0.0	.	1364	P35555	FBN1_HUMAN	Q	1364;254	ENSP00000325527:L1364Q	ENSP00000325527:L1364Q	L	-	2	0	FBN1	46553863	1.000000	0.71417	1.000000	0.80357	0.427000	0.31564	7.163000	0.77524	2.015000	0.59207	0.459000	0.35465	CTG	.		0.348	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
FBN2	2201	ucsc.edu;bcgsc.ca	37	5	127730952	127730952	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:127730952A>G	ENST00000508053.1	-	15	2068	c.1094T>C	c.(1093-1095)aTg>aCg	p.M365T	FBN2_ENST00000508989.1_Missense_Mutation_p.M332T|FBN2_ENST00000262464.4_Missense_Mutation_p.M365T			P35556	FBN2_HUMAN	fibrillin 2	365	TB 2.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CGAGAAACACATGCCTGTTCT	0.498																																					p.M365T		.											.	FBN2	146	0			c.T1094C						.						64.0	61.0	62.0					5																	127730952		2203	4300	6503	SO:0001583	missense	2201	exon9			AAACACATGCCTG	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1094T>C	5.37:g.127730952A>G	ENSP00000424571:p.Met365Thr	30.0	0.0		38.0	5.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	A	6.889	0.533575	0.13188	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.92048	-2.11;-2.11;-2.96	4.44	3.54	0.40534	Matrix fibril-associated (2);TGF-beta binding (1);	0.168657	0.38164	N	0.001790	T	0.64594	0.2612	N	0.00146	-1.995	0.25540	N	0.987186	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.63166	-0.6698	10	0.08837	T	0.75	.	5.5618	0.17148	0.1934:0.1657:0.6409:0.0	.	332;365	D6RJI3;P35556	.;FBN2_HUMAN	T	365;365;332	ENSP00000262464:M365T;ENSP00000424571:M365T;ENSP00000425596:M332T	ENSP00000262464:M365T	M	-	2	0	FBN2	127758851	0.994000	0.37717	0.988000	0.46212	0.993000	0.82548	2.260000	0.43267	1.381000	0.46364	0.533000	0.62120	ATG	.		0.498	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
FCF1	51077	ucsc.edu;bcgsc.ca	37	14	75200777	75200777	+	Splice_Site	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr14:75200777A>G	ENST00000341162.4	+	7	507		c.e7-1		FCF1_ENST00000534938.2_Splice_Site|FCF1_ENST00000553615.1_Splice_Site	NM_015962.4	NP_057046.1	Q9Y324	FCF1_HUMAN	FCF1 rRNA-processing protein						rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	8				BRCA - Breast invasive adenocarcinoma(234;0.0037)		TGTCTCTTACAGCATAAGTGT	0.438																																					.		.											.	FCF1	91	0			c.454-2A>G						.						132.0	98.0	109.0					14																	75200777		2203	4300	6503	SO:0001630	splice_region_variant	51077	exon7			TCTTACAGCATAA	AF132969	CCDS9832.1	14q24.2	2013-05-03	2013-05-03	2007-01-30	ENSG00000119616	ENSG00000119616			20220	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 111"", ""FCF1 small subunit (SSU) processome component homolog (S. cerevisiae)"""	C14orf111		16762320	Standard	XR_245690		Approved	CGI-35, Bka, UTP24	uc001xqh.3	Q9Y324		ENST00000341162.4:c.454-1A>G	14.37:g.75200777A>G		71.0	0.0		50.0	4.0	NM_015962	Q86TW8|Q8TBL8	Splice_Site	SNP	ENST00000341162.4	37	CCDS9832.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.211120	0.79240	.	.	ENSG00000119616	ENST00000341162;ENST00000534938;ENST00000553615	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9083	0.70737	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FCF1	74270530	1.000000	0.71417	0.992000	0.48379	0.852000	0.48524	8.852000	0.92215	2.064000	0.61679	0.459000	0.35465	.	.		0.438	FCF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413622.1	NM_015962	Intron
FER1L5	90342	ucsc.edu;bcgsc.ca	37	2	97338889	97338889	+	RNA	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:97338889C>A	ENST00000457909.1	+	0	106							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						CTTTAAAGAGCTGATCCATTT	0.493																																					p.L518M		.											.	FER1L5	23	0			c.C1552A						.						183.0	151.0	161.0					2																	97338889		692	1591	2283			90342	exon18			AAAGAGCTGATCC	BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		2.37:g.97338889C>A		56.0	0.0		51.0	7.0	NM_001113382	Q17RH2|Q6ZU24	Missense_Mutation	SNP	ENST00000457909.1	37		.	.	.	.	.	.	.	.	.	.	C	5.167	0.216448	0.09810	.	.	ENSG00000214272	ENST00000414152;ENST00000436930	.	.	.	5.48	2.7	0.31948	.	.	.	.	.	T	0.53061	0.1773	M	0.67953	2.075	.	.	.	D	0.67145	0.996	P	0.53450	0.726	T	0.62651	-0.6809	7	0.59425	D	0.04	.	6.0423	0.19740	0.0:0.6338:0.1352:0.2309	.	518	A0AVI2	FR1L5_HUMAN	M	518;511	.	ENSP00000444148:L518M	L	+	1	2	FER1L5	96702616	0.951000	0.32395	1.000000	0.80357	0.094000	0.18550	0.864000	0.27926	0.703000	0.31848	-0.277000	0.10078	CTG	.		0.493	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene	OTTHUMT00000339030.1	NM_001077400	
FIGNL1	63979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	50514900	50514900	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:50514900G>A	ENST00000419119.1	-	2	1639	c.86C>T	c.(85-87)cCg>cTg	p.P29L	FIGNL1_ENST00000395556.2_Missense_Mutation_p.P29L|FIGNL1_ENST00000433017.1_Missense_Mutation_p.P29L|FIGNL1_ENST00000435566.1_Missense_Mutation_p.P29L|FIGNL1_ENST00000356889.4_Missense_Mutation_p.P29L			Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	29					ATP metabolic process (GO:0046034)|cellular response to ionizing radiation (GO:0071479)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|regulation of cell cycle (GO:0051726)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	29	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				ATCTGCCTTCGGTCCGGTACA	0.438																																					p.P29L		.											.	FIGNL1	93	0			c.C86T						.						66.0	56.0	59.0					7																	50514900		2203	4300	6503	SO:0001583	missense	63979	exon4			GCCTTCGGTCCGG	AK023142	CCDS5510.1	7p12.2	2010-04-21			ENSG00000132436	ENSG00000132436		"""ATPases / AAA-type"""	13286	protein-coding gene	gene with protein product		615383					Standard	XM_005271783		Approved		uc003tpc.3	Q6PIW4	OTTHUMG00000022866	ENST00000419119.1:c.86C>T	7.37:g.50514900G>A	ENSP00000410811:p.Pro29Leu	82.0	0.0		70.0	20.0	NM_001042762	D3DVM6|Q86V18|Q8ND59|Q9H8P1|Q9H917	Missense_Mutation	SNP	ENST00000419119.1	37	CCDS5510.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.764053	0.49574	.	.	ENSG00000132436	ENST00000356889;ENST00000395556;ENST00000433017;ENST00000419119;ENST00000435566;ENST00000436590;ENST00000422854;ENST00000440350;ENST00000420829;ENST00000448788	T;T;T;T;T;T;T	0.20881	2.04;2.04;2.04;2.04;2.04;2.04;2.04	5.21	1.32	0.21799	.	0.129212	0.53938	D	0.000056	T	0.09905	0.0243	N	0.08118	0	0.24380	N	0.994792	B	0.09022	0.002	B	0.01281	0.0	T	0.22977	-1.0201	10	0.72032	D	0.01	-0.8423	8.2317	0.31601	0.0:0.1318:0.1152:0.753	.	29	Q6PIW4	FIGL1_HUMAN	L	29	ENSP00000349356:P29L;ENSP00000378924:P29L;ENSP00000399997:P29L;ENSP00000410811:P29L;ENSP00000394070:P29L;ENSP00000403012:P29L;ENSP00000388471:P29L	ENSP00000349356:P29L	P	-	2	0	FIGNL1	50482394	1.000000	0.71417	0.417000	0.26559	0.236000	0.25371	3.222000	0.51223	0.070000	0.16634	-2.631000	0.00153	CCG	.		0.438	FIGNL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342579.1	NM_001042762	
FN1	2335	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	216238044	216238044	+	Splice_Site	SNP	C	C	G	rs111852829		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:216238044C>G	ENST00000359671.1	-	38	6240		c.e38+1		FN1_ENST00000346544.3_Splice_Site|FN1_ENST00000357009.2_Splice_Site|FN1_ENST00000421182.1_Splice_Site|FN1_ENST00000345488.5_Splice_Site|FN1_ENST00000446046.1_Splice_Site|FN1_ENST00000443816.1_Splice_Site|FN1_ENST00000356005.4_Splice_Site|FN1_ENST00000354785.4_Splice_Site|FN1_ENST00000323926.6_Splice_Site|FN1_ENST00000336916.4_Splice_Site|FN1_ENST00000432072.2_Splice_Site|FN1_ENST00000357867.4_Splice_Site			P02751	FINC_HUMAN	fibronectin 1						acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GATACTCTTACCTGTCTTTTT	0.403																																					.		.											.	FN1	584	0			c.6247+1G>C						.						164.0	167.0	166.0					2																	216238044		2203	4300	6503	SO:0001630	splice_region_variant	2335	exon40			CTCTTACCTGTCT		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.5974+1G>C	2.37:g.216238044C>G		253.0	1.0		238.0	36.0	NM_212482	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Splice_Site	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	C	22.6	4.312740	0.81358	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923;ENST00000438981	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FN1	215946289	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	6.465000	0.73538	2.941000	0.99782	0.655000	0.94253	.	G|1.000		0.403	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	Intron
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	13	39265055	39265055	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr13:39265055G>T	ENST00000280481.7	+	1	3790	c.3574G>T	c.(3574-3576)Gag>Tag	p.E1192*		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1192					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGAACAGCCAGAGATGTTTAT	0.418																																					p.E1192X		.											.	FREM2	100	0			c.G3574T						.						229.0	219.0	222.0					13																	39265055		2203	4300	6503	SO:0001587	stop_gained	341640	exon1			CAGCCAGAGATGT	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.3574G>T	13.37:g.39265055G>T	ENSP00000280481:p.Glu1192*	136.0	0.0		55.0	44.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Nonsense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	44	11.144798	0.99522	.	.	ENSG00000150893	ENST00000280481	.	.	.	6.07	6.07	0.98685	.	0.199491	0.52532	D	0.000079	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	.	.	.	X	1192	.	ENSP00000280481:E1192X	E	+	1	0	FREM2	38163055	1.000000	0.71417	0.997000	0.53966	0.788000	0.44548	9.864000	0.99589	2.890000	0.99128	0.650000	0.86243	GAG	.		0.418	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
FSTL4	23105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	132585166	132585166	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:132585166C>T	ENST00000265342.7	-	7	1079	c.830G>A	c.(829-831)aGg>aAg	p.R277K	FSTL4_ENST00000507112.1_5'UTR|CTB-49A3.5_ENST00000515122.1_RNA|CTB-49A3.5_ENST00000504312.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	277	Ig-like 1.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GATTGGTGGCCTCAGGTCTCC	0.587																																					p.R277K		.											.	FSTL4	91	0			c.G830A						.						115.0	89.0	97.0					5																	132585166		2203	4300	6503	SO:0001583	missense	23105	exon7			GGTGGCCTCAGGT	AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.830G>A	5.37:g.132585166C>T	ENSP00000265342:p.Arg277Lys	74.0	0.0		91.0	13.0	NM_015082	Q8TBU0|Q9UPU1	Missense_Mutation	SNP	ENST00000265342.7	37	CCDS34238.1	.	.	.	.	.	.	.	.	.	.	C	31	5.103453	0.94245	.	.	ENSG00000053108	ENST00000265342;ENST00000360575	T	0.11821	2.74	5.51	5.51	0.81932	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.27489	0.0675	L	0.35542	1.07	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.01532	-1.1331	10	0.22706	T	0.39	-35.463	18.4076	0.90541	0.0:1.0:0.0:0.0	.	277	Q6MZW2	FSTL4_HUMAN	K	277;108	ENSP00000265342:R277K	ENSP00000265342:R277K	R	-	2	0	FSTL4	132613065	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.729000	0.68538	2.590000	0.87494	0.467000	0.42956	AGG	.		0.587	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370212.1	XM_048786	
FUS	2521	broad.mit.edu;bcgsc.ca	37	16	31193931	31193931	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:31193931G>C	ENST00000254108.7	+	3	241	c.136G>C	c.(136-138)Gac>Cac	p.D46H	RP11-388M20.6_ENST00000564743.1_RNA|FUS_ENST00000380244.3_Missense_Mutation_p.D46H|FUS_ENST00000568685.1_Missense_Mutation_p.D46H	NM_001170634.1|NM_001170937.1|NM_004960.3	NP_001164105.1|NP_001164408.1|NP_004951.1	P35637	FUS_HUMAN	FUS RNA binding protein	46	Gln/Gly/Ser/Tyr-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.D46H(1)	FUS/ERG(167)|FUS/DDIT3(631)|FUS/FEV(2)|FUS/ATF1(4)|FUS/CREB3L1(6)|FUS/CREB3L2(158)	breast(3)|endometrium(5)|kidney(3)|large_intestine(1)|lung(5)|prostate(3)|skin(1)|urinary_tract(1)	22		Renal(780;0.000219)|Breast(268;0.00957)|Hepatocellular(780;0.121)		GBM - Glioblastoma multiforme(240;2.31e-05)|Kidney(780;0.000209)		CCAGTCCACGGACACTTCAGG	0.547			T	"""DDIT3, ERG, FEV, ATF1, CREB3L2, CREB3L1"""	"""liposarcoma, AML, Ewing sarcoma, angiomatoid fibrous histiocytoma, fibromyxoid sarcoma"""																																p.D46H		.		Dom	yes		16	16p11.2	2521	"""fusion, derived from t(12;16) malignant liposarcoma"""		"""M, L"""	.	FUS	1719	1	Substitution - Missense(1)	kidney(1)	c.G136C						.						103.0	96.0	98.0					16																	31193931		2197	4300	6497	SO:0001583	missense	2521	exon3			TCCACGGACACTT	AF071213	CCDS10707.1, CCDS58454.1	16p11.2	2014-09-17	2014-05-09		ENSG00000089280	ENSG00000089280		"""RNA binding motif (RRM) containing"""	4010	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein P2"", ""translocated in liposarcoma"""	137070	"""fusion, derived from t(12;16) malignant liposarcoma"", ""amyotrophic lateral sclerosis 6"", ""fusion (involved in t(12;16) in malignant liposarcoma)"", ""fused in sarcoma"""	ALS6		2372777, 7503811, 19251628, 19251627	Standard	NM_004960		Approved	TLS, FUS1, hnRNP-P2, HNRNPP2	uc002ebe.2	P35637	OTTHUMG00000132395	ENST00000254108.7:c.136G>C	16.37:g.31193931G>C	ENSP00000254108:p.Asp46His	95.0	0.0		98.0	6.0	NM_001170634	Q9H4A8	Missense_Mutation	SNP	ENST00000254108.7	37	CCDS10707.1	.	.	.	.	.	.	.	.	.	.	G	19.29	3.800168	0.70567	.	.	ENSG00000089280	ENST00000254108;ENST00000394533	T	0.80304	-1.36	6.11	6.11	0.99139	.	0.261168	0.36893	N	0.002345	D	0.88396	0.6425	M	0.64997	1.995	0.42822	D	0.993991	D;P;P;P;P	0.71674	0.998;0.612;0.874;0.8;0.8	D;B;P;B;B	0.64595	0.927;0.417;0.621;0.417;0.319	D	0.88461	0.3055	10	0.87932	D	0	-18.9584	19.5024	0.95100	0.0:0.0:1.0:0.0	.	46;46;46;46;46	B4DVJ7;Q6IBQ5;P35637-2;P35637;E7EUX0	.;.;.;FUS_HUMAN;.	H	46	ENSP00000254108:D46H	ENSP00000254108:D46H	D	+	1	0	FUS	31101432	1.000000	0.71417	0.979000	0.43373	0.543000	0.35085	5.495000	0.66912	2.907000	0.99374	0.609000	0.83330	GAC	.		0.547	FUS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255526.2	NM_004960	
FZD9	8326	ucsc.edu;bcgsc.ca	37	7	72849142	72849142	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:72849142T>C	ENST00000344575.3	+	1	1034	c.805T>C	c.(805-807)Ttc>Ctc	p.F269L		NM_003508.2	NP_003499.1	O00144	FZD9_HUMAN	frizzled class receptor 9	269					B cell differentiation (GO:0030183)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuroblast proliferation (GO:0007405)|vasculature development (GO:0001944)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	14		Lung NSC(55;0.0659)|all_lung(88;0.152)				CCCCATCATCTTCCTCTCCAT	0.652																																					p.F269L	Pancreas(144;909 1878 36867 38226 39554)	.											.	FZD9	1082	0			c.T805C						.						140.0	137.0	138.0					7																	72849142		2203	4300	6503	SO:0001583	missense	8326	exon1			ATCATCTTCCTCT	U82169	CCDS5548.1	7q11.23	2014-01-29	2014-01-29		ENSG00000188763	ENSG00000188763		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4047	protein-coding gene	gene with protein product		601766	"""frizzled (Drosophila) homolog 9"", ""frizzled homolog 9 (Drosophila)"", ""frizzled 9, seven transmembrane spanning receptor"", ""frizzled family receptor 9"""			9147651, 10198163	Standard	NM_003508		Approved	FZD3, CD349	uc003tyb.3	O00144	OTTHUMG00000023051	ENST00000344575.3:c.805T>C	7.37:g.72849142T>C	ENSP00000345785:p.Phe269Leu	48.0	0.0		42.0	5.0	NM_003508		Missense_Mutation	SNP	ENST00000344575.3	37	CCDS5548.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.292232	0.80914	.	.	ENSG00000188763	ENST00000344575	D	0.86164	-2.08	4.1	4.1	0.47936	GPCR, family 2-like (1);	0.000000	0.85682	U	0.000000	D	0.92077	0.7489	M	0.80616	2.505	0.80722	D	1	D	0.54207	0.965	P	0.61722	0.893	D	0.92643	0.6126	10	0.59425	D	0.04	.	12.5608	0.56279	0.0:0.0:0.0:1.0	.	269	O00144	FZD9_HUMAN	L	269	ENSP00000345785:F269L	ENSP00000345785:F269L	F	+	1	0	FZD9	72487078	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.991000	0.88244	1.630000	0.50440	0.338000	0.21704	TTC	.		0.652	FZD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252120.1		
GGT7	2686	ucsc.edu;bcgsc.ca	37	20	33447305	33447305	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr20:33447305T>C	ENST00000336431.5	-	7	999	c.955A>G	c.(955-957)Acc>Gcc	p.T319A		NM_178026.2	NP_821158.2	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	319					glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			NS(2)|breast(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	20						GGGCCGGAGGTGCCAAGTACA	0.667																																					p.T319A		.											.	GGT7	91	0			c.A955G						.						36.0	32.0	33.0					20																	33447305		2202	4300	6502	SO:0001583	missense	2686	exon7			CGGAGGTGCCAAG	AL049709	CCDS13242.2	20q11.22	2008-11-24	2008-03-10	2008-03-10	ENSG00000131067	ENSG00000131067		"""Gamma-glutamyltransferases"""	4259	protein-coding gene	gene with protein product		612342	"""gamma-glutamyltransferase-like 3"""	GGTL5, GGTL3		8104871, 18357469	Standard	NM_178026		Approved	D20S101, dJ18C9.2	uc002xay.3	Q9UJ14	OTTHUMG00000032314	ENST00000336431.5:c.955A>G	20.37:g.33447305T>C	ENSP00000338964:p.Thr319Ala	38.0	1.0		37.0	4.0	NM_178026	Q8N899|Q8NF66|Q9BYP5|Q9BYP6	Missense_Mutation	SNP	ENST00000336431.5	37	CCDS13242.2	.	.	.	.	.	.	.	.	.	.	T	6.584	0.476140	0.12521	.	.	ENSG00000131067	ENST00000336431	T	0.20738	2.05	5.84	3.44	0.39384	.	0.725560	0.13604	N	0.375631	T	0.04588	0.0125	N	0.00648	-1.295	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.39683	-0.9602	10	0.07813	T	0.8	-24.6595	3.3488	0.07145	0.263:0.1947:0.0:0.5423	.	319;319	A4FU32;Q9UJ14	.;GGT7_HUMAN	A	319	ENSP00000338964:T319A	ENSP00000338964:T319A	T	-	1	0	GGT7	32910966	0.001000	0.12720	0.787000	0.31911	0.909000	0.53808	-0.243000	0.08915	1.006000	0.39211	0.459000	0.35465	ACC	.		0.667	GGT7-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078816.2	NM_178026	
GDF5	8200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	34022378	34022378	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr20:34022378C>T	ENST00000374372.1	-	4	1338	c.835G>A	c.(835-837)Gat>Aat	p.D279N	GDF5OS_ENST00000374375.1_Missense_Mutation_p.S141F|GDF5_ENST00000374369.3_Missense_Mutation_p.D279N			P43026	GDF5_HUMAN	growth differentiation factor 5	279					cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			GAGCGCACATCCAGCAAGGAG	0.687																																					p.D279N		.											.	GDF5	226	0			c.G835A						.						12.0	14.0	13.0					20																	34022378		2179	4278	6457	SO:0001583	missense	8200	exon2			GCACATCCAGCAA	X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.835G>A	20.37:g.34022378C>T	ENSP00000363492:p.Asp279Asn	50.0	0.0		51.0	12.0	NM_000557	E1P5Q2|Q96SB1	Missense_Mutation	SNP	ENST00000374372.1	37	CCDS13254.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.4|26.4	4.736835|4.736835	0.89482|0.89482	.|.	.|.	ENSG00000125965|ENSG00000204183	ENST00000374369;ENST00000374372|ENST00000374375	T;T|.	0.68903|.	-0.36;-0.36|.	4.56|4.56	4.56|4.56	0.56223|0.56223	Transforming growth factor-beta, N-terminal (1);|.	0.126917|.	0.50627|.	D|.	0.000104|.	T|T	0.76786|0.76786	0.4036|0.4036	M|M	0.74647|0.74647	2.275|2.275	0.58432|0.58432	D|D	0.999998|0.999998	D;D|.	0.71674|.	0.976;0.998|.	D;D|.	0.70935|.	0.926;0.971|.	T|T	0.80799|0.80799	-0.1221|-0.1221	10|6	0.66056|0.87932	D|D	0.02|0	.|.	17.5149|17.5149	0.87770|0.87770	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	279;279|.	F1T0J1;P43026|.	.;GDF5_HUMAN|.	N|F	279|141	ENSP00000363489:D279N;ENSP00000363492:D279N|.	ENSP00000363489:D279N|ENSP00000363495:S141F	D|S	-|+	1|2	0|0	GDF5|GDF5OS	33485792|33485792	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	4.774000|4.774000	0.62339|0.62339	2.353000|2.353000	0.79882|0.79882	0.491000|0.491000	0.48974|0.48974	GAT|TCC	.		0.687	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078875.2		
GPR115	221393	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	47681793	47681793	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:47681793G>A	ENST00000283303.2	+	6	1070	c.812G>A	c.(811-813)gGa>gAa	p.G271E	GPR115_ENST00000371220.1_Missense_Mutation_p.G328E|GPR115_ENST00000327753.3_Missense_Mutation_p.G271E|RN7SKP116_ENST00000516902.1_RNA	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	271					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						GATATCTTAGGAATGGTACAG	0.443																																					p.G271E	GBM(22;431 510 9010 26644 32828)	.											.	GPR115	160	0			c.G812A						.						60.0	61.0	61.0					6																	47681793		2203	4300	6503	SO:0001583	missense	221393	exon6			TCTTAGGAATGGT	AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.812G>A	6.37:g.47681793G>A	ENSP00000283303:p.Gly271Glu	61.0	0.0		93.0	24.0	NM_153838	B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Missense_Mutation	SNP	ENST00000283303.2	37	CCDS4922.2	.	.	.	.	.	.	.	.	.	.	G	11.10	1.540544	0.27563	.	.	ENSG00000153294	ENST00000371220;ENST00000327753;ENST00000283303	T;T;T	0.37752	1.41;1.18;1.18	5.19	4.3	0.51218	.	0.085998	0.50627	D	0.000110	T	0.47691	0.1459	M	0.81497	2.545	0.19775	N	0.999958	D	0.76494	0.999	D	0.71414	0.973	T	0.47849	-0.9085	10	0.72032	D	0.01	-6.2359	12.3905	0.55356	0.0:0.0:0.8257:0.1743	.	271	Q8IZF3	GP115_HUMAN	E	328;271;271	ENSP00000360264:G328E;ENSP00000328319:G271E;ENSP00000283303:G271E	ENSP00000283303:G271E	G	+	2	0	GPR115	47789752	0.996000	0.38824	0.205000	0.23548	0.010000	0.07245	3.133000	0.50531	1.250000	0.43966	0.655000	0.94253	GGA	.		0.443	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2	NM_153838	
GPR124	25960	ucsc.edu;bcgsc.ca	37	8	37687398	37687398	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr8:37687398A>G	ENST00000412232.2	+	6	597	c.584A>G	c.(583-585)gAc>gGc	p.D195G	GPR124_ENST00000315215.7_Missense_Mutation_p.D195G	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	195	LRRCT.				central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CTGACCTGTGACTGCCACCTG	0.672																																					p.D195G		.											.	GPR124	157	0			c.A584G						.						46.0	46.0	46.0					8																	37687398		2203	4300	6503	SO:0001583	missense	25960	exon6			CCTGTGACTGCCA	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.584A>G	8.37:g.37687398A>G	ENSP00000406367:p.Asp195Gly	58.0	0.0		21.0	4.0	NM_032777	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	A	24.4	4.528097	0.85706	.	.	ENSG00000020181	ENST00000428068;ENST00000416514;ENST00000315215;ENST00000412232	D;D;D	0.91237	-2.81;-2.81;-2.81	5.21	4.04	0.47022	Cysteine-rich flanking region, C-terminal (1);	0.054131	0.64402	N	0.000001	D	0.95598	0.8569	M	0.91663	3.23	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72625	0.978;0.977	D	0.95207	0.8322	10	0.72032	D	0.01	-42.0183	10.7731	0.46334	0.9248:0.0:0.0752:0.0	.	195;195	Q96PE1-2;Q96PE1	.;GP124_HUMAN	G	153;188;195;195	ENSP00000400860:D153G;ENSP00000323508:D195G;ENSP00000406367:D195G	ENSP00000323508:D195G	D	+	2	0	GPR124	37806556	1.000000	0.71417	0.998000	0.56505	0.888000	0.51559	9.162000	0.94745	0.824000	0.34613	0.379000	0.24179	GAC	.		0.672	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
GPR63	81491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	97246970	97246970	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:97246970A>G	ENST00000229955.3	-	2	983	c.638T>C	c.(637-639)tTa>tCa	p.L213S	GPR63_ENST00000417980.1_Missense_Mutation_p.L213S	NM_001143957.2|NM_030784.3	NP_001137429.1|NP_110411.1	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(5)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		TCCTACGGCTAAAGGAAAAGC	0.458																																					p.L213S		.											.	GPR63	92	0			c.T638C						.						75.0	75.0	75.0					6																	97246970		2203	4300	6503	SO:0001583	missense	81491	exon2			ACGGCTAAAGGAA	AF317654	CCDS5036.1	6q16.1-q16.3	2012-08-21			ENSG00000112218	ENSG00000112218		"""GPCR / Class A : Orphans"""	13302	protein-coding gene	gene with protein product		606915					Standard	NM_030784		Approved	PSP24(beta), PSP24B	uc003pou.3	Q9BZJ6	OTTHUMG00000015245	ENST00000229955.3:c.638T>C	6.37:g.97246970A>G	ENSP00000229955:p.Leu213Ser	58.0	0.0		25.0	15.0	NM_030784	Q9UJH3	Missense_Mutation	SNP	ENST00000229955.3	37	CCDS5036.1	.	.	.	.	.	.	.	.	.	.	A	11.24	1.580195	0.28180	.	.	ENSG00000112218	ENST00000536583;ENST00000417980;ENST00000229955;ENST00000369268	T;T;T	0.38560	1.13;1.13;1.13	5.3	4.13	0.48395	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000010	T	0.10337	0.0253	N	0.12422	0.21	0.54753	D	0.999985	B	0.32526	0.374	B	0.28991	0.097	T	0.08889	-1.0700	10	0.22109	T	0.4	-0.8812	11.3705	0.49697	0.9282:0.0:0.0718:0.0	.	213	Q9BZJ6	GPR63_HUMAN	S	237;213;213;213	ENSP00000393170:L213S;ENSP00000229955:L213S;ENSP00000358273:L213S	ENSP00000229955:L213S	L	-	2	0	GPR63	97353691	1.000000	0.71417	0.840000	0.33206	0.724000	0.41520	8.910000	0.92685	0.957000	0.37930	0.528000	0.53228	TTA	.		0.458	GPR63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041566.2		
GRID2IP	392862	broad.mit.edu;ucsc.edu;mdanderson.org	37	7	6554130	6554130	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:6554130G>T	ENST00000457091.2	-	8	1298	c.1299C>A	c.(1297-1299)taC>taA	p.Y433*	GRID2IP_ENST00000435185.1_Nonsense_Mutation_p.Y250*|GRID2IP_ENST00000452113.1_Nonsense_Mutation_p.Y243*	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	433					long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						CCAGCACAGGGTAGACGTCAA	0.557																																					p.Y433X		.											.	.	.	0			c.C1299A						.						106.0	113.0	111.0					7																	6554130		692	1591	2283	SO:0001587	stop_gained	392862	exon8			CACAGGGTAGACG		CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.1299C>A	7.37:g.6554130G>T	ENSP00000397351:p.Tyr433*	14.0	0.0		15.0	8.0	NM_001145118		Nonsense_Mutation	SNP	ENST00000457091.2	37	CCDS47537.1	.	.	.	.	.	.	.	.	.	.	G	36	5.961144	0.97151	.	.	ENSG00000215045	ENST00000452113;ENST00000435185;ENST00000457091	.	.	.	4.61	2.72	0.32119	.	0.066054	0.64402	U	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.9064	0.41379	0.1879:0.0:0.8121:0.0	.	.	.	.	X	243;250;433	.	ENSP00000408364:Y250X	Y	-	3	2	GRID2IP	6520655	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	1.641000	0.37197	1.030000	0.39839	0.563000	0.77884	TAC	.		0.557	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340534.1	XM_294249	
GRM2	2912	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	51749875	51749875	+	Missense_Mutation	SNP	G	G	A	rs567499268		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:51749875G>A	ENST00000395052.3	+	4	2320	c.2086G>A	c.(2086-2088)Gcc>Acc	p.A696T	GRM2_ENST00000475478.1_3'UTR|GRM2_ENST00000442933.2_Intron	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	696					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CATCGTGGTCGCCTGGCTGGT	0.667													G|||	1	0.000199681	0.0	0.0	5008	,	,		17826	0.0		0.001	False		,,,				2504	0.0				p.A696T		.											.	GRM2	522	0			c.G2086A						.						45.0	38.0	41.0					3																	51749875		2203	4299	6502	SO:0001583	missense	2912	exon4			GTGGTCGCCTGGC	L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.2086G>A	3.37:g.51749875G>A	ENSP00000378492:p.Ala696Thr	42.0	0.0		20.0	4.0	NM_000839	B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	ENST00000395052.3	37	CCDS2834.1	.	.	.	.	.	.	.	.	.	.	G	9.457	1.092000	0.20471	.	.	ENSG00000164082	ENST00000395052	D	0.87887	-2.31	5.14	1.31	0.21738	GPCR, family 3, C-terminal (2);	0.453331	0.24363	N	0.039161	T	0.68026	0.2956	N	0.05124	-0.11	0.39112	D	0.961493	P	0.39326	0.668	B	0.33454	0.164	T	0.65236	-0.6217	10	0.46703	T	0.11	.	8.0442	0.30540	0.5332:0.0:0.4668:0.0	.	696	Q14416	GRM2_HUMAN	T	696	ENSP00000378492:A696T	ENSP00000378492:A696T	A	+	1	0	GRM2	51724915	0.435000	0.25577	0.172000	0.22920	0.584000	0.36387	0.864000	0.27926	0.298000	0.22638	0.549000	0.68633	GCC	.		0.667	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1		
GRXCR1	389207	broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	42895631	42895631	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:42895631C>T	ENST00000399770.2	+	1	348	c.348C>T	c.(346-348)ggC>ggT	p.G116G	RN7SKP82_ENST00000516786.1_RNA	NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	116					auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						TGAGTGCTGGCCAGGCTCTAT	0.433																																					p.G116G		.											.	GRXCR1	23	0			c.C348T						.						104.0	104.0	104.0					4																	42895631		1944	4143	6087	SO:0001819	synonymous_variant	389207	exon1			TGCTGGCCAGGCT		CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.348C>T	4.37:g.42895631C>T		50.0	1.0		20.0	7.0	NM_001080476		Silent	SNP	ENST00000399770.2	37	CCDS43225.1																																																																																			.		0.433	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360576.1	NM_001080476	
GRSF1	2926	ucsc.edu;bcgsc.ca	37	4	71698873	71698873	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:71698873T>C	ENST00000254799.6	-	3	749	c.632A>G	c.(631-633)gAg>gGg	p.E211G	GRSF1_ENST00000502323.1_Missense_Mutation_p.E49G|GRSF1_ENST00000545193.1_Missense_Mutation_p.E93G|GRSF1_ENST00000508091.1_Intron|GRSF1_ENST00000439371.1_Missense_Mutation_p.E49G	NM_002092.3	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1	211	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anterior/posterior pattern specification (GO:0009952)|morphogenesis of embryonic epithelium (GO:0016331)|mRNA polyadenylation (GO:0006378)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(2)	17		all_hematologic(202;0.21)	Lung(101;0.235)			GCGGTGCTTCTCTAAGGCTTT	0.433																																					p.E211G		.											.	.	.	0			c.A632G						.						177.0	177.0	177.0					4																	71698873		2165	4266	6431	SO:0001583	missense	2926	exon3			TGCTTCTCTAAGG	BC040485	CCDS47069.1, CCDS47070.1	4q13	2013-07-16				ENSG00000132463		"""RNA binding motif (RRM) containing"""	4610	protein-coding gene	gene with protein product		604851				8036161	Standard	NM_001098477		Approved		uc010iia.1	Q12849		ENST00000254799.6:c.632A>G	4.37:g.71698873T>C	ENSP00000254799:p.Glu211Gly	77.0	0.0		35.0	4.0	NM_002092	B3KPW0|Q4W5S5|Q6ZST3|Q8IWD6|Q8NBD2	Missense_Mutation	SNP	ENST00000254799.6	37	CCDS47069.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.50|12.50	1.956899|1.956899	0.34565|0.34565	.|.	.|.	ENSG00000132463|ENSG00000132463	ENST00000254799;ENST00000439371;ENST00000540657;ENST00000499044;ENST00000502323;ENST00000545193|ENST00000514161	T;T;T;T;T|.	0.09538|.	2.97;2.97;2.97;2.97;2.97|.	5.11|5.11	3.91|3.91	0.45181|0.45181	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);|.	0.100500|.	0.64402|.	N|.	0.000002|.	T|T	0.59582|0.59582	0.2204|0.2204	L|L	0.51914|0.51914	1.62|1.62	0.52501|0.52501	D|D	0.99995|0.99995	B;B|.	0.12630|.	0.002;0.006|.	B;B|.	0.04013|.	0.001;0.001|.	T|T	0.56092|0.56092	-0.8036|-0.8036	10|5	0.66056|.	D|.	0.02|.	-7.273|-7.273	11.3094|11.3094	0.49356|0.49356	0.0:0.0719:0.0:0.928|0.0:0.0719:0.0:0.928	.|.	124;211|.	B7Z5F9;Q12849|.	.;GRSF1_HUMAN|.	G|G	211;49;143;184;49;93|148	ENSP00000254799:E211G;ENSP00000389219:E49G;ENSP00000427354:E184G;ENSP00000425430:E49G;ENSP00000443380:E93G|.	ENSP00000254799:E211G|.	E|R	-|-	2|1	0|2	GRSF1|GRSF1	71917737|71917737	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.080000|0.080000	0.17528|0.17528	3.997000|3.997000	0.57016|0.57016	1.048000|1.048000	0.40298|0.40298	0.533000|0.533000	0.62120|0.62120	GAG|AGA	.		0.433	GRSF1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362642.1	NM_002092	
GTF3C1	2975	ucsc.edu;bcgsc.ca	37	16	27474886	27474886	+	Missense_Mutation	SNP	T	T	C	rs373376775		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:27474886T>C	ENST00000356183.4	-	35	5915	c.5900A>G	c.(5899-5901)aAc>aGc	p.N1967S	GTF3C1_ENST00000567806.1_5'Flank|GTF3C1_ENST00000561623.1_Missense_Mutation_p.N1942S	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1967					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						CTGGGAGATGTTGGCAGCTCC	0.592													T|||	1	0.000199681	0.0	0.0	5008	,	,		15871	0.001		0.0	False		,,,				2504	0.0				p.N1967S		.											.	GTF3C1	94	0			c.A5900G						.						110.0	109.0	109.0					16																	27474886		2197	4300	6497	SO:0001583	missense	2975	exon35			GAGATGTTGGCAG	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.5900A>G	16.37:g.27474886T>C	ENSP00000348510:p.Asn1967Ser	36.0	0.0		36.0	4.0	NM_001520	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	T	1.107	-0.659297	0.03454	.	.	ENSG00000077235	ENST00000356183	T	0.21932	1.98	3.93	0.844	0.18943	.	0.600087	0.16740	N	0.201466	T	0.06735	0.0172	N	0.05124	-0.11	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.40079	-0.9582	10	0.02654	T	1	-21.5729	5.473	0.16680	0.0:0.6241:0.0:0.3759	.	1967;1942	Q12789;Q12789-3	TF3C1_HUMAN;.	S	1967	ENSP00000348510:N1967S	ENSP00000348510:N1967S	N	-	2	0	GTF3C1	27382387	0.004000	0.15560	0.000000	0.03702	0.017000	0.09413	0.145000	0.16157	0.182000	0.20032	-0.232000	0.12228	AAC	.		0.592	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
GUCY1B3	2983	ucsc.edu;bcgsc.ca	37	4	156715007	156715007	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:156715007G>T	ENST00000264424.8	+	6	577		c.e6-1		GUCY1B3_ENST00000505764.1_Splice_Site|GUCY1B3_ENST00000507146.1_Splice_Site|GUCY1B3_ENST00000503520.1_Splice_Site|GUCY1B3_ENST00000505154.1_Splice_Site|GUCY1B3_ENST00000502959.1_Splice_Site|GUCY1B3_ENST00000513437.1_Splice_Site	NM_000857.2	NP_000848.1	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3						blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)	cytoplasm (GO:0005737)|guanylate cyclase complex, soluble (GO:0008074)|intracellular membrane-bounded organelle (GO:0043231)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		TTGATATCCAGGTTATTCAGC	0.279																																					.		.											.	.	.	0			c.496-1G>T						.						37.0	38.0	38.0					4																	156715007		1811	4077	5888	SO:0001630	splice_region_variant	2983	exon6			TATCCAGGTTATT	AF020340	CCDS47154.1, CCDS75203.1	4q31.3-q33	2008-03-18			ENSG00000061918	ENSG00000061918	4.6.1.2		4687	protein-coding gene	gene with protein product		139397		GUC1B3		1352257	Standard	XM_005262959		Approved	GC-SB3, GC-S-beta-1	uc003ipc.3	Q02153	OTTHUMG00000161698	ENST00000264424.8:c.496-1G>T	4.37:g.156715007G>T		97.0	1.0		44.0	4.0	NM_000857	B7Z426|Q86WY5	Splice_Site	SNP	ENST00000264424.8	37	CCDS47154.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.164368	0.78339	.	.	ENSG00000061918	ENST00000505154;ENST00000502959;ENST00000505764;ENST00000507146;ENST00000264424;ENST00000503520;ENST00000513437	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3176	0.98660	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GUCY1B3	156934457	1.000000	0.71417	0.998000	0.56505	0.879000	0.50718	9.435000	0.97529	2.805000	0.96524	0.655000	0.94253	.	.		0.279	GUCY1B3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365770.2		Intron
HECW1	23072	ucsc.edu;bcgsc.ca	37	7	43506065	43506065	+	Silent	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:43506065A>G	ENST00000395891.2	+	15	3416	c.2811A>G	c.(2809-2811)tcA>tcG	p.S937S	HECW1_ENST00000453890.1_Silent_p.S903S	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	937					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GAGAAGGGTCACTTTCTCCAG	0.463																																					p.S937S		.											.	HECW1	669	0			c.A2811G						.						112.0	106.0	108.0					7																	43506065		1946	4135	6081	SO:0001819	synonymous_variant	23072	exon15			AGGGTCACTTTCT	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.2811A>G	7.37:g.43506065A>G		53.0	1.0		56.0	4.0	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Silent	SNP	ENST00000395891.2	37	CCDS5469.2																																																																																			.		0.463	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
HTR1B	3351	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	78172410	78172410	+	Silent	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:78172410G>A	ENST00000369947.2	-	1	1080	c.711C>T	c.(709-711)tcC>tcT	p.S237S		NM_000863.1	NP_000854.1	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled	237					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|bone remodeling (GO:0046849)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to temperature stimulus (GO:0071502)|drinking behavior (GO:0042756)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	25		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Methysergide(DB00247)|Naratriptan(DB00952)|Olanzapine(DB00334)|Ondansetron(DB00904)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	TCAAAATCCGGGAGCGGGCTT	0.597																																					p.S237S		.											.	HTR1B	90	0			c.C711T						.						51.0	57.0	55.0					6																	78172410		2203	4300	6503	SO:0001819	synonymous_variant	3351	exon1			AATCCGGGAGCGG	BC069065	CCDS4986.1	6q13	2012-08-08	2012-02-03		ENSG00000135312	ENSG00000135312		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5287	protein-coding gene	gene with protein product		182131	"""5-hydroxytryptamine (serotonin) receptor 1B"""			1348246, 11247661	Standard	NM_000863		Approved	S12, 5-HT1B, HTR1D2, 5-HT1DB	uc003pil.1	P28222	OTTHUMG00000015066	ENST00000369947.2:c.711C>T	6.37:g.78172410G>A		37.0	0.0		23.0	19.0	NM_000863	Q4VAY7	Silent	SNP	ENST00000369947.2	37	CCDS4986.1																																																																																			.		0.597	HTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041292.1	NM_000863	
HUNK	30811	ucsc.edu;bcgsc.ca	37	21	33340670	33340670	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr21:33340670T>C	ENST00000270112.2	+	6	1343	c.983T>C	c.(982-984)gTg>gCg	p.V328A		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	328					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						ACGGGCAAAGTGCCCTGTAAT	0.547																																					p.V328A		.											.	HUNK	334	0			c.T983C						.						100.0	93.0	96.0					21																	33340670		2203	4300	6503	SO:0001583	missense	30811	exon6			GCAAAGTGCCCTG	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.983T>C	21.37:g.33340670T>C	ENSP00000270112:p.Val328Ala	56.0	0.0		23.0	4.0	NM_014586		Missense_Mutation	SNP	ENST00000270112.2	37	CCDS13610.1	.	.	.	.	.	.	.	.	.	.	T	9.799	1.179977	0.21787	.	.	ENSG00000142149	ENST00000270112	T	0.68025	-0.3	5.37	1.65	0.23941	Protein kinase-like domain (1);	0.421176	0.22432	N	0.060136	T	0.36026	0.0952	N	0.03608	-0.345	0.26051	N	0.981478	B	0.06786	0.001	B	0.04013	0.001	T	0.16129	-1.0413	10	0.33940	T	0.23	-27.7201	4.9765	0.14144	0.0:0.3044:0.1548:0.5408	.	328	P57058	HUNK_HUMAN	A	328	ENSP00000270112:V328A	ENSP00000270112:V328A	V	+	2	0	HUNK	32262541	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.553000	0.23391	0.464000	0.27142	0.519000	0.50382	GTG	.		0.547	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586	
IGSF11	152404	broad.mit.edu;bcgsc.ca	37	3	118621409	118621409	+	Silent	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:118621409A>G	ENST00000393775.2	-	7	1559	c.1254T>C	c.(1252-1254)ccT>ccC	p.P418P	IGSF11_ENST00000441144.2_Silent_p.P393P|IGSF11_ENST00000489689.1_Silent_p.P394P|IGSF11_ENST00000354673.2_Silent_p.P417P|IGSF11_ENST00000425327.2_Silent_p.P417P|IGSF11_ENST00000491903.1_Silent_p.P390P	NM_001015887.1	NP_001015887.1	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11	418					cell adhesion (GO:0007155)|regulation of growth (GO:0040008)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GTACCATGACAGGTACTGCAC	0.522																																					p.P418P		.											.	IGSF11	90	0			c.T1254C						.						141.0	128.0	132.0					3																	118621409		2203	4300	6503	SO:0001819	synonymous_variant	152404	exon7			CATGACAGGTACT	AB079879	CCDS2983.1, CCDS46891.1	3q21.2	2013-01-11			ENSG00000144847	ENSG00000144847		"""Immunoglobulin superfamily / I-set domain containing"""	16669	protein-coding gene	gene with protein product	"""cancer/testis antigen 119"""	608351				12207903	Standard	XM_006713516		Approved	BT-IgSF, MGC35227, Igsf13, VSIG3, CT119	uc003ebw.3	Q5DX21	OTTHUMG00000159387	ENST00000393775.2:c.1254T>C	3.37:g.118621409A>G		105.0	0.0		94.0	8.0	NM_001015887	C9JZN0|Q8N4F1|Q8N7T8|Q8NDD2	Silent	SNP	ENST00000393775.2	37	CCDS46891.1																																																																																			.		0.522	IGSF11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355075.2		
IGSF10	285313	ucsc.edu;bcgsc.ca	37	3	151155692	151155692	+	Silent	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:151155692A>G	ENST00000282466.3	-	6	6656	c.6657T>C	c.(6655-6657)agT>agC	p.S2219S	IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2219	Ig-like C2-type 8.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGTCATCCCCACTGGGATTTC	0.423																																					p.S2219S		.											.	IGSF10	102	0			c.T6657C						.						118.0	110.0	113.0					3																	151155692		2203	4300	6503	SO:0001819	synonymous_variant	285313	exon6			ATCCCCACTGGGA	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.6657T>C	3.37:g.151155692A>G		49.0	0.0		39.0	4.0	NM_178822	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	ENST00000282466.3	37	CCDS3160.1																																																																																			.		0.423	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
IKZF4	64375	ucsc.edu;bcgsc.ca	37	12	56428968	56428968	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:56428968C>T	ENST00000262032.5	+	12	1978	c.1611C>T	c.(1609-1611)atC>atT	p.I537I	IKZF4_ENST00000547167.1_Silent_p.I537I|IKZF4_ENST00000547791.1_Silent_p.I492I|RP11-603J24.4_ENST00000551846.1_RNA|IKZF4_ENST00000431367.2_Silent_p.I435I			Q9H2S9	IKZF4_HUMAN	IKAROS family zinc finger 4 (Eos)	537					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|lung(3)|ovary(1)|prostate(1)	8			UCEC - Uterine corpus endometrioid carcinoma (6;0.025)|OV - Ovarian serous cystadenocarcinoma(18;0.123)			ACTGCCGTATCCTCTTCCTGG	0.577																																					p.I537I		.											.	IKZF4	205	0			c.C1611T						.						234.0	235.0	235.0					12																	56428968		2183	4296	6479	SO:0001819	synonymous_variant	64375	exon8			CCGTATCCTCTTC	AF230809	CCDS44917.1	12q13	2013-01-08	2006-08-25	2006-08-25		ENSG00000123411		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13179	protein-coding gene	gene with protein product		606239	"""zinc finger protein, subfamily 1A, 4 (Eos)"""	ZNFN1A4		10978333	Standard	NM_022465		Approved	Eos	uc001sjc.1	Q9H2S9		ENST00000262032.5:c.1611C>T	12.37:g.56428968C>T		37.0	0.0		41.0	4.0	NM_022465	Q96JP3	Silent	SNP	ENST00000262032.5	37	CCDS44917.1																																																																																			.		0.577	IKZF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407590.1	NM_022465	
IL12B	3593	ucsc.edu;bcgsc.ca	37	5	158750288	158750288	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:158750288C>T	ENST00000231228.2	-	3	593	c.138G>A	c.(136-138)gtG>gtA	p.V46V		NM_002187.2	NP_002178.2	P29460	IL12B_HUMAN	interleukin 12B	46	Ig-like C2-type.				cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|interferon-gamma biosynthetic process (GO:0042095)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of cell adhesion (GO:0045785)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to UV-B (GO:0010224)|sensory perception of pain (GO:0019233)|sexual reproduction (GO:0019953)|T-helper 1 type immune response (GO:0042088)|T-helper cell differentiation (GO:0042093)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)|interleukin-23 complex (GO:0070743)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)|identical protein binding (GO:0042802)|interleukin-12 alpha subunit binding (GO:0042164)|interleukin-12 receptor binding (GO:0005143)|protein heterodimerization activity (GO:0046982)			cervix(1)|endometrium(1)|large_intestine(5)|lung(4)	11	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGGTGAGGACCACCATTTCTC	0.512																																					p.V46V		.											.	IL12B	90	0			c.G138A						.						88.0	78.0	82.0					5																	158750288		2203	4300	6503	SO:0001819	synonymous_variant	3593	exon3			GAGGACCACCATT	M65290	CCDS4346.1	5q31.1-q33.1	2014-09-17	2014-04-04		ENSG00000113302	ENSG00000113302		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5970	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor-2"", ""cytotoxic lymphocyte maturation factor 2, p40"", ""interleukin 12, p40"", ""natural killer cell stimulatory factor, 40 kD subunit"", ""interleukin-12 beta chain"", ""IL12, subunit p40"""	161561	"""interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)"""	NKSF2		1673147	Standard	NM_002187		Approved	CLMF, IL-12B, NKSF, CLMF2	uc003lxr.1	P29460	OTTHUMG00000130307	ENST00000231228.2:c.138G>A	5.37:g.158750288C>T		53.0	1.0		44.0	5.0	NM_002187		Silent	SNP	ENST00000231228.2	37	CCDS4346.1																																																																																			.		0.512	IL12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252652.2	NM_002187	
IL33	90865	ucsc.edu;bcgsc.ca	37	9	6251188	6251188	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:6251188C>T	ENST00000381434.3	+	3	279	c.266C>T	c.(265-267)tCt>tTt	p.S89F	IL33_ENST00000417746.2_Intron|IL33_ENST00000456383.2_Missense_Mutation_p.S89F	NM_033439.3	NP_254274.1	O95760	IL33_HUMAN	interleukin 33	89	Interaction with RELA. {ECO:0000250}.				extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of immunoglobulin secretion (GO:0051025)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type 2 immune response (GO:0002830)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|nucleus (GO:0005634)	cytokine activity (GO:0005125)			breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|stomach(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(23;0.158)|Prostate(43;0.167)		GBM - Glioblastoma multiforme(50;0.0161)|Lung(218;0.105)		CAACAGCAGTCTACTGTGGAG	0.468																																					p.S89F		.											.	IL33	90	0			c.C266T						.						181.0	148.0	159.0					9																	6251188		2203	4300	6503	SO:0001583	missense	90865	exon4			AGCAGTCTACTGT	AB024518	CCDS6468.1, CCDS56563.1, CCDS56564.1	9p24.1	2014-01-28	2006-11-20	2006-11-20	ENSG00000137033	ENSG00000137033		"""Interleukins and interleukin receptors"""	16028	protein-coding gene	gene with protein product	"""DVS27-related protein"", ""nuclear factor for high endothelial venules"", ""interleukin-1 family, member 11"""	608678	"""chromosome 9 open reading frame 26 (NF-HEV)"""	C9orf26		10566975, 12819012	Standard	NM_033439		Approved	DVS27, DKFZp586H0523, NF-HEV, IL1F11	uc003zjt.3	O95760	OTTHUMG00000019516	ENST00000381434.3:c.266C>T	9.37:g.6251188C>T	ENSP00000370842:p.Ser89Phe	54.0	0.0		39.0	4.0	NM_001199640	B2R8L1|B4DJ35|B4E1Q9|D3DRI5|E7EAX4|Q2YEJ5	Missense_Mutation	SNP	ENST00000381434.3	37	CCDS6468.1	.	.	.	.	.	.	.	.	.	.	C	9.290	1.050301	0.19827	.	.	ENSG00000137033	ENST00000456383;ENST00000381434	T;T	0.41400	1.0;1.0	2.56	-0.873	0.10635	.	2.883760	0.01057	N	0.004578	T	0.31979	0.0814	L	0.29908	0.895	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.002	T	0.28202	-1.0051	10	0.62326	D	0.03	16.0233	5.4006	0.16293	0.0:0.4426:0.0:0.5574	.	89;89	B4E1Q9;O95760	.;IL33_HUMAN	F	89	ENSP00000414238:S89F;ENSP00000370842:S89F	ENSP00000370842:S89F	S	+	2	0	IL33	6241188	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.815000	0.04481	-0.189000	0.10482	-0.142000	0.14014	TCT	.		0.468	IL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051655.1	NM_033439	
