#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
A2M	2	ucsc.edu;bcgsc.ca	37	12	9225057	9225057	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:9225057G>T	ENST00000318602.7	-	31	4308	c.4001C>A	c.(4000-4002)cCa>cAa	p.P1334Q		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	1334					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	TTCCTTTTCTGGGAGAATATT	0.438																																					p.P1334Q		.											.	A2M	515	0			c.C4001A						.						96.0	93.0	94.0					12																	9225057		1955	4181	6136	SO:0001583	missense	2	exon31			TTTTCTGGGAGAA	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.4001C>A	12.37:g.9225057G>T	ENSP00000323929:p.Pro1334Gln	49.0	0.0		45.0	4.0	NM_000014	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	37	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308747	0.60305	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.31510	1.49	5.99	4.92	0.64577	.	0.540373	0.19136	N	0.121811	T	0.50154	0.1599	M	0.78801	2.425	0.09310	N	1	D	0.56968	0.978	P	0.55871	0.786	T	0.44159	-0.9346	10	0.45353	T	0.12	.	14.8468	0.70267	0.0812:0.0:0.9188:0.0	.	1334	P01023	A2MG_HUMAN	Q	1334;1349	ENSP00000323929:P1334Q	ENSP00000323929:P1334Q	P	-	2	0	A2M	9116324	0.998000	0.40836	0.490000	0.27465	0.683000	0.39861	2.735000	0.47377	2.840000	0.97914	0.655000	0.94253	CCA	.		0.438	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	
ACOX3	8310	ucsc.edu;bcgsc.ca	37	4	8372711	8372711	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr4:8372711T>C	ENST00000356406.5	-	17	1984	c.1907A>G	c.(1906-1908)gAt>gGt	p.D636G	ACOX3_ENST00000515797.1_5'UTR|ACOX3_ENST00000503233.1_Missense_Mutation_p.D636G|ACOX3_ENST00000413009.2_Silent_p.R613R	NM_003501.2	NP_003492.2	O15254	ACOX3_HUMAN	acyl-CoA oxidase 3, pristanoyl	636					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(17)|prostate(1)|skin(3)|stomach(1)	42						GGCAACTGCATCGTCTTTCAG	0.567																																					p.D636G		.											.	ACOX3	90	0			c.A1907G						.						112.0	97.0	102.0					4																	8372711		2203	4300	6503	SO:0001583	missense	8310	exon17			ACTGCATCGTCTT	Y11411	CCDS3401.1, CCDS47017.1	4p15.3	2010-04-30	2010-04-30		ENSG00000087008	ENSG00000087008	1.3.3.6		121	protein-coding gene	gene with protein product		603402	"""acyl-Coenzyme A oxidase 3, pristanoyl"""			9271077	Standard	NM_003501		Approved		uc003glc.4	O15254	OTTHUMG00000090509	ENST00000356406.5:c.1907A>G	4.37:g.8372711T>C	ENSP00000348775:p.Asp636Gly	25.0	0.0		33.0	4.0	NM_003501	Q96AJ8	Missense_Mutation	SNP	ENST00000356406.5	37	CCDS3401.1	.	.	.	.	.	.	.	.	.	.	T	15.27	2.785231	0.49997	.	.	ENSG00000087008	ENST00000356406;ENST00000503233	T;T	0.47528	0.84;0.84	4.88	4.88	0.63580	Acyl-CoA oxidase, C-terminal (1);Acyl-CoA dehydrogenase/oxidase C-terminal (2);	0.063541	0.64402	N	0.000010	T	0.65657	0.2712	.	.	.	0.58432	D	0.999992	D	0.60575	0.988	D	0.66979	0.948	T	0.68428	-0.5411	9	0.52906	T	0.07	-28.6616	12.4082	0.55451	0.0:0.0:0.0:1.0	.	636	O15254	ACOX3_HUMAN	G	636	ENSP00000348775:D636G;ENSP00000421625:D636G	ENSP00000348775:D636G	D	-	2	0	ACOX3	8423611	1.000000	0.71417	0.153000	0.22517	0.259000	0.26198	5.696000	0.68287	1.804000	0.52760	0.448000	0.29417	GAT	.		0.567	ACOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206997.4		
ACTR8	93973	ucsc.edu;bcgsc.ca	37	3	53905467	53905467	+	Silent	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:53905467C>T	ENST00000335754.3	-	11	1459	c.1359G>A	c.(1357-1359)ggG>ggA	p.G453G	ACTR8_ENST00000231909.7_Silent_p.G158G|ACTR8_ENST00000488802.1_5'Flank|ACTR8_ENST00000482349.1_Silent_p.G342G	NM_022899.4	NP_075050.3	Q9H981	ARP8_HUMAN	ARP8 actin-related protein 8 homolog (yeast)	453					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	ATP binding (GO:0005524)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		CACGAAGATCCCCTTCAAATC	0.468																																					p.G453G		.											.	ACTR8	91	0			c.G1359A						.						75.0	77.0	77.0					3																	53905467		2203	4300	6503	SO:0001819	synonymous_variant	93973	exon11			AAGATCCCCTTCA		CCDS2875.1	3p21.31	2011-07-06	2001-11-28		ENSG00000113812	ENSG00000113812		"""INO80 complex subunits"""	14672	protein-coding gene	gene with protein product	"""INO80 complex subunit N"""		"""ARP8 (actin-related protein 8, yeast) homolog"""			18163988, 16230350	Standard	NM_022899		Approved	INO80N	uc003dhd.3	Q9H981	OTTHUMG00000158279	ENST00000335754.3:c.1359G>A	3.37:g.53905467C>T		38.0	1.0		42.0	4.0	NM_022899	B3KSW7|Q8N566|Q9H663	Silent	SNP	ENST00000335754.3	37	CCDS2875.1	.	.	.	.	.	.	.	.	.	.	C	8.309	0.821671	0.16678	.	.	ENSG00000113812	ENST00000486794	D	0.96745	-4.11	5.84	-0.546	0.11840	.	0.053361	0.85682	D	0.000000	D	0.85362	0.5679	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.75510	-0.3292	7	0.02654	T	1	-3.4378	2.262	0.04069	0.1035:0.3228:0.2925:0.2812	.	.	.	.	E	207	ENSP00000417230:G207E	ENSP00000417230:G207E	G	-	2	0	ACTR8	53880507	0.030000	0.19436	0.999000	0.59377	0.948000	0.59901	-0.922000	0.04004	0.110000	0.17919	-2.079000	0.00380	GGG	.		0.468	ACTR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350562.2	NM_022899	
ADAM32	203102	ucsc.edu;bcgsc.ca	37	8	39022715	39022715	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr8:39022715T>C	ENST00000379907.4	+	9	960	c.833T>C	c.(832-834)aTt>aCt	p.I278T	ADAM32_ENST00000437682.2_Splice_Site_p.I285T|ADAM32_ENST00000519315.1_Splice_Site_p.I278T	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	278	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			TATCTACTAATGTAAGAATAA	0.294																																					p.I278T		.											.	ADAM32	227	0			c.T833C						.						43.0	40.0	41.0					8																	39022715		1802	4057	5859	SO:0001630	splice_region_variant	203102	exon9			TACTAATGTAAGA	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.833+1T>C	8.37:g.39022715T>C		32.0	0.0		34.0	4.0	NM_145004	Q8TC42	Missense_Mutation	SNP	ENST00000379907.4	37	CCDS47846.1	.	.	.	.	.	.	.	.	.	.	T	18.01	3.527560	0.64860	.	.	ENSG00000197140	ENST00000437682;ENST00000519315;ENST00000379907	T;T;T	0.61392	0.11;0.11;3.37	4.91	4.91	0.64330	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.498696	0.14922	N	0.290625	T	0.51805	0.1696	N	0.20845	0.615	0.41043	D	0.985249	P;B;P	0.38745	0.588;0.132;0.645	P;B;P	0.51055	0.657;0.326;0.542	T	0.35624	-0.9781	10	0.10636	T	0.68	.	11.2227	0.48864	0.0:0.0:0.0:1.0	.	285;278;278	E7EPX8;E7ER82;Q8TC27	.;.;ADA32_HUMAN	T	285;278;278	ENSP00000405978:I285T;ENSP00000429422:I278T;ENSP00000369238:I278T	ENSP00000369238:I278T	I	+	2	0	ADAM32	39141872	0.998000	0.40836	0.998000	0.56505	0.804000	0.45430	1.808000	0.38912	1.956000	0.56807	0.459000	0.35465	ATT	.		0.294	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004	Missense_Mutation
ADCY5	111	ucsc.edu;bcgsc.ca	37	3	123018993	123018993	+	Silent	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:123018993G>T	ENST00000462833.1	-	15	4086	c.2874C>A	c.(2872-2874)gcC>gcA	p.A958A	ADCY5_ENST00000491190.1_Silent_p.A591A|ADCY5_ENST00000309879.5_Silent_p.A608A	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	958					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CCAGCAGGTCGGCGTTGTCGA	0.607																																					p.A958A		.											.	ADCY5	94	0			c.C2874A						.						139.0	108.0	118.0					3																	123018993		2203	4300	6503	SO:0001819	synonymous_variant	111	exon15			CAGGTCGGCGTTG	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.2874C>A	3.37:g.123018993G>T		34.0	0.0		42.0	4.0	NM_183357	B7Z8A6|Q7RTV7|Q8NFM3	Silent	SNP	ENST00000462833.1	37	CCDS3022.1																																																																																			.		0.607	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
AKR1D1	6718	ucsc.edu;bcgsc.ca	37	7	137773383	137773383	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:137773383G>A	ENST00000242375.3	+	2	172	c.130G>A	c.(130-132)Gct>Act	p.A44T	AKR1D1_ENST00000468877.2_Intron|AKR1D1_ENST00000432161.1_Missense_Mutation_p.A44T|RN7SKP223_ENST00000410582.1_RNA|AKR1D1_ENST00000411726.2_Missense_Mutation_p.A44T	NM_005989.3	NP_005980.1	P51857	AK1D1_HUMAN	aldo-keto reductase family 1, member D1	44					androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|C21-steroid hormone metabolic process (GO:0008207)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|steroid binding (GO:0005496)			endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	23					Azelaic Acid(DB00548)|Finasteride(DB01216)	GGTGAAGGTTGCTATTGACAC	0.458																																					p.A44T		.											.	AKR1D1	91	0			c.G130A						.						108.0	92.0	98.0					7																	137773383		2203	4300	6503	SO:0001583	missense	6718	exon2			AAGGTTGCTATTG	Z28339	CCDS5846.1, CCDS55169.1, CCDS55170.1	7q32-q33	2012-12-04	2012-12-04		ENSG00000122787	ENSG00000122787	1.3.99.6	"""Aldo-keto reductases"""	388	protein-coding gene	gene with protein product	"""delta 4-3-ketosteroid-5-beta-reductase"""	604741	"""aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)"""	SRD5B1		7508385, 10343119	Standard	NM_005989		Approved		uc003vtz.3	P51857	OTTHUMG00000155787	ENST00000242375.3:c.130G>A	7.37:g.137773383G>A	ENSP00000242375:p.Ala44Thr	34.0	0.0		47.0	4.0	NM_001190907	A1L4P6|A8K060|B4DPN3|B4DPN8	Missense_Mutation	SNP	ENST00000242375.3	37	CCDS5846.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.979356	0.74360	.	.	ENSG00000122787	ENST00000432161;ENST00000411726;ENST00000242375	T;T;T	0.41065	1.01;1.01;1.01	5.3	5.3	0.74995	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.77260	0.4104	H	0.97340	3.985	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.85208	0.1019	10	0.87932	D	0	.	16.4942	0.84223	0.0:0.0:1.0:0.0	.	44;44;44	B4DPN8;B4DPN3;P51857	.;.;AK1D1_HUMAN	T	44	ENSP00000389197:A44T;ENSP00000402374:A44T;ENSP00000242375:A44T	ENSP00000242375:A44T	A	+	1	0	AKR1D1	137423923	1.000000	0.71417	0.549000	0.28204	0.185000	0.23345	8.458000	0.90364	2.747000	0.94245	0.650000	0.86243	GCT	.		0.458	AKR1D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341637.1	NM_005989	
ALDOB	229	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	104192169	104192169	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr9:104192169G>T	ENST00000374855.4	-	3	316	c.192C>A	c.(190-192)ttC>ttA	p.F64L	ALDOB_ENST00000468981.3_5'Flank	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	64					carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				TGTCCACAGAGAAGAGGATTT	0.552																																					p.F64L		.											.	ALDOB	226	0			c.C192A						.						148.0	143.0	145.0					9																	104192169		2203	4300	6503	SO:0001583	missense	229	exon3			CACAGAGAAGAGG	X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.192C>A	9.37:g.104192169G>T	ENSP00000363988:p.Phe64Leu	126.0	0.0		134.0	33.0	NM_000035	Q13741|Q13742|Q5T7D6	Missense_Mutation	SNP	ENST00000374855.4	37	CCDS6756.1	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429806	0.62844	.	.	ENSG00000136872	ENST00000374855;ENST00000430164	D	0.86694	-2.16	5.94	3.1	0.35709	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	T	0.81823	0.4904	L	0.39397	1.21	0.80722	D	1	B	0.21688	0.059	B	0.30401	0.115	T	0.75991	-0.3122	10	0.42905	T	0.14	-16.4465	9.6782	0.40054	0.2252:0.0:0.7748:0.0	.	64	P05062	ALDOB_HUMAN	L	64	ENSP00000363988:F64L	ENSP00000363988:F64L	F	-	3	2	ALDOB	103231990	1.000000	0.71417	0.878000	0.34440	0.935000	0.57460	4.157000	0.58144	0.832000	0.34804	0.650000	0.86243	TTC	.		0.552	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053434.2		
AMZ1	155185	ucsc.edu;bcgsc.ca	37	7	2748347	2748347	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:2748347C>A	ENST00000312371.4	+	4	966	c.598C>A	c.(598-600)Cac>Aac	p.H200N	AMZ1_ENST00000489665.1_3'UTR|AMZ1_ENST00000407112.1_Missense_Mutation_p.H200N	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	200							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		CCTTCCAGGGCACGGTGAGCC	0.647																																					p.H200N		.											.	AMZ1	90	0			c.C598A						.						66.0	59.0	61.0					7																	2748347		2202	4300	6502	SO:0001583	missense	155185	exon4			CCAGGGCACGGTG	AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.598C>A	7.37:g.2748347C>A	ENSP00000308149:p.His200Asn	22.0	0.0		27.0	4.0	NM_133463	B3KRS0|Q8TF51	Missense_Mutation	SNP	ENST00000312371.4	37	CCDS34589.1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.433830	0.62955	.	.	ENSG00000174945	ENST00000312371;ENST00000407112	T;T	0.39997	1.05;1.37	4.29	4.29	0.51040	.	0.220674	0.39020	N	0.001487	T	0.35393	0.0930	L	0.54323	1.7	0.25926	N	0.983055	P;B	0.36535	0.557;0.421	B;B	0.33620	0.167;0.073	T	0.22452	-1.0216	10	0.21014	T	0.42	-17.4768	12.9437	0.58362	0.0:0.8368:0.1632:0.0	.	200;200	B3KRS0;Q400G9	.;AMZ1_HUMAN	N	200	ENSP00000308149:H200N;ENSP00000386020:H200N	ENSP00000308149:H200N	H	+	1	0	AMZ1	2714873	1.000000	0.71417	0.987000	0.45799	0.758000	0.43043	2.188000	0.42612	2.078000	0.62432	0.462000	0.41574	CAC	.		0.647	AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325244.1	NM_133463	
APOB	338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	21235442	21235442	+	Nonsense_Mutation	SNP	G	G	T	rs200708197		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:21235442G>T	ENST00000233242.1	-	26	4425	c.4298C>A	c.(4297-4299)tCg>tAg	p.S1433*		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1433					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.S1433L(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTGATATTCGAATCTAGAAA	0.368																																					p.S1433X		.											.	APOB	175	1	Substitution - Missense(1)	large_intestine(1)	c.C4298A						.						83.0	88.0	86.0					2																	21235442		2202	4300	6502	SO:0001587	stop_gained	338	exon26			ATATTCGAATCTA	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4298C>A	2.37:g.21235442G>T	ENSP00000233242:p.Ser1433*	73.0	0.0		73.0	20.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Nonsense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	45	11.530493	0.99572	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	.	.	.	5.88	5.88	0.94601	.	0.000000	0.56097	D	0.000037	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.2422	0.98381	0.0:0.0:1.0:0.0	.	.	.	.	X	1433	.	ENSP00000233242:S1433X	S	-	2	0	APOB	21088947	1.000000	0.71417	0.987000	0.45799	0.931000	0.56810	8.712000	0.91403	2.782000	0.95742	0.655000	0.94253	TCG	G|0.999;A|0.001		0.368	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ARHGAP31	57514	ucsc.edu;bcgsc.ca	37	3	119133643	119133643	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:119133643A>G	ENST00000264245.4	+	12	3399	c.2867A>G	c.(2866-2868)gAt>gGt	p.D956G		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	956					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						CATTCTCTAGATAGCAAACCC	0.557																																					p.D956G	Pancreas(7;176 297 5394 51128 51241)	.											.	ARHGAP31	92	0			c.A2867G						.						140.0	136.0	137.0					3																	119133643		1893	4131	6024	SO:0001583	missense	57514	exon12			CTCTAGATAGCAA		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2867A>G	3.37:g.119133643A>G	ENSP00000264245:p.Asp956Gly	22.0	0.0		25.0	4.0	NM_020754	Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	37	CCDS43135.1	.	.	.	.	.	.	.	.	.	.	A	12.27	1.888707	0.33348	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.12774	2.65	4.74	4.74	0.60224	.	0.000000	0.56097	D	0.000031	T	0.26231	0.0640	L	0.34521	1.04	0.50467	D	0.999871	D	0.89917	1.0	D	0.80764	0.994	T	0.01935	-1.1244	10	0.87932	D	0	.	13.5597	0.61782	1.0:0.0:0.0:0.0	.	956	Q2M1Z3	RHG31_HUMAN	G	956	ENSP00000264245:D956G	ENSP00000264245:D956G	D	+	2	0	ARHGAP31	120616333	1.000000	0.71417	0.203000	0.23512	0.192000	0.23643	6.207000	0.72159	1.979000	0.57680	0.379000	0.24179	GAT	.		0.557	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2		
ARHGEF10L	55160	ucsc.edu;bcgsc.ca	37	1	17981129	17981129	+	Splice_Site	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:17981129A>G	ENST00000361221.3	+	23	2553		c.e23-1		ARHGEF10L_ENST00000167825.4_Splice_Site|ARHGEF10L_ENST00000452522.1_Splice_Site|ARHGEF10L_ENST00000375408.3_Splice_Site|ARHGEF10L_ENST00000375415.1_Splice_Site|ARHGEF10L_ENST00000469726.1_Splice_Site|ARHGEF10L_ENST00000434513.1_Splice_Site	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like							cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		CTGTCTCTGCAGCTTGGGGCC	0.562																																					.		.											.	ARHGEF10L	292	0			c.2395-2A>G						.						233.0	228.0	230.0					1																	17981129		2203	4300	6503	SO:0001630	splice_region_variant	55160	exon23			CTCTGCAGCTTGG	AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.2395-1A>G	1.37:g.17981129A>G		52.0	0.0		45.0	5.0	NM_018125	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Splice_Site	SNP	ENST00000361221.3	37	CCDS182.1	.	.	.	.	.	.	.	.	.	.	A	18.85	3.710439	0.68730	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375408;ENST00000457829;ENST00000167825	.	.	.	4.49	4.49	0.54785	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7167	0.51657	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGEF10L	17853716	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	7.447000	0.80620	1.664000	0.50801	0.459000	0.35465	.	.		0.562	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125	Intron
ASZ1	136991	ucsc.edu;bcgsc.ca	37	7	117060227	117060227	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:117060227C>A	ENST00000284629.2	-	4	492	c.430G>T	c.(430-432)Gtt>Ttt	p.V144F		NM_130768.2	NP_570124.1			ankyrin repeat, SAM and basic leucine zipper domain containing 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(3)|skin(1)	24	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			CTACAAGCAACATTTGGATCA	0.328																																					p.V144F		.											.	ASZ1	515	0			c.G430T						.						100.0	99.0	99.0					7																	117060227		2203	4300	6503	SO:0001583	missense	136991	exon4			AAGCAACATTTGG	AF461259	CCDS5772.1	7q31.2	2013-01-10	2005-03-15	2004-07-16	ENSG00000154438	ENSG00000154438		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	1350	protein-coding gene	gene with protein product		605797	"""ankyrin-like 1"""	C7orf7, ANKL1		12040005, 11279520	Standard	NM_130768		Approved	Orf3, GASZ, ALP1, CT1.19	uc003vjb.2	Q8WWH4	OTTHUMG00000064565	ENST00000284629.2:c.430G>T	7.37:g.117060227C>A	ENSP00000284629:p.Val144Phe	23.0	0.0		18.0	4.0	NM_130768		Missense_Mutation	SNP	ENST00000284629.2	37	CCDS5772.1	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747230	0.49257	.	.	ENSG00000154438	ENST00000284629	T	0.72051	-0.62	5.9	4.07	0.47477	Ankyrin repeat-containing domain (4);	0.529127	0.20743	N	0.086490	T	0.61813	0.2377	L	0.41079	1.255	0.37249	D	0.90647	P;P	0.41393	0.748;0.748	B;B	0.40410	0.328;0.328	T	0.66244	-0.5972	10	0.66056	D	0.02	0.0055	9.4602	0.38781	0.0:0.7763:0.0:0.2237	.	144;144	B7ZM20;Q8WWH4	.;ASZ1_HUMAN	F	144	ENSP00000284629:V144F	ENSP00000284629:V144F	V	-	1	0	ASZ1	116847463	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.652000	0.24888	0.820000	0.34516	0.552000	0.68991	GTT	.		0.328	ASZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000138907.7	NM_130768	
ATP8B3	148229	broad.mit.edu;bcgsc.ca	37	19	1807173	1807173	+	Silent	SNP	G	G	A	rs367593614		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr19:1807173G>A	ENST00000310127.6	-	6	847	c.609C>T	c.(607-609)gaC>gaT	p.D203D	ATP8B3_ENST00000525591.1_Silent_p.D150D|ATP8B3_ENST00000526092.2_Silent_p.D150D|ATP8B3_ENST00000539485.1_Silent_p.D203D	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	203					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCACCATGTCGTCCACCAGGT	0.662																																					p.D203D		.											.	.	.	0			c.C609T						.	G	,	0,4312		0,0,2156	118.0	134.0	128.0		450,609	-4.8	0.6	19		128	1,8495		0,1,4247	no	coding-synonymous,coding-synonymous	ATP8B3	NM_001178002.1,NM_138813.2	,	0,1,6403	AA,AG,GG		0.0118,0.0,0.0078	,	150/1264,203/1301	1807173	1,12807	2156	4248	6404	SO:0001819	synonymous_variant	148229	exon6			CATGTCGTCCACC	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.609C>T	19.37:g.1807173G>A		46.0	0.0		58.0	7.0	NM_138813	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Silent	SNP	ENST00000310127.6	37	CCDS45901.1	.	.	.	.	.	.	.	.	.	.	g	0.956	-0.704895	0.03255	0.0	1.18E-4	ENSG00000130270	ENST00000533993	.	.	.	3.9	-4.76	0.03229	.	.	.	.	.	T	0.55816	0.1944	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57631	-0.7778	4	.	.	.	.	12.5956	0.56468	0.8206:0.0:0.1794:0.0	.	.	.	.	M	166	.	.	T	-	2	0	ATP8B3	1758173	0.006000	0.16342	0.612000	0.29024	0.042000	0.13812	-0.950000	0.03889	-0.786000	0.04516	-0.254000	0.11334	ACG	.		0.662	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813	
ATP4A	495	ucsc.edu;bcgsc.ca	37	19	36049328	36049328	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr19:36049328A>G	ENST00000262623.3	-	10	1464	c.1436T>C	c.(1435-1437)aTg>aCg	p.M479T		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	479					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	CCGGTAGCCCATGGCGTTGCC	0.667																																					p.M479T		.											.	ATP4A	91	0			c.T1436C						.						38.0	45.0	43.0					19																	36049328		2203	4300	6503	SO:0001583	missense	495	exon10			TAGCCCATGGCGT		CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.1436T>C	19.37:g.36049328A>G	ENSP00000262623:p.Met479Thr	43.0	0.0		43.0	5.0	NM_000704	O00738	Missense_Mutation	SNP	ENST00000262623.3	37	CCDS12467.1	.	.	.	.	.	.	.	.	.	.	A	8.542	0.873404	0.17322	.	.	ENSG00000105675	ENST00000262623	D	0.95821	-3.82	4.07	4.07	0.47477	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.164731	0.38959	N	0.001508	D	0.83797	0.5332	N	0.01874	-0.695	0.32857	D	0.507479	B	0.10296	0.003	B	0.22753	0.041	T	0.79754	-0.1670	10	0.14656	T	0.56	.	6.7522	0.23493	0.7907:0.0:0.0:0.2093	.	479	P20648	ATP4A_HUMAN	T	479	ENSP00000262623:M479T	ENSP00000262623:M479T	M	-	2	0	ATP4A	40741168	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.108000	0.41854	1.713000	0.51359	0.379000	0.24179	ATG	.		0.667	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	
BCL6B	255877	ucsc.edu;bcgsc.ca	37	17	6927950	6927950	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr17:6927950G>T	ENST00000293805.5	+	4	724	c.632G>T	c.(631-633)aGc>aTc	p.S211I		NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	211					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			skin(1)	1						CAAGCAGGGAGCCTGGTCGGG	0.617																																					p.S211I		.											.	BCL6B	227	0			c.G632T						.						68.0	80.0	76.0					17																	6927950		2006	4170	6176	SO:0001583	missense	255877	exon4			CAGGGAGCCTGGT	AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	ENST00000293805.5:c.632G>T	17.37:g.6927950G>T	ENSP00000293805:p.Ser211Ile	39.0	0.0		29.0	4.0	NM_181844	Q6PCB4	Missense_Mutation	SNP	ENST00000293805.5	37	CCDS42248.1	.	.	.	.	.	.	.	.	.	.	G	10.32	1.317630	0.23994	.	.	ENSG00000161940	ENST00000293805	T	0.08807	3.05	5.44	3.38	0.38709	.	0.445685	0.27052	N	0.021173	T	0.04137	0.0115	N	0.08118	0	0.29291	N	0.86936	B	0.12630	0.006	B	0.10450	0.005	T	0.30031	-0.9992	10	0.23891	T	0.37	.	9.1745	0.37102	0.0864:0.1592:0.7544:0.0	.	211	Q8N143	BCL6B_HUMAN	I	211	ENSP00000293805:S211I	ENSP00000293805:S211I	S	+	2	0	BCL6B	6868674	.	.	0.993000	0.49108	0.090000	0.18270	.	.	1.533000	0.49186	0.655000	0.94253	AGC	.		0.617	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439455.2	NM_181844	
BEST1	7439	hgsc.bcm.edu;broad.mit.edu	37	11	61723374	61723376	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	CAC	CAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:61723374_61723376delCAC	ENST00000378043.4	+	4	1075_1077	c.432_434delCAC	c.(430-435)agcacc>agc	p.T145del	BEST1_ENST00000534553.1_In_Frame_Del_p.T39del|BEST1_ENST00000526988.1_In_Frame_Del_p.T39del|BEST1_ENST00000378042.3_In_Frame_Del_p.T85del|BEST1_ENST00000301774.9_5'UTR|BEST1_ENST00000435278.2_In_Frame_Del_p.T145del|BEST1_ENST00000449131.2_In_Frame_Del_p.T85del	NM_004183.3	NP_004174.1	O76090	BEST1_HUMAN	bestrophin 1	145					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|detection of light stimulus involved in visual perception (GO:0050908)|ion transmembrane transport (GO:0034220)|regulation of calcium ion transport (GO:0051924)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	basolateral plasma membrane (GO:0016323)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|urinary_tract(2)	25						GCAGCGTCAGCACCGCAGTCTAC	0.695																																					p.144_145del		.											.	BEST1	90	0			c.432_434del						.																																			SO:0001651	inframe_deletion	7439	exon4			CGTCAGCACCGCA	AF057170	CCDS31580.1, CCDS44623.1	11q12	2013-02-14	2006-10-18	2006-10-18	ENSG00000167995	ENSG00000167995		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	12703	protein-coding gene	gene with protein product	"""Best disease"""	607854	"""vitelliform macular dystrophy 2"""	VMD2		1302019, 17003041	Standard	NM_004183		Approved	BMD, BEST, RP50	uc001nsr.2	O76090	OTTHUMG00000167469	ENST00000378043.4:c.432_434delCAC	11.37:g.61723374_61723376delCAC	ENSP00000367282:p.Thr145del	25.0	0.0		35.0	13.0	NM_004183	A8K0W6|B7Z3J8|B7Z736|O75904|Q53YQ9|Q8IUR9|Q8IZ80	In_Frame_Del	DEL	ENST00000378043.4	37	CCDS31580.1																																																																																			.		0.695	BEST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394715.1	NM_004183	
BRCC3	79184	broad.mit.edu;bcgsc.ca	37	X	154348355	154348355	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chrX:154348355A>G	ENST00000369462.1	+	11	906	c.881A>G	c.(880-882)aAc>aGc	p.N294S	BRCC3_ENST00000330045.7_Missense_Mutation_p.N269S|BRCC3_ENST00000340647.4_Missense_Mutation_p.N270S|MTCP1_ENST00000362018.2_Intron|BRCC3_ENST00000369459.2_Missense_Mutation_p.N225S|BRCC3_ENST00000399042.1_Missense_Mutation_p.N295S	NM_024332.3	NP_077308.1	P46736	BRCC3_HUMAN	BRCA1/BRCA2-containing complex, subunit 3	294					double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|regulation of catalytic activity (GO:0050790)|response to ionizing radiation (GO:0010212)|response to X-ray (GO:0010165)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|nuclear ubiquitin ligase complex (GO:0000152)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	enzyme regulator activity (GO:0030234)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|polyubiquitin binding (GO:0031593)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|skin(1)	22	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTGGAGCAAAACCAACAGCAT	0.413																																					p.N294S		.											.	BRCC3	706	0			c.A881G						.						74.0	73.0	73.0					X																	154348355		2052	4210	6262	SO:0001583	missense	79184	exon11			AGCAAAACCAACA	X64643	CCDS56610.1, CCDS56611.1, CCDS56612.1	Xq28	2013-05-29	2005-11-21	2005-11-21	ENSG00000185515	ENSG00000185515			24185	protein-coding gene	gene with protein product	"""Lys-63-specific deubiquitinase"""	300617	"""chromosome X open reading frame 53"""	CXorf53		1303175, 14636569	Standard	NM_024332		Approved	C6.1A, BRCC36	uc004fna.3	P46736	OTTHUMG00000022658	ENST00000369462.1:c.881A>G	X.37:g.154348355A>G	ENSP00000358474:p.Asn294Ser	100.0	0.0		86.0	6.0	NM_024332	A6QRF8|A6QRF9|A8MUX5|A8MWH0|A9Z1Y0|A9Z1Y5|B1B062|B4DQN7|Q16107|Q53YX5|Q9BTZ6	Missense_Mutation	SNP	ENST00000369462.1	37	CCDS56611.1	.	.	.	.	.	.	.	.	.	.	A	17.18	3.323695	0.60634	.	.	ENSG00000185515	ENST00000340647;ENST00000330045;ENST00000369459;ENST00000369462;ENST00000399042;ENST00000457026	T;T;T;T;T	0.60040	0.5;0.52;0.59;0.39;0.22	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.73737	0.3625	M	0.77486	2.375	0.80722	D	1	D;D	0.58268	0.974;0.982	D;D	0.67725	0.953;0.952	T	0.74615	-0.3606	10	0.39692	T	0.17	-15.4173	13.2094	0.59815	1.0:0.0:0.0:0.0	.	269;294	P46736-2;P46736	.;BRCC3_HUMAN	S	270;269;225;294;295;226	ENSP00000344103:N270S;ENSP00000328641:N269S;ENSP00000358471:N225S;ENSP00000358474:N294S;ENSP00000381998:N295S	ENSP00000328641:N269S	N	+	2	0	BRCC3	154001549	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	8.855000	0.92236	1.958000	0.56883	0.481000	0.45027	AAC	.		0.413	BRCC3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058788.4	NM_024332	
BTBD9	114781	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	38256182	38256182	+	Silent	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr6:38256182G>A	ENST00000481247.1	-	8	1471	c.1320C>T	c.(1318-1320)gtC>gtT	p.V440V	BTBD9_ENST00000408958.1_Silent_p.V372V|BTBD9_ENST00000403056.1_Silent_p.V440V|BTBD9_ENST00000419706.2_Silent_p.V410V|BTBD9_ENST00000314100.6_Silent_p.V372V	NM_001099272.1|NM_052893.1	NP_001092742.1|NP_443125.1	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9	440					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|circadian sleep/wake cycle, non-REM sleep (GO:0042748)|long-term memory (GO:0007616)|multicellular organismal iron ion homeostasis (GO:0060586)|regulation of synaptic vesicle endocytosis (GO:1900242)|sensory perception of temperature stimulus (GO:0050951)|serotonin metabolic process (GO:0042428)					breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	12						GGCTCCGACTGACTCCTTCAA	0.463																																					p.V440V		.											.	BTBD9	226	0			c.C1320T						.						108.0	112.0	110.0					6																	38256182		2188	4293	6481	SO:0001819	synonymous_variant	114781	exon9			CCGACTGACTCCT		CCDS43458.1, CCDS47418.1, CCDS54998.1	6p21	2014-01-28			ENSG00000183826	ENSG00000183826		"""BTB/POZ domain containing"""	21228	protein-coding gene	gene with protein product		611237				11572484	Standard	NM_052893		Approved	KIAA1880, dJ322I12.1	uc010jwx.3	Q96Q07	OTTHUMG00000014634	ENST00000481247.1:c.1320C>T	6.37:g.38256182G>A		67.0	0.0		59.0	13.0	NM_052893	Q494V9|Q494W1|Q96M00	Silent	SNP	ENST00000481247.1	37	CCDS47418.1																																																																																			.		0.463	BTBD9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040433.2	NM_152733	
C11orf96	387763	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	43964686	43964686	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:43964686A>G	ENST00000339446.3	+	4	1171	c.1171A>G	c.(1171-1173)Aag>Gag	p.K391E	RP11-613D13.4_ENST00000526408.1_RNA|C11orf96_ENST00000528572.1_Missense_Mutation_p.E194G|RP11-613D13.8_ENST00000501541.1_lincRNA			Q7Z7L8	CK096_HUMAN	chromosome 11 open reading frame 96	391										pancreas(1)	1						GGAGGAGGAGAAGGCCAAGAA	0.662																																					p.K78E		.											.	C11orf96	46	0			c.A232G						.						89.0	99.0	96.0					11																	43964686		692	1591	2283	SO:0001583	missense	387763	exon1			GAGGAGAAGGCCA		CCDS73275.1	11p11.2	2012-08-10			ENSG00000187479	ENSG00000187479			38675	protein-coding gene	gene with protein product							Standard	NM_001145033		Approved	AG2	uc010rfl.2	Q7Z7L8	OTTHUMG00000166555	ENST00000339446.3:c.1171A>G	11.37:g.43964686A>G	ENSP00000340667:p.Lys391Glu	39.0	0.0		31.0	10.0	NM_001145033		Missense_Mutation	SNP	ENST00000339446.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	12.91|12.91	2.080811|2.080811	0.36758|0.36758	.|.	.|.	ENSG00000187479|ENSG00000187479	ENST00000528572|ENST00000339446	.|T	.|0.19394	.|2.15	4.65|4.65	3.43|3.43	0.39272|0.39272	.|.	.|0.208914	.|0.21799	.|U	.|0.068953	T|T	0.15176|0.15176	0.0366|0.0366	N|N	0.19112|0.19112	0.55|0.55	0.21325|0.21325	N|N	0.999724|0.999724	.|P	.|0.41450	.|0.75	.|B	.|0.42030	.|0.373	T|T	0.09378|0.09378	-1.0677|-1.0677	6|10	0.87932|0.72032	D|D	0|0.01	.|.	10.2187|10.2187	0.43184|0.43184	0.8334:0.1666:0.0:0.0|0.8334:0.1666:0.0:0.0	.|.	.|391	.|Q7Z7L8	.|CK096_HUMAN	G|E	194|391	.|ENSP00000340667:K391E	ENSP00000431597:E194G|ENSP00000340667:K391E	E|K	+|+	2|1	0|0	C11orf96|C11orf96	43921262|43921262	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	4.185000|4.185000	0.58330|0.58330	1.724000|1.724000	0.51502|0.51502	0.248000|0.248000	0.18094|0.18094	GAA|AAG	.		0.662	C11orf96-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001145033	
C4orf51	646603	broad.mit.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	146650320	146650321	+	Splice_Site	DNP	GG	GG	TT			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.|Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr4:146650320_146650321GG>TT	ENST00000438731.1	+	4	366_367	c.366_367GG>TT	c.(364-369)gtGGca>gtTTca	p.A123S		NM_001080531.1	NP_001074000.1	C9J302	CD051_HUMAN	chromosome 4 open reading frame 51	123										haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)	6						CCTTTTTATAGGCACATCAAAT	0.342																																					.|p.A123S		.											.	.	.	0			c.367-1G>T|c.G367T						.																																			SO:0001630	splice_region_variant	646603	exon4			TTTATAGGCACAT|TTATAGGCACATC		CCDS47140.1	4q31.21	2009-09-09			ENSG00000237136	ENSG00000237136			37264	protein-coding gene	gene with protein product							Standard	NM_001080531		Approved		uc003ikk.3	C9J302	OTTHUMG00000161367	Exception_encountered	4.37:g.146650320_146650321delinsTT		184.0	1.0|0.0		201.0|199.0	21.0|20.0	NM_001080531		Splice_Site|Missense_Mutation	SNP	ENST00000438731.1	37	CCDS47140.1																																																																																			.		0.342	C4orf51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080531	Missense_Mutation
C5orf42	65250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	37227754	37227754	+	Silent	SNP	T	T	C	rs186540080		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr5:37227754T>C	ENST00000508244.1	-	9	1380	c.1287A>G	c.(1285-1287)ctA>ctG	p.L429L	C5orf42_ENST00000425232.2_Silent_p.L429L|C5orf42_ENST00000274258.7_5'UTR			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	429						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CTGATGGAGATAGGCTATCAA	0.373													T|||	1	0.000199681	0.0008	0.0	5008	,	,		17559	0.0		0.0	False		,,,				2504	0.0				p.L429L		.											.	C5orf42	94	0			c.A1287G						.	T		0,1384		0,0,692	217.0	146.0	168.0		1287	-1.4	0.4	5		168	1,3181		0,1,1590	no	coding-synonymous	C5orf42	NM_023073.3		0,1,2282	CC,CT,TT		0.0314,0.0,0.0219		429/3198	37227754	1,4565	692	1591	2283	SO:0001819	synonymous_variant	65250	exon10			TGGAGATAGGCTA		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.1287A>G	5.37:g.37227754T>C		110.0	0.0		136.0	23.0	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Silent	SNP	ENST00000508244.1	37	CCDS34146.2																																																																																			T|0.999;C|0.000		0.373	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
CAV2	858	ucsc.edu;bcgsc.ca	37	7	116140371	116140371	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:116140371T>C	ENST00000222693.4	+	2	600	c.208T>C	c.(208-210)Tgg>Cgg	p.W70R	AC002066.1_ENST00000446355.2_RNA|CAV2_ENST00000462876.1_3'UTR|CAV2_ENST00000343213.2_Intron|CAV2_ENST00000393480.2_Missense_Mutation_p.W70R	NM_001206747.1|NM_001206748.1|NM_001233.4	NP_001193676.1|NP_001193677.1|NP_001224.1	P51636	CAV2_HUMAN	caveolin 2	70					caveola assembly (GO:0070836)|endoplasmic reticulum organization (GO:0007029)|mitochondrion organization (GO:0007005)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of endothelial cell proliferation (GO:0001938)|protein oligomerization (GO:0051259)|regulation of mitosis (GO:0007088)|skeletal muscle fiber development (GO:0048741)|synaptic transmission (GO:0007268)|vesicle docking (GO:0048278)|vesicle fusion (GO:0006906)|vesicle organization (GO:0016050)	acrosomal membrane (GO:0002080)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lipid particle (GO:0005811)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	D1 dopamine receptor binding (GO:0031748)|protein homodimerization activity (GO:0042803)			large_intestine(1)|lung(1)|skin(1)	3	all_epithelial(6;1.53e-06)|Lung NSC(10;0.00592)|all_lung(10;0.00642)		STAD - Stomach adenocarcinoma(10;0.00878)			TGACAAAGTGTGGATCTGCAG	0.542																																					p.W70R		.											.	CAV2	90	0			c.T208C						.						171.0	139.0	150.0					7																	116140371		2203	4300	6503	SO:0001583	missense	858	exon2			AAAGTGTGGATCT	AF035752	CCDS5765.1, CCDS5766.1	7q31	2006-02-09			ENSG00000105971	ENSG00000105971			1528	protein-coding gene	gene with protein product		601048				8552590, 10087206	Standard	NM_001233		Approved	CAV	uc003vid.3	P51636	OTTHUMG00000023414	ENST00000222693.4:c.208T>C	7.37:g.116140371T>C	ENSP00000222693:p.Trp70Arg	61.0	0.0		42.0	4.0	NM_001233	A4D0U2|Q9UGM7	Missense_Mutation	SNP	ENST00000222693.4	37	CCDS5766.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.784466	0.90282	.	.	ENSG00000105971	ENST00000222693;ENST00000393480	D;D	0.98060	-4.69;-4.69	4.6	4.6	0.57074	.	0.107611	0.64402	D	0.000002	D	0.98988	0.9655	M	0.94142	3.5	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	D	0.99406	1.0929	10	0.59425	D	0.04	-22.2244	14.2879	0.66258	0.0:0.0:0.0:1.0	.	70	P51636	CAV2_HUMAN	R	70	ENSP00000222693:W70R;ENSP00000377120:W70R	ENSP00000222693:W70R	W	+	1	0	CAV2	115927607	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.856000	0.86956	1.828000	0.53243	0.460000	0.39030	TGG	.		0.542	CAV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059735.4	NM_001233	
CCDC136	64753	ucsc.edu;bcgsc.ca	37	7	128441554	128441554	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:128441554G>T	ENST00000297788.4	+	4	1028	c.661G>T	c.(661-663)Ggg>Tgg	p.G221W	CCDC136_ENST00000464832.1_Missense_Mutation_p.G271W|CCDC136_ENST00000487361.1_Missense_Mutation_p.G221W|CCDC136_ENST00000378685.4_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	221	Glu-rich.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						AGATTACTCTGGGTTACAAGG	0.443																																					p.G221W		.											.	CCDC136	24	0			c.G661T						.						35.0	37.0	37.0					7																	128441554		1901	4119	6020	SO:0001583	missense	64753	exon4			TACTCTGGGTTAC		CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.661G>T	7.37:g.128441554G>T	ENSP00000297788:p.Gly221Trp	21.0	0.0		21.0	4.0	NM_022742	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Missense_Mutation	SNP	ENST00000297788.4	37	CCDS47704.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.531315	0.85706	.	.	ENSG00000128596	ENST00000464832;ENST00000487361;ENST00000297788;ENST00000397697;ENST00000320524	D;T;T	0.82984	-1.67;0.92;1.47	5.24	3.33	0.38152	.	0.607017	0.17597	N	0.168547	T	0.81688	0.4875	N	0.22421	0.69	0.28432	N	0.917227	D;D	0.65815	0.969;0.995	P;D	0.65874	0.518;0.939	T	0.72384	-0.4310	10	0.66056	D	0.02	-16.9588	7.6077	0.28112	0.0947:0.1697:0.7356:0.0	.	221;221	C9JE17;Q96JN2	.;CC136_HUMAN	W	271;221;221;221;221	ENSP00000419515:G271W;ENSP00000420509:G221W;ENSP00000297788:G221W	ENSP00000297788:G221W	G	+	1	0	CCDC136	128228790	0.604000	0.26932	0.999000	0.59377	0.773000	0.43773	1.162000	0.31786	2.469000	0.83416	0.655000	0.94253	GGG	.		0.443	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742	
CCDC65	85478	ucsc.edu;bcgsc.ca	37	12	49298806	49298806	+	Silent	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:49298806G>T	ENST00000320516.4	+	2	398	c.210G>T	c.(208-210)cgG>cgT	p.R70R	CCDC65_ENST00000266984.5_Silent_p.R70R|RP11-302B13.5_ENST00000398092.4_Intron	NM_033124.4	NP_149115.2	Q8IXS2	CCD65_HUMAN	coiled-coil domain containing 65	70										breast(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	15						CTGTCCTTCGGGAAGTCAAGA	0.448																																					p.R70R		.											.	CCDC65	92	0			c.G210T						.						147.0	120.0	129.0					12																	49298806		2203	4300	6503	SO:0001819	synonymous_variant	85478	exon2			CCTTCGGGAAGTC		CCDS8772.1	12q13.12	2014-07-18			ENSG00000139537	ENSG00000139537			29937	protein-coding gene	gene with protein product		611088				17089017, 21700706	Standard	NM_033124		Approved	NYD-SP28, FLJ35732, FAP250, CILD27	uc001rso.3	Q8IXS2		ENST00000320516.4:c.210G>T	12.37:g.49298806G>T		43.0	0.0		40.0	4.0	NM_033124	A6NJG5|B2RBE2|Q8N7G4|Q8NA91|Q96JA0	Silent	SNP	ENST00000320516.4	37	CCDS8772.1																																																																																			.		0.448	CCDC65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408922.1	NM_033124	
CCDC80	151887	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	112358316	112358316	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:112358316G>T	ENST00000206423.3	-	2	1390	c.437C>A	c.(436-438)gCa>gAa	p.A146E	CCDC80_ENST00000439685.2_Missense_Mutation_p.A146E|CCDC80_ENST00000475181.1_5'UTR	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	146					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						GTTCTTCCCTGCAAAGCTGGC	0.557																																					p.A146E		.											.	CCDC80	92	0			c.C437A						.						79.0	74.0	76.0					3																	112358316		2203	4300	6503	SO:0001583	missense	151887	exon2			TTCCCTGCAAAGC	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.437C>A	3.37:g.112358316G>T	ENSP00000206423:p.Ala146Glu	35.0	0.0		41.0	6.0	NM_199511	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	37	CCDS2968.1	.	.	.	.	.	.	.	.	.	.	G	31	5.102765	0.94245	.	.	ENSG00000091986	ENST00000206423;ENST00000439685	T;T	0.43688	0.94;0.94	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.61714	0.2369	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.51395	-0.8711	10	0.11485	T	0.65	-16.305	20.2227	0.98327	0.0:0.0:1.0:0.0	.	157;146;146	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	E	146	ENSP00000206423:A146E;ENSP00000411814:A146E	ENSP00000206423:A146E	A	-	2	0	CCDC80	113841006	1.000000	0.71417	0.878000	0.34440	0.970000	0.65996	9.827000	0.99397	2.778000	0.95560	0.650000	0.86243	GCA	.		0.557	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511	
CD93	22918	ucsc.edu;bcgsc.ca	37	20	23065836	23065836	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr20:23065836G>T	ENST00000246006.4	-	1	1141	c.994C>A	c.(994-996)Caa>Aaa	p.Q332K		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	332	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					TGGTACCCTTGGGGGCAGCGG	0.637																																					p.Q332K		.											.	CD93	153	0			c.C994A						.						29.0	33.0	32.0					20																	23065836		2203	4300	6503	SO:0001583	missense	22918	exon1			ACCCTTGGGGGCA	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.994C>A	20.37:g.23065836G>T	ENSP00000246006:p.Gln332Lys	36.0	0.0		42.0	5.0	NM_012072	O00274	Missense_Mutation	SNP	ENST00000246006.4	37	CCDS13149.1	.	.	.	.	.	.	.	.	.	.	G	0.032	-1.325673	0.01309	.	.	ENSG00000125810	ENST00000246006	D	0.94723	-3.5	5.42	-4.8	0.03190	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	2.657010	0.01388	N	0.013140	D	0.86087	0.5849	N	0.17278	0.47	0.09310	N	1	B	0.23490	0.086	B	0.24848	0.056	T	0.81136	-0.1070	10	0.06099	T	0.92	3.9649	7.4276	0.27109	0.0631:0.4788:0.2539:0.2042	.	332	Q9NPY3	C1QR1_HUMAN	K	332	ENSP00000246006:Q332K	ENSP00000246006:Q332K	Q	-	1	0	CD93	23013836	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.219000	0.17641	-0.555000	0.06142	-0.188000	0.12872	CAA	.		0.637	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072	