IMPDH1	3614	ucsc.edu;bcgsc.ca	37	7	128038520	128038520	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:128038520T>C	ENST00000480861.1	-	7	829	c.752A>G	c.(751-753)gAc>gGc	p.D251G	IMPDH1_ENST00000343214.4_Missense_Mutation_p.D231G|IMPDH1_ENST00000338791.6_Missense_Mutation_p.D341G|IMPDH1_ENST00000378717.4_Missense_Mutation_p.D272G|IMPDH1_ENST00000348127.6_Missense_Mutation_p.D305G|IMPDH1_ENST00000470772.1_Missense_Mutation_p.D255G|IMPDH1_ENST00000354269.5_Missense_Mutation_p.D331G|IMPDH1_ENST00000496200.1_Missense_Mutation_p.D231G|IMPDH1_ENST00000419067.2_Missense_Mutation_p.D308G	NM_001142574.1	NP_001136046.1			IMP (inosine 5'-monophosphate) dehydrogenase 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)	22						ACGGTATTTGTCATCCTCACG	0.617											OREG0018292	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D341G		.											.	IMPDH1	230	0			c.A1022G						.						51.0	53.0	52.0					7																	128038520		2203	4300	6503	SO:0001583	missense	3614	exon10			TATTTGTCATCCT		CCDS34748.1, CCDS34749.1, CCDS43643.1, CCDS47699.1, CCDS47700.1, CCDS55161.1	7q31.3-q32	2013-01-08	2010-04-29		ENSG00000106348	ENSG00000106348	1.1.1.205		6052	protein-coding gene	gene with protein product		146690	"""retinitis pigmentosa 10 (autosomal dominant)"", ""IMP (inosine monophosphate) dehydrogenase 1"""	RP10		1969416, 11875049, 11875050	Standard	NM_000883		Approved	sWSS2608, LCA11	uc003vmu.2	P20839	OTTHUMG00000157713	ENST00000480861.1:c.752A>G	7.37:g.128038520T>C	ENSP00000420185:p.Asp251Gly	63.0	0.0	1561	42.0	4.0	NM_000883		Missense_Mutation	SNP	ENST00000480861.1	37	CCDS55161.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.790225	0.90367	.	.	ENSG00000106348	ENST00000419067;ENST00000338791;ENST00000496200;ENST00000354269;ENST00000378717;ENST00000348127;ENST00000343214;ENST00000470772;ENST00000480861;ENST00000497868	T;T;T;T;T;T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26	5.29	5.29	0.74685	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.000000	0.85682	D	0.000000	D	0.86188	0.5873	M	0.67625	2.065	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.997;1.0;0.99;0.999;0.974;0.989;0.996	D;D;D;D;D;P;D;D	0.97110	1.0;0.993;1.0;0.98;0.996;0.789;0.923;0.988	D	0.87626	0.2513	10	0.87932	D	0	-40.2298	13.2157	0.59859	0.0:0.0:0.0:1.0	.	308;251;256;272;331;305;341;231	C9JV30;B4DE09;P20839;E7EQS0;Q5H9Q6;P20839-3;A4D0Z6;P20839-2	.;.;IMDH1_HUMAN;.;.;.;.;.	G	308;341;231;331;272;305;231;255;251;272	ENSP00000399400:D308G;ENSP00000345096:D341G;ENSP00000420803:D231G;ENSP00000346219:D331G;ENSP00000367989:D272G;ENSP00000265385:D305G;ENSP00000342438:D231G;ENSP00000417296:D255G;ENSP00000420185:D251G;ENSP00000419609:D272G	ENSP00000345096:D341G	D	-	2	0	IMPDH1	127825756	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.015000	0.88690	2.016000	0.59253	0.533000	0.62120	GAC	.		0.617	IMPDH1-009	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000349462.1	NM_000883	
INF2	64423	ucsc.edu;bcgsc.ca	37	14	105175662	105175662	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr14:105175662C>T	ENST00000392634.4	+	11	2106	c.1994C>T	c.(1993-1995)aCc>aTc	p.T665I	INF2_ENST00000330634.7_Missense_Mutation_p.T665I	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	665	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		GGAGATACCACCAAGTTTGAT	0.587											OREG0022959	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T665I		.											.	INF2	492	0			c.C1994T						.						74.0	80.0	78.0					14																	105175662		1983	4149	6132	SO:0001583	missense	64423	exon11			ATACCACCAAGTT	AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.1994C>T	14.37:g.105175662C>T	ENSP00000376410:p.Thr665Ile	37.0	0.0	1387	26.0	4.0	NM_022489	Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Missense_Mutation	SNP	ENST00000392634.4	37	CCDS9989.2	.	.	.	.	.	.	.	.	.	.	C	10.18	1.278250	0.23307	.	.	ENSG00000203485	ENST00000330634;ENST00000392634	T;T	0.17691	2.26;2.26	4.47	2.54	0.30619	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.553767	0.18917	U	0.127600	T	0.21761	0.0524	L	0.46157	1.445	0.80722	D	1	P;P	0.50369	0.919;0.934	B;P	0.47206	0.316;0.541	T	0.01309	-1.1389	10	0.56958	D	0.05	.	13.912	0.63873	0.0:0.6972:0.3028:0.0	.	665;665	Q27J81-2;Q27J81	.;INF2_HUMAN	I	665	ENSP00000376406:T665I;ENSP00000376410:T665I	ENSP00000252527:T133I	T	+	2	0	INF2	104246707	0.040000	0.19996	0.709000	0.30452	0.156000	0.22039	2.308000	0.43690	0.276000	0.22118	0.561000	0.74099	ACC	.		0.587	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000074371.4	NM_022489	
INF2	64423	ucsc.edu;bcgsc.ca	37	14	105178003	105178003	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr14:105178003C>T	ENST00000392634.4	+	16	2568	c.2456C>T	c.(2455-2457)cCc>cTc	p.P819L	INF2_ENST00000330634.7_Missense_Mutation_p.P819L	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	819	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		CTGCAGCTGCCCCGGGACCTG	0.647																																					p.P819L		.											.	INF2	492	0			c.C2456T						.						49.0	63.0	59.0					14																	105178003		2035	4181	6216	SO:0001583	missense	64423	exon16			AGCTGCCCCGGGA	AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.2456C>T	14.37:g.105178003C>T	ENSP00000376410:p.Pro819Leu	80.0	0.0		41.0	4.0	NM_022489	Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Missense_Mutation	SNP	ENST00000392634.4	37	CCDS9989.2	.	.	.	.	.	.	.	.	.	.	C	17.34	3.363795	0.61513	.	.	ENSG00000203485	ENST00000330634;ENST00000392634	T;T	0.17054	2.3;2.3	4.17	3.28	0.37604	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.115854	0.64402	N	0.000013	T	0.29355	0.0731	M	0.84846	2.72	0.80722	D	1	P;P	0.37525	0.543;0.598	B;B	0.42361	0.197;0.385	T	0.09640	-1.0665	10	0.72032	D	0.01	.	10.682	0.45819	0.0:0.9039:0.0:0.096	.	819;819	Q27J81-2;Q27J81	.;INF2_HUMAN	L	819	ENSP00000376406:P819L;ENSP00000376410:P819L	ENSP00000252527:P287L	P	+	2	0	INF2	104249048	0.978000	0.34361	0.455000	0.27031	0.374000	0.29953	6.529000	0.73812	0.738000	0.32606	0.491000	0.48974	CCC	.		0.647	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000074371.4	NM_022489	
INPP4B	8821	ucsc.edu;bcgsc.ca	37	4	143043367	143043367	+	Silent	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:143043367G>T	ENST00000513000.1	-	22	2482	c.2049C>A	c.(2047-2049)gcC>gcA	p.A683A	INPP4B_ENST00000262992.4_Silent_p.A683A|INPP4B_ENST00000508116.1_Silent_p.A683A|INPP4B_ENST00000308502.4_Silent_p.A683A|INPP4B_ENST00000509777.1_Silent_p.A683A	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	683				A -> P (in Ref. 1; AAB72153). {ECO:0000305}.	cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					AAATGCCAACGGCCATGTCCT	0.388																																					p.A683A		.											.	INPP4B	228	0			c.C2049A						.						98.0	95.0	96.0					4																	143043367		2203	4300	6503	SO:0001819	synonymous_variant	8821	exon22			GCCAACGGCCATG	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.2049C>A	4.37:g.143043367G>T		54.0	0.0		48.0	5.0	NM_003866	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Silent	SNP	ENST00000513000.1	37	CCDS3757.1																																																																																			.		0.388	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	
INSIG1	3638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	155094019	155094019	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:155094019G>A	ENST00000340368.4	+	4	807	c.596G>A	c.(595-597)gGc>gAc	p.G199D	INSIG1_ENST00000344756.4_Missense_Mutation_p.G47D|INSIG1_ENST00000342407.5_Intron	NM_005542.4	NP_005533.2	O15503	INSI1_HUMAN	insulin induced gene 1	199					cell proliferation (GO:0008283)|cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|metabolic process (GO:0008152)|middle ear morphogenesis (GO:0042474)|negative regulation of cargo loading into COPII-coated vesicle (GO:1901303)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)				endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	19	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTATCTTTGGGCCTTTGGTGG	0.433																																					p.G199D		.											.	INSIG1	90	0			c.G596A						.						109.0	103.0	105.0					7																	155094019		2203	4300	6503	SO:0001583	missense	3638	exon4			CTTTGGGCCTTTG		CCDS5938.1, CCDS5939.1	7q36	2008-07-18			ENSG00000186480	ENSG00000186480			6083	protein-coding gene	gene with protein product	"""INSIG-1 membrane protein"""	602055				9268630	Standard	NM_005542		Approved	CL-6, MGC1405	uc003wly.3	O15503	OTTHUMG00000151330	ENST00000340368.4:c.596G>A	7.37:g.155094019G>A	ENSP00000344741:p.Gly199Asp	246.0	0.0		209.0	41.0	NM_005542	A4D2N1|A8K6L0|Q53XW8|Q9BUV5	Missense_Mutation	SNP	ENST00000340368.4	37	CCDS5938.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.921890	0.92319	.	.	ENSG00000186480	ENST00000340368;ENST00000344756	T;T	0.50001	0.76;0.81	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.70202	0.3197	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.982;1.0	T	0.66697	-0.5858	10	0.35671	T	0.21	.	19.8944	0.96949	0.0:0.0:1.0:0.0	.	47;199	F5H6P3;O15503	.;INSI1_HUMAN	D	199;47	ENSP00000344741:G199D;ENSP00000340010:G47D	ENSP00000344741:G199D	G	+	2	0	INSIG1	154724954	1.000000	0.71417	0.958000	0.39756	0.644000	0.38419	9.113000	0.94321	2.695000	0.91970	0.650000	0.86243	GGC	.		0.433	INSIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322244.3	NM_198336	
IQGAP1	8826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	91020941	91020941	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr15:91020941C>T	ENST00000268182.5	+	26	3273	c.3149C>T	c.(3148-3150)aCg>aTg	p.T1050M	IQGAP1_ENST00000560738.1_Missense_Mutation_p.T478M	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1050	C1.|Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			GGAAATCCTACGGTTATTAAA	0.398																																					p.T1050M		.											.	IQGAP1	950	0			c.C3149T						.						93.0	97.0	96.0					15																	91020941		2198	4298	6496	SO:0001583	missense	8826	exon26			ATCCTACGGTTAT	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.3149C>T	15.37:g.91020941C>T	ENSP00000268182:p.Thr1050Met	63.0	0.0		67.0	15.0	NM_003870	A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	37	CCDS10362.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.929800	0.92389	.	.	ENSG00000140575	ENST00000268182	T	0.79749	-1.3	5.86	5.86	0.93980	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.000000	0.85682	D	0.000000	D	0.89399	0.6704	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87909	0.2696	10	0.42905	T	0.14	-16.0744	19.1654	0.93555	0.0:1.0:0.0:0.0	.	1050	P46940	IQGA1_HUMAN	M	1050	ENSP00000268182:T1050M	ENSP00000268182:T1050M	T	+	2	0	IQGAP1	88821945	1.000000	0.71417	0.993000	0.49108	0.976000	0.68499	7.755000	0.85180	2.778000	0.95560	0.655000	0.94253	ACG	.		0.398	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
ISL1	3670	ucsc.edu;bcgsc.ca	37	5	50685754	50685754	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:50685754C>T	ENST00000230658.7	+	4	1338	c.753C>T	c.(751-753)ccC>ccT	p.P251P	ISL1_ENST00000505475.2_3'UTR|ISL1_ENST00000511384.1_Silent_p.P251P	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	251	Gln-rich.				atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				AGCAGCAGCCCAATGACAAAA	0.602																																					p.P251P		.											.	ISL1	515	0			c.C753T						.						43.0	51.0	48.0					5																	50685754		2189	4292	6481	SO:0001819	synonymous_variant	3670	exon4			GCAGCCCAATGAC	BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.753C>T	5.37:g.50685754C>T		34.0	0.0		42.0	4.0	NM_002202	P20663|P47894	Silent	SNP	ENST00000230658.7	37	CCDS43314.1	.	.	.	.	.	.	.	.	.	.	C	1.349	-0.592071	0.03799	.	.	ENSG00000016082	ENST00000505475	.	.	.	5.63	0.941	0.19519	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.3106	0.26473	0.1018:0.454:0.3718:0.0725	.	.	.	.	X	198	.	ENSP00000421737:Q198X	Q	+	1	0	ISL1	50721511	0.653000	0.27358	1.000000	0.80357	0.144000	0.21451	-0.088000	0.11198	0.283000	0.22279	0.650000	0.86243	CAA	.		0.602	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3	NM_002202	
KBTBD3	143879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	105925003	105925003	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:105925003G>C	ENST00000526793.1	-	3	572	c.413C>G	c.(412-414)tCc>tGc	p.S138C	KBTBD3_ENST00000531837.1_Missense_Mutation_p.S138C|KBTBD3_ENST00000534815.1_Missense_Mutation_p.S59C	NM_152433.3	NP_689646.2	Q8NAB2	KBTB3_HUMAN	kelch repeat and BTB (POZ) domain containing 3	134										NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	25		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		GCAAGCTTTGGATAGGAAGGA	0.318																																					p.S138C		.											.	KBTBD3	91	0			c.C413G						.						66.0	70.0	68.0					11																	105925003		2200	4298	6498	SO:0001583	missense	143879	exon3			GCTTTGGATAGGA	AK055247	CCDS8334.1	11q22.3	2013-01-08	2003-12-12	2003-12-17		ENSG00000182359		"""BTB/POZ domain containing"""	22934	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 3"""	BKLHD3			Standard	NM_198439		Approved		uc001pjb.3	Q8NAB2		ENST00000526793.1:c.413C>G	11.37:g.105925003G>C	ENSP00000436262:p.Ser138Cys	138.0	0.0		72.0	26.0	NM_152433	Q6N066|Q86X38|Q96NK5	Missense_Mutation	SNP	ENST00000526793.1	37	CCDS8334.1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.785454	0.49997	.	.	ENSG00000182359	ENST00000534815;ENST00000526793;ENST00000531837	T;T;T	0.70869	-0.52;-0.52;-0.52	5.36	5.36	0.76844	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.163800	0.56097	D	0.000028	T	0.67869	0.2939	N	0.13098	0.295	0.38045	D	0.935583	B;P	0.42456	0.347;0.78	P;P	0.49999	0.505;0.628	T	0.75263	-0.3379	10	0.72032	D	0.01	.	19.0932	0.93238	0.0:0.0:1.0:0.0	.	138;134	A8K1K0;Q8NAB2	.;KBTB3_HUMAN	C	59;138;138	ENSP00000431910:S59C;ENSP00000436262:S138C;ENSP00000432163:S138C	ENSP00000436262:S138C	S	-	2	0	KBTBD3	105430213	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.923000	0.56469	2.511000	0.84671	0.650000	0.86243	TCC	.		0.318	KBTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388705.2	NM_152433	
KCNB2	9312	ucsc.edu;bcgsc.ca	37	8	73849698	73849698	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr8:73849698C>A	ENST00000523207.1	+	3	2696	c.2108C>A	c.(2107-2109)tCt>tAt	p.S703Y		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	703					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	CCTAAGAGCTCTCTAAAAGGC	0.532																																					p.S703Y		.											.	KCNB2	158	0			c.C2108A						.						71.0	72.0	71.0					8																	73849698		2203	4300	6503	SO:0001583	missense	9312	exon3			AGAGCTCTCTAAA	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.2108C>A	8.37:g.73849698C>A	ENSP00000430846:p.Ser703Tyr	40.0	0.0		49.0	4.0	NM_004770	Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	C	16.30	3.084991	0.55861	.	.	ENSG00000182674	ENST00000523207	T	0.28454	1.61	4.8	4.8	0.61643	.	1.543160	0.04694	N	0.414735	T	0.59838	0.2223	M	0.61703	1.905	0.50813	D	0.999891	D	0.69078	0.997	D	0.71870	0.975	T	0.44452	-0.9327	10	0.72032	D	0.01	.	18.0309	0.89283	0.0:1.0:0.0:0.0	.	703	Q92953	KCNB2_HUMAN	Y	703	ENSP00000430846:S703Y	ENSP00000430846:S703Y	S	+	2	0	KCNB2	74012252	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.144000	0.77357	2.486000	0.83907	0.591000	0.81541	TCT	.		0.532	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
KCNK10	54207	ucsc.edu;bcgsc.ca	37	14	88654418	88654418	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr14:88654418T>C	ENST00000340700.5	-	6	1340	c.889A>G	c.(889-891)Aag>Gag	p.K297E	KCNK10_ENST00000319231.5_Missense_Mutation_p.K302E|KCNK10_ENST00000312350.5_Missense_Mutation_p.K302E	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	297					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						ACTAGGGGCTTATACCACTCC	0.443																																					p.K302E		.											.	KCNK10	95	0			c.A904G						.						159.0	154.0	156.0					14																	88654418		2203	4300	6503	SO:0001583	missense	54207	exon6			GGGGCTTATACCA	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.889A>G	14.37:g.88654418T>C	ENSP00000343104:p.Lys297Glu	58.0	0.0		40.0	4.0	NM_138318	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	ENST00000340700.5	37	CCDS9880.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.817731	0.90790	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	T;T;T	0.37411	1.2;1.2;1.2	5.52	5.52	0.82312	Ion transport 2 (1);	0.043589	0.85682	D	0.000000	T	0.53012	0.1770	M	0.81614	2.55	0.80722	D	1	P;P;B	0.51537	0.732;0.946;0.418	P;P;B	0.51055	0.657;0.657;0.326	T	0.60115	-0.7326	10	0.62326	D	0.03	.	15.1125	0.72368	0.0:0.0:0.0:1.0	.	297;302;302	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	E	297;302;302	ENSP00000343104:K297E;ENSP00000310568:K302E;ENSP00000312811:K302E	ENSP00000310568:K302E	K	-	1	0	KCNK10	87724171	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.972000	0.88022	2.225000	0.72522	0.459000	0.35465	AAG	.		0.443	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161	
KCNT1	57582	ucsc.edu;bcgsc.ca	37	9	138661869	138661869	+	Silent	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:138661869C>A	ENST00000263604.3	+	16	1530	c.1530C>A	c.(1528-1530)ctC>ctA	p.L510L	KCNT1_ENST00000488444.2_Silent_p.L510L|KCNT1_ENST00000298480.5_Silent_p.L529L|KCNT1_ENST00000371757.2_Silent_p.L529L|KCNT1_ENST00000486577.2_Silent_p.L490L|KCNT1_ENST00000490355.2_Silent_p.L510L|KCNT1_ENST00000491806.2_Silent_p.L496L|KCNT1_ENST00000487664.1_Silent_p.L484L			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	510	RCK N-terminal.				potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CCTCCACCCTCATCACCCTGC	0.711																																					p.L529L		.											.	KCNT1	137	0			c.C1587A						.						65.0	42.0	50.0					9																	138661869		2160	4225	6385	SO:0001819	synonymous_variant	57582	exon16			CACCCTCATCACC	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.1530C>A	9.37:g.138661869C>A		72.0	0.0		35.0	4.0	NM_020822	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Silent	SNP	ENST00000263604.3	37																																																																																				.		0.711	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
KCNU1	157855	ucsc.edu;bcgsc.ca	37	8	36788605	36788605	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr8:36788605G>T	ENST00000399881.3	+	25	2910	c.2873G>T	c.(2872-2874)aGa>aTa	p.R958I	KCNU1_ENST00000518904.1_3'UTR	NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	958					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TTGTCTGGAAGAAACCGGTGT	0.433																																					p.R958I		.											.	KCNU1	23	0			c.G2873T						.						139.0	133.0	135.0					8																	36788605		1909	4126	6035	SO:0001583	missense	157855	exon25			CTGGAAGAAACCG	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.2873G>T	8.37:g.36788605G>T	ENSP00000382770:p.Arg958Ile	94.0	0.0		32.0	5.0	NM_001031836		Missense_Mutation	SNP	ENST00000399881.3	37	CCDS55220.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.073558	0.36566	.	.	ENSG00000215262	ENST00000399881	T	0.44881	0.91	5.41	2.65	0.31530	.	0.475516	0.15032	U	0.284415	T	0.43523	0.1251	M	0.73962	2.25	0.21105	N	0.99978	P	0.48162	0.906	P	0.44732	0.459	T	0.40887	-0.9539	10	0.87932	D	0	-6.737	5.057	0.14539	0.2487:0.1526:0.5987:0.0	.	958	A8MYU2	KCNU1_HUMAN	I	958	ENSP00000382770:R958I	ENSP00000382770:R958I	R	+	2	0	KCNU1	36907763	0.012000	0.17670	0.002000	0.10522	0.003000	0.03518	0.805000	0.27112	0.269000	0.21961	-0.145000	0.13849	AGA	.		0.433	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836	
KDM2A	22992	ucsc.edu;bcgsc.ca	37	11	66999328	66999328	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:66999328A>G	ENST00000529006.2	+	12	1822	c.1376A>G	c.(1375-1377)gAa>gGa	p.E459G	KDM2A_ENST00000398645.2_Missense_Mutation_p.E459G|KDM2A_ENST00000526258.1_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	459					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						TTTGAGCTTGAAGGCCTTCGC	0.517																																					p.E459G		.											.	KDM2A	661	0			c.A1376G						.						133.0	135.0	134.0					11																	66999328		2050	4184	6234	SO:0001583	missense	22992	exon12			AGCTTGAAGGCCT	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.1376A>G	11.37:g.66999328A>G	ENSP00000432786:p.Glu459Gly	42.0	0.0		17.0	4.0	NM_012308	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	ENST00000529006.2	37	CCDS44657.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.511772	0.85389	.	.	ENSG00000173120	ENST00000398645;ENST00000529006	T;T	0.34859	1.34;1.34	5.52	5.52	0.82312	.	0.053143	0.64402	D	0.000001	T	0.30978	0.0782	L	0.43923	1.385	0.80722	D	1	P	0.35745	0.518	B	0.33890	0.172	T	0.07009	-1.0795	10	0.33141	T	0.24	-18.0362	13.6726	0.62434	1.0:0.0:0.0:0.0	.	459	Q9Y2K7	KDM2A_HUMAN	G	459	ENSP00000381640:E459G;ENSP00000432786:E459G	ENSP00000381640:E459G	E	+	2	0	KDM2A	66755904	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.897000	0.92532	2.229000	0.72834	0.523000	0.50628	GAA	.		0.517	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393140.2	NM_012308	
KDM4A	9682	ucsc.edu;bcgsc.ca	37	1	44132198	44132198	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:44132198T>C	ENST00000372396.3	+	7	883	c.749T>C	c.(748-750)cTg>cCg	p.L250P	KDM4A_ENST00000463151.1_3'UTR	NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A	250	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						CCGTTAATGCTGAAGAAATAT	0.433																																					p.L250P		.											.	KDM4A	227	0			c.T749C						.						94.0	84.0	87.0					1																	44132198		2203	4300	6503	SO:0001583	missense	9682	exon7			TAATGCTGAAGAA	AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.749T>C	1.37:g.44132198T>C	ENSP00000361473:p.Leu250Pro	49.0	0.0		30.0	4.0	NM_014663	Q5VVB1	Missense_Mutation	SNP	ENST00000372396.3	37	CCDS491.1	.	.	.	.	.	.	.	.	.	.	T	30	5.052225	0.93793	.	.	ENSG00000066135	ENST00000372396	T	0.80123	-1.34	6.05	6.05	0.98169	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.93858	0.8035	H	0.98155	4.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95951	0.8954	10	0.87932	D	0	-13.8506	16.5932	0.84781	0.0:0.0:0.0:1.0	.	250;250	B4DT38;O75164	.;KDM4A_HUMAN	P	250	ENSP00000361473:L250P	ENSP00000361473:L250P	L	+	2	0	KDM4A	43904785	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.977000	0.88081	2.320000	0.78422	0.528000	0.53228	CTG	.		0.433	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019960.1	NM_014663	
RIC1	57589	ucsc.edu;bcgsc.ca	37	9	5774022	5774022	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:5774022G>A	ENST00000414202.2	+	26	4239	c.4048G>A	c.(4048-4050)Gaa>Aaa	p.E1350K	KIAA1432_ENST00000449720.2_Missense_Mutation_p.E1234K|KIAA1432_ENST00000418622.3_Missense_Mutation_p.E1271K	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		TGAGATAACAGAAGAGCAGGT	0.473																																					p.E1350K		.											.	KIAA1432	90	0			c.G4048A						.						78.0	74.0	75.0					9																	5774022		2203	4300	6503	SO:0001583	missense	57589	exon26			ATAACAGAAGAGC																												ENST00000414202.2:c.4048G>A	9.37:g.5774022G>A	ENSP00000416696:p.Glu1350Lys	111.0	0.0		48.0	5.0	NM_020829		Missense_Mutation	SNP	ENST00000414202.2	37	CCDS34982.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.56|15.56	2.869075|2.869075	0.51588|0.51588	.|.	.|.	ENSG00000107036|ENSG00000107036	ENST00000414202;ENST00000418622;ENST00000449720|ENST00000545641	.|.	.|.	.|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	0.159753|.	0.56097|.	D|.	0.000031|.	T|T	0.71290|0.71290	0.3322|0.3322	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	B;P|.	0.34462|.	0.255;0.454|.	B;B|.	0.22386|.	0.026;0.039|.	T|T	0.66118|0.66118	-0.6003|-0.6003	9|5	0.09590|.	T|.	0.72|.	-15.0087|-15.0087	20.0463|20.0463	0.97608|0.97608	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1234;1350|.	B7ZM67;Q4ADV7|.	.;RIC1_HUMAN|.	K|K	1350;1271;1234|1241	.|.	ENSP00000416696:E1350K|.	E|R	+|+	1|2	0|0	KIAA1432|KIAA1432	5764022|5764022	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.878000|0.878000	0.50629|0.50629	4.139000|4.139000	0.58024|0.58024	2.729000|2.729000	0.93468|0.93468	0.561000|0.561000	0.74099|0.74099	GAA|AGA	.		0.473	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3		
KIF13B	23303	ucsc.edu;bcgsc.ca	37	8	28988090	28988090	+	Missense_Mutation	SNP	G	G	A	rs368227895		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr8:28988090G>A	ENST00000524189.1	-	24	3073	c.3035C>T	c.(3034-3036)gCa>gTa	p.A1012V	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1012					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		GACATCCTTTGCAGAAATCAC	0.418																																					p.A1012V		.											.	KIF13B	22	0			c.C3035T						.	G	VAL/ALA	0,3740		0,0,1870	142.0	134.0	136.0		3035	4.6	1.0	8		136	2,8224		0,2,4111	no	missense	KIF13B	NM_015254.3	64	0,2,5981	AA,AG,GG		0.0243,0.0,0.0167	possibly-damaging	1012/1827	28988090	2,11964	1870	4113	5983	SO:0001583	missense	23303	exon24			TCCTTTGCAGAAA	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.3035C>T	8.37:g.28988090G>A	ENSP00000427900:p.Ala1012Val	90.0	0.0		35.0	4.0	NM_015254	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	ENST00000524189.1	37	CCDS55217.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.872693	0.72180	0.0	2.43E-4	ENSG00000197892	ENST00000524189	T	0.77358	-1.09	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.78685	0.4322	M	0.71581	2.175	0.80722	D	1	P	0.40794	0.729	B	0.40009	0.316	T	0.82396	-0.0478	10	0.56958	D	0.05	.	17.5119	0.87762	0.0:0.0:1.0:0.0	.	1012	F8VPJ2	.	V	1012	ENSP00000427900:A1012V	ENSP00000427900:A1012V	A	-	2	0	KIF13B	29044009	1.000000	0.71417	0.998000	0.56505	0.416000	0.31233	9.135000	0.94478	2.358000	0.79984	0.650000	0.86243	GCA	.		0.418	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
KIF22	3835	ucsc.edu;bcgsc.ca	37	16	29816207	29816207	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:29816207C>A	ENST00000160827.4	+	12	1790	c.1750C>A	c.(1750-1752)Cta>Ata	p.L584I	MAZ_ENST00000562337.1_5'Flank|KIF22_ENST00000561482.1_Missense_Mutation_p.L516I|MAZ_ENST00000322945.6_5'Flank|MAZ_ENST00000563402.1_5'Flank|KIF22_ENST00000400751.5_Missense_Mutation_p.L516I|MAZ_ENST00000545521.1_5'Flank|AC009133.15_ENST00000566537.1_RNA|MAZ_ENST00000219782.6_5'Flank|KIF22_ENST00000569382.2_Missense_Mutation_p.L530I|MAZ_ENST00000566906.2_5'Flank	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	584					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						CAGCCCGGAGCTACTGGCTCA	0.592																																					p.L584I		.											.	KIF22	68	0			c.C1750A						.						38.0	36.0	37.0					16																	29816207		2197	4296	6493	SO:0001583	missense	3835	exon12			CCGGAGCTACTGG	D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.1750C>A	16.37:g.29816207C>A	ENSP00000160827:p.Leu584Ile	26.0	0.0		33.0	4.0	NM_007317	B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Missense_Mutation	SNP	ENST00000160827.4	37	CCDS10653.1	.	.	.	.	.	.	.	.	.	.	C	12.11	1.838821	0.32513	.	.	ENSG00000079616	ENST00000160827;ENST00000400751	T;T	0.75477	-0.94;-0.87	5.47	3.51	0.40186	.	.	.	.	.	T	0.61148	0.2324	L	0.29908	0.895	0.31851	N	0.6222	B;B	0.25235	0.098;0.121	B;B	0.20955	0.023;0.032	T	0.61569	-0.7036	9	0.45353	T	0.12	.	9.3495	0.38129	0.0:0.8216:0.0:0.1784	.	516;584	B7Z265;Q14807	.;KIF22_HUMAN	I	584;516	ENSP00000160827:L584I;ENSP00000383562:L516I	ENSP00000160827:L584I	L	+	1	2	KIF22	29723708	0.680000	0.27605	0.544000	0.28141	0.451000	0.32288	0.800000	0.27042	0.667000	0.31107	0.561000	0.74099	CTA	.		0.592	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215012.2		
KIF3B	9371	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	30897746	30897746	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr20:30897746delA	ENST00000375712.3	+	2	333	c.166delA	c.(166-168)accfs	p.T56fs	KIF3B_ENST00000418717.2_5'Flank	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	56	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)			NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			AATGCCCAAGACCTTCACCTT	0.502																																					p.T56fs		.											.	KIF3B	517	0			c.166delA						.						159.0	135.0	143.0					20																	30897746		2203	4300	6503	SO:0001589	frameshift_variant	9371	exon2			CCCAAGACCTTCA	AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.166delA	20.37:g.30897746delA	ENSP00000364864:p.Thr56fs	97.0	0.0		68.0	19.0	NM_004798	B2RMP4|B4DSR5|E1P5M5	Frame_Shift_Del	DEL	ENST00000375712.3	37	CCDS13200.1																																																																																			.		0.502	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078619.1	NM_004798	
KLK4	9622	ucsc.edu;bcgsc.ca	37	19	51411692	51411692	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:51411692T>C	ENST00000324041.1	-	4	534	c.535A>G	c.(535-537)Agt>Ggt	p.S179G	KLK4_ENST00000431178.2_Intron|KLK4_ENST00000597441.1_5'Flank	NM_004917.3	NP_004908.3	Q9Y5K2	KLK4_HUMAN	kallikrein-related peptidase 4	179	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amelogenesis (GO:0097186)|extracellular matrix disassembly (GO:0022617)|protein catabolic process (GO:0030163)|proteolysis (GO:0006508)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(8)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00624)|GBM - Glioblastoma multiforme(134;0.00878)		TAGAGCTTACTGCAGACCTCC	0.642																																					p.S179G		.											.	KLK4	226	0			c.A535G						.						133.0	112.0	119.0					19																	51411692		2203	4300	6503	SO:0001583	missense	9622	exon4			GCTTACTGCAGAC	AF113141	CCDS12809.1	19q13.41	2014-09-04	2006-10-27		ENSG00000167749	ENSG00000167749		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6365	protein-coding gene	gene with protein product		603767	"""kallikrein 4 (prostase, enamel matrix, prostate)"""	PRSS17		10077646, 10438493, 16800724, 10863090, 9465170	Standard	XM_005259441		Approved	EMSP, EMSP1, PSTS, KLK-L1	uc002pua.1	Q9Y5K2	OTTHUMG00000182964	ENST00000324041.1:c.535A>G	19.37:g.51411692T>C	ENSP00000326159:p.Ser179Gly	38.0	0.0		43.0	5.0	NM_004917	Q4VB16|Q96RU5|Q9GZL6|Q9UBJ6	Missense_Mutation	SNP	ENST00000324041.1	37	CCDS12809.1	.	.	.	.	.	.	.	.	.	.	t	11.69	1.713978	0.30413	.	.	ENSG00000167749	ENST00000324041	D	0.89196	-2.48	3.79	-1.65	0.08291	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.374750	0.05386	N	0.538121	T	0.78960	0.4366	N	0.24115	0.695	0.09310	N	0.999998	P	0.40931	0.733	B	0.35859	0.212	T	0.69624	-0.5095	10	0.52906	T	0.07	.	5.9977	0.19503	0.0:0.1089:0.5303:0.3608	.	179	Q9Y5K2	KLK4_HUMAN	G	179	ENSP00000326159:S179G	ENSP00000326159:S179G	S	-	1	0	KLK4	56103504	0.011000	0.17503	0.009000	0.14445	0.001000	0.01503	-0.296000	0.08287	-0.162000	0.10964	-0.441000	0.05720	AGT	.		0.642	KLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464449.1	NM_004917	
KSR1	8844	ucsc.edu;bcgsc.ca	37	17	25944438	25944438	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr17:25944438T>C	ENST00000319524.6	+	20	2677	c.2677T>C	c.(2677-2679)Ttc>Ctc	p.F893L	KSR1_ENST00000398988.3_Missense_Mutation_p.F756L|KSR1_ENST00000582410.1_Missense_Mutation_p.F107L|KSR1_ENST00000509603.2_Missense_Mutation_p.F871L|KSR1_ENST00000268763.6_Missense_Mutation_p.F756L			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	893					Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		CCCTGGACACTTCTGGAAGTC	0.592																																					p.F756L	Esophageal Squamous(88;1120 1336 6324 10502 16832)	.											.	KSR1	964	0			c.T2266C						.						34.0	37.0	36.0					17																	25944438		1973	4158	6131	SO:0001583	missense	8844	exon20			GGACACTTCTGGA	U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.2677T>C	17.37:g.25944438T>C	ENSP00000323178:p.Phe893Leu	22.0	0.0		24.0	4.0	NM_014238	F8WEA9|H7BYU0|Q13476	Missense_Mutation	SNP	ENST00000319524.6	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.06|17.06	3.293092|3.293092	0.60086|0.60086	.|.	.|.	ENSG00000141068|ENSG00000141068	ENST00000319524;ENST00000509603;ENST00000268763;ENST00000398982|ENST00000398988	T;T;T|.	0.79141|.	-1.24;-1.2;-1.22|.	5.56|5.56	5.56|5.56	0.83823|0.83823	Protein kinase-like domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.53514|0.53514	0.1801|0.1801	L|L	0.27053|0.27053	0.805|0.805	0.58432|0.58432	D|D	0.999999|0.999999	D;P|.	0.76494|.	0.999;0.502|.	D;P|.	0.75484|.	0.986;0.574|.	T|T	0.50659|0.50659	-0.8802|-0.8802	10|5	0.09590|.	T|.	0.72|.	.|.	14.8975|14.8975	0.70654|0.70654	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	891;871|.	Q8IVT5;F5H0K8|.	KSR1_HUMAN;.|.	L|P	893;871;756;756|606	ENSP00000323178:F893L;ENSP00000438795:F871L;ENSP00000268763:F756L|.	ENSP00000268763:F756L|.	F|L	+|+	1|2	0|0	KSR1|KSR1	22968565|22968565	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	6.170000|6.170000	0.71920|0.71920	2.112000|2.112000	0.64535|0.64535	0.455000|0.455000	0.32223|0.32223	TTC|CTT	.		0.592	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_014238	
KRT35	3886	ucsc.edu;bcgsc.ca	37	17	39636914	39636914	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr17:39636914A>G	ENST00000393989.1	-	1	478	c.436T>C	c.(436-438)Tcc>Ccc	p.S146P	KRT35_ENST00000246639.2_Missense_Mutation_p.S116P	NM_002280.4	NP_002271.3	Q92764	KRT35_HUMAN	keratin 35	146	Coil 1B.|Rod.				anatomical structure morphogenesis (GO:0009653)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.000286)				CGGAAGTAGGACTGGTAGTCA	0.562																																					p.S146P		.											.	KRT35	92	0			c.T436C						.						73.0	78.0	76.0					17																	39636914		2203	4300	6503	SO:0001583	missense	3886	exon1			AGTAGGACTGGTA	X90762	CCDS11394.2	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000197079	ENSG00000197079		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6453	protein-coding gene	gene with protein product	"""hard keratin type I 5"""	602764	"""keratin, hair, acidic, 5"""	KRTHA5		8823373, 16831889	Standard	NM_002280		Approved	Ha-5	uc002hws.3	Q92764	OTTHUMG00000133425	ENST00000393989.1:c.436T>C	17.37:g.39636914A>G	ENSP00000377558:p.Ser146Pro	40.0	0.0		28.0	4.0	NM_002280	O76012|Q92651	Missense_Mutation	SNP	ENST00000393989.1	37	CCDS11394.2	.	.	.	.	.	.	.	.	.	.	A	11.30	1.598432	0.28445	.	.	ENSG00000197079	ENST00000246639;ENST00000393989	D;D	0.88818	-2.43;-2.43	5.18	5.18	0.71444	Filament (1);	0.000000	0.64402	D	0.000014	D	0.82416	0.5032	L	0.46885	1.475	0.30541	N	0.766442	B	0.15719	0.014	B	0.18263	0.021	T	0.72843	-0.4170	10	0.23891	T	0.37	.	5.7826	0.18314	0.77:0.0:0.0803:0.1496	.	146	Q92764	KRT35_HUMAN	P	116;146	ENSP00000246639:S116P;ENSP00000377558:S146P	ENSP00000246639:S116P	S	-	1	0	KRT35	36890440	0.007000	0.16637	1.000000	0.80357	0.798000	0.45092	0.115000	0.15540	2.173000	0.68751	0.418000	0.28097	TCC	.		0.562	KRT35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_002280	
L3MBTL1	26013	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	42143656	42143656	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr20:42143656delC	ENST00000427442.2	+	5	603	c.444delC	c.(442-444)cacfs	p.H148fs	L3MBTL1_ENST00000457824.1_3'UTR|L3MBTL1_ENST00000373134.1_Frame_Shift_Del_p.H80fs|L3MBTL1_ENST00000373135.3_Frame_Shift_Del_p.H80fs|L3MBTL1_ENST00000444063.1_Frame_Shift_Del_p.H80fs|L3MBTL1_ENST00000418998.1_Frame_Shift_Del_p.H148fs			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	80					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						CAGAGGACCACCCCCAGAATC	0.682																																					p.H148fs		.											.	L3MBTL1	227	0			c.444delC						.						37.0	36.0	36.0					20																	42143656		2203	4300	6503	SO:0001589	frameshift_variant	26013	exon5			GGACCACCCCCAG	U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.444delC	20.37:g.42143656delC	ENSP00000402107:p.His148fs	42.0	0.0		65.0	22.0	NM_032107	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Frame_Shift_Del	DEL	ENST00000427442.2	37	CCDS46602.2																																																																																			.		0.682	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079300.3	NM_032107	
LAMA1	284217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	6975955	6975955	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:6975955T>A	ENST00000389658.3	-	45	6563	c.6470A>T	c.(6469-6471)tAc>tTc	p.Y2157F	RN7SL537P_ENST00000584392.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2157	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GCTACCGAGGTAGAAGAGAAG	0.413																																					p.Y2157F		.											.	LAMA1	149	0			c.A6470T						.						157.0	157.0	157.0					18																	6975955		2203	4300	6503	SO:0001583	missense	284217	exon45			CCGAGGTAGAAGA	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.6470A>T	18.37:g.6975955T>A	ENSP00000374309:p.Tyr2157Phe	109.0	0.0		89.0	24.0	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	T	17.68	3.450028	0.63290	.	.	ENSG00000101680	ENST00000389658	T	0.81415	-1.49	5.64	5.64	0.86602	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.074260	0.56097	D	0.000032	T	0.82185	0.4982	L	0.53249	1.67	0.42293	D	0.992142	P	0.48162	0.906	P	0.48400	0.576	D	0.84025	0.0356	10	0.56958	D	0.05	.	16.1482	0.81586	0.0:0.0:0.0:1.0	.	2157	P25391	LAMA1_HUMAN	F	2157	ENSP00000374309:Y2157F	ENSP00000374309:Y2157F	Y	-	2	0	LAMA1	6965955	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	5.803000	0.69129	2.272000	0.75746	0.523000	0.50628	TAC	.		0.413	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
LAMA5	3911	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	60886538	60886538	+	Silent	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr20:60886538A>G	ENST00000252999.3	-	72	9927	c.9861T>C	c.(9859-9861)aaT>aaC	p.N3287N	LAMA5_ENST00000492698.1_5'Flank	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	3287	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CCGTGCTCACATTGACGCTGC	0.701																																					p.N3287N		.											.	LAMA5	93	0			c.T9861C						.						21.0	25.0	24.0					20																	60886538		2189	4289	6478	SO:0001819	synonymous_variant	3911	exon72			GCTCACATTGACG	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.9861T>C	20.37:g.60886538A>G		72.0	0.0		65.0	23.0	NM_005560	Q8TDF8|Q8WZA7|Q9H1P1	Silent	SNP	ENST00000252999.3	37	CCDS33502.1																																																																																			.		0.701	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
LCP1	3936	ucsc.edu;bcgsc.ca	37	13	46725197	46725197	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr13:46725197C>A	ENST00000398576.2	-	11	1144	c.756G>T	c.(754-756)ttG>ttT	p.L252F	LCP1_ENST00000323076.2_Missense_Mutation_p.L252F			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	252	Actin-binding 1.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)			breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		CACCTTCTCTCAAAAGAGCAA	0.458			T	BCL6	NHL																																p.L252F		.		Dom	yes		13	13q14.1-q14.3	3936	lymphocyte cytosolic protein 1 (L-plastin)		L	.	LCP1	685	0			c.G756T						.						51.0	51.0	51.0					13																	46725197		2203	4300	6503	SO:0001583	missense	3936	exon8			TTCTCTCAAAAGA	M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.756G>T	13.37:g.46725197C>A	ENSP00000381581:p.Leu252Phe	39.0	0.0		31.0	4.0	NM_002298	B2R613|B4DUA0|Q5TBN4	Missense_Mutation	SNP	ENST00000398576.2	37	CCDS9403.1	.	.	.	.	.	.	.	.	.	.	C	32	5.154233	0.94645	.	.	ENSG00000136167	ENST00000323076;ENST00000398576	D;D	0.96041	-3.89;-3.89	5.79	5.79	0.91817	Calponin homology domain (2);	0.070085	0.64402	D	0.000016	D	0.97751	0.9262	M	0.82056	2.57	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.98016	1.0368	10	0.66056	D	0.02	-11.5336	19.0163	0.92896	0.0:1.0:0.0:0.0	.	252	P13796	PLSL_HUMAN	F	252	ENSP00000315757:L252F;ENSP00000381581:L252F	ENSP00000315757:L252F	L	-	3	2	LCP1	45623198	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.882000	0.48546	2.727000	0.93392	0.655000	0.94253	TTG	.		0.458	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044800.3	NM_002298	
LEPRE1	64175	ucsc.edu;bcgsc.ca	37	1	43224989	43224989	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:43224989C>A	ENST00000296388.5	-	3	742	c.691G>T	c.(691-693)Gcg>Tcg	p.A231S	LEPRE1_ENST00000236040.4_Missense_Mutation_p.A231S|LEPRE1_ENST00000397054.3_Missense_Mutation_p.A231S			Q32P28	P3H1_HUMAN	leucine proline-enriched proteoglycan (leprecan) 1	231					bone development (GO:0060348)|cell growth (GO:0016049)|chaperone-mediated protein folding (GO:0061077)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein hydroxylation (GO:0018126)|protein stabilization (GO:0050821)|regulation of ossification (GO:0030278)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)|protein complex binding (GO:0032403)			large_intestine(2)|lung(15)|ovary(5)|prostate(1)|urinary_tract(3)	26	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TCTTGCAGCGCCGCCTCTAGG	0.547																																					p.A231S		.											.	LEPRE1	94	0			c.G691T						.						71.0	67.0	68.0					1																	43224989		2203	4300	6503	SO:0001583	missense	64175	exon3			GCAGCGCCGCCTC	AK027648	CCDS472.2, CCDS53307.1, CCDS57986.1	1p34.1	2014-09-17			ENSG00000117385	ENSG00000117385			19316	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 1"", ""growth suppressor 1"""	610339				10951563	Standard	NM_022356		Approved	GROS1, P3H1, LEPRECAN, MGC117314	uc001chx.4	Q32P28	OTTHUMG00000007525	ENST00000296388.5:c.691G>T	1.37:g.43224989C>A	ENSP00000296388:p.Ala231Ser	69.0	0.0		50.0	5.0	NM_001146289	Q7KZR4|Q96BR8|Q96SK8|Q96SL5|Q96SN3|Q9H6K3|Q9HC86|Q9HC87	Missense_Mutation	SNP	ENST00000296388.5	37	CCDS472.2	.	.	.	.	.	.	.	.	.	.	C	27.4	4.823717	0.90873	.	.	ENSG00000117385	ENST00000397054;ENST00000236040;ENST00000296388;ENST00000540027;ENST00000372526	D;D;D;T	0.85861	-2.04;-2.04;-2.04;0.19	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.89750	0.6805	L	0.47716	1.5	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.996	D	0.87774	0.2607	10	0.33141	T	0.24	-27.8663	17.3244	0.87243	0.0:1.0:0.0:0.0	.	231;96;231	Q32P28-3;B4DNM8;Q32P28	.;.;P3H1_HUMAN	S	231;231;231;96;188	ENSP00000380245:A231S;ENSP00000236040:A231S;ENSP00000296388:A231S;ENSP00000361604:A188S	ENSP00000236040:A231S	A	-	1	0	LEPRE1	42997576	1.000000	0.71417	0.155000	0.22561	0.744000	0.42396	7.298000	0.78815	2.682000	0.91365	0.563000	0.77884	GCG	.		0.547	LEPRE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019790.2	NM_022356	
LINGO2	158038	broad.mit.edu;bcgsc.ca	37	9	27950383	27950383	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:27950383A>T	ENST00000379992.2	-	6	736	c.287T>A	c.(286-288)gTg>gAg	p.V96E	LINGO2_ENST00000308675.3_Missense_Mutation_p.V96E	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	96						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		TCCTGGTTCCACATTGGCAAT	0.463																																					p.V96E		.											.	LINGO2	516	0			c.T287A						.						232.0	232.0	232.0					9																	27950383		2203	4300	6503	SO:0001583	missense	158038	exon7			GGTTCCACATTGG	AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.287T>A	9.37:g.27950383A>T	ENSP00000369328:p.Val96Glu	176.0	1.0		92.0	10.0	NM_001258282	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	ENST00000379992.2	37	CCDS6524.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.845233	0.91197	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	T;T	0.79141	-1.24;-1.24	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.84884	0.5571	L	0.52206	1.635	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.83894	0.0286	9	.	.	.	.	16.5764	0.84681	1.0:0.0:0.0:0.0	.	96	Q7L985	LIGO2_HUMAN	E	96	ENSP00000369328:V96E;ENSP00000310126:V96E	.	V	-	2	0	LINGO2	27940383	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.243000	0.95416	2.371000	0.80710	0.533000	0.62120	GTG	.		0.463	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051978.2	NM_152570	
LUZP4	51213	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	114541215	114541215	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chrX:114541215A>G	ENST00000371920.3	+	4	795	c.788A>G	c.(787-789)cAg>cGg	p.Q263R	LUZP4_ENST00000451986.2_Missense_Mutation_p.Q181R	NM_016383.3	NP_057467.1	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	263						nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	14						ATAGCCACTCAGAGAGATCTC	0.478																																					p.Q263R		.											.	LUZP4	132	0			c.A788G						.						118.0	105.0	110.0					X																	114541215		2203	4300	6503	SO:0001583	missense	51213	exon4			CCACTCAGAGAGA	AF124430	CCDS14567.1	Xq24	2009-03-25			ENSG00000102021	ENSG00000102021			24971	protein-coding gene	gene with protein product	"""cancer/testis antigen 28"""	300616				12032826, 11051238	Standard	XM_005268343		Approved	HOM-TES-85, CT-8, CT28	uc004eqa.3	Q9P127	OTTHUMG00000022234	ENST00000371920.3:c.788A>G	X.37:g.114541215A>G	ENSP00000360988:p.Gln263Arg	97.0	1.0		104.0	64.0	NM_016383	B3KSD6	Missense_Mutation	SNP	ENST00000371920.3	37	CCDS14567.1	.	.	.	.	.	.	.	.	.	.	a	10.90	1.480422	0.26598	.	.	ENSG00000102021	ENST00000451986;ENST00000371920	T;T	0.79554	-1.28;-1.28	3.68	-2.36	0.06663	.	0.604873	0.12604	N	0.454432	T	0.75774	0.3895	L	0.29908	0.895	0.09310	N	1	P;D	0.69078	0.865;0.997	B;P	0.60949	0.298;0.881	T	0.64605	-0.6368	10	0.72032	D	0.01	.	2.8852	0.05659	0.4632:0.0:0.2186:0.3181	.	181;263	B3KSD6;Q9P127	.;LUZP4_HUMAN	R	181;263	ENSP00000411212:Q181R;ENSP00000360988:Q263R	ENSP00000360988:Q263R	Q	+	2	0	LUZP4	114447471	0.000000	0.05858	0.000000	0.03702	0.083000	0.17756	-0.513000	0.06305	-0.263000	0.09378	0.235000	0.17854	CAG	.		0.478	LUZP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057972.1	NM_016383	
MADD	8567	ucsc.edu;bcgsc.ca	37	11	47308084	47308084	+	Splice_Site	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:47308084A>G	ENST00000311027.5	+	15	2817	c.2652A>G	c.(2650-2652)aaA>aaG	p.K884K	MADD_ENST00000402799.1_Splice_Site_p.K841K|MADD_ENST00000395344.3_Splice_Site_p.K841K|MADD_ENST00000406482.1_Splice_Site_p.K841K|MADD_ENST00000342922.4_Splice_Site_p.K884K|MADD_ENST00000402192.2_Splice_Site_p.K884K|MADD_ENST00000407859.3_Splice_Site_p.K841K|MADD_ENST00000349238.3_Splice_Site_p.K884K|MADD_ENST00000395336.3_Splice_Site_p.K884K	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		CCAGTCTGAAAGGTAACTACA	0.552																																					p.K884K		.											.	MADD	682	0			c.A2652G						.						110.0	103.0	105.0					11																	47308084		2201	4298	6499	SO:0001630	splice_region_variant	8567	exon15			TCTGAAAGGTAAC	AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.2653+1A>G	11.37:g.47308084A>G		40.0	0.0		34.0	4.0	NM_130470		Silent	SNP	ENST00000311027.5	37	CCDS7930.1																																																																																			.		0.552	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1		Silent