CHAT	1103	ucsc.edu;bcgsc.ca	37	10	50863450	50863450	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr10:50863450C>T	ENST00000337653.2	+	13	1948	c.1795C>T	c.(1795-1797)Ctc>Ttc	p.L599F	CHAT_ENST00000395559.2_Missense_Mutation_p.L481F|CHAT_ENST00000395562.2_Missense_Mutation_p.L517F|CHAT_ENST00000339797.1_Missense_Mutation_p.L481F|CHAT_ENST00000351556.3_Missense_Mutation_p.L481F|CHAT_ENST00000455728.2_Missense_Mutation_p.L481F	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	599					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	GAAGCTTCTGCTCCTGAAGGA	0.582																																					p.L599F		.											.	CHAT	514	0			c.C1795T						.						118.0	111.0	113.0					10																	50863450		2203	4300	6503	SO:0001583	missense	1103	exon13			CTTCTGCTCCTGA	AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.1795C>T	10.37:g.50863450C>T	ENSP00000337103:p.Leu599Phe	35.0	0.0		50.0	4.0	NM_020549	A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Missense_Mutation	SNP	ENST00000337653.2	37	CCDS7232.1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.427318	0.43122	.	.	ENSG00000070748	ENST00000339797;ENST00000351556;ENST00000395559;ENST00000337653;ENST00000395562;ENST00000455728	D;D;D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.88;-2.88;-2.88	5.36	5.36	0.76844	.	0.338132	0.31167	N	0.008134	D	0.91626	0.7354	M	0.82716	2.605	0.41364	D	0.987441	P;P	0.45957	0.869;0.626	B;B	0.38921	0.279;0.285	D	0.92900	0.6338	10	0.72032	D	0.01	-26.0803	13.5841	0.61919	0.1648:0.8352:0.0:0.0	.	481;599	F8W8I2;P28329	.;CLAT_HUMAN	F	481;481;481;599;517;481	ENSP00000343486:L481F;ENSP00000345878:L481F;ENSP00000378926:L481F;ENSP00000337103:L599F;ENSP00000378929:L517F;ENSP00000390521:L481F	ENSP00000337103:L599F	L	+	1	0	CHAT	50533456	0.929000	0.31497	0.769000	0.31535	0.370000	0.29829	1.145000	0.31577	2.672000	0.90937	0.591000	0.81541	CTC	.		0.582	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047997.1	NM_020549	
CHD9	80205	ucsc.edu;bcgsc.ca	37	16	53357978	53357978	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr16:53357978T>C	ENST00000398510.3	+	38	7952	c.7865T>C	c.(7864-7866)gTt>gCt	p.V2622A	CHD9_ENST00000564845.1_Missense_Mutation_p.V2606A|CHD9_ENST00000447540.1_Missense_Mutation_p.V2607A|CHD9_ENST00000566029.1_Missense_Mutation_p.V2606A			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2622					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				ACTGGTCCCGTTGTGAGAGAG	0.448																																					p.V2606A		.											.	CHD9	272	0			c.T7817C						.						93.0	94.0	94.0					16																	53357978		1864	4101	5965	SO:0001583	missense	80205	exon39			GTCCCGTTGTGAG	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.7865T>C	16.37:g.53357978T>C	ENSP00000381522:p.Val2622Ala	39.0	0.0		41.0	4.0	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	37		.	.	.	.	.	.	.	.	.	.	T	17.49	3.403727	0.62288	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000450543	T	0.44482	0.92	5.23	5.23	0.72850	.	0.279522	0.24988	N	0.034012	T	0.60457	0.2270	M	0.67397	2.05	0.41963	D	0.990719	P;P;D;D	0.64830	0.893;0.849;0.991;0.994	B;P;P;D	0.63283	0.446;0.555;0.82;0.913	T	0.62661	-0.6807	10	0.49607	T	0.09	-16.9432	15.4199	0.75003	0.0:0.0:0.0:1.0	.	688;2607;2622;2606	C9JR69;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	A	2607;2606;688	ENSP00000396345:V2607A	ENSP00000381522:V2606A	V	+	2	0	CHD9	51915479	1.000000	0.71417	0.136000	0.22124	0.671000	0.39405	7.940000	0.87693	2.112000	0.64535	0.533000	0.62120	GTT	.		0.448	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
CHMP7	91782	ucsc.edu;bcgsc.ca	37	8	23114093	23114093	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr8:23114093C>A	ENST00000397677.1	+	5	1426	c.778C>A	c.(778-780)Cag>Aag	p.Q260K	CHMP7_ENST00000313219.7_Missense_Mutation_p.Q260K	NM_152272.3	NP_689485.1	Q8WUX9	CHMP7_HUMAN	charged multivesicular body protein 7	260					endosomal transport (GO:0016197)|late endosome to vacuole transport (GO:0045324)|membrane organization (GO:0061024)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|ESCRT III complex (GO:0000815)	protein transporter activity (GO:0008565)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11		Prostate(55;0.0513)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		GTCCTTATCCCAGGAAGCAGA	0.507																																					p.Q260K		.											.	CHMP7	90	0			c.C778A						.						205.0	190.0	195.0					8																	23114093		2203	4300	6503	SO:0001583	missense	91782	exon5			TTATCCCAGGAAG	BC019110	CCDS6040.1	8p21.2	2011-09-21	2011-09-21		ENSG00000147457	ENSG00000147457		"""Charged multivesicular body proteins"""	28439	protein-coding gene	gene with protein product		611130	"""CHMP family, member 7"""			16856878	Standard	NM_152272		Approved	MGC29816	uc003xdc.2	Q8WUX9	OTTHUMG00000131785	ENST00000397677.1:c.778C>A	8.37:g.23114093C>A	ENSP00000380794:p.Gln260Lys	39.0	1.0		42.0	4.0	NM_152272	B2RDT3|B4DKJ6|D3DSS1|Q8NDM1|Q9BT50	Missense_Mutation	SNP	ENST00000397677.1	37	CCDS6040.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.067543	0.36470	.	.	ENSG00000147457	ENST00000397677;ENST00000313219	T;T	0.70282	-0.47;-0.47	5.93	5.93	0.95920	.	0.548944	0.21451	N	0.074327	T	0.59756	0.2217	L	0.32530	0.975	0.28025	N	0.934357	P;B	0.43542	0.81;0.09	B;B	0.40741	0.339;0.072	T	0.55547	-0.8124	10	0.06757	T	0.87	-12.5459	17.1234	0.86707	0.0:1.0:0.0:0.0	.	150;260	B3KRZ9;Q8WUX9	.;CHMP7_HUMAN	K	260	ENSP00000380794:Q260K;ENSP00000324491:Q260K	ENSP00000324491:Q260K	Q	+	1	0	CHMP7	23170038	0.996000	0.38824	1.000000	0.80357	0.949000	0.60115	3.259000	0.51515	2.823000	0.97156	0.650000	0.86243	CAG	.		0.507	CHMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254717.1	NM_152272	
CKS1B	1163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	154947279	154947279	+	Splice_Site	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:154947279C>T	ENST00000308987.5	+	1	105	c.58C>T	c.(58-60)Cga>Tga	p.R20*	SHC1_ENST00000368450.1_5'Flank|CKS1B_ENST00000368436.1_Splice_Site_p.R20*|SHC1_ENST00000368453.4_5'Flank|CKS1B_ENST00000368439.1_5'UTR|MIR4258_ENST00000580920.1_RNA	NM_001826.2	NP_001817.1	P61024	CKS1_HUMAN	CDC28 protein kinase regulatory subunit 1B	20					cell division (GO:0051301)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	nucleoplasm (GO:0005654)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|large_intestine(1)|lung(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GTTTGAGTATCGGTTAGTGCT	0.537																																					p.R20X		.											.	CKS1B	251	0			c.C58T						.						58.0	50.0	52.0					1																	154947279		2203	4300	6503	SO:0001630	splice_region_variant	1163	exon1			GAGTATCGGTTAG	BC007751	CCDS1077.1	1q21.2	2011-04-28	2002-10-07		ENSG00000173207	ENSG00000173207			19083	protein-coding gene	gene with protein product		116900	"""CDC28 protein kinase 1B"""			2227411	Standard	NM_001826		Approved	ckshs1, CKS1	uc001fgb.3	P61024	OTTHUMG00000037413	ENST00000308987.5:c.59+1C>T	1.37:g.154947279C>T		133.0	0.0		185.0	53.0	NM_001826	P33551	Nonsense_Mutation	SNP	ENST00000308987.5	37	CCDS1077.1	.	.	.	.	.	.	.	.	.	.	C	32	5.191087	0.94923	.	.	ENSG00000173207	ENST00000368436;ENST00000308987	.	.	.	5.26	2.21	0.28008	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.2945	0.60288	0.3965:0.6035:0.0:0.0	.	.	.	.	X	20	.	ENSP00000311083:R20X	R	+	1	2	CKS1B	153213903	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	2.771000	0.47670	0.305000	0.22832	0.591000	0.81541	CGA	.		0.537	CKS1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091078.1	NM_001826	Nonsense_Mutation
CLCN2	1181	ucsc.edu;bcgsc.ca	37	3	184069898	184069898	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:184069898T>C	ENST00000265593.4	-	22	2489	c.2318A>G	c.(2317-2319)gAg>gGg	p.E773G	CLCN2_ENST00000344937.7_Missense_Mutation_p.E756G|CLCN2_ENST00000434054.2_Missense_Mutation_p.E729G|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000457512.1_Missense_Mutation_p.E773G|CLCN2_ENST00000423355.2_3'UTR	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	773					cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	CTCCTCCCACTCCAGAATCTG	0.537																																					p.E773G		.											.	CLCN2	90	0			c.A2318G						.						116.0	107.0	110.0					3																	184069898		2203	4300	6503	SO:0001583	missense	1181	exon22			TCCCACTCCAGAA	S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.2318A>G	3.37:g.184069898T>C	ENSP00000265593:p.Glu773Gly	25.0	0.0		31.0	4.0	NM_004366	B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	ENST00000265593.4	37	CCDS3263.1	.	.	.	.	.	.	.	.	.	.	t	17.65	3.441689	0.63067	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.88	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.94768	0.8311	M	0.64997	1.995	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.998;1.0	P;D;D;D	0.69142	0.873;0.962;0.94;0.962	D	0.93863	0.7155	10	0.33940	T	0.23	-26.8068	15.7656	0.78123	0.0:0.0:0.0:1.0	.	729;773;756;773	E9PBD9;E9PCD2;P51788-3;P51788	.;.;.;CLCN2_HUMAN	G	773;756;729;773	ENSP00000265593:E773G;ENSP00000345056:E756G;ENSP00000400425:E729G;ENSP00000391928:E773G	ENSP00000265593:E773G	E	-	2	0	CLCN2	185552592	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	1.816000	0.38992	2.133000	0.65898	0.379000	0.24179	GAG	.		0.537	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1		
CLDN17	26285	ucsc.edu;bcgsc.ca	37	21	31538684	31538684	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr21:31538684C>A	ENST00000286808.3	-	1	287	c.252G>T	c.(250-252)atG>atT	p.M84I		NM_012131.2	NP_036263.1	P56750	CLD17_HUMAN	claudin 17	84					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	23						CAGCCACACACATGAGGGCCC	0.567																																					p.M84I		.											.	CLDN17	92	0			c.G252T						.						69.0	75.0	73.0					21																	31538684		2203	4300	6503	SO:0001583	missense	26285	exon1			CACACACATGAGG	AJ250712	CCDS13586.1	21q22.1	2008-07-31			ENSG00000156282	ENSG00000156282		"""Claudins"""	2038	protein-coding gene	gene with protein product						12736707	Standard	NM_012131		Approved	MGC126552, MGC126554	uc011acv.2	P56750	OTTHUMG00000081873	ENST00000286808.3:c.252G>T	21.37:g.31538684C>A	ENSP00000286808:p.Met84Ile	25.0	0.0		26.0	4.0	NM_012131	Q3MJB5|Q6UY37	Missense_Mutation	SNP	ENST00000286808.3	37	CCDS13586.1	.	.	.	.	.	.	.	.	.	.	C	19.81	3.896924	0.72639	.	.	ENSG00000156282	ENST00000286808	D	0.91011	-2.77	5.22	5.22	0.72569	.	0.038140	0.85682	N	0.000000	D	0.94673	0.8282	M	0.66560	2.04	0.58432	D	0.999995	D	0.76494	0.999	D	0.81914	0.995	D	0.93716	0.7028	10	0.45353	T	0.12	.	18.9509	0.92641	0.0:1.0:0.0:0.0	.	84	P56750	CLD17_HUMAN	I	84	ENSP00000286808:M84I	ENSP00000286808:M84I	M	-	3	0	CLDN17	30460555	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.659000	0.61504	2.885000	0.99019	0.655000	0.94253	ATG	.		0.567	CLDN17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000182261.1	NM_012131	
CMTM2	146225	ucsc.edu;bcgsc.ca	37	16	66613724	66613724	+	Silent	SNP	C	C	A	rs111592429	byFrequency	TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr16:66613724C>A	ENST00000268595.2	+	1	365	c.214C>A	c.(214-216)Cgg>Agg	p.R72R	CMTM2_ENST00000379486.2_Silent_p.R72R|RP11-403P17.2_ENST00000568430.1_RNA	NM_144673.2	NP_653274.1	Q8TAZ6	CKLF2_HUMAN	CKLF-like MARVEL transmembrane domain containing 2	72					chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.068)|Epithelial(162;0.212)		TCGCCGCTACCGGTGGGAATT	0.557																																					p.R72R		.											.	CMTM2	91	0			c.C214A						.						51.0	54.0	53.0					16																	66613724		2201	4300	6501	SO:0001819	synonymous_variant	146225	exon1			CGCTACCGGTGGG	BC025354	CCDS10814.1, CCDS56001.1	16q22.1-q22.3	2008-02-05	2005-11-08	2005-11-08	ENSG00000140932	ENSG00000140932			19173	protein-coding gene	gene with protein product		607885	"""chemokine-like factor super family 2"", ""chemokine-like factor superfamily 2"""	CKLFSF2			Standard	NM_001199317		Approved	MGC39436, FLJ25732	uc002ept.3	Q8TAZ6	OTTHUMG00000137501	ENST00000268595.2:c.214C>A	16.37:g.66613724C>A		53.0	0.0		67.0	6.0	NM_001199317	Q5I2A4|Q8N7E5	Silent	SNP	ENST00000268595.2	37	CCDS10814.1																																																																																			C|0.994;T|0.006		0.557	CMTM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268808.1		
CNPPD1	27013	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	220037368	220037368	+	Silent	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:220037368T>C	ENST00000409789.1	-	9	1600	c.1173A>G	c.(1171-1173)caA>caG	p.Q391Q	CNPPD1_ENST00000360507.5_Silent_p.Q391Q|SLC23A3_ENST00000396775.3_5'Flank|SLC23A3_ENST00000409878.3_5'Flank|SLC23A3_ENST00000455516.2_5'Flank|SLC23A3_ENST00000295738.7_5'Flank			Q9BV87	CNPD1_HUMAN	cyclin Pas1/PHO80 domain containing 1	391					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	integral component of membrane (GO:0016021)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	12						AAAGGGAACATTGCTGAGGCT	0.572																																					p.Q391Q		.											.	CNPPD1	90	0			c.A1173G						.						90.0	90.0	90.0					2																	220037368		2203	4300	6503	SO:0001819	synonymous_variant	27013	exon8			GGAACATTGCTGA	AF070638	CCDS2433.1	2q36	2011-03-23	2011-03-23	2011-03-23	ENSG00000115649	ENSG00000115649			25220	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 24"""	C2orf24		8619474, 9110174	Standard	NM_015680		Approved	CGI-57	uc002vju.4	Q9BV87	OTTHUMG00000133132	ENST00000409789.1:c.1173A>G	2.37:g.220037368T>C		42.0	0.0		37.0	12.0	NM_015680	B2RC77|O75548|Q9H4N0|Q9UQN0	Silent	SNP	ENST00000409789.1	37	CCDS2433.1																																																																																			.		0.572	CNPPD1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336220.1	NM_015680	
COL16A1	1307	ucsc.edu;bcgsc.ca	37	1	32120418	32120418	+	Silent	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:32120418T>C	ENST00000373672.3	-	68	4848	c.4332A>G	c.(4330-4332)agA>agG	p.R1444R	COL16A1_ENST00000271069.6_Silent_p.R1444R|RP11-73M7.6_ENST00000591929.1_RNA|RP11-73M7.6_ENST00000588288.1_RNA|RP11-73M7.6_ENST00000593188.1_RNA|RP11-73M7.6_ENST00000610043.1_RNA|RP11-73M7.6_ENST00000609338.1_RNA|RP11-73M7.6_ENST00000585660.1_RNA|RP11-73M7.6_ENST00000609033.1_RNA|RP11-73M7.6_ENST00000609373.1_RNA|RP11-73M7.6_ENST00000591592.1_RNA|RP11-73M7.6_ENST00000445166.1_RNA|RP11-73M7.6_ENST00000609549.1_RNA|RP11-73M7.6_ENST00000608888.1_RNA|RP11-73M7.6_ENST00000587445.1_RNA|RP11-73M7.6_ENST00000609625.1_RNA|RP11-73M7.6_ENST00000607926.1_RNA|RP11-73M7.6_ENST00000610216.1_RNA|RP11-73M7.6_ENST00000589462.1_RNA|RP11-73M7.6_ENST00000608246.1_RNA|RP11-73M7.6_ENST00000585413.1_RNA|RP11-73M7.6_ENST00000608332.1_RNA|COL16A1_ENST00000461217.1_5'UTR	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1444	Nonhelical region 2 (NC2).				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		TGATCTCTTGTCTGATGAACC	0.473																																					p.R1444R	Colon(143;498 1786 21362 25193 36625)	.											.	COL16A1	98	0			c.A4332G						.						264.0	252.0	256.0					1																	32120418		1965	4153	6118	SO:0001819	synonymous_variant	1307	exon68			CTCTTGTCTGATG	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.4332A>G	1.37:g.32120418T>C		45.0	0.0		45.0	4.0	NM_001856	Q16593|Q59F89|Q71RG9	Silent	SNP	ENST00000373672.3	37	CCDS41297.1																																																																																			.		0.473	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
COPS4	51138	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	83971134	83971134	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr4:83971134A>G	ENST00000264389.2	+	4	542	c.407A>G	c.(406-408)cAa>cGa	p.Q136R	COPS4_ENST00000511653.1_Missense_Mutation_p.Q136R|COPS4_ENST00000509093.1_Missense_Mutation_p.Q136R|COPS4_ENST00000503682.1_Missense_Mutation_p.Q136R	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	136					cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				GAAACAGGACAAAAGTATAGT	0.338																																					p.Q136R		.											.	COPS4	226	0			c.A407G						.						107.0	122.0	117.0					4																	83971134		2203	4299	6502	SO:0001583	missense	51138	exon4			CAGGACAAAAGTA	AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.407A>G	4.37:g.83971134A>G	ENSP00000264389:p.Gln136Arg	37.0	0.0		36.0	8.0	NM_016129	B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Missense_Mutation	SNP	ENST00000264389.2	37	CCDS3600.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.812310	0.90707	.	.	ENSG00000138663	ENST00000509093;ENST00000264389;ENST00000503682;ENST00000511653	T;T;T;T	0.50548	0.77;0.78;0.74;0.76	5.64	5.64	0.86602	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.60209	0.2251	M	0.90977	3.165	0.80722	D	1	P;P;P;B	0.48640	0.913;0.768;0.819;0.087	B;B;B;B	0.42625	0.303;0.393;0.322;0.05	T	0.69917	-0.5015	10	0.42905	T	0.14	-10.6486	15.8697	0.79101	1.0:0.0:0.0:0.0	.	136;136;136;136	B3KST5;D6RFN0;D6RAX7;Q9BT78	.;.;.;CSN4_HUMAN	R	136	ENSP00000425976:Q136R;ENSP00000264389:Q136R;ENSP00000424791:Q136R;ENSP00000424655:Q136R	ENSP00000264389:Q136R	Q	+	2	0	COPS4	84190158	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.129000	0.94430	2.151000	0.67156	0.528000	0.53228	CAA	.		0.338	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252643.1		
CPB2	1361	ucsc.edu;bcgsc.ca	37	13	46652945	46652945	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr13:46652945T>C	ENST00000181383.4	-	5	492	c.476A>G	c.(475-477)tAt>tGt	p.Y159C	CPB2_ENST00000439329.3_Missense_Mutation_p.Y159C|CPB2-AS1_ENST00000606351.1_RNA|CPB2-AS1_ENST00000415033.2_RNA|CPB2-AS1_ENST00000606991.1_RNA|CPB2-AS1_ENST00000606243.1_RNA	NM_001872.3	NP_001863.3	Q96IY4	CBPB2_HUMAN	carboxypeptidase B2 (plasma)	159					blood coagulation (GO:0007596)|cellular response to glucose stimulus (GO:0071333)|fibrinolysis (GO:0042730)|liver regeneration (GO:0097421)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of plasminogen activation (GO:0010757)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to heat (GO:0009408)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(3)|liver(1)|lung(9)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		CTTTAAAACATAGAGTGGGTA	0.368																																					p.Y159C		.											.	CPB2	92	0			c.A476G						.						109.0	112.0	111.0					13																	46652945		2203	4300	6503	SO:0001583	missense	1361	exon5			AAAACATAGAGTG	M75106	CCDS9401.1, CCDS73568.1	13q14.11	2012-02-10	2007-02-21		ENSG00000080618	ENSG00000080618			2300	protein-coding gene	gene with protein product	"""thrombin-activatable fibrinolysis inhibitor"", ""carboxypeptidase U"", ""plasma carboxypeptidase B"", ""carboxypeptidase R"""	603101	"""carboxypeptidase B2 (plasma, carboxypeptidase U)"""			1939207, 1427879	Standard	NM_001278541		Approved	CPU, PCPB, TAFI	uc001vaw.3	Q96IY4	OTTHUMG00000016867	ENST00000181383.4:c.476A>G	13.37:g.46652945T>C	ENSP00000181383:p.Tyr159Cys	37.0	0.0		30.0	4.0	NM_001872	A8K464|Q15114|Q5T9K1|Q5T9K2|Q9P2Y6	Missense_Mutation	SNP	ENST00000181383.4	37	CCDS9401.1	.	.	.	.	.	.	.	.	.	.	T	16.14	3.037947	0.54896	.	.	ENSG00000080618	ENST00000181383;ENST00000439329	T;T	0.11277	2.79;2.79	5.17	5.17	0.71159	Peptidase M14, carboxypeptidase A (3);	0.000000	0.85682	D	0.000000	T	0.42944	0.1225	M	0.94101	3.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.56214	-0.8016	10	0.87932	D	0	.	13.2359	0.59969	0.0:0.0:0.0:1.0	.	159;159	Q96IY4-2;Q96IY4	.;CBPB2_HUMAN	C	159	ENSP00000181383:Y159C;ENSP00000400714:Y159C	ENSP00000181383:Y159C	Y	-	2	0	CPB2	45550946	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	6.724000	0.74747	2.071000	0.62044	0.379000	0.24179	TAT	.		0.368	CPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044803.2	NM_001872	
CPNE3	8895	ucsc.edu;bcgsc.ca	37	8	87563426	87563426	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr8:87563426C>A	ENST00000521271.1	+	14	1246	c.1084C>A	c.(1084-1086)Cca>Aca	p.P362T	CPNE3_ENST00000198765.4_Missense_Mutation_p.P362T	NM_003909.3	NP_003900.1	O75131	CPNE3_HUMAN	copine III	362	VWFA.				lipid metabolic process (GO:0006629)|protein phosphorylation (GO:0006468)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|transporter activity (GO:0005215)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	23						ACATGAATTTCCAATGAACTT	0.383																																					p.P362T		.											.	CPNE3	117	0			c.C1084A						.						116.0	109.0	112.0					8																	87563426		2203	4300	6503	SO:0001583	missense	8895	exon14			GAATTTCCAATGA	AB014536	CCDS6243.1	8q21	2008-07-03				ENSG00000085719			2316	protein-coding gene	gene with protein product		604207				9430674	Standard	NM_003909		Approved		uc003ydv.2	O75131		ENST00000521271.1:c.1084C>A	8.37:g.87563426C>A	ENSP00000430934:p.Pro362Thr	31.0	0.0		44.0	4.0	NM_003909	A8KA47|Q8IYA1	Missense_Mutation	SNP	ENST00000521271.1	37	CCDS6243.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.0|27.0	4.791344|4.791344	0.90367|0.90367	.|.	.|.	ENSG00000085719|ENSG00000085719	ENST00000517391|ENST00000198765;ENST00000521271	T|T;T	0.31769|0.25414	1.48|1.8;1.8	5.64|5.64	5.64|5.64	0.86602|0.86602	.|von Willebrand factor, type A (1);Copine (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.47097|0.47097	0.1427|0.1427	M|M	0.87758|0.87758	2.905|2.905	0.80722|0.80722	D|D	1|1	.|B	.|0.30889	.|0.299	.|B	.|0.40782	.|0.34	T|T	0.47598|0.47598	-0.9105|-0.9105	7|10	0.87932|0.46703	D|T	0|0.11	-1.7349|-1.7349	19.3272|19.3272	0.94267|0.94267	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|362	.|O75131	.|CPNE3_HUMAN	L|T	250|362	ENSP00000428561:F250L|ENSP00000198765:P362T;ENSP00000430934:P362T	ENSP00000428561:F250L|ENSP00000198765:P362T	F|P	+|+	3|1	2|0	CPNE3|CPNE3	87632542|87632542	0.968000|0.968000	0.33430|0.33430	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	2.070000|2.070000	0.41491|0.41491	2.667000|2.667000	0.90743|0.90743	0.655000|0.655000	0.94253|0.94253	TTC|CCA	.		0.383	CPNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374994.1		
CYB561A3	220002	ucsc.edu;bcgsc.ca	37	11	61120553	61120553	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:61120553A>G	ENST00000294072.4	-	5	1129	c.452T>C	c.(451-453)cTc>cCc	p.L151P	CYB561A3_ENST00000544118.1_Intron|CYB561A3_ENST00000540317.1_5'UTR|CYB561A3_ENST00000546151.1_Missense_Mutation_p.S95P|CYB561A3_ENST00000426130.2_Missense_Mutation_p.L168P|CYB561A3_ENST00000536915.1_Missense_Mutation_p.L151P|CYB561A3_ENST00000447532.2_Missense_Mutation_p.L151P|CYB561A3_ENST00000539890.1_Intron	NM_001161452.1|NM_153611.4	NP_001154924.1|NP_705839.3	Q8NBI2	CYAC3_HUMAN	cytochrome b561 family, member A3	151	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.					integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)										AGGTTTTAGGAGGCTGCGCAG	0.532																																					p.L168P		.											.	CYBASC3	90	0			c.T503C						.						70.0	58.0	62.0					11																	61120553		2203	4299	6502	SO:0001583	missense	220002	exon6			TTTAGGAGGCTGC	AK024953	CCDS8004.1, CCDS53639.1, CCDS73296.1	11q12.2	2013-03-14	2013-03-14	2013-03-14		ENSG00000162144		"""Cytochrome b genes"""	23014	protein-coding gene	gene with protein product			"""cytochrome b, ascorbate dependent 3"""	CYBASC3		23249217	Standard	NM_153611		Approved		uc001nrf.4	Q8NBI2		ENST00000294072.4:c.452T>C	11.37:g.61120553A>G	ENSP00000294072:p.Leu151Pro	41.0	0.0		48.0	4.0	NM_001161454	B3KPU2|B4DLN9|J3KQH4|Q6PK96	Missense_Mutation	SNP	ENST00000294072.4	37	CCDS8004.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.4|24.4	4.528722|4.528722	0.85706|0.85706	.|.	.|.	ENSG00000162144|ENSG00000162144	ENST00000426130;ENST00000294072;ENST00000447532;ENST00000536915;ENST00000540139;ENST00000542361;ENST00000537364|ENST00000546151	T;T;T;T;T;T;T|.	0.49139|.	0.79;0.79;0.79;0.79;0.79;0.79;0.79|.	6.02|6.02	6.02|6.02	0.97574|0.97574	Cytochrome b561, eukaryote (1);Cytochrome b561/ferric reductase transmembrane (2);|.	0.322393|.	0.30820|.	N|.	0.008803|.	T|T	0.75110|0.75110	0.3805|0.3805	M|M	0.76574|0.76574	2.34|2.34	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D|.	0.67145|.	0.996;0.995;0.992|.	D;P;P|.	0.65573|.	0.936;0.902;0.908|.	T|T	0.75619|0.75619	-0.3255|-0.3255	10|5	0.36615|.	T|.	0.2|.	-27.1228|-27.1228	15.1157|15.1157	0.72401|0.72401	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	168;151;151|.	B4DLN9;F5H1Q2;Q8NBI2|.	.;.;CYAC3_HUMAN|.	P|P	168;151;151;151;63;151;151|95	ENSP00000398979:L168P;ENSP00000294072:L151P;ENSP00000389745:L151P;ENSP00000437390:L151P;ENSP00000441085:L63P;ENSP00000443321:L151P;ENSP00000438725:L151P|.	ENSP00000294072:L151P|.	L|S	-|-	2|1	0|0	CYBASC3|CYBASC3	60877129|60877129	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.940000|0.940000	0.58332|0.58332	5.461000|5.461000	0.66699|0.66699	2.311000|2.311000	0.77944|0.77944	0.533000|0.533000	0.62120|0.62120	CTC|TCC	.		0.532	CYB561A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398714.2	NM_153611	
CPT1A	1374	ucsc.edu;bcgsc.ca	37	11	68527778	68527778	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:68527778G>A	ENST00000265641.5	-	17	2211	c.2057C>T	c.(2056-2058)aCa>aTa	p.T686I	CPT1A_ENST00000540367.1_Missense_Mutation_p.T686I|CPT1A_ENST00000376618.2_Missense_Mutation_p.T686I|CPT1A_ENST00000539743.1_Missense_Mutation_p.T686I|CPT1A_ENST00000537756.2_5'Flank	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	686					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	GGTCTGGCTTGTTGATAATCT	0.537																																					p.T686I		.											.	CPT1A	149	0			c.C2057T						.						61.0	53.0	56.0					11																	68527778		2200	4294	6494	SO:0001583	missense	1374	exon17			TGGCTTGTTGATA	L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.2057C>T	11.37:g.68527778G>A	ENSP00000265641:p.Thr686Ile	47.0	0.0		46.0	4.0	NM_001876	Q8TCU0|Q9BWK0	Missense_Mutation	SNP	ENST00000265641.5	37	CCDS8185.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.422152	0.83559	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2	4.46	4.46	0.54185	.	0.110120	0.64402	D	0.000007	D	0.96269	0.8783	H	0.98314	4.2	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79784	0.993;0.991	D	0.98095	1.0411	10	0.87932	D	0	.	17.6988	0.88289	0.0:0.0:1.0:0.0	.	686;686	P50416;P50416-2	CPT1A_HUMAN;.	I	686	ENSP00000439084:T686I;ENSP00000365803:T686I;ENSP00000265641:T686I;ENSP00000446108:T686I	ENSP00000265641:T686I	T	-	2	0	CPT1A	68284354	1.000000	0.71417	0.855000	0.33649	0.862000	0.49288	9.208000	0.95075	2.480000	0.83734	0.655000	0.94253	ACA	.		0.537	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876	
CYFIP1	23191	ucsc.edu;bcgsc.ca	37	15	22956491	22956491	+	Silent	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr15:22956491C>A	ENST00000313077.7	+	16	1853	c.1728C>A	c.(1726-1728)tcC>tcA	p.S576S	CYFIP1_ENST00000435939.2_Silent_p.S145S|CYFIP1_ENST00000560848.1_Silent_p.S576S	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		AAAGTGGTTCCAAGAAAACCT	0.408																																					p.S576S		.											.	CYFIP1	99	0			c.C1728A						.						78.0	74.0	75.0					15																	22956491		2203	4300	6503	SO:0001819	synonymous_variant	23191	exon16			TGGTTCCAAGAAA	D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.1728C>A	15.37:g.22956491C>A		39.0	0.0		47.0	4.0	NM_014608		Silent	SNP	ENST00000313077.7	37	CCDS10009.1																																																																																			.		0.408	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608	
DAB2	1601	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	39376177	39376177	+	Silent	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr5:39376177G>T	ENST00000320816.6	-	13	2636	c.2169C>A	c.(2167-2169)tcC>tcA	p.S723S	DAB2_ENST00000509337.1_Silent_p.S702S|DAB2_ENST00000339788.6_Silent_p.S505S|DAB2_ENST00000545653.1_Silent_p.S702S	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	723	Required for interaction with MYO6. {ECO:0000250}.|Sufficient for interaction with GRB2. {ECO:0000250}.|Sufficient for interaction with SH3KBP1 SH3 domain. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			TAACTGGCAGGGAAACTTGTC	0.433																																					p.S723S		.											.	DAB2	227	0			c.C2169A						.						100.0	102.0	101.0					5																	39376177		2203	4300	6503	SO:0001819	synonymous_variant	1601	exon13			TGGCAGGGAAACT	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.2169C>A	5.37:g.39376177G>T		66.0	0.0		77.0	34.0	NM_001343	A6NES5|Q13598|Q9BTY0|Q9UK04	Silent	SNP	ENST00000320816.6	37	CCDS34149.1																																																																																			.		0.433	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343	
DCHS1	8642	broad.mit.edu;mdanderson.org	37	11	6654287	6654287	+	Splice_Site	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:6654287C>A	ENST00000299441.3	-	6	2867	c.2456G>T	c.(2455-2457)gGt>gTt	p.G819V	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	819	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGCCAAGCGACCTAGGGAGGA	0.562																																					p.G819V		.											.	DCHS1	73	0			c.G2456T						.						44.0	46.0	45.0					11																	6654287		2201	4295	6496	SO:0001630	splice_region_variant	8642	exon6			AAGCGACCTAGGG	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.2456-1G>T	11.37:g.6654287C>A		18.0	0.0		24.0	6.0	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	15.36	2.810505	0.50421	.	.	ENSG00000166341	ENST00000299441	T	0.51574	0.7	4.71	4.71	0.59529	Cadherin (4);Cadherin-like (1);	0.000000	0.46442	D	0.000293	T	0.74321	0.3701	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79480	-0.1786	10	0.54805	T	0.06	.	15.3264	0.74168	0.0:1.0:0.0:0.0	.	819	Q96JQ0	PCD16_HUMAN	V	819	ENSP00000299441:G819V	ENSP00000299441:G819V	G	-	2	0	DCHS1	6610863	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	2.691000	0.47010	2.607000	0.88179	0.462000	0.41574	GGT	.		0.562	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	Missense_Mutation
DAK	26007	ucsc.edu;bcgsc.ca	37	11	61113369	61113369	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:61113369G>T	ENST00000394900.3	+	17	1755	c.1526G>T	c.(1525-1527)tGg>tTg	p.W509L	CYB561A3_ENST00000540317.1_5'Flank	NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	509	DhaL. {ECO:0000255|PROSITE- ProRule:PRU00813}.				carbohydrate phosphorylation (GO:0046835)|cellular carbohydrate metabolic process (GO:0044262)|glycerol metabolic process (GO:0006071)|innate immune response (GO:0045087)|regulation of innate immune response (GO:0045088)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|FAD-AMP lyase (cyclizing) activity (GO:0034012)|glycerone kinase activity (GO:0004371)|metal ion binding (GO:0046872)|triokinase activity (GO:0050354)			NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23						CTCCAAGCCTGGAAGAGCCCA	0.612																																					p.W509L		.											.	DAK	115	0			c.G1526T						.						65.0	67.0	66.0					11																	61113369		2203	4299	6502	SO:0001583	missense	26007	exon17			AAGCCTGGAAGAG		CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476			24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""				Standard	XM_005273898		Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.1526G>T	11.37:g.61113369G>T	ENSP00000378360:p.Trp509Leu	39.0	0.0		37.0	4.0	NM_015533	Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	Missense_Mutation	SNP	ENST00000394900.3	37	CCDS8003.1	.	.	.	.	.	.	.	.	.	.	G	9.076	0.998226	0.19043	.	.	ENSG00000149476	ENST00000394900;ENST00000529479	T;T	0.27256	1.68;1.68	5.91	3.88	0.44766	Dak phosphatase (3);	0.133129	0.52532	N	0.000080	T	0.06645	0.0170	N	0.00377	-1.585	0.36331	D	0.858899	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.17961	-1.0352	10	0.14656	T	0.56	-10.3243	12.4173	0.55500	0.0:0.0:0.4349:0.5651	.	509;509	Q2L9C1;Q3LXA3	.;DHAK_HUMAN	L	509;508	ENSP00000378360:W509L;ENSP00000432539:W508L	ENSP00000378360:W509L	W	+	2	0	DAK	60869945	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.798000	0.47884	1.484000	0.48361	0.655000	0.94253	TGG	.		0.612	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394425.4	NM_015533	
DDC	1644	ucsc.edu;bcgsc.ca	37	7	50607706	50607706	+	Silent	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:50607706G>T	ENST00000444124.2	-	3	422	c.222C>A	c.(220-222)ccC>ccA	p.P74P	AC018705.5_ENST00000454521.1_RNA|DDC_ENST00000431062.1_Silent_p.P74P|DDC_ENST00000357936.5_Silent_p.P74P|DDC_ENST00000426377.1_Intron|DDC_ENST00000380984.4_Silent_p.P74P|DDC_ENST00000489162.1_5'UTR	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	74	2 X approximate tandem repeats.				catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	CGAAGAAGTAGGGGCTGTGCC	0.642																																					p.P74P		.											.	DDC	92	0			c.C222A						.						103.0	83.0	90.0					7																	50607706		2202	4300	6502	SO:0001819	synonymous_variant	1644	exon3			GAAGTAGGGGCTG		CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.222C>A	7.37:g.50607706G>T		45.0	0.0		41.0	4.0	NM_001082971	C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Silent	SNP	ENST00000444124.2	37	CCDS5511.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.859848	0.51482	.	.	ENSG00000132437	ENST00000430300	T	0.55930	0.49	5.5	2.58	0.30949	.	0.000000	0.85682	D	0.000000	T	0.64616	0.2614	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69018	-0.5256	7	0.87932	D	0	-10.0293	13.3586	0.60642	0.0651:0.5328:0.402:0.0	.	.	.	.	H	40	ENSP00000389422:P40H	ENSP00000389422:P40H	P	-	2	0	DDC	50575200	0.101000	0.21875	0.938000	0.37757	0.988000	0.76386	-0.530000	0.06179	0.659000	0.30945	0.655000	0.94253	CCT	.		0.642	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342593.1		
DEPDC5	9681	ucsc.edu;bcgsc.ca	37	22	32211144	32211144	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr22:32211144C>A	ENST00000382112.3	+	20	1682	c.1612C>A	c.(1612-1614)Ccc>Acc	p.P538T	DEPDC5_ENST00000400249.2_Missense_Mutation_p.P538T|DEPDC5_ENST00000535622.1_Missense_Mutation_p.P538T|DEPDC5_ENST00000382105.2_Missense_Mutation_p.P538T|DEPDC5_ENST00000536766.1_Missense_Mutation_p.P510T|DEPDC5_ENST00000266091.3_Missense_Mutation_p.P538T|DEPDC5_ENST00000400242.3_Missense_Mutation_p.P538T|DEPDC5_ENST00000400248.2_Missense_Mutation_p.P538T|DEPDC5_ENST00000400246.1_Missense_Mutation_p.P538T|DEPDC5_ENST00000382111.2_Missense_Mutation_p.P538T	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	538					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						GATCCCACACCCCCACCTGCA	0.552																																					p.P538T		.											.	DEPDC5	519	0			c.C1612A						.						98.0	95.0	96.0					22																	32211144		2049	4201	6250	SO:0001583	missense	9681	exon21			CCACACCCCCACC	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.1612C>A	22.37:g.32211144C>A	ENSP00000371546:p.Pro538Thr	48.0	0.0		48.0	5.0	NM_001242897	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	ENST00000382112.3	37	CCDS46692.1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.889913	0.52014	.	.	ENSG00000100150	ENST00000535622;ENST00000536766;ENST00000400242;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	T;T;T;T;T;T;T;T;T;T	0.41758	1.57;1.55;0.99;1.96;1.95;1.95;1.53;1.96;1.95;1.95	6.01	2.23	0.28157	.	0.447368	0.26549	N	0.023751	T	0.32406	0.0828	L	0.58101	1.795	0.46542	D	0.999095	B;B;B;B;B;B	0.31680	0.335;0.078;0.02;0.051;0.085;0.01	B;B;B;B;B;B	0.25140	0.058;0.053;0.016;0.016;0.026;0.033	T	0.15578	-1.0432	10	0.33940	T	0.23	.	7.9148	0.29812	0.0:0.6842:0.1311:0.1847	.	538;510;538;538;538;538	B9EGN9;F5GYZ8;B4DH93;A8MPX9;O75140;O75140-2	.;.;.;.;DEPD5_HUMAN;.	T	538;510;538;538;538;538;538;538;538;538;538	ENSP00000440210:P538T;ENSP00000441358:P510T;ENSP00000383101:P538T;ENSP00000266091:P538T;ENSP00000383108:P538T;ENSP00000383105:P538T;ENSP00000371539:P538T;ENSP00000371546:P538T;ENSP00000371545:P538T;ENSP00000383107:P538T	ENSP00000266091:P538T	P	+	1	0	DEPDC5	30541144	0.067000	0.21026	0.993000	0.49108	0.995000	0.86356	0.838000	0.27572	1.568000	0.49683	0.558000	0.71614	CCC	.		0.552	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662	
DNAH9	1770	ucsc.edu;bcgsc.ca	37	17	11593141	11593141	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr17:11593141G>T	ENST00000262442.4	+	20	4070	c.4002G>T	c.(4000-4002)ttG>ttT	p.L1334F	DNAH9_ENST00000454412.2_Missense_Mutation_p.L1334F	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1334	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CCATGGAGTTGGAGTGCAAAC	0.557																																					p.L1334F		.											.	DNAH9	168	0			c.G4002T						.						44.0	36.0	38.0					17																	11593141		2203	4300	6503	SO:0001583	missense	1770	exon20			GGAGTTGGAGTGC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.4002G>T	17.37:g.11593141G>T	ENSP00000262442:p.Leu1334Phe	46.0	0.0		47.0	4.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	G	2.934	-0.220301	0.06061	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	T;T	0.61274	0.12;0.12	5.73	2.2	0.27929	Dynein heavy chain, domain-2 (1);	0.341211	0.22986	N	0.053242	T	0.42698	0.1214	L	0.50333	1.59	0.80722	D	1	B	0.06786	0.001	B	0.13407	0.009	T	0.13282	-1.0515	10	0.09843	T	0.71	.	5.8974	0.18947	0.1435:0.1115:0.6308:0.1142	.	1334	Q9NYC9	DYH9_HUMAN	F	1334	ENSP00000262442:L1334F;ENSP00000414874:L1334F	ENSP00000262442:L1334F	L	+	3	2	DNAH9	11533866	0.015000	0.18098	0.764000	0.31436	0.870000	0.49936	0.038000	0.13862	0.762000	0.33152	-0.152000	0.13540	TTG	.		0.557	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
DOCK10	55619	ucsc.edu;bcgsc.ca	37	2	225634958	225634958	+	Silent	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:225634958G>T	ENST00000258390.7	-	55	6481	c.6414C>A	c.(6412-6414)ctC>ctA	p.L2138L	DOCK10_ENST00000409592.3_Silent_p.L2132L	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	2138	DHR-2.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AGAGTTCGCTGAGCATGTCCT	0.552																																					p.L2138L		.											.	DOCK10	92	0			c.C6414A						.						105.0	103.0	104.0					2																	225634958		2103	4218	6321	SO:0001819	synonymous_variant	55619	exon55			TTCGCTGAGCATG	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.6414C>A	2.37:g.225634958G>T		34.0	0.0		46.0	4.0	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Silent	SNP	ENST00000258390.7	37	CCDS46528.1																																																																																			.		0.552	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
DPP3	10072	ucsc.edu;bcgsc.ca	37	11	66262718	66262718	+	Silent	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:66262718C>A	ENST00000360510.2	+	13	1496	c.1431C>A	c.(1429-1431)atC>atA	p.I477I	DPP3_ENST00000541961.1_Silent_p.I477I|DPP3_ENST00000531863.1_Silent_p.I497I|DPP3_ENST00000530165.1_Silent_p.I447I|DPP3_ENST00000453114.1_Silent_p.I477I|DPP3_ENST00000532677.1_Silent_p.I496I|DPP3_ENST00000533799.1_3'UTR			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	477					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						AAACAGTGATCAACCCAGAGA	0.622																																					p.I477I		.											.	DPP3	46	0			c.C1431A						.						79.0	80.0	80.0					11																	66262718		2200	4295	6495	SO:0001819	synonymous_variant	10072	exon13			AGTGATCAACCCA	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.1431C>A	11.37:g.66262718C>A		33.0	0.0		25.0	4.0	NM_130443	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Silent	SNP	ENST00000360510.2	37	CCDS8141.1																																																																																			.		0.622	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393424.2		
DPP6	1804	ucsc.edu;bcgsc.ca	37	7	154172081	154172081	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:154172081A>G	ENST00000377770.3	+	3	557	c.416A>G	c.(415-417)gAa>gGa	p.E139G	DPP6_ENST00000427557.1_Missense_Mutation_p.E77G|DPP6_ENST00000496611.1_3'UTR|DPP6_ENST00000332007.3_Missense_Mutation_p.E77G|DPP6_ENST00000404039.1_Missense_Mutation_p.E75G|DPP6_ENST00000406326.1_Missense_Mutation_p.E139G			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	139					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CTCTTCAGTGAAGACTTCAAA	0.423																																					p.E139G	NSCLC(125;1384 1783 2490 7422 34254)	.											.	DPP6	652	0			c.A416G						.						91.0	89.0	90.0					7																	154172081		1919	4132	6051	SO:0001583	missense	1804	exon3			TCAGTGAAGACTT	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.416A>G	7.37:g.154172081A>G	ENSP00000367001:p.Glu139Gly	37.0	0.0		38.0	4.0	NM_130797		Missense_Mutation	SNP	ENST00000377770.3	37		.	.	.	.	.	.	.	.	.	.	A	12.69	2.012694	0.35511	.	.	ENSG00000130226	ENST00000404039;ENST00000406326;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T;T	0.27256	1.68;1.68;1.68;1.68;1.68	5.17	3.98	0.46160	.	0.741534	0.13533	N	0.380801	T	0.12433	0.0302	.	.	.	0.29027	N	0.885921	B;B;B;B;B;B	0.15719	0.0;0.0;0.0;0.0;0.014;0.0	B;B;B;B;B;B	0.15870	0.002;0.001;0.001;0.0;0.014;0.001	T	0.20874	-1.0262	9	0.09843	T	0.71	-9.9633	8.3887	0.32516	0.7421:0.2579:0.0:0.0	.	77;77;77;139;139;75	E9PDL2;B7Z1K3;P42658-2;P42658;Q8IYG9;E9PF59	.;.;.;DPP6_HUMAN;.;.	G	75;139;139;77;77	ENSP00000385578:E75G;ENSP00000384393:E139G;ENSP00000367001:E139G;ENSP00000328226:E77G;ENSP00000397303:E77G	ENSP00000328226:E77G	E	+	2	0	DPP6	153803014	0.106000	0.21978	0.951000	0.38953	0.989000	0.77384	0.479000	0.22228	2.067000	0.61834	0.455000	0.32223	GAA	.		0.423	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
EGR2	1959	ucsc.edu;bcgsc.ca	37	10	64575691	64575691	+	Silent	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr10:64575691G>A	ENST00000242480.3	-	1	424	c.99C>T	c.(97-99)gcC>gcT	p.A33A	EGR2_ENST00000411732.1_5'UTR|EGR2_ENST00000439032.1_Silent_p.A33A|EGR2_ENST00000493899.2_5'UTR	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	33					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					TCACCGACGTGGCGGCGAGGT	0.587																																					p.A33A		.											.	EGR2	92	0			c.C99T						.						156.0	143.0	148.0					10																	64575691		2203	4300	6503	SO:0001819	synonymous_variant	1959	exon1			CGACGTGGCGGCG	BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.99C>T	10.37:g.64575691G>A		32.0	0.0		47.0	4.0	NM_000399	B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Silent	SNP	ENST00000242480.3	37	CCDS7267.1																																																																																			.		0.587	EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048245.2	NM_000399	