MAGEB3	4114	ucsc.edu;bcgsc.ca	37	X	30254253	30254253	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chrX:30254253C>A	ENST00000361644.2	+	5	949	c.212C>A	c.(211-213)aCc>aAc	p.T71N		NM_002365.4	NP_002356.2	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	71										NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	25						GCACTATCCACCACTACATCT	0.443																																					p.T71N		.											.	MAGEB3	130	0			c.C212A						.						30.0	26.0	27.0					X																	30254253		2202	4300	6502	SO:0001583	missense	4114	exon5			TATCCACCACTAC	AK057441	CCDS14220.1	Xp21.3	2009-03-17			ENSG00000198798	ENSG00000198798			6810	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 5"""	300152				9441743	Standard	NM_002365		Approved	CT3.5	uc004dca.2	O15480	OTTHUMG00000021320	ENST00000361644.2:c.212C>A	X.37:g.30254253C>A	ENSP00000355198:p.Thr71Asn	46.0	0.0		45.0	4.0	NM_002365	A0AVE4|B3KQ52|O75861	Missense_Mutation	SNP	ENST00000361644.2	37	CCDS14220.1	.	.	.	.	.	.	.	.	.	.	C	13.12	2.143429	0.37825	.	.	ENSG00000198798	ENST00000378986;ENST00000361644	T;T	0.05649	3.41;3.41	4.1	2.31	0.28768	Melanoma associated antigen, MAGE, N-terminal (1);	.	.	.	.	T	0.19805	0.0476	M	0.77406	2.37	0.09310	N	1	D	0.71674	0.998	D	0.71414	0.973	T	0.07462	-1.0771	9	0.87932	D	0	.	4.7075	0.12856	0.0:0.657:0.2191:0.1239	.	71	O15480	MAGB3_HUMAN	N	71	ENSP00000368271:T71N;ENSP00000355198:T71N	ENSP00000355198:T71N	T	+	2	0	MAGEB3	30164174	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.277000	0.08502	0.484000	0.27630	0.600000	0.82982	ACC	.		0.443	MAGEB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056158.2	NM_002365	
MALT1	10892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	56415027	56415027	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:56415027G>A	ENST00000348428.3	+	17	2686	c.2428G>A	c.(2428-2430)Gaa>Aaa	p.E810K	RP11-126O1.4_ENST00000588835.1_RNA|MALT1_ENST00000345724.3_Missense_Mutation_p.E799K	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma translocation gene 1	810					activation of NF-kappaB-inducing kinase activity (GO:0007250)|B-1 B cell differentiation (GO:0001923)|defense response (GO:0006952)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|nuclear export (GO:0051168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|protein oligomerization (GO:0051259)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of T cell receptor signaling pathway (GO:0050856)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)|protein self-association (GO:0043621)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|large_intestine(7)|lung(1)|ovary(2)|skin(1)	12						GACAACTGATGAAATACCATT	0.378			T	BIRC3	MALT																																p.E810K		.		Dom	yes		18	18q21	10892	mucosa associated lymphoid tissue lymphoma translocation gene 1		L	.	MALT1	660	0			c.G2428A						.						109.0	114.0	112.0					18																	56415027		2203	4300	6503	SO:0001583	missense	10892	exon17			ACTGATGAAATAC		CCDS11967.1, CCDS11968.1	18q21	2013-01-11			ENSG00000172175	ENSG00000172175		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6819	protein-coding gene	gene with protein product	"""paracaspase"""	604860		MLT		10339464, 10406266, 10523859	Standard	NM_006785		Approved		uc002lhm.1	Q9UDY8	OTTHUMG00000132761	ENST00000348428.3:c.2428G>A	18.37:g.56415027G>A	ENSP00000319279:p.Glu810Lys	100.0	0.0		81.0	35.0	NM_006785	Q9NTB7|Q9ULX4	Missense_Mutation	SNP	ENST00000348428.3	37	CCDS11967.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438445	0.83885	.	.	ENSG00000172175	ENST00000348428;ENST00000345724	T;T	0.13901	2.55;2.56	5.77	5.77	0.91146	.	0.052727	0.64402	D	0.000001	T	0.21307	0.0513	L	0.56769	1.78	0.48185	D	0.999602	P;P	0.42692	0.787;0.682	B;B	0.41510	0.359;0.197	T	0.00536	-1.1683	10	0.66056	D	0.02	.	19.5879	0.95497	0.0:0.0:1.0:0.0	.	799;810	Q9UDY8-2;Q9UDY8	.;MALT1_HUMAN	K	810;799	ENSP00000319279:E810K;ENSP00000304161:E799K	ENSP00000304161:E799K	E	+	1	0	MALT1	54566007	1.000000	0.71417	0.800000	0.32199	0.962000	0.63368	7.196000	0.77805	2.745000	0.94114	0.650000	0.86243	GAA	.		0.378	MALT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256132.2		
MAOA	4128	ucsc.edu;bcgsc.ca	37	X	43571197	43571197	+	Missense_Mutation	SNP	A	A	G	rs1800464	byFrequency	TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chrX:43571197A>G	ENST00000338702.3	+	4	508	c.385A>G	c.(385-387)Agg>Ggg	p.R129G	MAOA_ENST00000542639.1_5'UTR|MAOA_ENST00000497485.1_3'UTR	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	129					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	TAATCTGTGGAGGACAATAGA	0.393																																					p.R129G		.											.	MAOA	194	0			c.A385G						.						132.0	123.0	126.0					X																	43571197		2203	4300	6503	SO:0001583	missense	4128	exon4			CTGTGGAGGACAA		CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.385A>G	X.37:g.43571197A>G	ENSP00000340684:p.Arg129Gly	53.0	0.0		37.0	4.0	NM_000240	B4DF46|Q16426	Missense_Mutation	SNP	ENST00000338702.3	37	CCDS14260.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114774	0.77210	.	.	ENSG00000189221	ENST00000338702	D	0.91894	-2.93	5.48	0.898	0.19264	Amine oxidase (1);	0.000000	0.85682	D	0.000000	D	0.93736	0.7998	M	0.79693	2.465	0.09310	P	1.0	D	0.54047	0.964	P	0.51550	0.673	D	0.93591	0.6921	9	0.42905	T	0.14	.	16.7739	0.85546	0.8325:0.1675:0.0:0.0	.	129	P21397	AOFA_HUMAN	G	129	ENSP00000340684:R129G	ENSP00000340684:R129G	R	+	1	2	MAOA	43456141	1.000000	0.71417	0.973000	0.42090	0.049000	0.14656	1.354000	0.34056	-0.117000	0.11872	-1.261000	0.01458	AGG	A|0.740;0|0.061		0.393	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056300.1	NM_000240	
MAP1A	4130	ucsc.edu;bcgsc.ca	37	15	43821659	43821659	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr15:43821659A>G	ENST00000300231.5	+	4	8438	c.7988A>G	c.(7987-7989)cAc>cGc	p.H2663R	MAP1A_ENST00000382031.1_Missense_Mutation_p.H2901R|MAP1A_ENST00000399453.1_Missense_Mutation_p.H2663R			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2663					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	AAGGATGGACACAGCCCCATG	0.587																																					p.H2663R		.											.	MAP1A	141	0			c.A7988G						.						41.0	50.0	47.0					15																	43821659		2089	4206	6295	SO:0001583	missense	4130	exon4			ATGGACACAGCCC	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.7988A>G	15.37:g.43821659A>G	ENSP00000300231:p.His2663Arg	41.0	0.0		29.0	4.0	NM_002373	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	37	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	A	12.78	2.041676	0.35989	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01359	4.98;4.98;4.98	5.14	5.14	0.70334	.	.	.	.	.	T	0.02610	0.0079	N	0.14661	0.345	0.36698	D	0.879967	D	0.61697	0.99	P	0.61592	0.891	T	0.72852	-0.4167	9	0.24483	T	0.36	-13.5684	13.6709	0.62424	1.0:0.0:0.0:0.0	.	2663	P78559	MAP1A_HUMAN	R	2901;2663;2663	ENSP00000371462:H2901R;ENSP00000382380:H2663R;ENSP00000300231:H2663R	ENSP00000300231:H2663R	H	+	2	0	MAP1A	41608951	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.289000	0.78701	2.148000	0.66965	0.379000	0.24179	CAC	.		0.587	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
MBD1	4152	ucsc.edu;bcgsc.ca	37	18	47800080	47800080	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:47800080G>T	ENST00000591416.1	-	12	1731	c.1300C>A	c.(1300-1302)Cat>Aat	p.H434N	MBD1_ENST00000588937.1_Missense_Mutation_p.H411N|MBD1_ENST00000590208.1_Missense_Mutation_p.H434N|MBD1_ENST00000585672.1_Missense_Mutation_p.H384N|MBD1_ENST00000587605.1_Missense_Mutation_p.H378N|MBD1_ENST00000269468.5_Missense_Mutation_p.H434N|MBD1_ENST00000591535.1_Missense_Mutation_p.H411N|MBD1_ENST00000382948.5_Missense_Mutation_p.H434N|MBD1_ENST00000349085.2_Missense_Mutation_p.H378N|MBD1_ENST00000424334.2_Missense_Mutation_p.H485N|MBD1_ENST00000398493.1_Missense_Mutation_p.H378N|MBD1_ENST00000585595.1_Missense_Mutation_p.H459N|MBD1_ENST00000457839.2_Missense_Mutation_p.H459N|MBD1_ENST00000347968.3_Missense_Mutation_p.H378N|MBD1_ENST00000398488.1_Missense_Mutation_p.H378N|MBD1_ENST00000353909.3_Missense_Mutation_p.H385N|MBD1_ENST00000398495.2_Missense_Mutation_p.H403N|MBD1_ENST00000339998.6_Missense_Mutation_p.H434N|MBD1_ENST00000436910.1_Missense_Mutation_p.H411N|MBD1_ENST00000269471.5_Missense_Mutation_p.H411N			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	434					negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						GCCTGGGTATGGTCTGGTTGG	0.612																																					p.H459N		.											.	MBD1	228	0			c.C1375A						.						107.0	91.0	96.0					18																	47800080		2203	4300	6503	SO:0001583	missense	4152	exon13			GGGTATGGTCTGG	Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.1300C>A	18.37:g.47800080G>T	ENSP00000467017:p.His434Asn	76.0	0.0		46.0	4.0	NM_001204137	A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Missense_Mutation	SNP	ENST00000591416.1	37	CCDS11943.1	.	.	.	.	.	.	.	.	.	.	G	0.616	-0.823008	0.02755	.	.	ENSG00000141644	ENST00000382948;ENST00000353909;ENST00000349085;ENST00000269468;ENST00000347968;ENST00000436910;ENST00000269471;ENST00000424334;ENST00000339998;ENST00000398495;ENST00000457839;ENST00000398493;ENST00000398488	D;D;D;D;D;D;D;D;D;D;D;D	0.95307	-3.62;-3.62;-3.67;-3.62;-3.64;-3.61;-3.61;-3.63;-3.61;-3.62;-3.64;-3.67	4.98	1.74	0.24563	.	1.702580	0.02727	N	0.114687	D	0.86719	0.6000	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B;B;B;B;B;B;B	0.29037	0.231;0.139;0.05;0.02;0.141;0.225;0.141;0.152;0.02;0.141;0.02;0.141	B;B;B;B;B;B;B;B;B;B;B;B	0.29598	0.048;0.03;0.034;0.021;0.104;0.066;0.066;0.023;0.021;0.066;0.021;0.066	T	0.79100	-0.1942	10	0.28530	T	0.3	5.9346	3.8427	0.08922	0.2435:0.0:0.5759:0.1806	.	378;485;411;434;434;411;385;378;434;378;459;378	B4DUR3;B4DI41;Q9UIS9-8;A8K654;Q9UIS9-6;Q9UIS9-2;Q9UIS9-5;Q9UIS9-4;Q9UIS9;Q9UIS9-7;B4DXJ5;Q9UIS9-3	.;.;.;.;.;.;.;.;MBD1_HUMAN;.;.;.	N	434;385;378;434;378;411;411;485;434;434;459;378;378	ENSP00000372407:H434N;ENSP00000269469:H385N;ENSP00000342531:H378N;ENSP00000269468:H434N;ENSP00000285102:H378N;ENSP00000409561:H411N;ENSP00000269471:H411N;ENSP00000408846:H485N;ENSP00000339546:H434N;ENSP00000405268:H459N;ENSP00000381506:H378N;ENSP00000381502:H378N	ENSP00000269468:H434N	H	-	1	0	MBD1	46054078	0.013000	0.17824	0.000000	0.03702	0.046000	0.14306	1.332000	0.33805	0.195000	0.20347	0.555000	0.69702	CAT	.		0.612	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255926.3	NM_015846	
MBD4	8930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	129155490	129155490	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:129155490T>A	ENST00000249910.1	-	3	1172	c.997A>T	c.(997-999)Ata>Tta	p.I333L	MBD4_ENST00000503197.1_Missense_Mutation_p.I333L|MBD4_ENST00000509587.1_Intron|MBD4_ENST00000429544.2_Missense_Mutation_p.I333L|MBD4_ENST00000507208.1_Missense_Mutation_p.I333L|MBD4_ENST00000393278.2_Intron	NM_003925.1	NP_003916.1	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4	333					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)	22						AATTTGTTTATGATGCCAGAA	0.348								Base excision repair (BER), DNA glycosylases																													p.I333L		.											.	MBD4	228	0			c.A997T						.						88.0	96.0	93.0					3																	129155490		2202	4300	6502	SO:0001583	missense	8930	exon3			TGTTTATGATGCC	AF072250	CCDS3058.1, CCDS63766.1, CCDS63767.1, CCDS63768.1, CCDS63769.1	3q21.3	2004-03-02			ENSG00000129071	ENSG00000129071			6919	protein-coding gene	gene with protein product		603574				9774669, 10097147	Standard	NM_003925		Approved	MED1	uc003emh.2	O95243	OTTHUMG00000159463	ENST00000249910.1:c.997A>T	3.37:g.129155490T>A	ENSP00000249910:p.Ile333Leu	180.0	0.0		143.0	23.0	NM_003925	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000249910.1	37	CCDS3058.1	.	.	.	.	.	.	.	.	.	.	T	6.389	0.439882	0.12104	.	.	ENSG00000129071	ENST00000429544;ENST00000249910;ENST00000503197;ENST00000507208	D;D;D;D	0.92647	-2.88;-2.88;-3.08;-3.08	5.27	-2.26	0.06867	.	1.310070	0.04720	N	0.419243	D	0.82536	0.5058	L	0.27053	0.805	0.20074	N	0.999931	B;B;B;B	0.24920	0.07;0.114;0.048;0.07	B;B;B;B	0.20955	0.024;0.032;0.022;0.014	T	0.67569	-0.5637	10	0.20519	T	0.43	-0.255	1.3947	0.02258	0.1389:0.2731:0.1424:0.4455	.	333;333;333;333	E9PEE4;O95243-2;O95243-3;O95243	.;.;.;MBD4_HUMAN	L	333	ENSP00000394080:I333L;ENSP00000249910:I333L;ENSP00000424873:I333L;ENSP00000422327:I333L	ENSP00000249910:I333L	I	-	1	0	MBD4	130638180	0.001000	0.12720	0.012000	0.15200	0.201000	0.24016	-0.239000	0.08965	-0.254000	0.09500	-0.256000	0.11100	ATA	.		0.348	MBD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355529.1	NM_003925	
MCM7	4176	broad.mit.edu;mdanderson.org	37	7	99697309	99697309	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:99697309G>C	ENST00000303887.5	-	3	824	c.179C>G	c.(178-180)cCc>cGc	p.P60R	AP4M1_ENST00000429084.1_5'Flank|MCM7_ENST00000343023.6_Missense_Mutation_p.P60R|AP4M1_ENST00000421755.1_5'Flank|MCM7_ENST00000354230.3_5'UTR|AP4M1_ENST00000422582.1_5'Flank|AP4M1_ENST00000359593.4_5'Flank	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	60					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CACCAACTCGGGGTCATCCTC	0.562																																					p.P60R		.											.	MCM7	651	0			c.C179G						.						132.0	124.0	126.0					7																	99697309		2203	4300	6503	SO:0001583	missense	4176	exon3			AACTCGGGGTCAT		CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.179C>G	7.37:g.99697309G>C	ENSP00000307288:p.Pro60Arg	13.0	0.0		14.0	8.0	NM_005916	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Missense_Mutation	SNP	ENST00000303887.5	37	CCDS5683.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.31|13.31	2.197802|2.197802	0.38806|0.38806	.|.	.|.	ENSG00000166508|ENSG00000166508	ENST00000542483|ENST00000343023;ENST00000303887	.|T;T	.|0.10763	.|2.84;2.84	4.5|4.5	4.5|4.5	0.54988|0.54988	.|Nucleic acid-binding, OB-fold-like (1);	0.199666|0.199666	0.41823|0.41823	D|D	0.000812|0.000812	T|T	0.10337|0.10337	0.0253|0.0253	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	.|B	.|0.29862	.|0.259	.|B	.|0.30029	.|0.11	T|T	0.18241|0.18241	-1.0343|-1.0343	7|10	0.87932|0.28530	D|T	0|0.3	.|.	14.7626|14.7626	0.69617|0.69617	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|60	.|P33993	.|MCM7_HUMAN	A|R	3|60	.|ENSP00000344006:P60R;ENSP00000307288:P60R	ENSP00000445904:P18A|ENSP00000307288:P60R	P|P	-|-	1|2	0|0	MCM7|MCM7	99535245|99535245	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	7.148000|7.148000	0.77389|0.77389	2.314000|2.314000	0.78098|0.78098	0.557000|0.557000	0.71058|0.71058	CCG|CCC	.		0.562	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336534.3		
MED12L	116931	ucsc.edu;bcgsc.ca	37	3	150873994	150873994	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:150873994G>T	ENST00000474524.1	+	5	641	c.603G>T	c.(601-603)aaG>aaT	p.K201N	MED12L_ENST00000273432.4_Missense_Mutation_p.K201N|MED12L_ENST00000309237.4_Missense_Mutation_p.K201N|MED12L_ENST00000422248.2_Missense_Mutation_p.K201N	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	201						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGTTGGCCAAGATTTCTGACT	0.453																																					p.K201N		.											.	MED12L	576	0			c.G603T						.						104.0	100.0	101.0					3																	150873994		2203	4300	6503	SO:0001583	missense	116931	exon5			GGCCAAGATTTCT	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.603G>T	3.37:g.150873994G>T	ENSP00000417235:p.Lys201Asn	41.0	1.0		33.0	4.0	NM_053002	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.216692	0.79352	.	.	ENSG00000144893	ENST00000422248;ENST00000309237;ENST00000474524;ENST00000273432	T;T;T;T	0.63255	0.33;0.31;0.21;-0.03	4.78	3.89	0.44902	.	0.000000	0.85682	D	0.000000	T	0.76011	0.3928	M	0.72894	2.215	0.33351	D	0.571117	D;D;D;D	0.76494	0.999;0.981;0.999;0.996	D;D;D;D	0.80764	0.991;0.95;0.994;0.99	D	0.83465	0.0056	10	0.87932	D	0	-18.1496	11.9814	0.53121	0.0875:0.0:0.9125:0.0	.	201;201;201;201	F8WAE6;Q86YW9;Q86YW9-2;Q86YW9-3	.;MD12L_HUMAN;.;.	N	201	ENSP00000403308:K201N;ENSP00000310760:K201N;ENSP00000417235:K201N;ENSP00000273432:K201N	ENSP00000273432:K201N	K	+	3	2	MED12L	152356684	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	4.404000	0.59735	1.101000	0.41535	0.557000	0.71058	AAG	.		0.453	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
METTL12	751071	ucsc.edu;bcgsc.ca	37	11	62434009	62434009	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:62434009A>G	ENST00000532971.1	+	3	466	c.209A>G	c.(208-210)gAg>gGg	p.E70G	RP11-831H9.11_ENST00000528405.1_5'Flank|C11orf48_ENST00000431002.2_Intron|C11orf48_ENST00000532208.1_Intron|SNORA57_ENST00000383870.1_RNA|C11orf48_ENST00000524958.1_5'Flank|C11orf48_ENST00000354588.3_Intron|METTL12_ENST00000398922.2_3'UTR|C11orf48_ENST00000525675.1_5'Flank	NM_001043229.1	NP_001036694.1	A8MUP2	MET12_HUMAN	methyltransferase like 12	70						mitochondrion (GO:0005739)	methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	6						TTGCTGCAGGAGGCACAGGCT	0.592																																					p.E70G		.											.	METTL12	22	0			c.A209G						.						54.0	61.0	59.0					11																	62434009		2024	4192	6216	SO:0001583	missense	751071	exon3			TGCAGGAGGCACA	BC041359	CCDS41657.1	11q12.3	2013-09-30			ENSG00000214756	ENSG00000214756			33113	protein-coding gene	gene with protein product							Standard	NM_001043229		Approved	U99HG	uc001nuh.3	A8MUP2	OTTHUMG00000167545	ENST00000532971.1:c.209A>G	11.37:g.62434009A>G	ENSP00000431287:p.Glu70Gly	44.0	1.0		31.0	4.0	NM_001043229	B7Z4C1	Missense_Mutation	SNP	ENST00000532971.1	37	CCDS41657.1	.	.	.	.	.	.	.	.	.	.	A	4.232	0.041899	0.08196	.	.	ENSG00000214756	ENST00000532971	T	0.47177	0.85	4.9	2.47	0.30058	.	1.745790	0.03814	U	0.266512	T	0.38639	0.1048	L	0.45228	1.405	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14420	-1.0473	10	0.27082	T	0.32	-0.1545	3.0354	0.06121	0.6087:0.0:0.2144:0.1769	.	70	A8MUP2	MTL12_HUMAN	G	70	ENSP00000431287:E70G	ENSP00000431287:E70G	E	+	2	0	METTL12	62190585	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	0.441000	0.21611	0.411000	0.25702	0.482000	0.46254	GAG	.		0.592	METTL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394990.1	NM_001043229	
MFN1	55669	broad.mit.edu;bcgsc.ca	37	3	179069781	179069781	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:179069781A>G	ENST00000471841.1	+	3	332	c.206A>G	c.(205-207)gAg>gGg	p.E69G	MFN1_ENST00000280653.7_Missense_Mutation_p.E69G|MFN1_ENST00000263969.5_Missense_Mutation_p.E69G	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	69					mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			ATCATTGGTGAGGTGCTATCT	0.383																																					p.E69G		.											.	MFN1	155	0			c.A206G						.						170.0	170.0	170.0					3																	179069781		2203	4300	6503	SO:0001583	missense	55669	exon3			TTGGTGAGGTGCT	AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.206A>G	3.37:g.179069781A>G	ENSP00000420617:p.Glu69Gly	230.0	1.0		206.0	11.0	NM_033540	B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Missense_Mutation	SNP	ENST00000471841.1	37	CCDS3228.1	.	.	.	.	.	.	.	.	.	.	A	16.69	3.193024	0.58017	.	.	ENSG00000171109	ENST00000471841;ENST00000280653;ENST00000539169;ENST00000467174;ENST00000263969	D;D;D;D	0.95756	-3.8;-3.8;-3.8;-3.8	5.16	5.16	0.70880	.	0.048228	0.85682	D	0.000000	D	0.96122	0.8736	M	0.76574	2.34	0.80722	D	1	D;P	0.59767	0.986;0.956	P;P	0.51229	0.66;0.663	D	0.96414	0.9306	10	0.66056	D	0.02	-6.5102	15.2812	0.73787	1.0:0.0:0.0:0.0	.	97;69	Q4AEJ4;Q8IWA4	.;MFN1_HUMAN	G	69	ENSP00000420617:E69G;ENSP00000280653:E69G;ENSP00000419134:E69G;ENSP00000263969:E69G	ENSP00000263969:E69G	E	+	2	0	MFN1	180552475	1.000000	0.71417	1.000000	0.80357	0.524000	0.34500	8.859000	0.92264	2.078000	0.62432	0.383000	0.25322	GAG	.		0.383	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348654.2	NM_017927	
TLE3	7090	ucsc.edu;mdanderson.org	37	15	70371772	70371772	+	Intron	SNP	C	C	A	rs111899904	byFrequency	TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr15:70371772C>A	ENST00000558939.1	-	5	1612				TLE3_ENST00000559191.1_Intron|TLE3_ENST00000451782.2_Intron|TLE3_ENST00000440567.3_Intron|TLE3_ENST00000557907.1_Intron|TLE3_ENST00000559929.1_Intron|TLE3_ENST00000539550.1_Intron|TLE3_ENST00000442299.2_Intron|TLE3_ENST00000559048.1_Intron|TLE3_ENST00000317509.8_Intron|TLE3_ENST00000560589.1_Intron|TLE3_ENST00000560939.1_Intron|TLE3_ENST00000558201.1_Intron|TLE3_ENST00000557997.1_Intron|MIR629_ENST00000385230.1_RNA|TLE3_ENST00000558379.1_Intron	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3						Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TAAAAGTTCTCCCAACGTAAA	0.572																																					.		.											.	.	.	0			.						.						36.0	38.0	38.0					15																	70371772		1564	3580	5144	SO:0001627	intron_variant	693214	.			AGTTCTCCCAACG	M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.235-3275G>T	15.37:g.70371772C>A		28.0	0.0		27.0	9.0	.	B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	RNA	SNP	ENST00000558939.1	37	CCDS45293.1																																																																																			C|0.993;T|0.007		0.572	TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416913.1	NM_005078	
MLC1	23209	ucsc.edu;bcgsc.ca	37	22	50512719	50512719	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr22:50512719T>C	ENST00000311597.5	-	8	1246	c.640A>G	c.(640-642)Atc>Gtc	p.I214V	MLC1_ENST00000538737.1_Missense_Mutation_p.I180V|MLC1_ENST00000535444.1_Missense_Mutation_p.I135V|MLC1_ENST00000483836.1_5'Flank|MLC1_ENST00000431262.2_Missense_Mutation_p.I184V|MLC1_ENST00000450140.2_Missense_Mutation_p.I162V|MLC1_ENST00000395876.2_Missense_Mutation_p.I214V	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	214					caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		AGGGCAATGATCCCCCCGAGG	0.597																																					p.I214V		.											.	MLC1	91	0			c.A640G						.						116.0	81.0	93.0					22																	50512719		2203	4300	6503	SO:0001583	missense	23209	exon8			CAATGATCCCCCC	D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.640A>G	22.37:g.50512719T>C	ENSP00000310375:p.Ile214Val	39.0	0.0		37.0	4.0	NM_015166	B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	Missense_Mutation	SNP	ENST00000311597.5	37	CCDS14083.1	.	.	.	.	.	.	.	.	.	.	T	4.267	0.048656	0.08243	.	.	ENSG00000100427	ENST00000395876;ENST00000311597;ENST00000538737;ENST00000431262;ENST00000535444;ENST00000450140;ENST00000442311	D;D;D;D;D;D;D	0.94232	-3.32;-3.32;-3.18;-2.93;-3.16;-3.24;-3.38	5.24	1.66	0.24008	.	0.187905	0.47852	N	0.000213	T	0.74935	0.3782	N	0.01188	-0.97	0.35315	D	0.784291	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.0;0.0;0.002;0.0	T	0.65948	-0.6044	10	0.11485	T	0.65	-8.5064	5.3439	0.15998	0.0:0.386:0.0:0.614	.	180;184;162;214	F5H1B9;B7Z659;B7Z1X1;Q15049	.;.;.;MLC1_HUMAN	V	214;214;180;184;135;162;184	ENSP00000379216:I214V;ENSP00000310375:I214V;ENSP00000445805:I180V;ENSP00000415877:I184V;ENSP00000438910:I135V;ENSP00000412448:I162V;ENSP00000401385:I184V	ENSP00000310375:I214V	I	-	1	0	MLC1	48854846	0.997000	0.39634	0.841000	0.33234	0.329000	0.28539	3.085000	0.50151	0.524000	0.28502	0.533000	0.62120	ATC	.		0.597	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316979.2	NM_015166	
MLNR	2862	ucsc.edu;bcgsc.ca	37	13	49796480	49796480	+	Silent	SNP	C	C	A	rs201685217		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr13:49796480C>A	ENST00000218721.1	+	2	1206	c.1206C>A	c.(1204-1206)acC>acA	p.T402T	MLNR_ENST00000398307.1_3'UTR	NM_001507.1	NP_001498.1	O43193	MTLR_HUMAN	motilin receptor	402					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone-releasing hormone receptor activity (GO:0016520)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)	14		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)		TGGGCTACACCGAGACAAGCG	0.572																																					p.T402T		.											.	MLNR	90	0			c.C1206A						.																																			SO:0001819	synonymous_variant	2862	exon2			CTACACCGAGACA	AF034632	CCDS9414.1	13q14-q21	2012-08-08	2004-05-27	2004-05-28	ENSG00000102539	ENSG00000102539		"""GPCR / Class A : Motilin receptors"""	4495	protein-coding gene	gene with protein product		602885	"""G protein-coupled receptor 38"""	GPR38		9441746	Standard	NM_001507		Approved		uc010tgj.2	O43193	OTTHUMG00000016909	ENST00000218721.1:c.1206C>A	13.37:g.49796480C>A		56.0	0.0		30.0	4.0	NM_001507		Silent	SNP	ENST00000218721.1	37	CCDS9414.1																																																																																			.		0.572	MLNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044897.1	NM_001507	
MPP4	58538	ucsc.edu;bcgsc.ca	37	2	202552052	202552052	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:202552052G>T	ENST00000409474.3	-	5	529	c.322C>A	c.(322-324)Caa>Aaa	p.Q108K	MPP4_ENST00000428900.2_Missense_Mutation_p.Q108K|MPP4_ENST00000409143.1_Intron|MPP4_ENST00000447335.2_Missense_Mutation_p.Q108K|MPP4_ENST00000315506.7_Missense_Mutation_p.Q108K|MPP4_ENST00000359962.5_Missense_Mutation_p.Q108K|MPP4_ENST00000396886.3_Missense_Mutation_p.Q108K	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	108	L27 2. {ECO:0000255|PROSITE- ProRule:PRU00365}.				protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)				kidney(1)|lung(11)	12						CTCAGCTCTTGGATCTCAGGG	0.408																																					p.Q108K		.											.	MPP4	22	0			c.C322A						.						76.0	74.0	75.0					2																	202552052		1840	4088	5928	SO:0001583	missense	58538	exon5			GCTCTTGGATCTC	AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.322C>A	2.37:g.202552052G>T	ENSP00000387278:p.Gln108Lys	67.0	0.0		49.0	4.0	NM_033066	C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Missense_Mutation	SNP	ENST00000409474.3	37	CCDS46491.1	.	.	.	.	.	.	.	.	.	.	G	10.72	1.428754	0.25726	.	.	ENSG00000082126	ENST00000409474;ENST00000315506;ENST00000396886;ENST00000359962;ENST00000315549;ENST00000428900;ENST00000447335	T;T;T;T;T	0.04275	3.66;3.67;3.66;3.66;3.67	5.76	4.88	0.63580	L27, C-terminal (1);L27 (2);	0.292334	0.31760	N	0.007107	T	0.02888	0.0086	N	0.11023	0.085	0.38714	D	0.953293	B;B;B;B;B;B;B;B;B	0.11235	0.0;0.001;0.001;0.001;0.001;0.001;0.004;0.001;0.0	B;B;B;B;B;B;B;B;B	0.12156	0.001;0.002;0.003;0.002;0.003;0.003;0.007;0.003;0.003	T	0.29579	-1.0007	10	0.06236	T	0.91	.	14.1603	0.65443	0.0:0.0:0.6732:0.3268	.	108;108;108;108;108;108;121;108;108	B4DUF3;E7ET46;B7ZM19;Q96JB8-2;E7EUL8;F8WC25;F8WBH8;Q96JB8;Q96JB8-4	.;.;.;.;.;.;.;MPP4_HUMAN;.	K	108	ENSP00000387278:Q108K;ENSP00000319363:Q108K;ENSP00000353047:Q108K;ENSP00000416781:Q108K;ENSP00000406160:Q108K	ENSP00000319363:Q108K	Q	-	1	0	MPP4	202260297	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.441000	0.35035	1.430000	0.47334	0.655000	0.94253	CAA	.		0.408	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335748.2		
MUC6	4588	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1026952	1026952	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:1026952C>T	ENST00000421673.2	-	19	2433	c.2383G>A	c.(2383-2385)Ggt>Agt	p.G795S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	795					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CAGGCAACACCGGTGGCCAGC	0.657																																					p.G795S		.											.	MUC6	23	0			c.G2383A						.						15.0	17.0	16.0					11																	1026952		1986	4142	6128	SO:0001583	missense	4588	exon19			CAACACCGGTGGC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.2383G>A	11.37:g.1026952C>T	ENSP00000406861:p.Gly795Ser	60.0	0.0		84.0	30.0	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	c	17.51	3.407709	0.62399	.	.	ENSG00000184956	ENST00000421673	D	0.90069	-2.61	4.66	4.66	0.58398	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	.	.	.	.	D	0.92737	0.7691	L	0.49350	1.555	0.35727	D	0.817651	D	0.89917	1.0	D	0.97110	1.0	D	0.94712	0.7893	9	0.49607	T	0.09	.	17.9246	0.88979	0.0:1.0:0.0:0.0	.	795	Q6W4X9	MUC6_HUMAN	S	795	ENSP00000406861:G795S	ENSP00000406861:G795S	G	-	1	0	MUC6	1016952	0.979000	0.34478	0.235000	0.24058	0.030000	0.12068	2.897000	0.48664	2.302000	0.77476	0.556000	0.70494	GGT	.		0.657	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MYLK4	340156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	2685624	2685624	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:2685624C>T	ENST00000274643.7	-	6	793	c.451G>A	c.(451-453)Gag>Aag	p.E151K	MYLK4_ENST00000268446.5_Missense_Mutation_p.E151K	NM_001012418.3	NP_001012418.2	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4	151	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				ACGCTGATCTCGTTCTTCACC	0.552																																					p.E151K		.											.	MYLK4	150	0			c.G451A						.						233.0	183.0	200.0					6																	2685624		2203	4300	6503	SO:0001583	missense	340156	exon6			TGATCTCGTTCTT		CCDS34330.1	6p25.2	2008-01-23			ENSG00000145949	ENSG00000145949			27972	protein-coding gene	gene with protein product	"""caMLCK like"""						Standard	NM_001012418		Approved	SgK085	uc003mty.4	Q86YV6	OTTHUMG00000014121	ENST00000274643.7:c.451G>A	6.37:g.2685624C>T	ENSP00000274643:p.Glu151Lys	75.0	0.0		92.0	25.0	NM_001012418	A2RUC0|Q5TAW2	Missense_Mutation	SNP	ENST00000274643.7	37	CCDS34330.1	.	.	.	.	.	.	.	.	.	.	C	36	5.741166	0.96873	.	.	ENSG00000145949	ENST00000268446;ENST00000274643	T;T	0.73469	-0.75;-0.75	5.63	5.63	0.86233	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.46442	D	0.000299	D	0.89795	0.6818	H	0.95114	3.625	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.92270	0.5824	10	0.87932	D	0	.	18.6673	0.91495	0.0:1.0:0.0:0.0	.	151	Q86YV6	MYLK4_HUMAN	K	151	ENSP00000268446:E151K;ENSP00000274643:E151K	ENSP00000268446:E151K	E	-	1	0	MYLK4	2630623	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	7.805000	0.86005	2.649000	0.89929	0.603000	0.83216	GAG	.		0.552	MYLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039632.2	NM_001012418	
MYO1E	4643	ucsc.edu;bcgsc.ca	37	15	59470655	59470655	+	Silent	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr15:59470655G>T	ENST00000288235.4	-	19	2385	c.1986C>A	c.(1984-1986)gtC>gtA	p.V662V		NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	662	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		TGTCCATGTTGACCGACTGCA	0.587																																					p.V662V		.											.	MYO1E	514	0			c.C1986A						.						111.0	89.0	96.0					15																	59470655		2191	4291	6482	SO:0001819	synonymous_variant	4643	exon19			CATGTTGACCGAC	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.1986C>A	15.37:g.59470655G>T		57.0	0.0		46.0	6.0	NM_004998	Q14778	Silent	SNP	ENST00000288235.4	37	CCDS32254.1																																																																																			.		0.587	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998	
NAV2	89797	ucsc.edu;bcgsc.ca	37	11	20127077	20127077	+	Splice_Site	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:20127077A>G	ENST00000396087.3	+	38	6921	c.6822A>G	c.(6820-6822)agA>agG	p.R2274R	NAV2_ENST00000527559.2_Splice_Site_p.R2203R|NAV2_ENST00000360655.4_Splice_Site_p.R2151R|NAV2_ENST00000533917.1_Splice_Site_p.R1279R|NAV2_ENST00000540292.1_Splice_Site_p.R2205R|NAV2_ENST00000311043.8_Splice_Site_p.R1279R|NAV2_ENST00000396085.1_Splice_Site_p.R2218R|NAV2_ENST00000349880.4_Splice_Site_p.R2215R	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	2274					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						CTTCCTCCAGATGGGTGCTTT	0.507																																					p.R2274R		.											.	NAV2	96	0			c.A6822G						.						71.0	70.0	70.0					11																	20127077		2203	4300	6503	SO:0001630	splice_region_variant	89797	exon37			CTCCAGATGGGTG	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.6822-1A>G	11.37:g.20127077A>G		61.0	0.0		67.0	6.0	NM_001244963	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	ENST00000396087.3	37	CCDS58126.1																																																																																			.		0.507	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	Silent
NBEA	26960	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	36229035	36229036	+	Frame_Shift_Ins	INS	-	-	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr13:36229035_36229036insC	ENST00000400445.3	+	53	8550_8551	c.8016_8017insC	c.(8017-8019)gacfs	p.D2673fs	NBEA_ENST00000379939.2_Frame_Shift_Ins_p.D2670fs|NBEA_ENST00000379922.3_Frame_Shift_Ins_p.D251fs|NBEA_ENST00000310336.4_Frame_Shift_Ins_p.D2673fs|NBEA_ENST00000537702.1_Frame_Shift_Ins_p.D466fs|NBEA_ENST00000540320.1_Frame_Shift_Ins_p.D2673fs	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2673					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CAGACCTCGTTGACCAGAGTAT	0.366																																					p.V2672fs		.											.	NBEA	144	0			c.8016_8017insC						.																																			SO:0001589	frameshift_variant	26960	exon53			CCTCGTTGACCAG	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	Exception_encountered	13.37:g.36229035_36229036insC	ENSP00000383295:p.Asp2673fs	73.0	0.0		45.0	30.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Frame_Shift_Ins	INS	ENST00000400445.3	37	CCDS45026.1																																																																																			.		0.366	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
NCDN	23154	ucsc.edu;bcgsc.ca	37	1	36026742	36026742	+	Silent	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:36026742A>G	ENST00000373243.2	+	3	1373	c.990A>G	c.(988-990)aaA>aaG	p.K330K	NCDN_ENST00000373253.3_Silent_p.K313K|NCDN_ENST00000356090.4_Silent_p.K330K	NM_014284.2	NP_055099.1	Q9UBB6	NCDN_HUMAN	neurochondrin	330					bone resorption (GO:0045453)|neuron projection development (GO:0031175)|regulation of neuronal synaptic plasticity (GO:0048168)	cytosol (GO:0005829)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|pancreas(1)|skin(2)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CGGAGGTGAAAGAGGATGTGG	0.627																																					p.K330K		.											.	NCDN	155	0			c.A990G						.						40.0	35.0	36.0					1																	36026742		2203	4300	6503	SO:0001819	synonymous_variant	23154	exon4			GGTGAAAGAGGAT	AB011179	CCDS392.1, CCDS30672.1	1p34.3	2008-02-05			ENSG00000020129	ENSG00000020129			17597	protein-coding gene	gene with protein product		608458				15007648	Standard	NM_014284		Approved	NCDN-1, NCDN-2	uc001bza.3	Q9UBB6	OTTHUMG00000059204	ENST00000373243.2:c.990A>G	1.37:g.36026742A>G		52.0	1.0		40.0	4.0	NM_001014839	D3DPR9|Q9UBY2|Q9Y4A6|Q9Y4D9	Silent	SNP	ENST00000373243.2	37	CCDS392.1																																																																																			.		0.627	NCDN-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131298.1	NM_014284	
NFATC4	4776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24844908	24844908	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr14:24844908T>A	ENST00000250373.4	+	7	2057	c.1916T>A	c.(1915-1917)cTg>cAg	p.L639Q	NFATC4_ENST00000557451.1_Missense_Mutation_p.L569Q|NFATC4_ENST00000555802.1_5'UTR|NFATC4_ENST00000554661.1_Missense_Mutation_p.L569Q|NFATC4_ENST00000554344.1_Missense_Mutation_p.L569Q|NFATC4_ENST00000556169.1_Missense_Mutation_p.L627Q|NFATC4_ENST00000424781.2_Missense_Mutation_p.L652Q|NFATC4_ENST00000553879.1_Missense_Mutation_p.L569Q|NFATC4_ENST00000554473.1_Missense_Mutation_p.L174Q|NFATC4_ENST00000555453.1_Missense_Mutation_p.L627Q|NFATC4_ENST00000554591.1_Missense_Mutation_p.L702Q|NFATC4_ENST00000555167.1_Missense_Mutation_p.L174Q|NFATC4_ENST00000554050.1_Missense_Mutation_p.L639Q|NFATC4_ENST00000555393.1_5'UTR|NFATC4_ENST00000422617.3_Missense_Mutation_p.L627Q|NFATC4_ENST00000555590.1_Missense_Mutation_p.L652Q|NFATC4_ENST00000539237.2_Missense_Mutation_p.L671Q|NFATC4_ENST00000557767.1_5'UTR|NFATC4_ENST00000554966.1_Missense_Mutation_p.L652Q|NFATC4_ENST00000556759.1_Missense_Mutation_p.L174Q|NFATC4_ENST00000553469.1_Missense_Mutation_p.L671Q|NFATC4_ENST00000413692.2_Missense_Mutation_p.L702Q|NFATC4_ENST00000553708.1_Missense_Mutation_p.L639Q|NFATC4_ENST00000556279.1_Missense_Mutation_p.L671Q	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	639	IPT/TIG.				cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		GTGAACCGACTGCAGAGCAAC	0.627																																					p.L702Q		.											.	NFATC4	92	0			c.T2105A						.						56.0	39.0	45.0					14																	24844908		2195	4288	6483	SO:0001583	missense	4776	exon8			ACCGACTGCAGAG	BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.1916T>A	14.37:g.24844908T>A	ENSP00000250373:p.Leu639Gln	96.0	0.0		53.0	17.0	NM_001198967	B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Missense_Mutation	SNP	ENST00000250373.4	37	CCDS9629.1	.	.	.	.	.	.	.	.	.	.	T	19.31	3.803041	0.70682	.	.	ENSG00000100968	ENST00000413692;ENST00000554591;ENST00000555590;ENST00000554966;ENST00000424781;ENST00000539237;ENST00000556279;ENST00000553469;ENST00000554050;ENST00000250373;ENST00000553708;ENST00000553879;ENST00000554344;ENST00000554661;ENST00000556169;ENST00000557451;ENST00000422617;ENST00000555453;ENST00000554473;ENST00000556759;ENST00000555167	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.29655	3.29;3.31;3.31;3.32;3.3;3.3;3.31;3.32;3.33;3.31;3.31;2.99;2.99;3.0;3.0;2.98;2.98;2.98;1.6;1.56;1.56	5.41	5.41	0.78517	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.290828	0.28730	N	0.014323	T	0.33265	0.0857	N	0.14661	0.345	0.80722	D	1	P;D;P;D;P;P;D;D;D;D;P;P;P	0.63880	0.936;0.981;0.935;0.993;0.935;0.935;0.981;0.993;0.993;0.981;0.935;0.935;0.947	P;P;P;P;P;P;P;P;P;P;P;P;P	0.59889	0.556;0.813;0.775;0.865;0.713;0.837;0.813;0.865;0.865;0.813;0.837;0.775;0.856	T	0.11616	-1.0580	10	0.40728	T	0.16	-1.8492	13.4467	0.61144	0.0:0.0:0.0:1.0	.	627;627;671;671;652;652;652;702;702;627;671;702;639	Q14934-17;Q14934-9;Q14934-14;Q14934-4;Q14934-15;Q14934-6;Q14934-7;Q14934-2;Q14934-3;Q14934-10;Q14934-5;Q14934-11;Q14934	.;.;.;.;.;.;.;.;.;.;.;.;NFAC4_HUMAN	Q	702;702;652;652;652;671;671;671;639;639;639;569;569;569;627;569;627;627;174;174;174	ENSP00000388910:L702Q;ENSP00000452039:L702Q;ENSP00000451224:L652Q;ENSP00000450644:L652Q;ENSP00000388668:L652Q;ENSP00000439350:L671Q;ENSP00000452270:L671Q;ENSP00000451502:L671Q;ENSP00000451151:L639Q;ENSP00000250373:L639Q;ENSP00000450590:L639Q;ENSP00000452349:L569Q;ENSP00000450469:L569Q;ENSP00000450733:L569Q;ENSP00000451454:L627Q;ENSP00000451284:L569Q;ENSP00000396788:L627Q;ENSP00000450686:L627Q;ENSP00000450810:L174Q;ENSP00000451183:L174Q;ENSP00000451395:L174Q	ENSP00000250373:L639Q	L	+	2	0	NFATC4	23914748	1.000000	0.71417	0.968000	0.41197	0.989000	0.77384	4.773000	0.62331	2.272000	0.75746	0.460000	0.39030	CTG	.		0.627	NFATC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073206.6	NM_004554	
NFIB	4781	ucsc.edu;bcgsc.ca	37	9	14179728	14179728	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:14179728G>T	ENST00000380959.3	-	3	1087	c.614C>A	c.(613-615)cCa>cAa	p.P205Q	NFIB_ENST00000380934.4_Missense_Mutation_p.P231Q|NFIB_ENST00000380953.1_Missense_Mutation_p.P205Q|NFIB_ENST00000380924.1_5'UTR|NFIB_ENST00000397579.2_Missense_Mutation_p.P205Q|NFIB_ENST00000397575.3_Missense_Mutation_p.P205Q|NFIB_ENST00000543693.1_5'UTR|NFIB_ENST00000397581.2_Missense_Mutation_p.P205Q	NM_005596.3	NP_005587.2	O00712	NFIB_HUMAN	nuclear factor I/B	205					anterior commissure morphogenesis (GO:0021960)|chondrocyte differentiation (GO:0002062)|Clara cell differentiation (GO:0060486)|commissural neuron axon guidance (GO:0071679)|DNA replication (GO:0006260)|glial cell differentiation (GO:0010001)|hindbrain development (GO:0030902)|lung ciliated cell differentiation (GO:0061141)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000795)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|principal sensory nucleus of trigeminal nerve development (GO:0021740)|transcription from RNA polymerase II promoter (GO:0006366)|Type I pneumocyte differentiation (GO:0060509)|Type II pneumocyte differentiation (GO:0060510)	cerebellar mossy fiber (GO:0044300)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)		ATATTTACCTGGAGGATTCTT	0.373			T	"""MYB, HGMA2"""	"""adenoid cystic carcinoma, lipoma"""																																p.P231Q	Esophageal Squamous(132;921 1730 14828 40753 46471)	.		Dom	yes		9	9p24.1	4781	nuclear factor I/B		E	.	NFIB	226	0			c.C692A						.						105.0	98.0	100.0					9																	14179728		2203	4300	6503	SO:0001583	missense	4781	exon3			TTACCTGGAGGAT	U07810	CCDS6474.1, CCDS55291.1, CCDS55292.1, CCDS65007.1	9p24.1	2008-02-05			ENSG00000147862	ENSG00000147862			7785	protein-coding gene	gene with protein product		600728				7590749	Standard	NM_001190737		Approved	NFI-RED, NFIB2, NFIB3	uc003zlf.3	O00712	OTTHUMG00000021027	ENST00000380959.3:c.614C>A	9.37:g.14179728G>T	ENSP00000370346:p.Pro205Gln	57.0	1.0		31.0	4.0	NM_001190738	G3V1P1|H7BYE8|O00166|Q12858|Q5VW29|Q63HM5|Q6ZNF9|Q96J45	Missense_Mutation	SNP	ENST00000380959.3	37	CCDS6474.1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152104	0.57259	.	.	ENSG00000147862	ENST00000380934;ENST00000380959;ENST00000380953;ENST00000397575;ENST00000397581;ENST00000397579	T;T;T;T;T;T	0.44083	0.96;0.97;0.96;0.94;0.93;0.97	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.32941	0.0846	L	0.32530	0.975	0.58432	D	0.999993	B;P;B	0.41041	0.396;0.736;0.001	B;B;B	0.30029	0.068;0.11;0.0	T	0.20974	-1.0259	10	0.56958	D	0.05	-4.2791	19.7049	0.96069	0.0:0.0:1.0:0.0	.	205;205;205	Q5VW27;Q5VW29;O00712	.;.;NFIB_HUMAN	Q	231;205;205;205;205;205	ENSP00000370321:P231Q;ENSP00000370346:P205Q;ENSP00000370340:P205Q;ENSP00000380705:P205Q;ENSP00000380711:P205Q;ENSP00000380709:P205Q	ENSP00000370321:P231Q	P	-	2	0	NFIB	14169728	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.507000	0.81676	2.753000	0.94483	0.585000	0.79938	CCA	.		0.373	NFIB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055468.1	NM_005596	
NFYC	4802	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	41215259	41215259	+	Silent	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:41215259A>G	ENST00000308733.5	+	3	198	c.192A>G	c.(190-192)gaA>gaG	p.E64E	NFYC_ENST00000372651.1_Silent_p.E64E|NFYC_ENST00000372654.1_Silent_p.E64E|NFYC_ENST00000440226.3_Silent_p.E64E|NFYC_ENST00000456393.2_Silent_p.E64E|NFYC_ENST00000447388.3_Silent_p.E64E|NFYC_ENST00000372653.1_Silent_p.E64E|NFYC_ENST00000427410.2_Intron|NFYC_ENST00000372652.1_Silent_p.E64E|NFYC_ENST00000425457.2_Silent_p.E64E			Q13952	NFYC_HUMAN	nuclear transcription factor Y, gamma	64					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription, DNA-templated (GO:0045893)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(1)|prostate(1)|skin(2)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.72e-17)			TCAGTGCAGAAGCGCCTGTAC	0.512																																					p.E64E		.											.	NFYC	289	0			c.A192G						.						113.0	109.0	110.0					1																	41215259		2203	4300	6503	SO:0001819	synonymous_variant	4802	exon4			TGCAGAAGCGCCT	U78774	CCDS455.1, CCDS44120.1, CCDS44121.1, CCDS44122.1, CCDS44123.1	1p32	2008-11-11			ENSG00000066136	ENSG00000066136			7806	protein-coding gene	gene with protein product		605344				8921405, 9249075	Standard	NM_014223		Approved	CBF-C, NF-YC	uc009vwd.3	Q13952	OTTHUMG00000007729	ENST00000308733.5:c.192A>G	1.37:g.41215259A>G		84.0	1.0		56.0	13.0	NM_001142587	B4DUS6|B4DW63|D3DPV9|F8VWM3|Q59GY4|Q5T6K8|Q5T6K9|Q5T6L1|Q5TZR6|Q92869|Q9HBX1|Q9NXB5|Q9UM67|Q9UML0|Q9UMT7	Silent	SNP	ENST00000308733.5	37																																																																																				.		0.512	NFYC-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000020802.1	NM_014223	
NLGN1	22871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	173322666	173322666	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:173322666G>T	ENST00000457714.1	+	3	707	c.278G>T	c.(277-279)cGt>cTt	p.R93L	NLGN1_ENST00000361589.4_Missense_Mutation_p.R93L|NLGN1_ENST00000401917.3_Missense_Mutation_p.R93L|NLGN1_ENST00000545397.1_Missense_Mutation_p.R93L	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	93					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)	p.R93L(2)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			ACAGGGGAACGTCGTTTTCAG	0.453																																					p.R93L		.											.	NLGN1	231	2	Substitution - Missense(2)	lung(2)	c.G278T						.						130.0	129.0	129.0					3																	173322666		2203	4300	6503	SO:0001583	missense	22871	exon3			GGGAACGTCGTTT	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.278G>T	3.37:g.173322666G>T	ENSP00000392500:p.Arg93Leu	102.0	0.0		94.0	39.0	NM_014932	Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	37	CCDS3222.1	.	.	.	.	.	.	.	.	.	.	G	6.574	0.474179	0.12521	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000415045;ENST00000545397;ENST00000401917	T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3	5.62	3.23	0.37069	.	0.229124	0.34314	N	0.004077	T	0.22666	0.0547	N	0.01410	-0.885	0.32782	N	0.502396	B;B	0.26195	0.004;0.144	B;B	0.18561	0.022;0.016	T	0.16630	-1.0396	10	0.23891	T	0.37	.	6.2449	0.20811	0.6324:0.0:0.3676:0.0	.	93;93	D2X2H5;Q8N2Q7-2	.;.	L	93	ENSP00000392500:R93L;ENSP00000354541:R93L;ENSP00000410374:R93L;ENSP00000441108:R93L;ENSP00000385750:R93L	ENSP00000354541:R93L	R	+	2	0	NLGN1	174805360	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.321000	0.43805	1.069000	0.40788	-0.373000	0.07131	CGT	.		0.453	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
NLGN1	22871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	173525610	173525610	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:173525610C>A	ENST00000457714.1	+	4	1063	c.634C>A	c.(634-636)Ctt>Att	p.L212I	NLGN1_ENST00000361589.4_Missense_Mutation_p.L212I|NLGN1_ENST00000401917.3_Missense_Mutation_p.L252I|NLGN1_ENST00000545397.1_Missense_Mutation_p.L212I	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	229					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			CAACTATCGACTTGGAGTACT	0.388																																					p.L212I		.											.	NLGN1	231	0			c.C634A						.						140.0	132.0	135.0					3																	173525610		2203	4300	6503	SO:0001583	missense	22871	exon4			TATCGACTTGGAG	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.634C>A	3.37:g.173525610C>A	ENSP00000392500:p.Leu212Ile	137.0	0.0		97.0	52.0	NM_014932	Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	37	CCDS3222.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.987790	0.93106	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000415045;ENST00000545397;ENST00000401917	T;T;T;T;T	0.74947	-0.6;-0.6;-0.89;-0.6;-0.6	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000001	D	0.85128	0.5626	M	0.88377	2.95	0.80722	D	1	P;P	0.50066	0.931;0.605	P;P	0.50934	0.654;0.619	D	0.87424	0.2384	10	0.62326	D	0.03	.	19.6981	0.96039	0.0:1.0:0.0:0.0	.	252;212	D2X2H5;Q8N2Q7-2	.;.	I	212;212;252;212;252	ENSP00000392500:L212I;ENSP00000354541:L212I;ENSP00000410374:L252I;ENSP00000441108:L212I;ENSP00000385750:L252I	ENSP00000354541:L212I	L	+	1	0	NLGN1	175008304	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.085000	0.71343	2.665000	0.90641	0.557000	0.71058	CTT	.		0.388	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