EIF4G2	1982	ucsc.edu;bcgsc.ca	37	11	10828411	10828411	+	Silent	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:10828411T>C	ENST00000526148.1	-	3	573	c.63A>G	c.(61-63)ggA>ggG	p.G21G	EIF4G2_ENST00000525681.1_Silent_p.G21G|EIF4G2_ENST00000525995.1_5'UTR|RP11-685M7.3_ENST00000499765.1_RNA|EIF4G2_ENST00000339995.5_Silent_p.G21G|EIF4G2_ENST00000396525.2_Silent_p.G21G	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		CACCCCTACTTCCTCCTCCGC	0.378																																					p.G21G		.											.	EIF4G2	91	0			c.A63G						.						139.0	131.0	134.0					11																	10828411		2201	4294	6495	SO:0001819	synonymous_variant	1982	exon3			CCTACTTCCTCCT	U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.63A>G	11.37:g.10828411T>C		39.0	0.0		45.0	4.0	NM_001042559		Silent	SNP	ENST00000526148.1	37	CCDS31428.1																																																																																			.		0.378	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386603.1	NM_001418	
ELFN1	392617	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	1784476	1784476	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:1784476C>T	ENST00000424383.2	+	3	731	c.244C>T	c.(244-246)Cgc>Tgc	p.R82C	ELFN1_ENST00000541472.1_Missense_Mutation_p.R82C|AC074389.9_ENST00000453348.1_lincRNA|ELFN1_ENST00000561626.1_Missense_Mutation_p.R82C			P0C7U0	ELFN1_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 1	82					negative regulation of phosphatase activity (GO:0010923)|synapse organization (GO:0050808)	dendrite (GO:0030425)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)	1						CTCGCTCAGCCGCTTTGGCAA	0.612																																					p.R82C		.											.	.	.	0			c.C244T						.						193.0	176.0	181.0					7																	1784476		692	1591	2283	SO:0001583	missense	392617	exon2			CTCAGCCGCTTTG		CCDS59046.1	7p22.3	2013-02-11	2011-10-27	2011-10-27	ENSG00000225968	ENSG00000225968		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	33154	protein-coding gene	gene with protein product		614964	"""extracellular leucine-rich repeat and fibronectin type III containing 1"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 1"", ""protein phosphatase 1, regulatory subunit 28"""	PPP1R28		17868438	Standard	NM_001128636		Approved		uc010ksg.2	P0C7U0	OTTHUMG00000151495	ENST00000424383.2:c.244C>T	7.37:g.1784476C>T	ENSP00000456548:p.Arg82Cys	65.0	0.0		55.0	9.0	NM_001128636	H3BS57	Missense_Mutation	SNP	ENST00000424383.2	37	CCDS59046.1																																																																																			.		0.612	ELFN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322893.2	NM_001128636	
EML5	161436	broad.mit.edu;bcgsc.ca	37	14	89124556	89124556	+	Silent	SNP	G	G	T	rs568412615		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr14:89124556G>T	ENST00000380664.5	-	26	3851	c.3852C>A	c.(3850-3852)tcC>tcA	p.S1284S	EML5_ENST00000352093.5_Silent_p.S1246S|EML5_ENST00000554922.1_Silent_p.S1284S			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1284						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						AATCAATGTCGGATTCTTCAC	0.378																																					p.S1284S		.											.	EML5	93	0			c.C3852A						.						116.0	104.0	108.0					14																	89124556		1849	4093	5942	SO:0001819	synonymous_variant	161436	exon26			AATGTCGGATTCT	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.3852C>A	14.37:g.89124556G>T		96.0	1.0		125.0	7.0	NM_183387	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Silent	SNP	ENST00000380664.5	37	CCDS45148.1																																																																																			.		0.378	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
ETS2	2114	ucsc.edu;bcgsc.ca	37	21	40186314	40186314	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr21:40186314A>G	ENST00000360214.3	+	5	762	c.302A>G	c.(301-303)aAg>aGg	p.K101R	ETS2_ENST00000360938.3_Missense_Mutation_p.K101R	NM_001256295.1	NP_001243224.1	P15036	ETS2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 2	101	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				GGCATTCCAAAGAGTAAGTAC	0.468																																					p.K241R		.											.	ETS2	849	0			c.A722G						.						54.0	56.0	55.0					21																	40186314		2203	4300	6503	SO:0001583	missense	2114	exon5			TTCCAAAGAGTAA		CCDS13659.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157557	ENSG00000157557			3489	protein-coding gene	gene with protein product		164740	"""v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)"""			17986575	Standard	NM_001256295		Approved		uc002yxf.3	P15036	OTTHUMG00000090769	ENST00000360214.3:c.302A>G	21.37:g.40186314A>G	ENSP00000353344:p.Lys101Arg	32.0	0.0		43.0	4.0	NM_001256295	A6NM68|D3DSH6|Q53Y89	Missense_Mutation	SNP	ENST00000360214.3	37	CCDS13659.1	.	.	.	.	.	.	.	.	.	.	A	9.595	1.127206	0.20959	.	.	ENSG00000157557	ENST00000360214;ENST00000360938;ENST00000432278;ENST00000456966	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.53	4.34	0.51931	Sterile alpha motif/pointed domain (2);Pointed domain (3);	.	.	.	.	T	0.25158	0.0611	L	0.46614	1.455	0.28801	N	0.898756	B;P	0.36010	0.334;0.532	B;B	0.35413	0.154;0.202	T	0.19745	-1.0296	9	0.45353	T	0.12	.	5.5321	0.16990	0.7078:0.1494:0.1429:0.0	.	101;101	P15036;C9JAG2	ETS2_HUMAN;.	R	101	ENSP00000353344:K101R;ENSP00000354194:K101R;ENSP00000401273:K101R;ENSP00000411086:K101R	ENSP00000353344:K101R	K	+	2	0	ETS2	39108184	1.000000	0.71417	0.975000	0.42487	0.020000	0.10135	3.255000	0.51484	0.992000	0.38840	0.533000	0.62120	AAG	.		0.468	ETS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207544.1		
EXOC4	60412	ucsc.edu;bcgsc.ca	37	7	133689750	133689750	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:133689750C>T	ENST00000253861.4	+	16	2463	c.2434C>T	c.(2434-2436)Ccc>Tcc	p.P812S	EXOC4_ENST00000541309.1_Missense_Mutation_p.P100S|EXOC4_ENST00000539845.1_Missense_Mutation_p.P711S|EXOC4_ENST00000545148.1_Missense_Mutation_p.P422S	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	812					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				GGATTATGACCCCCTGGTGGT	0.478																																					p.P812S		.											.	EXOC4	159	0			c.C2434T						.						134.0	124.0	127.0					7																	133689750		2203	4300	6503	SO:0001583	missense	60412	exon16			TATGACCCCCTGG	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.2434C>T	7.37:g.133689750C>T	ENSP00000253861:p.Pro812Ser	43.0	0.0		41.0	4.0	NM_021807	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	ENST00000253861.4	37	CCDS5829.1	.	.	.	.	.	.	.	.	.	.	C	19.85	3.904243	0.72868	.	.	ENSG00000131558	ENST00000253861;ENST00000546185;ENST00000539845;ENST00000545148;ENST00000541309	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.65460	0.2693	L	0.43152	1.355	0.80722	D	1	P;P;D	0.63880	0.936;0.754;0.993	P;P;P	0.55923	0.64;0.623;0.787	T	0.61307	-0.7089	9	0.33940	T	0.23	.	19.5441	0.95284	0.0:1.0:0.0:0.0	.	344;422;812	B7Z689;F5GZT1;Q96A65	.;.;EXOC4_HUMAN	S	812;431;711;422;100	.	ENSP00000253861:P812S	P	+	1	0	EXOC4	133340290	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.617000	0.54181	2.618000	0.88619	0.591000	0.81541	CCC	.		0.478	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807	
EYS	346007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	65300537	65300537	+	Silent	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr6:65300537A>G	ENST00000370621.3	-	26	5749	c.5223T>C	c.(5221-5223)gaT>gaC	p.D1741D	EYS_ENST00000503581.1_Silent_p.D1741D|EYS_ENST00000370616.2_Silent_p.D1741D			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1741					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CCAGAGAACTATCACTTGGGT	0.343																																					p.D1741D		.											.	EYS	660	0			c.T5223C						.						36.0	33.0	34.0					6																	65300537		692	1590	2282	SO:0001819	synonymous_variant	346007	exon26			AGAACTATCACTT		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.5223T>C	6.37:g.65300537A>G		128.0	0.0		125.0	21.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	ENST00000370621.3	37																																																																																				.		0.343	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
FAM129B	64855	ucsc.edu;bcgsc.ca	37	9	130279192	130279192	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr9:130279192C>T	ENST00000373312.3	-	8	1130	c.917G>A	c.(916-918)cGa>cAa	p.R306Q	FAM129B_ENST00000373314.3_Missense_Mutation_p.R293Q|FAM129B_ENST00000468379.1_Intron	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	306					negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						CATGTCAGTTCGGATGACGGC	0.637																																					p.R306Q		.											.	FAM129B	68	0			c.G917A						.						205.0	193.0	197.0					9																	130279192		2203	4300	6503	SO:0001583	missense	64855	exon8			TCAGTTCGGATGA	AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.917G>A	9.37:g.130279192C>T	ENSP00000362409:p.Arg306Gln	36.0	0.0		37.0	4.0	NM_022833	Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Missense_Mutation	SNP	ENST00000373312.3	37	CCDS35145.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.144244	0.77888	.	.	ENSG00000136830	ENST00000373314;ENST00000373312	T;T	0.34859	1.35;1.34	4.77	4.77	0.60923	.	0.056284	0.64402	D	0.000001	T	0.60483	0.2272	M	0.74647	2.275	0.46185	D	0.998916	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.65582	-0.6133	10	0.72032	D	0.01	-29.3813	15.3057	0.73990	0.0:1.0:0.0:0.0	.	293;306	Q96TA1-2;Q96TA1	.;NIBL1_HUMAN	Q	293;306	ENSP00000362411:R293Q;ENSP00000362409:R306Q	ENSP00000362409:R306Q	R	-	2	0	FAM129B	129319013	1.000000	0.71417	0.998000	0.56505	0.287000	0.27160	7.190000	0.77755	2.193000	0.70182	0.655000	0.94253	CGA	.		0.637	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054196.1	NM_022833	
FAM171A1	221061	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	15255747	15255747	+	Silent	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr10:15255747G>A	ENST00000378116.4	-	8	1846	c.1840C>T	c.(1840-1842)Cta>Tta	p.L614L	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	614						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						TCAGCCTGTAGTCTTTCTATC	0.592																																					p.L614L		.											.	FAM171A1	138	0			c.C1840T						.						65.0	73.0	70.0					10																	15255747		2203	4300	6503	SO:0001819	synonymous_variant	221061	exon8			CCTGTAGTCTTTC	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1840C>T	10.37:g.15255747G>A		78.0	0.0		68.0	13.0	NM_001010924	D3DRT9|Q32M49|Q8N4I0	Silent	SNP	ENST00000378116.4	37	CCDS31154.1																																																																																			.		0.592	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709	
FAM216B	144809	ucsc.edu;bcgsc.ca	37	13	43360911	43360911	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr13:43360911G>A	ENST00000537894.1	+	3	235	c.112G>A	c.(112-114)Ggg>Agg	p.G38R	FAM216B_ENST00000313851.1_Missense_Mutation_p.G38R	NM_182508.2	NP_872314.1	Q8N7L0	F216B_HUMAN	family with sequence similarity 216, member B	38																	CCTCAACCAAGGGCAACAGCG	0.473																																					p.G38R		.											.	.	.	0			c.G112A						.						125.0	122.0	123.0					13																	43360911		2203	4300	6503	SO:0001583	missense	144809	exon3			AACCAAGGGCAAC	AK098238	CCDS9386.1	13q14.11	2012-02-07	2012-02-07	2012-02-07	ENSG00000179813	ENSG00000179813			26883	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 30"""	C13orf30			Standard	NM_182508		Approved	FLJ40919	uc010tfk.2	Q8N7L0	OTTHUMG00000016809	ENST00000537894.1:c.112G>A	13.37:g.43360911G>A	ENSP00000445786:p.Gly38Arg	33.0	0.0		38.0	4.0	NM_182508	B1ALI3	Missense_Mutation	SNP	ENST00000537894.1	37	CCDS9386.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.598449	0.46318	.	.	ENSG00000179813	ENST00000537894;ENST00000313851	T;T	0.77877	-1.13;-1.13	5.41	4.55	0.56014	.	0.000000	0.49916	D	0.000122	D	0.85375	0.5682	M	0.71581	2.175	0.24455	N	0.994465	D	0.89917	1.0	D	0.91635	0.999	T	0.76724	-0.2854	10	0.72032	D	0.01	-15.6489	10.3049	0.43674	0.0911:0.0:0.9089:0.0	.	38	Q8N7L0	CM030_HUMAN	R	38	ENSP00000445786:G38R;ENSP00000319336:G38R	ENSP00000319336:G38R	G	+	1	0	C13orf30	42258911	0.988000	0.35896	0.957000	0.39632	0.183000	0.23260	2.147000	0.42226	2.816000	0.96949	0.563000	0.77884	GGG	.		0.473	FAM216B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044705.2	NM_182508	
FAM73B	84895	ucsc.edu;bcgsc.ca	37	9	131832221	131832221	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr9:131832221G>T	ENST00000358369.4	+	15	1778	c.1552G>T	c.(1552-1554)Gct>Tct	p.A518S	FAM73B_ENST00000277475.5_3'UTR|FAM73B_ENST00000406926.2_3'UTR	NM_032809.2	NP_116198.2	Q7L4E1	FA73B_HUMAN	family with sequence similarity 73, member B	518					bone development (GO:0060348)	integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)	13						GCCTCAGCTTGCTGAAGTCTG	0.562																																					p.A518S		.											.	FAM73B	91	0			c.G1552T						.						210.0	202.0	204.0					9																	131832221		2203	4300	6503	SO:0001583	missense	84895	exon15			CAGCTTGCTGAAG	AK074127	CCDS6917.1	9q34.13	2008-02-05	2005-08-11	2005-08-11	ENSG00000148343	ENSG00000148343			23621	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 54"""	C9orf54			Standard	NM_032809		Approved	FLJ14596, FLJ00199	uc004bxa.3	Q7L4E1	OTTHUMG00000020770	ENST00000358369.4:c.1552G>T	9.37:g.131832221G>T	ENSP00000351138:p.Ala518Ser	32.0	0.0		48.0	4.0	NM_032809	Q8NBM3|Q8TEJ6|Q969E6	Missense_Mutation	SNP	ENST00000358369.4	37	CCDS6917.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491908	0.44352	.	.	ENSG00000148343	ENST00000358369	T	0.21031	2.03	5.62	-9.07	0.00724	.	0.656162	0.16820	N	0.198219	T	0.07503	0.0189	N	0.08118	0	0.19300	N	0.999971	B;B	0.21688	0.059;0.0	B;B	0.19666	0.026;0.001	T	0.25745	-1.0123	10	0.20519	T	0.43	.	12.7678	0.57401	0.1135:0.0:0.1726:0.7139	.	94;518	Q96NP4;Q7L4E1	.;FA73B_HUMAN	S	518	ENSP00000351138:A518S	ENSP00000351138:A518S	A	+	1	0	FAM73B	130872042	0.001000	0.12720	0.014000	0.15608	0.987000	0.75469	0.019000	0.13444	-1.541000	0.01727	0.655000	0.94253	GCT	.		0.562	FAM73B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054542.7	NM_032809	
FBXO34	55030	ucsc.edu;bcgsc.ca	37	14	55819116	55819116	+	Silent	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr14:55819116C>A	ENST00000313833.4	+	2	2253	c.2008C>A	c.(2008-2010)Cgg>Agg	p.R670R	FBXO34_ENST00000440021.1_Silent_p.R670R	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	670										breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						GTGCTGCCACCGGTCTCAGAA	0.532																																					p.R670R		.											.	FBXO34	228	0			c.C2008A						.						59.0	59.0	59.0					14																	55819116		2203	4300	6503	SO:0001819	synonymous_variant	55030	exon2			TGCCACCGGTCTC	AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.2008C>A	14.37:g.55819116C>A		30.0	0.0		45.0	4.0	NM_017943	Q2VPB5|Q4VBP5|Q86TY4	Silent	SNP	ENST00000313833.4	37	CCDS32086.1																																																																																			.		0.532	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411322.1		
FLRT3	23767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	14306475	14306475	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr20:14306475A>T	ENST00000378053.3	-	2	1934	c.1678T>A	c.(1678-1680)Tca>Aca	p.S560T	MACROD2_ENST00000310348.4_Intron|FLRT3_ENST00000341420.4_Missense_Mutation_p.S560T|MACROD2_ENST00000217246.4_Intron	NM_013281.3	NP_037413.1	Q9NZU0	FLRT3_HUMAN	fibronectin leucine rich transmembrane protein 3	560					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Colorectal(1;0.0464)	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)		CAGTTCCTTGAGAAGAGCGAT	0.468																																					p.S560T		.											.	FLRT3	91	0			c.T1678A						.						149.0	137.0	141.0					20																	14306475		2203	4300	6503	SO:0001583	missense	23767	exon2			TCCTTGAGAAGAG	AF169677	CCDS13121.1	20p11	2013-02-11			ENSG00000125848	ENSG00000125848		"""Fibronectin type III domain containing"""	3762	protein-coding gene	gene with protein product		604808				10644439	Standard	NM_198391		Approved		uc002wow.2	Q9NZU0	OTTHUMG00000031914	ENST00000378053.3:c.1678T>A	20.37:g.14306475A>T	ENSP00000367292:p.Ser560Thr	146.0	0.0		154.0	31.0	NM_013281	D3DW20|Q542Z9|Q96K39|Q96K42|Q96KB1|Q9P259	Missense_Mutation	SNP	ENST00000378053.3	37	CCDS13121.1	.	.	.	.	.	.	.	.	.	.	A	10.34	1.321824	0.23994	.	.	ENSG00000125848	ENST00000378053;ENST00000341420;ENST00000541882	T;T	0.62364	0.03;0.03	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.45337	0.1337	N	0.05351	-0.065	0.80722	D	1	B	0.21147	0.052	B	0.27796	0.083	T	0.38714	-0.9648	10	0.22706	T	0.39	-10.4485	16.4781	0.84144	1.0:0.0:0.0:0.0	.	560	Q9NZU0	FLRT3_HUMAN	T	560	ENSP00000367292:S560T;ENSP00000339912:S560T	ENSP00000339912:S560T	S	-	1	0	FLRT3	14254475	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	9.339000	0.96797	2.288000	0.76882	0.528000	0.53228	TCA	.		0.468	FLRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078075.1	NM_013281	
FNBP4	23360	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	47745708	47745708	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:47745708G>A	ENST00000263773.5	-	14	2348	c.2336C>T	c.(2335-2337)aCc>aTc	p.T779I	Y_RNA_ENST00000363220.1_RNA	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	779						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						ACTAGAGATGGTGGAATCAAC	0.443																																					p.T779I		.											.	FNBP4	91	0			c.C2336T						.						111.0	109.0	110.0					11																	47745708		1873	4117	5990	SO:0001583	missense	23360	exon14			GAGATGGTGGAAT	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.2336C>T	11.37:g.47745708G>A	ENSP00000263773:p.Thr779Ile	54.0	0.0		52.0	10.0	NM_015308	Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	37	CCDS41644.1	.	.	.	.	.	.	.	.	.	.	G	6.441	0.449547	0.12223	.	.	ENSG00000109920	ENST00000263773	T	0.49432	0.78	5.28	3.28	0.37604	.	0.932851	0.09231	N	0.830508	T	0.36963	0.0986	L	0.36672	1.1	0.09310	N	1	B	0.17038	0.02	B	0.09377	0.004	T	0.30966	-0.9960	10	0.72032	D	0.01	-0.8284	6.0834	0.19954	0.2015:0.3459:0.4525:0.0	.	779	Q8N3X1	FNBP4_HUMAN	I	779	ENSP00000263773:T779I	ENSP00000263773:T779I	T	-	2	0	FNBP4	47702284	0.001000	0.12720	0.026000	0.17262	0.243000	0.25628	0.833000	0.27504	1.166000	0.42689	0.561000	0.74099	ACC	.		0.443	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
FNIP2	57600	ucsc.edu;bcgsc.ca	37	4	159791478	159791478	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr4:159791478A>G	ENST00000264433.6	+	14	2881	c.2806A>G	c.(2806-2808)Agc>Ggc	p.S936G	FNIP2_ENST00000379346.3_Missense_Mutation_p.S959G	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	936					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		TCAGAGCATCAGCACCCAGAA	0.448																																					p.S936G		.											.	FNIP2	68	0			c.A2806G						.						101.0	99.0	100.0					4																	159791478		2003	4178	6181	SO:0001583	missense	57600	exon14			AGCATCAGCACCC	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.2806A>G	4.37:g.159791478A>G	ENSP00000264433:p.Ser936Gly	35.0	0.0		38.0	4.0	NM_020840	Q05DC3|Q96I31|Q9H994	Missense_Mutation	SNP	ENST00000264433.6	37	CCDS47155.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.309461	0.81247	.	.	ENSG00000052795	ENST00000264433;ENST00000379346	T;T	0.25085	1.82;1.82	5.74	5.74	0.90152	.	0.104015	0.85682	D	0.000000	T	0.45216	0.1331	M	0.81239	2.535	0.51012	D	0.999905	P	0.38395	0.629	P	0.48334	0.574	T	0.37641	-0.9697	9	.	.	.	.	16.0368	0.80635	1.0:0.0:0.0:0.0	.	936	Q9P278	FNIP2_HUMAN	G	936;959	ENSP00000264433:S936G;ENSP00000368651:S959G	.	S	+	1	0	FNIP2	160010928	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.319000	0.65835	2.183000	0.69458	0.533000	0.62120	AGC	.		0.448	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840	
FSCN1	6624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	5645021	5645021	+	Silent	SNP	C	C	T	rs568861608		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:5645021C>T	ENST00000382361.3	+	5	1512	c.1398C>T	c.(1396-1398)ggC>ggT	p.G466G	FSCN1_ENST00000340250.6_Silent_p.G445G	NM_003088.3	NP_003079.1	Q16658	FSCN1_HUMAN	fascin actin-bundling protein 1	466					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|cell motility (GO:0048870)|cell proliferation (GO:0008283)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|invadopodium (GO:0071437)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|drug binding (GO:0008144)|poly(A) RNA binding (GO:0044822)	p.G466G(1)		central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;1.21e-13)		TCAAGGTGGGCGGGCGCTACC	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		16633	0.0		0.0	False		,,,				2504	0.001				p.G466G		.											.	FSCN1	91	1	Substitution - coding silent(1)	large_intestine(1)	c.C1398T						.						52.0	45.0	48.0					7																	5645021		2203	4300	6503	SO:0001819	synonymous_variant	6624	exon5			GGTGGGCGGGCGC	U03057	CCDS5342.1	7p22	2014-02-03	2014-02-03	2002-09-20	ENSG00000075618	ENSG00000075618		"""Fascins"""	11148	protein-coding gene	gene with protein product	"""Singed, drosophila, homolog-like"", ""actin bundling protein"""	602689	"""singed (Drosophila)-like (sea urchin fascin homolog like)"", ""fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)"""	SNL		8068206, 10783262	Standard	NM_003088		Approved	p55, FLJ38511	uc003sou.3	Q16658	OTTHUMG00000090599	ENST00000382361.3:c.1398C>T	7.37:g.5645021C>T		55.0	0.0		50.0	12.0	NM_003088	A6NI89|B2RE97|Q96IC5|Q96IH1|Q9BRF1	Silent	SNP	ENST00000382361.3	37	CCDS5342.1																																																																																			.		0.657	FSCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207153.3	NM_003088	
GALC	2581	broad.mit.edu;ucsc.edu;mdanderson.org	37	14	88416215	88416215	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr14:88416215G>C	ENST00000261304.2	-	12	1418	c.1312C>G	c.(1312-1314)Ctt>Gtt	p.L438V	GALC_ENST00000393568.4_Missense_Mutation_p.L415V|GALC_ENST00000393569.2_Missense_Mutation_p.L412V|GALC_ENST00000544807.2_Missense_Mutation_p.L382V	NM_000153.3|NM_001201401.1	NP_000144.2|NP_001188330.1	P54803	GALC_HUMAN	galactosylceramidase	438					carbohydrate metabolic process (GO:0005975)|galactosylceramide catabolic process (GO:0006683)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	galactosylceramidase activity (GO:0004336)			endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TGCTTAAAAAGAAATCTTTCG	0.328																																					p.L438V		.											.	GALC	90	0			c.C1312G						.						98.0	92.0	94.0					14																	88416215		1793	4063	5856	SO:0001583	missense	2581	exon12			TAAAAAGAAATCT	L23116	CCDS9878.2, CCDS55936.1, CCDS55937.1	14q31	2009-01-06	2005-11-29		ENSG00000054983	ENSG00000054983	3.2.1.46		4115	protein-coding gene	gene with protein product	"""Krabbe disease"""	606890	"""galactosylceramidase (Krabbe disease)"""				Standard	NM_000153		Approved		uc001xvt.3	P54803	OTTHUMG00000028646	ENST00000261304.2:c.1312C>G	14.37:g.88416215G>C	ENSP00000261304:p.Leu438Val	65.0	1.0		58.0	11.0	NM_000153	B4DKE8|B4DYN1|B4DZJ8|B7Z7Z2|J3KN25|J3KPP8|Q8J030	Missense_Mutation	SNP	ENST00000261304.2	37	CCDS9878.2	.	.	.	.	.	.	.	.	.	.	G	5.380	0.255329	0.10185	.	.	ENSG00000054983	ENST00000261304;ENST00000544807;ENST00000393569;ENST00000539620;ENST00000393568	D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22	5.57	1.08	0.20341	.	0.407958	0.26560	N	0.023683	D	0.84224	0.5425	L	0.28192	0.835	0.09310	N	1	B;B;B;B	0.24132	0.028;0.098;0.065;0.036	B;B;B;B	0.27076	0.046;0.076;0.067;0.076	T	0.68765	-0.5322	10	0.17369	T	0.5	-2.835	3.7506	0.08565	0.2417:0.0:0.4424:0.3159	.	382;415;412;438	P54803-5;E7EPA4;P54803-4;P54803	.;.;.;GALC_HUMAN	V	438;382;412;227;415	ENSP00000261304:L438V;ENSP00000437513:L382V;ENSP00000377199:L412V;ENSP00000377198:L415V	ENSP00000261304:L438V	L	-	1	0	GALC	87485968	0.200000	0.23398	0.470000	0.27216	0.891000	0.51852	0.989000	0.29629	0.290000	0.22444	0.557000	0.71058	CTT	.		0.328	GALC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071559.2		
GANAB	23193	ucsc.edu;bcgsc.ca	37	11	62394348	62394348	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:62394348G>A	ENST00000356638.3	-	20	2397	c.2381C>T	c.(2380-2382)cCt>cTt	p.P794L	GANAB_ENST00000534779.1_Missense_Mutation_p.P702L|GANAB_ENST00000540933.1_Missense_Mutation_p.P697L|GANAB_ENST00000346178.4_Missense_Mutation_p.P816L	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	794					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	TAGAGTTACAGGCAGGTACAG	0.512																																					p.P816L	Melanoma(23;1005 1074 15747 18937)	.											.	GANAB	94	0			c.C2447T						.						58.0	53.0	55.0					11																	62394348		2202	4299	6501	SO:0001583	missense	23193	exon21			GTTACAGGCAGGT	AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.2381C>T	11.37:g.62394348G>A	ENSP00000349053:p.Pro794Leu	56.0	1.0		35.0	4.0	NM_198335	A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	ENST00000356638.3	37	CCDS8026.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.464612	0.84425	.	.	ENSG00000089597	ENST00000346178;ENST00000356638;ENST00000534779;ENST00000540933	D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	D	0.93897	0.8047	M	0.89840	3.065	0.80722	D	1	P;P;P;B	0.41546	0.754;0.754;0.737;0.072	P;P;B;B	0.46510	0.519;0.519;0.319;0.213	D	0.95066	0.8200	10	0.87932	D	0	-15.6919	15.7443	0.77926	0.0:0.0:1.0:0.0	.	680;702;794;816	B4DIW2;E9PKU7;Q14697;Q14697-2	.;.;GANAB_HUMAN;.	L	816;794;702;697	ENSP00000340466:P816L;ENSP00000349053:P794L;ENSP00000435306:P702L;ENSP00000442962:P697L	ENSP00000340466:P816L	P	-	2	0	GANAB	62150924	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	8.724000	0.91462	2.564000	0.86499	0.561000	0.74099	CCT	.		0.512	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395689.1	NM_198334	
GIT2	9815	broad.mit.edu;bcgsc.ca	37	12	110390905	110390905	+	Silent	SNP	G	G	T	rs143551429		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:110390905G>T	ENST00000355312.3	-	13	1233	c.1234C>A	c.(1234-1236)Cgg>Agg	p.R412R	GIT2_ENST00000338373.5_Silent_p.R412R|TCHP_ENST00000550780.1_Intron|GIT2_ENST00000343646.5_Intron|GIT2_ENST00000547815.1_Silent_p.R412R|GIT2_ENST00000361006.5_Silent_p.R412R|GIT2_ENST00000360185.4_Silent_p.R412R|GIT2_ENST00000354574.4_Silent_p.R414R|GIT2_ENST00000356259.4_Silent_p.R412R|GIT2_ENST00000551209.1_Silent_p.R411R|GIT2_ENST00000320063.9_Silent_p.R412R|GIT2_ENST00000553118.1_Silent_p.R412R|GIT2_ENST00000457474.2_Silent_p.R414R	NM_057169.3	NP_476510.1	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 2	412					behavioral response to pain (GO:0048266)|regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|skin(4)	27						ACCTTCTGCCGGTTTGTTTTG	0.547																																					p.R414R		.											.	GIT2	226	0			c.C1240A						.						213.0	162.0	179.0					12																	110390905		2203	4300	6503	SO:0001819	synonymous_variant	9815	exon14			TCTGCCGGTTTGT	AF124491	CCDS9138.1, CCDS9139.1, CCDS44968.1, CCDS44969.1, CCDS55884.1	12q24.1	2013-01-10	2008-09-05			ENSG00000139436		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4273	protein-coding gene	gene with protein product		608564	"""G protein-coupled receptor kinase interactor 2"""			9826657, 10896954	Standard	NM_139201		Approved	KIAA0148	uc001tps.2	Q14161	OTTHUMG00000169313	ENST00000355312.3:c.1234C>A	12.37:g.110390905G>T		154.0	2.0		171.0	7.0	NM_001135213	Q86U59|Q96CI2|Q9BV91|Q9Y5V2	Silent	SNP	ENST00000355312.3	37	CCDS9138.1																																																																																			G|0.999;A|0.001		0.547	GIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403407.1	NM_057169	
GP2	2813	ucsc.edu;bcgsc.ca	37	16	20328667	20328667	+	Silent	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr16:20328667G>A	ENST00000381362.4	-	9	1369	c.1293C>T	c.(1291-1293)caC>caT	p.H431H	GP2_ENST00000573897.1_5'Flank|GP2_ENST00000302555.5_Silent_p.H428H|GP2_ENST00000341642.5_Silent_p.H281H|GP2_ENST00000381360.5_Silent_p.H284H	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	431	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						TCTCCTCCACGTGGATGGTGG	0.478																																					p.H431H		.											.	GP2	94	0			c.C1293T						.						98.0	78.0	85.0					16																	20328667		2203	4300	6503	SO:0001819	synonymous_variant	2813	exon9			CTCCACGTGGATG	U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.1293C>T	16.37:g.20328667G>A		41.0	0.0		41.0	4.0	NM_001007240	A6NFM9|A6NJA8|Q13338|Q9UIF1	Silent	SNP	ENST00000381362.4	37	CCDS42128.1																																																																																			.		0.478	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436920.1	NM_016295	
GPRIN1	114787	ucsc.edu;bcgsc.ca	37	5	176025338	176025338	+	Silent	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr5:176025338A>G	ENST00000303991.4	-	2	1675	c.1498T>C	c.(1498-1500)Ttg>Ctg	p.L500L		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	500					neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCTGTCCCCAAGGACCTGGGA	0.552																																					p.L500L		.											.	GPRIN1	92	0			c.T1498C						.						80.0	87.0	84.0					5																	176025338		2203	4298	6501	SO:0001819	synonymous_variant	114787	exon2			TCCCCAAGGACCT	AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.1498T>C	5.37:g.176025338A>G		37.0	0.0		43.0	4.0	NM_052899	C9JM70|Q8ND74|Q96PZ4	Silent	SNP	ENST00000303991.4	37	CCDS4405.1																																																																																			.		0.552	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253149.1	NM_052899	
GPS1	2873	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	80011842	80011842	+	Silent	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr17:80011842G>A	ENST00000306823.6	+	3	248	c.225G>A	c.(223-225)ctG>ctA	p.L75L	RFNG_ENST00000584838.1_5'Flank|GPS1_ENST00000320548.4_Silent_p.L59L|GPS1_ENST00000578552.1_Silent_p.L75L|RFNG_ENST00000310496.4_5'Flank|RFNG_ENST00000429557.3_5'Flank|GPS1_ENST00000392358.2_Silent_p.L115L|GPS1_ENST00000355130.2_Silent_p.L115L			Q13098	CSN1_HUMAN	G protein pathway suppressor 1	75					cell cycle (GO:0007049)|cullin deneddylation (GO:0010388)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)			breast(1)|central_nervous_system(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|skin(2)	13	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			TGGAGGCCCTGAAGATGGCCC	0.607																																					p.L115L		.											.	GPS1	226	0			c.G345A						.						67.0	53.0	58.0					17																	80011842		2202	4298	6500	SO:0001819	synonymous_variant	2873	exon3			GGCCCTGAAGATG		CCDS11800.1, CCDS32774.1	17q25.3	2013-03-14				ENSG00000169727			4549	protein-coding gene	gene with protein product	"""COP9 signalosome subunit 1"""	601934				9535219	Standard	NM_212492		Approved	COPS1, CSN1	uc002kdl.1	Q13098		ENST00000306823.6:c.225G>A	17.37:g.80011842G>A		16.0	0.0		34.0	8.0	NM_212492	Q8NA10|Q9BWL1	Silent	SNP	ENST00000306823.6	37	CCDS32774.1																																																																																			.		0.607	GPS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442176.1	NM_212492	
GRXCR2	643226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	145246178	145246178	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr5:145246178C>G	ENST00000377976.1	-	2	449	c.450G>C	c.(448-450)gaG>gaC	p.E150D		NM_001080516.1	NP_001073985.1	A6NFK2	GRCR2_HUMAN	glutaredoxin, cysteine rich 2	150						cell projection (GO:0042995)				breast(1)|endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						CCTCAGCCTCCTCTTCCTTCT	0.428																																					p.E150D		.											.	GRXCR2	22	0			c.G450C						.						144.0	140.0	141.0					5																	145246178		2203	4300	6503	SO:0001583	missense	643226	exon2			AGCCTCCTCTTCC		CCDS34263.1	5q32	2014-03-14			ENSG00000204928	ENSG00000204928			33862	protein-coding gene	gene with protein product		615762				24619944	Standard	NM_001080516		Approved	DFNB101	uc003lns.1	A6NFK2	OTTHUMG00000163417	ENST00000377976.1:c.450G>C	5.37:g.145246178C>G	ENSP00000367214:p.Glu150Asp	91.0	0.0		131.0	30.0	NM_001080516		Missense_Mutation	SNP	ENST00000377976.1	37	CCDS34263.1	.	.	.	.	.	.	.	.	.	.	C	1.138	-0.650427	0.03506	.	.	ENSG00000204928	ENST00000377976	T	0.24723	1.84	5.43	-0.984	0.10259	.	0.455549	0.24748	N	0.035933	T	0.13372	0.0324	L	0.33485	1.01	0.09310	N	0.999998	B	0.12630	0.006	B	0.13407	0.009	T	0.29027	-1.0025	10	0.15952	T	0.53	-7.8332	4.8326	0.13449	0.0891:0.4514:0.088:0.3715	.	150	A6NFK2	GRCR2_HUMAN	D	150	ENSP00000367214:E150D	ENSP00000367214:E150D	E	-	3	2	GRXCR2	145226371	0.004000	0.15560	0.932000	0.37286	0.162000	0.22319	-0.664000	0.05292	-0.532000	0.06332	-1.587000	0.00848	GAG	.		0.428	GRXCR2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373289.2		
GUK1	2987	ucsc.edu;bcgsc.ca	37	1	228336111	228336111	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:228336111A>G	ENST00000366718.1	+	7	942	c.515A>G	c.(514-516)gAc>gGc	p.D172G	GUK1_ENST00000391865.3_Missense_Mutation_p.D193G|GUK1_ENST00000366723.1_Missense_Mutation_p.T210A|GUK1_ENST00000470040.1_3'UTR|GJC2_ENST00000366714.2_5'Flank|GUK1_ENST00000366730.1_Missense_Mutation_p.D172G|GUK1_ENST00000366728.2_Intron|GUK1_ENST00000366722.1_Missense_Mutation_p.D170G|GUK1_ENST00000312726.4_Missense_Mutation_p.D172G|GUK1_ENST00000366716.1_Missense_Mutation_p.D172G|GUK1_ENST00000366721.1_Missense_Mutation_p.D174G|GUK1_ENST00000366726.1_Missense_Mutation_p.D172G	NM_001159391.1	NP_001152863.1	Q16774	KGUA_HUMAN	guanylate kinase 1	172	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				ATP metabolic process (GO:0046034)|dATP metabolic process (GO:0046060)|dGDP biosynthetic process (GO:0006185)|dGMP metabolic process (GO:0046054)|drug metabolic process (GO:0017144)|GDP biosynthetic process (GO:0046711)|GDP-mannose metabolic process (GO:0019673)|glycoprotein transport (GO:0034436)|GMP metabolic process (GO:0046037)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleotide metabolic process (GO:0006163)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			endometrium(2)|lung(5)|prostate(1)|soft_tissue(1)	9		Prostate(94;0.0405)				ATCATTAACGACAGCCTGGAC	0.667																																					p.D193G		.											.	GUK1	115	0			c.A578G						.						46.0	45.0	46.0					1																	228336111		2203	4300	6503	SO:0001583	missense	2987	exon7			TTAACGACAGCCT	BC006249	CCDS1568.1, CCDS53481.1, CCDS55689.1	1q32-q41	2012-10-02			ENSG00000143774	ENSG00000143774	2.7.4.8		4693	protein-coding gene	gene with protein product		139270				8647247	Standard	NM_000858		Approved		uc021pkf.1	Q16774	OTTHUMG00000039503	ENST00000366718.1:c.515A>G	1.37:g.228336111A>G	ENSP00000355679:p.Asp172Gly	28.0	0.0		36.0	4.0	NM_001159390	B1ANH1	Missense_Mutation	SNP	ENST00000366718.1	37	CCDS1568.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	14.28|14.28	2.488455|2.488455	0.44249|0.44249	.|.	.|.	ENSG00000143774|ENSG00000143774	ENST00000366730;ENST00000391865;ENST00000366726;ENST00000312726;ENST00000453943;ENST00000366722;ENST00000366721;ENST00000412265;ENST00000366718;ENST00000366716|ENST00000366723	T;T;T;T;T;T;T;T;T;T|.	0.52526|.	0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66|.	4.52|4.52	4.52|4.52	0.55395|0.55395	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);|.	.|.	.|.	.|.	.|.	T|T	0.75125|0.75125	0.3807|0.3807	M|M	0.90759|0.90759	3.145|3.145	0.48185|0.48185	D|D	0.999603|0.999603	D;D|.	0.64830|.	0.994;0.988|.	D;D|.	0.70716|.	0.97;0.958|.	T|T	0.75414|0.75414	-0.3326|-0.3326	9|6	0.87932|0.08837	D|T	0|0.75	.|.	13.6883|13.6883	0.62531|0.62531	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	193;172|.	B4E1H6;Q16774|.	.;KGUA_HUMAN|.	G|A	172;193;172;172;193;170;174;238;172;172|210	ENSP00000355691:D172G;ENSP00000375738:D193G;ENSP00000355687:D172G;ENSP00000317659:D172G;ENSP00000401832:D193G;ENSP00000355683:D170G;ENSP00000355682:D174G;ENSP00000407604:D238G;ENSP00000355679:D172G;ENSP00000355677:D172G|.	ENSP00000317659:D172G|ENSP00000355684:T210A	D|T	+|+	2|1	0|0	GUK1|GUK1	226402734|226402734	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.022000|0.022000	0.10575|0.10575	4.407000|4.407000	0.59754|0.59754	1.890000|1.890000	0.54733|0.54733	0.248000|0.248000	0.18094|0.18094	GAC|ACA	.		0.667	GUK1-021	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000095944.1	NM_000858	
HAUS3	79441	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	2242302	2242302	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr4:2242302T>G	ENST00000243706.4	-	2	601	c.372A>C	c.(370-372)caA>caC	p.Q124H	POLN_ENST00000515357.1_Intron|HAUS3_ENST00000443786.2_Missense_Mutation_p.Q124H|HAUS3_ENST00000506763.1_Missense_Mutation_p.Q124H|POLN_ENST00000511885.2_Intron	NM_024511.5	NP_078787.2	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	124					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				breast(3)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						AAGCCATCAATTGACATTTAT	0.368																																					p.Q124H		.											.	HAUS3	138	0			c.A372C						.						97.0	100.0	99.0					4																	2242302		2202	4299	6501	SO:0001583	missense	79441	exon2			CATCAATTGACAT	AF040964	CCDS33941.1	4p16.3	2013-10-11	2009-04-20	2009-04-20	ENSG00000214367	ENSG00000214367		"""HAUS augmin-like complex subunits"""	28719	protein-coding gene	gene with protein product		613430	"""chromosome 4 open reading frame 15"""	C4orf15		19427217, 19812674	Standard	NM_024511		Approved	MGC4701, IT1, dgt3	uc003ges.1	Q68CZ6		ENST00000243706.4:c.372A>C	4.37:g.2242302T>G	ENSP00000243706:p.Gln124His	97.0	1.0		124.0	26.0	NM_024511	B4DF64|O43606|Q8TAZ5|Q9BTJ9	Missense_Mutation	SNP	ENST00000243706.4	37	CCDS33941.1	.	.	.	.	.	.	.	.	.	.	T	12.44	1.937465	0.34189	.	.	ENSG00000214367	ENST00000506763;ENST00000243706;ENST00000443786	T;T	0.53857	0.6;0.6	5.29	1.19	0.21007	.	0.000000	0.64402	U	0.000001	T	0.67581	0.2908	M	0.76574	2.34	0.32591	N	0.527198	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.73294	-0.4028	10	0.87932	D	0	-9.8591	9.7138	0.40263	0.0:0.6166:0.0:0.3834	.	124;124	B4DF64;Q68CZ6	.;HAUS3_HUMAN	H	124	ENSP00000243706:Q124H;ENSP00000392903:Q124H	ENSP00000243706:Q124H	Q	-	3	2	HAUS3	2212100	0.004000	0.15560	0.927000	0.36925	0.437000	0.31866	-0.059000	0.11731	0.243000	0.21327	-0.993000	0.02533	CAA	.		0.368	HAUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357446.1	NM_024511	
HELB	92797	ucsc.edu;bcgsc.ca	37	12	66725072	66725072	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:66725072A>G	ENST00000247815.4	+	12	2868	c.2809A>G	c.(2809-2811)Atg>Gtg	p.M937V		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	937					DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		GAATGCCATTATGAAAAACAG	0.542																																					p.M937V		.											.	HELB	515	0			c.A2809G						.						47.0	49.0	48.0					12																	66725072		2203	4300	6503	SO:0001583	missense	92797	exon12			GCCATTATGAAAA	AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.2809A>G	12.37:g.66725072A>G	ENSP00000247815:p.Met937Val	41.0	1.0		34.0	4.0	NM_033647	A8K4C9|Q4G0T2|Q9H7L5	Missense_Mutation	SNP	ENST00000247815.4	37	CCDS8976.1	.	.	.	.	.	.	.	.	.	.	A	9.176	1.022370	0.19433	.	.	ENSG00000127311	ENST00000247815	T	0.11063	2.81	5.37	-3.91	0.04168	.	1.359530	0.04833	N	0.439044	T	0.05777	0.0151	N	0.22421	0.69	0.09310	N	1	B	0.14012	0.009	B	0.11329	0.006	T	0.38628	-0.9652	9	.	.	.	0.6158	1.3748	0.02218	0.2962:0.3566:0.1382:0.209	.	937	Q8NG08	HELB_HUMAN	V	937	ENSP00000247815:M937V	.	M	+	1	0	HELB	65011339	0.000000	0.05858	0.000000	0.03702	0.085000	0.17905	-0.947000	0.03901	-0.576000	0.05974	0.459000	0.35465	ATG	.		0.542	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401919.1		
HELZ2	85441	ucsc.edu;bcgsc.ca	37	20	62198260	62198260	+	Silent	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr20:62198260G>T	ENST00000467148.1	-	6	2520	c.2451C>A	c.(2449-2451)acC>acA	p.T817T	HELZ2_ENST00000427522.2_Silent_p.T248T	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	817	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										AGCTGGGCCAGGTGTTGTAGG	0.687																																					p.T817T		.											.	.	.	0			c.C2451A						.						46.0	45.0	46.0					20																	62198260		2198	4297	6495	SO:0001819	synonymous_variant	85441	exon7			GGGCCAGGTGTTG	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.2451C>A	20.37:g.62198260G>T		34.0	0.0		23.0	4.0	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	37	CCDS33508.1																																																																																			.		0.687	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
HEPHL1	341208	ucsc.edu;bcgsc.ca	37	11	93778947	93778947	+	Silent	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:93778947A>G	ENST00000315765.9	+	2	287	c.279A>G	c.(277-279)aaA>aaG	p.K93K		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	93	Plastocyanin-like 1.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				AGATCCCCAAACCTCCCTGGC	0.483																																					p.K93K		.											.	HEPHL1	71	0			c.A279G						.						74.0	73.0	74.0					11																	93778947		1873	4099	5972	SO:0001819	synonymous_variant	341208	exon2			CCCCAAACCTCCC	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.279A>G	11.37:g.93778947A>G		59.0	1.0		47.0	4.0	NM_001098672	Q3C1W7	Silent	SNP	ENST00000315765.9	37	CCDS44710.1																																																																																			.		0.483	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947	
HERC4	26091	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	69726472	69726472	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr10:69726472T>C	ENST00000395198.3	-	16	2141	c.1894A>G	c.(1894-1896)Atc>Gtc	p.I632V	HERC4_ENST00000277817.6_Missense_Mutation_p.I522V|HERC4_ENST00000395187.2_3'UTR|HERC4_ENST00000412272.2_Missense_Mutation_p.I632V|HERC4_ENST00000373700.4_Missense_Mutation_p.I632V	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	632					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						ACCCAGTTGATATAATCATTT	0.284																																					p.I632V		.											.	HERC4	659	0			c.A1894G						.						97.0	91.0	93.0					10																	69726472		2203	4300	6503	SO:0001583	missense	26091	exon16			AGTTGATATAATC	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.1894A>G	10.37:g.69726472T>C	ENSP00000378624:p.Ile632Val	120.0	0.0		100.0	17.0	NM_022079	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	ENST00000395198.3	37	CCDS41533.1	.	.	.	.	.	.	.	.	.	.	T	2.943	-0.218442	0.06101	.	.	ENSG00000148634	ENST00000277817;ENST00000412272;ENST00000395198;ENST00000373700	T;T;T;T	0.76060	1.19;0.93;0.94;-0.99	5.16	5.16	0.70880	.	0.218250	0.47852	D	0.000217	T	0.44623	0.1302	N	0.04116	-0.275	0.80722	D	1	B;B;B;B;B;B	0.13594	0.008;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.10450	0.005;0.003;0.0;0.001;0.001;0.001	T	0.45963	-0.9225	10	0.05525	T	0.97	.	6.2043	0.20593	0.1445:0.0795:0.0:0.776	.	632;522;632;482;632;632	Q5GLZ8-3;Q5GLZ8-6;A8K9U4;Q5VXS9;Q5GLZ8-2;Q5GLZ8	.;.;.;.;.;HERC4_HUMAN	V	522;632;632;632	ENSP00000277817:I522V;ENSP00000416504:I632V;ENSP00000378624:I632V;ENSP00000362804:I632V	ENSP00000277817:I522V	I	-	1	0	HERC4	69396478	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.237000	0.43061	2.086000	0.62901	0.374000	0.22700	ATC	.		0.284	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601	