NLRP13	126204	ucsc.edu;bcgsc.ca	37	19	56423971	56423971	+	Silent	SNP	T	T	C	rs149489544		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:56423971T>C	ENST00000342929.3	-	5	1211	c.1212A>G	c.(1210-1212)gaA>gaG	p.E404E	NLRP13_ENST00000588751.1_Silent_p.E404E	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	404	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)	p.E404D(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TTTTCTCAACTTCACTTGAGT	0.448																																					p.E404E		.											NLRP13,NS,carcinoma,0	NLRP13	211	1	Substitution - Missense(1)	ovary(1)	c.A1212G						.						86.0	90.0	89.0					19																	56423971		2203	4300	6503	SO:0001819	synonymous_variant	126204	exon5			CTCAACTTCACTT	AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.1212A>G	19.37:g.56423971T>C		41.0	0.0		60.0	6.0	NM_176810	Q7RTR5	Silent	SNP	ENST00000342929.3	37	CCDS33119.1																																																																																			T|1.000;G|0.000		0.448	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810	
NONO	4841	ucsc.edu;bcgsc.ca	37	X	70514267	70514267	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chrX:70514267T>C	ENST00000276079.8	+	5	744	c.539T>C	c.(538-540)aTt>aCt	p.I180T	NONO_ENST00000373841.1_Missense_Mutation_p.I180T|NONO_ENST00000535149.1_Missense_Mutation_p.I91T|NONO_ENST00000490044.1_3'UTR|NONO_ENST00000373856.3_Missense_Mutation_p.I180T	NM_007363.4	NP_031389.3	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding	180	DBHS.|RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				circadian rhythm (GO:0007623)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mRNA processing (GO:0006397)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)		NONO/TFE3(2)	endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	19	Renal(35;0.156)					GCTGTAGTCATTGTGGATGAT	0.512			T	TFE3	papillary renal cancer																																p.I180T		.		Dom	yes		X	Xq13.1	4841	"""non-POU domain containing, octamer-binding"""		E	.	NONO	231	0			c.T539C						.						103.0	78.0	86.0					X																	70514267		2203	4297	6500	SO:0001583	missense	4841	exon6			TAGTCATTGTGGA	L14599	CCDS14410.1, CCDS55445.1	Xq13.1	2014-06-13	2002-01-14		ENSG00000147140	ENSG00000147140		"""RNA binding motif (RRM) containing"""	7871	protein-coding gene	gene with protein product	"""Nuclear RNA-binding protein, 54-kD"", ""non-Pou domain-containing octamer (ATGCAAAT) binding protein"", ""protein phosphatase 1, regulatory subunit 114"""	300084	"""non-POU-domain-containing, octamer-binding"""			8371983, 9360842	Standard	NM_007363		Approved	NRB54, NMT55, P54NRB, P54, PPP1R114	uc004dzp.3	Q15233	OTTHUMG00000021798	ENST00000276079.8:c.539T>C	X.37:g.70514267T>C	ENSP00000276079:p.Ile180Thr	53.0	0.0		41.0	4.0	NM_001145408	B7Z4C2|D3DVV4|F5GYZ3|O00201|P30807|Q12786|Q9BQC5	Missense_Mutation	SNP	ENST00000276079.8	37	CCDS14410.1	.	.	.	.	.	.	.	.	.	.	t	13.20	2.165163	0.38217	.	.	ENSG00000147140	ENST00000535149;ENST00000276079;ENST00000373856;ENST00000373841;ENST00000454976	T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27	4.87	4.87	0.63330	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.049444	0.85682	D	0.000000	T	0.22975	0.0555	L	0.46567	1.45	0.80722	D	1	P	0.41597	0.756	P	0.46885	0.53	T	0.01262	-1.1402	10	0.37606	T	0.19	-9.74	13.7303	0.62783	0.0:0.0:0.0:1.0	.	180	Q15233	NONO_HUMAN	T	91;180;180;180;180	ENSP00000441364:I91T;ENSP00000276079:I180T;ENSP00000362963:I180T;ENSP00000362947:I180T;ENSP00000406673:I180T	ENSP00000276079:I180T	I	+	2	0	NONO	70430992	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.688000	0.84153	1.816000	0.52996	0.430000	0.28490	ATT	.		0.512	NONO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057138.1	NM_007363	
NPC1L1	29881	ucsc.edu;bcgsc.ca	37	7	44555743	44555743	+	Silent	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:44555743G>T	ENST00000289547.4	-	18	3709	c.3654C>A	c.(3652-3654)atC>atA	p.I1218I	NPC1L1_ENST00000381160.3_Silent_p.I1191I|NPC1L1_ENST00000546276.1_Silent_p.I1145I	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	1218					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	GCTTGGTGCTGATGGCAAAGG	0.607																																					p.I1218I		.											.	NPC1L1	94	0			c.C3654A						.						56.0	43.0	47.0					7																	44555743		2203	4300	6503	SO:0001819	synonymous_variant	29881	exon18			GGTGCTGATGGCA		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.3654C>A	7.37:g.44555743G>T		63.0	0.0		76.0	6.0	NM_013389	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	37	CCDS5491.1																																																																																			.		0.607	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
NRIP2	83714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	2944113	2944113	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:2944113G>A	ENST00000337508.4	-	1	77	c.37C>T	c.(37-39)Ccc>Tcc	p.P13S		NM_031474.2	NP_113662.1	Q9BQI9	NRIP2_HUMAN	nuclear receptor interacting protein 2	13					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(2)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			CAACAGGAGGGTCTCCACGGG	0.587																																					p.P13S		.											.	NRIP2	187	0			c.C37T						.						48.0	44.0	45.0					12																	2944113		2203	4300	6503	SO:0001583	missense	83714	exon1			AGGAGGGTCTCCA	AK054740	CCDS8514.1	12p13.33	2008-02-05			ENSG00000053702	ENSG00000053702			23078	protein-coding gene	gene with protein product						11230166	Standard	NM_031474		Approved	DKFZP761G1913	uc001qlc.3	Q9BQI9	OTTHUMG00000130616	ENST00000337508.4:c.37C>T	12.37:g.2944113G>A	ENSP00000337501:p.Pro13Ser	88.0	0.0		64.0	14.0	NM_031474	A2RRE3|B4DV61	Missense_Mutation	SNP	ENST00000337508.4	37	CCDS8514.1	.	.	.	.	.	.	.	.	.	.	G	9.806	1.181895	0.21787	.	.	ENSG00000053702	ENST00000337508;ENST00000546074	.	.	.	4.34	4.34	0.51931	.	.	.	.	.	T	0.49695	0.1572	L	0.43152	1.355	0.26649	N	0.972146	D	0.64830	0.994	P	0.56127	0.792	T	0.40979	-0.9534	8	0.87932	D	0	-12.3098	12.2247	0.54453	0.0:0.0:1.0:0.0	.	13	Q9BQI9	NRIP2_HUMAN	S	13	.	ENSP00000337501:P13S	P	-	1	0	NRIP2	2814374	0.998000	0.40836	0.942000	0.38095	0.031000	0.12232	1.929000	0.40114	2.259000	0.74868	0.484000	0.47621	CCC	.		0.587	NRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253090.4	NM_031474	
NUP188	23511	ucsc.edu;bcgsc.ca	37	9	131765129	131765129	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:131765129C>T	ENST00000372577.2	+	37	4192	c.4171C>T	c.(4171-4173)Ccc>Tcc	p.P1391S	RP11-167N5.5_ENST00000594418.1_lincRNA	NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1391					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						CCTGGATGCCCCCTCTTGGCC	0.572																																					p.P1391S		.											.	NUP188	207	0			c.C4171T						.						100.0	89.0	93.0					9																	131765129		2203	4300	6503	SO:0001583	missense	23511	exon37			GATGCCCCCTCTT	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.4171C>T	9.37:g.131765129C>T	ENSP00000361658:p.Pro1391Ser	45.0	0.0		35.0	4.0	NM_015354	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.167423	0.57476	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.29397	1.57	5.93	5.93	0.95920	.	0.098184	0.64402	D	0.000001	T	0.31358	0.0794	L	0.52364	1.645	0.58432	D	0.999994	B;P	0.39282	0.031;0.666	B;B	0.33339	0.01;0.162	T	0.09729	-1.0661	10	0.62326	D	0.03	-5.3289	19.3319	0.94293	0.0:1.0:0.0:0.0	.	724;1391	E9PET9;Q5SRE5	.;NU188_HUMAN	S	1280;1391	ENSP00000361658:P1391S	ENSP00000349125:P1280S	P	+	1	0	NUP188	130804950	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.732000	0.62029	2.815000	0.96918	0.561000	0.74099	CCC	.		0.572	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		
NUP214	8021	ucsc.edu;bcgsc.ca	37	9	134004676	134004676	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:134004676A>T	ENST00000359428.5	+	4	548	c.404A>T	c.(403-405)cAa>cTa	p.Q135L	RNU6-881P_ENST00000516813.1_RNA|NUP214_ENST00000411637.2_Missense_Mutation_p.Q135L|NUP214_ENST00000451030.1_Missense_Mutation_p.Q135L			P35658	NU214_HUMAN	nucleoporin 214kDa	135	Seven-bladed beta propeller.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		GCTAAACAGCAAAAACGCCCA	0.358			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.Q135L	Pancreas(4;24 48 25510 30394 32571)	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214	1131	0			c.A404T						.						104.0	90.0	94.0					9																	134004676		2203	4300	6503	SO:0001583	missense	8021	exon4			AACAGCAAAAACG	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.404A>T	9.37:g.134004676A>T	ENSP00000352400:p.Gln135Leu	86.0	0.0		39.0	4.0	NM_005085	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	A	15.29	2.789808	0.50102	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000531584	D;D;D;D	0.94092	-3.35;-3.35;-3.35;-3.35	5.58	4.41	0.53225	WD40/YVTN repeat-like-containing domain (1);	0.215117	0.22932	N	0.053890	D	0.87569	0.6210	L	0.29908	0.895	0.50632	D	0.999889	B;B	0.13594	0.008;0.008	B;B	0.14023	0.01;0.01	T	0.80560	-0.1328	10	0.23302	T	0.38	-4.8762	10.8873	0.46974	0.8548:0.0:0.0:0.1452	.	135;135	P35658-4;P35658	.;NU214_HUMAN	L	135;135;135;135;45	ENSP00000352400:Q135L;ENSP00000396576:Q135L;ENSP00000405014:Q135L;ENSP00000435874:Q45L	ENSP00000352400:Q135L	Q	+	2	0	NUP214	132994497	1.000000	0.71417	0.998000	0.56505	0.727000	0.41649	5.116000	0.64661	0.903000	0.36546	0.533000	0.62120	CAA	.		0.358	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
NUP88	4927	ucsc.edu;bcgsc.ca	37	17	5292266	5292266	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr17:5292266G>T	ENST00000573584.1	-	11	2008	c.1499C>A	c.(1498-1500)cCa>cAa	p.P500Q	NUP88_ENST00000573169.1_5'Flank	NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	500					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)			endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						AGGAGACGCTGGATGGACTGT	0.423																																					p.P500Q		.											.	NUP88	204	0			c.C1499A						.						66.0	63.0	64.0					17																	5292266		2203	4300	6503	SO:0001583	missense	4927	exon11			GACGCTGGATGGA	Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.1499C>A	17.37:g.5292266G>T	ENSP00000458954:p.Pro500Gln	58.0	1.0		39.0	4.0	NM_002532	D3DTM2|Q9BWE5	Missense_Mutation	SNP	ENST00000573584.1	37	CCDS11070.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.063175	0.76187	.	.	ENSG00000108559	ENST00000225696;ENST00000543132	.	.	.	5.23	4.26	0.50523	.	0.000000	0.85682	D	0.000000	T	0.74412	0.3713	M	0.70595	2.14	0.53688	D	0.999973	D;D;D	0.76494	0.998;0.973;0.999	D;P;D	0.70487	0.943;0.721;0.969	T	0.72090	-0.4395	9	0.20046	T	0.44	-12.7548	13.5142	0.61530	0.075:0.0:0.925:0.0	.	500;369;500	B7Z5I6;B4DP20;Q99567	.;.;NUP88_HUMAN	Q	500;369	.	ENSP00000225696:P500Q	P	-	2	0	NUP88	5232990	1.000000	0.71417	0.991000	0.47740	0.965000	0.64279	8.032000	0.88838	1.585000	0.49928	0.591000	0.81541	CCA	.		0.423	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216918.3	NM_002532	
OR2AE1	81392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99474046	99474046	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:99474046A>G	ENST00000316368.2	-	1	634	c.611T>C	c.(610-612)aTt>aCt	p.I204T		NM_001005276.1	NP_001005276.1	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE, member 1	204						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)	11	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					GAGGAGGAGAATGCTGCTGAT	0.473																																					p.I204T		.											.	OR2AE1	90	0			c.T611C						.						142.0	117.0	126.0					7																	99474046		2203	4300	6503	SO:0001583	missense	81392	exon1			AGGAGAATGCTGC	AC011904	CCDS34696.1	7q22.1	2014-02-19	2002-02-28		ENSG00000244623	ENSG00000244623		"""GPCR / Class A : Olfactory receptors"""	15087	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily AE, member 2"""	OR2AE2			Standard	NM_001005276		Approved		uc003usc.1	Q8NHA4	OTTHUMG00000156650	ENST00000316368.2:c.611T>C	7.37:g.99474046A>G	ENSP00000313936:p.Ile204Thr	59.0	0.0		51.0	15.0	NM_001005276	B2RPD2	Missense_Mutation	SNP	ENST00000316368.2	37	CCDS34696.1	.	.	.	.	.	.	.	.	.	.	A	1.190	-0.635584	0.03584	.	.	ENSG00000244623	ENST00000316368	T	0.00107	8.72	3.62	2.45	0.29901	GPCR, rhodopsin-like superfamily (1);	0.838313	0.09926	N	0.737781	T	0.00144	0.0004	L	0.42744	1.35	0.09310	N	1	B	0.06786	0.001	B	0.15052	0.012	T	0.38023	-0.9680	10	0.72032	D	0.01	.	4.0514	0.09796	0.6773:0.2099:0.1128:0.0	.	204	Q8NHA4	O2AE1_HUMAN	T	204	ENSP00000313936:I204T	ENSP00000313936:I204T	I	-	2	0	OR2AE1	99311982	0.002000	0.14202	0.001000	0.08648	0.012000	0.07955	2.012000	0.40932	0.739000	0.32628	0.405000	0.27470	ATT	.		0.473	OR2AE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345053.1		
OR8B8	26493	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	124310110	124310110	+	Missense_Mutation	SNP	C	C	T	rs147220624	byFrequency	TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:124310110C>T	ENST00000328064.2	-	1	944	c.872G>A	c.(871-873)aGc>aAc	p.S291N		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	291					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		ATTCCTCAGGCTATAAATTAA	0.408																																					p.S291N		.											.	OR8B8	69	0			c.G872A						.						107.0	98.0	101.0					11																	124310110		2201	4299	6500	SO:0001583	missense	26493	exon1			CTCAGGCTATAAA	AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.872G>A	11.37:g.124310110C>T	ENSP00000330280:p.Ser291Asn	66.0	0.0		35.0	16.0	NM_012378	A1L446|Q96RC8	Missense_Mutation	SNP	ENST00000328064.2	37	CCDS8446.1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.379611	0.42207	.	.	ENSG00000197125	ENST00000328064	T	0.39056	1.1	3.81	3.81	0.43845	.	0.000000	0.56097	D	0.000036	T	0.76870	0.4048	H	0.98559	4.265	0.25578	N	0.98683	D	0.71674	0.998	D	0.66847	0.947	T	0.75889	-0.3158	10	0.87932	D	0	.	16.615	0.84904	0.0:1.0:0.0:0.0	.	291	Q15620	OR8B8_HUMAN	N	291	ENSP00000330280:S291N	ENSP00000330280:S291N	S	-	2	0	OR8B8	123815320	0.017000	0.18338	0.749000	0.31150	0.468000	0.32798	1.191000	0.32138	2.412000	0.81896	0.655000	0.94253	AGC	C|0.999;A|0.001		0.408	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387056.1	NM_012378	
OR8B8	26493	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	124310343	124310343	+	Silent	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:124310343G>T	ENST00000328064.2	-	1	711	c.639C>A	c.(637-639)acC>acA	p.T213T		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	213					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		AAATGAAGATGGTGACTGTGG	0.488																																					p.T213T		.											.	OR8B8	69	0			c.C639A						.						187.0	159.0	169.0					11																	124310343		2201	4299	6500	SO:0001819	synonymous_variant	26493	exon1			GAAGATGGTGACT	AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.639C>A	11.37:g.124310343G>T		86.0	0.0		40.0	18.0	NM_012378	A1L446|Q96RC8	Silent	SNP	ENST00000328064.2	37	CCDS8446.1																																																																																			.		0.488	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387056.1	NM_012378	
OSBPL10	114884	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	31705616	31705616	+	Silent	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:31705616G>A	ENST00000396556.2	-	11	2327	c.2205C>T	c.(2203-2205)cgC>cgT	p.R735R	OSBPL10_ENST00000438237.2_Silent_p.R671R	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	735					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		GGAGGTTCTCGCGCTTCCGTT	0.602																																					p.R735R		.											.	OSBPL10	69	0			c.C2205T						.						146.0	134.0	138.0					3																	31705616		2203	4300	6503	SO:0001819	synonymous_variant	114884	exon11			GTTCTCGCGCTTC	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.2205C>T	3.37:g.31705616G>A		64.0	0.0		63.0	13.0	NM_017784	B4E212|Q9BTU5	Silent	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	G	8.748	0.920554	0.17982	.	.	ENSG00000144645	ENST00000429492	.	.	.	5.25	-1.21	0.09524	.	.	.	.	.	T	0.41743	0.1172	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23013	-1.0200	4	.	.	.	-23.4378	2.492	0.04613	0.0957:0.3146:0.1979:0.3918	.	.	.	.	V	504	.	.	A	-	2	0	OSBPL10	31680620	0.012000	0.17670	0.979000	0.43373	0.850000	0.48378	-0.876000	0.04201	-0.490000	0.06707	-0.165000	0.13383	GCG	.		0.602	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
OSBPL10	114884	ucsc.edu;bcgsc.ca	37	3	31871717	31871717	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:31871717G>A	ENST00000396556.2	-	4	666	c.544C>T	c.(544-546)Cca>Tca	p.P182S	OSBPL10_ENST00000467647.1_5'Flank|OSBPL10_ENST00000438237.2_Intron	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	182					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		CGGGAGCTTGGAGCACTCTAG	0.507																																					p.P182S		.											.	OSBPL10	69	0			c.C544T						.						51.0	52.0	52.0					3																	31871717		2203	4300	6503	SO:0001583	missense	114884	exon4			AGCTTGGAGCACT	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.544C>T	3.37:g.31871717G>A	ENSP00000379804:p.Pro182Ser	46.0	0.0		36.0	4.0	NM_017784	B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.734566	0.30774	.	.	ENSG00000144645	ENST00000396556	T	0.41065	1.01	5.54	4.67	0.58626	.	0.573986	0.19793	N	0.105925	T	0.25975	0.0633	N	0.19112	0.55	0.80722	D	1	B	0.19200	0.034	B	0.26517	0.07	T	0.07520	-1.0768	10	0.19590	T	0.45	-2.145	6.8186	0.23845	0.1647:0.1468:0.6884:0.0	.	182	Q9BXB5	OSB10_HUMAN	S	182	ENSP00000379804:P182S	ENSP00000379804:P182S	P	-	1	0	OSBPL10	31846721	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	2.150000	0.42254	1.350000	0.45770	0.561000	0.74099	CCA	.		0.507	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
P4HA2	8974	ucsc.edu;bcgsc.ca	37	5	131552900	131552900	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:131552900G>T	ENST00000401867.1	-	5	889	c.321C>A	c.(319-321)gaC>gaA	p.D107E	P4HA2_ENST00000166534.4_Missense_Mutation_p.D107E|P4HA2_ENST00000379086.1_Missense_Mutation_p.D107E|P4HA2_ENST00000379100.2_Missense_Mutation_p.D107E|P4HA2_ENST00000360568.3_Missense_Mutation_p.D107E|P4HA2_ENST00000379104.2_Missense_Mutation_p.D107E			O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha polypeptide II	107					peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|procollagen-proline 4-dioxygenase complex (GO:0016222)	electron carrier activity (GO:0009055)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	CTGCAGCTGAGTCCTGCAGGA	0.577																																					p.D107E	Esophageal Squamous(68;117 1135 17362 19256 34242)	.											.	P4HA2	68	0			c.C321A						.						124.0	104.0	111.0					5																	131552900		2203	4300	6503	SO:0001583	missense	8974	exon4			AGCTGAGTCCTGC	U90441	CCDS4151.1, CCDS34230.1	5q31	2008-12-09	2008-12-09		ENSG00000072682	ENSG00000072682	1.14.11.2		8547	protein-coding gene	gene with protein product	"""4-PH alpha 2"", ""collagen prolyl 4-hydroxylase alpha(II)"""	600608	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II"""			9211872, 9149945	Standard	NM_001142598		Approved	C-P4Halpha(II)	uc003kwl.3	O15460	OTTHUMG00000059647	ENST00000401867.1:c.321C>A	5.37:g.131552900G>T	ENSP00000384999:p.Asp107Glu	30.0	0.0		43.0	4.0	NM_001017974	D3DQ85|D3DQ86|Q8WWN0	Missense_Mutation	SNP	ENST00000401867.1	37	CCDS4151.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.329769	0.81690	.	.	ENSG00000072682	ENST00000401867;ENST00000379086;ENST00000166534;ENST00000360568;ENST00000379104;ENST00000379100;ENST00000417528;ENST00000431054;ENST00000439698;ENST00000395164;ENST00000453286;ENST00000428369;ENST00000418055	T;T;T;T;T;T	0.42900	0.96;0.97;0.96;0.97;0.96;0.97	6.17	3.05	0.35203	Prolyl 4-hydroxylase alpha-subunit, N-terminal (1);	0.225469	0.52532	D	0.000069	T	0.51346	0.1669	M	0.66560	2.04	0.58432	D	0.999992	P;P	0.35894	0.526;0.471	P;P	0.50405	0.617;0.64	T	0.51764	-0.8664	10	0.59425	D	0.04	-13.1301	7.2091	0.25923	0.3846:0.0:0.6154:0.0	.	107;107	O15460;O15460-2	P4HA2_HUMAN;.	E	107;107;107;107;107;107;107;139;107;107;107;107;107	ENSP00000384999:D107E;ENSP00000368379:D107E;ENSP00000166534:D107E;ENSP00000353772:D107E;ENSP00000368398:D107E;ENSP00000368394:D107E	ENSP00000166534:D107E	D	-	3	2	P4HA2	131580799	0.895000	0.30542	0.827000	0.32855	0.948000	0.59901	0.351000	0.20096	0.912000	0.36772	0.655000	0.94253	GAC	.		0.577	P4HA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132653.4	NM_004199	
PADI1	29943	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	17563890	17563890	+	Silent	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:17563890G>A	ENST00000375471.4	+	12	1487	c.1395G>A	c.(1393-1395)tcG>tcA	p.S465S	PADI1_ENST00000413717.2_Silent_p.S22S|PADI1_ENST00000537499.1_Silent_p.S22S|PADI1_ENST00000536552.1_Intron	NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I	465					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	AGCTCTACTCGGACTGGCTCT	0.642											OREG0013147	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S465S	Esophageal Squamous(80;414 1257 4580 27746 50832)	.											.	PADI1	68	0			c.G1395A						.						180.0	143.0	155.0					1																	17563890		2203	4300	6503	SO:0001819	synonymous_variant	29943	exon12			CTACTCGGACTGG	AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.1395G>A	1.37:g.17563890G>A		88.0	1.0	89	49.0	33.0	NM_013358	A1L4K6|Q70SX6	Silent	SNP	ENST00000375471.4	37	CCDS178.1																																																																																			.		0.642	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006621.1	NM_013358	
PADI3	51702	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	17609432	17609432	+	Missense_Mutation	SNP	G	G	A	rs35624745	byFrequency	TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:17609432G>A	ENST00000375460.3	+	16	1893	c.1853G>A	c.(1852-1854)cGg>cAg	p.R618Q		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	618			R -> Q (in dbSNP:rs35624745).		protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GAGAAGGTGCGGTCCCTGCTG	0.607																																					p.R618Q		.											.	PADI3	132	0			c.G1853A						.						81.0	66.0	71.0					1																	17609432		2203	4300	6503	SO:0001583	missense	51702	exon16			AGGTGCGGTCCCT	AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.1853G>A	1.37:g.17609432G>A	ENSP00000364609:p.Arg618Gln	55.0	0.0		36.0	14.0	NM_016233	Q58EY7|Q70SX5	Missense_Mutation	SNP	ENST00000375460.3	37	CCDS179.1	.	.	.	.	.	.	.	.	.	.	g	13.21	2.168383	0.38315	.	.	ENSG00000142619	ENST00000375460	T	0.23950	1.88	5.0	3.14	0.36123	Protein-arginine deiminase, C-terminal (1);	0.275088	0.37095	N	0.002252	T	0.25232	0.0613	M	0.72576	2.205	0.40261	D	0.978177	B	0.16802	0.019	B	0.17979	0.02	T	0.07539	-1.0767	10	0.13853	T	0.58	-18.3345	10.0706	0.42330	0.165:0.0:0.835:0.0	rs35624745	618	Q9ULW8	PADI3_HUMAN	Q	618	ENSP00000364609:R618Q	ENSP00000364609:R618Q	R	+	2	0	PADI3	17482019	1.000000	0.71417	0.996000	0.52242	0.954000	0.61252	3.852000	0.55934	0.526000	0.28541	-0.258000	0.10820	CGG	G|0.967;A|0.033		0.607	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006805.1		
PADI6	353238	ucsc.edu;bcgsc.ca	37	1	17727872	17727872	+	RNA	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:17727872T>C	ENST00000434762.2	+	0	2074							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	CGGAGACATCTGTGCCTGTGC	0.567																																					p.C675R		.											.	PADI6	113	0			c.T2023C						.						53.0	58.0	56.0					1																	17727872		2020	4190	6210			353238	exon17			GACATCTGTGCCT	AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17727872T>C		58.0	0.0		45.0	4.0	NM_207421	Q330K5|Q70SX3	Missense_Mutation	SNP	ENST00000434762.2	37																																																																																				.		0.567	PADI6-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000006804.4	NM_207421	
PAX8	7849	ucsc.edu;bcgsc.ca	37	2	114002034	114002034	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:114002034T>C	ENST00000429538.3	-	4	553	c.359A>G	c.(358-360)gAc>gGc	p.D120G	PAX8_ENST00000397647.3_Missense_Mutation_p.D120G|AC016683.6_ENST00000422956.2_RNA|AC016683.6_ENST00000445745.1_RNA|PAX8_ENST00000263334.5_Missense_Mutation_p.D120G|AC016683.6_ENST00000451179.1_RNA|AC016683.6_ENST00000333145.5_RNA|AC016683.6_ENST00000553869.2_RNA|AC016683.6_ENST00000556070.1_RNA|AC016683.6_ENST00000436293.2_RNA|PAX8_ENST00000348715.5_Missense_Mutation_p.D120G|PAX8_ENST00000263335.7_Missense_Mutation_p.D120G	NM_003466.3	NP_003457.1	Q06710	PAX8_HUMAN	paired box 8	120	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				anatomical structure morphogenesis (GO:0009653)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular response to gonadotropin stimulus (GO:0071371)|central nervous system development (GO:0007417)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesonephros development (GO:0001823)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric nephron tubule formation (GO:0072289)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|otic vesicle development (GO:0071599)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|regulation of apoptotic process (GO:0042981)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of thyroid-stimulating hormone secretion (GO:2000612)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone signaling pathway (GO:0038194)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid-stimulating hormone receptor activity (GO:0004996)|transcription regulatory region DNA binding (GO:0044212)		PAX8/PPARG(117)	breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|skin(1)	20						GGGCACAGTGTCATTGTCACA	0.552			T	PPARG	follicular thyroid		Thyroid dysgenesis																														p.D120G	Ovarian(188;7 2067 9084 29802 29892)	.		Dom	yes		2	2q12-q14	7849	paired box gene 8	yes	E	.	PAX8	684	0			c.A359G						.						121.0	136.0	130.0					2																	114002034		2199	4298	6497	SO:0001583	missense	7849	exon4			ACAGTGTCATTGT	X69699	CCDS42735.1, CCDS42736.1, CCDS46398.1, CCDS46399.1	2q13	2011-06-20	2007-07-12		ENSG00000125618	ENSG00000125618		"""Paired boxes"", ""Homeoboxes / PRD class"""	8622	protein-coding gene	gene with protein product		167415	"""paired box gene 8"""			8431641, 7981748	Standard	NM_003466		Approved		uc010yxt.2	Q06710	OTTHUMG00000128529	ENST00000429538.3:c.359A>G	2.37:g.114002034T>C	ENSP00000395498:p.Asp120Gly	24.0	0.0		30.0	4.0	NM_013952	Q09155|Q16337|Q16338|Q16339|Q4ZG35|Q96J49	Missense_Mutation	SNP	ENST00000429538.3	37	CCDS46398.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.576978	0.86645	.	.	ENSG00000125618	ENST00000263335;ENST00000397647;ENST00000348715;ENST00000429538;ENST00000263334	D;D;D;D;D	0.99409	-5.85;-5.85;-5.85;-5.85;-5.85	5.19	5.19	0.71726	Paired box protein, N-terminal (3);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99260	0.9742	L	0.57130	1.785	0.80722	D	1	D;D;D;B;B	0.76494	0.978;0.99;0.999;0.089;0.042	P;D;D;B;B	0.75484	0.817;0.962;0.986;0.193;0.164	D	0.99116	1.0848	10	0.66056	D	0.02	.	12.9947	0.58640	0.0:0.0:0.0:1.0	.	120;120;120;120;120	Q06710-2;Q06710-3;Q06710;Q06710-5;Q06710-4	.;.;PAX8_HUMAN;.;.	G	120	ENSP00000263335:D120G;ENSP00000380768:D120G;ENSP00000314750:D120G;ENSP00000395498:D120G;ENSP00000263334:D120G	ENSP00000263334:D120G	D	-	2	0	PAX8	113718504	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	1.969000	0.57287	0.460000	0.39030	GAC	.		0.552	PAX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250353.5		
PBX1	5087	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	164768969	164768969	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:164768969C>T	ENST00000420696.2	+	4	732	c.544C>T	c.(544-546)Ctc>Ttc	p.L182F	PBX1_ENST00000367897.1_Missense_Mutation_p.L182F|PBX1_ENST00000560641.1_Missense_Mutation_p.L77F|PBX1_ENST00000540236.1_Missense_Mutation_p.L182F|PBX1_ENST00000559240.1_Missense_Mutation_p.L182F|PBX1_ENST00000540246.1_Missense_Mutation_p.L77F|PBX1_ENST00000401534.1_Missense_Mutation_p.L182F	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	182					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						CGTGATGAATCTCCTGCGAGA	0.552			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																p.L182F		.		Dom	yes		1	1q23	5087	pre-B-cell leukemia transcription factor 1		"""L, M"""	.	PBX1	659	0			c.C544T						.						90.0	82.0	84.0					1																	164768969		2203	4300	6503	SO:0001583	missense	5087	exon4			ATGAATCTCCTGC	M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.544C>T	1.37:g.164768969C>T	ENSP00000405890:p.Leu182Phe	58.0	0.0		83.0	16.0	NM_001204963	B4DSC1|F5H4U9|Q5T488	Missense_Mutation	SNP	ENST00000420696.2	37	CCDS1246.1	.	.	.	.	.	.	.	.	.	.	C	34	5.333251	0.95758	.	.	ENSG00000185630	ENST00000420696;ENST00000367897;ENST00000540236;ENST00000401534;ENST00000540246	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	5.76	5.76	0.90799	PBX (1);	0.000000	0.85682	D	0.000000	T	0.66277	0.2773	M	0.87269	2.87	0.80722	D	1	D;D;D;D;D	0.71674	0.996;0.998;0.995;0.998;0.996	D;D;D;D;D	0.78314	0.985;0.991;0.974;0.991;0.985	T	0.69412	-0.5152	10	0.54805	T	0.06	-11.2331	19.571	0.95419	0.0:1.0:0.0:0.0	.	77;182;182;182;182	B7Z774;A8K5V0;F5H4U9;P40424;Q53YC7	.;.;.;PBX1_HUMAN;.	F	182;182;182;182;77	ENSP00000405890:L182F;ENSP00000356872:L182F;ENSP00000439943:L182F;ENSP00000384856:L182F;ENSP00000440869:L77F	ENSP00000356872:L182F	L	+	1	0	PBX1	163035593	1.000000	0.71417	0.996000	0.52242	0.977000	0.68977	7.380000	0.79704	2.713000	0.92767	0.655000	0.94253	CTC	.		0.552	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082864.4	NM_002585	
PCNXL2	80003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	233397906	233397906	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:233397906T>C	ENST00000258229.9	-	3	599	c.365A>G	c.(364-366)aAt>aGt	p.N122S	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	122						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				AATCTGCCTATTATTGCTAAC	0.448																																					p.N122S		.											.	PCNXL2	91	0			c.A365G						.						183.0	192.0	189.0					1																	233397906		1949	4139	6088	SO:0001583	missense	80003	exon3			TGCCTATTATTGC	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.365A>G	1.37:g.233397906T>C	ENSP00000258229:p.Asn122Ser	108.0	0.0		144.0	19.0	NM_014801	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	37	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	T	11.91	1.779032	0.31502	.	.	ENSG00000135749	ENST00000258229	T	0.62232	0.04	5.2	-0.286	0.12862	.	.	.	.	.	T	0.42585	0.1209	N	0.22421	0.69	0.18873	N	0.999985	B	0.29162	0.235	B	0.29077	0.098	T	0.23868	-1.0176	9	0.23891	T	0.37	.	7.4045	0.26983	0.0:0.0763:0.4036:0.5201	.	122	A6NKB5	PCX2_HUMAN	S	122	ENSP00000258229:N122S	ENSP00000258229:N122S	N	-	2	0	PCNXL2	231464529	0.593000	0.26840	0.000000	0.03702	0.543000	0.35085	0.748000	0.26305	-0.226000	0.09899	0.533000	0.62120	AAT	.		0.448	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
PDCL	5082	ucsc.edu;bcgsc.ca	37	9	125582879	125582879	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:125582879G>T	ENST00000259467.4	-	4	556	c.391C>A	c.(391-393)Caa>Aaa	p.Q131K		NM_005388.4	NP_005379.3	Q13371	PHLP_HUMAN	phosducin-like	131					heterotrimeric G-protein complex assembly (GO:1902605)|intracellular signal transduction (GO:0035556)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10						TCATCATCTTGGTCCTCATTC	0.458																																					p.Q131K		.											.	PDCL	90	0			c.C391A						.						61.0	60.0	61.0					9																	125582879		2203	4300	6503	SO:0001583	missense	5082	exon4			CATCTTGGTCCTC	AF083325	CCDS6845.1	9q12-q13	2008-07-21			ENSG00000136940	ENSG00000136940			8770	protein-coding gene	gene with protein product		604421				10095058	Standard	NM_005388		Approved	PhLP, DKFZp564M1863	uc004bmz.2	Q13371	OTTHUMG00000020624	ENST00000259467.4:c.391C>A	9.37:g.125582879G>T	ENSP00000259467:p.Gln131Lys	33.0	0.0		28.0	4.0	NM_005388	Q4VXB6|Q96AF1|Q9UEW7|Q9UFL0|Q9UNX1|Q9UNX2	Missense_Mutation	SNP	ENST00000259467.4	37	CCDS6845.1	.	.	.	.	.	.	.	.	.	.	G	7.705	0.693923	0.15039	.	.	ENSG00000136940	ENST00000259467	T	0.13307	2.6	5.47	4.56	0.56223	Thioredoxin-like fold (1);Phosducin, thioredoxin-like domain (1);Phosducin, domain 2 (1);	0.272686	0.39834	N	0.001252	T	0.04497	0.0123	N	0.02539	-0.55	0.22389	N	0.999149	B	0.02656	0.0	B	0.09377	0.004	T	0.41538	-0.9503	10	0.10377	T	0.69	-3.125	7.4141	0.27034	0.0931:0.1837:0.7232:0.0	.	131	Q13371	PHLP_HUMAN	K	131	ENSP00000259467:Q131K	ENSP00000259467:Q131K	Q	-	1	0	PDCL	124622700	0.998000	0.40836	0.998000	0.56505	0.988000	0.76386	3.435000	0.52849	1.288000	0.44600	0.655000	0.94253	CAA	.		0.458	PDCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053956.1	NM_005388	
PDE1A	5136	ucsc.edu;bcgsc.ca	37	2	183053724	183053724	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:183053724C>T	ENST00000410103.1	-	12	1320	c.1237G>A	c.(1237-1239)Gtg>Atg	p.V413M	PDE1A_ENST00000358139.2_Missense_Mutation_p.V413M|PDE1A_ENST00000351439.5_Missense_Mutation_p.V397M|PDE1A_ENST00000409365.1_Missense_Mutation_p.V397M|PDE1A_ENST00000456212.1_Missense_Mutation_p.V413M|PDE1A_ENST00000346717.4_Missense_Mutation_p.V379M|PDE1A_ENST00000331935.6_Missense_Mutation_p.V413M|PDE1A_ENST00000536095.1_Missense_Mutation_p.V309M|PDE1A_ENST00000435564.1_Missense_Mutation_p.V413M	NM_001003683.2	NP_001003683.1	P54750	PDE1A_HUMAN	phosphodiesterase 1A, calmodulin-dependent	413	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of smooth muscle cell apoptotic process (GO:0034391)|regulation of smooth muscle cell proliferation (GO:0048660)|signal transduction (GO:0007165)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(2)	35			OV - Ovarian serous cystadenocarcinoma(117;0.061)		Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	GACTGGGCCACCATGGTTGAC	0.423																																					p.V417M		.											.	PDE1A	93	0			c.G1249A						.						201.0	207.0	205.0					2																	183053724		2203	4300	6503	SO:0001583	missense	5136	exon12			GGGCCACCATGGT		CCDS2285.1, CCDS33344.1, CCDS58741.1, CCDS74612.1	2q32.1	2008-03-18			ENSG00000115252	ENSG00000115252	3.1.4.17	"""Phosphodiesterases"""	8774	protein-coding gene	gene with protein product		171890				8557689, 11342109	Standard	NM_005019		Approved		uc010zfq.2	P54750	OTTHUMG00000132596	ENST00000410103.1:c.1237G>A	2.37:g.183053724C>T	ENSP00000387037:p.Val413Met	37.0	0.0		43.0	4.0	NM_001258312	D3DPG5|Q86VZ0|Q9C0K8|Q9C0K9|Q9C0L0|Q9C0L1|Q9C0L2|Q9C0L3|Q9C0L4|Q9UFX3	Missense_Mutation	SNP	ENST00000410103.1	37	CCDS33344.1	.	.	.	.	.	.	.	.	.	.	C	19.04	3.750759	0.69533	.	.	ENSG00000115252	ENST00000435564;ENST00000346717;ENST00000536095;ENST00000409365;ENST00000331935;ENST00000351439;ENST00000410103;ENST00000358139;ENST00000456212	D;D;D;D;D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94	5.6	5.6	0.85130	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.057269	0.64402	D	0.000001	D	0.91164	0.7217	L	0.60904	1.88	0.53688	D	0.999978	D;D;P;D;D	0.71674	0.998;0.986;0.731;0.995;0.997	D;D;P;D;D	0.74348	0.983;0.94;0.669;0.972;0.979	D	0.91325	0.5085	10	0.72032	D	0.01	.	18.9615	0.92679	0.0:1.0:0.0:0.0	.	309;379;413;397;413	B7Z3A7;P54750-3;P54750;P54750-2;P54750-4	.;.;PDE1A_HUMAN;.;.	M	413;379;309;397;413;397;413;413;413	ENSP00000410309:V413M;ENSP00000329112:V379M;ENSP00000439938:V309M;ENSP00000386767:V397M;ENSP00000331574:V413M;ENSP00000309269:V397M;ENSP00000387037:V413M;ENSP00000350858:V413M;ENSP00000408874:V413M	ENSP00000331574:V413M	V	-	1	0	PDE1A	182761969	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.409000	0.44583	2.793000	0.96121	0.591000	0.81541	GTG	.		0.423	PDE1A-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334356.1		
PDLIM3	27295	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	186425735	186425735	+	Missense_Mutation	SNP	G	G	C	rs373419233		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:186425735G>C	ENST00000284770.5	-	7	872	c.799C>G	c.(799-801)Cgt>Ggt	p.R267G	PDLIM3_ENST00000284771.6_Missense_Mutation_p.R219G|PDLIM3_ENST00000284767.5_3'UTR	NM_014476.5	NP_055291.2	Q53GG5	PDLI3_HUMAN	PDZ and LIM domain 3	267					actin filament organization (GO:0007015)|heart development (GO:0007507)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of muscle (GO:0008307)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		all_lung(41;1.03e-13)|Lung NSC(41;2.49e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.00996)|Colorectal(36;0.0161)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.4e-10)|BRCA - Breast invasive adenocarcinoma(30;8.64e-05)|GBM - Glioblastoma multiforme(59;0.000167)|STAD - Stomach adenocarcinoma(60;0.000828)|LUSC - Lung squamous cell carcinoma(40;0.00984)|COAD - Colon adenocarcinoma(29;0.0115)|READ - Rectum adenocarcinoma(43;0.171)		CCAGCCGGACGGTCATCTGAA	0.537																																					p.R267G		.											.	PDLIM3	92	0			c.C799G						.						47.0	41.0	43.0					4																	186425735		2203	4300	6503	SO:0001583	missense	27295	exon7			CCGGACGGTCATC	AF002280	CCDS3844.1, CCDS47172.1, CCDS75218.1, CCDS75219.1	4q35	2014-09-17			ENSG00000154553	ENSG00000154553			20767	protein-coding gene	gene with protein product		605889				10063829, 8828038	Standard	NM_014476		Approved	ALP	uc003ixw.4	Q53GG5	OTTHUMG00000160412	ENST00000284770.5:c.799C>G	4.37:g.186425735G>C	ENSP00000284770:p.Arg267Gly	40.0	0.0		16.0	16.0	NM_014476	B2R866|O43590|O60439|O60440|Q8N6Y6|Q9BVP4	Missense_Mutation	SNP	ENST00000284770.5	37	CCDS3844.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.361487	0.82353	.	.	ENSG00000154553	ENST00000284770;ENST00000284771	T;T	0.37915	1.17;2.06	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.56277	0.1974	M	0.68593	2.085	0.80722	D	1	P;D	0.89917	0.947;1.0	P;D	0.74348	0.773;0.983	T	0.48399	-0.9039	10	0.27082	T	0.32	-23.5407	15.2145	0.73254	0.0:0.0:0.8587:0.1413	.	219;267	Q53GG5-2;Q53GG5	.;PDLI3_HUMAN	G	267;219	ENSP00000284770:R267G;ENSP00000284771:R219G	ENSP00000284770:R267G	R	-	1	0	PDLIM3	186662729	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.592000	0.82676	2.711000	0.92665	0.655000	0.94253	CGT	.		0.537	PDLIM3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360499.2	NM_014476	
PHF3	23469	ucsc.edu;bcgsc.ca	37	6	64390032	64390032	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:64390032C>A	ENST00000262043.3	+	3	716	c.376C>A	c.(376-378)Cca>Aca	p.P126T	PHF3_ENST00000393387.1_Missense_Mutation_p.P126T|PHF3_ENST00000509330.1_Missense_Mutation_p.P126T			Q92576	PHF3_HUMAN	PHD finger protein 3	126					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			AGTGAGATCTCCAAGAAAATC	0.373																																					p.P126T	GBM(135;136 1820 29512 34071 46235)	.											.	PHF3	229	0			c.C376A						.						144.0	143.0	143.0					6																	64390032		2203	4300	6503	SO:0001583	missense	23469	exon2			AGATCTCCAAGAA	AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.376C>A	6.37:g.64390032C>A	ENSP00000262043:p.Pro126Thr	72.0	1.0		41.0	4.0	NM_015153	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	ENST00000262043.3	37	CCDS4966.1	.	.	.	.	.	.	.	.	.	.	C	17.24	3.338541	0.60963	.	.	ENSG00000118482	ENST00000481385;ENST00000262043;ENST00000494284;ENST00000509330;ENST00000393387;ENST00000514822	T;T;T;T;T	0.57907	1.29;1.79;1.36;0.37;1.79	5.98	5.98	0.97165	.	0.000000	0.39274	N	0.001404	T	0.67942	0.2947	M	0.62723	1.935	0.45837	D	0.998708	D;D	0.89917	1.0;1.0	D;D	0.79784	0.96;0.993	T	0.68341	-0.5434	10	0.87932	D	0	-12.4528	20.452	0.99131	0.0:1.0:0.0:0.0	.	126;126	Q92576;D6R9X2	PHF3_HUMAN;.	T	38;126;79;126;126;56	ENSP00000425227:P38T;ENSP00000262043:P126T;ENSP00000424078:P79T;ENSP00000422841:P126T;ENSP00000377048:P126T	ENSP00000262043:P126T	P	+	1	0	PHF3	64447991	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.629000	0.67798	2.838000	0.97847	0.591000	0.81541	CCA	.		0.373	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
PITPNM1	9600	ucsc.edu;bcgsc.ca	37	11	67262555	67262555	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:67262555A>G	ENST00000534749.1	-	16	2812	c.2624T>C	c.(2623-2625)cTg>cCg	p.L875P	PITPNM1_ENST00000526450.1_5'Flank|PITPNM1_ENST00000436757.2_Missense_Mutation_p.L874P|PITPNM1_ENST00000356404.3_Missense_Mutation_p.L875P			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	875	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						CACCTGGCGCAGGATGAACGC	0.667																																					p.L875P	GBM(28;144 709 4607 5525)	.											.	PITPNM1	227	0			c.T2624C						.						61.0	62.0	62.0					11																	67262555		2200	4295	6495	SO:0001583	missense	9600	exon17			TGGCGCAGGATGA	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.2624T>C	11.37:g.67262555A>G	ENSP00000437286:p.Leu875Pro	38.0	0.0		23.0	4.0	NM_004910	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	ENST00000534749.1	37	CCDS31620.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.102069	0.76983	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	T;T;T	0.68479	-0.31;-0.33;-0.31	3.8	3.8	0.43715	DDHD (2);	0.000000	0.39615	N	0.001310	D	0.82591	0.5070	M	0.90082	3.085	0.80722	D	1	D;D	0.62365	0.989;0.991	D;D	0.67725	0.921;0.953	D	0.86056	0.1529	10	0.87932	D	0	-7.4608	11.8266	0.52271	1.0:0.0:0.0:0.0	.	874;875	O00562-2;O00562	.;PITM1_HUMAN	P	875;874;875	ENSP00000437286:L875P;ENSP00000398787:L874P;ENSP00000348772:L875P	ENSP00000348772:L875P	L	-	2	0	PITPNM1	67019131	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	8.947000	0.93000	1.734000	0.51633	0.402000	0.26972	CTG	.		0.667	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1	NM_004910	
PIWIL4	143689	ucsc.edu;bcgsc.ca	37	11	94331044	94331044	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:94331044T>C	ENST00000299001.6	+	11	1554	c.1343T>C	c.(1342-1344)aTt>aCt	p.I448T	RP11-867G2.8_ENST00000536540.1_RNA|RP11-867G2.8_ENST00000537874.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	448					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				ACTGGCCGGATTGTGCCTTCA	0.353																																					p.I448T		.											.	PIWIL4	91	0			c.T1343C						.						94.0	96.0	95.0					11																	94331044		2201	4298	6499	SO:0001583	missense	143689	exon11			GCCGGATTGTGCC	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.1343T>C	11.37:g.94331044T>C	ENSP00000299001:p.Ile448Thr	60.0	0.0		45.0	4.0	NM_152431	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	ENST00000299001.6	37	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	T	8.128	0.782545	0.16189	.	.	ENSG00000134627	ENST00000299001	T	0.04406	3.63	4.83	4.83	0.62350	Ribonuclease H-like (1);	0.579062	0.16039	N	0.232501	T	0.05914	0.0154	L	0.36672	1.1	0.80722	D	1	B	0.15719	0.014	B	0.14578	0.011	T	0.30995	-0.9959	10	0.45353	T	0.12	-5.6945	13.5216	0.61572	0.0:0.0:0.0:1.0	.	448	Q7Z3Z4	PIWL4_HUMAN	T	448	ENSP00000299001:I448T	ENSP00000299001:I448T	I	+	2	0	PIWIL4	93970692	0.355000	0.24921	0.061000	0.19648	0.147000	0.21601	4.936000	0.63506	2.038000	0.60285	0.482000	0.46254	ATT	.		0.353	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
PIWIL4	143689	ucsc.edu;bcgsc.ca	37	11	94351131	94351131	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:94351131A>G	ENST00000299001.6	+	17	2237	c.2026A>G	c.(2026-2028)Aaa>Gaa	p.K676E	RP11-867G2.8_ENST00000536540.1_RNA|RP11-867G2.8_ENST00000537874.1_RNA|PIWIL4_ENST00000537419.1_Missense_Mutation_p.K27E	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	676	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				AGCACTCAACAAATGGTACAA	0.383																																					p.K676E		.											.	PIWIL4	91	0			c.A2026G						.						81.0	76.0	77.0					11																	94351131		2201	4298	6499	SO:0001583	missense	143689	exon17			CTCAACAAATGGT	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.2026A>G	11.37:g.94351131A>G	ENSP00000299001:p.Lys676Glu	78.0	0.0		31.0	4.0	NM_152431	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	ENST00000299001.6	37	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	A	5.806	0.332924	0.11013	.	.	ENSG00000134627	ENST00000299001;ENST00000537419	T;T	0.27557	1.66;1.66	6.02	2.36	0.29203	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.471754	0.20551	N	0.090109	T	0.21307	0.0513	L	0.42632	1.34	0.20403	N	0.999904	B	0.06786	0.001	B	0.12837	0.008	T	0.32295	-0.9912	10	0.11485	T	0.65	-9.1236	7.9424	0.29965	0.6742:0.2578:0.068:0.0	.	676	Q7Z3Z4	PIWL4_HUMAN	E	676;27	ENSP00000299001:K676E;ENSP00000439710:K27E	ENSP00000299001:K676E	K	+	1	0	PIWIL4	93990779	0.846000	0.29590	0.253000	0.24343	0.956000	0.61745	1.879000	0.39618	0.142000	0.18901	0.533000	0.62120	AAA	.		0.383	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
PKD1L2	114780	ucsc.edu;bcgsc.ca	37	16	81241133	81241133	+	RNA	SNP	T	T	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:81241133T>A	ENST00000525539.1	-	0	867				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CTGTCTCCTGTACTAATTATA	0.468																																					p.T290S		.											.	PKD1L2	92	0			c.A868T						.						117.0	120.0	119.0					16																	81241133		1939	4133	6072			114780	exon5			CTCCTGTACTAAT	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81241133T>A		59.0	0.0		44.0	4.0	NM_001076780	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	ENST00000525539.1	37		.	.	.	.	.	.	.	.	.	.	T	15.00	2.702247	0.48307	.	.	ENSG00000166473	ENST00000337114	T	0.67523	-0.27	5.25	5.25	0.73442	.	0.423876	0.25178	N	0.032552	T	0.61413	0.2345	.	.	.	0.09310	N	0.999995	B;B	0.24317	0.101;0.038	B;B	0.29077	0.098;0.05	T	0.58370	-0.7648	9	0.54805	T	0.06	-7.8273	15.1489	0.72681	0.0:0.0:0.0:1.0	.	290;290	Q7Z442-3;Q7Z442	.;PK1L2_HUMAN	S	290	ENSP00000337397:T290S	ENSP00000337397:T290S	T	-	1	0	PKD1L2	79798634	0.155000	0.22806	0.171000	0.22900	0.621000	0.37620	1.643000	0.37217	1.984000	0.57885	0.460000	0.39030	ACA	.		0.468	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	51824795	51824795	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:51824795T>A	ENST00000371117.3	-	36	6056	c.5781A>T	c.(5779-5781)agA>agT	p.R1927S	PKHD1_ENST00000340994.4_Missense_Mutation_p.R1927S	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1927					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TCCTGGACCATCTCCGGCAGA	0.517											OREG0017492	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R1927S		.											.	PKHD1	603	0			c.A5781T						.						115.0	104.0	108.0					6																	51824795		2203	4300	6503	SO:0001583	missense	5314	exon36			GGACCATCTCCGG	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.5781A>T	6.37:g.51824795T>A	ENSP00000360158:p.Arg1927Ser	60.0	0.0	980	122.0	13.0	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	T	12.71	2.018562	0.35606	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.88896	-2.23;-2.44	5.54	-1.88	0.07713	.	0.169465	0.38663	N	0.001612	T	0.67961	0.2949	L	0.27053	0.805	0.27444	N	0.953639	P;D	0.53151	0.922;0.958	P;B	0.45610	0.487;0.386	T	0.69323	-0.5175	10	0.33940	T	0.23	.	7.4349	0.27150	0.0:0.4524:0.1792:0.3684	.	1927;1927	P08F94-2;P08F94	.;PKHD1_HUMAN	S	1927	ENSP00000360158:R1927S;ENSP00000341097:R1927S	ENSP00000341097:R1927S	R	-	3	2	PKHD1	51932754	0.004000	0.15560	0.992000	0.48379	0.959000	0.62525	-1.021000	0.03615	-0.351000	0.08249	0.533000	0.62120	AGA	.		0.517	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