HESX1	8820	broad.mit.edu;ucsc.edu	37	3	57233897	57233897	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:57233897G>T	ENST00000295934.3	-	1	86	c.50C>A	c.(49-51)tCa>tAa	p.S17*	HESX1_ENST00000473921.1_Nonsense_Mutation_p.S17*	NM_003865.2	NP_003856.1	Q9UBX0	HESX1_HUMAN	HESX homeobox 1	17					brain development (GO:0007420)|forebrain morphogenesis (GO:0048853)|negative regulation of transcription, DNA-templated (GO:0045892)|nose development (GO:0043584)|otic vesicle formation (GO:0030916)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(284;0.0109)|Kidney(284;0.0126)		GGAGCAAGTTGAGGGTTTGTT	0.547																																					p.S17X	Esophageal Squamous(84;267 1272 9034 48993 52677)	.											.	HESX1	227	0			c.C50A						.						120.0	120.0	120.0					3																	57233897		2203	4300	6503	SO:0001587	stop_gained	8820	exon1			CAAGTTGAGGGTT	AF059734	CCDS2881.1	3p14.3	2014-06-16	2007-02-16		ENSG00000163666	ENSG00000163666		"""Homeoboxes / PRD class"""	4877	protein-coding gene	gene with protein product		601802	"""homeobox, ES cell expressed 1"""			9373136, 9620767, 7876132	Standard	NM_003865		Approved	RPX, ANF	uc003din.4	Q9UBX0	OTTHUMG00000158597	ENST00000295934.3:c.50C>A	3.37:g.57233897G>T	ENSP00000295934:p.Ser17*	71.0	0.0		71.0	9.0	NM_003865	Q52LC5|Q99667	Nonsense_Mutation	SNP	ENST00000295934.3	37	CCDS2881.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.192582	0.78902	.	.	ENSG00000163666	ENST00000295934;ENST00000473921;ENST00000495160	.	.	.	5.66	4.78	0.61160	.	0.578947	0.17090	N	0.187413	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	-0.2329	14.7028	0.69166	0.0696:0.0:0.9304:0.0	.	.	.	.	X	17	.	ENSP00000295934:S17X	S	-	2	0	HESX1	57208937	0.982000	0.34865	0.550000	0.28217	0.940000	0.58332	2.818000	0.48041	1.536000	0.49237	0.655000	0.94253	TCA	.		0.547	HESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351430.2		
HFE2	148738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	145414811	145414811	+	Silent	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:145414811C>T	ENST00000336751.5	+	2	268	c.30C>T	c.(28-30)ccC>ccT	p.P10P	HFE2_ENST00000475797.1_Intron|HFE2_ENST00000357836.5_Intron|HFE2_ENST00000497365.1_Intron	NM_213653.3	NP_998818.1	Q6ZVN8	RGMC_HUMAN	hemochromatosis type 2 (juvenile)	10					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|iron ion homeostasis (GO:0055072)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	14	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCCCTAGTCCCAGGTCCTCCC	0.582																																					p.P10P		.											.	HFE2	91	0			c.C30T						.						96.0	83.0	88.0					1																	145414811		2203	4300	6503	SO:0001819	synonymous_variant	148738	exon2			TAGTCCCAGGTCC	AY372521	CCDS72877.1, CCDS72878.1, CCDS72879.1	1q21.2	2014-06-26			ENSG00000168509	ENSG00000168509			4887	protein-coding gene	gene with protein product	"""repulsive guidance molecule c"""	608374				10205270, 14647275	Standard	NM_213653		Approved	JH, HFE2A, RGMC, HJV, hemojuvelin, haemojuvelin	uc001eni.2	Q6ZVN8	OTTHUMG00000013748	ENST00000336751.5:c.30C>T	1.37:g.145414811C>T		60.0	0.0		80.0	22.0	NM_213653	B1ALI7|Q2PQ63|Q6IMF6|Q8NAH2|Q8WVJ5	Silent	SNP	ENST00000336751.5	37	CCDS910.1																																																																																			.		0.582	HFE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038527.1	NM_145277	
HMCN1	83872	broad.mit.edu;bcgsc.ca	37	1	186088390	186088390	+	Silent	SNP	G	G	T	rs374616091		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:186088390G>T	ENST00000271588.4	+	78	12145	c.11916G>T	c.(11914-11916)gcG>gcT	p.A3972A	HMCN1_ENST00000367492.2_Silent_p.A3972A	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3972	Ig-like C2-type 38.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTAGGAATGCGGCTGGCTCTG	0.398																																					p.A3972A		.											.	HMCN1	113	0			c.G11916T						.						121.0	114.0	117.0					1																	186088390		2203	4300	6503	SO:0001819	synonymous_variant	83872	exon78			GAATGCGGCTGGC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11916G>T	1.37:g.186088390G>T		72.0	0.0		100.0	8.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	CCDS30956.1																																																																																			.		0.398	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HSD17B14	51171	ucsc.edu;bcgsc.ca	37	19	49316448	49316448	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr19:49316448G>T	ENST00000263278.4	-	9	1063	c.797C>A	c.(796-798)cCc>cAc	p.P266H	BCAT2_ENST00000402551.1_5'Flank|BCAT2_ENST00000598162.1_5'Flank|BCAT2_ENST00000601496.1_5'Flank|BCAT2_ENST00000316273.6_5'Flank|BCAT2_ENST00000597011.1_5'Flank|HSD17B14_ENST00000599157.1_Missense_Mutation_p.P242H|BCAT2_ENST00000545387.2_5'Flank|BCAT2_ENST00000599246.1_5'Flank	NM_016246.2	NP_057330.2	Q9BPX1	DHB14_HUMAN	hydroxysteroid (17-beta) dehydrogenase 14	266					steroid catabolic process (GO:0006706)	cytosol (GO:0005829)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)			large_intestine(3)|lung(1)|skin(1)	5		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000341)|all cancers(93;0.000764)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.0346)		AGGGATATCGGGGGCGTCCAC	0.612																																					p.P266H		.											.	HSD17B14	90	0			c.C797A						.						16.0	18.0	17.0					19																	49316448		2199	4296	6495	SO:0001583	missense	51171	exon9			ATATCGGGGGCGT	AF126781	CCDS12736.1	19q13.33	2011-09-14	2006-11-22	2006-11-22		ENSG00000087076		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	23238	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 3"", ""short chain dehydrogenase/reductase family 47C, member 1"""	612832	"""dehydrogenase/reductase (SDR family) member 10"""	DHRS10		10800688, 17067289, 19027726	Standard	XM_005258969		Approved	retSDR3, SDR47C1	uc002pkv.1	Q9BPX1		ENST00000263278.4:c.797C>A	19.37:g.49316448G>T	ENSP00000263278:p.Pro266His	51.0	0.0		28.0	4.0	NM_016246	Q9UKU3	Missense_Mutation	SNP	ENST00000263278.4	37	CCDS12736.1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199107	0.58126	.	.	ENSG00000087076	ENST00000263278	D	0.84944	-1.92	3.88	3.88	0.44766	.	0.181701	0.31797	N	0.007043	T	0.72045	0.3412	N	0.08118	0	0.32324	N	0.562005	P	0.49635	0.926	B	0.42882	0.401	T	0.80313	-0.1435	10	0.72032	D	0.01	.	12.0356	0.53423	0.0:0.0:1.0:0.0	.	266	Q9BPX1	DHB14_HUMAN	H	266	ENSP00000263278:P266H	ENSP00000263278:P266H	P	-	2	0	HSD17B14	54008260	0.748000	0.28294	0.116000	0.21606	0.022000	0.10575	5.000000	0.63940	2.121000	0.65114	0.561000	0.74099	CCC	.		0.612	HSD17B14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466212.1	NM_016246	
HSF2	3298	ucsc.edu;bcgsc.ca	37	6	122737443	122737443	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr6:122737443T>C	ENST00000368455.4	+	5	723		c.e5+2		HSF2_ENST00000452194.1_Splice_Site	NM_004506.3	NP_004497.1	Q03933	HSF2_HUMAN	heat shock transcription factor 2						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stress (GO:0006950)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			large_intestine(4)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(136;0.00371)|all cancers(137;0.0299)|GBM - Glioblastoma multiforme(226;0.0586)		ATTCGAAAGGTAAGAAGCTCT	0.368																																					.		.											.	HSF2	90	0			c.531+2T>C						.						128.0	116.0	120.0					6																	122737443		2203	4300	6503	SO:0001630	splice_region_variant	3298	exon5			GAAAGGTAAGAAG	M65217	CCDS5124.1, CCDS47470.1	6q22	2008-08-29			ENSG00000025156	ENSG00000025156			5225	protein-coding gene	gene with protein product		140581				1871106	Standard	NM_004506		Approved		uc003pyu.2	Q03933	OTTHUMG00000016216	ENST00000368455.4:c.531+2T>C	6.37:g.122737443T>C		38.0	1.0		43.0	4.0	NM_004506	B4DGJ4|Q0VAH9|Q2M1K4|Q9H445	Splice_Site	SNP	ENST00000368455.4	37	CCDS5124.1	.	.	.	.	.	.	.	.	.	.	t	21.5	4.164975	0.78339	.	.	ENSG00000025156	ENST00000368455;ENST00000452194	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0	0.71464	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	HSF2	122779142	1.000000	0.71417	0.987000	0.45799	0.880000	0.50808	7.114000	0.77103	1.945000	0.56424	0.478000	0.44815	.	.		0.368	HSF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043520.1	NM_004506	Intron
HTRA3	94031	ucsc.edu;bcgsc.ca	37	4	8293156	8293156	+	Silent	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr4:8293156G>T	ENST00000307358.2	+	4	972	c.768G>T	c.(766-768)gtG>gtT	p.V256V	HTRA3_ENST00000382512.3_Silent_p.V256V	NM_053044.3	NP_444272.1	P83110	HTRA3_HUMAN	HtrA serine peptidase 3	256	Serine protease.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|prostate(1)|urinary_tract(1)	18						GGGAGTTTGTGGTGGCCATCG	0.627																																					p.V256V		.											.	HTRA3	91	0			c.G768T						.						77.0	77.0	77.0					4																	8293156		2203	4300	6503	SO:0001819	synonymous_variant	94031	exon4			GTTTGTGGTGGCC	AY040094	CCDS3400.1, CCDS75105.1	4p16.1	2008-02-05			ENSG00000170801	ENSG00000170801			30406	protein-coding gene	gene with protein product	"""pregnancy-related serine protease"""	608785				12513693, 14500695	Standard	XM_005248040		Approved	Tasp, Prsp	uc003gla.3	P83110	OTTHUMG00000090561	ENST00000307358.2:c.768G>T	4.37:g.8293156G>T		76.0	0.0		51.0	6.0	NM_053044	Q7Z7A2	Silent	SNP	ENST00000307358.2	37	CCDS3400.1																																																																																			.		0.627	HTRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092669.1	NM_053044	
IFI16	3428	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158984635	158984635	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:158984635G>C	ENST00000295809.7	+	2	420	c.165G>C	c.(163-165)aaG>aaC	p.K55N	IFI16_ENST00000368132.3_Missense_Mutation_p.K55N|IFI16_ENST00000368131.4_Missense_Mutation_p.K55N|IFI16_ENST00000340979.6_Missense_Mutation_p.K55N|IFI16_ENST00000448393.2_Missense_Mutation_p.K55N|IFI16_ENST00000359709.3_Missense_Mutation_p.K55N|IFI16_ENST00000430894.2_Missense_Mutation_p.K59N			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	55	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.|Lys-rich.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					TGGAAGAAAAGTTCCGAGGTG	0.333																																					p.K55N		.											.	IFI16	91	0			c.G165C						.						80.0	85.0	84.0					1																	158984635		2203	4300	6503	SO:0001583	missense	3428	exon2			AGAAAAGTTCCGA	M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.165G>C	1.37:g.158984635G>C	ENSP00000295809:p.Lys55Asn	258.0	0.0		270.0	63.0	NM_001206567	B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	ENST00000295809.7	37		.	.	.	.	.	.	.	.	.	.	.	13.48	2.250355	0.39797	.	.	ENSG00000163565	ENST00000359709;ENST00000426592;ENST00000447473;ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894	T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68	3.27	2.34	0.29019	Pyrin (2);DEATH-like (1);	.	.	.	.	T	0.47673	0.1458	M	0.71206	2.165	0.09310	N	1	D;P;D	0.67145	0.992;0.713;0.996	P;B;P	0.62491	0.903;0.223;0.903	T	0.23833	-1.0177	9	0.62326	D	0.03	.	8.4964	0.33130	0.0:0.2393:0.7607:0.0	.	59;55;55	E7EPR3;Q16666-2;Q16666	.;.;IF16_HUMAN	N	55;55;55;55;55;55;55;59	ENSP00000352740:K55N;ENSP00000406406:K55N;ENSP00000407052:K55N;ENSP00000295809:K55N;ENSP00000342741:K55N;ENSP00000357113:K55N;ENSP00000357114:K55N;ENSP00000394935:K59N	ENSP00000295809:K55N	K	+	3	2	IFI16	157251259	0.020000	0.18652	0.019000	0.16419	0.001000	0.01503	-0.027000	0.12371	0.916000	0.36871	0.555000	0.69702	AAG	.		0.333	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531	
IL17RD	54756	ucsc.edu;bcgsc.ca	37	3	57148813	57148813	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:57148813G>T	ENST00000296318.7	-	3	305	c.217C>A	c.(217-219)Cat>Aat	p.H73N	IL17RD_ENST00000479825.1_5'UTR|IL17RD_ENST00000320057.5_5'UTR|IL17RD_ENST00000463523.1_5'UTR|IL17RD_ENST00000427856.2_Missense_Mutation_p.H49N	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	73					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		GCAATCACATGCTTCCCCACT	0.448																																					p.H73N		.											.	IL17RD	500	0			c.C217A						.						70.0	71.0	71.0					3																	57148813		1933	4143	6076	SO:0001583	missense	54756	exon3			TCACATGCTTCCC	AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.217C>A	3.37:g.57148813G>T	ENSP00000296318:p.His73Asn	31.0	0.0		31.0	5.0	NM_017563	Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Missense_Mutation	SNP	ENST00000296318.7	37	CCDS2880.2	.	.	.	.	.	.	.	.	.	.	G	16.90	3.249308	0.59103	.	.	ENSG00000144730	ENST00000296318;ENST00000427856	T;T	0.14266	2.52;2.54	5.8	5.8	0.92144	.	0.043286	0.85682	D	0.000000	T	0.28962	0.0719	L	0.29908	0.895	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.71870	0.915;0.975	T	0.01301	-1.1391	10	0.87932	D	0	-8.7603	20.063	0.97692	0.0:0.0:1.0:0.0	.	73;49	Q8NFM7;Q8NFM7-3	I17RD_HUMAN;.	N	73;49	ENSP00000296318:H73N;ENSP00000399209:H49N	ENSP00000296318:H73N	H	-	1	0	IL17RD	57123853	1.000000	0.71417	0.996000	0.52242	0.045000	0.14185	8.125000	0.89590	2.735000	0.93741	0.655000	0.94253	CAT	.		0.448	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316680.1	NM_017563	
IMPACT	55364	ucsc.edu;bcgsc.ca	37	18	22023067	22023067	+	Missense_Mutation	SNP	G	G	T	rs370501606		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr18:22023067G>T	ENST00000284202.4	+	7	686	c.545G>T	c.(544-546)cGa>cTa	p.R182L		NM_018439.3	NP_060909	Q9P2X3	IMPCT_HUMAN	impact RWD domain protein	182					negative regulation of protein phosphorylation (GO:0001933)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(2)	16	all_cancers(21;0.00018)|all_epithelial(16;1.5e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)					ATTACAGACCGAAGAAGTACT	0.353																																					p.R182L		.											.	IMPACT	90	0			c.G545T						.						147.0	135.0	139.0					18																	22023067		2203	4300	6503	SO:0001583	missense	55364	exon7			CAGACCGAAGAAG	AB026264	CCDS11886.1	18q11.2-q12.1	2012-12-07	2012-12-07		ENSG00000154059	ENSG00000154059			20387	protein-coding gene	gene with protein product	"""RWD domain containing 5"""	615319	"""Impact homolog (mouse)"""			11116084	Standard	NM_018439		Approved	RWDD5	uc002kvh.4	Q9P2X3	OTTHUMG00000131943	ENST00000284202.4:c.545G>T	18.37:g.22023067G>T	ENSP00000284202:p.Arg182Leu	54.0	0.0		40.0	4.0	NM_018439	A8MXG0|Q49AM0|Q9H2X4	Missense_Mutation	SNP	ENST00000284202.4	37	CCDS11886.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.792399	0.50102	.	.	ENSG00000154059	ENST00000284202	T	0.43688	0.94	5.43	5.43	0.79202	Ribosomal protein S5 domain 2-type fold (1);Impact, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.68641	0.3023	M	0.87758	2.905	0.58432	D	0.999999	D	0.69078	0.997	D	0.70487	0.969	T	0.73439	-0.3982	10	0.56958	D	0.05	.	16.1348	0.81476	0.0:0.0:1.0:0.0	.	182	Q9P2X3	IMPCT_HUMAN	L	182	ENSP00000284202:R182L	ENSP00000284202:R182L	R	+	2	0	IMPACT	20277065	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.464000	0.73534	2.538000	0.85594	0.655000	0.94253	CGA	.		0.353	IMPACT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254901.1	NM_018439	
IPO9	55705	ucsc.edu;bcgsc.ca	37	1	201832722	201832722	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:201832722A>G	ENST00000361565.4	+	14	1684	c.1615A>G	c.(1615-1617)Aga>Gga	p.R539G		NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	539					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						TTCTGCAGTGAGAGCCATCTG	0.463																																					p.R539G		.											.	IPO9	228	0			c.A1615G						.						86.0	76.0	79.0					1																	201832722		2203	4300	6503	SO:0001583	missense	55705	exon14			GCAGTGAGAGCCA	AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.1615A>G	1.37:g.201832722A>G	ENSP00000354742:p.Arg539Gly	50.0	0.0		42.0	5.0	NM_018085	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	ENST00000361565.4	37	CCDS1415.1	.	.	.	.	.	.	.	.	.	.	A	19.25	3.790936	0.70452	.	.	ENSG00000198700	ENST00000361565	T	0.68025	-0.3	5.72	3.34	0.38264	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76962	0.4061	M	0.73962	2.25	0.80722	D	1	D	0.76494	0.999	D	0.66196	0.942	T	0.72855	-0.4166	10	0.26408	T	0.33	-23.969	11.132	0.48351	0.7052:0.2948:0.0:0.0	.	539	Q96P70	IPO9_HUMAN	G	539	ENSP00000354742:R539G	ENSP00000354742:R539G	R	+	1	2	IPO9	200099345	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.475000	0.53136	0.401000	0.25424	0.533000	0.62120	AGA	.		0.463	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087088.1	NM_018085	
IRX1	79192	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	3600204	3600204	+	Missense_Mutation	SNP	C	C	A	rs530506520		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr5:3600204C>A	ENST00000302006.3	+	2	1194	c.1142C>A	c.(1141-1143)gCa>gAa	p.A381E	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	381					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						GCATTCCTCGCACAGGGCTCC	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		15024	0.001		0.0	False		,,,				2504	0.0				p.A381E		.											.	IRX1	228	0			c.C1142A						.						49.0	42.0	45.0					5																	3600204		2202	4300	6502	SO:0001583	missense	79192	exon2			TCCTCGCACAGGG	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.1142C>A	5.37:g.3600204C>A	ENSP00000305244:p.Ala381Glu	74.0	0.0		98.0	27.0	NM_024337	Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	37	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	C	6.905	0.536543	0.13188	.	.	ENSG00000170549	ENST00000302006	T	0.59083	0.29	4.3	4.3	0.51218	.	0.519375	0.21854	N	0.068122	T	0.48021	0.1477	L	0.36672	1.1	0.18873	N	0.999981	P	0.38922	0.651	B	0.35859	0.212	T	0.43475	-0.9389	10	0.34782	T	0.22	.	16.7647	0.85521	0.0:1.0:0.0:0.0	.	381	P78414	IRX1_HUMAN	E	381	ENSP00000305244:A381E	ENSP00000305244:A381E	A	+	2	0	IRX1	3653204	0.612000	0.27000	0.570000	0.28473	0.013000	0.08279	3.560000	0.53763	1.900000	0.55004	0.563000	0.77884	GCA	.		0.682	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337	
ITPR3	3710	ucsc.edu;bcgsc.ca	37	6	33631612	33631612	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr6:33631612A>G	ENST00000374316.5	+	12	2163	c.1103A>G	c.(1102-1104)gAg>gGg	p.E368G	ITPR3_ENST00000605930.1_Missense_Mutation_p.E368G			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	368	MIR 4. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	TCTCTCTTTGAGCTGGACCCC	0.622																																					p.E368G		.											.	ITPR3	1085	0			c.A1103G						.						76.0	74.0	75.0					6																	33631612		2203	4300	6503	SO:0001583	missense	3710	exon11			TCTTTGAGCTGGA	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.1103A>G	6.37:g.33631612A>G	ENSP00000363435:p.Glu368Gly	45.0	0.0		31.0	4.0	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.808597	0.90707	.	.	ENSG00000096433	ENST00000374316	D	0.88509	-2.39	4.74	4.74	0.60224	MIR motif (2);MIR (2);	0.057763	0.64402	D	0.000001	D	0.93812	0.8021	M	0.87456	2.885	0.58432	D	0.999998	D	0.67145	0.996	D	0.70227	0.968	D	0.94935	0.8086	10	0.87932	D	0	-36.3419	14.3985	0.67027	1.0:0.0:0.0:0.0	.	368	Q14573	ITPR3_HUMAN	G	368	ENSP00000363435:E368G	ENSP00000363435:E368G	E	+	2	0	ITPR3	33739590	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	9.131000	0.94446	1.985000	0.57927	0.397000	0.26171	GAG	.		0.622	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
KALRN	8997	ucsc.edu;bcgsc.ca	37	3	124418823	124418823	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:124418823C>A	ENST00000291478.5	+	23	3011	c.2848C>A	c.(2848-2850)Ccc>Acc	p.P950T	AC080008.1_ENST00000584173.1_RNA|KALRN_ENST00000360013.3_Missense_Mutation_p.P2647T|KALRN_ENST00000428018.2_Missense_Mutation_p.P918T	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2646					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TGCCAGTAACCCCTGGGGAAT	0.582																																					p.P2647T		.											.	KALRN	738	0			c.C7939A						.						182.0	161.0	168.0					3																	124418823		2203	4300	6503	SO:0001583	missense	8997	exon56			AGTAACCCCTGGG	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.2848C>A	3.37:g.124418823C>A	ENSP00000291478:p.Pro950Thr	44.0	0.0		45.0	6.0	NM_001024660	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000291478.5	37	CCDS3028.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611021	0.66558	.	.	ENSG00000160145	ENST00000360013;ENST00000291478;ENST00000428018	T;T;T	0.54866	0.55;0.55;0.55	6.02	6.02	0.97574	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.082080	0.51477	D	0.000089	T	0.49729	0.1574	N	0.16037	0.36	0.34076	D	0.658965	P;B	0.47841	0.901;0.411	P;B	0.52823	0.71;0.321	T	0.48115	-0.9063	10	0.13853	T	0.58	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	950;2646	C9JQ37;O60229	.;KALRN_HUMAN	T	2647;950;918	ENSP00000353109:P2647T;ENSP00000291478:P950T;ENSP00000402419:P918T	ENSP00000291478:P950T	P	+	1	0	KALRN	125901513	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.644000	0.67902	2.865000	0.98341	0.655000	0.94253	CCC	.		0.582	KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246891.5	NM_003947	
KCNA10	3744	broad.mit.edu;bcgsc.ca	37	1	111060014	111060014	+	Silent	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:111060014G>T	ENST00000369771.2	-	1	1783	c.1396C>A	c.(1396-1398)Cgg>Agg	p.R466R		NM_005549.2	NP_005540.1	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 10	466					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|intracellular cyclic nucleotide activated cation channel activity (GO:0005221)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(3)|skin(1)|urinary_tract(1)	35		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Dalfampridine(DB06637)	TCAGTCTCCCGGTGGTAGAAG	0.488																																					p.R466R		.											.	KCNA10	156	0			c.C1396A						.						108.0	100.0	103.0					1																	111060014		2203	4300	6503	SO:0001819	synonymous_variant	3744	exon1			TCTCCCGGTGGTA	U96110	CCDS826.1	1p13.1	2012-07-05			ENSG00000143105	ENSG00000143105		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6219	protein-coding gene	gene with protein product		602420				16382104	Standard	NM_005549		Approved	Kv1.8	uc001dzt.1	Q16322	OTTHUMG00000022785	ENST00000369771.2:c.1396C>A	1.37:g.111060014G>T		157.0	1.0		187.0	8.0	NM_005549		Silent	SNP	ENST00000369771.2	37	CCDS826.1																																																																																			.		0.488	KCNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059081.1	NM_005549	
KDM2A	22992	ucsc.edu;bcgsc.ca	37	11	66975111	66975111	+	Silent	SNP	C	C	A	rs369124261		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:66975111C>A	ENST00000529006.2	+	6	884	c.438C>A	c.(436-438)ctC>ctA	p.L146L	KDM2A_ENST00000398645.2_Silent_p.L146L|KDM2A_ENST00000526258.1_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	146					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						TCATCAGCCTCGAGTTTAGCC	0.463																																					p.L146L		.											.	KDM2A	661	0			c.C438A						.						63.0	66.0	65.0					11																	66975111		1976	4150	6126	SO:0001819	synonymous_variant	22992	exon6			CAGCCTCGAGTTT	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.438C>A	11.37:g.66975111C>A		51.0	0.0		41.0	4.0	NM_012308	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Silent	SNP	ENST00000529006.2	37	CCDS44657.1																																																																																			.		0.463	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393140.2	NM_012308	
KDM5B	10765	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	202710671	202710671	+	Silent	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:202710671C>T	ENST00000367265.3	-	19	3933	c.2769G>A	c.(2767-2769)gtG>gtA	p.V923V	KDM5B_ENST00000367264.2_Silent_p.V959V	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	923					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						AAGCTTGCTGCACCTCTTCTA	0.502																																					p.V923V		.											.	KDM5B	273	0			c.G2769A						.						92.0	79.0	84.0					1																	202710671		2203	4300	6503	SO:0001819	synonymous_variant	10765	exon19			TTGCTGCACCTCT	AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.2769G>A	1.37:g.202710671C>T		44.0	0.0		46.0	10.0	NM_006618	O95811|Q15752|Q9Y3Q5	Silent	SNP	ENST00000367265.3	37	CCDS30974.1																																																																																			.		0.502	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	NM_006618	
KIAA0368	23392	ucsc.edu;bcgsc.ca	37	9	114195630	114195630	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr9:114195630A>G	ENST00000338205.5	-	7	950	c.731T>C	c.(730-732)tTc>tCc	p.F244S	KIAA0368_ENST00000259335.4_Missense_Mutation_p.F422S			Q5VYK3	ECM29_HUMAN	KIAA0368	250					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						AGCTTCTATGAATTTCACGAT	0.468																																					p.F422S		.											.	KIAA0368	68	0			c.T1265C						.						92.0	87.0	89.0					9																	114195630		1931	4132	6063	SO:0001583	missense	23392	exon9			TCTATGAATTTCA	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.731T>C	9.37:g.114195630A>G	ENSP00000339889:p.Phe244Ser	29.0	0.0		42.0	4.0	NM_001080398	O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	37		.	.	.	.	.	.	.	.	.	.	A	29.9	5.043107	0.93685	.	.	ENSG00000136813	ENST00000338205;ENST00000259335	T	0.66280	-0.2	5.95	5.95	0.96441	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79924	0.4530	M	0.77486	2.375	0.80722	D	1	D	0.59357	0.985	D	0.74674	0.984	T	0.82313	-0.0519	10	0.87932	D	0	.	16.4069	0.83677	1.0:0.0:0.0:0.0	.	250	Q5VYK3	ECM29_HUMAN	S	244;422	ENSP00000259335:F422S	ENSP00000259335:F422S	F	-	2	0	KIAA0368	113235451	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.923000	0.92808	2.272000	0.75746	0.460000	0.39030	TTC	.		0.468	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
KIAA1551	55196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	32135645	32135645	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:32135645G>A	ENST00000312561.4	+	4	2170	c.1756G>A	c.(1756-1758)Gct>Act	p.A586T	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	586																	GCTACTTCTCGCTTTGCTTTC	0.353																																					p.A586T		.											C12orf35,NS,carcinoma,-1	.	.	0			c.G1756A						.						38.0	39.0	38.0					12																	32135645		2203	4299	6502	SO:0001583	missense	55196	exon4			CTTCTCGCTTTGC	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.1756G>A	12.37:g.32135645G>A	ENSP00000310338:p.Ala586Thr	51.0	0.0		51.0	9.0	NM_018169	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	37	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	G	9.285	1.049138	0.19827	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	T;T	0.05925	4.0;3.37	4.46	-2.73	0.05950	.	5.264380	0.00496	N	0.000142	T	0.03053	0.0090	N	0.08118	0	0.09310	N	1	B	0.20780	0.048	B	0.17098	0.017	T	0.33904	-0.9850	9	.	.	.	.	1.4483	0.02369	0.2113:0.397:0.1678:0.2239	.	586	Q9HCM1	CL035_HUMAN	T	586	ENSP00000310338:A586T;ENSP00000370442:A586T	.	A	+	1	0	C12orf35	32026912	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.370000	0.07523	-0.928000	0.03761	-1.339000	0.01253	GCT	.		0.353	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169	
KIFC1	3833	ucsc.edu;bcgsc.ca	37	6	33371612	33371612	+	Silent	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr6:33371612T>C	ENST00000428849.2	+	6	912	c.462T>C	c.(460-462)cgT>cgC	p.R154R	KIFC1_ENST00000486695.1_3'UTR	NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	154					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						AACGGTGCCGTGAGAGGACTC	0.552																																					p.R154R		.											.	KIFC1	90	0			c.T462C						.						102.0	99.0	100.0					6																	33371612		2203	4300	6503	SO:0001819	synonymous_variant	3833	exon6			GTGCCGTGAGAGG	D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.462T>C	6.37:g.33371612T>C		42.0	0.0		43.0	4.0	NM_002263	O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Silent	SNP	ENST00000428849.2	37	CCDS34430.1																																																																																			.		0.552	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076417.1	NM_002263	
KLC4	89953	ucsc.edu;bcgsc.ca	37	6	43033408	43033408	+	Silent	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr6:43033408T>C	ENST00000394056.2	+	5	1035	c.540T>C	c.(538-540)ccT>ccC	p.P180P	KLC4_ENST00000453940.2_Silent_p.P103P|KLC4_ENST00000479388.1_Silent_p.P180P|KLC4_ENST00000259708.3_Silent_p.P198P|KLC4_ENST00000394058.1_Silent_p.P180P|KLC4_ENST00000458460.2_Silent_p.P180P|KLC4_ENST00000347162.5_Silent_p.P180P			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	180						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			ACCTCTTTCCTAATGAGGAGG	0.557																																					p.P198P		.											.	KLC4	94	0			c.T594C						.						79.0	70.0	73.0					6																	43033408		2203	4300	6503	SO:0001819	synonymous_variant	89953	exon4			CTTTCCTAATGAG	AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.540T>C	6.37:g.43033408T>C		31.0	0.0		41.0	4.0	NM_201523	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Silent	SNP	ENST00000394056.2	37	CCDS4883.1																																																																																			.		0.557	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040579.2	NM_138343	
KLK1	3816	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51323553	51323553	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr19:51323553C>G	ENST00000301420.2	-	3	388	c.353G>C	c.(352-354)aGc>aCc	p.S118T	CTD-2568A17.5_ENST00000326989.5_lincRNA|KLK1_ENST00000448701.2_Missense_Mutation_p.S16T	NM_002257.2	NP_002248.1	P06870	KLK1_HUMAN	kallikrein 1	118	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			breast(1)|large_intestine(4)|lung(7)|urinary_tract(1)	13		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	Aprotinin(DB06692)	GAGGTCGTGGCTGTAGTCCTC	0.582																																					p.S118T		.											.	KLK1	226	0			c.G353C						.						170.0	144.0	153.0					19																	51323553		2203	4300	6503	SO:0001583	missense	3816	exon3			TCGTGGCTGTAGT	L10038	CCDS12804.1	19q13.3	2008-02-05	2006-10-27			ENSG00000167748	3.4.21.35	"""Kallikreins"""	6357	protein-coding gene	gene with protein product		147910	"""kallikrein 1, renal/pancreas/salivary"""			1684954, 16800724, 16800723	Standard	NM_002257		Approved	Klk6	uc002ptk.1	P06870		ENST00000301420.2:c.353G>C	19.37:g.51323553C>G	ENSP00000301420:p.Ser118Thr	108.0	1.0		121.0	17.0	NM_002257	Q66US9|Q86U61|Q8TCV8|Q9BS53|Q9NQU4|Q9UD19|Q9UMJ1	Missense_Mutation	SNP	ENST00000301420.2	37	CCDS12804.1	.	.	.	.	.	.	.	.	.	.	c	14.22	2.471498	0.43942	.	.	ENSG00000167748	ENST00000301420;ENST00000448701	D;D	0.88664	-2.41;-2.41	3.17	3.17	0.36434	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.88804	0.6536	N	0.20328	0.56	0.26400	N	0.976437	D	0.61080	0.989	D	0.75020	0.985	T	0.79553	-0.1756	9	0.72032	D	0.01	.	10.0793	0.42379	0.0:1.0:0.0:0.0	.	118	P06870	KLK1_HUMAN	T	118;16	ENSP00000301420:S118T;ENSP00000400994:S16T	ENSP00000301420:S118T	S	-	2	0	KLK1	56015365	1.000000	0.71417	0.997000	0.53966	0.012000	0.07955	3.083000	0.50136	2.063000	0.61619	0.313000	0.20887	AGC	.		0.582	KLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464135.2	NM_002257	
LCN6	158062	ucsc.edu;bcgsc.ca	37	9	139641977	139641977	+	Silent	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr9:139641977C>A	ENST00000341206.4	-	2	173	c.129G>T	c.(127-129)cgG>cgT	p.R43R	LCN6_ENST00000471509.1_5'Flank|LCN6_ENST00000476567.1_5'Flank|LCN6_ENST00000480584.1_5'Flank|LCN6_ENST00000435202.1_Silent_p.R33R	NM_198946.2	NP_945184.1	P62502	LCN6_HUMAN	lipocalin 6	43					single fertilization (GO:0007338)	extracellular region (GO:0005576)				lung(3)|upper_aerodigestive_tract(1)	4	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.32e-06)|Epithelial(140;7.83e-05)		AGCCCTTTTCCCGGGAGGCCA	0.632																																					p.R43R	Melanoma(172;919 2704 37090 48131)	.											.	LCN6	90	0			c.G129T						.						99.0	83.0	89.0					9																	139641977		2203	4300	6503	SO:0001819	synonymous_variant	158062	exon2			CTTTTCCCGGGAG	AF303084	CCDS7005.1	9q34.3	2012-10-08			ENSG00000267206	ENSG00000267206		"""Lipocalins"""	17337	protein-coding gene	gene with protein product		609379					Standard	NM_198946		Approved		uc004ciy.2	P62502	OTTHUMG00000020941	ENST00000341206.4:c.129G>T	9.37:g.139641977C>A		33.0	0.0		39.0	4.0	NM_198946	B0QZ80|Q71SF6	Silent	SNP	ENST00000341206.4	37	CCDS7005.1																																																																																			.		0.632	LCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055107.3	NM_198946	
LHX9	56956	ucsc.edu;bcgsc.ca	37	1	197890497	197890497	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:197890497G>T	ENST00000367387.4	+	3	866	c.441G>T	c.(439-441)atG>atT	p.M147I	LHX9_ENST00000367391.1_Missense_Mutation_p.M138I|LHX9_ENST00000337020.2_Missense_Mutation_p.M147I|LHX9_ENST00000367390.3_Missense_Mutation_p.M138I|LHX9_ENST00000561173.1_Missense_Mutation_p.M153I	NM_020204.2	NP_064589.2	Q9NQ69	LHX9_HUMAN	LIM homeobox 9	147	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell proliferation (GO:0008283)|female gonad development (GO:0008585)|gonad morphogenesis (GO:0035262)|male gonad development (GO:0008584)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			endometrium(8)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|skin(1)|stomach(1)	35						AGATGGTCATGCGCGCCCGAG	0.577																																					p.M147I		.											.	LHX9	91	0			c.G441T						.						62.0	61.0	61.0					1																	197890497		2203	4300	6503	SO:0001583	missense	56956	exon3			GGTCATGCGCGCC	AJ277915	CCDS1393.1, CCDS30962.1	1q31.1	2011-06-20			ENSG00000143355	ENSG00000143355		"""Homeoboxes / LIM class"""	14222	protein-coding gene	gene with protein product		606066					Standard	NM_020204		Approved		uc001guk.1	Q9NQ69	OTTHUMG00000035656	ENST00000367387.4:c.441G>T	1.37:g.197890497G>T	ENSP00000356357:p.Met147Ile	37.0	0.0		48.0	5.0	NM_020204	Q5VUE2|Q5VUE3|Q5VUE6|Q86UH2|Q9BYU6|Q9NQ70	Missense_Mutation	SNP	ENST00000367387.4	37	CCDS1393.1	.	.	.	.	.	.	.	.	.	.	G	36	5.724834	0.96847	.	.	ENSG00000143355	ENST00000367391;ENST00000367390;ENST00000337020;ENST00000367387	D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13	6.17	6.17	0.99709	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.91586	0.7342	L	0.55017	1.72	0.80722	D	1	P;P;P	0.51240	0.589;0.943;0.721	B;P;B	0.58721	0.403;0.844;0.373	D	0.91027	0.4861	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	147;138;138	Q9NQ69;Q9NQ69-3;Q9NQ69-2	LHX9_HUMAN;.;.	I	138;138;147;147	ENSP00000356361:M138I;ENSP00000356360:M138I;ENSP00000337969:M147I;ENSP00000356357:M147I	ENSP00000337969:M147I	M	+	3	0	LHX9	196157120	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	ATG	.		0.577	LHX9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086547.2	NM_020204	
LNX2	222484	ucsc.edu;bcgsc.ca	37	13	28124470	28124470	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr13:28124470T>C	ENST00000316334.3	-	9	2066	c.1937A>G	c.(1936-1938)aAg>aGg	p.K646R		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	646	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		CAAGACTCACTTTAATCTTCC	0.383																																					p.K646R		.											.	LNX2	228	0			c.A1937G						.						90.0	86.0	87.0					13																	28124470		2203	4300	6503	SO:0001630	splice_region_variant	222484	exon9			ACTCACTTTAATC	AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.1937+1A>G	13.37:g.28124470T>C		33.0	0.0		43.0	4.0	NM_153371	Q5W0P0|Q6ZMH2|Q96SH4	Missense_Mutation	SNP	ENST00000316334.3	37	CCDS9323.1	.	.	.	.	.	.	.	.	.	.	T	13.98	2.399782	0.42512	.	.	ENSG00000139517	ENST00000316334	T	0.28666	1.6	5.92	5.92	0.95590	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.21962	0.0529	N	0.10707	0.03	0.80722	D	1	B	0.23806	0.091	B	0.35688	0.208	T	0.16660	-1.0395	9	.	.	.	.	16.3444	0.83118	0.0:0.0:0.0:1.0	.	646	Q8N448	LNX2_HUMAN	R	646	ENSP00000325929:K646R	.	K	-	2	0	LNX2	27022470	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.004000	0.88535	2.265000	0.75225	0.533000	0.62120	AAG	.		0.383	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044302.2		Missense_Mutation
LONRF3	79836	ucsc.edu;bcgsc.ca	37	X	118148310	118148310	+	Silent	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chrX:118148310C>A	ENST00000371628.3	+	10	2146	c.2115C>A	c.(2113-2115)gcC>gcA	p.A705A	LONRF3_ENST00000422289.2_Silent_p.A449A|LONRF3_ENST00000472173.1_3'UTR|LONRF3_ENST00000304778.7_Silent_p.A664A	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	705	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						AGAAAGACGCCGATCCTCAGG	0.433																																					p.A705A		.											.	LONRF3	289	0			c.C2115A						.						144.0	124.0	131.0					X																	118148310		2203	4300	6503	SO:0001819	synonymous_variant	79836	exon10			AGACGCCGATCCT	AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.2115C>A	X.37:g.118148310C>A		73.0	0.0		46.0	4.0	NM_001031855	Q5JPN6|Q8NB00|Q9H647	Silent	SNP	ENST00000371628.3	37	CCDS35374.1																																																																																			.		0.433	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355124.2	NM_024778	
LRCH4	4034	ucsc.edu;bcgsc.ca	37	7	100175837	100175837	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:100175837A>G	ENST00000310300.6	-	7	945	c.893T>C	c.(892-894)cTg>cCg	p.L298P	LRCH4_ENST00000497245.1_5'UTR	NM_002319.3	NP_002310.2	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 4	298					nervous system development (GO:0007399)	PML body (GO:0016605)				NS(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	23	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCCTGAGTCCAGCCCACCATC	0.607																																					p.L298P		.											.	LRCH4	136	0			c.T893C						.						133.0	103.0	113.0					7																	100175837		2203	4300	6503	SO:0001583	missense	4034	exon7			GAGTCCAGCCCAC	AF053356	CCDS34706.1	7q22	2008-05-20	2004-05-27	2004-05-28	ENSG00000077454	ENSG00000077454			6691	protein-coding gene	gene with protein product				LRN, LRRN1		9799793	Standard	XM_005250346		Approved		uc003uvj.3	O75427	OTTHUMG00000159544	ENST00000310300.6:c.893T>C	7.37:g.100175837A>G	ENSP00000309689:p.Leu298Pro	53.0	0.0		44.0	4.0	NM_002319	A4D2D5|Q8WV85|Q96ID0	Missense_Mutation	SNP	ENST00000310300.6	37	CCDS34706.1	.	.	.	.	.	.	.	.	.	.	a	17.76	3.469590	0.63625	.	.	ENSG00000077454	ENST00000310300	T	0.37752	1.18	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000004	T	0.52629	0.1746	L	0.51853	1.615	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.47611	-0.9104	10	0.34782	T	0.22	-12.2951	13.53	0.61617	1.0:0.0:0.0:0.0	.	298	O75427	LRCH4_HUMAN	P	298	ENSP00000309689:L298P	ENSP00000309689:L298P	L	-	2	0	LRCH4	100013773	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	8.870000	0.92336	2.092000	0.63282	0.440000	0.28878	CTG	.		0.607	LRCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356110.1	NM_002319	
LRMP	4033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	25232338	25232338	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:25232338T>A	ENST00000354454.3	+	7	907	c.78T>A	c.(76-78)taT>taA	p.Y26*	LRMP_ENST00000547044.1_Nonsense_Mutation_p.Y26*|LRMP_ENST00000548766.1_Nonsense_Mutation_p.Y26*	NM_006152.3	NP_006143.2	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein	82					immune system process (GO:0002376)|single fertilization (GO:0007338)|vesicle fusion (GO:0006906)|vesicle targeting (GO:0006903)	chromosome (GO:0005694)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)		p.Y26*(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					GCAGGGAATATTCCTCACTAC	0.343																																					p.Y26X		.											.	LRMP	228	1	Substitution - Nonsense(1)	kidney(1)	c.T78A						.						194.0	184.0	187.0					12																	25232338		2203	4300	6503	SO:0001587	stop_gained	4033	exon6			GGAATATTCCTCA		CCDS8701.1	12p12.1	2012-05-16			ENSG00000118308	ENSG00000118308			6690	protein-coding gene	gene with protein product		602003				8021504	Standard	NM_006152		Approved	JAW1	uc010sja.2	Q12912	OTTHUMG00000170192	ENST00000354454.3:c.78T>A	12.37:g.25232338T>A	ENSP00000346442:p.Tyr26*	109.0	0.0		123.0	22.0	NM_001204126	A0AVM2|B4E077|Q8N301	Nonsense_Mutation	SNP	ENST00000354454.3	37	CCDS8701.1	.	.	.	.	.	.	.	.	.	.	T	18.41	3.616908	0.66672	.	.	ENSG00000118308	ENST00000550945;ENST00000557489;ENST00000354454;ENST00000548766;ENST00000554942;ENST00000547044	.	.	.	4.82	-1.46	0.08800	.	1.274630	0.05414	N	0.542971	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	1.4078	8.6515	0.34038	0.0:0.48:0.0:0.52	.	.	.	.	X	26	.	ENSP00000346442:Y26X	Y	+	3	2	LRMP	25123605	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.194000	0.17135	-0.333000	0.08476	-0.353000	0.07706	TAT	.		0.343	LRMP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407870.1	NM_006152	
LRRC30	339291	ucsc.edu;bcgsc.ca	37	18	7231329	7231329	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr18:7231329G>T	ENST00000383467.2	+	1	207	c.193G>T	c.(193-195)Gac>Tac	p.D65Y		NM_001105581.1	NP_001099051.1	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	65										central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						AGACATCCCCGACTTTCTGTG	0.617																																					p.D65Y		.											.	LRRC30	24	0			c.G193T						.						57.0	61.0	60.0					18																	7231329		1971	4163	6134	SO:0001583	missense	339291	exon1			ATCCCCGACTTTC		CCDS42409.1	18p11.23	2005-01-06				ENSG00000206422			30219	protein-coding gene	gene with protein product							Standard	NM_001105581		Approved		uc010wzk.2	A6NM36		ENST00000383467.2:c.193G>T	18.37:g.7231329G>T	ENSP00000372959:p.Asp65Tyr	44.0	0.0		40.0	4.0	NM_001105581		Missense_Mutation	SNP	ENST00000383467.2	37	CCDS42409.1	.	.	.	.	.	.	.	.	.	.	G	18.06	3.539176	0.65085	.	.	ENSG00000206422	ENST00000383467	T	0.26067	1.76	5.65	4.78	0.61160	.	0.287283	0.43919	D	0.000512	T	0.26738	0.0654	L	0.32530	0.975	0.35830	D	0.825202	D	0.54964	0.969	P	0.49477	0.612	T	0.33163	-0.9879	10	0.66056	D	0.02	.	10.7891	0.46422	0.1442:0.0:0.8558:0.0	.	65	A6NM36	LRC30_HUMAN	Y	65	ENSP00000372959:D65Y	ENSP00000372959:D65Y	D	+	1	0	LRRC30	7221329	0.981000	0.34729	0.996000	0.52242	0.994000	0.84299	1.781000	0.38644	1.522000	0.49001	0.650000	0.86243	GAC	.		0.617	LRRC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442140.1	XM_292678	