PLA2G6	8398	ucsc.edu;bcgsc.ca	37	22	38508273	38508273	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr22:38508273C>T	ENST00000332509.3	-	17	2499	c.2316G>A	c.(2314-2316)gaG>gaA	p.E772E	BAIAP2L2_ENST00000332536.5_5'Flank|PLA2G6_ENST00000402064.1_Silent_p.E718E|PLA2G6_ENST00000335539.3_Silent_p.E718E|BAIAP2L2_ENST00000381669.3_5'Flank	NM_003560.2	NP_003551.2	O60733	PLPL9_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)	772					cardiolipin acyl-chain remodeling (GO:0035965)|cardiolipin biosynthetic process (GO:0032049)|cell death (GO:0008219)|chemotaxis (GO:0006935)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of exocytosis (GO:0045921)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of vasodilation (GO:0045909)|regulation of store-operated calcium channel activity (GO:1901339)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|urinary bladder smooth muscle contraction (GO:0014832)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipase A2 activity (GO:0004623)			breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				Quinacrine(DB01103)	TGTCACTGACCTCATCCAGCA	0.617																																					p.E772E		.											.	PLA2G6	91	0			c.G2316A						.						61.0	47.0	52.0					22																	38508273		2203	4298	6501	SO:0001819	synonymous_variant	8398	exon17			ACTGACCTCATCC	AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	3.1.1.4	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604				9417066, 16799181, 19029121	Standard	NM_001199562		Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.2316G>A	22.37:g.38508273C>T		28.0	0.0		25.0	4.0	NM_003560	A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	Silent	SNP	ENST00000332509.3	37	CCDS13967.1																																																																																			.		0.617	PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321860.1	NM_001004426	
PLCB1	23236	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	8626827	8626827	+	Splice_Site	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr20:8626827G>A	ENST00000338037.6	+	5	490	c.463G>A	c.(463-465)Gcc>Acc	p.A155T	PLCB1_ENST00000378641.3_Splice_Site_p.A155T|PLCB1_ENST00000378637.2_Splice_Site_p.A155T	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	155					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TCTGGAAAAAGCGTAAGTCAC	0.408																																					p.S155S		.											.	PLCB1	297	0			c.A463A						.						116.0	113.0	114.0					20																	8626827		2203	4300	6503	SO:0001630	splice_region_variant	23236	exon5			GAAAAAGCGTAAG	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.464+1G>A	20.37:g.8626827G>A		137.0	0.0		121.0	16.0	NM_015192	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Silent	SNP	ENST00000338037.6	37	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.929190	0.73327	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000404098;ENST00000441163;ENST00000535719	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	6.07	6.07	0.98685	.	0.044969	0.85682	D	0.000000	T	0.67401	0.2889	M	0.80746	2.51	0.80722	D	1	P;B;D;D	0.76494	0.632;0.19;0.986;0.999	B;B;P;D	0.81914	0.271;0.05;0.828;0.995	T	0.60372	-0.7276	10	0.22706	T	0.39	.	20.2389	0.98366	0.0:0.0:1.0:0.0	.	54;155;155;154	B4DRC6;Q9NQ66;Q9NQ66-2;B1AK73	.;PLCB1_HUMAN;.;.	T	155;155;155;154;75;75	ENSP00000367908:A155T;ENSP00000338185:A155T;ENSP00000367904:A155T;ENSP00000384001:A154T	ENSP00000338185:A155T	A	+	1	0	PLCB1	8574827	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.109000	0.89561	2.890000	0.99128	0.650000	0.86243	GCC	.		0.408	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		Missense_Mutation
PLD5	200150	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	242451667	242451667	+	Nonsense_Mutation	SNP	A	A	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:242451667A>T	ENST00000536534.2	-	3	733	c.492T>A	c.(490-492)tgT>tgA	p.C164*	PLD5_ENST00000442594.2_Nonsense_Mutation_p.C72*|PLD5_ENST00000427495.1_Nonsense_Mutation_p.C102*			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	164						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			AGCTTACCTGACATGCTGATG	0.423																																					p.C164X		.											.	PLD5	96	0			c.T492A						.						176.0	151.0	160.0					1																	242451667		2203	4300	6503	SO:0001587	stop_gained	200150	exon4			TACCTGACATGCT	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.492T>A	1.37:g.242451667A>T	ENSP00000440896:p.Cys164*	424.0	0.0		561.0	61.0	NM_152666	A1KXV0|B7Z324|Q494U9|Q8NB22	Nonsense_Mutation	SNP	ENST00000536534.2	37	CCDS1621.2	.	.	.	.	.	.	.	.	.	.	A	38	6.957052	0.97964	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534;ENST00000459864	.	.	.	4.33	3.17	0.36434	.	0.173929	0.52532	D	0.000062	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-18.0311	6.029	0.19669	0.8142:0.0:0.1858:0.0	.	.	.	.	X	102;72;164;102	.	ENSP00000401285:C102X	C	-	3	2	PLD5	240518290	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.486000	0.35530	1.733000	0.51620	0.482000	0.46254	TGT	.		0.423	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666	
PLXNA1	5361	ucsc.edu;bcgsc.ca	37	3	126737196	126737196	+	Silent	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:126737196G>T	ENST00000393409.2	+	19	3720	c.3720G>T	c.(3718-3720)ctG>ctT	p.L1240L	PLXNA1_ENST00000251772.4_Silent_p.L1217L	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1240					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CGGACAGCCTGCTGACGCTGC	0.632																																					p.L1240L		.											.	PLXNA1	93	0			c.G3720T						.						49.0	45.0	46.0					3																	126737196		2202	4300	6502	SO:0001819	synonymous_variant	5361	exon19			CAGCCTGCTGACG	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.3720G>T	3.37:g.126737196G>T		63.0	0.0		53.0	4.0	NM_032242		Silent	SNP	ENST00000393409.2	37	CCDS33847.2																																																																																			.		0.632	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
PPARGC1B	133522	ucsc.edu;bcgsc.ca	37	5	149200062	149200062	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:149200062G>A	ENST00000309241.5	+	2	177	c.145G>A	c.(145-147)Gcc>Acc	p.A49T	PPARGC1B_ENST00000360453.4_Missense_Mutation_p.A49T|PPARGC1B_ENST00000394320.3_Missense_Mutation_p.A49T|PPARGC1B_ENST00000403750.1_Missense_Mutation_p.A24T	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	49	Abolishes DNA transcriptional activity when missing.				actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CCAGCTGGATGCCAGCGACTT	0.582																																					p.A49T		.											.	PPARGC1B	186	0			c.G145A						.						104.0	102.0	102.0					5																	149200062		2203	4300	6503	SO:0001583	missense	133522	exon2			CTGGATGCCAGCG	AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.145G>A	5.37:g.149200062G>A	ENSP00000312649:p.Ala49Thr	27.0	0.0		25.0	4.0	NM_133263	A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	ENST00000309241.5	37	CCDS4298.1	.	.	.	.	.	.	.	.	.	.	g	13.87	2.365585	0.41902	.	.	ENSG00000155846	ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	T;T;T;T	0.10382	2.9;2.88;2.9;2.96	5.76	2.04	0.26737	.	0.257731	0.45606	N	0.000352	T	0.12603	0.0306	L	0.59436	1.845	0.26668	N	0.971784	B;B;B;B;B	0.21606	0.02;0.021;0.011;0.012;0.058	B;B;B;B;B	0.27076	0.028;0.028;0.019;0.007;0.076	T	0.15492	-1.0435	10	0.45353	T	0.12	-4.8805	10.4424	0.44472	0.3246:0.0:0.6754:0.0	.	28;28;49;49;49	Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3	.;.;.;PRGC2_HUMAN;.	T	49;49;49;24	ENSP00000353638:A49T;ENSP00000377855:A49T;ENSP00000312649:A49T;ENSP00000384403:A24T	ENSP00000312649:A49T	A	+	1	0	PPARGC1B	149180255	0.909000	0.30893	0.014000	0.15608	0.987000	0.75469	1.508000	0.35769	0.095000	0.17434	-0.141000	0.14075	GCC	.		0.582	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252334.1	NM_133263	
PPP1R13B	23368	ucsc.edu;bcgsc.ca	37	14	104204199	104204199	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr14:104204199T>C	ENST00000202556.9	-	15	3147		c.e15-2		PPP1R13B_ENST00000555391.1_Splice_Site|PPP1R13B_ENST00000423488.2_Intron	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B						intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				AGCGGCGTCCTGGAATAGAGC	0.577																																					.		.											.	PPP1R13B	227	0			c.2865-2A>G						.						29.0	31.0	31.0					14																	104204199		2111	4237	6348	SO:0001630	splice_region_variant	23368	exon16			GCGTCCTGGAATA	AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.2865-2A>G	14.37:g.104204199T>C		36.0	0.0		16.0	4.0	NM_015316	B2RMX5|O94870	Splice_Site	SNP	ENST00000202556.9	37	CCDS41997.1	.	.	.	.	.	.	.	.	.	.	t	15.57	2.873628	0.51695	.	.	ENSG00000088808	ENST00000202556	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1127	0.72372	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PPP1R13B	103273952	1.000000	0.71417	0.945000	0.38365	0.468000	0.32798	7.803000	0.85983	2.157000	0.67596	0.533000	0.62120	.	.		0.577	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414591.1	NM_015316	Intron
PPP3CA	5530	ucsc.edu;bcgsc.ca	37	4	102030193	102030193	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:102030193A>G	ENST00000394854.3	-	3	985	c.302T>C	c.(301-303)cTc>cCc	p.L101P	PPP3CA_ENST00000510292.1_5'UTR|PPP3CA_ENST00000507176.1_Missense_Mutation_p.L3P|PPP3CA_ENST00000523694.2_Missense_Mutation_p.L34P|PPP3CA_ENST00000394853.4_Missense_Mutation_p.L101P|PPP3CA_ENST00000512215.1_Intron|PPP3CA_ENST00000323055.6_Missense_Mutation_p.L101P	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	101	Catalytic.				calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		GACTTCAAAGAGCTTCATCAA	0.378																																					p.L101P		.											.	PPP3CA	227	0			c.T302C						.						79.0	75.0	76.0					4																	102030193		2203	4300	6503	SO:0001583	missense	5530	exon3			TCAAAGAGCTTCA		CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.302T>C	4.37:g.102030193A>G	ENSP00000378323:p.Leu101Pro	45.0	0.0		39.0	4.0	NM_000944	A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Missense_Mutation	SNP	ENST00000394854.3	37	CCDS34037.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.268494	0.80469	.	.	ENSG00000138814	ENST00000394854;ENST00000323055;ENST00000394853;ENST00000507176;ENST00000523694;ENST00000529324;ENST00000525819	T;T;T;T;T;T;T	0.10192	2.9;2.9;2.9;2.9;2.9;2.9;2.9	5.07	5.07	0.68467	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.64402	D	0.000001	T	0.52901	0.1763	H	0.99182	4.46	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.998;0.994;1.0;0.999	T	0.74813	-0.3537	10	0.87932	D	0	-13.6588	15.1623	0.72793	1.0:0.0:0.0:0.0	.	101;101;101;3;34	Q08209;A8W6Z7;Q08209-2;E7ETC2;A1A441	PP2BA_HUMAN;.;.;.;.	P	101;101;101;3;34;51;51	ENSP00000378323:L101P;ENSP00000320580:L101P;ENSP00000378322:L101P;ENSP00000422990:L3P;ENSP00000429350:L34P;ENSP00000431619:L51P;ENSP00000434599:L51P	ENSP00000320580:L101P	L	-	2	0	PPP3CA	102249216	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.999000	0.93557	2.032000	0.59987	0.528000	0.53228	CTC	.		0.378	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258379.2	NM_000944	
PRDM10	56980	ucsc.edu;bcgsc.ca	37	11	129793150	129793150	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:129793150T>C	ENST00000360871.3	-	13	2258	c.2027A>G	c.(2026-2028)cAa>cGa	p.Q676R	PRDM10_ENST00000528746.1_Missense_Mutation_p.Q650R|PRDM10_ENST00000358825.5_Missense_Mutation_p.Q680R|PRDM10_ENST00000304538.6_Missense_Mutation_p.Q590R|PRDM10_ENST00000423662.2_Missense_Mutation_p.Q594R|PRDM10_ENST00000526082.1_Missense_Mutation_p.Q594R	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	680					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		TACCTTAAATTGCTTCCCACA	0.507											OREG0021513	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q680R		.											.	PRDM10	91	0			c.A2039G						.						91.0	71.0	78.0					11																	129793150		2201	4297	6498	SO:0001583	missense	56980	exon14			TTAAATTGCTTCC	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.2027A>G	11.37:g.129793150T>C	ENSP00000354118:p.Gln676Arg	39.0	0.0	1575	35.0	4.0	NM_020228	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	ENST00000360871.3	37	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.560810	0.86335	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	T;T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81;0.81	6.16	6.16	0.99307	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.44850	0.1313	N	0.02973	-0.45	0.80722	D	1	D;D;D;D;P;D	0.64830	0.994;0.992;0.994;0.992;0.82;0.992	D;D;D;D;P;D	0.76575	0.988;0.979;0.988;0.979;0.666;0.979	T	0.54490	-0.8286	10	0.21014	T	0.42	-13.4947	16.8061	0.85666	0.0:0.0:0.0:1.0	.	590;676;680;594;590;594	B7ZL72;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;PRD10_HUMAN;.;.;.	R	680;590;676;594;650;594;393	ENSP00000351686:Q680R;ENSP00000302669:Q590R;ENSP00000354118:Q676R;ENSP00000398431:Q594R;ENSP00000431262:Q650R;ENSP00000432237:Q594R;ENSP00000435940:Q393R	ENSP00000302669:Q590R	Q	-	2	0	PRDM10	129298360	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.516000	0.81772	2.367000	0.80283	0.528000	0.53228	CAA	.		0.507	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437	
PRL	5617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	22294684	22294684	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:22294684A>T	ENST00000306482.1	-	2	676	c.158T>A	c.(157-159)cTg>cAg	p.L53Q	RP3-404K8.2_ENST00000561912.1_RNA	NM_000948.5|NM_001163558.2	NP_000939.1|NP_001157030.1	P01236	PRL_HUMAN	prolactin	53					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|circadian rhythm (GO:0007623)|female pregnancy (GO:0007565)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|multicellular organismal response to stress (GO:0033555)|ovulation cycle (GO:0042698)|parturition (GO:0007567)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of JAK-STAT cascade (GO:0046427)|regulation of multicellular organism growth (GO:0040014)|regulation of ossification (GO:0030278)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	prolactin receptor binding (GO:0005148)			NS(1)|endometrium(2)|large_intestine(6)|lung(6)|prostate(1)	16	Ovarian(93;0.163)					GTAGTGGGACAGGACGACGGC	0.587																																					p.L53Q		.											.	PRL	90	0			c.T158A						.						103.0	93.0	96.0					6																	22294684		2203	4300	6503	SO:0001583	missense	5617	exon2			TGGGACAGGACGA	D00411	CCDS4548.1	6p22.3	2013-09-16			ENSG00000172179	ENSG00000172179			9445	protein-coding gene	gene with protein product		176760					Standard	NM_000948		Approved		uc003ndq.3	P01236	OTTHUMG00000016111	ENST00000306482.1:c.158T>A	6.37:g.22294684A>T	ENSP00000302150:p.Leu53Gln	142.0	0.0		270.0	56.0	NM_000948	Q15199|Q92996	Missense_Mutation	SNP	ENST00000306482.1	37	CCDS4548.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.1|22.1	4.242959|4.242959	0.79912|0.79912	.|.	.|.	ENSG00000172179|ENSG00000172179	ENST00000438606|ENST00000306482	.|D	.|0.89939	.|-2.59	6.04|6.04	4.86|4.86	0.63082|0.63082	.|Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	.|0.256840	.|0.40222	.|N	.|0.001143	.|D	.|0.92652	.|0.7665	M|M	0.82323|0.82323	2.585|2.585	0.54753|0.54753	D|D	0.999985|0.999985	.|B;D	.|0.89917	.|0.222;1.0	.|P;D	.|0.81914	.|0.814;0.995	.|D	.|0.92698	.|0.6172	.|10	.|0.49607	.|T	.|0.09	.|-0.0438	12.5677|12.5677	0.56318|0.56318	0.8753:0.0:0.0:0.1247|0.8753:0.0:0.0:0.1247	.|.	.|53;54	.|P01236;Q5I0G2	.|PRL_HUMAN;.	.|Q	-1|53	.|ENSP00000302150:L53Q	.|ENSP00000302150:L53Q	.|L	-|-	.|2	.|0	PRL|PRL	22402663|22402663	0.999000|0.999000	0.42202|0.42202	0.943000|0.943000	0.38184|0.38184	0.954000|0.954000	0.61252|0.61252	4.588000|4.588000	0.60999|0.60999	1.068000|1.068000	0.40764|0.40764	0.460000|0.460000	0.39030|0.39030	.|CTG	.		0.587	PRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043327.1	NM_000948	
PROM1	8842	ucsc.edu;bcgsc.ca	37	4	16002203	16002203	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:16002203C>A	ENST00000510224.1	-	14	1742	c.1494G>T	c.(1492-1494)atG>atT	p.M498I	PROM1_ENST00000543373.1_Missense_Mutation_p.M489I|PROM1_ENST00000508167.1_Missense_Mutation_p.M489I|PROM1_ENST00000447510.2_Missense_Mutation_p.M498I|PROM1_ENST00000505450.1_Missense_Mutation_p.M489I|PROM1_ENST00000540805.1_Missense_Mutation_p.M498I|PROM1_ENST00000539194.1_Missense_Mutation_p.M498I			O43490	PROM1_HUMAN	prominin 1	498					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						CCACAATGATCATCAATATCC	0.333																																					p.M498I		.											.	PROM1	207	0			c.G1494T						.						76.0	68.0	71.0					4																	16002203		1840	4087	5927	SO:0001583	missense	8842	exon13			AATGATCATCAAT	AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.1494G>T	4.37:g.16002203C>A	ENSP00000426809:p.Met498Ile	55.0	0.0		44.0	4.0	NM_006017	Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Missense_Mutation	SNP	ENST00000510224.1	37	CCDS47029.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442481	0.83993	.	.	ENSG00000007062	ENST00000447510;ENST00000540805;ENST00000539194;ENST00000505450;ENST00000508167;ENST00000510224;ENST00000543373	T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.61324	0.2338	L	0.61036	1.89	0.58432	D	0.999996	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.996;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.986;0.998	T	0.55042	-0.8202	10	0.21540	T	0.41	-16.5201	17.7531	0.88440	0.0:1.0:0.0:0.0	.	489;498;489;498;489;498	O43490-5;O43490-6;O43490-4;O43490-7;O43490-2;O43490	.;.;.;.;.;PROM1_HUMAN	I	498;498;498;489;489;498;489	ENSP00000415481:M498I;ENSP00000438045:M498I;ENSP00000443620:M498I;ENSP00000426090:M489I;ENSP00000427346:M489I;ENSP00000426809:M498I;ENSP00000445526:M489I	ENSP00000415481:M498I	M	-	3	0	PROM1	15611301	1.000000	0.71417	0.982000	0.44146	0.950000	0.60333	7.245000	0.78237	2.464000	0.83262	0.650000	0.86243	ATG	.		0.333	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359595.2	NM_006017	
PRR16	51334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	120022233	120022233	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:120022233C>T	ENST00000407149.2	+	2	953	c.744C>T	c.(742-744)ggC>ggT	p.G248G	PRR16_ENST00000446965.1_Silent_p.G178G|PRR16_ENST00000505123.1_Silent_p.G178G|PRR16_ENST00000379551.2_Silent_p.G225G			Q569H4	LARGN_HUMAN	proline rich 16	248	Pro-rich.				positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)					endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		CTCACCAAGGCCCTCCCCTCC	0.522																																					p.G225G		.											.	PRR16	71	0			c.C675T						.						91.0	85.0	87.0					5																	120022233		2203	4300	6503	SO:0001819	synonymous_variant	51334	exon3			CCAAGGCCCTCCC	AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.744C>T	5.37:g.120022233C>T		100.0	0.0		118.0	28.0	NM_016644	D3DSZ0|Q8IXY1|Q9NYI5	Silent	SNP	ENST00000407149.2	37																																																																																				.		0.522	PRR16-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000371059.1	NM_016644	
PTPN14	5784	broad.mit.edu;bcgsc.ca	37	1	214531354	214531354	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:214531354G>T	ENST00000366956.5	-	19	3669	c.3475C>A	c.(3475-3477)Cag>Aag	p.Q1159K	RP11-176D17.3_ENST00000443622.1_RNA|PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	1159	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		AACATCCTCTGCTCCCTGAGG	0.488																																					p.Q1159K	Colon(92;557 1424 24372 34121 40073)	.											.	PTPN14	290	0			c.C3475A						.						168.0	152.0	157.0					1																	214531354		2203	4300	6503	SO:0001583	missense	5784	exon19			TCCTCTGCTCCCT	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.3475C>A	1.37:g.214531354G>T	ENSP00000355923:p.Gln1159Lys	103.0	0.0		144.0	7.0	NM_005401	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	37	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	G	34	5.344752	0.95807	.	.	ENSG00000152104	ENST00000366956	D	0.85773	-2.03	5.61	5.61	0.85477	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.94331	0.8178	M	0.91717	3.235	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.94837	0.8001	10	0.87932	D	0	.	19.9969	0.97387	0.0:0.0:1.0:0.0	.	1159	Q15678	PTN14_HUMAN	K	1159	ENSP00000355923:Q1159K	ENSP00000355923:Q1159K	Q	-	1	0	PTPN14	212597977	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	9.611000	0.98342	2.801000	0.96364	0.655000	0.94253	CAG	.		0.488	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
PTPN6	5777	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7064833	7064833	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:7064833A>G	ENST00000318974.9	+	7	1002	c.758A>G	c.(757-759)aAg>aGg	p.K253R	PTPN6_ENST00000456013.1_Missense_Mutation_p.K253R|PTPN6_ENST00000447931.2_Missense_Mutation_p.K214R|PTPN6_ENST00000399448.1_Missense_Mutation_p.K255R	NM_002831.5	NP_002822.2	P29350	PTN6_HUMAN	protein tyrosine phosphatase, non-receptor type 6	253	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				abortive mitotic cell cycle (GO:0033277)|apoptotic process (GO:0006915)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|G-protein coupled receptor signaling pathway (GO:0007186)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|natural killer cell mediated cytotoxicity (GO:0042267)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell proliferation (GO:0008285)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein dephosphorylation (GO:0006470)|regulation of B cell differentiation (GO:0045577)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|type I interferon signaling pathway (GO:0060337)	alpha-beta T cell receptor complex (GO:0042105)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|prostate(3)	18						AGTTTGCAGAAGCAGGAGGTG	0.592																																					p.K255R		.											.	PTPN6	703	0			c.A764G						.						78.0	91.0	87.0					12																	7064833		2086	4219	6305	SO:0001583	missense	5777	exon7			TGCAGAAGCAGGA		CCDS41744.1, CCDS44820.1, CCDS44821.1	12p13.31	2013-02-14			ENSG00000111679	ENSG00000111679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9658	protein-coding gene	gene with protein product		176883				1639416	Standard	NM_080548		Approved	HCP, HCPH, PTP-1C, SHP-1, SHP1	uc001qsa.1	P29350	OTTHUMG00000168518	ENST00000318974.9:c.758A>G	12.37:g.7064833A>G	ENSP00000326010:p.Lys253Arg	59.0	0.0		55.0	7.0	NM_080548	A8K306|G3V0F8|Q969V8|Q9UK67	Missense_Mutation	SNP	ENST00000318974.9	37	CCDS44820.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.962954	0.74016	.	.	ENSG00000111679	ENST00000399448;ENST00000447931;ENST00000318974;ENST00000456013	T;T;T;T	0.13420	2.65;2.61;2.6;2.59	5.4	5.4	0.78164	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.85682	D	0.000000	T	0.12347	0.0300	N	0.21194	0.64	0.80722	D	1	P;B;B;B;B	0.38110	0.618;0.101;0.051;0.015;0.013	B;B;B;B;B	0.39935	0.314;0.05;0.05;0.012;0.007	T	0.11867	-1.0570	10	0.36615	T	0.2	.	15.4304	0.75092	1.0:0.0:0.0:0.0	.	241;214;253;253;255	B4DPS0;P29350-2;G3V0F8;P29350;Q53XS4	.;.;.;PTN6_HUMAN;.	R	255;214;253;253	ENSP00000382376:K255R;ENSP00000415979:K214R;ENSP00000326010:K253R;ENSP00000391592:K253R	ENSP00000326010:K253R	K	+	2	0	PTPN6	6935094	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.809000	0.75211	2.052000	0.61016	0.459000	0.35465	AAG	.		0.592	PTPN6-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400023.1	NM_002831	
RAB31	11031	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	9859227	9859227	+	Missense_Mutation	SNP	C	C	A	rs147665641	byFrequency	TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:9859227C>A	ENST00000578921.1	+	7	734	c.493C>A	c.(493-495)Cgc>Agc	p.R165S	RAB31_ENST00000577284.1_3'UTR	NM_006868.3	NP_006859.2	Q13636	RAB31_HUMAN	RAB31, member RAS oncogene family	164					cellular response to insulin stimulus (GO:0032869)|Golgi to plasma membrane protein transport (GO:0043001)|GTP catabolic process (GO:0006184)|phagosome maturation (GO:0090382)|receptor internalization (GO:0031623)|regulated secretory pathway (GO:0045055)|small GTPase mediated signal transduction (GO:0007264)	early endosome (GO:0005769)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(2)|large_intestine(2)|lung(3)|skin(1)	10						TGTTGCAGGCCGCCAGATCCC	0.527																																					p.R165S		.											.	RAB31	205	0			c.C493A						.						43.0	48.0	46.0					18																	9859227		1948	4140	6088	SO:0001583	missense	11031	exon7			GCAGGCCGCCAGA	U59877	CCDS45826.1	18p11.22	2014-03-18			ENSG00000168461	ENSG00000168461		"""RAB, member RAS oncogene"""	9771	protein-coding gene	gene with protein product		605694				8863739	Standard	NM_006868		Approved	Rab22B	uc002kog.2	Q13636	OTTHUMG00000178513	ENST00000578921.1:c.493C>A	18.37:g.9859227C>A	ENSP00000461945:p.Arg165Ser	68.0	0.0		41.0	12.0	NM_006868	B2RBT7|Q15770|Q9HC00	Missense_Mutation	SNP	ENST00000578921.1	37	CCDS45826.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.308590	0.60305	.	.	ENSG00000168461	ENST00000306096;ENST00000435762	.	.	.	5.73	5.73	0.89815	.	0.302822	0.35525	N	0.003154	T	0.51601	0.1684	L	0.28400	0.85	0.54753	D	0.999986	B	0.13145	0.007	B	0.23419	0.046	T	0.40942	-0.9536	8	.	.	.	1.9938	15.769	0.78149	0.0:1.0:0.0:0.0	.	164	Q13636	RAB31_HUMAN	S	165;156	.	.	R	+	1	0	RAB31	9849227	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	4.220000	0.58567	2.868000	0.98415	0.557000	0.71058	CGC	C|0.999;T|0.001		0.527	RAB31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442280.3		
RADIL	55698	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	4874647	4874647	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:4874647G>A	ENST00000399583.3	-	4	1194	c.1007C>T	c.(1006-1008)aCc>aTc	p.T336I	RADIL_ENST00000538469.1_Missense_Mutation_p.T96I|RADIL_ENST00000536091.1_Missense_Mutation_p.T336I	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	336	FHA.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CAGCACCACGGTCCTGTGCCC	0.716																																					p.T336I		.											.	RADIL	994	0			c.C1007T						.						13.0	17.0	16.0					7																	4874647		1949	4134	6083	SO:0001583	missense	55698	exon4			ACCACGGTCCTGT	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.1007C>T	7.37:g.4874647G>A	ENSP00000382492:p.Thr336Ile	41.0	0.0		35.0	20.0	NM_018059	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Missense_Mutation	SNP	ENST00000399583.3	37	CCDS43544.1	.	.	.	.	.	.	.	.	.	.	-	12.21	1.870496	0.33069	.	.	ENSG00000157927	ENST00000399583;ENST00000316919;ENST00000544486;ENST00000536091;ENST00000538469	T;T;T	0.06371	3.31;3.31;3.31	4.45	4.45	0.53987	Forkhead-associated (FHA) domain (1);SMAD/FHA domain (1);	0.452476	0.23889	N	0.043575	T	0.08358	0.0208	L	0.47716	1.5	0.09310	N	1	B	0.16396	0.017	B	0.15870	0.014	T	0.15321	-1.0441	10	0.66056	D	0.02	-2.6864	14.2662	0.66121	0.0:0.0:1.0:0.0	.	336	Q96JH8	RADIL_HUMAN	I	336;307;70;336;96	ENSP00000382492:T336I;ENSP00000442533:T336I;ENSP00000442966:T96I	ENSP00000320946:T307I	T	-	2	0	RADIL	4841173	0.988000	0.35896	0.003000	0.11579	0.811000	0.45836	5.874000	0.69652	2.046000	0.60703	0.651000	0.88453	ACC	.		0.716	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059	
RBM47	54502	ucsc.edu;bcgsc.ca	37	4	40440519	40440519	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:40440519A>G	ENST00000381793.2	-	3	788	c.392T>C	c.(391-393)cTc>cCc	p.L131P	RBM47_ENST00000319592.4_Missense_Mutation_p.L131P|RBM47_ENST00000514014.1_Missense_Mutation_p.L93P|RBM47_ENST00000381795.6_Missense_Mutation_p.L131P|RBM47_ENST00000515809.1_Intron|RBM47_ENST00000295971.7_Missense_Mutation_p.L131P			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	131	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GTAGTTGTTGAGCTCACGCAC	0.627																																					p.L131P		.											.	RBM47	25	0			c.T392C						.						57.0	48.0	51.0					4																	40440519		2203	4300	6503	SO:0001583	missense	54502	exon4			TTGTTGAGCTCAC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.392T>C	4.37:g.40440519A>G	ENSP00000371212:p.Leu131Pro	59.0	0.0		44.0	5.0	NM_001098634	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Missense_Mutation	SNP	ENST00000381793.2	37	CCDS43223.1	.	.	.	.	.	.	.	.	.	.	A	19.02	3.746254	0.69418	.	.	ENSG00000163694	ENST00000319592;ENST00000381793;ENST00000381795;ENST00000295971;ENST00000514014;ENST00000515053;ENST00000513473;ENST00000505414;ENST00000514782	T;T;T;T;T;T;T;T;T	0.58358	1.71;0.34;1.71;0.34;0.34;1.71;0.34;0.34;0.34	5.44	5.44	0.79542	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.79667	0.4485	M	0.94021	3.485	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.996;0.997	D	0.85486	0.1182	10	0.87932	D	0	-25.2838	15.4872	0.75575	1.0:0.0:0.0:0.0	.	131;131	A0AV96-2;A0AV96	.;RBM47_HUMAN	P	131;131;131;131;93;131;131;131;131	ENSP00000320108:L131P;ENSP00000371212:L131P;ENSP00000371214:L131P;ENSP00000295971:L131P;ENSP00000423243:L93P;ENSP00000422564:L131P;ENSP00000421589:L131P;ENSP00000423527:L131P;ENSP00000426542:L131P	ENSP00000295971:L131P	L	-	2	0	RBM47	40135276	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	9.333000	0.96459	2.065000	0.61736	0.260000	0.18958	CTC	.		0.627	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
RCBTB2	1102	ucsc.edu;bcgsc.ca	37	13	49073784	49073784	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr13:49073784T>C	ENST00000344532.3	-	13	1780	c.1357A>G	c.(1357-1359)Atc>Gtc	p.I453V	RCBTB2_ENST00000430805.2_Missense_Mutation_p.I458V|RCBTB2_ENST00000544492.1_Missense_Mutation_p.I179V	NM_001268.2	NP_001259.1	O95199	RCBT2_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2	453	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				positive regulation of Ran GTPase activity (GO:0032853)	acrosomal vesicle (GO:0001669)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)			breast(5)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(3)	31		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		GAAAGGCTGATGCTGTCTGTG	0.413																																					p.I453V		.											.	RCBTB2	418	0			c.A1357G						.						127.0	125.0	126.0					13																	49073784		2203	4300	6503	SO:0001583	missense	1102	exon13			GGCTGATGCTGTC	AF060219	CCDS9411.1, CCDS73570.1, CCDS73571.1, CCDS73572.1	13q14.3	2013-01-08	2005-05-09	2005-05-09	ENSG00000136161	ENSG00000136161		"""BTB/POZ domain containing"""	1914	protein-coding gene	gene with protein product		603524	"""chromosome condensation 1-like"""	CHC1L		9806834	Standard	XM_005266242		Approved		uc001vch.3	O95199	OTTHUMG00000016902	ENST00000344532.3:c.1357A>G	13.37:g.49073784T>C	ENSP00000345144:p.Ile453Val	82.0	0.0		38.0	4.0	NM_001268	B2RDW8	Missense_Mutation	SNP	ENST00000344532.3	37	CCDS9411.1	.	.	.	.	.	.	.	.	.	.	T	8.277	0.814603	0.16607	.	.	ENSG00000136161	ENST00000344532;ENST00000450343;ENST00000452987;ENST00000430805;ENST00000544492	T;T;T	0.65916	-0.18;-0.18;-0.18	5.09	5.09	0.68999	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.097389	0.64402	D	0.000001	T	0.39091	0.1065	N	0.04245	-0.25	0.80722	D	1	B;B;B;B	0.25272	0.003;0.001;0.122;0.001	B;B;B;B	0.27380	0.015;0.015;0.079;0.006	T	0.33343	-0.9872	10	0.09843	T	0.71	.	15.1976	0.73104	0.0:0.0:0.0:1.0	.	179;458;405;453	B4E372;B4DWG0;B3KVB1;O95199	.;.;.;RCBT2_HUMAN	V	453;405;458;458;179	ENSP00000345144:I453V;ENSP00000389910:I458V;ENSP00000443862:I179V	ENSP00000345144:I453V	I	-	1	0	RCBTB2	47971785	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.882000	0.56160	2.050000	0.60909	0.392000	0.25879	ATC	.		0.413	RCBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044888.2	NM_001268	
REG1B	5968	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	79314699	79314699	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:79314699G>T	ENST00000305089.3	-	2	120	c.40C>A	c.(40-42)Ctg>Atg	p.L14M		NM_006507.3	NP_006498.1	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta	14					cell proliferation (GO:0008283)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(40)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	51						AGGAACATCAGGGAGGAGATC	0.483																																					p.L14M		.											.	REG1B	91	0			c.C40A						.						143.0	118.0	126.0					2																	79314699		2203	4300	6503	SO:0001583	missense	5968	exon2			ACATCAGGGAGGA		CCDS1963.1	2p12	2008-06-04	2008-06-04		ENSG00000172023	ENSG00000172023			9952	protein-coding gene	gene with protein product	"""lithostathine 1 beta"", ""secretory pancreatic stone protein 2"""	167771	"""regenerating islet-derived 1 beta (pancreatic stone protein, pancreatic thread protein)"""			8110835	Standard	NM_006507		Approved	REGL, PSPS2, REGH, REGI-BETA	uc002sny.2	P48304	OTTHUMG00000130019	ENST00000305089.3:c.40C>A	2.37:g.79314699G>T	ENSP00000303206:p.Leu14Met	148.0	0.0		106.0	30.0	NM_006507		Missense_Mutation	SNP	ENST00000305089.3	37	CCDS1963.1	.	.	.	.	.	.	.	.	.	.	g	15.90	2.969208	0.53614	.	.	ENSG00000172023	ENST00000305089	T	0.05382	3.45	2.71	1.8	0.24995	.	0.000000	0.29126	N	0.013075	T	0.22859	0.0552	M	0.86740	2.835	0.21627	N	0.999616	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.02307	-1.1179	10	0.72032	D	0.01	.	5.8691	0.18793	0.1547:0.0:0.8453:0.0	.	14;14	Q6ICS1;P48304	.;REG1B_HUMAN	M	14	ENSP00000303206:L14M	ENSP00000303206:L14M	L	-	1	2	REG1B	79168207	0.990000	0.36364	0.646000	0.29493	0.459000	0.32528	0.857000	0.27831	0.678000	0.31325	0.555000	0.69702	CTG	.		0.483	REG1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252292.2	NM_006507	
RELT	84957	ucsc.edu;bcgsc.ca	37	11	73103403	73103403	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:73103403T>C	ENST00000064780.2	+	6	776	c.515T>C	c.(514-516)tTc>tCc	p.F172S	RELT_ENST00000393580.2_Missense_Mutation_p.F172S	NM_152222.1	NP_689408.1	Q969Z4	TR19L_HUMAN	RELT tumor necrosis factor receptor	172						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	12						GTCCCTGTCTTCTGCCTCATG	0.677																																					p.F172S		.											.	RELT	228	0			c.T515C						.						62.0	64.0	63.0					11																	73103403		2200	4293	6493	SO:0001583	missense	84957	exon6			CTGTCTTCTGCCT	AF319553	CCDS8222.1	11q13.2	2013-05-22	2007-06-14	2007-06-14		ENSG00000054967		"""Tumor necrosis factor receptor superfamily"""	13764	protein-coding gene	gene with protein product		611211	"""tumor necrosis factor receptor superfamily, member 19-like"""	TNFRSF19L		11313261, 16547002, 16950202, 16389068	Standard	NM_032871		Approved	FLJ14993	uc001otv.3	Q969Z4		ENST00000064780.2:c.515T>C	11.37:g.73103403T>C	ENSP00000064780:p.Phe172Ser	66.0	0.0		45.0	4.0	NM_152222	Q86V34|Q96JU1|Q9BUX7	Missense_Mutation	SNP	ENST00000064780.2	37	CCDS8222.1	.	.	.	.	.	.	.	.	.	.	T	32	5.139184	0.94560	.	.	ENSG00000054967	ENST00000064780;ENST00000393580	D;D	0.88431	-2.38;-2.38	5.42	5.42	0.78866	.	0.121505	0.56097	D	0.000026	D	0.92492	0.7616	L	0.55213	1.73	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	D	0.93102	0.6509	10	0.87932	D	0	-23.0081	12.8501	0.57852	0.0:0.0:0.0:1.0	.	172	Q969Z4	TR19L_HUMAN	S	172	ENSP00000064780:F172S;ENSP00000377207:F172S	ENSP00000064780:F172S	F	+	2	0	RELT	72781051	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.259000	0.78381	2.054000	0.61138	0.459000	0.35465	TTC	.		0.677	RELT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397380.2	NM_032871	
REPS2	9185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	17095520	17095520	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chrX:17095520C>T	ENST00000357277.3	+	13	1677	c.1506C>T	c.(1504-1506)ccC>ccT	p.P502P	REPS2_ENST00000303843.7_Silent_p.P501P|REPS2_ENST00000469714.1_Intron|REPS2_ENST00000380064.4_Intron	NM_001080975.1|NM_004726.2	NP_001074444.1|NP_004717.2	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	502	Pro-rich.				epidermal growth factor receptor signaling pathway (GO:0007173)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(3)|urinary_tract(1)	17	Hepatocellular(33;0.183)					TCTTCCAGCCCAGTGTGCCAG	0.602																																					p.P502P		.											.	REPS2	131	0			c.C1506T						.						61.0	55.0	57.0					X																	17095520		2203	4300	6503	SO:0001819	synonymous_variant	9185	exon13			CCAGCCCAGTGTG	AF010233	CCDS14180.2, CCDS43919.1	Xp22.2	2013-01-10			ENSG00000169891	ENSG00000169891		"""EF-hand domain containing"""	9963	protein-coding gene	gene with protein product		300317				9422736, 9928989	Standard	NM_001080975		Approved	POB1	uc004cxv.1	Q8NFH8	OTTHUMG00000021199	ENST00000357277.3:c.1506C>T	X.37:g.17095520C>T		26.0	0.0		33.0	15.0	NM_004726	A6PWZ6|O43428|Q5JNZ8|Q8NFI5	Silent	SNP	ENST00000357277.3	37	CCDS14180.2																																																																																			.		0.602	REPS2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316778.1	NM_004726	
RFX3	5991	broad.mit.edu;ucsc.edu;mdanderson.org	37	9	3346710	3346710	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:3346710G>A	ENST00000382004.3	-	4	483	c.172C>T	c.(172-174)Cag>Tag	p.Q58*	RFX3_ENST00000302303.1_Nonsense_Mutation_p.Q58*|RFX3_ENST00000381984.2_Nonsense_Mutation_p.Q58*|RFX3_ENST00000358730.2_Nonsense_Mutation_p.Q58*	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	58					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		TCCACATACTGCACCTGAGCG	0.418																																					p.Q58X		.											.	RFX3	93	0			c.C172T						.						150.0	127.0	135.0					9																	3346710		2203	4300	6503	SO:0001587	stop_gained	5991	exon4			CATACTGCACCTG	AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.172C>T	9.37:g.3346710G>A	ENSP00000371434:p.Gln58*	70.0	0.0		44.0	10.0	NM_134428	A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Nonsense_Mutation	SNP	ENST00000382004.3	37	CCDS6449.1	.	.	.	.	.	.	.	.	.	.	G	37	5.987667	0.97179	.	.	ENSG00000080298	ENST00000382004;ENST00000381992;ENST00000358730;ENST00000302303;ENST00000457373;ENST00000451859;ENST00000442560;ENST00000420720;ENST00000381985;ENST00000449190;ENST00000381984	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-8.7085	18.3614	0.90375	0.0:0.0:1.0:0.0	.	.	.	.	X	58;58;58;58;58;58;19;19;58;58;58	.	ENSP00000303847:Q58X	Q	-	1	0	RFX3	3336710	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.257000	0.89851	2.612000	0.88384	0.655000	0.94253	CAG	.		0.418	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051545.1	NM_002919	
RHCG	51458	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	15	90023512	90023512	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr15:90023512G>T	ENST00000268122.4	-	4	718	c.650C>A	c.(649-651)tCg>tAg	p.S217*	RHCG_ENST00000544600.1_Nonsense_Mutation_p.S217*	NM_016321.1	NP_057405.1	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	217					amine transport (GO:0015837)|ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|cellular ion homeostasis (GO:0006873)|epithelial cell differentiation (GO:0030855)|homeostatic process (GO:0042592)|regulation of pH (GO:0006885)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(78;0.0237)|all_lung(78;0.0478)					AAAGAGGTCCGACTGGTACAC	0.547																																					p.S217X		.											.	RHCG	226	0			c.C650A						.						205.0	179.0	188.0					15																	90023512		2200	4299	6499	SO:0001587	stop_gained	51458	exon4			AGGTCCGACTGGT	AF081497	CCDS10351.1	15q25	2013-05-22	2006-02-23		ENSG00000140519	ENSG00000140519		"""Solute carriers"""	18140	protein-coding gene	gene with protein product		605381	"""chromosome 15 open reading frame 6"", ""Rhesus blood group, C glycoprotein"""	C15orf6		10852913	Standard	NM_016321		Approved	RHGK, PDRC2, SLC42A3	uc002bnz.2	Q9UBD6	OTTHUMG00000149647	ENST00000268122.4:c.650C>A	15.37:g.90023512G>T	ENSP00000268122:p.Ser217*	44.0	0.0		44.0	19.0	NM_016321	A8K4D4|Q6X3Y4	Nonsense_Mutation	SNP	ENST00000268122.4	37	CCDS10351.1	.	.	.	.	.	.	.	.	.	.	G	38	6.998013	0.97990	.	.	ENSG00000140519	ENST00000544600;ENST00000268122;ENST00000536247	.	.	.	5.59	5.59	0.84812	.	0.107977	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.7037	19.6374	0.95740	0.0:0.0:1.0:0.0	.	.	.	.	X	217;217;208	.	.	S	-	2	0	RHCG	87824516	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	9.830000	0.99415	2.647000	0.89833	0.558000	0.71614	TCG	.		0.547	RHCG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000312855.2	NM_016321	
RHCG	51458	ucsc.edu;bcgsc.ca	37	15	90039658	90039658	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr15:90039658A>G	ENST00000268122.4	-	1	186	c.118T>C	c.(118-120)Tgg>Cgg	p.W40R	RHCG_ENST00000544600.1_Missense_Mutation_p.W40R	NM_016321.1	NP_057405.1	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	40					amine transport (GO:0015837)|ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|cellular ion homeostasis (GO:0006873)|epithelial cell differentiation (GO:0030855)|homeostatic process (GO:0042592)|regulation of pH (GO:0006885)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(78;0.0237)|all_lung(78;0.0478)					TCTGACCACCAGTGGGCGTCG	0.607																																					p.W40R		.											.	RHCG	226	0			c.T118C						.						141.0	127.0	132.0					15																	90039658		2200	4299	6499	SO:0001583	missense	51458	exon1			ACCACCAGTGGGC	AF081497	CCDS10351.1	15q25	2013-05-22	2006-02-23		ENSG00000140519	ENSG00000140519		"""Solute carriers"""	18140	protein-coding gene	gene with protein product		605381	"""chromosome 15 open reading frame 6"", ""Rhesus blood group, C glycoprotein"""	C15orf6		10852913	Standard	NM_016321		Approved	RHGK, PDRC2, SLC42A3	uc002bnz.2	Q9UBD6	OTTHUMG00000149647	ENST00000268122.4:c.118T>C	15.37:g.90039658A>G	ENSP00000268122:p.Trp40Arg	32.0	0.0		31.0	4.0	NM_016321	A8K4D4|Q6X3Y4	Missense_Mutation	SNP	ENST00000268122.4	37	CCDS10351.1	.	.	.	.	.	.	.	.	.	.	A	11.97	1.798832	0.31777	.	.	ENSG00000140519	ENST00000544600;ENST00000268122;ENST00000536247	T;T	0.20069	2.11;2.1	5.14	5.14	0.70334	.	1.678880	0.02823	N	0.125735	T	0.41811	0.1175	M	0.88241	2.94	0.80722	D	1	B	0.21753	0.06	B	0.25405	0.06	T	0.47497	-0.9113	9	.	.	.	-9.6481	14.9548	0.71104	1.0:0.0:0.0:0.0	.	40	Q9UBD6	RHCG_HUMAN	R	40;40;31	ENSP00000438123:W40R;ENSP00000268122:W40R	.	W	-	1	0	RHCG	87840662	1.000000	0.71417	0.805000	0.32314	0.074000	0.17049	8.644000	0.91044	1.949000	0.56562	0.402000	0.26972	TGG	.		0.607	RHCG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000312855.2	NM_016321	
RHOBTB2	23221	ucsc.edu;bcgsc.ca	37	8	22874843	22874843	+	Missense_Mutation	SNP	G	G	A	rs143264894		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr8:22874843G>A	ENST00000251822.6	+	10	2582	c.2045G>A	c.(2044-2046)cGg>cAg	p.R682Q	RHOBTB2_ENST00000519685.1_Missense_Mutation_p.R704Q|RP11-875O11.1_ENST00000502083.2_RNA|RHOBTB2_ENST00000522948.1_Missense_Mutation_p.R689Q	NM_015178.2	NP_055993.2	Q9BYZ6	RHBT2_HUMAN	Rho-related BTB domain containing 2	682					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	31		Prostate(55;0.0513)|Breast(100;0.214)		Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)		CAGCGGGCACGGAAGGAGCGT	0.587																																					p.R704Q		.											.	RHOBTB2	416	0			c.G2111A						.	G	GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	153.0	119.0	131.0		2111,2066,2045	4.8	1.0	8	dbSNP_134	131	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	RHOBTB2	NM_001160036.1,NM_001160037.1,NM_015178.2	43,43,43	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign,benign,benign	704/750,689/735,682/728	22874843	2,13004	2203	4300	6503	SO:0001583	missense	23221	exon12			GGGCACGGAAGGA	AF315385	CCDS6034.1, CCDS55210.1, CCDS55211.1	8p21.2	2013-01-08			ENSG00000008853	ENSG00000008853		"""BTB/POZ domain containing"""	18756	protein-coding gene	gene with protein product		607352				11222756	Standard	NM_001160036		Approved	KIAA0717, DBC2	uc011kzp.1	Q9BYZ6	OTTHUMG00000097827	ENST00000251822.6:c.2045G>A	8.37:g.22874843G>A	ENSP00000251822:p.Arg682Gln	66.0	0.0		33.0	4.0	NM_001160036	A8K9Z8|D3DSR8|E9PBU2|E9PEI7|O94825|Q8N4A8|Q9BZK6	Missense_Mutation	SNP	ENST00000251822.6	37	CCDS6034.1	.	.	.	.	.	.	.	.	.	.	g	13.35	2.210829	0.39102	0.0	2.33E-4	ENSG00000008853	ENST00000519685;ENST00000522948;ENST00000251822	T;T;T	0.08546	3.08;3.08;3.08	5.66	4.78	0.61160	.	0.267213	0.38959	N	0.001508	T	0.04092	0.0114	N	0.11106	0.095	0.38938	D	0.958095	B;B;B	0.13145	0.007;0.007;0.007	B;B;B	0.10450	0.002;0.001;0.005	T	0.43130	-0.9410	10	0.23891	T	0.37	.	5.6585	0.17656	0.1484:0.0:0.6832:0.1684	.	689;682;704	E9PEI7;Q9BYZ6;E9PBU2	.;RHBT2_HUMAN;.	Q	704;689;682	ENSP00000427926:R704Q;ENSP00000429141:R689Q;ENSP00000251822:R682Q	ENSP00000251822:R682Q	R	+	2	0	RHOBTB2	22930788	1.000000	0.71417	0.993000	0.49108	0.971000	0.66376	2.912000	0.48782	1.378000	0.46305	0.655000	0.94253	CGG	G|1.000;A|0.000		0.587	RHOBTB2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215101.2		
RIMS2	9699	ucsc.edu;bcgsc.ca	37	8	105001616	105001616	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr8:105001616T>C	ENST00000436393.2	+	15	2586	c.2345T>C	c.(2344-2346)gTc>gCc	p.V782A	RIMS2_ENST00000406091.3_Missense_Mutation_p.V1004A|RIMS2_ENST00000262231.10_Missense_Mutation_p.V843A|RIMS2_ENST00000507740.1_Missense_Mutation_p.V796A			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1066					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AGACATCGTGTCATGGATGAC	0.398										HNSCC(12;0.0054)																											p.V1004A		.											.	RIMS2	279	0			c.T3011C						.						114.0	111.0	112.0					8																	105001616		1859	4090	5949	SO:0001583	missense	9699	exon17			ATCGTGTCATGGA	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2345T>C	8.37:g.105001616T>C	ENSP00000390665:p.Val782Ala	29.0	0.0		34.0	4.0	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37		.	.	.	.	.	.	.	.	.	.	T	9.441	1.088104	0.20390	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T	0.16196	2.36;2.88;2.52;2.52;2.45;2.88	5.54	5.54	0.83059	.	.	.	.	.	T	0.10852	0.0265	N	0.16478	0.41	0.80722	D	1	B;B;B;B;B	0.11235	0.0;0.004;0.0;0.0;0.0	B;B;B;B;B	0.09377	0.001;0.004;0.004;0.001;0.0	T	0.11792	-1.0573	9	0.08837	T	0.75	.	15.3304	0.74203	0.0:0.0:0.0:1.0	.	1066;782;843;796;1004	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	A	1004;1019;1004;1066;843;796;796;782	ENSP00000427018:V1004A;ENSP00000384892:V1004A;ENSP00000262231:V843A;ENSP00000423559:V796A;ENSP00000386228:V796A;ENSP00000390665:V782A	ENSP00000262231:V843A	V	+	2	0	RIMS2	105070792	0.622000	0.27085	1.000000	0.80357	0.983000	0.72400	0.726000	0.25984	2.115000	0.64714	0.397000	0.26171	GTC	.		0.398	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
RNF123	63891	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49753579	49753579	+	Silent	SNP	G	G	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:49753579G>C	ENST00000327697.6	+	34	3528	c.3384G>C	c.(3382-3384)ctG>ctC	p.L1128L	RNF123_ENST00000433785.1_Silent_p.L240L	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	1128					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		AGAGGAACCTGTTTGATCGTG	0.592																																					p.L1128L		.											.	RNF123	584	0			c.G3384C						.						92.0	79.0	84.0					3																	49753579		2203	4300	6503	SO:0001819	synonymous_variant	63891	exon34			GAACCTGTTTGAT	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.3384G>C	3.37:g.49753579G>C		28.0	0.0		47.0	8.0	NM_022064	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Silent	SNP	ENST00000327697.6	37	CCDS33758.1																																																																																			.		0.592	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
RNF168	165918	ucsc.edu;bcgsc.ca	37	3	196229935	196229935	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:196229935T>C	ENST00000318037.3	-	1	704	c.110A>G	c.(109-111)aAa>aGa	p.K37R		NM_152617.3	NP_689830.2	Q8IYW5	RN168_HUMAN	ring finger protein 168, E3 ubiquitin protein ligase	37					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K13 ubiquitination (GO:0036351)|histone H2A-K15 ubiquitination (GO:0036352)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)	20	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		GAAGCACGGTTTACACAGCGT	0.587																																					p.K37R		.											.	RNF168	90	0			c.A110G						.						135.0	111.0	119.0					3																	196229935		2203	4300	6503	SO:0001583	missense	165918	exon1			CACGGTTTACACA	AK054732	CCDS3317.1	3q29	2014-09-17	2012-02-23		ENSG00000163961	ENSG00000163961		"""RING-type (C3HC4) zinc fingers"""	26661	protein-coding gene	gene with protein product		612688	"""ring finger protein 168"""			12477932	Standard	NM_152617		Approved	FLJ35794	uc003fwq.3	Q8IYW5	OTTHUMG00000155582	ENST00000318037.3:c.110A>G	3.37:g.196229935T>C	ENSP00000320898:p.Lys37Arg	78.0	0.0		43.0	5.0	NM_152617	Q8NA67|Q96NS4	Missense_Mutation	SNP	ENST00000318037.3	37	CCDS3317.1	.	.	.	.	.	.	.	.	.	.	T	7.811	0.715788	0.15306	.	.	ENSG00000163961	ENST00000318037	D	0.85258	-1.96	6.0	2.4	0.29515	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.357941	0.27004	N	0.021417	T	0.66167	0.2762	N	0.04245	-0.25	0.18873	N	0.999981	B	0.18013	0.025	B	0.26416	0.069	T	0.51317	-0.8721	10	0.11182	T	0.66	-6.8124	10.0685	0.42319	0.0:0.1915:0.0:0.8085	.	37	Q8IYW5	RN168_HUMAN	R	37	ENSP00000320898:K37R	ENSP00000320898:K37R	K	-	2	0	RNF168	197714332	0.738000	0.28186	0.049000	0.19019	0.017000	0.09413	1.266000	0.33039	0.479000	0.27511	-0.709000	0.03644	AAA	.		0.587	RNF168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340778.1	NM_152617	
RWDD1	51389	ucsc.edu;bcgsc.ca	37	6	116901493	116901493	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:116901493G>A	ENST00000466444.2	+	2	325	c.109G>A	c.(109-111)Gtg>Atg	p.V37M	RWDD1_ENST00000517800.1_3'UTR|RWDD1_ENST00000487832.2_5'UTR|RWDD1_ENST00000392526.1_5'UTR	NM_015952.2	NP_057036.2	Q9H446	RWDD1_HUMAN	RWD domain containing 1	37	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.									NS(1)|breast(2)|central_nervous_system(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)	12		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.0312)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)|Epithelial(106;0.161)		CACCATTACTGTGACGTCTGA	0.348																																					p.V37M		.											.	RWDD1	92	0			c.G109A						.						56.0	53.0	54.0					6																	116901493		2203	4300	6503	SO:0001583	missense	51389	exon2			ATTACTGTGACGT	AF092134	CCDS34520.1, CCDS43496.1	6q13-q22.33	2012-12-07			ENSG00000111832	ENSG00000111832			20993	protein-coding gene	gene with protein product						10810093	Standard	NM_016104		Approved	PTD013	uc003pxd.3	Q9H446	OTTHUMG00000015441	ENST00000466444.2:c.109G>A	6.37:g.116901493G>A	ENSP00000420357:p.Val37Met	65.0	0.0		31.0	4.0	NM_015952	A8K3W2|A8MT24|Q9Y313|Q9Y6B3	Missense_Mutation	SNP	ENST00000466444.2	37	CCDS34520.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.306634	0.81247	.	.	ENSG00000111832	ENST00000466444	T	0.24151	1.87	5.95	5.09	0.68999	Ubiquitin-conjugating enzyme/RWD-like (2);RWD domain (3);	0.000000	0.85682	D	0.000000	T	0.38506	0.1043	M	0.86343	2.81	0.80722	D	1	P	0.40066	0.701	P	0.50109	0.631	T	0.45716	-0.9242	10	0.87932	D	0	-4.7397	15.1184	0.72423	0.0676:0.0:0.9324:0.0	.	37	Q9H446	RWDD1_HUMAN	M	37	ENSP00000420357:V37M	ENSP00000420357:V37M	V	+	1	0	RWDD1	117008186	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.143000	0.94623	1.531000	0.49152	0.650000	0.86243	GTG	.		0.348	RWDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041952.2	NM_015952	
RXFP1	59350	ucsc.edu;bcgsc.ca	37	4	159572966	159572966	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:159572966C>A	ENST00000307765.5	+	18	2284	c.2033C>A	c.(2032-2034)cCa>cAa	p.P678Q	RXFP1_ENST00000343542.5_Missense_Mutation_p.P630Q|RXFP1_ENST00000448688.2_Missense_Mutation_p.P573Q|RXFP1_ENST00000470033.1_Missense_Mutation_p.P645Q|RXFP1_ENST00000460056.2_Missense_Mutation_p.P597Q	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	678					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		GCTTTGAACCCAATTCTCTAT	0.328																																					p.P705Q		.											.	RXFP1	91	0			c.C2114A						.						87.0	81.0	82.0					4																	159572966		1838	4086	5924	SO:0001583	missense	59350	exon18			TGAACCCAATTCT	AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.2033C>A	4.37:g.159572966C>A	ENSP00000303248:p.Pro678Gln	71.0	0.0		30.0	4.0	NM_001253727	B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Missense_Mutation	SNP	ENST00000307765.5	37	CCDS43276.1	.	.	.	.	.	.	.	.	.	.	C	30	5.052646	0.93793	.	.	ENSG00000171509	ENST00000460056;ENST00000307765;ENST00000448688;ENST00000343542;ENST00000470033;ENST00000440678	D;D;D;D;D	0.98807	-5.15;-5.15;-5.15;-5.15;-5.15	5.75	5.75	0.90469	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99417	0.9794	M	0.93638	3.44	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.98727	1.0711	10	0.87932	D	0	.	19.9449	0.97179	0.0:1.0:0.0:0.0	.	689;705;573;630;645;597;548;678	B3KV27;B4DGP2;B4DHD1;Q9HBX9-4;Q9HBX9-2;E9PCA3;Q59H16;Q9HBX9	.;.;.;.;.;.;.;RXFP1_HUMAN	Q	597;678;573;630;645;548	ENSP00000423306:P597Q;ENSP00000303248:P678Q;ENSP00000414885:P573Q;ENSP00000345889:P630Q;ENSP00000420712:P645Q	ENSP00000303248:P678Q	P	+	2	0	RXFP1	159792416	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.601000	0.82783	2.696000	0.92011	0.655000	0.94253	CCA	.		0.328	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314865.1	NM_021634	
RXRG	6258	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	165376062	165376062	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:165376062C>T	ENST00000359842.5	-	9	1533	c.1231G>A	c.(1231-1233)Gaa>Aaa	p.E411K		NM_001256570.1|NM_006917.4	NP_001243499.1|NP_008848.1	P48443	RXRG_HUMAN	retinoid X receptor, gamma	411	Ligand-binding. {ECO:0000250}.				gene expression (GO:0010467)|heart development (GO:0007507)|neuron differentiation (GO:0030182)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|skeletal muscle tissue development (GO:0007519)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	9-cis retinoic acid receptor activity (GO:0004886)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(6)|lung(22)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	38	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tretinoin(DB00755)	CCTGGCTGTTCCGGATACTTC	0.537																																					p.E411K		.											.	RXRG	186	0			c.G1231A						.						197.0	152.0	167.0					1																	165376062		2203	4300	6503	SO:0001583	missense	6258	exon9			GCTGTTCCGGATA	U38480	CCDS1248.1, CCDS72970.1	1q22-q23	2013-01-16			ENSG00000143171	ENSG00000143171		"""Nuclear hormone receptors"""	10479	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 3"""	180247				8034312	Standard	NR_033824		Approved	NR2B3	uc001gda.3	P48443	OTTHUMG00000034626	ENST00000359842.5:c.1231G>A	1.37:g.165376062C>T	ENSP00000352900:p.Glu411Lys	34.0	0.0		74.0	7.0	NM_006917	A6NIP1|Q6IBU7	Missense_Mutation	SNP	ENST00000359842.5	37	CCDS1248.1	.	.	.	.	.	.	.	.	.	.	C	18.46	3.629340	0.67015	.	.	ENSG00000143171	ENST00000359842	T	0.70749	-0.51	4.24	4.24	0.50183	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.231791	0.43260	D	0.000585	T	0.54191	0.1843	L	0.53617	1.68	0.36415	D	0.863941	B	0.31503	0.326	B	0.26969	0.075	T	0.66775	-0.5838	9	0.87932	D	0	.	15.7167	0.77672	0.0:1.0:0.0:0.0	.	411	P48443	RXRG_HUMAN	K	411	ENSP00000352900:E411K	ENSP00000352900:E411K	E	-	1	0	RXRG	163642686	1.000000	0.71417	0.810000	0.32431	0.813000	0.45954	7.403000	0.79983	2.332000	0.79248	0.563000	0.77884	GAA	.		0.537	RXRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083794.2	NM_006917	
S1PR5	53637	ucsc.edu;bcgsc.ca	37	19	10625491	10625491	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:10625491C>A	ENST00000439028.3	-	2	322	c.197G>T	c.(196-198)cGc>cTc	p.R66L	S1PR5_ENST00000333430.4_Missense_Mutation_p.R66L	NM_001166215.1	NP_001159687.1	Q9H228	S1PR5_HUMAN	sphingosine-1-phosphate receptor 5	66					regulation of neuron differentiation (GO:0045664)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	12					Fingolimod(DB08868)	AGCGTGGAAGCGCGGGTGGCG	0.682																																					p.R66L		.											.	S1PR5	523	0			c.G197T						.						38.0	31.0	34.0					19																	10625491		2194	4296	6490	SO:0001583	missense	53637	exon2			TGGAAGCGCGGGT	AK074661	CCDS12240.1	19p13.2	2012-08-08	2008-04-30	2008-04-30		ENSG00000180739		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	14299	protein-coding gene	gene with protein product		605146	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 8"""	EDG8		10799507	Standard	NM_030760		Approved	Edg-8	uc002mou.2	Q9H228		ENST00000439028.3:c.197G>T	19.37:g.10625491C>A	ENSP00000416915:p.Arg66Leu	27.0	0.0		24.0	4.0	NM_030760	Q6NW11	Missense_Mutation	SNP	ENST00000439028.3	37	CCDS12240.1	.	.	.	.	.	.	.	.	.	.	c	14.00	2.405636	0.42715	.	.	ENSG00000180739	ENST00000439028;ENST00000333430;ENST00000359134	T;T	0.73363	-0.74;-0.74	4.27	2.02	0.26589	GPCR, rhodopsin-like superfamily (1);	0.078178	0.47093	U	0.000250	T	0.77343	0.4116	M	0.86097	2.795	0.31738	N	0.636168	P	0.43169	0.8	P	0.48304	0.573	T	0.78828	-0.2050	10	0.87932	D	0	.	4.4832	0.11776	0.0:0.5563:0.0:0.4437	.	66	Q9H228	S1PR5_HUMAN	L	66	ENSP00000416915:R66L;ENSP00000328472:R66L	ENSP00000328472:R66L	R	-	2	0	S1PR5	10486491	0.747000	0.28283	0.979000	0.43373	0.010000	0.07245	1.196000	0.32198	1.003000	0.39130	0.461000	0.40582	CGC	.		0.682	S1PR5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452015.1	NM_030760	
SDCCAG3	10807	ucsc.edu;bcgsc.ca	37	9	139298615	139298615	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:139298615T>C	ENST00000357365.3	-	9	1229	c.1100A>G	c.(1099-1101)gAa>gGa	p.E367G	SDCCAG3_ENST00000371725.3_Missense_Mutation_p.E294G|SDCCAG3_ENST00000298537.7_Missense_Mutation_p.E344G|SDCCAG3_ENST00000461693.1_5'UTR	NM_001039707.1	NP_001034796.1	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3	367						cytoplasm (GO:0005737)				NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)	16		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		CCGCAGGGCTTCATTCTCTCG	0.647																																					p.E367G		.											.	SDCCAG3	90	0			c.A1100G						.						87.0	97.0	94.0					9																	139298615		1992	4156	6148	SO:0001583	missense	10807	exon9			AGGGCTTCATTCT	AF039688	CCDS6999.2, CCDS43903.1, CCDS43904.1	9q34.3	2010-10-27			ENSG00000165689	ENSG00000165689			10667	protein-coding gene	gene with protein product						9610721	Standard	XM_005266050		Approved	NY-CO-3	uc004chi.3	Q96C92	OTTHUMG00000020928	ENST00000357365.3:c.1100A>G	9.37:g.139298615T>C	ENSP00000349929:p.Glu367Gly	66.0	0.0		44.0	4.0	NM_001039707	A6NCP1|O60525|Q5SXN1|Q5SXN2|Q5SXN3|Q5SXN4|Q5SXN8|Q6V704|Q9NVY5	Missense_Mutation	SNP	ENST00000357365.3	37	CCDS43904.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.02|17.02	3.281446|3.281446	0.59758|0.59758	.|.	.|.	ENSG00000165689|ENSG00000165689	ENST00000357365;ENST00000298537;ENST00000371725|ENST00000417512	T;T;T|.	0.79247|.	1.6;-1.25;1.6|.	4.66|4.66	4.66|4.66	0.58398|0.58398	.|.	0.144445|.	0.52532|.	D|.	0.000071|.	T|T	0.70780|0.70780	0.3263|0.3263	M|M	0.66939|0.66939	2.045|2.045	0.48901|0.48901	D|D	0.999728|0.999728	D;D;D|.	0.65815|.	0.975;0.995;0.995|.	P;P;D|.	0.64687|.	0.789;0.897;0.928|.	T|T	0.71069|0.71069	-0.4699|-0.4699	10|5	0.72032|.	D|.	0.01|.	-22.7759|-22.7759	13.5876|13.5876	0.61940|0.61940	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	294;344;367|.	Q96C92-4;Q96C92-2;Q96C92|.	.;.;SDCG3_HUMAN|.	G|E	367;344;294|99	ENSP00000349929:E367G;ENSP00000298537:E344G;ENSP00000360790:E294G|.	ENSP00000298537:E344G|.	E|K	-|-	2|1	0|0	SDCCAG3|SDCCAG3	138418436|138418436	0.987000|0.987000	0.35691|0.35691	0.842000|0.842000	0.33263|0.33263	0.062000|0.062000	0.15995|0.15995	4.992000|4.992000	0.63889|0.63889	1.850000|1.850000	0.53721|0.53721	0.533000|0.533000	0.62120|0.62120	GAA|AAG	.		0.647	SDCCAG3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055060.2	NM_006643	
SEMA3A	10371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	83590805	83590805	+	Missense_Mutation	SNP	C	C	A	rs318240753		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:83590805C>A	ENST00000265362.4	-	17	2512	c.2198G>T	c.(2197-2199)cGt>cTt	p.R733L	SEMA3A_ENST00000436949.1_Missense_Mutation_p.R733L	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	733	Arg/Lys-rich (basic).		R -> H (in HH16; phenotype consistent with Kallmann syndrome; dbSNP:rs318240753). {ECO:0000269|PubMed:22927827}.		apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						CCTTTGCCGACGTTGTTTTCG	0.458																																					p.R733L		.											.	SEMA3A	156	0			c.G2198T						.						222.0	197.0	206.0					7																	83590805		2203	4300	6503	SO:0001583	missense	10371	exon17			TGCCGACGTTGTT	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.2198G>T	7.37:g.83590805C>A	ENSP00000265362:p.Arg733Leu	234.0	0.0		182.0	76.0	NM_006080		Missense_Mutation	SNP	ENST00000265362.4	37	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.537539	0.45176	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.28255	1.62;1.62	6.08	6.08	0.98989	.	0.048367	0.85682	D	0.000000	T	0.23649	0.0572	N	0.13235	0.315	0.58432	D	0.999996	B	0.30563	0.285	B	0.28385	0.089	T	0.03739	-1.1008	10	0.44086	T	0.13	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	733	Q14563	SEM3A_HUMAN	L	733	ENSP00000265362:R733L;ENSP00000415260:R733L	ENSP00000265362:R733L	R	-	2	0	SEMA3A	83428741	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	4.589000	0.61006	2.894000	0.99253	0.655000	0.94253	CGT	.		0.458	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
SEMA4F	10505	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	74901762	74901762	+	Silent	SNP	G	G	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:74901762G>C	ENST00000357877.2	+	8	1109	c.960G>C	c.(958-960)ggG>ggC	p.G320G	SEMA4F_ENST00000339773.5_Silent_p.G165G	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	320	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)			biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						CTGAGCTTGGGGCAGGGACTC	0.567																																					p.G320G		.											.	SEMA4F	93	0			c.G960C						.						162.0	156.0	158.0					2																	74901762		2203	4300	6503	SO:0001819	synonymous_variant	10505	exon8			GCTTGGGGCAGGG	AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.960G>C	2.37:g.74901762G>C		140.0	0.0		93.0	27.0	NM_004263	Q542Y7|Q9NS35	Silent	SNP	ENST00000357877.2	37	CCDS1955.1																																																																																			.		0.567	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252214.2	NM_004263	
SERPINC1	462	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	173878764	173878764	+	Missense_Mutation	SNP	C	C	T	rs199469509		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:173878764C>T	ENST00000367698.3	-	5	1197	c.1079G>A	c.(1078-1080)gGc>gAc	p.G360D	SERPINC1_ENST00000494024.1_5'Flank	NM_000488.3	NP_000479.1	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C (antithrombin), member 1	360					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of inflammatory response (GO:0050728)|regulation of blood coagulation, intrinsic pathway (GO:2000266)|regulation of proteolysis (GO:0030162)|response to nutrient (GO:0007584)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(15)|ovary(1)	25					Ardeparin(DB00407)|Dalteparin(DB06779)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Nadroparin(DB08813)|Sulodexide(DB06271)|Tinzaparin(DB06822)	CAAACTGAAGCCGTCCTCAAT	0.542																																					p.G360D		.											.	SERPINC1	227	0			c.G1079A						.						116.0	116.0	116.0					1																	173878764		2203	4300	6503	SO:0001583	missense	462	exon5			CTGAAGCCGTCCT	X68793	CCDS1313.1	1q25.1	2014-02-18	2005-08-18		ENSG00000117601	ENSG00000117601		"""Serine (or cysteine) peptidase inhibitors"""	775	protein-coding gene	gene with protein product	"""antithrombin III"", ""signal peptide antithrombin part 1"", ""coding sequence signal peptide antithrombin part 1"", ""antithrombin (aa 375-432)"""	107300	"""serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1"""	AT3		3979120, 24172014	Standard	NM_000488		Approved	ATIII, MGC22579	uc001gjt.3	P01008	OTTHUMG00000037276	ENST00000367698.3:c.1079G>A	1.37:g.173878764C>T	ENSP00000356671:p.Gly360Asp	34.0	0.0		40.0	7.0	NM_000488	B2R6P0|P78439|P78447|Q13815|Q5TC78|Q7KZ43|Q7KZ97|Q9UC78	Missense_Mutation	SNP	ENST00000367698.3	37	CCDS1313.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.638244	0.47153	.	.	ENSG00000117601	ENST00000367698	D	0.83755	-1.76	5.64	3.55	0.40652	Serpin domain (3);	0.616386	0.19807	N	0.105640	T	0.52386	0.1731	N	0.12853	0.265	0.24628	N	0.993637	B	0.30605	0.287	B	0.35607	0.206	T	0.45934	-0.9227	10	0.46703	T	0.11	.	6.8314	0.23913	0.0:0.6521:0.1486:0.1993	.	360	P01008	ANT3_HUMAN	D	360	ENSP00000356671:G360D	ENSP00000356671:G360D	G	-	2	0	SERPINC1	172145387	1.000000	0.71417	0.994000	0.49952	0.967000	0.64934	1.138000	0.31491	1.392000	0.46585	0.655000	0.94253	GGC	.		0.542	SERPINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090734.1	NM_000488	
SETX	23064	ucsc.edu;bcgsc.ca	37	9	135210076	135210076	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:135210076T>A	ENST00000224140.5	-	7	939	c.757A>T	c.(757-759)Atg>Ttg	p.M253L	SETX_ENST00000372169.2_Missense_Mutation_p.M253L|SETX_ENST00000393220.1_Missense_Mutation_p.M253L	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	253					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		AGGGAATCCATGGCTTGTTCC	0.363																																					p.M253L		.											.	SETX	93	0			c.A757T						.						163.0	136.0	145.0					9																	135210076		2203	4300	6503	SO:0001583	missense	23064	exon7			AATCCATGGCTTG	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.757A>T	9.37:g.135210076T>A	ENSP00000224140:p.Met253Leu	72.0	0.0		39.0	4.0	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.511312	0.85389	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	T;T;T	0.63255	-0.03;-0.03;-0.03	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.70395	0.3219	L	0.32530	0.975	0.35069	D	0.76227	D	0.64830	0.994	D	0.70716	0.97	T	0.78713	-0.2097	10	0.62326	D	0.03	.	15.5243	0.75890	0.0:0.0:0.0:1.0	.	253	Q7Z333	SETX_HUMAN	L	253	ENSP00000224140:M253L;ENSP00000361242:M253L;ENSP00000376913:M253L	ENSP00000224140:M253L	M	-	1	0	SETX	134199897	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	4.236000	0.58675	2.263000	0.75096	0.377000	0.23210	ATG	.		0.363	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
SIN3B	23309	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	16989085	16989085	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:16989085delG	ENST00000248054.5	+	18	3067	c.3046delG	c.(3046-3048)gtgfs	p.V1016fs	SIN3B_ENST00000379803.1_Frame_Shift_Del_p.V1048fs|SIN3B_ENST00000595541.1_Frame_Shift_Del_p.V606fs|SIN3B_ENST00000594235.1_3'UTR					SIN3 transcription regulator family member B											endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						GCTGGTGGGCGTGGAGAGCGC	0.667																																					p.V1048fs		.											.	SIN3B	228	0			c.3142delG						.						20.0	16.0	17.0					19																	16989085		2192	4289	6481	SO:0001589	frameshift_variant	23309	exon19			GTGGGCGTGGAGA	AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.3046delG	19.37:g.16989085delG	ENSP00000248054:p.Val1016fs	20.0	0.0		16.0	16.0	NM_015260		Frame_Shift_Del	DEL	ENST00000248054.5	37																																																																																				.		0.667	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000462846.1	NM_015260	
SLC22A6	9356	ucsc.edu;bcgsc.ca	37	11	62751010	62751010	+	Splice_Site	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:62751010C>A	ENST00000377871.3	-	3	893	c.627G>T	c.(625-627)ctG>ctT	p.L209L	SLC22A6_ENST00000360421.4_Splice_Site_p.L209L|SLC22A6_ENST00000421062.2_Splice_Site_p.L209L|SLC22A6_ENST00000458333.2_Splice_Site_p.L209L|SLC22A6_ENST00000537349.1_5'UTR	NM_004790.4|NM_153278.2	NP_004781.2|NP_695010.1	Q4U2R8	S22A6_HUMAN	solute carrier family 22 (organic anion transporter), member 6	209					alpha-ketoglutarate transport (GO:0015742)|organic anion transport (GO:0015711)|protein homooligomerization (GO:0051260)|renal tubular secretion (GO:0097254)|response to methotrexate (GO:0031427)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride ion binding (GO:0031404)|inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(18)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36					Acetaminophen(DB00316)|Acetazolamide(DB00819)|Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Aminohippurate(DB00345)|Aminophenazone(DB01424)|Amoxicillin(DB01060)|Antipyrine(DB01435)|Aspartame(DB00168)|Benzylpenicillin(DB01053)|Bromodiphenhydramine(DB01237)|Bumetanide(DB00887)|Captopril(DB01197)|Carbenicillin(DB00578)|Carprofen(DB00821)|Caspofungin(DB00520)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cefotiam(DB00229)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Chloramphenicol(DB00446)|Chlorothiazide(DB00880)|Chlorpropamide(DB00672)|Cidofovir(DB00369)|Cilastatin(DB01597)|Cimetidine(DB00501)|Cinoxacin(DB00827)|Cloxacillin(DB01147)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Cyclothiazide(DB00606)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Didanosine(DB00900)|Diflunisal(DB00861)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Fluorescein(DB00693)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Foscarnet(DB00529)|Furosemide(DB00695)|Ganciclovir(DB01004)|Gentamicin(DB00798)|Glyburide(DB01016)|Hydrochlorothiazide(DB00999)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Levofloxacin(DB01137)|Losartan(DB00678)|Meclofenamic acid(DB00939)|Methazolamide(DB00703)|Methotrexate(DB00563)|Minocycline(DB01017)|Nafcillin(DB00607)|Nalidixic Acid(DB00779)|Naproxen(DB00788)|Nateglinide(DB00731)|Norfloxacin(DB01059)|Novobiocin(DB01051)|Ofloxacin(DB01165)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piperacillin(DB00319)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Riboflavin(DB00140)|Salicylic acid(DB00936)|Stavudine(DB00649)|Streptomycin(DB01082)|Sulindac(DB00605)|Tenofovir(DB00300)|Tetracycline(DB00759)|Tolbutamide(DB01124)|Tolmetin(DB00500)|Trifluridine(DB00432)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Vancomycin(DB00512)|Zalcitabine(DB00943)|Zidovudine(DB00495)	ATCTCTCACTCAGTGTCATGC	0.657																																					p.L209L		.											.	SLC22A6	90	0			c.G627T						.						44.0	37.0	39.0					11																	62751010		2181	4271	6452	SO:0001630	splice_region_variant	9356	exon3			CTCACTCAGTGTC	AF057039	CCDS8041.1, CCDS31591.1, CCDS44631.1, CCDS44632.1	11q12.3	2013-07-15			ENSG00000197901	ENSG00000197901		"""Solute carriers"""	10970	protein-coding gene	gene with protein product		607582				9762842, 9950961	Standard	NM_004790		Approved	ROAT1, PAHT, OAT1	uc001nwk.3	Q4U2R8	OTTHUMG00000167767	ENST00000377871.3:c.628+1G>T	11.37:g.62751010C>A		40.0	0.0		30.0	4.0	NM_153276	A8MY93|B2D0R6|O95187|O95742|Q7LDA0|Q8N192|Q9NQA6|Q9NQC2|Q9UBG6|Q9UEQ8	Silent	SNP	ENST00000377871.3	37	CCDS31591.1																																																																																			.		0.657	SLC22A6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396186.1	NM_004790	Silent
SLC7A5	8140	ucsc.edu;bcgsc.ca	37	16	87868106	87868106	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:87868106C>A	ENST00000261622.4	-	9	1447	c.1382G>T	c.(1381-1383)gGc>gTc	p.G461V	SLC7A5_ENST00000565644.1_Missense_Mutation_p.G195V|RP4-536B24.2_ENST00000563687.1_RNA	NM_003486.5	NP_003477.4	Q01650	LAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 5	461					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(80;0.049)	Dextrothyroxine(DB00509)|L-DOPA(DB01235)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Melphalan(DB01042)	GATGGTGAAGCCGATGCCACA	0.597																																					p.G461V		.											.	SLC7A5	90	0			c.G1382T						.						53.0	45.0	48.0					16																	87868106		2191	4292	6483	SO:0001583	missense	8140	exon9			GTGAAGCCGATGC	AF077866	CCDS10964.1	16q24.3	2013-05-22	2011-07-12		ENSG00000103257	ENSG00000103257		"""CD molecules"", ""Solute carriers"""	11063	protein-coding gene	gene with protein product		600182				9751058, 7829099	Standard	XM_006721286		Approved	LAT1, E16, D16S469E, MPE16, CD98	uc002fkm.3	Q01650	OTTHUMG00000137658	ENST00000261622.4:c.1382G>T	16.37:g.87868106C>A	ENSP00000261622:p.Gly461Val	80.0	0.0		45.0	4.0	NM_003486	Q8IV97|Q9UBN8|Q9UP15|Q9UQC0	Missense_Mutation	SNP	ENST00000261622.4	37	CCDS10964.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.011795	0.93346	.	.	ENSG00000103257	ENST00000261622	D	0.90324	-2.65	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.94660	0.8278	M	0.62209	1.925	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94969	0.8115	10	0.87932	D	0	.	18.3254	0.90252	0.0:1.0:0.0:0.0	.	461	Q01650	LAT1_HUMAN	V	461	ENSP00000261622:G461V	ENSP00000261622:G461V	G	-	2	0	SLC7A5	86425607	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.588000	0.82629	2.578000	0.87016	0.456000	0.33151	GGC	.		0.597	SLC7A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269110.2	NM_003486	
SMYD1	150572	ucsc.edu;bcgsc.ca	37	2	88410004	88410004	+	Silent	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:88410004C>T	ENST00000419482.2	+	10	1531	c.1446C>T	c.(1444-1446)tcC>tcT	p.S482S	SMYD1_ENST00000444564.2_Silent_p.S469S|SMYD1_ENST00000438570.1_Intron	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	482					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						ATGAGCCATCCCCAGCTCTGT	0.597																																					p.S482S		.											.	SMYD1	229	0			c.C1446T						.						54.0	45.0	48.0					2																	88410004		2203	4300	6503	SO:0001819	synonymous_variant	150572	exon10			GCCATCCCCAGCT	AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.1446C>T	2.37:g.88410004C>T		47.0	0.0		45.0	4.0	NM_198274	A0AV30|A6NE13	Silent	SNP	ENST00000419482.2	37	CCDS33240.1																																																																																			.		0.597	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338229.2	XM_097915	
SND1	27044	ucsc.edu;bcgsc.ca	37	7	127344990	127344990	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:127344990C>A	ENST00000354725.3	+	8	1132	c.938C>A	c.(937-939)gCg>gAg	p.A313E		NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	313	TNase-like 2. {ECO:0000255|PROSITE- ProRule:PRU00272}.				gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)			central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						AAGCTGAGGGCGGCAGAGAGG	0.527																																					p.A313E		.											.	SND1	92	0			c.C938A						.						78.0	69.0	72.0					7																	127344990		2203	4300	6503	SO:0001583	missense	27044	exon8			TGAGGGCGGCAGA		CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.938C>A	7.37:g.127344990C>A	ENSP00000346762:p.Ala313Glu	68.0	0.0		43.0	4.0	NM_014390	Q13122|Q96AG0	Missense_Mutation	SNP	ENST00000354725.3	37	CCDS34747.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546255	0.86022	.	.	ENSG00000197157	ENST00000354725;ENST00000438400	T	0.30182	1.54	5.92	5.04	0.67666	Staphylococcal nuclease (SNase-like) (4);Staphylococcal nuclease (SNase-like), OB-fold (1);	0.000000	0.85682	D	0.000000	T	0.49287	0.1548	M	0.62723	1.935	0.80722	D	1	P	0.50156	0.932	P	0.62740	0.906	T	0.39440	-0.9614	10	0.25106	T	0.35	-8.8744	14.8905	0.70606	0.0:0.8558:0.1442:0.0	.	313	Q7KZF4	SND1_HUMAN	E	313;303	ENSP00000346762:A313E	ENSP00000346762:A313E	A	+	2	0	SND1	127132226	1.000000	0.71417	0.992000	0.48379	0.971000	0.66376	7.575000	0.82447	1.507000	0.48752	-0.181000	0.13052	GCG	.		0.527	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349148.1	NM_014390	
SPEF2	79925	broad.mit.edu;ucsc.edu;mdanderson.org	37	5	35618118	35618118	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:35618118C>T	ENST00000356031.3	+	1	173	c.19C>T	c.(19-21)Cag>Tag	p.Q7*	SPEF2_ENST00000440995.2_Nonsense_Mutation_p.Q7*|SPEF2_ENST00000282469.6_Nonsense_Mutation_p.Q7*|SPEF2_ENST00000509059.1_Nonsense_Mutation_p.Q7*	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	7	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GATCCTGTGCCAGTGGCTCAA	0.662											OREG0016560	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q7X		.											.	SPEF2	26	0			c.C19T						.						53.0	43.0	46.0					5																	35618118		2202	4299	6501	SO:0001587	stop_gained	79925	exon1			CTGTGCCAGTGGC	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.19C>T	5.37:g.35618118C>T	ENSP00000348314:p.Gln7*	99.0	0.0	856	118.0	15.0	NM_024867	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Nonsense_Mutation	SNP	ENST00000356031.3	37	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	C	38	6.904356	0.97924	.	.	ENSG00000152582	ENST00000282469;ENST00000356031;ENST00000509059;ENST00000510777;ENST00000440995	.	.	.	6.01	4.15	0.48705	.	0.311043	0.30959	N	0.008532	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	9.9092	0.41394	0.156:0.6939:0.1502:0.0	.	.	.	.	X	7	.	ENSP00000282469:Q7X	Q	+	1	0	SPEF2	35653875	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	0.599000	0.24089	1.521000	0.48983	0.643000	0.83706	CAG	.		0.662	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
SPINK9	643394	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	147718126	147718126	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:147718126G>T	ENST00000377906.1	+	3	228	c.173G>T	c.(172-174)gGc>gTc	p.G58V	RP11-373N22.3_ENST00000501695.3_RNA|SPINK9_ENST00000511717.2_Missense_Mutation_p.G79V	NM_001040433.1	NP_001035523.1	Q5DT21	ISK9_HUMAN	serine peptidase inhibitor, Kazal type 9	58	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(1)|urinary_tract(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGATCTGATGGCAAAACTTAT	0.274																																					p.G58V		.											.	SPINK9	22	0			c.G173T						.						78.0	81.0	80.0					5																	147718126		2202	4300	6502	SO:0001583	missense	643394	exon3			CTGATGGCAAAAC	AY396740	CCDS34269.1	5q33.1	2011-08-31				ENSG00000204909		"""Serine peptidase inhibitors, Kazal type"""	32951	protein-coding gene	gene with protein product		613511					Standard	NM_001040433		Approved		uc003lpe.1	Q5DT21		ENST00000377906.1:c.173G>T	5.37:g.147718126G>T	ENSP00000367139:p.Gly58Val	370.0	2.0		469.0	131.0	NM_001040433	B2RPN9	Missense_Mutation	SNP	ENST00000377906.1	37	CCDS34269.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468154	0.43839	.	.	ENSG00000204909	ENST00000511717;ENST00000377906	D;D	0.81996	-1.56;-1.56	4.1	4.1	0.47936	Proteinase inhibitor I1, Kazal (3);	0.309970	0.24742	N	0.035965	D	0.89966	0.6868	.	.	.	0.58432	D	0.999995	D	0.89917	1.0	D	0.85130	0.997	D	0.90693	0.4614	9	0.72032	D	0.01	-13.8967	12.0308	0.53396	0.0:0.0:1.0:0.0	.	58	Q5DT21	ISK9_HUMAN	V	79;58	ENSP00000427240:G79V;ENSP00000367139:G58V	ENSP00000367139:G58V	G	+	2	0	SPINK9	147698319	0.975000	0.34042	0.996000	0.52242	0.421000	0.31385	2.034000	0.41145	2.275000	0.75901	0.650000	0.86243	GGC	.		0.274	SPINK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373382.1	NM_001040433	
SPTBN4	57731	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	41009905	41009905	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:41009905G>C	ENST00000352632.3	+	12	1617	c.1531G>C	c.(1531-1533)Gac>Cac	p.D511H	SPTBN4_ENST00000595535.1_Missense_Mutation_p.D511H|SPTBN4_ENST00000598249.1_Missense_Mutation_p.D511H|SPTBN4_ENST00000344104.3_Missense_Mutation_p.D511H|SPTBN4_ENST00000338932.3_Missense_Mutation_p.D511H			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	511					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGCCCAGCGTGACAGCGTCCT	0.657																																					p.D511H		.											.	SPTBN4	94	0			c.G1531C						.						43.0	46.0	45.0					19																	41009905		2203	4300	6503	SO:0001583	missense	57731	exon12			CAGCGTGACAGCG	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.1531G>C	19.37:g.41009905G>C	ENSP00000263373:p.Asp511His	65.0	1.0		63.0	40.0	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	g	16.90	3.251342	0.59212	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.52526	0.66;0.66;0.66	4.2	4.2	0.49525	.	0.081866	0.48286	U	0.000188	T	0.64136	0.2571	M	0.62723	1.935	0.80722	D	1	D;B	0.65815	0.995;0.357	D;B	0.68353	0.957;0.162	T	0.65796	-0.6081	10	0.46703	T	0.11	.	15.4391	0.75168	0.0:0.0:1.0:0.0	.	511;511	Q9H254;Q71S06	SPTN4_HUMAN;.	H	511	ENSP00000263373:D511H;ENSP00000340345:D511H;ENSP00000340741:D511H	ENSP00000340345:D511H	D	+	1	0	SPTBN4	45701745	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.691000	0.84191	2.180000	0.69256	0.486000	0.48141	GAC	.		0.657	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
SRBD1	55133	ucsc.edu;bcgsc.ca	37	2	45832562	45832562	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:45832562T>C	ENST00000263736.4	-	2	81	c.19A>G	c.(19-21)Aga>Gga	p.R7G		NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	7					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			ACTTTCGCTCTTCTTGGCAAT	0.358																																					p.R7G		.											.	SRBD1	90	0			c.A19G						.						165.0	163.0	163.0					2																	45832562		2203	4300	6503	SO:0001583	missense	55133	exon2			TCGCTCTTCTTGG	AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.19A>G	2.37:g.45832562T>C	ENSP00000263736:p.Arg7Gly	47.0	0.0		44.0	4.0	NM_018079	Q53T56|Q96TA4|Q9NW11	Missense_Mutation	SNP	ENST00000263736.4	37	CCDS1823.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.013870	0.75161	.	.	ENSG00000068784	ENST00000263736	T	0.28666	1.6	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000004	T	0.22437	0.0541	L	0.32530	0.975	0.80722	D	1	P	0.36282	0.546	B	0.29353	0.101	T	0.06041	-1.0849	10	0.87932	D	0	.	12.1443	0.54014	0.0:0.0:0.0:1.0	.	7	Q8N5C6	SRBD1_HUMAN	G	7	ENSP00000263736:R7G	ENSP00000263736:R7G	R	-	1	2	SRBD1	45686066	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.117000	0.57877	2.136000	0.66102	0.533000	0.62120	AGA	.		0.358	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250747.3	NM_018079	
SYNE2	23224	ucsc.edu;bcgsc.ca	37	14	64678684	64678684	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr14:64678684C>A	ENST00000344113.4	+	104	18941	c.18729C>A	c.(18727-18729)ttC>ttA	p.F6243L	SYNE2_ENST00000458046.2_5'Flank|SYNE2_ENST00000555002.1_Missense_Mutation_p.F2877L|SYNE2_ENST00000358025.3_Missense_Mutation_p.F6243L|SYNE2_ENST00000554805.1_Missense_Mutation_p.F26L|SYNE2_ENST00000555022.1_Missense_Mutation_p.F121L|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000357395.3_Missense_Mutation_p.F2628L|SYNE2_ENST00000394768.2_Missense_Mutation_p.F2628L|SYNE2_ENST00000554584.1_Missense_Mutation_p.F6202L	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6243					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGCAGCATTTCACCAACCAGA	0.522																																					p.F6243L		.											.	SYNE2	164	0			c.C18729A						.						127.0	121.0	123.0					14																	64678684		2203	4300	6503	SO:0001583	missense	23224	exon104			GCATTTCACCAAC	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.18729C>A	14.37:g.64678684C>A	ENSP00000341781:p.Phe6243Leu	55.0	0.0		18.0	4.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.643235	0.47153	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768;ENST00000555022;ENST00000554805	T;T;T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49	5.44	4.53	0.55603	.	0.000000	0.51477	D	0.000089	T	0.49898	0.1584	M	0.73217	2.22	0.80722	D	1	P;B;D;P;D	0.89917	0.926;0.315;1.0;0.944;0.999	P;B;D;P;D	0.85130	0.729;0.317;0.997;0.824;0.991	T	0.37776	-0.9691	10	0.33940	T	0.23	.	9.8546	0.41077	0.0:0.7965:0.0:0.2035	.	2628;631;6202;6243;6243	Q8WXH0-7;Q7Z362;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;.;SYNE2_HUMAN;.	L	6243;2628;6243;6202;6208;2877;2628;121;26	ENSP00000350719:F6243L;ENSP00000349969:F2628L;ENSP00000341781:F6243L;ENSP00000452570:F6202L;ENSP00000450831:F2877L;ENSP00000378249:F2628L;ENSP00000451009:F121L;ENSP00000450605:F26L	ENSP00000261678:F6208L	F	+	3	2	SYNE2	63748437	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	0.927000	0.28818	2.712000	0.92718	0.561000	0.74099	TTC	.		0.522	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
SYNPO2	171024	ucsc.edu;bcgsc.ca	37	4	119952907	119952907	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:119952907T>C	ENST00000429713.2	+	4	3159	c.2977T>C	c.(2977-2979)Tca>Cca	p.S993P	SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000307142.4_Missense_Mutation_p.S993P|SYNPO2_ENST00000434046.2_Missense_Mutation_p.S993P	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	993						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CCAGAAGTCATCAGTCAAGGT	0.512																																					p.S993P		.											.	SYNPO2	92	0			c.T2977C						.						108.0	88.0	95.0					4																	119952907		2203	4300	6503	SO:0001583	missense	171024	exon4			AAGTCATCAGTCA	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.2977T>C	4.37:g.119952907T>C	ENSP00000395143:p.Ser993Pro	75.0	0.0		36.0	4.0	NM_001128934	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000429713.2	37	CCDS47129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.770|3.770	-0.047790|-0.047790	0.07407|0.07407	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000504178|ENST00000307142;ENST00000429713;ENST00000434046	.|T;T;T	.|0.08546	.|3.09;3.08;3.08	5.3|5.3	-10.6|-10.6	0.00265|0.00265	.|.	.|1.458310	.|0.04077	.|N	.|0.309038	T|T	0.03011|0.03011	0.0089|0.0089	N|N	0.12182|0.12182	0.205|0.205	0.23406|0.23406	N|N	0.997749|0.997749	.|B;B;B;B	.|0.06786	.|0.0;0.001;0.0;0.0	.|B;B;B;B	.|0.06405	.|0.001;0.002;0.001;0.001	T|T	0.36040|0.36040	-0.9764|-0.9764	5|9	.|.	.|.	.|.	0.0069|0.0069	1.7052|1.7052	0.02880|0.02880	0.3175:0.2545:0.3035:0.1245|0.3175:0.2545:0.3035:0.1245	.|.	.|993;993;993;993	.|B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6	.|.;.;.;SYNP2_HUMAN	T|P	944|993	.|ENSP00000306015:S993P;ENSP00000395143:S993P;ENSP00000390965:S993P	.|.	I|S	+|+	2|1	0|0	SYNPO2|SYNPO2	120172355|120172355	0.000000|0.000000	0.05858|0.05858	0.005000|0.005000	0.12908|0.12908	0.863000|0.863000	0.49368|0.49368	-3.109000|-3.109000	0.00600|0.00600	-2.116000|-2.116000	0.00830|0.00830	-1.140000|-1.140000	0.01884|0.01884	ATC|TCA	.		0.512	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1		
TACR2	6865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	71175879	71175879	+	Silent	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr10:71175879G>A	ENST00000373306.4	-	1	744	c.201C>T	c.(199-201)gtC>gtT	p.V67V		NM_001057.2	NP_001048.2	P21452	NK2R_HUMAN	tachykinin receptor 2	67					excretion (GO:0007588)|intestine smooth muscle contraction (GO:0014827)|muscle contraction (GO:0006936)|negative regulation of luteinizing hormone secretion (GO:0033685)|operant conditioning (GO:0035106)|positive regulation of acetylcholine secretion, neurotransmission (GO:0014057)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|prolactin secretion (GO:0070459)|tachykinin receptor signaling pathway (GO:0007217)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance K receptor activity (GO:0016497)|tachykinin receptor activity (GO:0004995)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	11						AGTAGTTGGTGACTGTGCGCA	0.577																																					p.V67V		.											.	TACR2	522	0			c.C201T						.						140.0	103.0	115.0					10																	71175879		2203	4300	6503	SO:0001819	synonymous_variant	6865	exon1			GTTGGTGACTGTG		CCDS7293.1	10q22.1	2012-09-20			ENSG00000075073	ENSG00000075073		"""GPCR / Class A : Tachykinin receptors"""	11527	protein-coding gene	gene with protein product		162321		TAC2R, NKNAR			Standard	NM_001057		Approved	SKR, NK2R	uc001jpn.2	P21452	OTTHUMG00000018377	ENST00000373306.4:c.201C>T	10.37:g.71175879G>A		50.0	0.0		82.0	27.0	NM_001057	A8K7I1|Q4QRI5|Q8NGQ8|Q9UDE6|Q9UDE7	Silent	SNP	ENST00000373306.4	37	CCDS7293.1																																																																																			.		0.577	TACR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048411.1		
TADA2B	93624	ucsc.edu;bcgsc.ca	37	4	7055982	7055982	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:7055982A>G	ENST00000310074.7	+	2	653	c.464A>G	c.(463-465)gAc>gGc	p.D155G	TADA2B_ENST00000515646.1_Missense_Mutation_p.D63G|TADA2B_ENST00000512388.1_Missense_Mutation_p.D80G	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	155					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						CCCCCGCTGGACATCTCTGTG	0.657																																					p.D155G		.											.	TADA2B	68	0			c.A464G						.						16.0	18.0	17.0					4																	7055982		2044	4173	6217	SO:0001583	missense	93624	exon2			CGCTGGACATCTC	AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.464A>G	4.37:g.7055982A>G	ENSP00000308022:p.Asp155Gly	50.0	0.0		30.0	4.0	NM_152293	A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Missense_Mutation	SNP	ENST00000310074.7	37	CCDS47007.1	.	.	.	.	.	.	.	.	.	.	A	13.72	2.322361	0.41096	.	.	ENSG00000173011	ENST00000506692;ENST00000310074;ENST00000512388;ENST00000515646;ENST00000510704	T;T;T;T;T	0.48522	0.81;1.0;1.0;1.0;1.0	5.59	5.59	0.84812	.	0.095910	0.64402	D	0.000001	T	0.54838	0.1883	M	0.71206	2.165	0.80722	D	1	P;P	0.48350	0.909;0.604	P;B	0.47705	0.555;0.093	T	0.53718	-0.8399	10	0.23891	T	0.37	-50.2193	15.7429	0.77914	1.0:0.0:0.0:0.0	.	80;155	Q86TJ2-2;Q86TJ2	.;TAD2B_HUMAN	G	63;155;80;63;63	ENSP00000422398:D63G;ENSP00000308022:D155G;ENSP00000423947:D80G;ENSP00000423181:D63G;ENSP00000425731:D63G	ENSP00000308022:D155G	D	+	2	0	TADA2B	7106883	1.000000	0.71417	1.000000	0.80357	0.173000	0.22820	8.828000	0.92047	2.125000	0.65367	0.459000	0.35465	GAC	.		0.657	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358687.2	NM_152293	
TBL3	10607	ucsc.edu;bcgsc.ca	37	16	2027783	2027783	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:2027783A>G	ENST00000568546.1	+	18	2068	c.1940A>G	c.(1939-1941)cAa>cGa	p.Q647R		NM_006453.2	NP_006444.2	Q12788	TBL3_HUMAN	transducin (beta)-like 3	647					G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|intracellular signal transduction (GO:0035556)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	18						CAGGCCAGGCAAGAGGAGCAG	0.657																																					p.Q647R	Melanoma(118;616 1651 35077 38081 48633)	.											.	TBL3	90	0			c.A1940G						.						48.0	39.0	42.0					16																	2027783		2166	4252	6418	SO:0001583	missense	10607	exon18			CCAGGCAAGAGGA	U02609	CCDS10453.1	16p13.3	2013-01-10			ENSG00000183751	ENSG00000183751		"""WD repeat domain containing"""	11587	protein-coding gene	gene with protein product		605915				8307582	Standard	NM_006453		Approved	SAZD, UTP13	uc002cnu.1	Q12788	OTTHUMG00000128710	ENST00000568546.1:c.1940A>G	16.37:g.2027783A>G	ENSP00000454836:p.Gln647Arg	66.0	0.0		50.0	4.0	NM_006453	Q59GD6|Q8IVB7|Q96A78	Missense_Mutation	SNP	ENST00000568546.1	37	CCDS10453.1	.	.	.	.	.	.	.	.	.	.	A	0.650	-0.809900	0.02798	.	.	ENSG00000183751	ENST00000332704	.	.	.	5.72	-0.892	0.10570	.	0.389120	0.28977	N	0.013535	T	0.10723	0.0262	N	0.03903	-0.33	0.20873	N	0.999836	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.33189	-0.9878	9	0.02654	T	1	-6.3119	6.3283	0.21257	0.4808:0.0:0.4019:0.1173	.	409;647	A0JLS5;Q12788	.;TBL3_HUMAN	R	647	.	ENSP00000331815:Q647R	Q	+	2	0	TBL3	1967784	0.001000	0.12720	0.010000	0.14722	0.453000	0.32348	-0.126000	0.10563	-0.391000	0.07763	0.459000	0.35465	CAA	.		0.657	TBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250615.3	NM_006453	
TBPL1	9519	ucsc.edu;bcgsc.ca	37	6	134308131	134308131	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:134308131G>A	ENST00000237264.4	+	7	789	c.514G>A	c.(514-516)Gaa>Aaa	p.E172K	TBPL1_ENST00000477527.1_3'UTR	NM_001253676.1|NM_004865.3	NP_001240605.1|NP_004856.1	P62380	TBPL1_HUMAN	TBP-like 1	172					acrosome assembly (GO:0001675)|DNA-templated transcription, initiation (GO:0006352)|dTTP biosynthetic process (GO:0006235)|regulation of transcription, DNA-templated (GO:0006355)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	6	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00591)|OV - Ovarian serous cystadenocarcinoma(155;0.00848)		TACTGCTGTGGAACAGATTTA	0.393																																					p.E172K		.											.	TBPL1	90	0			c.G514A						.						79.0	77.0	78.0					6																	134308131		2203	4300	6503	SO:0001583	missense	9519	exon7			GCTGTGGAACAGA	AB020881	CCDS5168.1	6q22.1-q22.3	2008-05-23			ENSG00000028839	ENSG00000028839			11589	protein-coding gene	gene with protein product		605521				10082669, 10220372, 15767669	Standard	NM_001253676		Approved	TLP, STUD, TRF2, TLF	uc010kgg.3	P62380	OTTHUMG00000015609	ENST00000237264.4:c.514G>A	6.37:g.134308131G>A	ENSP00000237264:p.Glu172Lys	69.0	0.0		37.0	4.0	NM_004865	A8K8F5|O95753|Q9BWD5|Q9Z2Z0	Missense_Mutation	SNP	ENST00000237264.4	37	CCDS5168.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.025767	0.75390	.	.	ENSG00000028839	ENST00000237264	.	.	.	5.94	5.06	0.68205	Transcription factor TFIID, C-terminal/DNA glycosylase, N-terminal (1);Beta2-adaptin/TATA-box binding, C-terminal (1);	0.241651	0.47455	D	0.000226	T	0.52917	0.1764	L	0.46670	1.46	0.58432	D	0.999994	P	0.50369	0.934	P	0.51701	0.677	T	0.59364	-0.7468	9	0.62326	D	0.03	-3.9877	16.2529	0.82497	0.0:0.1328:0.8672:0.0	.	172	P62380	TBPL1_HUMAN	K	172	.	ENSP00000237264:E172K	E	+	1	0	TBPL1	134349824	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	8.656000	0.91102	1.490000	0.48466	0.643000	0.83706	GAA	.		0.393	TBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042294.2		