LRRC7	57554	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	70501869	70501869	+	Silent	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:70501869C>T	ENST00000035383.5	+	17	1977	c.1947C>T	c.(1945-1947)acC>acT	p.T649T	LRRC7_ENST00000415775.2_Intron|LRRC7_ENST00000310961.5_Silent_p.T654T	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	649						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TAGCTGAGACCCCTCTGTACC	0.408																																					p.T649T		.											.	LRRC7	163	0			c.C1947T						.						94.0	96.0	95.0					1																	70501869		2203	4300	6503	SO:0001819	synonymous_variant	57554	exon17			TGAGACCCCTCTG		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.1947C>T	1.37:g.70501869C>T		71.0	0.0		75.0	9.0	NM_020794	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Silent	SNP	ENST00000035383.5	37	CCDS645.1																																																																																			.		0.408	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794	
LRRTM3	347731	ucsc.edu;bcgsc.ca	37	10	68687800	68687800	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr10:68687800C>A	ENST00000361320.4	+	2	1704	c.1126C>A	c.(1126-1128)Cca>Aca	p.P376T	CTNNA3_ENST00000373744.4_Intron|CTNNA3_ENST00000433211.2_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	376					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						CAGGGCTCTCCCAAAGCCGAC	0.567																																					p.P376T		.											.	LRRTM3	93	0			c.C1126A						.						58.0	61.0	60.0					10																	68687800		2203	4300	6503	SO:0001583	missense	347731	exon2			GCTCTCCCAAAGC	BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.1126C>A	10.37:g.68687800C>A	ENSP00000355187:p.Pro376Thr	46.0	0.0		35.0	4.0	NM_178011	A8K2A3|Q2NKX7|Q6N0A3	Missense_Mutation	SNP	ENST00000361320.4	37	CCDS7270.1	.	.	.	.	.	.	.	.	.	.	C	10.45	1.353343	0.24512	.	.	ENSG00000198739	ENST00000361320;ENST00000373722	D	0.81908	-1.55	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000002	T	0.74928	0.3781	N	0.16743	0.435	0.47905	D	0.999549	B;B	0.15141	0.012;0.012	B;B	0.17098	0.008;0.017	T	0.68081	-0.5503	10	0.46703	T	0.11	.	19.1373	0.93433	0.0:1.0:0.0:0.0	.	376;376	Q86VH5;Q86VH5-2	LRRT3_HUMAN;.	T	376	ENSP00000355187:P376T	ENSP00000355187:P376T	P	+	1	0	LRRTM3	68357806	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.102000	0.50291	2.820000	0.97059	0.650000	0.86243	CCA	.		0.567	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048277.2	NM_178011	
MAPKAPK5	8550	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	112308091	112308091	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:112308091G>A	ENST00000551404.2	+	6	518	c.410G>A	c.(409-411)cGg>cAg	p.R137Q	MAPKAPK5_ENST00000550735.2_Missense_Mutation_p.R137Q|MAPKAPK5_ENST00000546394.1_3'UTR			Q8IW41	MAPK5_HUMAN	mitogen-activated protein kinase-activated protein kinase 5	137	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|MAPK cascade (GO:0000165)|negative regulation of TOR signaling (GO:0032007)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)|stress-induced premature senescence (GO:0090400)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(11)|ovary(1)	13						TTGGCTCTGCGGCACTGTCAC	0.403																																					p.R137Q		.											.	MAPKAPK5	1215	0			c.G410A						.						127.0	113.0	117.0					12																	112308091		1873	4102	5975	SO:0001583	missense	8550	exon6			CTCTGCGGCACTG	AF032437	CCDS44975.1, CCDS44976.1	12q24.13	2012-05-30			ENSG00000089022	ENSG00000089022			6889	protein-coding gene	gene with protein product		606723				9628874	Standard	NM_003668		Approved	PRAK	uc001tta.4	Q8IW41	OTTHUMG00000169605	ENST00000551404.2:c.410G>A	12.37:g.112308091G>A	ENSP00000449381:p.Arg137Gln	149.0	0.0		151.0	27.0	NM_139078	B3KVA5|O60491|Q86X46|Q9BVX9|Q9UG86	Missense_Mutation	SNP	ENST00000551404.2	37	CCDS44975.1	.	.	.	.	.	.	.	.	.	.	G	8.256	0.810106	0.16537	.	.	ENSG00000089022	ENST00000550735;ENST00000202788;ENST00000428907;ENST00000551404	T;T	0.64618	-0.11;-0.11	5.6	4.47	0.54385	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.234953	0.44097	N	0.000486	T	0.32346	0.0826	N	0.03891	-0.335	0.28693	N	0.90448	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.004;0.0;0.0	T	0.22941	-1.0202	10	0.02654	T	1	.	10.837	0.46694	0.9248:0.0:0.0752:0.0	.	131;137;137	C9J458;Q8IW41;Q8IW41-2	.;MAPK5_HUMAN;.	Q	137	ENSP00000449667:R137Q;ENSP00000449381:R137Q	ENSP00000202788:R137Q	R	+	2	0	MAPKAPK5	110792474	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.081000	0.64444	0.965000	0.38133	-0.469000	0.05056	CGG	.		0.403	MAPKAPK5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405019.2	NM_139078	
MARCO	8685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	119739211	119739211	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:119739211C>T	ENST00000327097.4	+	10	1015	c.880C>T	c.(880-882)Cct>Tct	p.P294S	MARCO_ENST00000541757.1_Missense_Mutation_p.P216S	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	294	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						GGCTGGTTTTCCTGGAGCTAA	0.443																																					p.P294S	GBM(8;18 374 7467 11269 32796)	.											.	MARCO	95	0			c.C880T						.						75.0	79.0	78.0					2																	119739211		2202	4298	6500	SO:0001583	missense	8685	exon10			GGTTTTCCTGGAG	AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.880C>T	2.37:g.119739211C>T	ENSP00000318916:p.Pro294Ser	84.0	0.0		89.0	27.0	NM_006770	B4DW79|Q9Y5S3	Missense_Mutation	SNP	ENST00000327097.4	37	CCDS2124.1	.	.	.	.	.	.	.	.	.	.	C	9.481	1.098186	0.20552	.	.	ENSG00000019169	ENST00000327097;ENST00000410021;ENST00000541757	D;D	0.93133	-3.17;-3.17	5.2	3.36	0.38483	.	0.329727	0.29692	N	0.011451	D	0.91068	0.7189	M	0.74467	2.265	0.32272	N	0.568704	P	0.36162	0.54	B	0.37346	0.247	D	0.89187	0.3548	9	.	.	.	.	6.1027	0.20057	0.1856:0.7205:0.0:0.0939	.	294	Q9UEW3	MARCO_HUMAN	S	294;294;216	ENSP00000318916:P294S;ENSP00000441769:P216S	.	P	+	1	0	MARCO	119455681	0.868000	0.29978	0.428000	0.26697	0.969000	0.65631	0.880000	0.28159	0.730000	0.32425	0.561000	0.74099	CCT	.		0.443	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770	
METTL2B	55798	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	128119304	128119304	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:128119304G>A	ENST00000262432.8	+	3	332	c.295G>A	c.(295-297)Gaa>Aaa	p.E99K	METTL2B_ENST00000480046.1_Missense_Mutation_p.E34K|RP11-212P7.3_ENST00000462662.1_RNA	NM_018396.2	NP_060866.2	Q6P1Q9	MET2B_HUMAN	methyltransferase like 2B	99					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						GCTTTTTACCGAATTCCCTGA	0.378																																					p.E99K		.											.	METTL2B	23	0			c.G295A						.						55.0	57.0	56.0					7																	128119304		2202	4297	6499	SO:0001583	missense	55798	exon3			TTTACCGAATTCC	AK002212	CCDS5803.2	7q32.2	2012-06-12	2006-02-09	2006-02-09	ENSG00000165055	ENSG00000165055			18272	protein-coding gene	gene with protein product		607846	"""methyltransferase like 2"""	METTL2		11738826	Standard	NM_018396		Approved	METL, FLJ11350	uc003vnf.3	Q6P1Q9	OTTHUMG00000143738	ENST00000262432.8:c.295G>A	7.37:g.128119304G>A	ENSP00000262432:p.Glu99Lys	238.0	0.0		250.0	41.0	NM_018396	B4DZ68|Q0IJ54|Q3B7J1	Missense_Mutation	SNP	ENST00000262432.8	37	CCDS5803.2	.	.	.	.	.	.	.	.	.	.	G	16.89	3.248049	0.59103	.	.	ENSG00000165055	ENST00000462662;ENST00000262432;ENST00000480046	T;T;T	0.03951	3.75;3.75;3.75	2.86	1.97	0.26223	.	0.000000	0.85682	D	0.000000	T	0.24624	0.0597	M	0.93854	3.465	0.52501	D	0.999959	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.01583	-1.1319	10	0.87932	D	0	0.0553	7.7593	0.28942	0.1338:0.0:0.8662:0.0	.	34;99	Q6P1Q9-2;Q6P1Q9	.;MTL2B_HUMAN	K	93;99;34	ENSP00000418634:E93K;ENSP00000262432:E99K;ENSP00000418402:E34K	ENSP00000262432:E99K	E	+	1	0	METTL2B	127906540	1.000000	0.71417	0.801000	0.32222	0.494000	0.33585	9.445000	0.97587	0.540000	0.28808	-0.491000	0.04670	GAA	.		0.378	METTL2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289817.1	NM_018396	
MLF2	8079	ucsc.edu;bcgsc.ca	37	12	6859046	6859046	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:6859046T>C	ENST00000203630.5	-	7	1171	c.527A>G	c.(526-528)gAg>gGg	p.E176G	MLF2_ENST00000542154.1_Missense_Mutation_p.E176G|MLF2_ENST00000564181.1_5'Flank|MLF2_ENST00000435120.1_Missense_Mutation_p.E176G|MLF2_ENST00000539187.1_Missense_Mutation_p.E176G			Q15773	MLF2_HUMAN	myeloid leukemia factor 2	176					defense response (GO:0006952)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				kidney(2)|large_intestine(3)|lung(4)	9						CTGCCGCTCCTCCTGGTCCCC	0.602																																					p.E176G		.											.	MLF2	153	0			c.A527G						.						113.0	97.0	102.0					12																	6859046		2203	4300	6503	SO:0001583	missense	8079	exon7			CGCTCCTCCTGGT	U57342	CCDS8559.1	12p13.31	2014-09-11			ENSG00000089693	ENSG00000089693			7126	protein-coding gene	gene with protein product		601401				8661158	Standard	NM_005439		Approved	NTN4	uc010sfi.2	Q15773	OTTHUMG00000168717	ENST00000203630.5:c.527A>G	12.37:g.6859046T>C	ENSP00000203630:p.Glu176Gly	29.0	0.0		31.0	5.0	NM_005439		Missense_Mutation	SNP	ENST00000203630.5	37	CCDS8559.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	33|33	5.241828|5.241828	0.95272|0.95272	.|.	.|.	ENSG00000089693|ENSG00000089693	ENST00000435120;ENST00000203630;ENST00000542154;ENST00000539187|ENST00000537126	.|.	.|.	.|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78773|0.78773	0.4336|0.4336	M|M	0.84082|0.84082	2.675|2.675	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.87578|.	0.998|.	T|T	0.80703|0.80703	-0.1264|-0.1264	9|5	0.72032|.	D|.	0.01|.	.|.	16.2013|16.2013	0.82084|0.82084	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	176|.	Q15773|.	MLF2_HUMAN|.	G|G	176|187	.|.	ENSP00000203630:E176G|.	E|R	-|-	2|1	0|2	MLF2|MLF2	6729307|6729307	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.698000|7.698000	0.84413|0.84413	2.227000|2.227000	0.72691|0.72691	0.459000|0.459000	0.35465|0.35465	GAG|AGG	.		0.602	MLF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400733.2		
MPHOSPH10	10199	ucsc.edu;bcgsc.ca	37	2	71366928	71366928	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:71366928C>A	ENST00000244230.2	+	6	1596	c.1244C>A	c.(1243-1245)cCt>cAt	p.P415H		NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	415					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						CCTTTAGCACCTGTGATTACA	0.388																																					p.P415H		.											.	MPHOSPH10	93	0			c.C1244A						.						143.0	145.0	145.0					2																	71366928		2203	4300	6503	SO:0001583	missense	10199	exon6			TAGCACCTGTGAT	X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.1244C>A	2.37:g.71366928C>A	ENSP00000244230:p.Pro415His	36.0	0.0		43.0	4.0	NM_005791	A0AVJ8	Missense_Mutation	SNP	ENST00000244230.2	37	CCDS1916.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.650656	0.87958	.	.	ENSG00000124383	ENST00000244230;ENST00000425650	T;T	0.19250	2.16;2.16	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.58409	0.2120	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69580	-0.5107	10	0.87932	D	0	.	16.8902	0.86085	0.0:1.0:0.0:0.0	.	415	O00566	MPP10_HUMAN	H	415;275	ENSP00000244230:P415H;ENSP00000393034:P275H	ENSP00000244230:P415H	P	+	2	0	MPHOSPH10	71220436	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.142000	0.77339	2.669000	0.90835	0.585000	0.79938	CCT	.		0.388	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251924.2	NM_005791	
MLPH	79083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	238434305	238434305	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:238434305A>T	ENST00000264605.3	+	7	1031	c.737A>T	c.(736-738)gAg>gTg	p.E246V	MLPH_ENST00000338530.4_Missense_Mutation_p.E246V|MLPH_ENST00000468178.1_3'UTR|MLPH_ENST00000445024.2_Missense_Mutation_p.E246V|MLPH_ENST00000410032.1_Intron|MLPH_ENST00000409373.1_Missense_Mutation_p.E206V	NM_024101.5	NP_077006.1	Q9BV36	MELPH_HUMAN	melanophilin	246					melanocyte differentiation (GO:0030318)|melanosome localization (GO:0032400)|protein targeting (GO:0006605)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|microtubule plus-end (GO:0035371)|stress fiber (GO:0001725)	metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		GGCCTGGAGGAGGCTGATACT	0.632																																					p.E246V		.											.	MLPH	91	0			c.A737T						.						50.0	52.0	51.0					2																	238434305		2203	4300	6503	SO:0001583	missense	79083	exon7			TGGAGGAGGCTGA	AY358857	CCDS2518.1, CCDS42836.1, CCDS63172.1, CCDS63173.1	2q37.2	2014-09-17			ENSG00000115648	ENSG00000115648			29643	protein-coding gene	gene with protein product		606526				11980908, 11504925	Standard	NM_024101		Approved	l1Rk3, l(1)-3Rk, Slac-2a, ln, exophilin-3	uc002vwt.3	Q9BV36	OTTHUMG00000133298	ENST00000264605.3:c.737A>T	2.37:g.238434305A>T	ENSP00000264605:p.Glu246Val	40.0	0.0		52.0	14.0	NM_001042467	B3KSS2|B4DKW7|G5E9G5|Q9HA71	Missense_Mutation	SNP	ENST00000264605.3	37	CCDS2518.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.803|9.803	1.180978|1.180978	0.21787|0.21787	.|.	.|.	ENSG00000115648|ENSG00000115648	ENST00000264605;ENST00000445024;ENST00000338530;ENST00000409373|ENST00000437893	T;T;T;T|T	0.33865|0.31247	1.89;1.88;1.68;1.39|1.5	3.24|3.24	2.07|2.07	0.26955|0.26955	.|.	0.533147|.	0.13871|.	U|.	0.357000|.	T|T	0.32224|0.32224	0.0822|0.0822	L|L	0.47190|0.47190	1.495|1.495	0.09310|0.09310	N|N	1|1	D;D;D;D;D;D|.	0.63046|.	0.98;0.966;0.992;0.985;0.981;0.967|.	P;P;P;P;P;P|.	0.57324|.	0.578;0.543;0.818;0.587;0.793;0.547|.	T|T	0.22871|0.22871	-1.0204|-1.0204	10|7	0.66056|0.87932	D|D	0.02|0	-10.8271|-10.8271	7.5003|7.5003	0.27513|0.27513	0.8826:0.0:0.1174:0.0|0.8826:0.0:0.1174:0.0	.|.	246;130;246;206;246;246|.	B4DKW7;Q6UWC1;A8KA64;B8ZZ97;Q9BV36-2;Q9BV36|.	.;.;.;.;.;MELPH_HUMAN|.	V|W	246;246;246;206|53	ENSP00000264605:E246V;ENSP00000414849:E246V;ENSP00000341845:E246V;ENSP00000386780:E206V|ENSP00000412438:R53W	ENSP00000264605:E246V|ENSP00000412438:R53W	E|R	+|+	2|1	0|2	MLPH|MLPH	238099044|238099044	0.015000|0.015000	0.18098|0.18098	0.003000|0.003000	0.11579|0.11579	0.001000|0.001000	0.01503|0.01503	0.929000|0.929000	0.28844|0.28844	0.159000|0.159000	0.19401|0.19401	-1.450000|-1.450000	0.01041|0.01041	GAG|AGG	.		0.632	MLPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257083.2	NM_024101	
MPP3	4356	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	41879127	41879127	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr17:41879127A>G	ENST00000398389.4	-	20	1865	c.1700T>C	c.(1699-1701)gTg>gCg	p.V567A	MPP3_ENST00000398393.1_Missense_Mutation_p.V592A	NM_001932.4	NP_001923.2	Q13368	MPP3_HUMAN	membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)	567	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	guanylate kinase activity (GO:0004385)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		CTCTAAGACCACTTTGAGCTG	0.552																																					p.V567A		.											.	MPP3	91	0			c.T1700C						.						117.0	113.0	115.0					17																	41879127		1946	4142	6088	SO:0001583	missense	4356	exon20			AAGACCACTTTGA		CCDS42344.1	17q12-q21	2008-07-18			ENSG00000161647	ENSG00000161647			7221	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 3"", ""discs, large (Drosophila) homolog 3"", ""membrane protein palmitoylated 3"""	601114		DLG3		8824795	Standard	NR_003562		Approved		uc002iei.4	Q13368	OTTHUMG00000133838	ENST00000398389.4:c.1700T>C	17.37:g.41879127A>G	ENSP00000381425:p.Val567Ala	25.0	0.0		20.0	5.0	NM_001932	B2R7N0|D3DX47|Q4GX05|Q6PGR3|Q86SV1	Missense_Mutation	SNP	ENST00000398389.4	37	CCDS42344.1	.	.	.	.	.	.	.	.	.	.	A	10.67	1.414338	0.25465	.	.	ENSG00000161647	ENST00000398393;ENST00000398389	T;T	0.39787	1.06;1.06	5.42	-7.91	0.01165	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	1.344970	0.04615	N	0.400942	T	0.18425	0.0442	N	0.03917	-0.325	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.28073	-1.0055	10	0.16896	T	0.51	.	13.4256	0.61024	0.1542:0.2365:0.6093:0.0	.	567;592	Q13368;D3DX46	MPP3_HUMAN;.	A	592;567	ENSP00000381430:V592A;ENSP00000381425:V567A	ENSP00000381425:V567A	V	-	2	0	MPP3	39234653	0.000000	0.05858	0.000000	0.03702	0.987000	0.75469	-0.693000	0.05121	-1.358000	0.02177	0.460000	0.39030	GTG	.		0.552	MPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258371.1	NM_001932	
MRPS25	64432	ucsc.edu;bcgsc.ca	37	3	15094002	15094002	+	Silent	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:15094002G>T	ENST00000253686.2	-	4	608	c.468C>A	c.(466-468)ccC>ccA	p.P156P	MRPS25_ENST00000449354.2_Intron|MRPS25_ENST00000444840.2_Missense_Mutation_p.P127Q|MRPS25_ENST00000496484.1_5'Flank	NM_022497.3	NP_071942.1	P82663	RT25_HUMAN	mitochondrial ribosomal protein S25	156						mitochondrion (GO:0005739)|ribosome (GO:0005840)		p.P156P(1)		large_intestine(1)|lung(1)	2						TCATCTCCTTGGGTAATGGCA	0.607																																					p.P156P		.											.	MRPS25	90	1	Substitution - coding silent(1)	lung(1)	c.C468A						.						187.0	171.0	176.0					3																	15094002		2203	4300	6503	SO:0001819	synonymous_variant	64432	exon4			CTCCTTGGGTAAT	AB061208	CCDS2622.1	3p25	2012-09-13			ENSG00000131368	ENSG00000131368		"""Mitochondrial ribosomal proteins / small subunits"""	14511	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S25"""	611987				11279123	Standard	NM_022497		Approved	MRP-S25, FLJ00023, DKFZp313H0817, RPMS25	uc003bzl.3	P82663	OTTHUMG00000129836	ENST00000253686.2:c.468C>A	3.37:g.15094002G>T		73.0	0.0		48.0	4.0	NM_022497	B4DFJ5|B4DQG6|Q9H7P5	Silent	SNP	ENST00000253686.2	37	CCDS2622.1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.014606	0.54468	.	.	ENSG00000131368	ENST00000444840	.	.	.	5.5	3.7	0.42460	.	0.000000	0.85682	D	0.000000	T	0.30792	0.0776	.	.	.	0.23260	N	0.998024	B	0.21071	0.051	B	0.16722	0.016	T	0.28299	-1.0048	8	0.87932	D	0	-24.8356	7.1559	0.25637	0.0789:0.0:0.508:0.413	.	127	B4DQG6	.	Q	127	.	ENSP00000407733:P127Q	P	-	2	0	MRPS25	15069006	1.000000	0.71417	0.997000	0.53966	0.923000	0.55619	1.442000	0.35046	0.694000	0.31654	0.491000	0.48974	CCA	.		0.607	MRPS25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252076.2	NM_022497	
MTG1	92170	ucsc.edu;bcgsc.ca	37	10	135211954	135211954	+	Silent	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr10:135211954T>C	ENST00000317502.6	+	4	348	c.298T>C	c.(298-300)Tta>Cta	p.L100L	RP11-108K14.8_ENST00000468317.2_Silent_p.L105L|MTG1_ENST00000477902.2_Silent_p.L59L	NM_138384.2	NP_612393.2	Q9BT17	MTG1_HUMAN	mitochondrial ribosome-associated GTPase 1	100	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)		TATGCAACACTTAGAAGGAGA	0.403																																					p.L100L		.											.	MTG1	91	0			c.T298C						.						105.0	103.0	104.0					10																	135211954		2203	4300	6503	SO:0001819	synonymous_variant	92170	exon4			CAACACTTAGAAG		CCDS31320.1	10q26.3	2013-05-24	2013-05-24	2006-01-09	ENSG00000148824	ENSG00000148824			32159	protein-coding gene	gene with protein product			"""GTP-binding protein 7"", ""GTP-binding protein 7 (putative)"", ""mitochondrial GTPase 1 homolog (S. cerevisiae)"""	GTPBP7		12808030, 23396448	Standard	NM_138384		Approved		uc001lnd.3	Q9BT17	OTTHUMG00000166564	ENST00000317502.6:c.298T>C	10.37:g.135211954T>C		40.0	0.0		42.0	5.0	NM_138384	Q5VWX8|Q6PIY9|Q8IYJ4|Q8NC48|Q9BVU8	Silent	SNP	ENST00000317502.6	37	CCDS31320.1																																																																																			.		0.403	MTG1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051166.1	NM_138384	
MUC16	94025	ucsc.edu;bcgsc.ca	37	19	9048403	9048403	+	Silent	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr19:9048403A>G	ENST00000397910.4	-	5	33431	c.33228T>C	c.(33226-33228)agT>agC	p.S11076S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11078	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGCCCCATGACTGGTGGCCA	0.507																																					p.S11076S		.											.	MUC16	566	0			c.T33228C						.						84.0	76.0	78.0					19																	9048403		1915	4133	6048	SO:0001819	synonymous_variant	94025	exon5			CCCATGACTGGTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.33228T>C	19.37:g.9048403A>G		78.0	0.0		48.0	4.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			.		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYH10	4628	ucsc.edu;bcgsc.ca	37	17	8381680	8381680	+	Silent	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr17:8381680T>C	ENST00000269243.4	-	39	5727	c.5589A>G	c.(5587-5589)cgA>cgG	p.R1863R	MYH10_ENST00000379980.4_Silent_p.R1879R|MYH10_ENST00000360416.3_Silent_p.R1894R|MYH10_ENST00000396239.1_Silent_p.R1884R|NDEL1_ENST00000299734.7_Intron	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1863					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						GGTCCGCGTGTCGACGCTCAT	0.542																																					p.R1894R		.											.	MYH10	92	0			c.A5682G						.						152.0	123.0	133.0					17																	8381680		2203	4300	6503	SO:0001819	synonymous_variant	4628	exon41			CGCGTGTCGACGC	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.5589A>G	17.37:g.8381680T>C		61.0	0.0		47.0	4.0	NM_001256012	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Silent	SNP	ENST00000269243.4	37	CCDS11144.1																																																																																			.		0.542	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
MYO16	23026	broad.mit.edu;mdanderson.org	37	13	109507803	109507803	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr13:109507803C>T	ENST00000357550.2	+	10	1236	c.1195C>T	c.(1195-1197)Cct>Tct	p.P399S	MYO16_ENST00000356711.2_Missense_Mutation_p.P399S|MYO16_ENST00000251041.5_Missense_Mutation_p.P399S	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CAAGCTAATGCCTCCTGCCCC	0.458																																					p.P421S		.											.	MYO16	142	0			c.C1261T						.						83.0	69.0	73.0					13																	109507803		2203	4300	6503	SO:0001583	missense	23026	exon11			CTAATGCCTCCTG		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.1195C>T	13.37:g.109507803C>T	ENSP00000350160:p.Pro399Ser	57.0	2.0		56.0	11.0	NM_001198950		Missense_Mutation	SNP	ENST00000357550.2	37	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.781935	0.70222	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857	D;D;D	0.94931	-3.56;-3.56;-3.56	5.81	5.81	0.92471	Myosin head, motor domain (1);	0.000000	0.40469	U	0.001089	D	0.97052	0.9037	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.993	D	0.96512	0.9379	9	.	.	.	.	18.7092	0.91649	0.0:1.0:0.0:0.0	.	399;399	Q9Y6X6-2;Q9Y6X6	.;MYO16_HUMAN	S	399;399;399;399;187	ENSP00000349145:P399S;ENSP00000350160:P399S;ENSP00000251041:P399S	.	P	+	1	0	MYO16	108305804	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	6.877000	0.75562	2.749000	0.94314	0.650000	0.86243	CCT	.		0.458	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
MYO3B	140469	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	171358299	171358299	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:171358299G>T	ENST00000408978.4	+	28	3437	c.3294G>T	c.(3292-3294)tgG>tgT	p.W1098C	MYO3B_ENST00000409044.3_Intron|MYO3B_ENST00000334231.6_Missense_Mutation_p.W1107C|MYO3B_ENST00000602629.1_Intron	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	1098	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						TTTTAGCCTGGAGAGGATATG	0.383																																					p.W1098C		.											.	MYO3B	530	0			c.G3294T						.						70.0	64.0	66.0					2																	171358299		1828	4088	5916	SO:0001583	missense	140469	exon28			AGCCTGGAGAGGA		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.3294G>T	2.37:g.171358299G>T	ENSP00000386213:p.Trp1098Cys	48.0	0.0		38.0	14.0	NM_138995	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	ENST00000408978.4	37	CCDS42773.1	.	.	.	.	.	.	.	.	.	.	G	13.56	2.273145	0.40194	.	.	ENSG00000071909	ENST00000408978;ENST00000317915;ENST00000334231	T;T	0.30182	1.54;1.54	5.62	4.74	0.60224	.	0.110120	0.64402	D	0.000003	T	0.34337	0.0894	M	0.62209	1.925	0.80722	D	1	B;B	0.19200	0.012;0.034	B;B	0.24269	0.012;0.052	T	0.10753	-1.0616	10	0.41790	T	0.15	.	14.7211	0.69308	0.0699:0.0:0.9301:0.0	.	1098;1098	Q8WXR4-5;Q8WXR4	.;MYO3B_HUMAN	C	1098;1097;1107	ENSP00000386213:W1098C;ENSP00000335100:W1107C	ENSP00000314213:W1097C	W	+	3	0	MYO3B	171066545	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.901000	0.75693	1.376000	0.46267	0.561000	0.74099	TGG	.		0.383	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1		
MYT1	4661	ucsc.edu;bcgsc.ca	37	20	62839474	62839474	+	Missense_Mutation	SNP	C	C	A	rs200028860		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr20:62839474C>A	ENST00000328439.1	+	7	1289	c.925C>A	c.(925-927)Cct>Act	p.P309T	MYT1_ENST00000360149.4_Intron|MYT1_ENST00000536311.1_Missense_Mutation_p.P309T	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					ggaggCAGCTCCTGATGTGAT	0.572																																					p.P309T	GBM(59;481 1041 20555 21139 33705)	.											.	MYT1	704	0			c.C925A						.						75.0	76.0	75.0					20																	62839474		2203	4300	6503	SO:0001583	missense	4661	exon7			GCAGCTCCTGATG	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.925C>A	20.37:g.62839474C>A	ENSP00000327465:p.Pro309Thr	21.0	0.0		27.0	6.0	NM_004535	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	c	0.047	-1.261277	0.01445	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.69435	-0.4;-0.4	4.6	-1.1	0.09872	.	21.670500	0.00783	U	0.001284	T	0.54367	0.1854	L	0.54323	1.7	0.20074	N	0.999935	B	0.23377	0.084	B	0.25759	0.063	T	0.18116	-1.0347	10	0.05833	T	0.94	-0.479	1.8614	0.03189	0.1243:0.3878:0.1215:0.3663	.	309	Q01538	MYT1_HUMAN	T	309	ENSP00000327465:P309T;ENSP00000442412:P309T	ENSP00000327465:P309T	P	+	1	0	MYT1	62309918	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.204000	0.09425	-0.184000	0.10567	-1.316000	0.01300	CCT	C|1.000;T|0.000		0.572	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
NBR1	4077	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	41347052	41347052	+	Silent	SNP	T	T	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr17:41347052T>G	ENST00000422280.1	+	14	2205	c.1746T>G	c.(1744-1746)ccT>ccG	p.P582P	NBR1_ENST00000341165.6_Silent_p.P582P|NBR1_ENST00000590996.1_Silent_p.P582P|NBR1_ENST00000589872.1_Silent_p.P582P|NBR1_ENST00000389312.4_Silent_p.P582P|NBR1_ENST00000542611.1_Silent_p.P561P	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	582	ATG8 family protein-binding.				macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		ACAACACCCCTGTGGGTAAGA	0.418																																					p.P582P		.											.	NBR1	130	0			c.T1746G						.						94.0	94.0	94.0					17																	41347052		1914	4113	6027	SO:0001819	synonymous_variant	4077	exon14			CACCCCTGTGGGT	X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.1746T>G	17.37:g.41347052T>G		102.0	0.0		117.0	16.0	NM_031862	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Silent	SNP	ENST00000422280.1	37	CCDS45694.1																																																																																			.		0.418	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453461.1	NM_005899	
NCOR2	9612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	124835268	124835268	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:124835268C>T	ENST00000405201.1	-	28	3709	c.3709G>A	c.(3709-3711)Gtc>Atc	p.V1237I	NCOR2_ENST00000404621.1_Missense_Mutation_p.V1227I|NCOR2_ENST00000429285.2_Missense_Mutation_p.V1227I|NCOR2_ENST00000356219.3_Missense_Mutation_p.V1244I|NCOR2_ENST00000404121.2_Missense_Mutation_p.V798I|NCOR2_ENST00000397355.1_Missense_Mutation_p.V1228I			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1245					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TTGTACAGGACGTCAGCTGGC	0.637																																					p.V1237I		.											.	NCOR2	229	0			c.G3709A						.						55.0	60.0	58.0					12																	124835268		2193	4280	6473	SO:0001583	missense	9612	exon30			ACAGGACGTCAGC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.3709G>A	12.37:g.124835268C>T	ENSP00000384018:p.Val1237Ile	14.0	0.0		32.0	10.0	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	ENST00000405201.1	37	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	C	18.66	3.672057	0.67928	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285;ENST00000458234	T;T;T;T;T;T;T	0.35789	2.06;2.33;2.07;2.33;2.07;2.33;1.29	4.99	4.99	0.66335	.	0.000000	0.64402	D	0.000001	T	0.59046	0.2165	M	0.64997	1.995	0.58432	D	0.999997	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.76071	0.986;0.979;0.987	T	0.62134	-0.6918	10	0.62326	D	0.03	-42.5425	18.2573	0.90023	0.0:1.0:0.0:0.0	.	1227;1228;1237	C9J0Q5;C9J239;C9JFD3	.;.;.	I	1237;1227;1244;1228;1236;798;1227;1245	ENSP00000384018:V1237I;ENSP00000384202:V1227I;ENSP00000348551:V1244I;ENSP00000380513:V1228I;ENSP00000385618:V798I;ENSP00000400281:V1227I;ENSP00000402808:V1245I	ENSP00000348551:V1244I	V	-	1	0	NCOR2	123401221	1.000000	0.71417	0.719000	0.30619	0.656000	0.38851	5.703000	0.68340	2.315000	0.78130	0.478000	0.44815	GTC	.		0.637	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
NEMF	9147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	50269987	50269987	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr14:50269987T>C	ENST00000298310.5	-	20	2332	c.1883A>G	c.(1882-1884)gAa>gGa	p.E628G	NEMF_ENST00000556925.1_5'UTR|NEMF_ENST00000546046.1_Missense_Mutation_p.E607G|NEMF_ENST00000545773.1_Missense_Mutation_p.E586G			O60524	NEMF_HUMAN	nuclear export mediator factor	628					nuclear export (GO:0051168)	nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						TGTCAAATATTCTCCAGTTGG	0.328																																					p.E628G		.											.	NEMF	90	0			c.A1883G						.						130.0	116.0	121.0					14																	50269987		2202	4299	6501	SO:0001583	missense	9147	exon20			AAATATTCTCCAG	AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.1883A>G	14.37:g.50269987T>C	ENSP00000298310:p.Glu628Gly	105.0	0.0		105.0	32.0	NM_004713	A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Missense_Mutation	SNP	ENST00000298310.5	37	CCDS9694.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.748169	0.89663	.	.	ENSG00000165525	ENST00000298310;ENST00000545773;ENST00000546046;ENST00000534912;ENST00000555970	T;T;T;T	0.59364	0.38;0.37;0.27;0.36	5.79	5.79	0.91817	Domain of unknown function DUF814 (1);	0.000000	0.85682	D	0.000000	T	0.80549	0.4644	M	0.90483	3.12	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.87578	0.986;0.996;0.996;0.998	D	0.83900	0.0289	10	0.54805	T	0.06	-27.6727	15.8372	0.78808	0.0:0.0:0.0:1.0	.	607;603;586;628	O60524-3;O60524-5;O60524-4;O60524	.;.;.;NEMF_HUMAN	G	628;586;607;400;586	ENSP00000298310:E628G;ENSP00000438309:E586G;ENSP00000441016:E607G;ENSP00000452540:E586G	ENSP00000298310:E628G	E	-	2	0	NEMF	49339737	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.913000	0.75759	2.225000	0.72522	0.477000	0.44152	GAA	.		0.328	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410798.1	NM_004713	
NLRC5	84166	ucsc.edu;bcgsc.ca	37	16	57075465	57075465	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr16:57075465A>G	ENST00000262510.6	+	18	3233	c.3008A>G	c.(3007-3009)cAc>cGc	p.H1003R	NLRC5_ENST00000308149.7_Missense_Mutation_p.H1003R|NLRC5_ENST00000539144.1_Missense_Mutation_p.H1003R|NLRC5_ENST00000436936.1_Missense_Mutation_p.H1003R	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1003					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				GGAAGCTGCCACCTCGGTCAC	0.542																																					p.H1003R		.											.	NLRC5	159	0			c.A3008G						.						79.0	74.0	76.0					16																	57075465		2198	4300	6498	SO:0001583	missense	84166	exon17			GCTGCCACCTCGG	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.3008A>G	16.37:g.57075465A>G	ENSP00000262510:p.His1003Arg	33.0	0.0		35.0	4.0	NM_032206	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	37	CCDS10773.1	.	.	.	.	.	.	.	.	.	.	A	11.30	1.599336	0.28534	.	.	ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030	T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68	2.66	0.296	0.15757	.	1.066340	0.07479	N	0.903569	T	0.25531	0.0621	N	0.16066	0.365	0.09310	N	1	B;B;B;B	0.13145	0.003;0.007;0.004;0.0	B;B;B;B	0.10450	0.003;0.005;0.004;0.004	T	0.23084	-1.0198	10	0.13853	T	0.58	.	4.3926	0.11348	0.6116:0.0:0.3884:0.0	.	1003;1003;1003;1003	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3	.;.;.;NLRC5_HUMAN	R	1003;1003;1003;477;1003;510;302	ENSP00000262510:H1003R;ENSP00000308886:H1003R;ENSP00000389739:H1003R;ENSP00000441727:H1003R;ENSP00000441597:H510R;ENSP00000440153:H302R	ENSP00000262510:H1003R	H	+	2	0	NLRC5	55632966	0.000000	0.05858	0.001000	0.08648	0.267000	0.26476	-1.105000	0.03323	0.024000	0.15214	0.533000	0.62120	CAC	.		0.542	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206	
NPAT	4863	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	108032148	108032148	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:108032148G>A	ENST00000278612.8	-	17	3770	c.3665C>T	c.(3664-3666)tCa>tTa	p.S1222L		NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	1222					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		TGTACCTACTGAAAGTACATT	0.393																																					p.S1222L		.											.	NPAT	117	0			c.C3665T						.						240.0	242.0	241.0					11																	108032148		1841	4095	5936	SO:0001583	missense	4863	exon17			CCTACTGAAAGTA	X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.3665C>T	11.37:g.108032148G>A	ENSP00000278612:p.Ser1222Leu	285.0	1.0		250.0	42.0	NM_002519	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	ENST00000278612.8	37	CCDS41710.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.80|10.80	1.452400|1.452400	0.26074|0.26074	.|.	.|.	ENSG00000149308|ENSG00000149308	ENST00000527296|ENST00000278612	.|T	.|0.04758	.|3.56	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	.|0.354983	.|0.26507	.|N	.|0.023984	.|T	.|0.07052	.|0.0179	L|L	0.54323|0.54323	1.7|1.7	0.09310|0.09310	N|N	1|1	.|P	.|0.38078	.|0.617	.|B	.|0.34242	.|0.178	.|T	.|0.20538	.|-1.0272	.|10	.|0.66056	.|D	.|0.02	-7.7222|-7.7222	14.509|14.509	0.67772|0.67772	0.0:0.0:0.8535:0.1465|0.0:0.0:0.8535:0.1465	.|.	.|1222	.|Q14207	.|NPAT_HUMAN	X|L	221|1222	.|ENSP00000278612:S1222L	.|ENSP00000278612:S1222L	Q|S	-|-	1|2	0|0	NPAT|NPAT	107537358|107537358	0.945000|0.945000	0.32115|0.32115	0.223000|0.223000	0.23860|0.23860	0.302000|0.302000	0.27658|0.27658	4.936000|4.936000	0.63506|0.63506	2.890000|2.890000	0.99128|0.99128	0.650000|0.650000	0.86243|0.86243	CAG|TCA	.		0.393	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	NM_002519	
NPHP3	27031	ucsc.edu;bcgsc.ca	37	3	132418879	132418879	+	Silent	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:132418879A>G	ENST00000337331.5	-	12	1856	c.1770T>C	c.(1768-1770)tcT>tcC	p.S590S	NPHP3_ENST00000326682.8_Silent_p.S590S	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	590					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GTGTCAGAGCAGAGACTGACC	0.438																																					p.S590S		.											.	NPHP3	91	0			c.T1770C						.						72.0	69.0	70.0					3																	132418879		2203	4300	6503	SO:0001819	synonymous_variant	27031	exon12			CAGAGCAGAGACT	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.1770T>C	3.37:g.132418879A>G		32.0	0.0		41.0	4.0	NM_153240	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Silent	SNP	ENST00000337331.5	37	CCDS3078.1																																																																																			.		0.438	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	NM_153240	
NPR1	4881	ucsc.edu;bcgsc.ca	37	1	153660156	153660156	+	Silent	SNP	T	T	C	rs373643330		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:153660156T>C	ENST00000368680.3	+	14	2611	c.2139T>C	c.(2137-2139)ccT>ccC	p.P713P		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	713	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	CTTCACCCCCTGTGCGGGGCT	0.597																																					p.P713P	Pancreas(141;1349 1870 15144 15830 40702)	.											.	NPR1	393	0			c.T2139C						.						89.0	87.0	88.0					1																	153660156		2203	4300	6503	SO:0001819	synonymous_variant	4881	exon14			ACCCCCTGTGCGG	BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.2139T>C	1.37:g.153660156T>C		29.0	0.0		60.0	4.0	NM_000906	B0ZBF0|Q5SR08|Q6P4Q3	Silent	SNP	ENST00000368680.3	37	CCDS1051.1																																																																																			.		0.597	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090034.1	NM_000906	
NR3C2	4306	ucsc.edu;bcgsc.ca	37	4	149115938	149115938	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr4:149115938C>A	ENST00000358102.3	-	4	2335	c.1973G>T	c.(1972-1974)tGc>tTc	p.C658F	NR3C2_ENST00000512865.1_Missense_Mutation_p.C658F|NR3C2_ENST00000511528.1_Missense_Mutation_p.C662F|NR3C2_ENST00000355292.3_Missense_Mutation_p.C662F|NR3C2_ENST00000503313.1_5'UTR|RP11-76G10.1_ENST00000514843.1_RNA|NR3C2_ENST00000344721.4_Missense_Mutation_p.C658F	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	658					gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	CTGAAGTCTGCAAGCAGGACA	0.308																																					p.C658F	Melanoma(27;428 957 40335 51025 51111)	.											.	NR3C2	154	0			c.G1973T						.						92.0	92.0	92.0					4																	149115938		2203	4300	6503	SO:0001583	missense	4306	exon4			AGTCTGCAAGCAG	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.1973G>T	4.37:g.149115938C>A	ENSP00000350815:p.Cys658Phe	37.0	0.0		32.0	5.0	NM_001166104	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	ENST00000358102.3	37	CCDS3772.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.851188	0.91277	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000512865;ENST00000342437;ENST00000511528	D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.99939	0.9973	H	0.98918	4.37	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96222	0.9161	9	.	.	.	.	20.1979	0.98245	0.0:1.0:0.0:0.0	.	658;658	B0ZBF5;B0ZBF6	.;.	F	658;662;658;658;658;662	ENSP00000341390:C658F;ENSP00000347441:C662F;ENSP00000350815:C658F;ENSP00000423510:C658F;ENSP00000343907:C658F;ENSP00000421481:C662F	.	C	-	2	0	NR3C2	149335388	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.846000	0.97976	0.650000	0.86243	TGC	.		0.308	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
NTN4	59277	ucsc.edu;bcgsc.ca	37	12	96181034	96181034	+	Silent	SNP	G	G	A	rs138865446		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:96181034G>A	ENST00000343702.4	-	2	716	c.268C>T	c.(268-270)Ctg>Ttg	p.L90L	NTN4_ENST00000538383.1_Silent_p.L53L|NTN4_ENST00000553059.1_Silent_p.L90L|NTN4_ENST00000344911.4_Silent_p.L53L	NM_021229.3	NP_067052.2	Q9HB63	NET4_HUMAN	netrin 4	90	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|extracellular matrix organization (GO:0030198)|neuron remodeling (GO:0016322)|regulation of branching involved in salivary gland morphogenesis by extracellular matrix-epithelial cell signaling (GO:0060668)	basement membrane (GO:0005604)|plasma membrane (GO:0005886)				NS(2)|breast(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						GCAGATGGCAGGTGAGCCAGG	0.537													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21334	0.0		0.0	False		,,,				2504	0.0				p.L90L		.											.	NTN4	92	0			c.C268T						.	G		4,4402	8.1+/-20.4	0,4,2199	143.0	108.0	120.0		268	5.5	1.0	12	dbSNP_134	120	0,8600		0,0,4300	no	coding-synonymous	NTN4	NM_021229.3		0,4,6499	AA,AG,GG		0.0,0.0908,0.0308		90/629	96181034	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	59277	exon2			ATGGCAGGTGAGC	AF119916	CCDS9054.1	12q22	2013-03-01			ENSG00000074527	ENSG00000074527		"""Netrins"""	13658	protein-coding gene	gene with protein product	"""beta-netrin"", ""Netrin-4"""	610401				11038171	Standard	NM_021229		Approved		uc001tei.3	Q9HB63	OTTHUMG00000170290	ENST00000343702.4:c.268C>T	12.37:g.96181034G>A		36.0	0.0		43.0	4.0	NM_021229	B2RNC2|Q658K9|Q7L3F1|Q7L9D6|Q7Z5B6|Q9BZP1|Q9NT44|Q9P133	Silent	SNP	ENST00000343702.4	37	CCDS9054.1																																																																																			G|1.000;A|0.000		0.537	NTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408372.1	NM_021229	
OSBPL8	114882	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	76765334	76765334	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:76765334T>C	ENST00000261183.3	-	19	2427	c.1948A>G	c.(1948-1950)Act>Gct	p.T650A	OSBPL8_ENST00000393250.4_Missense_Mutation_p.T608A|OSBPL8_ENST00000393249.2_Missense_Mutation_p.T608A	NM_020841.4	NP_065892.1	Q9BZF1	OSBL8_HUMAN	oxysterol binding protein-like 8	650					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|negative regulation of cell migration (GO:0030336)|negative regulation of sequestering of triglyceride (GO:0010891)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of protein kinase B signaling (GO:0051897)|protein localization to nuclear pore (GO:0090204)	membrane (GO:0016020)|nuclear membrane (GO:0031965)	cholesterol binding (GO:0015485)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(2)	28						GAATTATCAGTCTTTTTATCA	0.269																																					p.T650A		.											.	OSBPL8	69	0			c.A1948G						.						95.0	90.0	92.0					12																	76765334		2201	4297	6498	SO:0001583	missense	114882	exon19			TATCAGTCTTTTT	AF392452	CCDS31862.1, CCDS41814.1	12q14	2013-01-10				ENSG00000091039		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16396	protein-coding gene	gene with protein product		606736				1735225, 17991739	Standard	NM_020841		Approved	OSBP10, ORP8, MST120, MSTP120	uc001sye.1	Q9BZF1		ENST00000261183.3:c.1948A>G	12.37:g.76765334T>C	ENSP00000261183:p.Thr650Ala	54.0	0.0		65.0	12.0	NM_020841	A8K1T2|E9PE66|E9PE68|Q52LQ3|Q68D75|Q8WXP8|Q9P277	Missense_Mutation	SNP	ENST00000261183.3	37	CCDS31862.1	.	.	.	.	.	.	.	.	.	.	T	17.68	3.448705	0.63178	.	.	ENSG00000091039	ENST00000393249;ENST00000261183;ENST00000446075;ENST00000393250;ENST00000438913;ENST00000547540;ENST00000546946	T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.43255	0.1239	M	0.64676	1.99	0.58432	D	0.999998	B;P	0.37548	0.314;0.599	B;B	0.41135	0.142;0.348	T	0.42832	-0.9428	10	0.59425	D	0.04	-15.1946	15.9189	0.79544	0.0:0.0:0.0:1.0	.	625;650	F8VUA7;Q9BZF1	.;OSBL8_HUMAN	A	608;650;635;608;650;650;625	ENSP00000376939:T608A;ENSP00000261183:T650A;ENSP00000376940:T608A;ENSP00000450238:T650A;ENSP00000447893:T625A	ENSP00000261183:T650A	T	-	1	0	OSBPL8	75289465	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.762000	0.62250	2.226000	0.72624	0.377000	0.23210	ACT	.		0.269	OSBPL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406357.1	NM_020841	