TCP1	6950	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	160206479	160206479	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:160206479G>C	ENST00000321394.7	-	5	707	c.427C>G	c.(427-429)Ctg>Gtg	p.L143V	TCP1_ENST00000544255.1_Intron|SNORA29_ENST00000384183.1_RNA|TCP1_ENST00000420894.2_Missense_Mutation_p.L143V|TCP1_ENST00000392168.2_5'UTR|TCP1_ENST00000546023.1_5'Flank	NM_030752.2	NP_110379.2	P17987	TCPA_HUMAN	t-complex 1	143					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|tubulin complex assembly (GO:0007021)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|nuclear heterochromatin (GO:0005720)|pericentriolar material (GO:0000242)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(2)	10		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(65;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		TCTCTTCCCAGTTCATCTGTG	0.358																																					p.L143V		.											.	TCP1	153	0			c.C427G						.						203.0	176.0	185.0					6																	160206479		2203	4300	6503	SO:0001583	missense	6950	exon5			TTCCCAGTTCATC	X52882	CCDS5269.1, CCDS43522.1	6q25-q27	2012-10-02			ENSG00000120438	ENSG00000120438		"""Heat Shock Proteins / Chaperonins"""	11655	protein-coding gene	gene with protein product		186980				3476253, 3653076	Standard	NM_030752		Approved	D6S230E, CCT1, Ccta	uc003qsr.3	P17987	OTTHUMG00000015937	ENST00000321394.7:c.427C>G	6.37:g.160206479G>C	ENSP00000317334:p.Leu143Val	73.0	0.0		49.0	15.0	NM_030752	E1P5B2|Q15556|Q5TCM3	Missense_Mutation	SNP	ENST00000321394.7	37	CCDS5269.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.773706	0.49786	.	.	ENSG00000120438	ENST00000321394;ENST00000420894;ENST00000538128;ENST00000539948	T;T;D;T	0.87809	-0.39;-0.37;-2.3;-1.19	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.82692	0.5092	M	0.79011	2.435	0.80722	D	1	P;B	0.41978	0.767;0.346	B;B	0.41813	0.367;0.278	T	0.81280	-0.1004	10	0.30078	T	0.28	-21.3082	10.9774	0.47473	0.0685:0.0:0.8003:0.1312	.	143;143	E7ERF2;P17987	.;TCPA_HUMAN	V	143;143;23;121	ENSP00000317334:L143V;ENSP00000390159:L143V;ENSP00000442185:L23V;ENSP00000439671:L121V	ENSP00000317334:L143V	L	-	1	2	TCP1	160126469	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.168000	0.71908	2.882000	0.98803	0.655000	0.94253	CTG	.		0.358	TCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042917.2	NM_030752	
TCTN2	79867	ucsc.edu;bcgsc.ca	37	12	124189231	124189231	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:124189231A>G	ENST00000303372.5	+	15	1893	c.1765A>G	c.(1765-1767)Aca>Gca	p.T589A	RP11-338K17.8_ENST00000538837.1_lincRNA|TCTN2_ENST00000426174.2_Missense_Mutation_p.T588A	NM_001143850.2|NM_024809.4	NP_001137322.1|NP_079085.2	Q96GX1	TECT2_HUMAN	tectonic family member 2	589					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		CGGTGTAGAGACAAGGTATGA	0.468																																					p.T589A		.											.	TCTN2	91	0			c.A1765G						.						92.0	76.0	81.0					12																	124189231		2203	4300	6503	SO:0001583	missense	79867	exon15			GTAGAGACAAGGT	AK056924	CCDS9253.1, CCDS45007.1	12q24.31	2011-04-12	2007-08-20	2007-08-20	ENSG00000168778	ENSG00000168778		"""Tectonic proteins"""	25774	protein-coding gene	gene with protein product	"""Meckel syndrome, type 8"""	613846	"""chromosome 12 open reading frame 38"""	C12orf38		21462283	Standard	NM_024809		Approved	FLJ12975, TECT2, MKS8	uc001ufp.3	Q96GX1	OTTHUMG00000168700	ENST00000303372.5:c.1765A>G	12.37:g.124189231A>G	ENSP00000304941:p.Thr589Ala	66.0	0.0		35.0	4.0	NM_024809	A8K7Y8|B3KPW5|Q9H966	Missense_Mutation	SNP	ENST00000303372.5	37	CCDS9253.1	.	.	.	.	.	.	.	.	.	.	A	11.70	1.715521	0.30413	.	.	ENSG00000168778	ENST00000426174;ENST00000303372	D;D	0.82526	-1.62;-1.62	5.58	0.641	0.17759	.	0.309667	0.32273	N	0.006333	T	0.74696	0.3750	M	0.72479	2.2	0.22911	N	0.998571	P;P	0.40875	0.731;0.731	B;B	0.34093	0.175;0.175	T	0.63229	-0.6684	10	0.18276	T	0.48	-11.2791	9.2115	0.37322	0.7249:0.0:0.2751:0.0	.	588;589	A8K7Y8;Q96GX1	.;TECT2_HUMAN	A	588;589	ENSP00000395171:T588A;ENSP00000304941:T589A	ENSP00000304941:T589A	T	+	1	0	TCTN2	122755184	0.990000	0.36364	0.919000	0.36401	0.512000	0.34134	1.068000	0.30629	0.161000	0.19458	-0.256000	0.11100	ACA	.		0.468	TCTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400652.1	NM_024809	
TDRD7	23424	ucsc.edu;bcgsc.ca	37	9	100232863	100232863	+	Silent	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:100232863T>C	ENST00000355295.4	+	9	1948	c.1653T>C	c.(1651-1653)ttT>ttC	p.F551F	TDRD7_ENST00000540902.1_5'UTR|TDRD7_ENST00000422139.2_Silent_p.F477F	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	551	Tudor 1. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				ACTATGGTTTTAGTGAAAATG	0.308																																					p.F551F		.											.	TDRD7	93	0			c.T1653C						.						89.0	94.0	92.0					9																	100232863		2201	4300	6501	SO:0001819	synonymous_variant	23424	exon9			TGGTTTTAGTGAA	AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.1653T>C	9.37:g.100232863T>C		76.0	0.0		39.0	4.0	NM_014290	A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Silent	SNP	ENST00000355295.4	37	CCDS6725.1																																																																																			.		0.308	TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053322.1	NM_014290	
TFAP2C	7022	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	55212882	55212882	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr20:55212882G>A	ENST00000201031.2	+	7	1409	c.1166G>A	c.(1165-1167)tGc>tAc	p.C389Y	TFAP2C_ENST00000544508.1_Missense_Mutation_p.C220Y	NM_003222.3	NP_003213.1	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)	389	H-S-H (helix-span-helix), dimerization.				cell-cell signaling (GO:0007267)|cerebral cortex development (GO:0021987)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|forebrain neuron fate commitment (GO:0021877)|germ-line stem cell maintenance (GO:0030718)|hair follicle development (GO:0001942)|keratinocyte development (GO:0003334)|male gonad development (GO:0008584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sebaceous gland development (GO:0048733)|somatic stem cell maintenance (GO:0035019)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			Colorectal(105;0.229)			ATACAGAACTGCTTGTCTCAT	0.542																																					p.C389Y		.											.	TFAP2C	514	0			c.G1166A						.						118.0	106.0	110.0					20																	55212882		2203	4300	6503	SO:0001583	missense	7022	exon7			AGAACTGCTTGTC		CCDS13454.1	20q13.2	2008-07-17	2001-11-28		ENSG00000087510	ENSG00000087510			11744	protein-coding gene	gene with protein product	"""estrogen receptor factor 1"""	601602	"""transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma)"""			8661133	Standard	NM_003222		Approved	AP2-GAMMA, ERF1, TFAP2G, hAP-2g	uc002xya.3	Q92754	OTTHUMG00000032805	ENST00000201031.2:c.1166G>A	20.37:g.55212882G>A	ENSP00000201031:p.Cys389Tyr	72.0	0.0		63.0	7.0	NM_003222	B4DWK3|O00685|O00730|Q86V30|Q8IVB6|Q9P1X2	Missense_Mutation	SNP	ENST00000201031.2	37	CCDS13454.1	.	.	.	.	.	.	.	.	.	.	G	14.64	2.594858	0.46318	.	.	ENSG00000087510	ENST00000201031;ENST00000544508	D;D	0.96885	-4.16;-4.16	5.91	3.95	0.45737	Transcription factor AP-2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97117	0.9058	M	0.81802	2.56	0.80722	D	1	D	0.65815	0.995	D	0.71184	0.972	D	0.96888	0.9651	10	0.02654	T	1	-13.071	12.9823	0.58570	0.1322:0.0:0.8678:0.0	.	389	Q92754	AP2C_HUMAN	Y	389;220	ENSP00000201031:C389Y;ENSP00000442274:C220Y	ENSP00000201031:C389Y	C	+	2	0	TFAP2C	54646289	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.488000	0.66869	1.508000	0.48769	0.655000	0.94253	TGC	.		0.542	TFAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079823.2	NM_003222	
TIRAP	114609	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	126162958	126162958	+	Intron	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:126162958A>G	ENST00000392680.2	+	5	1051				TIRAP_ENST00000392678.3_Silent_p.L218L|RP11-712L6.5_ENST00000528876.1_5'Flank|TIRAP_ENST00000392679.1_Intron|RP11-712L6.7_ENST00000533378.1_RNA	NM_001039661.1	NP_001034750.1	P58753	TIRAP_HUMAN	toll-interleukin 1 receptor (TIR) domain containing adaptor protein						3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine (C-X-C motif) ligand 1 production (GO:2000340)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-15 production (GO:0032738)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of toll-like receptor 2 signaling pathway (GO:0034137)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of innate immune response (GO:0045088)|regulation of interferon-beta production (GO:0032648)|response to lipopolysaccharide (GO:0032496)|TIRAP-dependent toll-like receptor 4 signaling pathway (GO:0035665)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|Toll-like receptor 2 binding (GO:0035663)|Toll-like receptor 4 binding (GO:0035662)			breast(1)|endometrium(1)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	6	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0739)		GTTGTAAGCTACTACAGGAGG	0.512																																					p.L218L		.											.	TIRAP	523	0			c.A654G						.						59.0	64.0	62.0					11																	126162958		2173	4276	6449	SO:0001627	intron_variant	114609	exon5			TAAGCTACTACAG	AF378129	CCDS8472.1, CCDS41731.1	11q24.2	2008-02-05	2002-01-14		ENSG00000150455	ENSG00000150455			17192	protein-coding gene	gene with protein product	"""MyD88 adapter-like"""	606252	"""Toll-interleukin 1 receptor (TIR) domain-containing adaptor protein"""			11526399, 11544529	Standard	XM_005271399		Approved	Mal, wyatt	uc001qdl.1	P58753	OTTHUMG00000140373	ENST00000392680.2:c.646+8A>G	11.37:g.126162958A>G		25.0	0.0		20.0	5.0	NM_148910	B3KW65|Q56UH9|Q56UI0|Q8N5E5	Silent	SNP	ENST00000392680.2	37	CCDS8472.1																																																																																			.		0.512	TIRAP-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000277092.1	NM_148910	
TJP2	9414	ucsc.edu;bcgsc.ca	37	9	71849423	71849423	+	Silent	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:71849423A>G	ENST00000377245.4	+	12	1948	c.1740A>G	c.(1738-1740)aaA>aaG	p.K580K	TJP2_ENST00000453658.2_Silent_p.K557K|TJP2_ENST00000265384.7_Silent_p.K580K|TJP2_ENST00000539225.1_Silent_p.K611K|TJP2_ENST00000535702.1_Silent_p.K584K|TJP2_ENST00000348208.4_Silent_p.K580K	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	580	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						AAATCCCTAAAGGTGAAATGG	0.453																																					p.K611K		.											.	TJP2	115	0			c.A1833G						.						85.0	80.0	82.0					9																	71849423		2203	4300	6503	SO:0001819	synonymous_variant	9414	exon12			CCCTAAAGGTGAA	L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.1740A>G	9.37:g.71849423A>G		75.0	0.0		47.0	4.0	NM_001170416	A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Silent	SNP	ENST00000377245.4	37	CCDS6627.1																																																																																			.		0.453	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052572.2	NM_201629	
TMC7	79905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	19049310	19049310	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:19049310G>T	ENST00000304381.5	+	8	1250	c.1120G>T	c.(1120-1122)Ggg>Tgg	p.G374W	TMC7_ENST00000561963.1_3'UTR|TMC7_ENST00000421369.3_Missense_Mutation_p.G264W|TMC7_ENST00000569532.1_Missense_Mutation_p.G374W	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	374					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						GGCTGTTTTAGGGGCATGCTT	0.398																																					p.G374W		.											.	TMC7	93	0			c.G1120T						.						214.0	185.0	195.0					16																	19049310		2197	4300	6497	SO:0001583	missense	79905	exon8			GTTTTAGGGGCAT	AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.1120G>T	16.37:g.19049310G>T	ENSP00000304710:p.Gly374Trp	177.0	0.0		161.0	85.0	NM_024847	E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Missense_Mutation	SNP	ENST00000304381.5	37	CCDS10573.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.886793	0.33348	.	.	ENSG00000170537	ENST00000304381;ENST00000421369	T;T	0.53640	0.61;0.61	5.5	3.51	0.40186	.	0.422877	0.25319	N	0.031530	T	0.37293	0.0998	L	0.52126	1.63	0.22601	N	0.998941	B;B	0.33904	0.229;0.431	B;B	0.31290	0.08;0.127	T	0.36040	-0.9764	10	0.59425	D	0.04	.	6.4874	0.22097	0.085:0.0:0.5074:0.4076	.	374;374	Q7Z402;B3KSZ3	TMC7_HUMAN;.	W	374;264	ENSP00000304710:G374W;ENSP00000397081:G264W	ENSP00000304710:G374W	G	+	1	0	TMC7	18956811	0.998000	0.40836	0.051000	0.19133	0.548000	0.35241	4.618000	0.61211	1.284000	0.44531	0.650000	0.86243	GGG	.		0.398	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3	NM_024847	
TMEM120A	83862	ucsc.edu;bcgsc.ca	37	7	75621559	75621559	+	RNA	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:75621559C>A	ENST00000338761.4	-	0	308				TMEM120A_ENST00000493111.2_RNA			Q9BXJ8	T120A_HUMAN	transmembrane protein 120A							integral component of membrane (GO:0016021)											TCGGCCTCTGCTGGGAGGGAG	0.587																																					.		.											.	.	.	0			.						.						57.0	63.0	61.0					7																	75621559		1917	4117	6034			83862	.			CCTCTGCTGGGAG	AF327923	CCDS64688.1	7q11.23	2009-11-06			ENSG00000189077	ENSG00000189077			21697	protein-coding gene	gene with protein product							Standard	NM_031925		Approved	TMPIT, NET29	uc003ued.3	Q9BXJ8	OTTHUMG00000156620		7.37:g.75621559C>A		31.0	0.0		35.0	4.0	.	Q86TE9|Q8N6P1	Splice_Site	SNP	ENST00000338761.4	37																																																																																				.		0.587	TMEM120A-001	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000344834.4	NM_031925	
TMEM132B	114795	ucsc.edu;bcgsc.ca	37	12	126135429	126135429	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:126135429A>G	ENST00000299308.3	+	7	1837	c.1829A>G	c.(1828-1830)gAg>gGg	p.E610G	TMEM132B_ENST00000535886.1_Missense_Mutation_p.E122G	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	610						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		AAGGTGGAGGAGCCGAAAATC	0.602																																					p.E610G		.											.	TMEM132B	185	0			c.A1829G						.						65.0	70.0	68.0					12																	126135429		2080	4206	6286	SO:0001583	missense	114795	exon7			TGGAGGAGCCGAA	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1829A>G	12.37:g.126135429A>G	ENSP00000299308:p.Glu610Gly	54.0	1.0		34.0	4.0	NM_052907	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	37	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	A	29.9	5.042755	0.93685	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.15139	2.45;2.45	5.14	5.14	0.70334	.	0.090159	0.47852	D	0.000209	T	0.25121	0.0610	M	0.63843	1.955	0.52501	D	0.999959	P	0.46142	0.873	P	0.44811	0.461	T	0.02345	-1.1173	10	0.56958	D	0.05	.	14.9632	0.71171	1.0:0.0:0.0:0.0	.	610	Q14DG7	T132B_HUMAN	G	610;122	ENSP00000299308:E610G;ENSP00000440436:E122G	ENSP00000299308:E610G	E	+	2	0	TMEM132B	124701382	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	7.219000	0.78000	1.912000	0.55364	0.528000	0.53228	GAG	.		0.602	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
TMEM200A	114801	ucsc.edu;bcgsc.ca	37	6	130762511	130762511	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:130762511T>C	ENST00000296978.3	+	3	1815	c.944T>C	c.(943-945)cTc>cCc	p.L315P	TMEM200A_ENST00000545622.1_Missense_Mutation_p.L315P|TMEM200A_ENST00000392429.1_Missense_Mutation_p.L315P	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	315						integral component of membrane (GO:0016021)				NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		GCTGACAACCTCAAAAGTAGG	0.433																																					p.L315P		.											.	TMEM200A	23	0			c.T944C						.						112.0	104.0	106.0					6																	130762511		2203	4300	6503	SO:0001583	missense	114801	exon3			ACAACCTCAAAAG	AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.944T>C	6.37:g.130762511T>C	ENSP00000296978:p.Leu315Pro	82.0	1.0		42.0	4.0	NM_001258277	Q96PX5	Missense_Mutation	SNP	ENST00000296978.3	37	CCDS5140.1	.	.	.	.	.	.	.	.	.	.	T	6.125	0.391315	0.11581	.	.	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	5.93	3.39	0.38822	.	0.894345	0.09723	N	0.764162	T	0.07007	0.0178	N	0.19112	0.55	0.21147	N	0.999775	B	0.26876	0.162	B	0.27887	0.084	T	0.33497	-0.9866	9	0.23302	T	0.38	-6.1989	1.0097	0.01495	0.3128:0.0981:0.1653:0.4239	.	315	Q86VY9	T200A_HUMAN	P	315	.	ENSP00000296978:L315P	L	+	2	0	TMEM200A	130804204	0.043000	0.20138	0.977000	0.42913	0.944000	0.59088	1.103000	0.31062	1.048000	0.40298	0.533000	0.62120	CTC	.		0.433	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042201.1	NM_052913	
TMEM181	57583	ucsc.edu;bcgsc.ca	37	6	159005044	159005044	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:159005044T>C	ENST00000367090.3	+	4	649	c.638T>C	c.(637-639)cTg>cCg	p.L213P		NM_020823.1	NP_065874.1	Q9P2C4	TM181_HUMAN	transmembrane protein 181	213					pathogenesis (GO:0009405)	integral component of membrane (GO:0016021)	toxic substance binding (GO:0015643)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)	22		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		CAACTATGGCTGACATGTGTT	0.328																																					p.L213P		.											.	TMEM181	70	0			c.T638C						.						135.0	122.0	126.0					6																	159005044		1873	4112	5985	SO:0001583	missense	57583	exon4			TATGGCTGACATG	AB037844	CCDS43520.1	6q25.3	2012-08-10	2006-10-19	2006-10-19	ENSG00000146433	ENSG00000146433			20958	protein-coding gene	gene with protein product		613209	"""G protein-coupled receptor 178"", ""KIAA1423"""	KIAA1423, GPR178		16452613	Standard	NM_020823		Approved		uc003qrm.4	Q9P2C4	OTTHUMG00000015913	ENST00000367090.3:c.638T>C	6.37:g.159005044T>C	ENSP00000356057:p.Leu213Pro	80.0	0.0		32.0	4.0	NM_020823	Q5VTU1	Missense_Mutation	SNP	ENST00000367090.3	37	CCDS43520.1	.	.	.	.	.	.	.	.	.	.	T	19.82	3.898990	0.72754	.	.	ENSG00000146433	ENST00000314630;ENST00000367090	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.72622	0.3483	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77294	-0.2641	9	0.87932	D	0	.	13.8059	0.63230	0.0:0.0:0.0:1.0	.	213;124	Q9P2C4;Q8N4V6	TM181_HUMAN;.	P	120;213	.	ENSP00000323755:L120P	L	+	2	0	TMEM181	158925032	1.000000	0.71417	0.999000	0.59377	0.878000	0.50629	5.052000	0.64263	2.141000	0.66446	0.528000	0.53228	CTG	.		0.328	TMEM181-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042873.1	NM_020823	
TMEM260	54916	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	57088308	57088308	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr14:57088308C>G	ENST00000261556.6	+	11	1408	c.1286C>G	c.(1285-1287)tCt>tGt	p.S429C	TMEM260_ENST00000536419.1_Intron|TMEM260_ENST00000538838.1_Intron	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	429						integral component of membrane (GO:0016021)											CTTCTCACCTCTATGCCTCAT	0.378																																					p.S429C		.											.	.	.	0			c.C1286G						.						138.0	125.0	129.0					14																	57088308		2203	4300	6503	SO:0001583	missense	0	exon11			TCACCTCTATGCC	AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.1286C>G	14.37:g.57088308C>G	ENSP00000261556:p.Ser429Cys	48.0	0.0		25.0	5.0	NM_017799	A8KAN4|B3KPF5|Q86XE1	Missense_Mutation	SNP	ENST00000261556.6	37	CCDS9727.2	.	.	.	.	.	.	.	.	.	.	C	19.04	3.749800	0.69533	.	.	ENSG00000070269	ENST00000261556	T	0.39229	1.09	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.67869	0.2939	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71784	-0.4488	10	0.87932	D	0	-16.8853	19.1303	0.93402	0.0:1.0:0.0:0.0	.	429	Q9NX78	CN101_HUMAN	C	429	ENSP00000261556:S429C	ENSP00000261556:S429C	S	+	2	0	C14orf101	56158061	1.000000	0.71417	0.980000	0.43619	0.457000	0.32468	7.066000	0.76734	2.518000	0.84900	0.655000	0.94253	TCT	.		0.378	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276924.1	NM_017799	
TMPRSS7	344805	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	111764780	111764780	+	Silent	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:111764780G>A	ENST00000452346.2	+	5	684	c.681G>A	c.(679-681)gtG>gtA	p.V227V	TMPRSS7_ENST00000419127.1_Silent_p.V114V			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	227	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TGGACTCTGTGGTACTAAATG	0.463																																					p.V114V		.											.	TMPRSS7	70	0			c.G342A						.						260.0	226.0	236.0					3																	111764780		692	1591	2283	SO:0001819	synonymous_variant	344805	exon4			CTCTGTGGTACTA	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.681G>A	3.37:g.111764780G>A		372.0	0.0		322.0	117.0	NM_001042575	C9J8P7|E9PAS3|Q17RH4	Silent	SNP	ENST00000452346.2	37																																																																																				.		0.463	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000347592.2	XM_293599	
TNFRSF4	7293	ucsc.edu;bcgsc.ca	37	1	1146981	1146981	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:1146981A>G	ENST00000379236.3	-	7	792	c.788T>C	c.(787-789)aTc>aCc	p.I263T	TNFRSF4_ENST00000453580.1_5'Flank	NM_003327.3	NP_003318.1	P43489	TNR4_HUMAN	tumor necrosis factor receptor superfamily, member 4	263					cellular defense response (GO:0006968)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin secretion (GO:0051024)|regulation of apoptotic process (GO:0042981)|regulation of protein kinase activity (GO:0045859)|T cell proliferation (GO:0042098)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	tumor necrosis factor-activated receptor activity (GO:0005031)			large_intestine(1)|lung(2)|urinary_tract(1)	4	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CTCCTCTTGGATGGGGGTCCG	0.687																																					p.I263T		.											.	TNFRSF4	227	0			c.T788C						.						30.0	37.0	35.0					1																	1146981		2202	4300	6502	SO:0001583	missense	7293	exon7			TCTTGGATGGGGG	X75962	CCDS11.1	1p36	2008-02-05			ENSG00000186827	ENSG00000186827		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11918	protein-coding gene	gene with protein product		600315		TXGP1L		7510240, 2828930	Standard	NM_003327		Approved	ACT35, OX40, CD134	uc001ade.3	P43489	OTTHUMG00000001415	ENST00000379236.3:c.788T>C	1.37:g.1146981A>G	ENSP00000368538:p.Ile263Thr	50.0	1.0		41.0	4.0	NM_003327	Q13663|Q2M312|Q5T7M0	Missense_Mutation	SNP	ENST00000379236.3	37	CCDS11.1	.	.	.	.	.	.	.	.	.	.	A	15.96	2.985845	0.53934	.	.	ENSG00000186827	ENST00000379236	T	0.68479	-0.33	3.27	3.27	0.37495	.	0.363595	0.19033	N	0.124485	T	0.72503	0.3468	L	0.55990	1.75	0.33068	D	0.535039	D	0.71674	0.998	D	0.75484	0.986	T	0.74290	-0.3713	10	0.32370	T	0.25	-23.946	6.5575	0.22468	0.8837:0.0:0.1163:0.0	.	263	P43489	TNR4_HUMAN	T	263	ENSP00000368538:I263T	ENSP00000368538:I263T	I	-	2	0	TNFRSF4	1136844	0.907000	0.30839	0.999000	0.59377	0.853000	0.48598	1.143000	0.31553	1.736000	0.51660	0.402000	0.26972	ATC	.		0.687	TNFRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004086.1		
TNKS1BP1	85456	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57080520	57080520	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:57080520G>C	ENST00000532437.1	-	4	1953	c.1642C>G	c.(1642-1644)Cca>Gca	p.P548A	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.P548A|TNKS1BP1_ENST00000530920.1_5'Flank			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	548	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				GACATGCTTGGATCATCCCCC	0.597																																					p.P548A		.											.	TNKS1BP1	91	0			c.C1642G						.						68.0	60.0	63.0					11																	57080520		2201	4296	6497	SO:0001583	missense	85456	exon5			TGCTTGGATCATC	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.1642C>G	11.37:g.57080520G>C	ENSP00000437271:p.Pro548Ala	48.0	1.0		137.0	25.0	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	G	10.33	1.320708	0.23994	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.32023	1.47;1.47	4.01	-0.132	0.13489	.	0.762466	0.10715	N	0.642424	T	0.19765	0.0475	L	0.27053	0.805	0.09310	N	1	B	0.25272	0.122	B	0.22601	0.04	T	0.23691	-1.0181	10	0.59425	D	0.04	0.5936	7.4517	0.27242	0.5047:0.0:0.4953:0.0	.	548	Q9C0C2	TB182_HUMAN	A	548	ENSP00000350990:P548A;ENSP00000437271:P548A	ENSP00000350990:P548A	P	-	1	0	TNKS1BP1	56837096	0.000000	0.05858	0.001000	0.08648	0.169000	0.22640	0.108000	0.15396	0.061000	0.16311	-0.379000	0.06801	CCA	.		0.597	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
TNKS1BP1	85456	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	57080662	57080662	+	Silent	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:57080662G>T	ENST00000532437.1	-	4	1811	c.1500C>A	c.(1498-1500)atC>atA	p.I500I	TNKS1BP1_ENST00000358252.3_Silent_p.I500I|TNKS1BP1_ENST00000530920.1_5'Flank			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	500	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				TGGCTTCAGTGATGGGGGAGG	0.647																																					p.I500I		.											.	TNKS1BP1	91	0			c.C1500A						.						17.0	20.0	19.0					11																	57080662		1993	4010	6003	SO:0001819	synonymous_variant	85456	exon5			TTCAGTGATGGGG	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.1500C>A	11.37:g.57080662G>T		18.0	0.0		70.0	18.0	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Silent	SNP	ENST00000532437.1	37	CCDS7951.1																																																																																			.		0.647	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
TRIM44	54765	broad.mit.edu;ucsc.edu;mdanderson.org	37	11	35684743	35684743	+	Silent	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:35684743G>T	ENST00000299413.5	+	1	391	c.84G>T	c.(82-84)ggG>ggT	p.G28G	RP1-276E15.1_ENST00000525573.2_lincRNA	NM_017583.4	NP_060053.2	Q96DX7	TRI44_HUMAN	tripartite motif containing 44	28						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_lung(20;0.0317)|Lung NSC(22;0.0661)|all_epithelial(35;0.115)	all_hematologic(20;0.107)				AGGCTCCGGGGGCCGAGGAAG	0.667																																					p.G28G		.											.	TRIM44	227	0			c.G84T						.						29.0	31.0	30.0					11																	35684743		2197	4290	6487	SO:0001819	synonymous_variant	54765	exon1			TCCGGGGGCCGAG	BC024031	CCDS31461.1	11p13	2011-04-20	2011-01-25		ENSG00000166326	ENSG00000166326		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19016	protein-coding gene	gene with protein product		612298	"""tripartite motif-containing 44"""				Standard	NM_017583		Approved	DIPB, MC7	uc001mwi.2	Q96DX7	OTTHUMG00000166312	ENST00000299413.5:c.84G>T	11.37:g.35684743G>T		17.0	0.0		25.0	9.0	NM_017583	D3DR14|Q96QY2|Q9UGK0	Silent	SNP	ENST00000299413.5	37	CCDS31461.1																																																																																			.		0.667	TRIM44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389081.1	NM_017583	
TNKS1BP1	85456	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57080609	57080609	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:57080609G>A	ENST00000532437.1	-	4	1864	c.1553C>T	c.(1552-1554)tCc>tTc	p.S518F	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.S518F|TNKS1BP1_ENST00000530920.1_5'Flank			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	518	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				TTCCCTGCTGGAAACGGCCAA	0.652																																					p.S518F		.											.	TNKS1BP1	91	0			c.C1553T						.						34.0	31.0	32.0					11																	57080609		2174	4245	6419	SO:0001583	missense	85456	exon5			CTGCTGGAAACGG	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.1553C>T	11.37:g.57080609G>A	ENSP00000437271:p.Ser518Phe	28.0	0.0		85.0	21.0	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.591782	0.46214	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.37058	1.22;1.22	2.93	2.93	0.34026	.	0.557718	0.13538	N	0.380456	T	0.39886	0.1095	L	0.27053	0.805	0.09310	N	1	D	0.61697	0.99	P	0.60345	0.873	T	0.10567	-1.0624	10	0.54805	T	0.06	.	9.558	0.39351	0.0:0.0:1.0:0.0	.	518	Q9C0C2	TB182_HUMAN	F	518	ENSP00000350990:S518F;ENSP00000437271:S518F	ENSP00000350990:S518F	S	-	2	0	TNKS1BP1	56837185	0.039000	0.19947	0.017000	0.16124	0.072000	0.16883	1.973000	0.40550	1.964000	0.57103	0.462000	0.41574	TCC	.		0.652	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
TNKS1BP1	85456	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57080675	57080675	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr11:57080675G>A	ENST00000532437.1	-	4	1798	c.1487C>T	c.(1486-1488)cCt>cTt	p.P496L	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.P496L|TNKS1BP1_ENST00000530920.1_5'Flank			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	496	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				GGGGGAGGGAGGCGGGGAGTC	0.642																																					p.P496L		.											.	TNKS1BP1	91	0			c.C1487T						.						17.0	20.0	19.0					11																	57080675		2072	4090	6162	SO:0001583	missense	85456	exon5			GAGGGAGGCGGGG	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.1487C>T	11.37:g.57080675G>A	ENSP00000437271:p.Pro496Leu	17.0	0.0		65.0	15.0	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	G	19.14	3.769583	0.69992	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.69175	-0.38;-0.38	3.8	3.8	0.43715	.	0.000000	0.38164	N	0.001783	T	0.71771	0.3379	L	0.29908	0.895	0.33473	D	0.586439	D	0.89917	1.0	D	0.91635	0.999	T	0.80317	-0.1433	10	0.87932	D	0	-1.0273	13.6105	0.62076	0.0:0.0:1.0:0.0	.	496	Q9C0C2	TB182_HUMAN	L	496	ENSP00000350990:P496L;ENSP00000437271:P496L	ENSP00000350990:P496L	P	-	2	0	TNKS1BP1	56837251	1.000000	0.71417	0.360000	0.25837	0.777000	0.43975	5.494000	0.66905	1.968000	0.57251	0.462000	0.41574	CCT	.		0.642	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
TRNT1	51095	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	3186326	3186329	+	Frame_Shift_Del	DEL	AGTT	AGTT	-			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	AGTT	AGTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:3186326_3186329delAGTT	ENST00000251607.6	+	5	642_645	c.540_543delAGTT	c.(538-543)aaagttfs	p.KV180fs	TRNT1_ENST00000280591.6_Frame_Shift_Del_p.KV180fs	NM_182916.2	NP_886552	Q96Q11	TRNT1_HUMAN	tRNA nucleotidyl transferase, CCA-adding, 1	180					protein targeting to mitochondrion (GO:0006626)|tRNA 3'-end processing (GO:0042780)|tRNA 3'-terminal CCA addition (GO:0001680)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP:3'-cytidine-cytidine-tRNA adenylyltransferase activity (GO:0052929)|CTP:3'-cytidine-tRNA cytidylyltransferase activity (GO:0052928)|CTP:tRNA cytidylyltransferase activity (GO:0052927)|tRNA adenylyltransferase activity (GO:0004810)|tRNA binding (GO:0000049)			breast(2)|endometrium(3)|large_intestine(4)|lung(2)|urinary_tract(1)	12				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)		AAAATAAGAAAGTTAGATTTGTTG	0.26																																					p.180_181del		.											.	TRNT1	90	0			c.540_543del						.			0,4250		0,0,2125						5.7	1.0			56	1,8237		0,1,4118	no	frameshift	TRNT1	NM_182916.2		0,1,6243	A1A1,A1R,RR		0.0121,0.0,0.0080				1,12487				SO:0001589	frameshift_variant	51095	exon5			TAAGAAAGTTAGA	AF151805	CCDS2561.2	3p25.1	2002-05-30			ENSG00000072756	ENSG00000072756	2.7.7.25		17341	protein-coding gene	gene with protein product		612907				10810093, 11504732	Standard	NM_182916		Approved	MtCCA, CGI-47, CCA1	uc003bpp.4	Q96Q11	OTTHUMG00000090259	ENST00000251607.6:c.540_543delAGTT	3.37:g.3186326_3186329delAGTT	ENSP00000251607:p.Lys180fs	204.0	0.0		155.0	23.0	NM_182916	A8K2Z6|B7WP13|C9JKA2|Q8ND57|Q9BS97|Q9Y362	Frame_Shift_Del	DEL	ENST00000251607.6	37	CCDS2561.2																																																																																			.		0.260	TRNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337616.1		
TRPV2	51393	ucsc.edu;bcgsc.ca	37	17	16335396	16335396	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr17:16335396A>G	ENST00000338560.7	+	12	2170	c.1771A>G	c.(1771-1773)Agg>Ggg	p.R591G	TRPV2_ENST00000583241.1_3'UTR|TRPV2_ENST00000577397.1_Missense_Mutation_p.R161G	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	591					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		GGCCCAGTACAGGGGTATCCT	0.637																																					p.R591G		.											.	TRPV2	91	0			c.A1771G						.						70.0	71.0	71.0					17																	16335396		2203	4300	6503	SO:0001583	missense	51393	exon12			CAGTACAGGGGTA	AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.1771A>G	17.37:g.16335396A>G	ENSP00000342222:p.Arg591Gly	66.0	0.0		48.0	4.0	NM_016113	A6NML2|A8K0Z0|Q9Y670	Missense_Mutation	SNP	ENST00000338560.7	37	CCDS32576.1	.	.	.	.	.	.	.	.	.	.	A	8.827	0.938988	0.18281	.	.	ENSG00000187688	ENST00000338560	D	0.98493	-4.96	4.81	-9.63	0.00544	Ion transport (1);	0.834188	0.11430	N	0.564902	D	0.90638	0.7064	N	0.11064	0.09	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.81974	-0.0687	10	0.12103	T	0.63	-27.0174	8.7251	0.34465	0.4091:0.3497:0.2413:0.0	.	591	Q9Y5S1	TRPV2_HUMAN	G	591	ENSP00000342222:R591G	ENSP00000342222:R591G	R	+	1	2	TRPV2	16276121	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.433000	0.02428	-2.698000	0.00400	-1.674000	0.00743	AGG	.		0.637	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130464.2	NM_016113	
TRRAP	8295	ucsc.edu;bcgsc.ca	37	7	98562268	98562268	+	Silent	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:98562268C>A	ENST00000359863.4	+	47	7034	c.6825C>A	c.(6823-6825)ctC>ctA	p.L2275L	TRRAP_ENST00000355540.3_Silent_p.L2257L|TRRAP_ENST00000446306.3_Silent_p.L2256L	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2275	Interaction with TP53.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TTATGATCCTCAAGTCTGCCT	0.448																																					p.L2275L		.											.	TRRAP	923	0			c.C6825A						.						101.0	95.0	97.0					7																	98562268		2203	4300	6503	SO:0001819	synonymous_variant	8295	exon47			GATCCTCAAGTCT	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.6825C>A	7.37:g.98562268C>A		41.0	0.0		30.0	4.0	NM_001244580	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	ENST00000359863.4	37	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	C	8.976	0.974030	0.18736	.	.	ENSG00000196367	ENST00000456197	.	.	.	5.17	3.25	0.37280	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.597	0.33721	0.1265:0.495:0.3785:0.0	.	.	.	.	X	1997	.	.	S	+	2	0	TRRAP	98400204	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.996000	0.40776	2.553000	0.86117	0.655000	0.94253	TCA	.		0.448	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
TSC2	7249	ucsc.edu;bcgsc.ca	37	16	2136204	2136204	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:2136204A>G	ENST00000219476.3	+	37	5303	c.4673A>G	c.(4672-4674)gAg>gGg	p.E1558G	TSC2_ENST00000439673.2_Missense_Mutation_p.E1455G|TSC2_ENST00000568454.1_Missense_Mutation_p.E1502G|TSC2_ENST00000401874.2_Missense_Mutation_p.E1491G|TSC2_ENST00000350773.4_Missense_Mutation_p.E1535G|TSC2_ENST00000353929.4_Missense_Mutation_p.E1515G|TSC2_ENST00000382538.6_Missense_Mutation_p.E1443G	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1558	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				AGCAACAGCGAGCTCGCCATC	0.687			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.E1558G		.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	1908	0			c.A4673G						.						68.0	60.0	63.0					16																	2136204		2198	4297	6495	SO:0001583	missense	7249	exon37	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	ACAGCGAGCTCGC	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.4673A>G	16.37:g.2136204A>G	ENSP00000219476:p.Glu1558Gly	33.0	0.0		37.0	4.0	NM_000548	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	37	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.254154	0.80135	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D	0.95980	-3.87;-3.87;-3.87;-3.87;-3.87	4.47	4.47	0.54385	Rap/ran-GAP (1);	0.000000	0.85682	D	0.000000	D	0.97387	0.9145	M	0.81179	2.53	0.80722	D	1	D;D;D;P;D;D;D	0.69078	0.991;0.997;0.995;0.855;0.995;0.995;0.997	D;D;D;P;D;D;D	0.81914	0.989;0.993;0.995;0.542;0.995;0.995;0.985	D	0.97662	1.0161	10	0.54805	T	0.06	-32.5821	13.9283	0.63978	1.0:0.0:0.0:0.0	.	1443;1455;1535;333;1514;1491;1558	B4DIL8;P49815-6;P49815-4;B3KSR9;P49815-3;P49815-5;P49815	.;.;.;.;.;.;TSC2_HUMAN	G	1558;1492;1515;1455;1443;1535	ENSP00000219476:E1558G;ENSP00000248099:E1515G;ENSP00000399232:E1455G;ENSP00000371978:E1443G;ENSP00000344383:E1535G	ENSP00000219476:E1558G	E	+	2	0	TSC2	2076205	1.000000	0.71417	0.997000	0.53966	0.596000	0.36781	9.037000	0.93765	1.881000	0.54492	0.459000	0.35465	GAG	.		0.687	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
TTC28	23331	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	28504014	28504014	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr22:28504014G>A	ENST00000397906.2	-	7	1960	c.1819C>T	c.(1819-1821)Cgg>Tgg	p.R607W		NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	607					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						TACTCTCCCCGAGAGCAGTGG	0.572																																					p.R607W		.											.	.	.	0			c.C1819T						.						32.0	31.0	31.0					22																	28504014		692	1591	2283	SO:0001583	missense	23331	exon7			CTCCCCGAGAGCA	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.1819C>T	22.37:g.28504014G>A	ENSP00000381003:p.Arg607Trp	51.0	0.0		35.0	6.0	NM_001145418	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	ENST00000397906.2	37	CCDS46678.1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.109225	0.56398	.	.	ENSG00000100154	ENST00000397906	D	0.94576	-3.46	6.17	2.83	0.33086	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.070226	0.64402	D	0.000020	D	0.95535	0.8549	L	0.51853	1.615	0.58432	D	0.999998	D	0.89917	1.0	D	0.85130	0.997	D	0.94369	0.7594	10	0.59425	D	0.04	-24.2411	11.7105	0.51623	0.0:0.12:0.6315:0.2485	.	607	Q96AY4	TTC28_HUMAN	W	607	ENSP00000381003:R607W	ENSP00000381003:R607W	R	-	1	2	TTC28	26834014	0.980000	0.34600	0.321000	0.25320	0.994000	0.84299	1.760000	0.38430	0.423000	0.26033	0.655000	0.94253	CGG	.		0.572	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320930.2	XM_929318	
TTC3	7267	broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	38532006	38532006	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr21:38532006C>T	ENST00000399017.2	+	29	5745	c.2998C>T	c.(2998-3000)Cgc>Tgc	p.R1000C	TTC3_ENST00000354749.2_Missense_Mutation_p.R1000C|TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000355666.1_Missense_Mutation_p.R1000C	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1000					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TACAGACAGCCGCTGTACTGT	0.373																																					p.R1000C	Ovarian(38;194 1649 35661)	.											.	TTC3	590	0			c.C2998T						.						88.0	79.0	82.0					21																	38532006		2203	4300	6503	SO:0001583	missense	7267	exon29			GACAGCCGCTGTA	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.2998C>T	21.37:g.38532006C>T	ENSP00000381981:p.Arg1000Cys	43.0	0.0		26.0	6.0	NM_001001894	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	37	CCDS13651.1	.	.	.	.	.	.	.	.	.	.	C	17.50	3.405500	0.62288	.	.	ENSG00000182670	ENST00000418766;ENST00000438055;ENST00000355666;ENST00000399017;ENST00000354749	T;T;T;T;T	0.12879	2.64;2.64;2.97;2.97;2.97	5.25	4.34	0.51931	.	0.206543	0.33772	N	0.004579	T	0.30166	0.0756	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;P	0.69824	0.966;0.869	T	0.01375	-1.1371	10	0.48119	T	0.1	-4.4516	11.1817	0.48631	0.197:0.803:0.0:0.0	.	58;1000	Q5GIT6;P53804	.;TTC3_HUMAN	C	1000;982;1000;1000;1000	ENSP00000403943:R1000C;ENSP00000391891:R982C;ENSP00000347889:R1000C;ENSP00000381981:R1000C;ENSP00000346791:R1000C	ENSP00000346791:R1000C	R	+	1	0	TTC3	37453876	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	2.665000	0.46791	1.302000	0.44855	0.591000	0.81541	CGC	.		0.373	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1		
TTC3	7267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	38538901	38538901	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr21:38538901A>G	ENST00000399017.2	+	33	7132	c.4385A>G	c.(4384-4386)cAg>cGg	p.Q1462R	TTC3_ENST00000354749.2_Missense_Mutation_p.Q1462R|TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000355666.1_Missense_Mutation_p.Q1462R	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1462					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				CCACACGTGCAGATGGTTGCC	0.348																																					p.Q1462R	Ovarian(38;194 1649 35661)	.											.	TTC3	590	0			c.A4385G						.						40.0	38.0	38.0					21																	38538901		2203	4300	6503	SO:0001583	missense	7267	exon33			ACGTGCAGATGGT	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.4385A>G	21.37:g.38538901A>G	ENSP00000381981:p.Gln1462Arg	108.0	0.0		67.0	21.0	NM_001001894	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	37	CCDS13651.1	.	.	.	.	.	.	.	.	.	.	A	3.781	-0.045728	0.07452	.	.	ENSG00000182670	ENST00000355666;ENST00000399017;ENST00000354749	T;T;T	0.07800	3.16;3.16;3.16	4.96	2.15	0.27550	.	0.452951	0.20187	N	0.097386	T	0.04092	0.0114	L	0.31065	0.9	0.09310	N	0.999997	B;P	0.35433	0.201;0.501	B;B	0.25140	0.032;0.058	T	0.36915	-0.9728	9	.	.	.	-3.6352	2.6852	0.05105	0.5413:0.2717:0.187:0.0	.	520;1462	Q5GIT6;P53804	.;TTC3_HUMAN	R	1462	ENSP00000347889:Q1462R;ENSP00000381981:Q1462R;ENSP00000346791:Q1462R	.	Q	+	2	0	TTC3	37460771	0.002000	0.14202	0.010000	0.14722	0.142000	0.21351	1.121000	0.31283	0.796000	0.33947	0.460000	0.39030	CAG	.		0.348	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1		
TTLL3	26140	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	9870684	9870685	+	Frame_Shift_Del	DEL	GA	GA	-	rs201240908		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:9870684_9870685delGA	ENST00000547186.1	+	10	1375_1376	c.1159_1160delGA	c.(1159-1161)gagfs	p.E387fs	TTLL3_ENST00000426895.4_Frame_Shift_Del_p.E530fs|TTLL3_ENST00000455274.1_Frame_Shift_Del_p.E175fs|ARPC4-TTLL3_ENST00000397256.1_Frame_Shift_Del_p.E448fs|TTLL3_ENST00000397241.1_Frame_Shift_Del_p.E175fs|TTLL3_ENST00000383827.1_Frame_Shift_Del_p.E175fs|TTLL3_ENST00000430793.1_Frame_Shift_Del_p.E175fs|TTLL3_ENST00000427853.3_Frame_Shift_Del_p.E175fs|TTLL3_ENST00000466245.1_3'UTR	NM_001025930.3	NP_001021100.3	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	387	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				axoneme assembly (GO:0035082)|cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	Medulloblastoma(99;0.227)					GAAGCACCTGGAGAACTCATGC	0.569																																					p.530_530del		.											.	TTLL3	585	0			c.1588_1589del						.																																			SO:0001589	frameshift_variant	26140	exon10			CACCTGGAGAACT		CCDS43048.1, CCDS43048.2	3p25.3	2013-02-14			ENSG00000214021	ENSG00000214021		"""Tubulin tyrosine ligase-like family"""	24483	protein-coding gene	gene with protein product						11054573	Standard	NR_037162		Approved	DKFZP434B103, HOTTL	uc003btg.4	Q9Y4R7	OTTHUMG00000128439	ENST00000547186.1:c.1159_1160delGA	3.37:g.9870686_9870687delGA	ENSP00000446659:p.Glu387fs	50.0	0.0		36.0	15.0	NM_001025930	Q4KMS8|Q6AWA3|Q6ZU95|Q8NDN8|Q96GG8|Q9H876|Q9UI99	Frame_Shift_Del	DEL	ENST00000547186.1	37																																																																																				.		0.569	TTLL3-203	KNOWN	basic	protein_coding	protein_coding		NM_001025930.2	
TTYH3	80727	ucsc.edu;bcgsc.ca	37	7	2695773	2695773	+	Missense_Mutation	SNP	C	C	A	rs561364736		TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:2695773C>A	ENST00000258796.7	+	10	1273	c.1068C>A	c.(1066-1068)aaC>aaA	p.N356K	TTYH3_ENST00000407643.1_Missense_Mutation_p.N324K|TTYH3_ENST00000403167.1_Missense_Mutation_p.N185K	NM_025250.2	NP_079526.1	Q9C0H2	TTYH3_HUMAN	tweety family member 3	356					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|intracellular calcium activated chloride channel activity (GO:0005229)			kidney(1)|large_intestine(3)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	17		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		CGGAGGTGAACCTGCAGCACC	0.672																																					p.N356K		.											.	TTYH3	90	0			c.C1068A						.						23.0	20.0	21.0					7																	2695773		2186	4282	6468	SO:0001583	missense	80727	exon10			GGTGAACCTGCAG		CCDS34588.1	7p22	2013-09-02	2013-09-02		ENSG00000136295	ENSG00000136295			22222	protein-coding gene	gene with protein product		608919	"""tweety homolog 3 (Drosophila)"""				Standard	NM_025250		Approved	KIAA1691	uc003smp.3	Q9C0H2	OTTHUMG00000152050	ENST00000258796.7:c.1068C>A	7.37:g.2695773C>A	ENSP00000258796:p.Asn356Lys	66.0	0.0		65.0	7.0	NM_025250	A4D201|B7WP98|Q6L749|Q6ZVG3|Q8TEG6	Missense_Mutation	SNP	ENST00000258796.7	37	CCDS34588.1	.	.	.	.	.	.	.	.	.	.	C	14.50	2.553546	0.45487	.	.	ENSG00000136295	ENST00000258796;ENST00000407643;ENST00000403167;ENST00000429448	T;T;T;T	0.12147	2.71;2.71;2.71;2.71	4.32	-0.6	0.11642	.	0.104145	0.64402	U	0.000004	T	0.18593	0.0446	M	0.70595	2.14	0.36267	D	0.854894	P;D	0.53462	0.902;0.96	B;P	0.49799	0.442;0.622	T	0.29212	-1.0019	10	0.22109	T	0.4	.	9.5548	0.39332	0.0:0.5795:0.0:0.4205	.	185;356	Q9C0H2-3;Q9C0H2	.;TTYH3_HUMAN	K	356;324;185;16	ENSP00000258796:N356K;ENSP00000385316:N324K;ENSP00000385015:N185K;ENSP00000413757:N16K	ENSP00000258796:N356K	N	+	3	2	TTYH3	2662299	1.000000	0.71417	0.998000	0.56505	0.942000	0.58702	0.894000	0.28350	-0.009000	0.14296	0.390000	0.25778	AAC	.		0.672	TTYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325082.2	XM_166523	
TUBB4B	10383	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	140137668	140137668	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:140137668T>C	ENST00000340384.4	+	4	1146	c.998T>C	c.(997-999)gTc>gCc	p.V333A		NM_006088.5	NP_006079.1	P68371	TBB4B_HUMAN	tubulin, beta 4B class IVb	333					'de novo' posttranslational protein folding (GO:0051084)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|unfolded protein binding (GO:0051082)									Albendazole(DB00518)|Mebendazole(DB00643)	ATGCTTAATGTCCAAAACAAA	0.552																																					p.V333A		.											.	.	.	0			c.T998C						.						58.0	59.0	58.0					9																	140137668		2203	4299	6502	SO:0001583	missense	10383	exon4			TTAATGTCCAAAA	BC019359	CCDS7039.1	9q34.3	2011-10-10	2011-10-10	2011-10-10	ENSG00000188229	ENSG00000188229		"""Tubulins"""	20771	protein-coding gene	gene with protein product	"""class IVb beta-tubulin"""	602660	"""tubulin, beta 2C"""	TUBB2C		3999141	Standard	NM_006088		Approved	Beta2	uc004cmh.1	P68371	OTTHUMG00000131783	ENST00000340384.4:c.998T>C	9.37:g.140137668T>C	ENSP00000341289:p.Val333Ala	143.0	1.0		76.0	24.0	NM_006088	A2BFA2|P05217	Missense_Mutation	SNP	ENST00000340384.4	37	CCDS7039.1	.	.	.	.	.	.	.	.	.	.	T	11.08	1.534919	0.27475	.	.	ENSG00000188229	ENST00000340384	D	0.82803	-1.65	5.57	5.57	0.84162	.	0.081416	0.48286	D	0.000185	D	0.86318	0.5904	M	0.80508	2.5	0.58432	D	0.999997	B	0.10296	0.003	B	0.33690	0.168	D	0.84831	0.0802	10	0.87932	D	0	.	14.5794	0.68274	0.0:0.0:0.0:1.0	.	333	P68371	TBB4B_HUMAN	A	333	ENSP00000341289:V333A	ENSP00000341289:V333A	V	+	2	0	TUBB2C	139257489	1.000000	0.71417	0.540000	0.28089	0.561000	0.35649	7.884000	0.87274	2.122000	0.65172	0.533000	0.62120	GTC	.		0.552	TUBB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254715.1	NM_006088	