OTOGL	283310	ucsc.edu;bcgsc.ca	37	12	80655780	80655780	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:80655780C>A	ENST00000547103.1	+	18	1900	c.1894C>A	c.(1894-1896)Caa>Aaa	p.Q632K	OTOGL_ENST00000458043.2_Missense_Mutation_p.Q632K			Q3ZCN5	OTOGL_HUMAN	otogelin-like	632	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						AGGTACACCACAACTTCACGC	0.403																																					p.Q632K		.											.	.	.	0			c.C1894A						.						130.0	133.0	132.0					12																	80655780		1940	4129	6069	SO:0001583	missense	283310	exon18			ACACCACAACTTC	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.1894C>A	12.37:g.80655780C>A	ENSP00000447211:p.Gln632Lys	34.0	0.0		50.0	6.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	37		.	.	.	.	.	.	.	.	.	.	C	22.9	4.349728	0.82132	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.15718	2.4;2.4	5.57	5.57	0.84162	.	.	.	.	.	T	0.34832	0.0911	L	0.58101	1.795	0.58432	D	0.999999	.	.	.	.	.	.	T	0.00496	-1.1705	7	0.35671	T	0.21	.	19.5529	0.95328	0.0:1.0:0.0:0.0	.	.	.	.	K	632	ENSP00000447211:Q632K;ENSP00000400895:Q632K	ENSP00000400895:Q632K	Q	+	1	0	OTOGL	79179911	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	7.336000	0.79245	2.621000	0.88768	0.655000	0.94253	CAA	.		0.403	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
OAS2	4939	ucsc.edu;bcgsc.ca	37	12	113433226	113433226	+	Missense_Mutation	SNP	C	C	A	rs533259756		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:113433226C>A	ENST00000342315.4	+	3	788	c.574C>A	c.(574-576)Cgt>Agt	p.R192S	RP1-71H24.1_ENST00000552784.1_RNA|OAS2_ENST00000392583.2_Missense_Mutation_p.R192S	NM_016817.2	NP_058197.2	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2, 69/71kDa	192	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|nucleobase-containing compound metabolic process (GO:0006139)|protein glycosylation (GO:0006486)|protein myristoylation (GO:0018377)|purine nucleotide biosynthetic process (GO:0006164)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)	p.R192C(1)		NS(1)|breast(2)|endometrium(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						TTTTGACAACCGTCCTGGAAA	0.393																																					p.R192S	Pancreas(199;709 2232 18410 33584 35052)	.											.	OAS2	91	1	Substitution - Missense(1)	large_intestine(1)	c.C574A						.						93.0	90.0	91.0					12																	113433226		2203	4300	6503	SO:0001583	missense	4939	exon3			GACAACCGTCCTG	M87284	CCDS31906.1, CCDS41839.1, CCDS44982.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111335			8087	protein-coding gene	gene with protein product		603350	"""2'-5'-oligoadenylate synthetase 2 (69-71 kD)"""			9790745	Standard	NM_002535		Approved		uc001tuj.3	P29728	OTTHUMG00000169802	ENST00000342315.4:c.574C>A	12.37:g.113433226C>A	ENSP00000342278:p.Arg192Ser	48.0	0.0		41.0	4.0	NM_002535	A8K9T1|Q6PJ33|Q86XX8	Missense_Mutation	SNP	ENST00000342315.4	37	CCDS31906.1	.	.	.	.	.	.	.	.	.	.	C	6.258	0.415665	0.11870	.	.	ENSG00000111335	ENST00000342315;ENST00000392583;ENST00000552756	T;T;T	0.12465	2.68;2.68;2.68	4.21	-1.89	0.07689	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	2.833050	0.01634	U	0.023691	T	0.21427	0.0516	M	0.78456	2.415	0.09310	N	1	B;B	0.33637	0.42;0.312	B;B	0.35039	0.194;0.091	T	0.39143	-0.9628	10	0.62326	D	0.03	-23.8138	8.5572	0.33489	0.0:0.3012:0.0:0.6988	.	192;192	P29728;P29728-2	OAS2_HUMAN;.	S	192;192;117	ENSP00000342278:R192S;ENSP00000376362:R192S;ENSP00000446977:R117S	ENSP00000342278:R192S	R	+	1	0	OAS2	111917609	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	-0.041000	0.12084	-0.699000	0.05077	-0.444000	0.05651	CGT	.		0.393	OAS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405937.1		
PARP4	143	ucsc.edu;bcgsc.ca	37	13	25026551	25026551	+	Missense_Mutation	SNP	C	C	A	rs373274417		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr13:25026551C>A	ENST00000381989.3	-	24	3112	c.3007G>T	c.(3007-3009)Ggt>Tgt	p.G1003C		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1003	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		CACCCGATACCGCAGGCGAAT	0.582																																					p.G1003C		.											.	PARP4	94	0			c.G3007T						.						126.0	127.0	127.0					13																	25026551		2203	4300	6503	SO:0001583	missense	143	exon24			CGATACCGCAGGC	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3007G>T	13.37:g.25026551C>A	ENSP00000371419:p.Gly1003Cys	39.0	0.0		45.0	4.0	NM_006437	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	ENST00000381989.3	37	CCDS9307.1	.	.	.	.	.	.	.	.	.	.	C	16.51	3.143436	0.57044	.	.	ENSG00000102699	ENST00000381989	T	0.32988	1.43	5.29	5.29	0.74685	von Willebrand factor, type A (3);	0.108050	0.64402	D	0.000006	T	0.60025	0.2237	M	0.83953	2.67	0.50171	D	0.999856	D	0.89917	1.0	D	0.97110	1.0	T	0.64550	-0.6381	10	0.87932	D	0	-12.1742	16.5315	0.84361	0.0:1.0:0.0:0.0	.	1003	Q9UKK3	PARP4_HUMAN	C	1003	ENSP00000371419:G1003C	ENSP00000371419:G1003C	G	-	1	0	PARP4	23924551	1.000000	0.71417	0.337000	0.25536	0.062000	0.15995	5.915000	0.69973	2.778000	0.95560	0.638000	0.83543	GGT	.		0.582	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437	
PASD1	139135	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	150839639	150839639	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chrX:150839639G>T	ENST00000370357.4	+	12	1446	c.1201G>T	c.(1201-1203)Gca>Tca	p.A401S		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	401						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					CCAGCAGAATGCATTGGAATT	0.463																																					p.A401S		.											.	PASD1	133	0			c.G1201T						.						195.0	161.0	172.0					X																	150839639		2203	4300	6503	SO:0001583	missense	139135	exon12			CAGAATGCATTGG	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1201G>T	X.37:g.150839639G>T	ENSP00000359382:p.Ala401Ser	94.0	0.0		109.0	21.0	NM_173493	Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	ENST00000370357.4	37	CCDS35431.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.707719	0.30322	.	.	ENSG00000166049	ENST00000370357	T	0.17370	2.28	3.78	-2.68	0.06041	.	.	.	.	.	T	0.09335	0.0230	L	0.27053	0.805	0.09310	N	1	P	0.37101	0.582	B	0.35688	0.208	T	0.18053	-1.0349	9	0.49607	T	0.09	-35.6315	3.2783	0.06906	0.314:0.0:0.2256:0.4603	.	401	Q8IV76	PASD1_HUMAN	S	401	ENSP00000359382:A401S	ENSP00000359382:A401S	A	+	1	0	PASD1	150590295	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.227000	0.17795	-0.877000	0.04012	0.529000	0.55759	GCA	.		0.463	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493	
PCDH10	57575	ucsc.edu;bcgsc.ca	37	4	134071608	134071608	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr4:134071608C>A	ENST00000264360.5	+	1	1139	c.313C>A	c.(313-315)Ctg>Atg	p.L105M	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	105	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CCCCCTGGAGCTGTTCCAGGT	0.572																																					p.L105M		.											.	PCDH10	92	0			c.C313A						.						51.0	57.0	55.0					4																	134071608		2203	4300	6503	SO:0001583	missense	57575	exon1			CTGGAGCTGTTCC	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.313C>A	4.37:g.134071608C>A	ENSP00000264360:p.Leu105Met	31.0	0.0		36.0	4.0	NM_032961	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	C	12.51	1.959638	0.34565	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.39229	1.09	4.78	4.78	0.61160	Cadherin (3);Cadherin-like (1);	0.000000	0.35436	N	0.003220	T	0.50854	0.1640	M	0.66560	2.04	0.52099	D	0.999945	D;B	0.57899	0.981;0.114	P;B	0.52267	0.694;0.096	T	0.54200	-0.8329	10	0.59425	D	0.04	.	11.1379	0.48386	0.0:0.914:0.0:0.086	.	105;105	Q9P2E7;Q96SF0	PCD10_HUMAN;.	M	105	ENSP00000264360:L105M	ENSP00000264360:L105M	L	+	1	2	PCDH10	134291058	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.933000	0.70130	2.467000	0.83353	0.555000	0.69702	CTG	.		0.572	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
PCDHGA8	9708	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140772531	140772531	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr5:140772531G>T	ENST00000398604.2	+	1	151	c.151G>T	c.(151-153)Gac>Tac	p.D51Y	PCDHGB4_ENST00000519479.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	51	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TATCTCCAAGGACCTGGGGCT	0.612																																					p.D51Y		.											.	.	.	0			c.G151T						.						38.0	47.0	44.0					5																	140772531		2157	4277	6434	SO:0001583	missense	9708	exon1			TCCAAGGACCTGG	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.151G>T	5.37:g.140772531G>T	ENSP00000381605:p.Asp51Tyr	42.0	0.0		51.0	8.0	NM_014004	A7MCZ4|O15039	Missense_Mutation	SNP	ENST00000398604.2	37	CCDS47291.1	.	.	.	.	.	.	.	.	.	.	.	15.17	2.754618	0.49362	.	.	ENSG00000253767	ENST00000398604	T	0.34667	1.35	5.26	5.26	0.73747	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.32578	U	0.005911	T	0.76948	0.4059	H	0.98769	4.325	0.46823	D	0.999213	D;D	0.89917	1.0;1.0	D;D	0.77557	0.98;0.99	D	0.87168	0.2219	10	0.87932	D	0	.	18.4817	0.90813	0.0:0.0:1.0:0.0	.	51;51	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	Y	51	ENSP00000381605:D51Y	ENSP00000381605:D51Y	D	+	1	0	PCDHGA8	140752715	1.000000	0.71417	1.000000	0.80357	0.152000	0.21847	9.611000	0.98342	2.471000	0.83476	0.655000	0.94253	GAC	.		0.612	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	NM_032088	
PCSK4	54760	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	1484037	1484037	+	Silent	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr19:1484037C>T	ENST00000300954.5	-	9	1219	c.1158G>A	c.(1156-1158)gcG>gcA	p.A386A	CTB-25B13.6_ENST00000585643.1_RNA	NM_017573.3	NP_060043.2			proprotein convertase subtilisin/kexin type 4											cervix(2)|endometrium(2)|kidney(1)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGCCTCCAGCGCTAGGGCGA	0.766																																					p.A386A		.											.	PCSK4	90	0			c.G1158A						.						7.0	8.0	8.0					19																	1484037		2148	4198	6346	SO:0001819	synonymous_variant	54760	exon9			CTCCAGCGCTAGG	AK057235	CCDS12069.2	19p13.3	2008-02-05			ENSG00000115257	ENSG00000115257			8746	protein-coding gene	gene with protein product		600487				7782070	Standard	XM_005259586		Approved	PC4, SPC5, DKFZp434B217, MGC34749	uc002ltb.1	Q6UW60	OTTHUMG00000128541	ENST00000300954.5:c.1158G>A	19.37:g.1484037C>T		28.0	0.0		33.0	11.0	NM_017573		Silent	SNP	ENST00000300954.5	37	CCDS12069.2																																																																																			.		0.766	PCSK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449703.1	NM_017573	
PDE10A	10846	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	165749696	165749696	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr6:165749696C>A	ENST00000366882.1	-	22	2307	c.2153G>T	c.(2152-2154)gGg>gTg	p.G718V	PDE10A_ENST00000354448.4_Missense_Mutation_p.G718V|PDE10A_ENST00000539869.2_Missense_Mutation_p.G728V			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	718					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	ATTGTAGAACCCAAGCTGCCT	0.458																																					p.G728V	Esophageal Squamous(22;308 615 5753 12038 40624)	.											.	PDE10A	519	0			c.G2183T						.						69.0	65.0	66.0					6																	165749696		2203	4300	6503	SO:0001583	missense	10846	exon21			TAGAACCCAAGCT	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.2153G>T	6.37:g.165749696C>A	ENSP00000355847:p.Gly718Val	21.0	0.0		37.0	10.0	NM_001130690	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37		.	.	.	.	.	.	.	.	.	.	C	27.9	4.876481	0.91664	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	D;D	0.81579	-1.51;-1.51	5.4	5.4	0.78164	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.89870	0.6840	M	0.82716	2.605	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.961	D	0.90609	0.4550	10	0.87932	D	0	.	19.5373	0.95257	0.0:1.0:0.0:0.0	.	728;718	Q9ULW9;Q9Y233	.;PDE10_HUMAN	V	718;746;728;718;717	ENSP00000355847:G718V;ENSP00000346435:G718V	ENSP00000341187:G728V	G	-	2	0	PDE10A	165669686	1.000000	0.71417	0.721000	0.30653	0.926000	0.56050	7.075000	0.76798	2.681000	0.91329	0.655000	0.94253	GGG	.		0.458	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		
PHKB	5257	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	47533690	47533690	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr16:47533690C>G	ENST00000323584.5	+	3	214	c.190C>G	c.(190-192)Caa>Gaa	p.Q64E	PHKB_ENST00000566044.1_Missense_Mutation_p.Q57E|PHKB_ENST00000299167.8_Missense_Mutation_p.Q64E|PHKB_ENST00000455779.1_Missense_Mutation_p.Q57E|PHKB_ENST00000567402.1_3'UTR	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	64					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				GCTGCTGTATCAAAGTCCAAC	0.473																																					p.Q64E		.											.	PHKB	154	0			c.C190G						.						164.0	158.0	160.0					16																	47533690		2201	4300	6501	SO:0001583	missense	5257	exon3			CTGTATCAAAGTC		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.190C>G	16.37:g.47533690C>G	ENSP00000313504:p.Gln64Glu	32.0	0.0		23.0	7.0	NM_000293	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	C	35	5.516089	0.96402	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.92965	-3.14;-3.14	5.81	5.81	0.92471	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.052713	0.85682	N	0.000000	D	0.97365	0.9138	M	0.93638	3.44	0.80722	D	1	D;D;D	0.89917	0.992;1.0;0.992	D;D;D	0.91635	0.987;0.999;0.986	D	0.97774	1.0228	10	0.87932	D	0	-18.7238	20.0758	0.97742	0.0:1.0:0.0:0.0	.	57;64;57	B4DQ16;Q93100;Q93100-4	.;KPBB_HUMAN;.	E	57;57;64	ENSP00000414345:Q57E;ENSP00000313504:Q64E	ENSP00000299167:Q57E	Q	+	1	0	PHKB	46091191	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.763000	0.85283	2.737000	0.93849	0.655000	0.94253	CAA	.		0.473	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
PIGZ	80235	ucsc.edu;bcgsc.ca	37	3	196678748	196678748	+	Missense_Mutation	SNP	G	G	T	rs201038840		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:196678748G>T	ENST00000412723.1	-	2	301	c.155C>A	c.(154-156)cCg>cAg	p.P52Q	PIGZ_ENST00000443835.1_Missense_Mutation_p.P52Q	NM_025163.2	NP_079439.2	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Z	52					GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	alpha-1,2-mannosyltransferase activity (GO:0000026)|mannosyltransferase activity (GO:0000030)			breast(1)|endometrium(1)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	14	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		GCCCGTCTGCGGAAGGAGACA	0.572																																					p.P52Q		.											.	PIGZ	93	0			c.C155A						.						113.0	97.0	102.0					3																	196678748		2203	4300	6503	SO:0001583	missense	80235	exon2			GTCTGCGGAAGGA	BC018804	CCDS3324.1	3q29	2013-02-26	2006-06-28		ENSG00000119227	ENSG00000119227		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	30596	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 4"", ""dol-P-Man dependent GPI mannosyltransferase"""	611671	"""phosphatidylinositol glycan, class Z"""			15208306	Standard	NM_025163		Approved	FLJ12768, MGC52163, SMP3	uc003fxh.3	Q86VD9	OTTHUMG00000155522	ENST00000412723.1:c.155C>A	3.37:g.196678748G>T	ENSP00000413405:p.Pro52Gln	45.0	0.0		44.0	4.0	NM_025163	Q9H9G6	Missense_Mutation	SNP	ENST00000412723.1	37	CCDS3324.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.495766	0.64186	.	.	ENSG00000119227	ENST00000412723;ENST00000443835	T;T	0.63913	-0.07;-0.07	4.69	2.9	0.33743	.	0.000000	0.50627	D	0.000119	T	0.80752	0.4683	M	0.92970	3.365	0.31224	N	0.697075	D	0.89917	1.0	D	0.91635	0.999	T	0.80037	-0.1550	10	0.38643	T	0.18	-29.9176	9.8488	0.41043	0.1686:0.0:0.8314:0.0	.	52	Q86VD9	PIGZ_HUMAN	Q	52	ENSP00000413405:P52Q;ENSP00000389327:P52Q	ENSP00000413405:P52Q	P	-	2	0	PIGZ	198163145	1.000000	0.71417	0.836000	0.33094	0.991000	0.79684	6.149000	0.71795	0.542000	0.28846	-0.258000	0.10820	CCG	G|0.999;A|0.000		0.572	PIGZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340486.2	NM_025163	
PLCE1	51196	ucsc.edu;bcgsc.ca	37	10	95791057	95791057	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr10:95791057A>G	ENST00000371380.3	+	1	489	c.254A>G	c.(253-255)aAc>aGc	p.N85S	PLCE1_ENST00000260766.3_Missense_Mutation_p.N85S			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	85					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				AGTGATGAGAACAGTAATGAA	0.388																																					p.N85S		.											.	PLCE1	229	0			c.A254G						.						82.0	75.0	77.0					10																	95791057		1869	4103	5972	SO:0001583	missense	51196	exon2			ATGAGAACAGTAA		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.254A>G	10.37:g.95791057A>G	ENSP00000360431:p.Asn85Ser	46.0	0.0		45.0	4.0	NM_016341	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	A	12.50	1.955720	0.34471	.	.	ENSG00000138193	ENST00000260766;ENST00000371380	T;T	0.70631	-0.5;-0.5	5.02	3.8	0.43715	.	0.591766	0.14968	N	0.287969	T	0.53674	0.1811	N	0.24115	0.695	0.25368	N	0.988721	B;B	0.14438	0.01;0.01	B;B	0.08055	0.003;0.003	T	0.45454	-0.9260	10	0.52906	T	0.07	.	7.221	0.25988	0.7057:0.1502:0.0:0.1441	.	85;85	B7ZM61;Q9P212	.;PLCE1_HUMAN	S	85	ENSP00000260766:N85S;ENSP00000360431:N85S	ENSP00000260766:N85S	N	+	2	0	PLCE1	95781047	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	1.874000	0.39568	2.013000	0.59113	0.533000	0.62120	AAC	.		0.388	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
PLEK	5341	ucsc.edu;bcgsc.ca	37	2	68607905	68607905	+	Silent	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:68607905A>G	ENST00000234313.7	+	3	428	c.249A>G	c.(247-249)gcA>gcG	p.A83A		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	83	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		TCTTCCAGGCAGCCTTCCTGG	0.458																																					p.A83A		.											.	PLEK	91	0			c.A249G						.						131.0	131.0	131.0					2																	68607905		2203	4300	6503	SO:0001819	synonymous_variant	5341	exon3			CCAGGCAGCCTTC	X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.249A>G	2.37:g.68607905A>G		39.0	0.0		54.0	5.0	NM_002664	B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Silent	SNP	ENST00000234313.7	37	CCDS1887.1																																																																																			.		0.458	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251755.1	NM_002664	
PLXNA1	5361	ucsc.edu;bcgsc.ca	37	3	126746843	126746843	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:126746843G>A	ENST00000393409.2	+	23	4423	c.4423G>A	c.(4423-4425)Ggc>Agc	p.G1475S	PLXNA1_ENST00000251772.4_Missense_Mutation_p.G1452S	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1475					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		GATGGAGAAGGGCCCCATTGA	0.637																																					p.G1475S		.											.	PLXNA1	93	0			c.G4423A						.						123.0	99.0	108.0					3																	126746843		2203	4300	6503	SO:0001583	missense	5361	exon23			GAGAAGGGCCCCA	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.4423G>A	3.37:g.126746843G>A	ENSP00000377061:p.Gly1475Ser	52.0	0.0		37.0	4.0	NM_032242		Missense_Mutation	SNP	ENST00000393409.2	37	CCDS33847.2	.	.	.	.	.	.	.	.	.	.	g	29.5	5.010480	0.93346	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.35789	1.29;1.29	3.52	3.52	0.40303	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000008	T	0.68760	0.3036	M	0.93150	3.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80082	-0.1531	10	0.87932	D	0	.	15.5936	0.76558	0.0:0.0:1.0:0.0	.	89;1475	Q6ZTY7;Q9UIW2	.;PLXA1_HUMAN	S	1475;1452	ENSP00000377061:G1475S;ENSP00000251772:G1452S	ENSP00000251772:G1452S	G	+	1	0	PLXNA1	128229533	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.568000	0.98166	1.966000	0.57179	0.306000	0.20318	GGC	.		0.637	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
POLK	51426	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	74892708	74892708	+	Silent	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr5:74892708T>C	ENST00000241436.4	+	13	2362	c.2190T>C	c.(2188-2190)agT>agC	p.S730S	POLK_ENST00000508526.1_Silent_p.S532S|POLK_ENST00000380481.3_Silent_p.S640S|POLK_ENST00000352007.5_Silent_p.S532S|POLK_ENST00000506928.1_3'UTR|CTC-366B18.2_ENST00000511329.1_RNA|POLK_ENST00000504026.1_Intron	NM_016218.2	NP_057302.1	Q9UBT6	POLK_HUMAN	polymerase (DNA directed) kappa	730					DNA repair (GO:0006281)|nucleotide-excision repair, DNA gap filling (GO:0006297)	nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			endometrium(1)|kidney(4)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	27		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		AATGTTCTAGTCTCCCAAGCA	0.333								DNA polymerases (catalytic subunits)																													p.S730S		.											.	POLK	229	0			c.T2190C						.						63.0	67.0	66.0					5																	74892708		2203	4300	6503	SO:0001819	synonymous_variant	51426	exon13			TTCTAGTCTCCCA	AB027564	CCDS4030.1	5q13	2012-05-18			ENSG00000122008	ENSG00000122008		"""DNA polymerases"""	9183	protein-coding gene	gene with protein product	"""polymerase (DNA-directed) kappa"", ""DINB protein"", ""DNA polymerase kappa"""	605650		DINB1		10887153, 10518552	Standard	NM_016218		Approved	POLQ, DINP	uc003kdw.3	Q9UBT6	OTTHUMG00000102107	ENST00000241436.4:c.2190T>C	5.37:g.74892708T>C		36.0	0.0		44.0	7.0	NM_016218	B2RBD2|Q5Q9G5|Q5Q9G6|Q5Q9G7|Q5Q9G8|Q86VJ8|Q8IZY0|Q8IZY1|Q8NB30|Q96L01|Q96Q86|Q96Q87|Q9UHC5	Silent	SNP	ENST00000241436.4	37	CCDS4030.1																																																																																			.		0.333	POLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219945.3	NM_016218	
POLR2A	5430	ucsc.edu;bcgsc.ca	37	17	7416382	7416382	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr17:7416382A>T	ENST00000322644.6	+	29	5198	c.4799A>T	c.(4798-4800)tAc>tTc	p.Y1600F		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	1600	C-terminal domain (CTD); 52 X 7 AA approximate tandem repeats of Y-[ST]-P- [STQ]-[ST]-P-[SRTEVKGN].				7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				TCACCTGCCTACGAGCCCCGC	0.582																																					p.Y1600F		.											.	POLR2A	91	0			c.A4799T						.						198.0	203.0	201.0					17																	7416382		2203	4300	6503	SO:0001583	missense	5430	exon29			CTGCCTACGAGCC			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.4799A>T	17.37:g.7416382A>T	ENSP00000314949:p.Tyr1600Phe	77.0	0.0		57.0	5.0	NM_000937	A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	37	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.120333	0.77323	.	.	ENSG00000181222	ENST00000535204;ENST00000545644;ENST00000322644	T	0.71698	-0.59	3.93	3.93	0.45458	.	0.107177	0.39083	N	0.001471	T	0.67097	0.2857	L	0.55834	1.745	0.80722	D	1	P	0.43431	0.807	B	0.43623	0.425	T	0.67488	-0.5658	10	0.36615	T	0.2	-8.8334	12.2383	0.54528	1.0:0.0:0.0:0.0	.	1600	P24928	RPB1_HUMAN	F	1556;499;1600	ENSP00000314949:Y1600F	ENSP00000314949:Y1600F	Y	+	2	0	SLC35G6	7357106	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	5.188000	0.65093	1.778000	0.52293	0.374000	0.22700	TAC	.		0.582	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937	
PPL	5493	ucsc.edu;bcgsc.ca	37	16	4945347	4945347	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr16:4945347T>A	ENST00000345988.2	-	11	1246	c.1157A>T	c.(1156-1158)cAg>cTg	p.Q386L	PPL_ENST00000590782.2_Missense_Mutation_p.Q384L	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	386					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CACCACCTGCTGGCCTCGCTT	0.652																																					p.Q386L		.											.	PPL	95	0			c.A1157T						.						58.0	55.0	56.0					16																	4945347		2197	4300	6497	SO:0001583	missense	5493	exon11			ACCTGCTGGCCTC	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.1157A>T	16.37:g.4945347T>A	ENSP00000340510:p.Gln386Leu	34.0	0.0		26.0	4.0	NM_002705	O60314|O60454|Q14C98	Missense_Mutation	SNP	ENST00000345988.2	37	CCDS10526.1	.	.	.	.	.	.	.	.	.	.	T	9.946	1.218954	0.22373	.	.	ENSG00000118898	ENST00000345988	T	0.38240	1.15	4.57	4.57	0.56435	.	0.079273	0.52532	D	0.000063	T	0.22475	0.0542	N	0.17631	0.505	0.26773	N	0.969754	B	0.32573	0.376	B	0.30401	0.115	T	0.14035	-1.0487	10	0.39692	T	0.17	.	10.2964	0.43627	0.0:0.0812:0.0:0.9188	.	386	O60437	PEPL_HUMAN	L	386	ENSP00000340510:Q386L	ENSP00000340510:Q386L	Q	-	2	0	PPL	4885348	1.000000	0.71417	0.997000	0.53966	0.252000	0.25951	3.118000	0.50414	1.921000	0.55644	0.459000	0.35465	CAG	.		0.652	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705	
PPP1CA	5499	ucsc.edu;bcgsc.ca	37	11	67166297	67166297	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:67166297T>C	ENST00000376745.4	-	6	926	c.778A>G	c.(778-780)Aag>Gag	p.K260E	PPP1CA_ENST00000358239.4_Missense_Mutation_p.K216E|PPP1CA_ENST00000312989.7_Missense_Mutation_p.K271E|PPP1CA_ENST00000532446.1_5'UTR	NM_001008709.1|NM_002708.3	NP_001008709.1|NP_002699.1	P62136	PP1A_HUMAN	protein phosphatase 1, catalytic subunit, alpha isozyme	260					branching morphogenesis of an epithelial tube (GO:0048754)|cell cycle (GO:0007049)|cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|glycogen metabolic process (GO:0005977)|lung development (GO:0030324)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein dephosphorylation (GO:0006470)|regulation of circadian rhythm (GO:0042752)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|MLL5-L complex (GO:0070688)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein phosphatase type 1 complex (GO:0000164)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)|ribonucleoprotein complex binding (GO:0043021)			breast(1)|lung(2)|pancreas(1)|urinary_tract(3)	7			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			AGCTGCCGCTTGGCAAAGAAC	0.607																																					p.K271E		.											.	PPP1CA	659	0			c.A811G						.						91.0	92.0	91.0					11																	67166297		2200	4295	6495	SO:0001583	missense	5499	exon6			GCCGCTTGGCAAA		CCDS8160.1, CCDS8161.1, CCDS31618.1	11q13	2013-01-18	2010-03-05			ENSG00000172531	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9281	protein-coding gene	gene with protein product		176875	"""protein phosphatase 1, catalytic subunit, alpha isoform"""	PPP1A			Standard	NM_002708		Approved	PP1A, PP-1A, PP1alpha	uc001oku.1	P62136		ENST00000376745.4:c.778A>G	11.37:g.67166297T>C	ENSP00000365936:p.Lys260Glu	17.0	0.0		20.0	4.0	NM_001008709	A6NNR3|B2R908|P08129|P20653|P22802|Q07161	Missense_Mutation	SNP	ENST00000376745.4	37	CCDS8160.1	.	.	.	.	.	.	.	.	.	.	T	14.89	2.670741	0.47781	.	.	ENSG00000172531	ENST00000312989;ENST00000451458;ENST00000376745;ENST00000358239;ENST00000527663	T;T;T;T	0.62788	0.0;0.0;0.0;0.0	5.75	4.61	0.57282	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);	0.000000	0.85682	D	0.000000	T	0.56775	0.2008	L	0.48218	1.51	0.58432	D	0.999998	B;B;B;B;B;B	0.21381	0.049;0.049;0.055;0.008;0.005;0.041	B;B;B;B;B;B	0.26202	0.029;0.029;0.046;0.007;0.007;0.067	T	0.55321	-0.8159	10	0.66056	D	0.02	-17.9719	12.176	0.54186	0.0:0.0:0.1432:0.8568	.	357;357;260;216;271;269	B3KXM2;E9PDP1;P62136;A6NNR3;Q07161;F8W0W8	.;.;PP1A_HUMAN;.;.;.	E	271;357;260;216;225	ENSP00000326031:K271E;ENSP00000365936:K260E;ENSP00000350974:K216E;ENSP00000431146:K225E	ENSP00000326031:K271E	K	-	1	0	PPP1CA	66922873	1.000000	0.71417	1.000000	0.80357	0.477000	0.33069	8.020000	0.88740	0.987000	0.38709	-0.316000	0.08728	AAG	.		0.607	PPP1CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395487.1	NM_002708	
PPP1R15A	23645	ucsc.edu;bcgsc.ca	37	19	49379178	49379178	+	Missense_Mutation	SNP	G	G	A	rs386810065		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr19:49379178G>A	ENST00000200453.5	+	3	2242	c.1973G>A	c.(1972-1974)cGc>cAc	p.R658H		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	658					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		ACACCTTCCCGCTCGTCTGCT	0.572																																					p.R658H		.											.	PPP1R15A	226	0			c.G1973A						.						74.0	75.0	74.0					19																	49379178		2203	4300	6503	SO:0001583	missense	23645	exon3			CTTCCCGCTCGTC	U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.1973G>A	19.37:g.49379178G>A	ENSP00000200453:p.Arg658His	64.0	0.0		56.0	9.0	NM_014330	B4DKQ3|Q6IA96|Q9NVU6	Missense_Mutation	SNP	ENST00000200453.5	37	CCDS12738.1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.263798	0.39995	.	.	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	T	0.05081	3.5	3.96	0.603	0.17541	.	1.484980	0.04312	N	0.349124	T	0.03651	0.0104	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41052	-0.9530	10	0.46703	T	0.11	0.1651	2.7079	0.05166	0.1878:0.5232:0.186:0.1031	.	658	O75807	PR15A_HUMAN	H	658;498;616	ENSP00000200453:R658H	ENSP00000200453:R658H	R	+	2	0	PPP1R15A	54070990	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.495000	0.06443	0.242000	0.21303	-0.182000	0.12963	CGC	.		0.572	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466226.1	NM_014330	
PRDM16	63976	ucsc.edu;bcgsc.ca	37	1	3350306	3350306	+	Silent	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:3350306G>A	ENST00000270722.5	+	17	3811	c.3762G>A	c.(3760-3762)ctG>ctA	p.L1254L	PRDM16_ENST00000441472.2_Silent_p.L1253L|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378391.2_Silent_p.L1235L|PRDM16_ENST00000442529.2_Silent_p.L1234L|PRDM16_ENST00000511072.1_3'UTR|PRDM16_ENST00000378398.3_Silent_p.L1254L|PRDM16_ENST00000514189.1_3'UTR			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	1254	Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		AGGGTTCTCTGGACGCTTGGT	0.622			T	EVI1	"""MDS, AML"""																																p.L1254L		.		Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	.	PRDM16	660	0			c.G3762A						.						127.0	142.0	137.0					1																	3350306		2042	4159	6201	SO:0001819	synonymous_variant	63976	exon17			TTCTCTGGACGCT	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.3762G>A	1.37:g.3350306G>A		29.0	0.0		42.0	4.0	NM_022114	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Silent	SNP	ENST00000270722.5	37	CCDS41236.2																																																																																			.		0.622	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000001382.3	NM_022114	
PRKCG	5582	ucsc.edu;bcgsc.ca	37	19	54403529	54403529	+	Silent	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr19:54403529T>C	ENST00000263431.3	+	12	1606	c.1324T>C	c.(1324-1326)Ttg>Ctg	p.L442L	PRKCG_ENST00000542049.1_Silent_p.L329L|PRKCG_ENST00000540413.1_Silent_p.L442L	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	442	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	CGGGGGAGACTTGATGTACCA	0.562																																					p.L442L		.											.	PRKCG	1367	0			c.T1324C						.						90.0	87.0	88.0					19																	54403529		2203	4300	6503	SO:0001819	synonymous_variant	5582	exon12			GGAGACTTGATGT	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1324T>C	19.37:g.54403529T>C		29.0	1.0		32.0	5.0	NM_002739	B7Z8Q0	Silent	SNP	ENST00000263431.3	37	CCDS12867.1																																																																																			.		0.562	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
PRPS2	5634	broad.mit.edu;bcgsc.ca	37	X	12838909	12838909	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chrX:12838909G>C	ENST00000380668.5	+	6	979	c.851G>C	c.(850-852)tGc>tCc	p.C284S	PRPS2_ENST00000398491.2_Missense_Mutation_p.C287S	NM_001039091.2|NM_002765.4	NP_001034180.1|NP_002756.1	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	284					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|AMP biosynthetic process (GO:0006167)|nucleobase-containing compound metabolic process (GO:0006139)|organ regeneration (GO:0031100)	extracellular vesicular exosome (GO:0070062)|ribose phosphate diphosphokinase complex (GO:0002189)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|carbohydrate binding (GO:0030246)|GDP binding (GO:0019003)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	16						ATGAAACACTGCACCAAGATT	0.453																																					p.C287S		.											.	PRPS2	130	0			c.G860C						.						88.0	71.0	77.0					X																	12838909		2203	4300	6503	SO:0001583	missense	5634	exon6			AACACTGCACCAA	Y00971	CCDS14150.1, CCDS43918.1	Xp22.2	2012-10-02			ENSG00000101911	ENSG00000101911	2.7.6.1		9465	protein-coding gene	gene with protein product	"""PRS II"", ""ribose-phosphate diphosphokinase 2"""	311860				1962753	Standard	NM_002765		Approved		uc004cva.3	P11908	OTTHUMG00000021139	ENST00000380668.5:c.851G>C	X.37:g.12838909G>C	ENSP00000370043:p.Cys284Ser	52.0	0.0		50.0	7.0	NM_001039091	Q0VDH9|Q0VDI0|Q15245|Q2TAK7	Missense_Mutation	SNP	ENST00000380668.5	37	CCDS14150.1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152276	0.57259	.	.	ENSG00000101911	ENST00000380668;ENST00000398491;ENST00000461630;ENST00000460220	T;T;T	0.73897	-0.79;-0.79;-0.79	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	D	0.84037	0.5384	L	0.53780	1.695	0.80722	D	1	B;B	0.30021	0.173;0.265	B;P	0.54401	0.303;0.751	D	0.83855	0.0265	10	0.52906	T	0.07	-15.322	17.5895	0.87992	0.0:0.0:1.0:0.0	.	284;287	P11908;P11908-2	PRPS2_HUMAN;.	S	284;287;139;116	ENSP00000370043:C284S;ENSP00000381504:C287S;ENSP00000418911:C139S	ENSP00000370043:C284S	C	+	2	0	PRPS2	12748830	1.000000	0.71417	0.993000	0.49108	0.966000	0.64601	9.273000	0.95719	2.169000	0.68431	0.468000	0.43344	TGC	.		0.453	PRPS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055772.2	NM_002765	
PRRT2	112476	ucsc.edu;bcgsc.ca	37	16	29825202	29825202	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr16:29825202G>T	ENST00000358758.7	+	2	1110	c.827G>T	c.(826-828)tGc>tTc	p.C276F	AC009133.14_ENST00000569981.1_RNA|PAGR1_ENST00000320330.6_5'Flank|AC009133.20_ENST00000569039.1_RNA|PAGR1_ENST00000609618.1_5'Flank|PRRT2_ENST00000300797.6_Missense_Mutation_p.C276F|PRRT2_ENST00000567659.1_Missense_Mutation_p.C276F	NM_001256442.1|NM_001256443.1|NM_145239.2	NP_001243371.1|NP_001243372.1|NP_660282.2	Q7Z6L0	PRRT2_HUMAN	proline-rich transmembrane protein 2	276					neuromuscular process controlling posture (GO:0050884)|response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	8						ATCCTGTCCTGCTTCTGCCCC	0.632																																					p.C276F		.											.	PRRT2	68	0			c.G827T						.						105.0	98.0	101.0					16																	29825202		2197	4300	6497	SO:0001583	missense	112476	exon2			TGTCCTGCTTCTG	BC011405	CCDS10654.1, CCDS58445.1, CCDS58446.1	16p11.2	2014-02-03			ENSG00000167371	ENSG00000167371		"""Proline-rich transmembrane proteins"""	30500	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 1"""	614386	"""infantile convulsions and paroxysmal choreoathetosis"""	ICCA		22101681, 22243967	Standard	NM_145239		Approved	FLJ25513, DKFZp547J199, IFITMD1, FICCA	uc002dud.3	Q7Z6L0	OTTHUMG00000177142	ENST00000358758.7:c.827G>T	16.37:g.29825202G>T	ENSP00000351608:p.Cys276Phe	44.0	0.0		40.0	4.0	NM_001256442	A8K8M8|Q8N2N8|Q8NAQ7|Q8ND36|Q96FA8	Missense_Mutation	SNP	ENST00000358758.7	37	CCDS10654.1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.918671	0.52546	.	.	ENSG00000167371	ENST00000358758;ENST00000300797	D;D	0.85861	-2.04;-2.04	4.33	4.33	0.51752	.	0.545059	0.20258	N	0.095935	D	0.92427	0.7596	M	0.82630	2.6	0.58432	D	0.999995	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.91635	0.997;0.999;0.998	D	0.93471	0.6819	10	0.87932	D	0	-4.5174	14.7325	0.69393	0.0:0.0:1.0:0.0	.	276;276;276	Q7Z6L0-3;Q7Z6L0;Q7Z6L0-2	.;PRRT2_HUMAN;.	F	276	ENSP00000351608:C276F;ENSP00000300797:C276F	ENSP00000300797:C276F	C	+	2	0	PRRT2	29732703	1.000000	0.71417	1.000000	0.80357	0.639000	0.38242	6.989000	0.76219	2.143000	0.66587	0.650000	0.86243	TGC	.		0.632	PRRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255161.3	NM_145239	
PSD3	23362	ucsc.edu;bcgsc.ca	37	8	18432732	18432732	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr8:18432732G>T	ENST00000327040.8	-	13	2647	c.2545C>A	c.(2545-2547)Cac>Aac	p.H849N	PSD3_ENST00000440756.2_Missense_Mutation_p.H851N|PSD3_ENST00000523619.1_Missense_Mutation_p.H784N|PSD3_ENST00000286485.8_Missense_Mutation_p.H315N|PSD3_ENST00000428502.2_Missense_Mutation_p.H178N	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	850	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		GCCAATGCGTGGTGCACACTC	0.423																																					p.H849N		.											.	PSD3	93	0			c.C2545A						.						122.0	115.0	117.0					8																	18432732		2203	4300	6503	SO:0001583	missense	23362	exon13			ATGCGTGGTGCAC	AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.2545C>A	8.37:g.18432732G>T	ENSP00000324127:p.His849Asn	69.0	0.0		60.0	5.0	NM_015310	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Missense_Mutation	SNP	ENST00000327040.8	37	CCDS43720.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.566487	0.86439	.	.	ENSG00000156011	ENST00000327040;ENST00000440756;ENST00000286485;ENST00000428502;ENST00000523619	T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15	5.93	5.93	0.95920	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.51477	U	0.000096	D	0.88089	0.6343	M	0.73598	2.24	0.80722	D	1	D;D;D;D	0.76494	0.989;0.989;0.992;0.999	D;D;P;D	0.79108	0.966;0.954;0.903;0.992	D	0.88391	0.3008	10	0.72032	D	0.01	.	17.8477	0.88736	0.0:0.0:1.0:0.0	.	849;850;315;178	E9KL50;Q9NYI0;Q9NYI0-3;B4DKF8	.;PSD3_HUMAN;.;.	N	849;851;315;178;784	ENSP00000324127:H849N;ENSP00000401704:H851N;ENSP00000286485:H315N;ENSP00000393228:H178N;ENSP00000430640:H784N	ENSP00000286485:H315N	H	-	1	0	PSD3	18477012	1.000000	0.71417	0.998000	0.56505	0.742000	0.42306	9.796000	0.99103	2.826000	0.97356	0.655000	0.94253	CAC	.		0.423	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374867.1	NM_015310	
RAB34	83871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27041897	27041897	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr17:27041897A>G	ENST00000395245.3	-	9	1252	c.626T>C	c.(625-627)tTc>tCc	p.F209S	RAB34_ENST00000395242.2_Missense_Mutation_p.F210S|RAB34_ENST00000453384.3_Intron|RAB34_ENST00000436730.3_Missense_Mutation_p.F209S|RAB34_ENST00000447716.1_Missense_Mutation_p.F266S|RAB34_ENST00000395243.3_Missense_Mutation_p.F201S|RAB34_ENST00000450529.1_Missense_Mutation_p.F201S|RAB34_ENST00000301043.6_Missense_Mutation_p.F209S|RAB34_ENST00000415040.2_Missense_Mutation_p.F187S	NM_001256281.1|NM_031934.5	NP_001243210.1|NP_114140.4	Q9BZG1	RAB34_HUMAN	RAB34, member RAS oncogene family	209					antigen processing and presentation (GO:0019882)|Golgi to plasma membrane protein transport (GO:0043001)|lysosome localization (GO:0032418)|phagosome maturation (GO:0090382)|phagosome-lysosome fusion (GO:0090385)|protein localization to plasma membrane (GO:0072659)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi stack (GO:0005795)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|vesicle (GO:0031982)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|skin(2)	14	Lung NSC(42;0.00431)					CACACGGAAGAAGAATTCTCG	0.577																																					p.F266S	Pancreas(175;216 2049 29940 32498 41589)	.											.	RAB34	227	0			c.T797C						.						64.0	56.0	59.0					17																	27041897		2203	4300	6503	SO:0001583	missense	83871	exon10			CGGAAGAAGAATT	AF322067	CCDS11240.1, CCDS45636.1, CCDS54101.1, CCDS58536.1	17q11.2	2008-07-18			ENSG00000109113	ENSG00000109113		"""RAB, member RAS oncogene"""	16519	protein-coding gene	gene with protein product		610917				12446704	Standard	NM_031934		Approved	RAB39, RAH	uc010was.1	P0DI83	OTTHUMG00000132680	ENST00000395245.3:c.626T>C	17.37:g.27041897A>G	ENSP00000378666:p.Phe209Ser	26.0	0.0		41.0	12.0	NM_001144943	B4E3A0|E9PEJ9|Q5BJE6|Q8NCJ8|Q96AR4	Missense_Mutation	SNP	ENST00000395245.3	37	CCDS11240.1	.	.	.	.	.	.	.	.	.	.	A	14.86	2.661743	0.47572	.	.	ENSG00000109113	ENST00000447716;ENST00000301043;ENST00000395243;ENST00000415040;ENST00000450529;ENST00000395242;ENST00000395245;ENST00000436730;ENST00000430132;ENST00000412625;ENST00000353676	D;D;D;D;D;D;T;D;D	0.84070	-1.8;-1.8;-1.8;-1.8;-1.8;-1.8;-1.24;-1.8;-1.8	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.93812	0.8021	H	0.96547	3.84	0.48632	D	0.999683	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;0.999;0.999	D	0.95526	0.8599	9	0.87932	D	0	-20.8825	14.437	0.67287	1.0:0.0:0.0:0.0	.	187;201;232;224;210;209	E9PEJ9;Q9BZG1-2;C9JI96;B4DNC0;A8MYQ9;Q9BZG1	.;.;.;.;.;RAB34_HUMAN	S	266;209;201;187;224;210;209;232;210;209;209	ENSP00000410403:F266S;ENSP00000301043:F209S;ENSP00000378664:F201S;ENSP00000410279:F187S;ENSP00000378663:F210S;ENSP00000378666:F209S;ENSP00000407953:F210S;ENSP00000398706:F209S;ENSP00000226259:F209S	ENSP00000301043:F209S	F	-	2	0	RAB34	24066024	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.953000	0.93041	2.087000	0.62958	0.460000	0.39030	TTC	.		0.577	RAB34-018	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345906.1	NM_031934	
RAPGEF6	51735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	130841171	130841171	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr5:130841171A>T	ENST00000509018.1	-	10	1192	c.987T>A	c.(985-987)agT>agA	p.S329R	RAPGEF6_ENST00000507093.1_Missense_Mutation_p.S329R|RAPGEF6_ENST00000512052.1_Missense_Mutation_p.S44R|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.S329R|RAPGEF6_ENST00000510071.1_Missense_Mutation_p.S329R|RAPGEF6_ENST00000296859.6_Missense_Mutation_p.S329R|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.S379R|RAPGEF6_ENST00000308008.6_Missense_Mutation_p.S329R	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	329					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		CATCTGGATGACTGATTTCCA	0.333																																					p.S329R	Melanoma(168;435 1955 13113 13877 23213)	.											.	RAPGEF6	661	0			c.T987A						.						80.0	77.0	78.0					5																	130841171		2203	4300	6503	SO:0001583	missense	51735	exon10			TGGATGACTGATT	AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.987T>A	5.37:g.130841171A>T	ENSP00000421684:p.Ser329Arg	70.0	0.0		114.0	20.0	NM_001164387	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	37	CCDS34225.1	.	.	.	.	.	.	.	.	.	.	A	18.34	3.603150	0.66445	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000512052;ENST00000308008;ENST00000510071;ENST00000514667	D;D;D;D;D;D;D;D	0.92911	-3.13;-3.13;-3.13;-3.13;-3.13;-3.13;-3.13;-3.13	5.67	3.22	0.36961	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.047074	0.85682	D	0.000000	D	0.93200	0.7834	L	0.54323	1.7	0.80722	D	1	B;B;P;D;B;B;B	0.54772	0.145;0.145;0.689;0.968;0.38;0.119;0.227	P;B;P;D;P;B;B	0.67382	0.489;0.18;0.677;0.951;0.687;0.357;0.416	D	0.90978	0.4825	10	0.54805	T	0.06	.	7.4174	0.27053	0.6307:0.0:0.3693:0.0	.	329;329;329;44;379;329;329	A3KN82;B7ZML2;Q8TEU7-2;D6RE77;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;.;.;RPGF6_HUMAN	R	329;329;329;329;329;44;329;329;379	ENSP00000421684:S329R;ENSP00000309298:S329R;ENSP00000426081:S329R;ENSP00000296859:S329R;ENSP00000426910:S44R;ENSP00000311419:S329R;ENSP00000425389:S329R;ENSP00000426948:S379R	ENSP00000426948:S379R	S	-	3	2	RAPGEF6;FNIP1	130869070	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	1.444000	0.35068	0.397000	0.25310	0.383000	0.25322	AGT	.		0.333	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340	