TUBGCP2	10844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	135099037	135099037	+	Silent	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr10:135099037C>A	ENST00000252936.3	-	11	1857	c.1818G>T	c.(1816-1818)acG>acT	p.T606T	TUBGCP2_ENST00000368563.2_Silent_p.T606T|TUBGCP2_ENST00000368562.1_Silent_p.T199T|TUBGCP2_ENST00000417178.2_Silent_p.T476T|TUBGCP2_ENST00000543663.1_Silent_p.T634T			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	606					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		GCGCCAGCTCCGTGGGGTCGG	0.632																																					p.T634T		.											.	TUBGCP2	90	0			c.G1902T						.						39.0	41.0	40.0					10																	135099037		2203	4300	6503	SO:0001819	synonymous_variant	10844	exon13			CAGCTCCGTGGGG	AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.1818G>T	10.37:g.135099037C>A		49.0	0.0		39.0	16.0	NM_001256617	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Silent	SNP	ENST00000252936.3	37	CCDS7676.1																																																																																			.		0.632	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1		
ULK2	9706	ucsc.edu;bcgsc.ca	37	17	19684355	19684355	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr17:19684355A>G	ENST00000395544.4	-	24	3201	c.2702T>C	c.(2701-2703)cTt>cCt	p.L901P	ULK2_ENST00000361658.2_Missense_Mutation_p.L901P	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	901	CTD-like region.				autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					GGCTTTGGCAAGATGCAGAGA	0.537																																					p.L901P		.											.	ULK2	334	0			c.T2702C						.						59.0	49.0	52.0					17																	19684355		2203	4300	6503	SO:0001583	missense	9706	exon24			TTGGCAAGATGCA	AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.2702T>C	17.37:g.19684355A>G	ENSP00000378914:p.Leu901Pro	82.0	1.0		45.0	4.0	NM_001142610	A8MY69|O75119	Missense_Mutation	SNP	ENST00000395544.4	37	CCDS11213.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.604085	0.87157	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.50001	0.76;0.76	5.56	5.56	0.83823	Serine/threonine-protein kinase, C-terminal (1);	0.060314	0.64402	D	0.000002	T	0.60856	0.2301	L	0.43152	1.355	0.80722	D	1	D	0.76494	0.999	D	0.70487	0.969	T	0.63681	-0.6582	10	0.72032	D	0.01	-14.7114	14.8874	0.70579	1.0:0.0:0.0:0.0	.	901	Q8IYT8	ULK2_HUMAN	P	901	ENSP00000354877:L901P;ENSP00000378914:L901P	ENSP00000354877:L901P	L	-	2	0	ULK2	19624947	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	8.764000	0.91719	2.111000	0.64477	0.482000	0.46254	CTT	.		0.537	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683	
UNC79	57578	ucsc.edu;bcgsc.ca	37	14	94046510	94046510	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr14:94046510G>T	ENST00000393151.2	+	19	2449	c.2449G>T	c.(2449-2451)Gat>Tat	p.D817Y	UNC79_ENST00000555664.1_Missense_Mutation_p.D817Y|UNC79_ENST00000256339.4_Missense_Mutation_p.D640Y|UNC79_ENST00000553484.1_Missense_Mutation_p.D817Y			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	817					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						GTTACAAGATGATGGAATCAC	0.413																																					p.D640Y		.											.	.	.	0			c.G1918T						.						70.0	72.0	71.0					14																	94046510		2203	4300	6503	SO:0001583	missense	57578	exon19			CAAGATGATGGAA	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.2449G>T	14.37:g.94046510G>T	ENSP00000376858:p.Asp817Tyr	68.0	1.0		46.0	4.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	G	10.72	1.428453	0.25726	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.18657	2.2;2.2;2.2;2.2	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.40040	0.1101	L	0.40543	1.245	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	T	0.22382	-1.0218	10	0.62326	D	0.03	-18.474	18.3038	0.90174	0.0:0.0:1.0:0.0	.	817	C9JQL1	.	Y	640;817;817;817;817	ENSP00000256339:D640Y;ENSP00000450868:D817Y;ENSP00000451360:D817Y;ENSP00000376858:D817Y	ENSP00000256339:D640Y	D	+	1	0	KIAA1409	93116263	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.336000	0.79503	0.561000	0.74099	GAT	.		0.413	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
USP14	9097	ucsc.edu;bcgsc.ca	37	18	210405	210405	+	Silent	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:210405T>C	ENST00000261601.7	+	15	1336	c.1245T>C	c.(1243-1245)tgT>tgC	p.C415C	USP14_ENST00000582707.1_Silent_p.C380C|USP14_ENST00000383589.2_Silent_p.C369C|USP14_ENST00000400266.3_Silent_p.C404C	NM_005151.3	NP_005142.1	P54578	UBP14_HUMAN	ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)	415	USP.				negative regulation of endopeptidase activity (GO:0010951)|protein deubiquitination (GO:0016579)|regulation of chemotaxis (GO:0050920)|regulation of proteasomal protein catabolic process (GO:0061136)|synaptic transmission (GO:0007268)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)|synapse (GO:0045202)	cysteine-type endopeptidase activity (GO:0004197)|endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)|tRNA guanylyltransferase activity (GO:0008193)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(2)	11		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				CCAATAATTGTGGATACTATG	0.348																																					p.C415C		.											.	USP14	659	0			c.T1245C						.						105.0	103.0	104.0					18																	210405		2203	4297	6500	SO:0001819	synonymous_variant	9097	exon15			TAATTGTGGATAC	U30888	CCDS32780.1, CCDS32781.1	18p11.32	2006-10-06	2005-08-08			ENSG00000101557		"""Ubiquitin-specific peptidases"""	12612	protein-coding gene	gene with protein product		607274	"""ubiquitin specific protease 14 (tRNA-guanine transglycosylase)"""			12838346	Standard	NM_001037334		Approved	TGT	uc002kkf.1	P54578		ENST00000261601.7:c.1245T>C	18.37:g.210405T>C		100.0	0.0		48.0	4.0	NM_005151	J3QRZ5|Q53XY5	Silent	SNP	ENST00000261601.7	37	CCDS32780.1																																																																																			.		0.348	USP14-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440305.3	NM_005151	
USP15	9958	ucsc.edu;bcgsc.ca	37	12	62783237	62783237	+	Silent	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:62783237A>G	ENST00000280377.5	+	12	1558	c.1500A>G	c.(1498-1500)ggA>ggG	p.G500G	USP15_ENST00000353364.3_Silent_p.G471G|USP15_ENST00000393654.3_Silent_p.G475G	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	500	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		CCAAAATTGGAAACATATTAG	0.313																																					p.G500G	Melanoma(181;615 2041 39364 49691 50001)	.											.	USP15	1084	0			c.A1500G						.						93.0	95.0	94.0					12																	62783237		2203	4300	6503	SO:0001819	synonymous_variant	9958	exon12			AATTGGAAACATA	AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.1500A>G	12.37:g.62783237A>G		55.0	0.0		58.0	6.0	NM_001252078	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Silent	SNP	ENST00000280377.5	37	CCDS58251.1																																																																																			.		0.313	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407831.2	NM_006313	
USP25	29761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	17197365	17197365	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr21:17197365A>G	ENST00000285679.6	+	12	1658	c.1289A>G	c.(1288-1290)cAa>cGa	p.Q430R	USP25_ENST00000400183.2_Missense_Mutation_p.Q430R|USP25_ENST00000285681.2_Missense_Mutation_p.Q430R|USP25_ENST00000351097.5_Intron	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	430	USP.				cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		ACGGTATTACAACAAAGGCTA	0.303																																					p.Q430R		.											.	USP25	663	0			c.A1289G						.						97.0	97.0	97.0					21																	17197365		2203	4300	6503	SO:0001583	missense	29761	exon12			TATTACAACAAAG	AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.1289A>G	21.37:g.17197365A>G	ENSP00000285679:p.Gln430Arg	275.0	0.0		157.0	36.0	NM_013396	C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	ENST00000285679.6	37	CCDS33515.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.0|23.0	4.367884|4.367884	0.82463|0.82463	.|.	.|.	ENSG00000155313|ENSG00000155313	ENST00000453553|ENST00000285681;ENST00000285679;ENST00000400183	.|T;T;T	.|0.74002	.|-0.8;-0.8;-0.8	5.74|5.74	5.74|5.74	0.90152|0.90152	.|Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.|0.106920	.|0.64402	.|D	.|0.000003	D|D	0.82664|0.82664	0.5086|0.5086	L|L	0.52905|0.52905	1.665|1.665	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.71674	.|0.984;0.998;0.982	.|D;D;P	.|0.70487	.|0.917;0.969;0.828	T|T	0.82494|0.82494	-0.0429|-0.0429	5|10	.|0.45353	.|T	.|0.12	.|.	15.3343|15.3343	0.74238|0.74238	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|430;430;430	.|Q9UHP3-3;Q9UHP3-1;Q9UHP3	.|.;.;UBP25_HUMAN	D|R	13|430	.|ENSP00000285681:Q430R;ENSP00000285679:Q430R;ENSP00000383044:Q430R	.|ENSP00000285679:Q430R	N|Q	+|+	1|2	0|0	USP25|USP25	16119236|16119236	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	8.621000|8.621000	0.90949|0.90949	2.330000|2.330000	0.79161|0.79161	0.528000|0.528000	0.53228|0.53228	AAC|CAA	.		0.303	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1		
USP48	84196	ucsc.edu;bcgsc.ca	37	1	22050539	22050539	+	Silent	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:22050539T>C	ENST00000308271.9	-	12	2148	c.1500A>G	c.(1498-1500)gaA>gaG	p.E500E	USP48_ENST00000400301.1_Silent_p.E500E|USP48_ENST00000374732.3_Silent_p.E39E|USP48_ENST00000529637.1_Silent_p.E499E	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	500	DUSP 1. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		TAGGTGTTGATTCATCCAACC	0.403																																					p.E500E		.											.	USP48	659	0			c.A1500G						.						84.0	83.0	83.0					1																	22050539		2203	4300	6503	SO:0001819	synonymous_variant	84196	exon12			TGTTGATTCATCC	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.1500A>G	1.37:g.22050539T>C		50.0	0.0		46.0	4.0	NM_032236	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	ENST00000308271.9	37	CCDS30623.1																																																																																			.		0.403	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
USP5	8078	ucsc.edu;bcgsc.ca	37	12	6970233	6970233	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr12:6970233G>A	ENST00000229268.8	+	12	1513	c.1461G>A	c.(1459-1461)atG>atA	p.M487I	USP5_ENST00000389231.5_Missense_Mutation_p.M487I|USP5_ENST00000541969.1_3'UTR	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	487	USP.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)			breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						ACTACATCATGCAGCTGCCTG	0.532																																					p.M487I		.											.	USP5	659	0			c.G1461A						.						162.0	147.0	152.0					12																	6970233		2203	4300	6503	SO:0001583	missense	8078	exon12			CATCATGCAGCTG	U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.1461G>A	12.37:g.6970233G>A	ENSP00000229268:p.Met487Ile	49.0	0.0		47.0	4.0	NM_003481	D3DUS7|D3DUS8|Q96J22	Missense_Mutation	SNP	ENST00000229268.8	37	CCDS41743.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007776	0.54361	.	.	ENSG00000111667	ENST00000229268;ENST00000389231;ENST00000542087	T;T	0.71341	-0.56;-0.56	5.04	5.04	0.67666	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.137618	0.64402	D	0.000002	T	0.48624	0.1510	N	0.02247	-0.625	0.51012	D	0.999909	B;B	0.10296	0.003;0.003	B;B	0.14023	0.01;0.004	T	0.43032	-0.9416	10	0.28530	T	0.3	-8.3819	18.5776	0.91161	0.0:0.0:1.0:0.0	.	487;487	P45974;P45974-2	UBP5_HUMAN;.	I	487;487;130	ENSP00000229268:M487I;ENSP00000373883:M487I	ENSP00000229268:M487I	M	+	3	0	USP5	6840494	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.290000	0.51755	2.610000	0.88304	0.561000	0.74099	ATG	.		0.532	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402982.1		
VAV1	7409	ucsc.edu;bcgsc.ca	37	19	6825416	6825416	+	Splice_Site	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:6825416A>G	ENST00000602142.1	+	8	908	c.826A>G	c.(826-828)Agg>Ggg	p.R276G	VAV1_ENST00000539284.1_Splice_Site_p.R179G|VAV1_ENST00000596764.1_Splice_Site_p.R244G|VAV1_ENST00000304076.2_Splice_Site_p.R276G|VAV1_ENST00000599806.1_Splice_Site_p.R221G	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	276	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						ATACAAGGAGAGGTGAGACCC	0.562																																					p.R276G		.											VAV1,NS,malignant_melanoma,-1	VAV1	1276	0			c.A826G						.						25.0	25.0	25.0					19																	6825416		2203	4300	6503	SO:0001630	splice_region_variant	7409	exon8			AAGGAGAGGTGAG		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.827+1A>G	19.37:g.6825416A>G		34.0	0.0		35.0	4.0	NM_005428	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.275323	0.80580	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;T	0.62639	0.01;0.01	5.35	5.35	0.76521	Dbl homology (DH) domain (5);	0.216114	0.46758	D	0.000272	T	0.74581	0.3735	M	0.70595	2.14	0.80722	D	1	P;D;D;D	0.69078	0.948;0.967;0.994;0.997	P;P;D;D	0.69142	0.562;0.755;0.962;0.944	T	0.71981	-0.4428	10	0.20046	T	0.44	.	13.2701	0.60155	1.0:0.0:0.0:0.0	.	179;276;221;276	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	G	276;179	ENSP00000302269:R276G;ENSP00000443242:R179G	ENSP00000302269:R276G	R	+	1	2	VAV1	6776416	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	7.751000	0.85126	2.021000	0.59480	0.533000	0.62120	AGG	.		0.562	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		Missense_Mutation
WBP2	23558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	73851333	73851333	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr17:73851333T>C	ENST00000591399.1	-	2	470	c.46A>G	c.(46-48)Aat>Gat	p.N16D	WBP2_ENST00000590450.1_5'UTR|WBP2_ENST00000433525.2_Missense_Mutation_p.N16D|WBP2_ENST00000344296.4_5'UTR|WBP2_ENST00000254806.3_Missense_Mutation_p.N16D|WBP2_ENST00000585462.1_5'UTR|WBP2_ENST00000590221.1_Missense_Mutation_p.N16D			Q969T9	WBP2_HUMAN	WW domain binding protein 2	16	GRAM.				cellular response to estrogen stimulus (GO:0071391)|establishment of protein localization (GO:0045184)|positive regulation of gene expression, epigenetic (GO:0045815)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nuclear chromatin (GO:0000790)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	7			all cancers(21;2.61e-06)|Epithelial(20;2.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			TCGGTGTTATTGACGATCACT	0.577																																					p.N16D		.											.	WBP2	90	0			c.A46G						.						170.0	171.0	170.0					17																	73851333		2203	4300	6503	SO:0001583	missense	23558	exon1			TGTTATTGACGAT	U79458	CCDS11731.1	17q25	2008-02-01				ENSG00000132471			12738	protein-coding gene	gene with protein product		606962				7644498	Standard	NM_012478		Approved	WBP-2	uc002jps.3	Q969T9		ENST00000591399.1:c.46A>G	17.37:g.73851333T>C	ENSP00000467579:p.Asn16Asp	85.0	0.0		105.0	98.0	NM_012478	O95638	Missense_Mutation	SNP	ENST00000591399.1	37	CCDS11731.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.847164	0.91277	.	.	ENSG00000132471	ENST00000254806;ENST00000433525;ENST00000431190;ENST00000416574	D;D	0.88354	-2.37;-2.37	4.21	4.21	0.49690	GRAM (1);	0.117941	0.64402	D	0.000001	D	0.92364	0.7577	L	0.61036	1.89	0.80722	D	1	D;D;D;D	0.76494	0.988;0.999;0.998;0.998	P;D;D;D	0.71414	0.825;0.973;0.963;0.963	D	0.91452	0.5182	10	0.35671	T	0.21	-19.4032	13.7292	0.62776	0.0:0.0:0.0:1.0	.	16;16;16;16	B4DV07;B4DFG2;Q7Z511;Q969T9	.;.;.;WBP2_HUMAN	D	16	ENSP00000254806:N16D;ENSP00000415251:N16D	ENSP00000254806:N16D	N	-	1	0	WBP2	71362928	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.631000	0.54280	1.891000	0.54761	0.460000	0.39030	AAT	.		0.577	WBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448862.1	NM_012478	
CFAP44	55779	ucsc.edu;bcgsc.ca	37	3	113152468	113152468	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr3:113152468A>G	ENST00000295868.2	-	2	206	c.44T>C	c.(43-45)gTt>gCt	p.V15A	WDR52-AS1_ENST00000498480.1_RNA|WDR52_ENST00000393845.2_Missense_Mutation_p.V15A	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						CTTTGATGTAACTGATTTCTC	0.333																																					p.V15A		.											.	WDR52	90	0			c.T44C						.						153.0	150.0	151.0					3																	113152468		2203	4300	6503	SO:0001583	missense	55779	exon2			GATGTAACTGATT																												ENST00000295868.2:c.44T>C	3.37:g.113152468A>G	ENSP00000295868:p.Val15Ala	63.0	0.0		40.0	4.0	NM_001164496		Missense_Mutation	SNP	ENST00000295868.2	37	CCDS2972.1	.	.	.	.	.	.	.	.	.	.	A	3.989	-0.004811	0.07773	.	.	ENSG00000206530	ENST00000393845;ENST00000295868;ENST00000473143	T;T;T	0.48522	2.88;0.96;0.81	3.59	-0.156	0.13391	.	.	.	.	.	T	0.19525	0.0469	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.22277	-1.0221	9	0.11485	T	0.65	.	2.463	0.04546	0.2111:0.2377:0.0:0.5512	.	15	Q96MT7	WDR52_HUMAN	A	15	ENSP00000377428:V15A;ENSP00000295868:V15A;ENSP00000419671:V15A	ENSP00000295868:V15A	V	-	2	0	WDR52	114635158	0.249000	0.23941	0.003000	0.11579	0.191000	0.23601	0.188000	0.17018	-0.022000	0.13986	-1.488000	0.00978	GTT	.		0.333	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354128.3		
WHSC1	7468	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	1957733	1957733	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:1957733A>G	ENST00000382895.3	+	17	3130	c.2699A>G	c.(2698-2700)cAt>cGt	p.H900R	WHSC1_ENST00000508803.1_Missense_Mutation_p.H900R|WHSC1_ENST00000382892.2_Missense_Mutation_p.H900R|WHSC1_ENST00000382891.5_Missense_Mutation_p.H900R|WHSC1_ENST00000482415.2_3'UTR|WHSC1_ENST00000382888.3_Missense_Mutation_p.H248R	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	900	PWWP 2. {ECO:0000255|PROSITE- ProRule:PRU00162}.				anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		GAAGTTTGCCATCCCAAAAAT	0.373			T	IGH@	MM																																p.H900R		.		Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	.	WHSC1	664	0			c.A2699G						.						106.0	127.0	120.0					4																	1957733		2203	4300	6503	SO:0001583	missense	7468	exon15			TTTGCCATCCCAA	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.2699A>G	4.37:g.1957733A>G	ENSP00000372351:p.His900Arg	110.0	0.0		89.0	14.0	NM_133335	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	ENST00000382895.3	37	CCDS33940.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.453864	0.84209	.	.	ENSG00000109685	ENST00000508803;ENST00000382891;ENST00000382892;ENST00000382895;ENST00000382888	T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61	5.53	5.53	0.82687	PWWP (3);	0.000000	0.64402	D	0.000011	T	0.48519	0.1504	L	0.43923	1.385	0.80722	D	1	P;D	0.89917	0.797;1.0	P;D	0.87578	0.716;0.998	T	0.41448	-0.9508	10	0.48119	T	0.1	.	15.9509	0.79835	1.0:0.0:0.0:0.0	.	248;900	A2A2T2;O96028	.;NSD2_HUMAN	R	900;900;900;900;248	ENSP00000423972:H900R;ENSP00000372347:H900R;ENSP00000372348:H900R;ENSP00000372351:H900R;ENSP00000372344:H248R	ENSP00000372344:H248R	H	+	2	0	WHSC1	1927531	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.118000	0.94355	2.225000	0.72522	0.533000	0.62120	CAT	.		0.373	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330	
XIRP2	129446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	168097234	168097234	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr2:168097234G>T	ENST00000409728.1	+	8	1218	c.1129G>T	c.(1129-1131)Gtt>Ttt	p.V377F	XIRP2_ENST00000409043.1_Missense_Mutation_p.V344F|XIRP2_ENST00000409273.1_Missense_Mutation_p.V122F|XIRP2_ENST00000295237.9_Missense_Mutation_p.V344F|XIRP2_ENST00000409756.2_Missense_Mutation_p.V344F|XIRP2_ENST00000409605.1_Missense_Mutation_p.V122F|XIRP2_ENST00000420519.1_Missense_Mutation_p.V377F|XIRP2_ENST00000409195.1_Missense_Mutation_p.V344F	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	169					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TCATCAATATGTTCAAGAAAC	0.348																																					p.V377F		.											.	XIRP2	104	0			c.G1129T						.						119.0	115.0	116.0					2																	168097234		1853	4082	5935	SO:0001583	missense	129446	exon8			CAATATGTTCAAG	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.1129G>T	2.37:g.168097234G>T	ENSP00000386619:p.Val377Phe	184.0	0.0		164.0	71.0	NM_001199143	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409728.1	37	CCDS56143.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468899	0.84533	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237;ENST00000409273;ENST00000409605	T;T;T;T;T;T;T;T	0.78816	-1.21;-1.21;4.1;-1.21;-1.21;4.1;4.11;-1.21	5.81	5.81	0.92471	.	0.325101	0.29321	N	0.012484	D	0.85600	0.5734	M	0.62723	1.935	0.39531	D	0.968665	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;0.998	D;D;D;D;D	0.87578	0.943;0.997;0.998;0.996;0.935	T	0.81300	-0.0995	10	0.15499	T	0.54	-17.2181	17.5701	0.87933	0.0:0.0:1.0:0.0	.	169;344;377;169;122	A4UGR9;A4UGR9-4;A4UGR9-6;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.;.;.	F	344;377;344;344;377;344;122;122	ENSP00000386454:V344F;ENSP00000386619:V377F;ENSP00000386840:V344F;ENSP00000386724:V344F;ENSP00000415541:V377F;ENSP00000295237:V344F;ENSP00000387255:V122F;ENSP00000386981:V122F	ENSP00000295237:V344F	V	+	1	0	XIRP2	167805480	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.927000	0.56499	2.756000	0.94617	0.655000	0.94253	GTT	.		0.348	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381	
YES1	7525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	742994	742994	+	Silent	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:742994T>C	ENST00000584307.1	-	8	1154	c.984A>G	c.(982-984)agA>agG	p.R328R	YES1_ENST00000577961.1_Silent_p.R333R|YES1_ENST00000314574.4_Silent_p.R328R			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	328	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	GTTTATCATGTCTTAATTTTT	0.343																																					p.R328R		.											.	YES1	547	0			c.A984G						.						107.0	105.0	106.0					18																	742994		2202	4300	6502	SO:0001819	synonymous_variant	7525	exon8			ATCATGTCTTAAT	M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.984A>G	18.37:g.742994T>C		184.0	0.0		132.0	69.0	NM_005433	A6NLB3|D3DUH1	Silent	SNP	ENST00000584307.1	37	CCDS11824.1																																																																																			.		0.343	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440827.2	NM_005433	
YES1	7525	ucsc.edu;bcgsc.ca	37	18	747938	747938	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr18:747938T>C	ENST00000584307.1	-	4	622	c.452A>G	c.(451-453)gAt>gGt	p.D151G	YES1_ENST00000577961.1_Missense_Mutation_p.D156G|YES1_ENST00000314574.4_Missense_Mutation_p.D151G			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	151	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	CTGAATGGAATCTGCAGGCGC	0.373																																					p.D151G		.											.	YES1	547	0			c.A452G						.						160.0	150.0	153.0					18																	747938		2203	4300	6503	SO:0001583	missense	7525	exon4			ATGGAATCTGCAG	M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.452A>G	18.37:g.747938T>C	ENSP00000462468:p.Asp151Gly	58.0	0.0		37.0	4.0	NM_005433	A6NLB3|D3DUH1	Missense_Mutation	SNP	ENST00000584307.1	37	CCDS11824.1	.	.	.	.	.	.	.	.	.	.	T	17.90	3.502893	0.64298	.	.	ENSG00000176105	ENST00000359834;ENST00000314574	T	0.42513	0.97	5.64	5.64	0.86602	Src homology-3 domain (2);	0.000000	0.85682	D	0.000000	T	0.41465	0.1160	L	0.51853	1.615	0.80722	D	1	B	0.10296	0.003	B	0.11329	0.006	T	0.24368	-1.0162	10	0.56958	D	0.05	.	16.1432	0.81544	0.0:0.0:0.0:1.0	.	151	P07947	YES_HUMAN	G	151	ENSP00000324740:D151G	ENSP00000324740:D151G	D	-	2	0	YES1	737938	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.893000	0.87330	2.276000	0.75962	0.397000	0.26171	GAT	.		0.373	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440827.2	NM_005433	
YOD1	55432	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207224106	207224106	+	Silent	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr1:207224106G>A	ENST00000315927.4	-	1	316	c.270C>T	c.(268-270)ctC>ctT	p.L90L	YOD1_ENST00000391927.1_Silent_p.L46L|YOD1_ENST00000367084.1_Silent_p.L46L|PFKFB2_ENST00000411990.2_Intron|PFKFB2_ENST00000367080.3_5'Flank|PFKFB2_ENST00000367079.2_5'Flank	NM_018566.3	NP_061036.3	Q5VVQ6	OTU1_HUMAN	YOD1 deubiquitinase	90	UBX-like.			L -> F (in Ref. 1; BAC87233). {ECO:0000305}.	cellular amino acid metabolic process (GO:0006520)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)		Lys48-specific deubiquitinase activity (GO:1990380)|metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			cervix(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(3)	11	Prostate(682;0.19)					GGTATCCGACGAGGATTCGCT	0.627																																					p.L90L		.											.	YOD1	522	0			c.C270T						.						48.0	55.0	52.0					1																	207224106		2203	4299	6502	SO:0001819	synonymous_variant	55432	exon1			TCCGACGAGGATT		CCDS31002.1, CCDS60402.1	1q32.2	2013-06-04	2013-06-04		ENSG00000180667	ENSG00000180667		"""OTU domain containing"""	25035	protein-coding gene	gene with protein product		612023	"""YOD1 OTU deubiquinating enzyme 1 homolog ( yeast)"", ""YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)"""				Standard	NM_001276320		Approved	DKFZp451J1719, OTUD2, DUBA8	uc001hfe.1	Q5VVQ6	OTTHUMG00000036032	ENST00000315927.4:c.270C>T	1.37:g.207224106G>A		68.0	0.0		123.0	11.0	NM_018566	B2RNX3|Q5VVQ5|Q6ZRS6|Q86T63|Q9P1L8	Silent	SNP	ENST00000315927.4	37	CCDS31002.1																																																																																			.		0.627	YOD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087837.1	NM_018566	
ZAN	7455	ucsc.edu;bcgsc.ca	37	7	100391477	100391477	+	RNA	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr7:100391477T>C	ENST00000348028.3	+	0	8016				ZAN_ENST00000443370.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000427578.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ATATCAGAGCTGTATGACACC	0.632																																					.		.											.	ZAN	142	0			.						.						78.0	83.0	82.0					7																	100391477		2042	4194	6236			7455	.			CAGAGCTGTATGA	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100391477T>C		39.0	0.0		25.0	4.0	.	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	T	14.75	2.628218	0.46944	.	.	ENSG00000146839	ENST00000542585	D	0.98264	-4.83	4.67	4.67	0.58626	.	.	.	.	.	D	0.98210	0.9408	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.98693	1.0697	6	0.87932	D	0	.	11.0501	0.47882	0.0:0.0:0.0:1.0	.	.	.	.	R	2629	ENSP00000444427:C2629R	ENSP00000422387:C2608R	C	+	1	0	ZAN	100229413	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	6.438000	0.73426	2.047000	0.60756	0.459000	0.35465	TGT	.		0.632	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
ZCCHC6	79670	ucsc.edu;bcgsc.ca	37	9	88932158	88932158	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:88932158C>A	ENST00000375963.3	-	17	3422	c.3250G>T	c.(3250-3252)Gca>Tca	p.A1084S	ZCCHC6_ENST00000375957.1_Missense_Mutation_p.A22S|ZCCHC6_ENST00000375961.2_Missense_Mutation_p.A1084S|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.A848S|ZCCHC6_ENST00000277141.6_Missense_Mutation_p.A373S	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	1084					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						AGGACTCTTGCTAATTCTTCA	0.348																																					p.A1084S		.											.	ZCCHC6	92	0			c.G3250T						.						90.0	94.0	93.0					9																	88932158		2203	4300	6503	SO:0001583	missense	79670	exon17			CTCTTGCTAATTC	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.3250G>T	9.37:g.88932158C>A	ENSP00000365130:p.Ala1084Ser	37.0	0.0		37.0	4.0	NM_024617	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	37	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239204	0.58995	.	.	ENSG00000083223	ENST00000277141;ENST00000375960;ENST00000375961;ENST00000375957;ENST00000375963	T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86	4.85	3.88	0.44766	.	0.112950	0.64402	D	0.000016	T	0.55386	0.1917	L	0.43646	1.37	0.46564	D	0.999108	B;P;B	0.48503	0.141;0.911;0.086	B;P;B	0.57468	0.028;0.821;0.066	T	0.55636	-0.8110	10	0.51188	T	0.08	-7.4496	14.8473	0.70270	0.144:0.856:0.0:0.0	.	1084;848;1084	Q5VYS8-6;Q5VYS8-4;Q5VYS8	.;.;TUT7_HUMAN	S	373;848;1084;22;1084	ENSP00000277141:A373S;ENSP00000365127:A848S;ENSP00000365128:A1084S;ENSP00000365124:A22S;ENSP00000365130:A1084S	ENSP00000277141:A373S	A	-	1	0	ZCCHC6	88121978	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.926000	0.63433	2.692000	0.91855	0.655000	0.94253	GCA	.		0.348	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
ZBTB6	10773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	125674263	125674263	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr9:125674263T>C	ENST00000373659.3	-	2	177	c.89A>G	c.(88-90)aAt>aGt	p.N30S		NM_006626.5	NP_006617.1	Q15916	ZBTB6_HUMAN	zinc finger and BTB domain containing 6	30					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	11						ACAAAATAAATTCTGCTGTCT	0.388																																					p.N30S		.											.	ZBTB6	90	0			c.A89G						.						104.0	113.0	110.0					9																	125674263		2203	4300	6503	SO:0001583	missense	10773	exon2			AATAAATTCTGCT	X82018	CCDS6846.1	9q33.1-q33.3	2013-01-08	2006-04-10	2006-04-10	ENSG00000186130	ENSG00000186130		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16764	protein-coding gene	gene with protein product		605976	"""zinc finger protein 482"""	ZNF482		7958847	Standard	NM_006626		Approved	ZID	uc004bnh.4	Q15916	OTTHUMG00000020628	ENST00000373659.3:c.89A>G	9.37:g.125674263T>C	ENSP00000362763:p.Asn30Ser	112.0	0.0		65.0	56.0	NM_006626	A8K8N6	Missense_Mutation	SNP	ENST00000373659.3	37	CCDS6846.1	.	.	.	.	.	.	.	.	.	.	T	16.66	3.186360	0.57909	.	.	ENSG00000186130	ENST00000373659	T	0.70399	-0.48	6.17	6.17	0.99709	BTB/POZ (1);BTB/POZ fold (2);	0.141133	0.64402	D	0.000006	T	0.75554	0.3865	L	0.33710	1.025	0.36865	D	0.888606	D	0.53151	0.958	P	0.60012	0.867	T	0.80625	-0.1299	10	0.62326	D	0.03	.	16.0034	0.80327	0.0:0.0:0.0:1.0	.	30	Q15916	ZBTB6_HUMAN	S	30	ENSP00000362763:N30S	ENSP00000362763:N30S	N	-	2	0	ZBTB6	124714084	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.824000	0.55723	2.371000	0.80710	0.533000	0.62120	AAT	.		0.388	ZBTB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053962.1	NM_006626	
ZNF106	64397	ucsc.edu;bcgsc.ca	37	15	42720252	42720252	+	Silent	SNP	T	T	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr15:42720252T>A	ENST00000263805.4	-	12	5219	c.4893A>T	c.(4891-4893)ggA>ggT	p.G1631G	ZNF106_ENST00000565380.1_Silent_p.G859G|ZNF106_ENST00000565611.1_Silent_p.G816G|RNU6-188P_ENST00000364207.1_RNA	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	1631					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CATTTGCCAGTCCCGCATAGA	0.507																																					p.G1631G		.											.	ZFP106	515	0			c.A4893T						.						162.0	129.0	140.0					15																	42720252		2203	4299	6502	SO:0001819	synonymous_variant	64397	exon12			TGCCAGTCCCGCA	AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.4893A>T	15.37:g.42720252T>A		48.0	0.0		43.0	4.0	NM_022473	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Silent	SNP	ENST00000263805.4	37	CCDS32208.1																																																																																			.		0.507	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1	NM_022473	
ZFYVE28	57732	ucsc.edu;bcgsc.ca	37	4	2275874	2275874	+	Silent	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:2275874A>G	ENST00000290974.2	-	9	2460	c.2121T>C	c.(2119-2121)gcT>gcC	p.A707A	ZFYVE28_ENST00000511071.1_Silent_p.A677A|ZFYVE28_ENST00000515312.1_Silent_p.A637A|ZFYVE28_ENST00000508471.1_Silent_p.A12A	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	707					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						CCTGTGGGGCAGCATGCGTGG	0.627																																					p.A707A		.											.	ZFYVE28	93	0			c.T2121C						.						99.0	91.0	94.0					4																	2275874		2203	4300	6503	SO:0001819	synonymous_variant	57732	exon9			TGGGGCAGCATGC	AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.2121T>C	4.37:g.2275874A>G		53.0	0.0		41.0	5.0	NM_020972	B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Silent	SNP	ENST00000290974.2	37	CCDS33942.1																																																																																			.		0.627	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360078.1	XM_035371	
ZNF131	7690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	43161948	43161948	+	Silent	SNP	T	T	C			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr5:43161948T>C	ENST00000399534.1	+	5	1013	c.969T>C	c.(967-969)acT>acC	p.T323T	ZNF131_ENST00000509931.1_Intron|ZNF131_ENST00000505606.2_Silent_p.T289T|ZNF131_ENST00000509634.1_Silent_p.T289T|ZNF131_ENST00000306938.4_Silent_p.T289T|ZNF131_ENST00000509156.1_Silent_p.T323T			P52739	ZN131_HUMAN	zinc finger protein 131	323					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	17						AGCAAAGAACTGGGAAAAAAA	0.368																																					p.T289T		.											.	ZNF131	90	0			c.T867C						.						63.0	59.0	60.0					5																	43161948		1871	4106	5977	SO:0001819	synonymous_variant	7690	exon6			AAGAACTGGGAAA	U09410	CCDS43313.1	5p12	2013-01-09	2006-06-13		ENSG00000172262	ENSG00000172262		"""Zinc fingers, C2H2-type"", ""-"", ""BTB/POZ domain containing"""	12915	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 35"""	604073	"""zinc finger protein 131 (clone pHZ-10)"""				Standard	XM_005248359		Approved	ZBTB35, pHZ-10	uc003jnk.3	P52739	OTTHUMG00000162223	ENST00000399534.1:c.969T>C	5.37:g.43161948T>C		169.0	0.0		145.0	78.0	NM_003432	B4DRL3|Q6PIF0	Silent	SNP	ENST00000399534.1	37																																																																																				.		0.368	ZNF131-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000367982.1	NM_003432	
ZNF577	84765	ucsc.edu;bcgsc.ca	37	19	52375795	52375795	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:52375795A>T	ENST00000301399.5	-	7	1813	c.1448T>A	c.(1447-1449)gTa>gAa	p.V483E	ZNF577_ENST00000420592.1_Missense_Mutation_p.V424E|ZNF577_ENST00000451628.2_Missense_Mutation_p.V424E|ZNF577_ENST00000485702.1_Intron|ZNF577_ENST00000412216.1_Intron	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577	483					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TTATTCTGATACAATATCTGT	0.358																																					p.V483E		.											.	ZNF577	91	0			c.T1448A						.						33.0	33.0	33.0					19																	52375795		2200	4300	6500	SO:0001583	missense	84765	exon7			TCTGATACAATAT	AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.1448T>A	19.37:g.52375795A>T	ENSP00000301399:p.Val483Glu	43.0	0.0		38.0	5.0	NM_032679	A8K0B4|A8K6Z7|C9JFB9	Missense_Mutation	SNP	ENST00000301399.5	37	CCDS12842.2	.	.	.	.	.	.	.	.	.	.	.	9.132	1.011701	0.19277	.	.	ENSG00000161551	ENST00000301399;ENST00000420592;ENST00000451628	T;T;T	0.07216	3.21;3.26;3.26	2.78	-0.531	0.11894	.	.	.	.	.	T	0.05090	0.0136	N	0.22421	0.69	0.09310	N	1	B;B	0.26195	0.089;0.144	B;B	0.23574	0.021;0.047	T	0.39542	-0.9609	9	0.87932	D	0	.	3.1586	0.06512	0.3728:0.0:0.4115:0.2156	.	483;424	Q9BSK1;Q9BSK1-2	ZN577_HUMAN;.	E	483;424;424	ENSP00000301399:V483E;ENSP00000413476:V424E;ENSP00000389652:V424E	ENSP00000301399:V483E	V	-	2	0	ZNF577	57067607	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.237000	0.17985	-0.064000	0.13043	-0.256000	0.11100	GTA	.		0.358	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347243.1	NM_032679	
ZNF534	147658	ucsc.edu;bcgsc.ca	37	19	52941840	52941840	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:52941840A>G	ENST00000332323.6	+	4	1227	c.1166A>G	c.(1165-1167)cAt>cGt	p.H389R	ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000433050.1_Missense_Mutation_p.H376R|ZNF534_ENST00000432303.2_Intron	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	389					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						CGGAAAGTTCATACTGGAGAG	0.438																																					p.H389R		.											.	ZNF534	68	0			c.A1166G						.						89.0	85.0	86.0					19																	52941840		692	1591	2283	SO:0001583	missense	147658	exon4			AAGTTCATACTGG	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.1166A>G	19.37:g.52941840A>G	ENSP00000327538:p.His389Arg	58.0	0.0		41.0	4.0	NM_001143939	Q76KX9	Missense_Mutation	SNP	ENST00000332323.6	37	CCDS46165.1	.	.	.	.	.	.	.	.	.	.	A	12.20	1.867916	0.32977	.	.	ENSG00000198633	ENST00000332323;ENST00000433050;ENST00000391790	T;T	0.67523	-0.27;-0.27	1.8	1.8	0.24995	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.80929	0.4718	M	0.91717	3.235	0.80722	D	1	P;D	0.58620	0.761;0.983	B;D	0.72338	0.283;0.977	T	0.78966	-0.1995	9	0.87932	D	0	.	4.5149	0.11930	0.8211:0.0:0.1789:0.0	.	376;389	Q76KX8-2;Q76KX8	.;ZN534_HUMAN	R	389;376;388	ENSP00000327538:H389R;ENSP00000391358:H376R	ENSP00000327538:H389R	H	+	2	0	ZNF534	57633652	0.960000	0.32886	0.173000	0.22940	0.312000	0.27988	4.233000	0.58651	0.807000	0.34208	0.372000	0.22366	CAT	.		0.438	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512	
ZNF646	9726	ucsc.edu;bcgsc.ca	37	16	31091072	31091072	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr16:31091072G>A	ENST00000394979.2	+	1	3850	c.3427G>A	c.(3427-3429)Ggg>Agg	p.G1143R	ZNF646_ENST00000300850.5_Missense_Mutation_p.G1143R			O15015	ZN646_HUMAN	zinc finger protein 646	1143					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						GGCAGAGGAGGGGCCGGGGCA	0.617																																					p.G1143R		.											.	ZNF646	153	0			c.G3427A						.						30.0	36.0	34.0					16																	31091072		2197	4299	6496	SO:0001583	missense	9726	exon2			GAGGAGGGGCCGG	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.3427G>A	16.37:g.31091072G>A	ENSP00000378429:p.Gly1143Arg	38.0	0.0		34.0	4.0	NM_014699	Q8IVD8	Missense_Mutation	SNP	ENST00000394979.2	37		.	.	.	.	.	.	.	.	.	.	G	12.26	1.883169	0.33255	.	.	ENSG00000167395	ENST00000300850;ENST00000394979	T;T	0.09163	3.01;3.04	5.75	4.8	0.61643	.	.	.	.	.	T	0.10551	0.0258	L	0.29908	0.895	0.09310	N	1	B	0.33212	0.402	B	0.35899	0.213	T	0.21861	-1.0233	9	0.87932	D	0	-8.1242	10.7088	0.45971	0.1539:0.0:0.8461:0.0	.	1143	O15015-2	.	R	1143	ENSP00000300850:G1143R;ENSP00000378429:G1143R	ENSP00000300850:G1143R	G	+	1	0	ZNF646	30998573	0.006000	0.16342	0.006000	0.13384	0.097000	0.18754	1.563000	0.36364	1.436000	0.47453	0.563000	0.77884	GGG	.		0.617	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	NM_014699	
ZNF69	7620	ucsc.edu;bcgsc.ca	37	19	11998759	11998759	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:11998759G>T	ENST00000429654.2	+	1	161	c.21G>T	c.(19-21)agG>agT	p.R7S	ZNF69_ENST00000340180.5_Missense_Mutation_p.R7S			Q9UC07	ZNF69_HUMAN	zinc finger protein 69	7					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|skin(2)	4				Lung(535;0.011)		GTAGTCACAGGAGGTGTAGAG	0.642																																					p.R7S		.											.	ZNF69	91	0			c.G21T						.						82.0	70.0	74.0					19																	11998759		2203	4300	6503	SO:0001583	missense	7620	exon1			TCACAGGAGGTGT	X60076	CCDS32914.1	19p13.2	2013-01-08	2006-05-12		ENSG00000198429	ENSG00000198429		"""Zinc fingers, C2H2-type"", ""-"""	13138	protein-coding gene	gene with protein product		194543	"""zinc finger protein 69 (Cos5)"""			1639391	Standard	NM_021915		Approved	Cos5	uc002mst.4	Q9UC07	OTTHUMG00000156526	ENST00000429654.2:c.21G>T	19.37:g.11998759G>T	ENSP00000402985:p.Arg7Ser	40.0	0.0		37.0	4.0	NM_021915	Q86VA7	Missense_Mutation	SNP	ENST00000429654.2	37		.	.	.	.	.	.	.	.	.	.	g	12.13	1.847038	0.32606	.	.	ENSG00000198429	ENST00000429654;ENST00000445911;ENST00000340180	T;T;T	0.10668	2.85;3.99;4.02	0.618	0.618	0.17624	.	.	.	.	.	T	0.03434	0.0099	N	0.08118	0	0.09310	N	1	B	0.31655	0.334	B	0.18263	0.021	T	0.37314	-0.9711	8	0.05525	T	0.97	.	.	.	.	.	7	C9JR48	.	S	7	ENSP00000402985:R7S;ENSP00000388784:R7S;ENSP00000345333:R7S	ENSP00000345333:R7S	R	+	3	2	ZNF69	11859759	0.005000	0.15991	0.004000	0.12327	0.615000	0.37417	-0.214000	0.09292	0.612000	0.30071	0.205000	0.17691	AGG	.		0.642	ZNF69-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000344082.1	NM_021915	
ZNF671	79891	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58232430	58232430	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr19:58232430C>T	ENST00000317398.6	-	4	1119	c.1024G>A	c.(1024-1026)Gag>Aag	p.E342K	ZNF671_ENST00000335820.3_Missense_Mutation_p.E244K|ZNF671_ENST00000594803.1_5'Flank|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	342					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TCGCTGCACTCGTATGGCCTT	0.468																																					p.E342K		.											.	ZNF671	91	0			c.G1024A						.						90.0	84.0	86.0					19																	58232430		2203	4300	6503	SO:0001583	missense	79891	exon4			TGCACTCGTATGG		CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.1024G>A	19.37:g.58232430C>T	ENSP00000321848:p.Glu342Lys	48.0	0.0		34.0	6.0	NM_024833	A6NF07|Q9H5E9	Missense_Mutation	SNP	ENST00000317398.6	37	CCDS12961.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.652730	0.47362	.	.	ENSG00000083814	ENST00000317398;ENST00000335820	T;T	0.19250	2.16;2.16	1.88	0.688	0.18027	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06096	0.0158	N	0.00621	-1.32	0.09310	N	1	D	0.57257	0.979	P	0.46419	0.516	T	0.08432	-1.0722	9	0.17832	T	0.49	.	3.9278	0.09272	0.2749:0.454:0.2711:0.0	.	342	Q8TAW3	ZN671_HUMAN	K	342;244	ENSP00000321848:E342K;ENSP00000338670:E244K	ENSP00000321848:E342K	E	-	1	0	ZNF671	62924242	0.000000	0.05858	0.769000	0.31535	0.820000	0.46376	-3.818000	0.00358	0.286000	0.22352	0.467000	0.42956	GAG	.		0.468	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466817.1	NM_024833	
ZNF827	152485	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	146859553	146859553	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr4:146859553T>A	ENST00000508784.1	-	1	234	c.7A>T	c.(7-9)Agg>Tgg	p.R3W	ZNF827_ENST00000513320.1_Missense_Mutation_p.R3W|ZNF827_ENST00000379448.4_Missense_Mutation_p.R3W			Q17R98	ZN827_HUMAN	zinc finger protein 827	3					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					TGCTTCCTCCTGGGCATTTTC	0.572																																					p.R3W		.											.	ZNF827	22	0			c.A7T						.						277.0	212.0	234.0					4																	146859553		2203	4300	6503	SO:0001583	missense	152485	exon1			TCCTCCTGGGCAT	AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.7A>T	4.37:g.146859553T>A	ENSP00000421863:p.Arg3Trp	160.0	0.0		96.0	68.0	NM_178835	B7ZL52|Q7Z4S7|Q8N279	Missense_Mutation	SNP	ENST00000508784.1	37		.	.	.	.	.	.	.	.	.	.	t	12.81	2.049397	0.36181	.	.	ENSG00000151612	ENST00000508784;ENST00000513320;ENST00000379448;ENST00000440280	T;T;T	0.09723	2.95;3.14;2.98	4.53	3.29	0.37713	.	0.376195	0.24303	U	0.039706	T	0.16854	0.0405	N	0.19112	0.55	0.42996	D	0.9945	B;D;D	0.76494	0.098;0.999;0.999	B;D;D	0.79784	0.221;0.984;0.993	T	0.02345	-1.1173	10	0.72032	D	0.01	.	9.5955	0.39571	0.0:0.0:0.177:0.823	.	3;3;3	G5E9Z1;Q17R98;Q17R98-2	.;ZN827_HUMAN;.	W	3	ENSP00000421863:R3W;ENSP00000423130:R3W;ENSP00000368761:R3W	ENSP00000368761:R3W	R	-	1	2	ZNF827	147079003	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.285000	0.65633	0.673000	0.31224	0.228000	0.17796	AGG	.		0.572	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000364654.2	NM_178835	
ZNF831	128611	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	20	57767023	57767023	+	Silent	SNP	C	C	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr20:57767023C>A	ENST00000371030.2	+	1	949	c.949C>A	c.(949-951)Cgg>Agg	p.R317R		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	317							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CGCCCTGCAGCGGCAGCAGGC	0.711																																					p.R317R		.											.	ZNF831	126	0			c.C949A						.						13.0	16.0	15.0					20																	57767023		1691	3870	5561	SO:0001819	synonymous_variant	128611	exon1			CTGCAGCGGCAGC	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.949C>A	20.37:g.57767023C>A		19.0	0.0		16.0	10.0	NM_178457	Q5TDR4|Q8TCP0	Silent	SNP	ENST00000371030.2	37	CCDS42894.1																																																																																			.		0.711	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
ZSWIM8	23053	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	75548453	75548453	+	Silent	SNP	G	G	A			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr10:75548453G>A	ENST00000605216.1	+	2	451	c.234G>A	c.(232-234)gaG>gaA	p.E78E	ZSWIM8_ENST00000603114.1_Silent_p.E78E|ZSWIM8_ENST00000604729.1_Silent_p.E78E|ZSWIM8_ENST00000604524.1_Silent_p.E78E|ZSWIM8_ENST00000398706.2_Silent_p.E78E	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	78							zinc ion binding (GO:0008270)										CATTGGTGGAGCTGTCAGCAA	0.483																																					p.E78E		.											.	.	.	0			c.G234A						.						82.0	79.0	80.0					10																	75548453		1992	4162	6154	SO:0001819	synonymous_variant	23053	exon2			GGTGGAGCTGTCA	BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.234G>A	10.37:g.75548453G>A		58.0	0.0		44.0	6.0	NM_015037	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Silent	SNP	ENST00000605216.1	37		.	.	.	.	.	.	.	.	.	.	G	6.992	0.553182	0.13374	.	.	ENSG00000214655	ENST00000446546	.	.	.	5.86	4.95	0.65309	.	.	.	.	.	T	0.60340	0.2261	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58797	-0.7573	4	.	.	.	.	9.5091	0.39065	0.2001:0.0:0.7999:0.0	.	.	.	.	N	163	.	.	S	+	2	0	KIAA0913	75218459	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.266000	0.65525	1.473000	0.48159	0.655000	0.94253	AGC	.		0.483	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1	NM_001242487	
CRIP3	401262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	43274045	43274046	+	Missense_Mutation	DNP	TT	TT	AC			TCGA-G3-A25S-01A-11D-A16V-10	TCGA-G3-A25S-10A-01D-A16V-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c05adc19-2e01-4712-a35a-69eee4d40998	084d16c3-f0e8-4cc5-b2a9-cb055fd6ebe5	g.chr6:43274045_43274046TT>AC	ENST00000274990.4	-	6	410_411	c.406_407AA>GT	c.(406-408)AAg>GTg	p.K136V	ZNF318_ENST00000607252.1_5'Flank|CRIP3_ENST00000372569.3_Missense_Mutation_p.K136V			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	136	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			TGACATCACCTTCTCAGCTGGT	0.569																																					p.K136V		.											.	.	.	0			.						.																																			SO:0001583	missense	401262	.			ATCACCTTCTCAG	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.406_407delinsAC	6.37:g.43274045_43274046delinsAC	ENSP00000274990:p.Lys136Val	43.0	0.0		51.0	47.0	.	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Missense_Mutation	DNP	ENST00000274990.4	37																																																																																				.		0.569	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1		