RASAL2	9462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	178420786	178420786	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:178420786G>A	ENST00000462775.1	+	8	1389	c.1264G>A	c.(1264-1266)Gac>Aac	p.D422N	RASAL2_ENST00000448150.3_Missense_Mutation_p.D552N|RASAL2_ENST00000367649.3_Missense_Mutation_p.D570N	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	422	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						TGAACTGATAGACCATCAGAG	0.408																																					p.D570N		.											.	RASAL2	155	0			c.G1708A						.						180.0	170.0	173.0					1																	178420786		2203	4300	6503	SO:0001583	missense	9462	exon10			CTGATAGACCATC	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.1264G>A	1.37:g.178420786G>A	ENSP00000420558:p.Asp422Asn	66.0	0.0		54.0	19.0	NM_170692	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	ENST00000462775.1	37	CCDS1322.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875079	0.91664	.	.	ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775	D;T;D	0.81739	-1.53;2.33;-1.53	5.84	5.84	0.93424	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.109437	0.64402	D	0.000009	T	0.81380	0.4810	N	0.25380	0.74	0.80722	D	1	P;B	0.38863	0.65;0.241	P;B	0.49140	0.601;0.148	T	0.82345	-0.0503	10	0.87932	D	0	.	20.1551	0.98106	0.0:0.0:1.0:0.0	.	422;570	Q9UJF2;F8W755	NGAP_HUMAN;.	N	552;570;422	ENSP00000407768:D552N;ENSP00000356621:D570N;ENSP00000420558:D422N	ENSP00000356621:D570N	D	+	1	0	RASAL2	176687409	1.000000	0.71417	0.988000	0.46212	0.998000	0.95712	9.731000	0.98807	2.760000	0.94817	0.655000	0.94253	GAC	.		0.408	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692	
REV1	51455	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	100019252	100019253	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:100019252_100019253delAG	ENST00000258428.3	-	21	3623_3624	c.3395_3396delCT	c.(3394-3396)tctfs	p.S1132fs	REV1_ENST00000393445.3_Frame_Shift_Del_p.S1131fs|RP11-527J8.1_ENST00000608144.1_RNA|REV1_ENST00000465835.1_5'Flank	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	1132					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AAGTAGAAGCAGAGAGTTCTTC	0.416								Direct reversal of damage																													p.1132_1132del		.											.	REV1	92	0			c.3395_3396del						.																																			SO:0001589	frameshift_variant	51455	exon21			AGAAGCAGAGAGT	AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.3395_3396delCT	2.37:g.100019256_100019257delAG	ENSP00000258428:p.Ser1132fs	32.0	0.0		64.0	21.0	NM_016316	O95941|Q53SI7|Q9C0J4|Q9NUP2	Frame_Shift_Del	DEL	ENST00000258428.3	37	CCDS2045.1																																																																																			.		0.416	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	
REV3L	5980	ucsc.edu;bcgsc.ca	37	6	111709275	111709275	+	Silent	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr6:111709275C>A	ENST00000358835.3	-	9	1330	c.876G>T	c.(874-876)gtG>gtT	p.V292V	REV3L_ENST00000368802.3_Silent_p.V292V|REV3L_ENST00000435970.1_Silent_p.V214V|REV3L_ENST00000368805.1_Silent_p.V292V			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	292					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		CTGTTGCTGGCACAAACCTGT	0.299								DNA polymerases (catalytic subunits)																													p.V292V		.											.	REV3L	294	0			c.G876T						.						49.0	52.0	51.0					6																	111709275		2203	4297	6500	SO:0001819	synonymous_variant	5980	exon8			TGCTGGCACAAAC	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.876G>T	6.37:g.111709275C>A		38.0	0.0		41.0	4.0	NM_002912	O43214|Q5TC33	Silent	SNP	ENST00000358835.3	37	CCDS5091.2																																																																																			.		0.299	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
RIC8B	55188	ucsc.edu;bcgsc.ca	37	12	107254187	107254187	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:107254187C>A	ENST00000392839.2	+	8	1554	c.1448C>A	c.(1447-1449)cCa>cAa	p.P483Q	RIC8B_ENST00000392837.4_Missense_Mutation_p.P483Q|RIC8B_ENST00000355478.2_Missense_Mutation_p.P443Q|RIC8B_ENST00000549643.1_5'UTR	NM_018157.2	NP_060627.2	Q9NVN3	RIC8B_HUMAN	RIC8 guanine nucleotide exchange factor B	483					regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	G-protein alpha-subunit binding (GO:0001965)|guanyl-nucleotide exchange factor activity (GO:0005085)			kidney(2)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	19						AATGCAAAACCAAAGTATAGT	0.418																																					p.P483Q		.											.	RIC8B	91	0			c.C1448A						.						62.0	63.0	63.0					12																	107254187		2203	4300	6503	SO:0001583	missense	55188	exon8			CAAAACCAAAGTA	AK128102	CCDS9109.2	12q23.3	2013-08-05	2013-08-05		ENSG00000111785	ENSG00000111785			25555	protein-coding gene	gene with protein product		609147	"""resistance to inhibitors of cholinesterase 8 homolog B (C. elegans)"""				Standard	XM_005268998		Approved	FLJ10620, hSyn, RIC8	uc001tlx.3	Q9NVN3	OTTHUMG00000144188	ENST00000392839.2:c.1448C>A	12.37:g.107254187C>A	ENSP00000376583:p.Pro483Gln	53.0	0.0		39.0	4.0	NM_018157	A2RTZ0|Q4G103|Q6ZRN4|Q86WD3	Missense_Mutation	SNP	ENST00000392839.2	37	CCDS9109.2	.	.	.	.	.	.	.	.	.	.	C	28.3	4.905441	0.92107	.	.	ENSG00000111785	ENST00000392837;ENST00000392839;ENST00000355478	.	.	.	5.84	5.84	0.93424	Synembryn (1);	0.000000	0.85682	D	0.000000	T	0.72716	0.3495	L	0.37750	1.13	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.67428	-0.5673	9	0.30078	T	0.28	-4.2408	20.1346	0.98019	0.0:1.0:0.0:0.0	.	443;483;483	Q9NVN3-3;Q9NVN3;B7WPL0	.;RIC8B_HUMAN;.	Q	483;483;443	.	ENSP00000347662:P443Q	P	+	2	0	RIC8B	105778317	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.763000	0.94921	0.557000	0.71058	CCA	.		0.418	RIC8B-006	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000291398.2	NM_018157	
RIMS4	140730	ucsc.edu;bcgsc.ca	37	20	43384815	43384815	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr20:43384815G>A	ENST00000372851.3	-	6	836	c.770C>T	c.(769-771)tCc>tTc	p.S257F	RIMS4_ENST00000541604.2_Missense_Mutation_p.S258F	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4	257					exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)				central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				GCTCTCGAGGGACAACTGGGA	0.662																																					p.S258F		.											.	RIMS4	94	0			c.C773T						.						63.0	64.0	64.0					20																	43384815		2203	4300	6503	SO:0001583	missense	140730	exon6			TCGAGGGACAACT		CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546	ENST00000372851.3:c.770C>T	20.37:g.43384815G>A	ENSP00000361942:p.Ser257Phe	33.0	0.0		44.0	6.0	NM_001205317	A4FU94|E1P613|Q3MI44|Q5JWT7	Missense_Mutation	SNP	ENST00000372851.3	37	CCDS13338.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.320249	0.81469	.	.	ENSG00000101098	ENST00000372851;ENST00000541604	T;T	0.35421	1.31;1.32	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.59169	0.2174	L	0.61036	1.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.63501	-0.6623	10	0.87932	D	0	.	18.204	0.89848	0.0:0.0:1.0:0.0	.	258;257	E1P613;Q9H426	.;RIMS4_HUMAN	F	257;258	ENSP00000361942:S257F;ENSP00000439287:S258F	ENSP00000361942:S257F	S	-	2	0	RIMS4	42818229	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.750000	0.98875	2.285000	0.76669	0.563000	0.77884	TCC	.		0.662	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101027.2	NM_182970	
RIN1	9610	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66101485	66101485	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:66101485A>G	ENST00000311320.4	-	7	1622	c.1496T>C	c.(1495-1497)cTg>cCg	p.L499P	RIN1_ENST00000524804.1_5'Flank|RIN1_ENST00000424433.2_Missense_Mutation_p.L394P|RIN1_ENST00000530056.1_Missense_Mutation_p.L333P|RP11-867G23.12_ENST00000526655.1_RNA	NM_004292.2	NP_004283.2	Q13671	RIN1_HUMAN	Ras and Rab interactor 1	499	Ras and 14-3-3 protein binding region.|VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				associative learning (GO:0008306)|endocytosis (GO:0006897)|memory (GO:0007613)|negative regulation of synaptic plasticity (GO:0031914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(1)	14						CAGCTGCAGCAGCTTCTGGCG	0.687																																					p.L499P		.											.	RIN1	710	0			c.T1496C						.						14.0	10.0	11.0					11																	66101485		2145	4245	6390	SO:0001583	missense	9610	exon7			TGCAGCAGCTTCT	L36463	CCDS31614.1	11q13.2	2005-09-18				ENSG00000174791			18749	protein-coding gene	gene with protein product		605965				9144171, 1849280	Standard	NM_004292		Approved		uc001ohn.1	Q13671		ENST00000311320.4:c.1496T>C	11.37:g.66101485A>G	ENSP00000310406:p.Leu499Pro	46.0	0.0		57.0	9.0	NM_004292	O15010|Q00427|Q96CC8	Missense_Mutation	SNP	ENST00000311320.4	37	CCDS31614.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.994932	0.74703	.	.	ENSG00000174791	ENST00000311320;ENST00000424433;ENST00000530056	T;T;T	0.58797	0.31;0.31;0.31	4.6	4.6	0.57074	Vacuolar sorting protein 9, subgroup (1);Vacuolar sorting protein 9 (2);	0.082822	0.49916	D	0.000136	T	0.76241	0.3960	M	0.84683	2.71	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.997	D;D;D	0.91635	0.998;0.999;0.997	T	0.79904	-0.1606	10	0.87932	D	0	-10.5398	10.6658	0.45731	1.0:0.0:0.0:0.0	.	333;130;499	E9PNR2;B4DW96;Q13671	.;.;RIN1_HUMAN	P	499;394;333	ENSP00000310406:L499P;ENSP00000400560:L394P;ENSP00000432798:L333P	ENSP00000310406:L499P	L	-	2	0	RIN1	65858061	0.997000	0.39634	0.956000	0.39512	0.858000	0.48976	5.336000	0.65935	1.858000	0.53909	0.374000	0.22700	CTG	.		0.687	RIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392980.2	NM_004292	
RLIM	51132	broad.mit.edu;bcgsc.ca	37	X	73812528	73812528	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chrX:73812528delG	ENST00000332687.6	-	4	840	c.622delC	c.(622-624)cagfs	p.Q208fs	RLIM_ENST00000349225.2_Frame_Shift_Del_p.Q208fs	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	208					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GCCCTCCTCTGACCTCTGGTA	0.498																																					p.Q208fs	Esophageal Squamous(169;1899 1923 14997 18818 32118)	.											.	RLIM	228	0			c.622delC						.						161.0	135.0	144.0					X																	73812528		2203	4300	6503	SO:0001589	frameshift_variant	51132	exon5			TCCTCTGACCTCT	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.622delC	X.37:g.73812528delG	ENSP00000328059:p.Gln208fs	73.0	0.0		68.0	9.0	NM_183353	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Frame_Shift_Del	DEL	ENST00000332687.6	37	CCDS14427.1																																																																																			.		0.498	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
RNF123	63891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49738928	49738928	+	Missense_Mutation	SNP	G	G	T	rs369164501		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:49738928G>T	ENST00000327697.6	+	16	1426	c.1282G>T	c.(1282-1284)Gac>Tac	p.D428Y	RNF123_ENST00000432042.1_Missense_Mutation_p.D282Y	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	428					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		CGCCAGCTTCGACGTGCTCCG	0.632											OREG0015570	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D428Y		.											.	RNF123	584	0			c.G1282T						.						52.0	56.0	54.0					3																	49738928		2203	4300	6503	SO:0001583	missense	63891	exon16			AGCTTCGACGTGC	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.1282G>T	3.37:g.49738928G>T	ENSP00000328287:p.Asp428Tyr	32.0	0.0	964	37.0	12.0	NM_022064	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.119186	0.77323	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000432042	T;T	0.79033	-0.91;-1.23	5.71	5.71	0.89125	.	0.176658	0.47852	D	0.000204	T	0.81744	0.4887	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.84283	0.0495	10	0.87932	D	0	-32.0212	18.8457	0.92205	0.0:0.0:1.0:0.0	.	282;428	C9J266;Q5XPI4	.;RN123_HUMAN	Y	428;428;282	ENSP00000328287:D428Y;ENSP00000392443:D282Y	ENSP00000328287:D428Y	D	+	1	0	RNF123	49713932	1.000000	0.71417	0.991000	0.47740	0.200000	0.23975	9.153000	0.94687	2.698000	0.92095	0.561000	0.74099	GAC	.		0.632	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
RPGR	6103	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	38144823	38144823	+	Intron	SNP	A	A	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chrX:38144823A>C	ENST00000339363.3	-	14	2688				RPGR_ENST00000309513.3_Intron|RPGR_ENST00000342811.3_Intron|RPGR_ENST00000378505.2_Missense_Mutation_p.N1143K|RPGR_ENST00000318842.7_Intron|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000338898.3_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						GTGGTAATACATTATTCCAGA	0.403																																					p.N1143K		.											.	RPGR	131	0			c.T3429G						.						137.0	120.0	126.0					X																	38144823		2202	4300	6502	SO:0001627	intron_variant	6103	exon15			TAATACATTATTC	U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+1523T>G	X.37:g.38144823A>C		181.0	1.0		176.0	40.0	NM_001034853	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	ENST00000339363.3	37		.	.	.	.	.	.	.	.	.	.	a	10.01	1.233936	0.22626	.	.	ENSG00000156313	ENST00000378505	T	0.58358	0.34	3.6	2.4	0.29515	.	.	.	.	.	T	0.52322	0.1727	M	0.61703	1.905	0.80722	D	1	D	0.55172	0.97	P	0.48770	0.589	T	0.51957	-0.8639	9	0.87932	D	0	.	6.1235	0.20165	0.7661:0.0:0.2339:0.0	.	1143	E9PE28	.	K	1143	ENSP00000367766:N1143K	ENSP00000367766:N1143K	N	-	3	2	RPGR	38029767	1.000000	0.71417	0.989000	0.46669	0.963000	0.63663	3.572000	0.53849	0.396000	0.25283	0.338000	0.21704	AAT	.		0.403	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000328	
RSF1	51773	ucsc.edu;bcgsc.ca	37	11	77378439	77378439	+	Silent	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:77378439T>C	ENST00000308488.6	-	16	4151	c.3849A>G	c.(3847-3849)gaA>gaG	p.E1283E	RSF1_ENST00000360355.2_Silent_p.E1252E|RSF1_ENST00000480887.1_Silent_p.E1031E			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	1283					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			CCTCATCTGCTTCTGAATACT	0.502																																					p.E1283E		.											.	RSF1	93	0			c.A3849G						.						102.0	94.0	96.0					11																	77378439		2200	4292	6492	SO:0001819	synonymous_variant	51773	exon16			ATCTGCTTCTGAA	AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.3849A>G	11.37:g.77378439T>C		41.0	0.0		42.0	4.0	NM_016578	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Silent	SNP	ENST00000308488.6	37	CCDS8253.1																																																																																			.		0.502	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318075.2	NM_016578	
RTTN	25914	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	67871371	67871371	+	Silent	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr18:67871371A>G	ENST00000255674.6	-	3	634	c.348T>C	c.(346-348)ccT>ccC	p.P116P	RTTN_ENST00000454359.1_Silent_p.P116P|RTTN_ENST00000437017.1_Silent_p.P116P	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	116					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				GAACTTCCGAAGGAAGAAGAA	0.383																																					p.P116P		.											.	RTTN	141	0			c.T348C						.						85.0	81.0	82.0					18																	67871371		1870	4112	5982	SO:0001819	synonymous_variant	25914	exon3			TTCCGAAGGAAGA	AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.348T>C	18.37:g.67871371A>G		97.0	1.0		85.0	13.0	NM_173630	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Silent	SNP	ENST00000255674.6	37	CCDS42443.1																																																																																			.		0.383	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630	
SEC23A	10484	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	39524374	39524374	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr14:39524374C>A	ENST00000307712.6	-	14	2149	c.1632G>T	c.(1630-1632)agG>agT	p.R544S	SEC23A_ENST00000537403.1_Missense_Mutation_p.R342S|SEC23A_ENST00000536508.1_Missense_Mutation_p.R418S|SEC23A_ENST00000545328.2_Missense_Mutation_p.R515S	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	544					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		TGTCCAGCCACCTAAGCACAT	0.413																																					p.R544S		.											.	SEC23A	95	0			c.G1632T						.						137.0	129.0	132.0					14																	39524374		2203	4300	6503	SO:0001583	missense	10484	exon14			CAGCCACCTAAGC	X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1632G>T	14.37:g.39524374C>A	ENSP00000306881:p.Arg544Ser	83.0	0.0		96.0	21.0	NM_006364	B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	ENST00000307712.6	37	CCDS9668.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095346	0.76870	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328	D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55	5.81	-0.68	0.11346	Sec23/Sec24, helical domain (2);	0.180500	0.49305	D	0.000154	D	0.94873	0.8343	H	0.94503	3.545	0.80722	D	1	D;D;D	0.89917	1.0;0.957;0.97	D;P;P	0.80764	0.994;0.877;0.892	D	0.93921	0.7206	10	0.87932	D	0	-19.4958	11.2054	0.48767	0.0:0.5516:0.0:0.4484	.	515;418;544	F5H365;F5H6C4;Q15436	.;.;SC23A_HUMAN	S	342;544;418;515	ENSP00000444193:R342S;ENSP00000306881:R544S;ENSP00000437715:R418S;ENSP00000445393:R515S	ENSP00000306881:R544S	R	-	3	2	SEC23A	38594125	0.266000	0.24112	0.994000	0.49952	0.998000	0.95712	-0.655000	0.05348	-0.116000	0.11893	0.551000	0.68910	AGG	.		0.413	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2		
SEMA3E	9723	ucsc.edu;bcgsc.ca	37	7	83026017	83026017	+	Silent	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:83026017T>C	ENST00000307792.3	-	12	1862	c.1395A>G	c.(1393-1395)acA>acG	p.T465T	SEMA3E_ENST00000427262.1_Silent_p.T405T	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	465	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				GGTTGTAAATTGTGATTACTT	0.294																																					p.T465T		.											.	SEMA3E	93	0			c.A1395G						.						112.0	99.0	103.0					7																	83026017		2202	4298	6500	SO:0001819	synonymous_variant	9723	exon12			GTAAATTGTGATT	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1395A>G	7.37:g.83026017T>C		36.0	0.0		49.0	4.0	NM_012431	B4E1P1|Q75M94|Q75M97	Silent	SNP	ENST00000307792.3	37	CCDS34674.1																																																																																			.		0.294	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
SEMA3F	6405	ucsc.edu;bcgsc.ca	37	3	50223132	50223132	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:50223132T>C	ENST00000002829.3	+	15	2063	c.1579T>C	c.(1579-1581)Tct>Cct	p.S527P	SEMA3F_ENST00000413852.1_Missense_Mutation_p.S428P|SEMA3F_ENST00000434342.1_Missense_Mutation_p.S496P	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	527	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		GACCATCTCTTCTAAGAGGGT	0.567																																					p.S527P		.											.	SEMA3F	279	0			c.T1579C						.						79.0	75.0	76.0					3																	50223132		2203	4300	6503	SO:0001583	missense	6405	exon15			ATCTCTTCTAAGA	U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.1579T>C	3.37:g.50223132T>C	ENSP00000002829:p.Ser527Pro	45.0	0.0		45.0	4.0	NM_004186	C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Missense_Mutation	SNP	ENST00000002829.3	37	CCDS2811.1	.	.	.	.	.	.	.	.	.	.	T	13.39	2.224311	0.39300	.	.	ENSG00000001617	ENST00000413852;ENST00000002829;ENST00000434342	T;T;T	0.12147	2.71;2.71;2.71	5.03	3.84	0.44239	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.284737	0.41712	D	0.000839	T	0.12433	0.0302	L	0.39397	1.21	0.49798	D	0.999828	B;B	0.20459	0.045;0.044	B;B	0.26693	0.072;0.055	T	0.05869	-1.0859	10	0.52906	T	0.07	.	8.5114	0.33220	0.3103:0.0:0.0:0.6897	.	496;527	C9JQ85;Q13275	.;SEM3F_HUMAN	P	428;527;496	ENSP00000388931:S428P;ENSP00000002829:S527P;ENSP00000409859:S496P	ENSP00000002829:S527P	S	+	1	0	SEMA3F	50198136	1.000000	0.71417	1.000000	0.80357	0.674000	0.39518	5.315000	0.65810	0.904000	0.36572	0.379000	0.24179	TCT	.		0.567	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345929.1	NM_004186	
SEPHS1	22929	ucsc.edu;bcgsc.ca	37	10	13371747	13371747	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr10:13371747T>C	ENST00000327347.5	-	6	977	c.602A>G	c.(601-603)aAa>aGa	p.K201R	SEPHS1_ENST00000378614.4_Missense_Mutation_p.K201R|SEPHS1_ENST00000545675.1_Missense_Mutation_p.K201R|SEPHS1_ENST00000537130.1_Missense_Mutation_p.K134R	NM_001195602.1|NM_012247.4	NP_001182531.1|NP_036379.2	P49903	SPS1_HUMAN	selenophosphate synthetase 1	201					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|selenide, water dikinase activity (GO:0004756)			cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|stomach(1)	16						CCCCAGGGGTTTTGTCAGCAC	0.532																																					p.K201R		.											.	SEPHS1	116	0			c.A602G						.						60.0	45.0	50.0					10																	13371747		2203	4300	6503	SO:0001583	missense	22929	exon6			AGGGGTTTTGTCA	BC000941	CCDS7098.1, CCDS55702.1, CCDS55703.1	10p14	2006-10-06			ENSG00000086475	ENSG00000086475			19685	protein-coding gene	gene with protein product		600902				7665581	Standard	NM_012247		Approved	SPS, SPS1	uc001imk.3	P49903	OTTHUMG00000017696	ENST00000327347.5:c.602A>G	10.37:g.13371747T>C	ENSP00000367893:p.Lys201Arg	37.0	0.0		40.0	5.0	NM_001195604	B4DWK0|D3DRS9|D6PSQ9|Q5T5U8|Q5T5U9|Q9BVT4	Missense_Mutation	SNP	ENST00000327347.5	37	CCDS7098.1	.	.	.	.	.	.	.	.	.	.	T	31	5.062382	0.93898	.	.	ENSG00000086475	ENST00000327347;ENST00000319684;ENST00000378614;ENST00000545675;ENST00000537130	T;T;T;T	0.52295	2.06;0.67;2.06;2.06	5.37	5.37	0.77165	AIR synthase-related protein, C-terminal (2);	0.040967	0.85682	D	0.000000	T	0.78013	0.4217	H	0.95816	3.725	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.998;1.0;1.0;1.0;0.999	D;D;D;D;D;D	0.91635	0.999;0.981;0.997;0.999;0.997;0.997	D	0.85254	0.1046	10	0.87932	D	0	-17.8044	15.3671	0.74531	0.0:0.0:0.0:1.0	.	153;201;201;201;201;134	B4DLS1;Q5T5U9;P49903;D6PSQ9;D3DRS9;B4DWK0	.;.;SPS1_HUMAN;.;.;.	R	201;201;201;201;134	ENSP00000367893:K201R;ENSP00000367877:K201R;ENSP00000441119:K201R;ENSP00000442768:K134R	ENSP00000367887:K201R	K	-	2	0	SEPHS1	13411753	1.000000	0.71417	0.946000	0.38457	0.941000	0.58515	8.027000	0.88791	2.028000	0.59812	0.459000	0.35465	AAA	.		0.532	SEPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046856.1	NM_012247	
SERPINA10	51156	ucsc.edu;bcgsc.ca	37	14	94752572	94752572	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr14:94752572T>C	ENST00000393096.1	-	4	1481	c.1016A>G	c.(1015-1017)aAg>aGg	p.K339R	SERPINA10_ENST00000554173.1_Missense_Mutation_p.K339R|SERPINA10_ENST00000261994.4_Missense_Mutation_p.K339R|SERPINA10_ENST00000554723.1_Missense_Mutation_p.K379R	NM_016186.2	NP_057270.1	Q9UK55	ZPI_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10	339					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	33		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		TAGCTTGAACTTCGGAAAGAA	0.423																																					p.K339R		.											.	SERPINA10	228	0			c.A1016G						.						141.0	130.0	134.0					14																	94752572		2203	4300	6503	SO:0001583	missense	51156	exon4			TTGAACTTCGGAA	AF181467	CCDS9923.1	14q32.13	2014-02-18	2005-08-18		ENSG00000140093	ENSG00000140093		"""Serine (or cysteine) peptidase inhibitors"""	15996	protein-coding gene	gene with protein product		605271	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10"""			10460162, 9689066, 24172014	Standard	NM_016186		Approved	PZI, ZPI	uc001yct.3	Q9UK55	OTTHUMG00000171345	ENST00000393096.1:c.1016A>G	14.37:g.94752572T>C	ENSP00000376809:p.Lys339Arg	36.0	0.0		48.0	8.0	NM_001100607	A5Z2A5|Q6UWX9|Q86U20	Missense_Mutation	SNP	ENST00000393096.1	37	CCDS9923.1	.	.	.	.	.	.	.	.	.	.	T	15.22	2.769516	0.49680	.	.	ENSG00000140093	ENST00000554723;ENST00000393096;ENST00000261994;ENST00000554173	D;D;D;D	0.90844	-2.74;-2.74;-2.74;-2.74	5.34	5.34	0.76211	Serpin domain (3);	0.000000	0.64402	D	0.000010	D	0.91057	0.7186	L	0.46614	1.455	0.50313	D	0.999865	P	0.46859	0.885	P	0.51918	0.684	D	0.91118	0.4927	10	0.48119	T	0.1	.	14.9836	0.71330	0.0:0.0:0.0:1.0	.	339	Q9UK55	ZPI_HUMAN	R	379;339;339;339	ENSP00000450896:K379R;ENSP00000376809:K339R;ENSP00000261994:K339R;ENSP00000450971:K339R	ENSP00000261994:K339R	K	-	2	0	SERPINA10	93822325	1.000000	0.71417	0.989000	0.46669	0.009000	0.06853	5.115000	0.64655	2.032000	0.59987	0.460000	0.39030	AAG	.		0.423	SERPINA10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413061.1	NM_016186	
SHCBP1	79801	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	46615855	46615855	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr16:46615855G>A	ENST00000303383.3	-	13	2071	c.1805C>T	c.(1804-1806)aCt>aTt	p.T602I		NM_024745.4	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	602					fibroblast growth factor receptor signaling pathway (GO:0008543)|regulation of neural precursor cell proliferation (GO:2000177)					breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				AGAAGGGTCAGTTCTTGCACA	0.423																																					p.T602I		.											.	SHCBP1	154	0			c.C1805T						.						128.0	123.0	124.0					16																	46615855		2203	4300	6503	SO:0001583	missense	79801	exon13			GGGTCAGTTCTTG	AK055931	CCDS10720.1	16q11	2008-02-05			ENSG00000171241	ENSG00000171241			29547	protein-coding gene	gene with protein product		611027				10086341	Standard	NM_024745		Approved	FLJ22009	uc002eec.4	Q8NEM2	OTTHUMG00000132540	ENST00000303383.3:c.1805C>T	16.37:g.46615855G>A	ENSP00000306473:p.Thr602Ile	110.0	1.0		96.0	23.0	NM_024745	Q96N60|Q9BVS0|Q9H6P6	Missense_Mutation	SNP	ENST00000303383.3	37	CCDS10720.1	.	.	.	.	.	.	.	.	.	.	A	4.291	0.053181	0.08291	.	.	ENSG00000171241	ENST00000303383	T	0.22336	1.96	4.06	3.1	0.35709	.	1.732190	0.02531	N	0.093597	T	0.14141	0.0342	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.28332	-1.0047	10	0.40728	T	0.16	-0.1197	9.259	0.37601	0.0851:0.0:0.7817:0.1332	.	602	Q8NEM2	SHCBP_HUMAN	I	602	ENSP00000306473:T602I	ENSP00000306473:T602I	T	-	2	0	SHCBP1	45173356	0.212000	0.23540	0.003000	0.11579	0.151000	0.21798	1.433000	0.34947	0.383000	0.24910	-0.925000	0.02716	ACT	.		0.423	SHCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255740.1	NM_024745	
SHD	56961	ucsc.edu;bcgsc.ca	37	19	4280289	4280289	+	Silent	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr19:4280289C>A	ENST00000543264.2	+	1	1692	c.229C>A	c.(229-231)Cgg>Agg	p.R77R	SHD_ENST00000599689.1_Silent_p.R77R	NM_020209.3	NP_064594.3	Q96IW2	SHD_HUMAN	Src homology 2 domain containing transforming protein D	77										breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|stomach(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0337)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCCAAGCACCGGCTCATCAA	0.687																																					p.R77R		.											.	SHD	90	0			c.C229A						.						14.0	15.0	15.0					19																	4280289		2198	4298	6496	SO:0001819	synonymous_variant	56961	exon1			AAGCACCGGCTCA	BC007206	CCDS12125.1	19p13.3	2013-02-14				ENSG00000105251		"""SH2 domain containing"""	30633	protein-coding gene	gene with protein product		610481				9315092	Standard	NM_020209		Approved		uc002lzw.2	Q96IW2		ENST00000543264.2:c.229C>A	19.37:g.4280289C>A		35.0	0.0		42.0	4.0	NM_020209	Q96NC2	Silent	SNP	ENST00000543264.2	37	CCDS12125.1																																																																																			.		0.687	SHD-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458082.1	NM_020209	
SLC38A2	54407	ucsc.edu;bcgsc.ca	37	12	46756885	46756885	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:46756885C>A	ENST00000256689.5	-	13	1542	c.1098G>T	c.(1096-1098)ttG>ttT	p.L366F	SLC38A2_ENST00000547252.1_5'Flank|SLC38A2_ENST00000551374.1_Missense_Mutation_p.L204F	NM_018976.4	NP_061849.2	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2	366					amino acid transport (GO:0006865)|glutamate secretion (GO:0014047)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|sodium ion transport (GO:0006814)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	18	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		TATCAGTTCCCAAGATAGAAG	0.403																																					p.L366F	Ovarian(9;448 492 8335 28722 40361)	.											.	SLC38A2	226	0			c.G1098T						.						155.0	140.0	145.0					12																	46756885		2203	4300	6503	SO:0001583	missense	54407	exon13			AGTTCCCAAGATA	AB037803	CCDS8749.1	12q13.11	2014-08-12			ENSG00000134294	ENSG00000134294		"""Solute carriers"""	13448	protein-coding gene	gene with protein product		605180				10747860, 17237199	Standard	NM_018976		Approved	SAT2, ATA2, KIAA1382, SNAT2	uc001rpg.3	Q96QD8	OTTHUMG00000169471	ENST00000256689.5:c.1098G>T	12.37:g.46756885C>A	ENSP00000256689:p.Leu366Phe	47.0	0.0		40.0	5.0	NM_018976	Q6IA88|Q6ZMG2|Q9HAV3|Q9NVA8|Q9P2G5	Missense_Mutation	SNP	ENST00000256689.5	37	CCDS8749.1	.	.	.	.	.	.	.	.	.	.	C	3.647	-0.072333	0.07228	.	.	ENSG00000134294	ENST00000256689;ENST00000551374	T;T	0.02323	4.34;4.34	5.5	4.59	0.56863	.	0.843376	0.11351	N	0.572929	T	0.02193	0.0068	N	0.20357	0.565	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.09377	0.004;0.003;0.002	T	0.46162	-0.9211	10	0.10111	T	0.7	-0.3844	8.7933	0.34863	0.2552:0.6719:0.0:0.0728	.	204;266;366	F8VQW8;Q96QD8-2;Q96QD8	.;.;S38A2_HUMAN	F	366;204	ENSP00000256689:L366F;ENSP00000450406:L204F	ENSP00000256689:L366F	L	-	3	2	SLC38A2	45043152	0.234000	0.23783	0.047000	0.18901	0.776000	0.43924	1.085000	0.30840	2.729000	0.93468	0.563000	0.77884	TTG	.		0.403	SLC38A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404226.1		
SLC6A9	6536	ucsc.edu;bcgsc.ca	37	1	44466893	44466893	+	Silent	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:44466893A>G	ENST00000360584.2	-	10	1688	c.1497T>C	c.(1495-1497)taT>taC	p.Y499Y	SLC6A9_ENST00000475075.2_Silent_p.Y315Y|SLC6A9_ENST00000537678.1_Silent_p.Y361Y|SLC6A9_ENST00000372310.3_Silent_p.Y426Y|SLC6A9_ENST00000372307.3_Silent_p.Y361Y|SLC6A9_ENST00000372306.3_Silent_p.Y426Y|SLC6A9_ENST00000357730.2_Silent_p.Y445Y	NM_201649.3	NP_964012.2	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9	499					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	CCAAGGTCACATAGGTCTTTT	0.592																																					p.Y499Y		.											.	SLC6A9	90	0			c.T1497C						.						148.0	139.0	142.0					1																	44466893		2203	4300	6503	SO:0001819	synonymous_variant	6536	exon10			GGTCACATAGGTC	S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517		"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019				8183239, 7587377	Standard	NM_006934		Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000360584.2:c.1497T>C	1.37:g.44466893A>G		52.0	1.0		44.0	4.0	NM_201649	A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	Silent	SNP	ENST00000360584.2	37	CCDS41317.1																																																																																			.		0.592	SLC6A9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000022825.2	NM_201649	
SMARCA4	6597	ucsc.edu;bcgsc.ca	37	19	11118666	11118666	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr19:11118666A>G	ENST00000429416.3	+	15	2371	c.2090A>G	c.(2089-2091)gAc>gGc	p.D697G	SMARCA4_ENST00000589677.1_Missense_Mutation_p.D697G|SMARCA4_ENST00000590574.1_Missense_Mutation_p.D697G|SMARCA4_ENST00000413806.3_Missense_Mutation_p.D697G|SMARCA4_ENST00000541122.2_Missense_Mutation_p.D697G|CTC-215O4.4_ENST00000587831.1_RNA|SMARCA4_ENST00000450717.3_Missense_Mutation_p.D697G|SMARCA4_ENST00000344626.4_Missense_Mutation_p.D697G|SMARCA4_ENST00000444061.3_Missense_Mutation_p.D697G|SMARCA4_ENST00000358026.2_Missense_Mutation_p.D697G	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	697					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GACAGCGATGACGTCTCTGAG	0.602			"""F, N, Mis"""		NSCLC																																p.D697G		.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4	1523	1	Unknown(1)	lung(1)	c.A2090G						.						116.0	89.0	98.0					19																	11118666		2203	4300	6503	SO:0001583	missense	6597	exon14			GCGATGACGTCTC	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2090A>G	19.37:g.11118666A>G	ENSP00000395654:p.Asp697Gly	43.0	0.0		45.0	4.0	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	A	15.09	2.730253	0.48939	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.22;-2.23;-2.23;-2.22	5.19	5.19	0.71726	.	0.056779	0.64402	D	0.000002	D	0.84647	0.5518	L	0.53249	1.67	0.54753	D	0.999983	B;B;B;B;B;B;B	0.09022	0.001;0.002;0.002;0.0;0.001;0.0;0.0	B;B;B;B;B;B;B	0.13407	0.002;0.006;0.006;0.002;0.009;0.002;0.002	T	0.81970	-0.0689	10	0.59425	D	0.04	-32.9246	14.1702	0.65506	1.0:0.0:0.0:0.0	.	697;697;697;697;697;697;697	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	G	697;697;761;697;697;697;697;697	ENSP00000395654:D697G;ENSP00000350720:D697G;ENSP00000343896:D697G;ENSP00000445036:D697G;ENSP00000392837:D697G;ENSP00000397783:D697G;ENSP00000414727:D697G	ENSP00000343896:D697G	D	+	2	0	SMARCA4	10979666	1.000000	0.71417	0.962000	0.40283	0.708000	0.40852	9.006000	0.93592	2.187000	0.69744	0.459000	0.35465	GAC	.		0.602	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
SNX14	57231	ucsc.edu;bcgsc.ca	37	6	86303303	86303303	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr6:86303303A>G	ENST00000314673.3	-	1	310	c.134T>C	c.(133-135)cTt>cCt	p.L45P	SNX14_ENST00000369627.2_Missense_Mutation_p.L45P|SNX14_ENST00000346348.3_Missense_Mutation_p.L45P|SNX14_ENST00000513865.1_Missense_Mutation_p.L45P|SNX14_ENST00000505648.1_Intron|RP11-321N4.5_ENST00000503906.1_Intron	NM_153816.3	NP_722523.1	Q9Y5W7	SNX14_HUMAN	sorting nexin 14	45					protein transport (GO:0015031)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)	phosphatidylinositol binding (GO:0035091)			NS(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(11)|skin(1)	22		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		TTACCTGTTAAGAAGCAGGGA	0.672																																					p.L45P		.											.	SNX14	226	0			c.T134C						.						23.0	22.0	22.0					6																	86303303		2202	4298	6500	SO:0001583	missense	57231	exon1			CTGTTAAGAAGCA	AF121863	CCDS5003.1, CCDS5004.1, CCDS75490.1	6q15	2008-10-22			ENSG00000135317	ENSG00000135317		"""Sorting nexins"""	14977	protein-coding gene	gene with protein product						11485546, 11736640	Standard	XM_005248738		Approved	RGS-PX2	uc003pkr.3	Q9Y5W7	OTTHUMG00000015140	ENST00000314673.3:c.134T>C	6.37:g.86303303A>G	ENSP00000313121:p.Leu45Pro	34.0	0.0		45.0	4.0	NM_153816	B4DI55|Q4VBR3|Q5TCF9|Q5TCG0|Q6NUI7|Q6PI37|Q9BSD1	Missense_Mutation	SNP	ENST00000314673.3	37	CCDS5004.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.230694	0.79688	.	.	ENSG00000135317	ENST00000346348;ENST00000314673;ENST00000513865;ENST00000369627;ENST00000514419	T;T;T;T	0.43688	0.94;1.57;1.17;1.54	5.07	5.07	0.68467	.	0.060753	0.64402	D	0.000003	T	0.39279	0.1072	L	0.29908	0.895	0.80722	D	1	D;D;D	0.62365	0.991;0.989;0.985	D;D;P	0.65323	0.934;0.91;0.86	T	0.41106	-0.9527	10	0.66056	D	0.02	-9.304	12.3051	0.54898	1.0:0.0:0.0:0.0	.	45;45;45	Q9Y5W7-4;Q9Y5W7-2;Q9Y5W7	.;.;SNX14_HUMAN	P	45	ENSP00000257769:L45P;ENSP00000313121:L45P;ENSP00000420938:L45P;ENSP00000358641:L45P	ENSP00000313121:L45P	L	-	2	0	SNX14	86360022	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	4.268000	0.58883	2.126000	0.65437	0.402000	0.26972	CTT	.		0.672	SNX14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041393.2	NM_153816	
SPG11	80208	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	44943731	44943731	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr15:44943731C>A	ENST00000261866.7	-	6	1430	c.1414G>T	c.(1414-1416)Gta>Tta	p.V472L	SPG11_ENST00000535302.2_Missense_Mutation_p.V472L|SPG11_ENST00000427534.2_Missense_Mutation_p.V472L|SPG11_ENST00000558319.1_Missense_Mutation_p.V472L|SPG11_ENST00000559193.1_Missense_Mutation_p.V472L	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	472					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		CTACTGTCTACAGGAATACAC	0.453																																					p.V472L		.											.	SPG11	95	0			c.G1414T						.						86.0	81.0	82.0					15																	44943731		2198	4298	6496	SO:0001583	missense	80208	exon6			TGTCTACAGGAAT		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.1414G>T	15.37:g.44943731C>A	ENSP00000261866:p.Val472Leu	50.0	0.0		42.0	8.0	NM_025137	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	ENST00000261866.7	37	CCDS10112.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.528990	0.44969	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	D;T;T	0.82167	-1.58;-1.35;-1.33	6.06	-0.211	0.13172	.	0.305959	0.30311	N	0.009908	T	0.77903	0.4200	M	0.65498	2.005	0.36483	D	0.867949	P;B;B;B	0.34800	0.469;0.196;0.028;0.196	B;B;B;B	0.33620	0.167;0.095;0.041;0.088	T	0.74047	-0.3790	10	0.59425	D	0.04	.	9.5845	0.39508	0.0:0.5802:0.0:0.4198	.	472;472;472;472	C4B7M2;F5H3N6;B9EK60;Q96JI7	.;.;.;SPTCS_HUMAN	L	472	ENSP00000261866:V472L;ENSP00000445278:V472L;ENSP00000396110:V472L	ENSP00000261866:V472L	V	-	1	0	SPG11	42731023	0.998000	0.40836	0.976000	0.42696	0.983000	0.72400	0.418000	0.21230	-0.284000	0.09102	-0.137000	0.14449	GTA	.		0.453	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1		
SRM	6723	ucsc.edu;bcgsc.ca	37	1	11118901	11118901	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:11118901T>C	ENST00000376957.2	-	3	417	c.337A>G	c.(337-339)Aag>Gag	p.K113E		NM_003132.2	NP_003123.2	P19623	SPEE_HUMAN	spermidine synthase	113	PABS.				cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)|spermidine synthase activity (GO:0004766)			large_intestine(1)|lung(1)|urinary_tract(1)	3	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.228)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)	S-Adenosylmethionine(DB00118)	GAGGGGTGCTTCACCACCTCC	0.672																																					p.K113E		.											.	SRM	90	0			c.A337G						.						48.0	35.0	40.0					1																	11118901		2197	4299	6496	SO:0001583	missense	6723	exon3			GGTGCTTCACCAC	BC033106	CCDS125.1	1p36-p22	2010-11-08			ENSG00000116649	ENSG00000116649	2.5.1.16		11296	protein-coding gene	gene with protein product		182891		SRML1		2344393	Standard	NM_003132		Approved	SPS1	uc001arz.1	P19623	OTTHUMG00000002119	ENST00000376957.2:c.337A>G	1.37:g.11118901T>C	ENSP00000366156:p.Lys113Glu	36.0	0.0		37.0	4.0	NM_003132	B1AKP9|Q15511	Missense_Mutation	SNP	ENST00000376957.2	37	CCDS125.1	.	.	.	.	.	.	.	.	.	.	T	28.3	4.911287	0.92178	.	.	ENSG00000116649	ENST00000376957	D	0.82255	-1.59	4.09	4.09	0.47781	.	0.052869	0.64402	D	0.000001	D	0.86543	0.5958	M	0.92784	3.345	0.80722	D	1	P	0.52170	0.951	B	0.42462	0.388	D	0.89649	0.3868	10	0.87932	D	0	.	12.5913	0.56445	0.0:0.0:0.0:1.0	.	113	P19623	SPEE_HUMAN	E	113	ENSP00000366156:K113E	ENSP00000366156:K113E	K	-	1	0	SRM	11041488	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	7.809000	0.86057	1.616000	0.50265	0.379000	0.24179	AAG	.		0.672	SRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006056.1	NM_003132	
ST8SIA1	6489	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	22486954	22486954	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:22486954G>C	ENST00000396037.4	-	1	694	c.213C>G	c.(211-213)aaC>aaG	p.N71K	ST8SIA1_ENST00000536558.1_Intron|ST8SIA1_ENST00000381424.3_Missense_Mutation_p.N71K|ST8SIA1_ENST00000404299.3_Missense_Mutation_p.N71K|ST8SIA1_ENST00000539510.1_5'UTR	NM_003034.3	NP_003025.1	Q92185	SIA8A_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1	71					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|glycosphingolipid biosynthetic process (GO:0006688)|positive regulation of cell proliferation (GO:0008284)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25						CCGCGGTCTGGTTCCTCCTCC	0.647																																					p.N71K		.											.	ST8SIA1	93	0			c.C213G						.						68.0	65.0	66.0					12																	22486954		2203	4300	6503	SO:0001583	missense	6489	exon1			GGTCTGGTTCCTC	L32867	CCDS8697.1	12p12.1-p11.2	2013-03-01	2003-01-14	2005-02-07	ENSG00000111728	ENSG00000111728	2.4.99.8	"""Sialyltransferases"""	10869	protein-coding gene	gene with protein product	"""ST8Sia I"""	601123	"""sialyltransferase 8 (alpha-N-acetylneuraminate: alpha-2,8-sialytransferase, GD3 synthase) A"""	SIAT8, SIAT8A		7901202	Standard	NM_003034		Approved		uc001rfo.4	Q92185	OTTHUMG00000169098	ENST00000396037.4:c.213C>G	12.37:g.22486954G>C	ENSP00000379353:p.Asn71Lys	21.0	0.0		27.0	9.0	NM_003034	A8K4H6|Q17RL0|Q6PZN5|Q93064	Missense_Mutation	SNP	ENST00000396037.4	37	CCDS8697.1	.	.	.	.	.	.	.	.	.	.	G	19.06	3.754733	0.69648	.	.	ENSG00000111728	ENST00000396037;ENST00000541868;ENST00000404299;ENST00000381424	T;T	0.61742	0.08;0.08	4.45	3.54	0.40534	.	0.097479	0.64402	N	0.000001	T	0.67230	0.2871	L	0.61218	1.895	0.80722	D	1	D	0.62365	0.991	P	0.58928	0.848	T	0.70306	-0.4908	10	0.72032	D	0.01	-17.4253	11.4489	0.50140	0.0:0.0:0.8195:0.1805	.	71	Q92185	SIA8A_HUMAN	K	71;48;71;71	ENSP00000379353:N71K;ENSP00000440292:N48K	ENSP00000261197:N71K	N	-	3	2	ST8SIA1	22378221	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.821000	0.48065	1.161000	0.42604	0.563000	0.77884	AAC	.		0.647	ST8SIA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402245.2	NM_003034	
SULF2	55959	ucsc.edu;bcgsc.ca	37	20	46307514	46307514	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr20:46307514G>T	ENST00000359930.4	-	8	1950	c.1099C>A	c.(1099-1101)Ccc>Acc	p.P367T	CTD-2653D5.1_ENST00000526566.2_RNA|SULF2_ENST00000484875.1_Missense_Mutation_p.P367T|SULF2_ENST00000467815.1_Missense_Mutation_p.P367T|SULF2_ENST00000361612.4_Missense_Mutation_p.P367T	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	367					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						AGGATGGTGGGGGCCAGGTCA	0.627																																					p.P367T		.											.	SULF2	293	0			c.C1099A						.						102.0	92.0	96.0					20																	46307514		2203	4300	6503	SO:0001583	missense	55959	exon8			TGGTGGGGGCCAG	AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.1099C>A	20.37:g.46307514G>T	ENSP00000353007:p.Pro367Thr	52.0	0.0		49.0	5.0	NM_001161841	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	ENST00000359930.4	37	CCDS13408.1	.	.	.	.	.	.	.	.	.	.	g	28.2	4.896389	0.91962	.	.	ENSG00000196562	ENST00000359930;ENST00000484875;ENST00000361612;ENST00000467815	D;D;D;D	0.99409	-5.85;-5.85;-5.85;-5.85	5.26	5.26	0.73747	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.99635	0.9866	M	0.91818	3.245	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.969;1.0	D	0.97866	1.0283	10	0.87932	D	0	-23.8472	18.8803	0.92353	0.0:0.0:1.0:0.0	.	367;367	Q8IWU5-2;Q8IWU5	.;SULF2_HUMAN	T	367	ENSP00000353007:P367T;ENSP00000418290:P367T;ENSP00000354662:P367T;ENSP00000418442:P367T	ENSP00000353007:P367T	P	-	1	0	SULF2	45740921	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.866000	0.99616	2.464000	0.83262	0.457000	0.33378	CCC	.		0.627	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837	
SYNE1	23345	ucsc.edu;bcgsc.ca	37	6	152683374	152683374	+	Silent	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr6:152683374G>T	ENST00000367255.5	-	64	10831	c.10230C>A	c.(10228-10230)gcC>gcA	p.A3410A	SYNE1_ENST00000265368.4_Silent_p.A3410A|SYNE1_ENST00000448038.1_Silent_p.A3417A|SYNE1_ENST00000423061.1_Silent_p.A3417A|SYNE1_ENST00000341594.5_Intron	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3410					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CATTCAGGTTGGCTTCCATAC	0.483										HNSCC(10;0.0054)																											p.A3417A		.											.	SYNE1	607	0			c.C10251A						.						138.0	122.0	127.0					6																	152683374		2203	4300	6503	SO:0001819	synonymous_variant	23345	exon64			CAGGTTGGCTTCC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10230C>A	6.37:g.152683374G>T		53.0	0.0		40.0	4.0	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																			.		0.483	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
TENM1	10178	broad.mit.edu;ucsc.edu	37	X	123695669	123695669	+	Splice_Site	SNP	T	T	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chrX:123695669T>A	ENST00000371130.3	-	14	2351		c.e14-2		TENM1_ENST00000422452.2_Splice_Site	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1						immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GGCAGCCATCTGAAAAGACAT	0.502																																					.		.											.	.	.	0			c.2288-2A>T						.						117.0	93.0	102.0					X																	123695669		2203	4300	6503	SO:0001630	splice_region_variant	10178	exon15			GCCATCTGAAAAG	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.2288-2A>T	X.37:g.123695669T>A		25.0	0.0		47.0	5.0	NM_001163278	B2RTR5|Q5JZ17	Splice_Site	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.410600	0.83340	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6091	0.68504	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ODZ1	123523350	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.902000	0.87389	1.899000	0.54978	0.481000	0.45027	.	.		0.502	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	Intron
THSD7B	80731	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	137988754	137988754	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:137988754T>C	ENST00000409968.1	+	8	2042	c.1864T>C	c.(1864-1866)Tca>Cca	p.S622P	THSD7B_ENST00000272643.3_Missense_Mutation_p.S622P|THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000413152.2_Missense_Mutation_p.S591P			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	622	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		AAATAAAAACTCAGATGGGAA	0.468																																					.		.											.	THSD7B	75	0			.						.						49.0	50.0	50.0					2																	137988754		1927	4136	6063	SO:0001583	missense	80731	.			AAAAACTCAGATG			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1864T>C	2.37:g.137988754T>C	ENSP00000387145:p.Ser622Pro	84.0	0.0		92.0	16.0	.		Missense_Mutation	SNP	ENST00000409968.1	37		.	.	.	.	.	.	.	.	.	.	T	18.66	3.671558	0.67928	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.23754	2.41;2.28;1.89	5.89	0.574	0.17368	.	0.755866	0.12963	N	0.424840	T	0.27697	0.0681	L	0.33189	0.99	0.52501	D	0.999951	P;P	0.50272	0.933;0.865	P;B	0.54590	0.756;0.439	T	0.08576	-1.0715	10	0.39692	T	0.17	.	7.7878	0.29101	0.1826:0.0:0.3931:0.4243	.	622;591	Q9C0I4;C9JKN6	THS7B_HUMAN;.	P	622;622;591	ENSP00000387145:S622P;ENSP00000272643:S622P;ENSP00000413841:S591P	ENSP00000272643:S622P	S	+	1	0	THSD7B	137705224	0.000000	0.05858	0.998000	0.56505	0.995000	0.86356	-0.095000	0.11077	0.464000	0.27142	0.460000	0.39030	TCA	.		0.468	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
TMEM2	23670	ucsc.edu;bcgsc.ca	37	9	74360144	74360144	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr9:74360144T>C	ENST00000377044.4	-	4	1363	c.824A>G	c.(823-825)gAc>gGc	p.D275G	TMEM2_ENST00000377066.5_Missense_Mutation_p.D275G	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	275					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		TTTGGCCGTGTCTTGGTCAAT	0.498																																					p.D275G		.											.	TMEM2	92	0			c.A824G						.						87.0	82.0	84.0					9																	74360144		2203	4300	6503	SO:0001583	missense	23670	exon4			GCCGTGTCTTGGT		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.824A>G	9.37:g.74360144T>C	ENSP00000366243:p.Asp275Gly	48.0	0.0		38.0	4.0	NM_001135820	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	T	17.49	3.403840	0.62288	.	.	ENSG00000135048	ENST00000377044;ENST00000377066	T;T	0.73681	-0.77;-0.73	6.03	6.03	0.97812	.	0.042831	0.85682	D	0.000000	T	0.73118	0.3546	M	0.61703	1.905	0.80722	D	1	B;B	0.23377	0.023;0.084	B;B	0.26310	0.031;0.068	T	0.68055	-0.5510	10	0.25751	T	0.34	.	16.5582	0.84512	0.0:0.0:0.0:1.0	.	275;275	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	G	275	ENSP00000366243:D275G;ENSP00000366266:D275G	ENSP00000366243:D275G	D	-	2	0	TMEM2	73549964	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.466000	0.80914	2.308000	0.77769	0.533000	0.62120	GAC	.		0.498	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
TMEM232	642987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	109941886	109941886	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr5:109941886G>T	ENST00000455884.2	-	9	1055	c.1005C>A	c.(1003-1005)agC>agA	p.S335R	TMEM232_ENST00000429839.2_Missense_Mutation_p.S335R|TMEM232_ENST00000515518.2_5'UTR			C9JQI7	TM232_HUMAN	transmembrane protein 232	335						integral component of membrane (GO:0016021)				breast(1)|kidney(2)	3						CAGACATAATGCTTGAAACAA	0.358																																					p.S335R		.											.	.	.	0			c.C1005A						.						69.0	58.0	61.0					5																	109941886		692	1591	2283	SO:0001583	missense	642987	exon9			CATAATGCTTGAA	AK125070	CCDS47253.1, CCDS47253.2	5q22.1	2014-02-12	2009-10-02		ENSG00000186952	ENSG00000186952			37270	protein-coding gene	gene with protein product							Standard	NM_001039763		Approved	FLJ43080	uc011cvh.2	C9JQI7	OTTHUMG00000163297	ENST00000455884.2:c.1005C>A	5.37:g.109941886G>T	ENSP00000401477:p.Ser335Arg	129.0	0.0		143.0	22.0	NM_001039763	B4DKF4	Missense_Mutation	SNP	ENST00000455884.2	37	CCDS47253.2	.	.	.	.	.	.	.	.	.	.	G	14.88	2.668349	0.47677	.	.	ENSG00000186952	ENST00000429839;ENST00000455884	.	.	.	5.45	3.58	0.41010	.	0.756414	0.13148	N	0.410099	T	0.54919	0.1888	L	0.59436	1.845	0.09310	N	1	D;P;D	0.63046	0.992;0.904;0.977	P;P;P	0.58873	0.847;0.571;0.803	T	0.43261	-0.9402	8	.	.	.	-1.5952	12.1974	0.54305	0.0:0.0:0.6919:0.3081	.	335;335;217	C9JQI7;C9JQI7-2;E9PFK0	TM232_HUMAN;.;.	R	335	.	.	S	-	3	2	TMEM232	109969785	0.000000	0.05858	0.510000	0.27712	0.573000	0.36030	-0.047000	0.11963	1.283000	0.44513	-0.324000	0.08512	AGC	.		0.358	TMEM232-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372488.2	NM_001039763	
TNRC6A	27327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	24802369	24802369	+	Silent	SNP	G	G	A	rs113829020	byFrequency	TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr16:24802369G>A	ENST00000395799.3	+	6	2535	c.2406G>A	c.(2404-2406)ggG>ggA	p.G802G	TNRC6A_ENST00000315183.7_Silent_p.G802G	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	802	Interaction with argonaute family proteins.|Sufficient for interaction with AGO1 and AGO4.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		ACTGCCAGGGGGGGTGGGAAG	0.507																																					p.G802G		.											.	TNRC6A	92	0			c.G2406A						.						31.0	33.0	32.0					16																	24802369		2196	4298	6494	SO:0001819	synonymous_variant	27327	exon6			CCAGGGGGGGTGG	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.2406G>A	16.37:g.24802369G>A		27.0	0.0		24.0	12.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Silent	SNP	ENST00000395799.3	37	CCDS10624.2																																																																																			G|0.997;C|0.003		0.507	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
TPM2	7169	ucsc.edu;bcgsc.ca	37	9	35685294	35685294	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr9:35685294A>G	ENST00000360958.2	-	5	639	c.535T>C	c.(535-537)Tcg>Ccg	p.S179P	TPM2_ENST00000378292.3_Missense_Mutation_p.S179P|TPM2_ENST00000329305.2_Missense_Mutation_p.S179P|TPM2_ENST00000378300.5_Missense_Mutation_p.S179P	NM_003289.3	NP_003280.2	P07951	TPM2_HUMAN	tropomyosin 2 (beta)	179					muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)	cytosol (GO:0005829)|muscle thin filament tropomyosin (GO:0005862)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_epithelial(49;0.121)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTCTCCTCCGAGCGCTCCAGC	0.607																																					p.S179P		.											.	TPM2	515	0			c.T535C						.						46.0	46.0	46.0					9																	35685294		2203	4300	6503	SO:0001583	missense	7169	exon5			CCTCCGAGCGCTC		CCDS6586.1, CCDS6587.1	9p13	2014-09-17	2003-12-02		ENSG00000198467	ENSG00000198467		"""Tropomyosins"""	12011	protein-coding gene	gene with protein product	"""nemaline myopathy type 4"""	190990	"""arthrogryposis multiplex congenital, distal, type 1"""	AMCD1		7606936	Standard	NM_003289		Approved	DA1, NEM4	uc003zxq.3	P07951	OTTHUMG00000019878	ENST00000360958.2:c.535T>C	9.37:g.35685294A>G	ENSP00000354219:p.Ser179Pro	27.0	0.0		32.0	4.0	NM_213674	A6NM85|P06468|Q13894|Q53FM4|Q5TCU4|Q5TCU7|Q9UH67	Missense_Mutation	SNP	ENST00000360958.2	37	CCDS6587.1	.	.	.	.	.	.	.	.	.	.	A	13.96	2.394130	0.42410	.	.	ENSG00000198467	ENST00000378300;ENST00000378292;ENST00000329305;ENST00000360958	D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41	5.24	5.24	0.73138	.	.	.	.	.	D	0.95790	0.8630	M	0.73372	2.23	0.51233	D	0.999916	P;B;B;B;B	0.35208	0.49;0.007;0.009;0.115;0.03	B;B;B;B;B	0.35607	0.153;0.049;0.049;0.141;0.206	D	0.95524	0.8597	9	0.87932	D	0	.	11.3262	0.49450	0.8481:0.1519:0.0:0.0	.	179;179;179;179;179	B4DGC2;A7XZE4;P07951;Q5TCU8;P07951-2	.;.;TPM2_HUMAN;.;.	P	179	ENSP00000367550:S179P;ENSP00000367542:S179P;ENSP00000367541:S179P;ENSP00000354219:S179P	ENSP00000367541:S179P	S	-	1	0	TPM2	35675294	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.185000	0.42584	2.199000	0.70637	0.533000	0.62120	TCG	.		0.607	TPM2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052376.1	NM_003289	
TRAIP	10293	broad.mit.edu;bcgsc.ca	37	3	49869470	49869470	+	Missense_Mutation	SNP	G	G	A	rs567150349		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:49869470G>A	ENST00000331456.2	-	11	1029	c.916C>T	c.(916-918)Cgc>Tgc	p.R306C	TRAIP_ENST00000469027.1_Missense_Mutation_p.R151C	NM_005879.2	NP_005870.2	Q9BWF2	TRAIP_HUMAN	TRAF interacting protein	306	Interaction with CYLD.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|receptor signaling protein activity (GO:0005057)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GATGGCCGGCGGAGCTTCAGA	0.557																																					p.R306C		.											.	TRAIP	849	0			c.C916T						.						70.0	73.0	72.0					3																	49869470		2203	4300	6503	SO:0001583	missense	10293	exon11			GCCGGCGGAGCTT	BC019283	CCDS2806.1	3p21.31	2013-01-09			ENSG00000183763	ENSG00000183763		"""RING-type (C3HC4) zinc fingers"""	30764	protein-coding gene	gene with protein product	"""ring finger protein 206"""	605958				9104814	Standard	NM_005879		Approved	TRIP, RNF206	uc003cxs.1	Q9BWF2	OTTHUMG00000158269	ENST00000331456.2:c.916C>T	3.37:g.49869470G>A	ENSP00000328203:p.Arg306Cys	33.0	0.0		40.0	9.0	NM_005879	B5BU84|B5BUL3|O00467	Missense_Mutation	SNP	ENST00000331456.2	37	CCDS2806.1	.	.	.	.	.	.	.	.	.	.	G	16.16	3.043664	0.55003	.	.	ENSG00000183763	ENST00000331456;ENST00000469027	T	0.51574	0.7	5.71	3.0	0.34707	.	0.354158	0.37136	N	0.002225	T	0.41581	0.1165	L	0.53249	1.67	0.31011	N	0.719178	B;B	0.22541	0.071;0.013	B;B	0.12156	0.007;0.007	T	0.46261	-0.9204	10	0.72032	D	0.01	-20.3028	10.6408	0.45592	0.2048:0.0:0.7952:0.0	.	306;306	A8K807;Q9BWF2	.;TRAIP_HUMAN	C	306;151	ENSP00000420085:R151C	ENSP00000328203:R306C	R	-	1	0	TRAIP	49844474	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	1.664000	0.37439	0.374000	0.24650	0.655000	0.94253	CGC	.		0.557	TRAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350518.1	NM_005879	
TRAM1	23471	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	71499196	71499196	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr8:71499196T>C	ENST00000262213.2	-	8	849	c.680A>G	c.(679-681)tAt>tGt	p.Y227C	TRAM1_ENST00000521049.1_5'UTR|TRAM1_ENST00000521425.1_Missense_Mutation_p.Y141C|TRAM1_ENST00000536748.1_Missense_Mutation_p.Y196C	NM_014294.5	NP_055109.1	Q15629	TRAM1_HUMAN	translocation associated membrane protein 1	227	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	17			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)			TTCAACAAAATAATGTAGCAC	0.323																																					p.Y227C	Ovarian(85;984 1334 5116 12432 40638)	.											.	TRAM1	227	0			c.A680G						.						98.0	93.0	95.0					8																	71499196		2203	4300	6503	SO:0001583	missense	23471	exon8			ACAAAATAATGTA	X63679	CCDS6207.1	8q13.1	2004-01-22			ENSG00000067167	ENSG00000067167			20568	protein-coding gene	gene with protein product		605190				1315422	Standard	NM_014294		Approved	TRAM, TRAMP	uc003xyo.2	Q15629	OTTHUMG00000164428	ENST00000262213.2:c.680A>G	8.37:g.71499196T>C	ENSP00000262213:p.Tyr227Cys	102.0	0.0		114.0	22.0	NM_014294	B4E0K2	Missense_Mutation	SNP	ENST00000262213.2	37	CCDS6207.1	.	.	.	.	.	.	.	.	.	.	T	17.64	3.438708	0.62955	.	.	ENSG00000067167	ENST00000521425;ENST00000262213;ENST00000536748	D;D;D	0.85171	-1.95;-1.95;-1.95	5.66	5.66	0.87406	TRAM/LAG1/CLN8 homology domain (3);	0.116921	0.64402	D	0.000011	D	0.89856	0.6836	M	0.89601	3.045	0.80722	D	1	B	0.30563	0.285	B	0.38378	0.272	D	0.89377	0.3679	10	0.49607	T	0.09	-4.0819	15.8852	0.79241	0.0:0.0:0.0:1.0	.	227	Q15629	TRAM1_HUMAN	C	141;227;196	ENSP00000428052:Y141C;ENSP00000262213:Y227C;ENSP00000439359:Y196C	ENSP00000262213:Y227C	Y	-	2	0	TRAM1	71661750	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.163000	0.71880	2.146000	0.66826	0.477000	0.44152	TAT	.		0.323	TRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378738.1	NM_014294	
TSC2	7249	ucsc.edu;bcgsc.ca	37	16	2112539	2112539	+	Silent	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr16:2112539C>T	ENST00000219476.3	+	13	1929	c.1299C>T	c.(1297-1299)tcC>tcT	p.S433S	TSC2_ENST00000439673.2_Silent_p.S396S|TSC2_ENST00000568454.1_Silent_p.S444S|TSC2_ENST00000382538.6_Silent_p.S384S|TSC2_ENST00000353929.4_Silent_p.S433S|TSC2_ENST00000401874.2_Silent_p.S433S|TSC2_ENST00000350773.4_Silent_p.S433S	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	433					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GAGCGCAGTCCATCCACCCGG	0.607			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.S433S		.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	1908	0			c.C1299T						.						50.0	50.0	50.0					16																	2112539		2198	4299	6497	SO:0001819	synonymous_variant	7249	exon13	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	GCAGTCCATCCAC	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.1299C>T	16.37:g.2112539C>T		40.0	0.0		42.0	4.0	NM_001114382	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Silent	SNP	ENST00000219476.3	37	CCDS10458.1																																																																																			.		0.607	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179407524	179407524	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:179407524C>T	ENST00000591111.1	-	298	92358	c.92134G>A	c.(92134-92136)Gtc>Atc	p.V30712I	TTN_ENST00000342992.6_Missense_Mutation_p.V29785I|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000590807.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V23480I|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.V23288I|TTN_ENST00000589042.1_Missense_Mutation_p.V32353I|TTN_ENST00000359218.5_Missense_Mutation_p.V23413I|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA			Q8WZ42	TITIN_HUMAN	titin	30712	Ig-like 138.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAACTGTGACACGCTCTGAT	0.458																																					p.V32353I		.											.	TTN	636	0			c.G97057A						.						209.0	199.0	202.0					2																	179407524		1965	4156	6121	SO:0001583	missense	7273	exon348			CTGTGACACGCTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.92134G>A	2.37:g.179407524C>T	ENSP00000465570:p.Val30712Ile	104.0	0.0		122.0	20.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	12.76	2.035655	0.35893	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.67	3.87	0.44632	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.46092	0.1375	N	0.10618	0.005	0.34369	D	0.691823	B;B;B;B	0.10296	0.003;0.003;0.003;0.003	B;B;B;B	0.10450	0.005;0.005;0.005;0.005	T	0.55289	-0.8164	9	0.87932	D	0	.	10.0264	0.42074	0.0:0.7803:0.0:0.2197	.	23288;23413;23480;30712	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	29785;23288;23480;23413;23285	ENSP00000343764:V29785I;ENSP00000434586:V23288I;ENSP00000340554:V23480I;ENSP00000352154:V23413I	ENSP00000340554:V23480I	V	-	1	0	TTN	179115770	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.541000	0.36126	1.402000	0.46780	0.655000	0.94253	GTC	.		0.458	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UBASH3B	84959	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	122659905	122659905	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:122659905G>A	ENST00000284273.5	+	6	1244	c.869G>A	c.(868-870)aGc>aAc	p.S290N		NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B	290	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		GAGCAGACCAGCACCAGCGAG	0.537																																					p.S290N		.											.	UBASH3B	68	0			c.G869A						.						183.0	178.0	180.0					11																	122659905		2202	4299	6501	SO:0001583	missense	84959	exon6			AGACCAGCACCAG	AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.869G>A	11.37:g.122659905G>A	ENSP00000284273:p.Ser290Asn	32.0	0.0		48.0	9.0	NM_032873	Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Missense_Mutation	SNP	ENST00000284273.5	37	CCDS31694.1	.	.	.	.	.	.	.	.	.	.	G	14.51	2.555587	0.45487	.	.	ENSG00000154127	ENST00000284273	T	0.29917	1.55	5.86	4.94	0.65067	Src homology-3 domain (4);	0.075626	0.85682	D	0.000000	T	0.29817	0.0745	L	0.39020	1.185	0.47778	D	0.999511	B	0.34399	0.452	B	0.39465	0.3	T	0.03433	-1.1037	10	0.23302	T	0.38	-20.1167	16.0247	0.80536	0.0:0.2536:0.7464:0.0	.	290	Q8TF42	UBS3B_HUMAN	N	290	ENSP00000284273:S290N	ENSP00000284273:S290N	S	+	2	0	UBASH3B	122165115	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.895000	0.48648	1.459000	0.47892	0.563000	0.77884	AGC	.		0.537	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387499.1	NM_032873	
UCN2	90226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	48600437	48600437	+	Nonsense_Mutation	SNP	G	G	A	rs149022309		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:48600437G>A	ENST00000273610.3	-	2	203	c.121C>T	c.(121-123)Cga>Tga	p.R41*	PFKFB4_ENST00000536104.1_5'Flank|COL7A1_ENST00000470076.1_5'Flank	NM_033199.3	NP_149976.1	Q96RP3	UCN2_HUMAN	urocortin 2	41					cAMP biosynthetic process (GO:0006171)|cell proliferation (GO:0008283)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hypoxia (GO:0071456)|digestion (GO:0007586)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of gene expression (GO:0010629)|negative regulation of luteinizing hormone secretion (GO:0033685)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone binding (GO:0042562)|receptor binding (GO:0005102)								BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GCCGCAGGTCGGGGAGTGGTC	0.652																																					p.R41X		.											.	UCN2	68	0			c.C121T						.	A	stop/ARG	0,4406		0,0,2203	30.0	32.0	32.0		121	-10.6	0.0	3	dbSNP_134	32	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	UCN2	NM_033199.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		41/113	48600437	1,13005	2203	4300	6503	SO:0001587	stop_gained	90226	exon2			CAGGTCGGGGAGT	AF320560	CCDS2772.1	3p21.3	2013-02-28			ENSG00000145040	ENSG00000145040		"""Endogenous ligands"""	18414	protein-coding gene	gene with protein product	"""prepro-urocortin 2"""	605902				11329063	Standard	NM_033199		Approved	UCNI, SRP, URP, UCN-II	uc003cty.1	Q96RP3	OTTHUMG00000133533	ENST00000273610.3:c.121C>T	3.37:g.48600437G>A	ENSP00000273610:p.Arg41*	74.0	0.0		71.0	17.0	NM_033199	Q9BUG0	Nonsense_Mutation	SNP	ENST00000273610.3	37	CCDS2772.1	.	.	.	.	.	.	.	.	.	.	g	8.413	0.844566	0.16963	0.0	1.16E-4	ENSG00000145040	ENST00000273610	.	.	.	5.28	-10.6	0.00265	.	2.567240	0.01439	N	0.015013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-3.5288	0.3326	0.00321	0.2654:0.158:0.2353:0.3414	.	.	.	.	X	41	.	ENSP00000273610:R41X	R	-	1	2	UCN2	48575441	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.503000	0.00449	-3.150000	0.00231	-5.056000	0.00002	CGA	G|1.000;A|0.000		0.652	UCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257510.1	NM_033199	
USP12	219333	ucsc.edu;bcgsc.ca	37	13	27643523	27643523	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr13:27643523T>C	ENST00000282344.6	-	9	1268		c.e9-2			NM_182488.3	NP_872294.2	O75317	UBP12_HUMAN	ubiquitin specific peptidase 12						protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Lung SC(185;0.0161)		all cancers(112;0.0508)|GBM - Glioblastoma multiforme(144;0.168)|Epithelial(112;0.244)|OV - Ovarian serous cystadenocarcinoma(117;0.246)		ATCTATTTTCTGTGAGGTAaa	0.363																																					.	Ovarian(37;808 911 7590 44442 44991)	.											.	USP12	522	0			c.1012-2A>G						.						101.0	96.0	98.0					13																	27643523		2203	4300	6503	SO:0001630	splice_region_variant	219333	exon10			ATTTTCTGTGAGG	AL049221	CCDS31952.1	13q12.13	2010-05-12	2005-08-08	2003-10-08	ENSG00000152484	ENSG00000152484		"""Ubiquitin-specific peptidases"""	20485	protein-coding gene	gene with protein product			"""ubiquitin specific protease 12 like 1"", ""ubiquitin specific protease 12"""	USP12L1		12838346	Standard	NM_182488		Approved		uc001uqy.3	O75317	OTTHUMG00000016626	ENST00000282344.6:c.1012-2A>G	13.37:g.27643523T>C		57.0	0.0		46.0	4.0	NM_182488	A8K0X0|Q5VZV3|Q8TC49	Splice_Site	SNP	ENST00000282344.6	37	CCDS31952.1	.	.	.	.	.	.	.	.	.	.	T	17.01	3.279249	0.59758	.	.	ENSG00000152484	ENST00000282344	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6715	0.77279	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	USP12	26541523	1.000000	0.71417	0.997000	0.53966	0.968000	0.65278	7.844000	0.86867	2.170000	0.68504	0.533000	0.62120	.	.		0.363	USP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044264.1	NM_182488	Intron
USP46	64854	ucsc.edu;bcgsc.ca	37	4	53494294	53494294	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr4:53494294C>T	ENST00000441222.3	-	3	338	c.154G>A	c.(154-156)Gca>Aca	p.A52T	USP46_ENST00000504078.1_5'Flank|USP46_ENST00000451218.2_Missense_Mutation_p.A25T|USP46_ENST00000508499.1_Missense_Mutation_p.A45T	NM_022832.3	NP_073743.2	P62068	UBP46_HUMAN	ubiquitin specific peptidase 46	52	USP.				adult feeding behavior (GO:0008343)|behavioral fear response (GO:0001662)|behavioral response to ethanol (GO:0048149)|protein deubiquitination (GO:0016579)|regulation of synaptic transmission, GABAergic (GO:0032228)|righting reflex (GO:0060013)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)	12			LUSC - Lung squamous cell carcinoma(32;0.0295)			AAGTACAATGCCTGAAGCACG	0.512																																					p.A52T		.											.	USP46	637	0			c.G154A						.						87.0	82.0	84.0					4																	53494294		2038	4198	6236	SO:0001583	missense	64854	exon3			ACAATGCCTGAAG	AK022614	CCDS47053.1, CCDS47054.1	4q12	2008-02-05	2005-08-08		ENSG00000109189	ENSG00000109189		"""Ubiquitin-specific peptidases"""	20075	protein-coding gene	gene with protein product		612849	"""ubiquitin specific protease 46"""			12838346	Standard	NM_022832		Approved	FLJ12552	uc003gzn.3	P62068	OTTHUMG00000160640	ENST00000441222.3:c.154G>A	4.37:g.53494294C>T	ENSP00000407818:p.Ala52Thr	56.0	0.0		43.0	4.0	NM_022832	B7Z3Y7|B7Z675|B7Z7S3|G8ACC7|Q80V95|Q9H7U4|Q9H9T8	Missense_Mutation	SNP	ENST00000441222.3	37	CCDS47053.1	.	.	.	.	.	.	.	.	.	.	C	35	5.440272	0.96168	.	.	ENSG00000109189	ENST00000441222;ENST00000451218;ENST00000508499	T;T;T	0.32272	1.46;1.46;1.46	5.25	5.25	0.73442	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.64402	D	0.000009	T	0.53786	0.1818	L	0.60067	1.865	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.97110	0.965;1.0;0.999	T	0.53173	-0.8476	10	0.59425	D	0.04	-12.5993	18.2056	0.89853	0.0:1.0:0.0:0.0	.	40;52;45	P62068-4;P62068;P62068-3	.;UBP46_HUMAN;.	T	52;25;45	ENSP00000407818:A52T;ENSP00000390102:A25T;ENSP00000423244:A45T	ENSP00000407818:A52T	A	-	1	0	USP46	53189051	1.000000	0.71417	0.996000	0.52242	0.959000	0.62525	7.701000	0.84566	2.618000	0.88619	0.655000	0.94253	GCA	.		0.512	USP46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361516.2	NM_022832	
UTRN	7402	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	6	144783916	144783916	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr6:144783916C>T	ENST00000367545.3	+	22	2980	c.2980C>T	c.(2980-2982)Caa>Taa	p.Q994*		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	994					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TGATGATGTGCAAGGAAAGTG	0.378																																					p.Q994X		.											.	UTRN	95	0			c.C2980T						.						104.0	119.0	114.0					6																	144783916		2203	4300	6503	SO:0001587	stop_gained	7402	exon22			GATGTGCAAGGAA	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.2980C>T	6.37:g.144783916C>T	ENSP00000356515:p.Gln994*	81.0	0.0		86.0	22.0	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Nonsense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	C	38	7.192009	0.98125	.	.	ENSG00000152818	ENST00000367529;ENST00000367545	.	.	.	5.47	3.54	0.40534	.	0.131201	0.34828	N	0.003641	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	10.7754	0.46346	0.1319:0.5824:0.2857:0.0	.	.	.	.	X	994	.	ENSP00000356499:Q994X	Q	+	1	0	UTRN	144825609	0.998000	0.40836	0.963000	0.40424	0.403000	0.30841	1.301000	0.33447	1.237000	0.43756	0.655000	0.94253	CAA	.		0.378	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
VWA3A	146177	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	22144300	22144300	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr16:22144300A>G	ENST00000389398.5	+	20	2048	c.1952A>G	c.(1951-1953)gAg>gGg	p.E651G	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	651	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		TACGTGGGCGAGCCAAAGATG	0.632																																					p.E651G		.											.	VWA3A	1	0			c.A1952G						.						46.0	51.0	49.0					16																	22144300		2088	4200	6288	SO:0001583	missense	146177	exon20			TGGGCGAGCCAAA	AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.1952A>G	16.37:g.22144300A>G	ENSP00000374049:p.Glu651Gly	24.0	1.0		27.0	6.0	NM_173615	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	ENST00000389398.5	37	CCDS45441.1	.	.	.	.	.	.	.	.	.	.	A	17.81	3.480053	0.63849	.	.	ENSG00000175267	ENST00000389398;ENST00000299840	T	0.21734	1.99	5.49	5.49	0.81192	.	0.218239	0.39146	N	0.001442	T	0.25195	0.0612	L	0.51422	1.61	0.80722	D	1	B;B	0.28636	0.218;0.074	B;B	0.34138	0.176;0.034	T	0.03166	-1.1065	10	0.49607	T	0.09	.	14.4106	0.67113	1.0:0.0:0.0:0.0	.	651;275	A6NCI4;A6NCI4-2	VWA3A_HUMAN;.	G	651;274	ENSP00000374049:E651G	ENSP00000299840:E274G	E	+	2	0	VWA3A	22051801	0.957000	0.32711	0.847000	0.33407	0.370000	0.29829	2.420000	0.44679	2.081000	0.62600	0.528000	0.53228	GAG	.		0.632	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430052.1		
WDFY4	57705	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	49983837	49983837	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr10:49983837A>G	ENST00000325239.5	+	14	2876	c.2849A>G	c.(2848-2850)aAc>aGc	p.N950S	WDFY4_ENST00000413659.2_Missense_Mutation_p.N950S	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	950						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CACAGAGGCAACCCTGGGTGC	0.478																																					p.N950S		.											.	WDFY4	22	0			c.A2849G						.						156.0	130.0	138.0					10																	49983837		692	1591	2283	SO:0001583	missense	57705	exon15			GAGGCAACCCTGG	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2849A>G	10.37:g.49983837A>G	ENSP00000320563:p.Asn950Ser	40.0	0.0		64.0	7.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	ENST00000325239.5	37	CCDS44385.1	.	.	.	.	.	.	.	.	.	.	A	0.009	-1.845758	0.00568	.	.	ENSG00000128815	ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	T;T	0.41065	1.01;1.01	4.51	-9.01	0.00744	.	.	.	.	.	T	0.18045	0.0433	N	0.14661	0.345	0.09310	N	1	B	0.14438	0.01	B	0.09377	0.004	T	0.14587	-1.0467	8	.	.	.	.	6.9217	0.24391	0.149:0.5637:0.1997:0.0876	.	950	Q6ZS81	WDFY4_HUMAN	S	959;950;950;950	ENSP00000320563:N950S;ENSP00000403789:N950S	.	N	+	2	0	WDFY4	49653843	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.983000	0.03759	-3.002000	0.00275	-1.137000	0.01932	AAC	.		0.478	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
WDR7	23335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	54362254	54362254	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr18:54362254A>G	ENST00000254442.3	+	11	1393	c.1182A>G	c.(1180-1182)atA>atG	p.I394M	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.I394M	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	394					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		CTGGAATTATAGATCAGCTGA	0.403																																					p.I394M		.											.	WDR7	93	0			c.A1182G						.						109.0	102.0	104.0					18																	54362254		2203	4300	6503	SO:0001583	missense	23335	exon11			AATTATAGATCAG	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.1182A>G	18.37:g.54362254A>G	ENSP00000254442:p.Ile394Met	130.0	0.0		130.0	29.0	NM_052834	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	ENST00000254442.3	37	CCDS11962.1	.	.	.	.	.	.	.	.	.	.	A	15.86	2.958476	0.53400	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000398311	T;T	0.69175	-0.38;-0.37	5.68	0.0866	0.14447	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	T	0.74861	0.3772	M	0.68593	2.085	0.53688	D	0.99997	D;D	0.71674	0.995;0.998	D;D	0.78314	0.954;0.991	T	0.70299	-0.4910	10	0.44086	T	0.13	.	9.028	0.36241	0.5044:0.3799:0.0:0.1157	.	394;394	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	M	394	ENSP00000254442:I394M;ENSP00000350187:I394M	ENSP00000254442:I394M	I	+	3	3	WDR7	52513252	0.996000	0.38824	0.996000	0.52242	0.970000	0.65996	0.497000	0.22514	-0.201000	0.10284	0.477000	0.44152	ATA	.		0.403	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1		
ZAN	7455	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100349904	100349904	+	RNA	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:100349904A>G	ENST00000348028.3	+	0	2341				ZAN_ENST00000349350.6_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000538115.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AAAACCCACCATCCCCACAGA	0.507																																					.		.											.	ZAN	142	0			.						.						151.0	168.0	163.0					7																	100349904		1824	4075	5899			7455	.			CCCACCATCCCCA	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100349904A>G		338.0	1.0		288.0	43.0	.	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	RNA	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	a	7.979	0.750860	0.15778	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.69306	-0.39;-0.13;-0.39	3.75	-5.48	0.02592	.	.	.	.	.	T	0.33990	0.0882	N	0.03253	-0.375	0.09310	N	0.999998	B;B	0.10296	0.003;0.002	B;B	0.09377	0.004;0.002	T	0.12041	-1.0563	9	0.33940	T	0.23	.	4.4539	0.11633	0.4777:0.0:0.2772:0.245	.	726;726	F5H0T8;Q9Y493	.;ZAN_HUMAN	V	726	ENSP00000445943:I726V;ENSP00000445091:I726V;ENSP00000444427:I726V	ENSP00000423579:I726V	I	+	1	0	ZAN	100187840	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.528000	0.02225	-1.366000	0.02155	0.454000	0.30748	ATC	.		0.507	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
ZCCHC14	23174	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	87446754	87446754	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr16:87446754C>T	ENST00000268616.4	-	11	1457	c.1240G>A	c.(1240-1242)Ggc>Agc	p.G414S		NM_015144.2	NP_055959.1	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	414							nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	36				BRCA - Breast invasive adenocarcinoma(80;0.0285)		GAGGAACTGCCTTCCCGGGGC	0.637																																					p.G414S		.											.	ZCCHC14	154	0			c.G1240A						.						42.0	39.0	40.0					16																	87446754		2198	4300	6498	SO:0001583	missense	23174	exon11			AACTGCCTTCCCG	AB011151	CCDS10961.1	16q24.2	2013-01-10			ENSG00000140948	ENSG00000140948		"""Zinc fingers, CCHC domain containing"", ""Sterile alpha motif (SAM) domain containing"""	24134	protein-coding gene	gene with protein product						9628581	Standard	XM_005255858		Approved	BDG29, MGC14139	uc002fjz.1	Q8WYQ9	OTTHUMG00000137655	ENST00000268616.4:c.1240G>A	16.37:g.87446754C>T	ENSP00000268616:p.Gly414Ser	23.0	0.0		30.0	7.0	NM_015144	D3DUN1|O60324|Q3MJD8|Q9UFP0	Missense_Mutation	SNP	ENST00000268616.4	37	CCDS10961.1	.	.	.	.	.	.	.	.	.	.	C	3.010	-0.204141	0.06180	.	.	ENSG00000140948	ENST00000268616	T	0.32272	1.46	5.44	5.44	0.79542	.	0.050443	0.85682	D	0.000000	T	0.22437	0.0541	N	0.20986	0.625	0.41819	D	0.990017	P;P	0.38788	0.577;0.647	B;B	0.30855	0.121;0.091	T	0.04650	-1.0936	10	0.48119	T	0.1	-38.6446	19.2534	0.93935	0.0:1.0:0.0:0.0	.	414;414	Q8WYQ9-2;Q8WYQ9	.;ZCH14_HUMAN	S	414	ENSP00000268616:G414S	ENSP00000268616:G414S	G	-	1	0	ZCCHC14	86004255	1.000000	0.71417	1.000000	0.80357	0.426000	0.31534	4.433000	0.59929	2.536000	0.85505	0.514000	0.50259	GGC	.		0.637	ZCCHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269107.1	NM_015144	
ZIC5	85416	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	100617641	100617641	+	Missense_Mutation	SNP	G	G	A	rs146570814		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr13:100617641G>A	ENST00000267294.4	-	2	2215	c.1982C>T	c.(1981-1983)aCg>aTg	p.T661M		NM_033132.3	NP_149123.2	Q96T25	ZIC5_HUMAN	Zic family member 5	661					cell differentiation (GO:0030154)|forebrain development (GO:0030900)|neural tube closure (GO:0001843)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T661M(1)		endometrium(3)|kidney(1)|lung(2)|prostate(1)|skin(2)	9	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CTAATGTATCGTCCGCACAAC	0.478																																					p.T661M		.											.	ZIC5	90	1	Substitution - Missense(1)	prostate(1)	c.C1982T						.	G	MET/THR	0,4406		0,0,2203	60.0	60.0	60.0		1982	6.1	1.0	13	dbSNP_134	60	2,8598	2.2+/-6.3	0,2,4298	yes	missense	ZIC5	NM_033132.3	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	661/664	100617641	2,13004	2203	4300	6503	SO:0001583	missense	85416	exon2			TGTATCGTCCGCA	AF378304	CCDS9494.2	13q32.2	2013-01-08	2011-05-19		ENSG00000139800	ENSG00000139800		"""Zinc fingers, C2H2-type"""	20322	protein-coding gene	gene with protein product			"""Zic family member 5 (odd-paired homolog, Drosophila)"""				Standard	NM_033132		Approved		uc001vom.1	Q96T25	OTTHUMG00000017280	ENST00000267294.4:c.1982C>T	13.37:g.100617641G>A	ENSP00000267294:p.Thr661Met	60.0	0.0		63.0	13.0	NM_033132	Q5VYB0	Missense_Mutation	SNP	ENST00000267294.4	37	CCDS9494.2	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619827	0.66787	0.0	2.33E-4	ENSG00000139800	ENST00000267294	T	0.15718	2.4	6.06	6.06	0.98353	.	.	.	.	.	T	0.18341	0.0440	L	0.36672	1.1	0.40278	D	0.978365	P	0.52577	0.954	B	0.40659	0.336	T	0.00778	-1.1570	9	0.87932	D	0	.	19.3997	0.94623	0.0:0.0:1.0:0.0	.	661	Q96T25	ZIC5_HUMAN	M	661	ENSP00000267294:T661M	ENSP00000267294:T661M	T	-	2	0	ZIC5	99415642	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.533000	0.67160	2.871000	0.98454	0.655000	0.94253	ACG	G|1.000;A|0.000		0.478	ZIC5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000045623.3	NM_033132	
ZNF233	353355	ucsc.edu;bcgsc.ca	37	19	44777921	44777921	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr19:44777921T>C	ENST00000391958.2	+	5	1235	c.1108T>C	c.(1108-1110)Tgt>Cgt	p.C370R	ZNF233_ENST00000334152.1_Missense_Mutation_p.C352R|ZNF235_ENST00000589799.1_Intron|ZNF233_ENST00000592581.1_3'UTR	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	370					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				AGAGAAGTTGTGTACATGTGG	0.483																																					p.C370R		.											.	ZNF233	92	0			c.T1108C						.						103.0	104.0	104.0					19																	44777921		2203	4300	6503	SO:0001583	missense	353355	exon5			AAGTTGTGTACAT	AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.1108T>C	19.37:g.44777921T>C	ENSP00000375820:p.Cys370Arg	48.0	0.0		44.0	4.0	NM_001207005	B2RN78|B2RN79|Q86WL8	Missense_Mutation	SNP	ENST00000391958.2	37	CCDS33047.1	.	.	.	.	.	.	.	.	.	.	T	11.08	1.533854	0.27387	.	.	ENSG00000159915	ENST00000334152;ENST00000391958;ENST00000280305	T;T	0.14766	2.48;2.48	3.76	1.55	0.23275	.	.	.	.	.	T	0.09423	0.0232	N	0.25332	0.735	0.09310	N	0.999996	B	0.19331	0.035	B	0.18871	0.023	T	0.31392	-0.9945	9	0.87932	D	0	-0.7337	5.727	0.18018	0.0:0.0954:0.1698:0.7347	.	370	A6NK53	ZN233_HUMAN	R	352;370;291	ENSP00000334957:C352R;ENSP00000375820:C370R	ENSP00000280305:C291R	C	+	1	0	ZNF233	49469761	0.072000	0.21174	0.000000	0.03702	0.061000	0.15899	3.341000	0.52151	0.135000	0.18707	0.491000	0.48974	TGT	.		0.483	ZNF233-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460737.1	NM_181756	
ZNF473	25888	ucsc.edu;bcgsc.ca	37	19	50550100	50550100	+	Silent	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr19:50550100T>C	ENST00000595661.1	+	6	2895	c.2400T>C	c.(2398-2400)aaT>aaC	p.N800N	CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000601364.1_Intron|ZNF473_ENST00000391821.2_Silent_p.N800N|ZNF473_ENST00000270617.3_Silent_p.N800N|ZNF473_ENST00000445728.3_Silent_p.N788N|CTD-2126E3.3_ENST00000599410.1_RNA			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	800					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		AGAAAGCAAATCTAACACAGC	0.502											OREG0025632	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N800N		.											.	ZNF473	91	0			c.T2400C						.						89.0	81.0	84.0					19																	50550100		2203	4300	6503	SO:0001819	synonymous_variant	25888	exon5			AGCAAATCTAACA	AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.2400T>C	19.37:g.50550100T>C		33.0	0.0	970	34.0	4.0	NM_015428	A8K8T7|Q9ULS9|Q9Y4Q7	Silent	SNP	ENST00000595661.1	37	CCDS33077.1																																																																																			.		0.502	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464833.1	XM_046390	
ZNF532	55205	ucsc.edu;bcgsc.ca	37	18	56646394	56646394	+	Silent	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr18:56646394C>A	ENST00000336078.4	+	9	4034	c.3258C>A	c.(3256-3258)gcC>gcA	p.A1086A	ZNF532_ENST00000589288.1_Silent_p.A1086A|ZNF532_ENST00000591083.1_Silent_p.A1086A|ZNF532_ENST00000588956.1_3'UTR|ZNF532_ENST00000591808.1_Silent_p.A1086A|ZNF532_ENST00000591230.1_Silent_p.A1086A	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	1086					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						AAGTGTACGCCTGCTCGTAAG	0.527																																					p.A1086A		.											.	ZNF532	154	0			c.C3258A						.						91.0	88.0	89.0					18																	56646394		2203	4300	6503	SO:0001819	synonymous_variant	55205	exon9			GTACGCCTGCTCG	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.3258C>A	18.37:g.56646394C>A		60.0	0.0		47.0	4.0	NM_018181	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Silent	SNP	ENST00000336078.4	37	CCDS11969.1																																																																																			.		0.527	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181	
ZNF578	147660	ucsc.edu;bcgsc.ca	37	19	53015353	53015353	+	Silent	SNP	T	T	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr19:53015353T>A	ENST00000421239.2	+	6	1963	c.1719T>A	c.(1717-1719)ggT>ggA	p.G573G	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	573					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		ATGAGTGTGGTAAGGCTCACA	0.388																																					p.G573G		.											.	.	.	0			c.T1719A						.						55.0	59.0	57.0					19																	53015353		2198	4299	6497	SO:0001819	synonymous_variant	147660	exon6			GTGTGGTAAGGCT	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.1719T>A	19.37:g.53015353T>A		39.0	0.0		40.0	4.0	NM_001099694	B4DR51|I3L1Y6	Silent	SNP	ENST00000421239.2	37	CCDS54310.1																																																																																			.		0.388	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472	
ZNF75D	7626	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	134426310	134426310	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chrX:134426310T>G	ENST00000370766.3	-	4	3210	c.501A>C	c.(499-501)caA>caC	p.Q167H	ZNF75D_ENST00000494295.1_Intron|ZNF75D_ENST00000370764.1_Intron	NM_007131.3	NP_009062.2	P51815	ZN75D_HUMAN	zinc finger protein 75D	167					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						CACCCATTGGTTGGGGCTCTG	0.502																																					p.Q167H		.											.	ZNF75D	130	0			c.A501C						.						111.0	100.0	103.0					X																	134426310		2203	4300	6503	SO:0001583	missense	7626	exon3			CATTGGTTGGGGC	S43109	CCDS14648.1, CCDS55503.1	Xq26	2013-01-09	2008-06-11	2008-06-11	ENSG00000186376	ENSG00000186376		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13145	protein-coding gene	gene with protein product		314997	"""zinc finger protein 75 (D8C6)"""	ZNF82, ZNF75		1505955	Standard	XM_005262469		Approved	ZKSCAN24, D8C6, ZSCAN28	uc004eyo.3	P51815	OTTHUMG00000022482	ENST00000370766.3:c.501A>C	X.37:g.134426310T>G	ENSP00000359802:p.Gln167His	87.0	1.0		74.0	10.0	NM_007131	A6NK62|B3KRI7|Q5JPG0|Q6LDE0	Missense_Mutation	SNP	ENST00000370766.3	37	CCDS14648.1	.	.	.	.	.	.	.	.	.	.	T	11.29	1.595535	0.28445	.	.	ENSG00000186376	ENST00000370766	T	0.07800	3.16	2.3	-0.275	0.12906	.	.	.	.	.	T	0.12178	0.0296	L	0.32530	0.975	0.27454	N	0.953351	D	0.76494	0.999	D	0.68192	0.956	T	0.20605	-1.0270	9	0.45353	T	0.12	.	1.6592	0.02787	0.2947:0.1871:0.0:0.5182	.	167	P51815	ZN75D_HUMAN	H	167	ENSP00000359802:Q167H	ENSP00000359802:Q167H	Q	-	3	2	ZNF75D	134253976	0.478000	0.25917	0.085000	0.20634	0.945000	0.59286	-0.147000	0.10234	-0.156000	0.11079	0.417000	0.27973	CAA	.		0.502	ZNF75D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058415.1	NM_007131	
